[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000998

Length: 1,129

Sequence [FASTA format sequence]
ATATATCGCA CGCCTAGACC AGCCCGGCGC TCTATCGGCA GCTTCCGACC GCGGGATGTC
TCACAGGAAG TTCTCCGCTC CCAGGCACGG GTCCCTGGGC TTCCTGCCTC GGAAGCGTAG
CAGCCGGCAC CGCGGGAAGG TGAAGAGTTT CCCCAAGGAT GACTCTTCCA AGCCCGTGCA
CCTCACCGCC TTCCTTGGCT ACAAGGCTGG CATGACCCAC ATTGTGAGGG AGGTCGATAG
GCCTGGGTCC AAGGTGAACA AGAAGGAAGT TGTGGAGGCT GTGACTATTG TGGAGACGCC
ACCCATGGTG ATTGTGGGCA TCGTGGGCTA TGTGGAAACC CCTCGGGGCC TCCGGACCTT
TAAGACCATC TTCGCGGAGC ACATCAGCGA TGAGTGCAAG AGGCGCTTCT ATAAGAACTG
GCATAAATCT AAGAAGAAGG CCTTCACCAA ATACTGCAAG AAGTGGCAGG ATGAAGATGG
CAAGAAGCAG TTGGAGAGGG ACTTCAGTAG CATGAAGAAG TACTGCCAGG TCATCCGGGT
CATTGCCCAC ACCCAGATGC GCCTGCTTCC TCTCCGCCAG AAGAAGGCCC ACCTCATGGA
GATCCAGGTG AACGGAGGCA CAGTGGCTGA AAAACTGGAC TGGGCCCGGG AGAGGCTAGA
GCAGCAGGTC CCTGTGAACC AGGTGTTTGG GCAGGATGAG ATGATTGATG TCATTGGCGT
GACCAAGGGC AAGGGCTACA AAGGGGTCAC CAGCCGTTGG CATACCAAGA AGCTGCCCCG
GAAGACCCAC CGGGGGCTCC GCAAGGTTGC CTGTATTGGC GCGTGGCATC CTGCGCGTGT
GGCCTTCTCC GTGGCCCGGG CTGGGCAGAA AGGCTACCAT CACCGCACAG AGATCAACAA
GAAGATCTAC AAGATCGGCC AGGGCTACCT CATCAAGGAC GGCAAGCTGA TCAAGAACAA
ACGCCTCCCC GGATACGATC TCTCCGACAG AGCATCATCC TCTGGGGAGC CTTGTCACTA
TGGTGAGTGA CCATGACTTG TCATGCTCAA GGCTGGCGTC GTGGGGACCA AAAGCGAGTG
CTCACCCTTC GCAGTCCTTG CTGGTACAAA CCAAACGACG GGCCCTGGA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRPL360S ribosomal protein L3 isoform a [Homo sapiens]. 607e-174O
Contig/Assembly ProteinRPL3L60S ribosomal protein L3-like [Homo sapiens]. 505e-143O
Contig/Assembly ProteinRPL360S ribosomal protein L3 isoform b [Homo sapiens]. 484e-137O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRpl360S ribosomal protein L3 [Mus musculus]. 602e-172O
Contig/Assembly ProteinGm12816PREDICTED: 60S ribosomal protein L3-like [Mus musculus]. 571e-163O
Contig/Assembly ProteinLOC674810PREDICTED: 60S ribosomal protein L3-like [Mus musculus]. 550e-157O
Contig/Assembly ProteinRpl3lribosomal protein L3-like isoform 1 [Mus musculus]. 507e-144O
Contig/Assembly ProteinRpl3lribosomal protein L3-like isoform 2 [Mus musculus]. 2172e-56O
Contig/Assembly ProteinGm12816PREDICTED: 60S ribosomal protein L3-like, partial [Mus musculus]. 1602e-39O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC474504PREDICTED: similar to 60S ribosomal protein L3 (L4) isoform 2 [Canis familiaris]. 607e-174O
Contig/Assembly ProteinLOC475009PREDICTED: similar to 60S ribosomal protein L3 (L4) isoform 1 [Canis familiaris]. 606e-173O
Contig/Assembly ProteinLOC475009PREDICTED: similar to 60S ribosomal protein L3 (L4) isoform 9 [Canis familiaris]. 595e-170O
Contig/Assembly ProteinLOC475009PREDICTED: similar to 60S ribosomal protein L3 (L4) isoform 8 [Canis familiaris]. 571e-163O
Contig/Assembly ProteinLOC475009PREDICTED: similar to 60S ribosomal protein L3 (L4) isoform 6 [Canis familiaris]. 493e-140O
Contig/Assembly ProteinLOC475009PREDICTED: similar to ribosomal protein L3 isoform 5 [Canis familiaris]. 485e-137O
Contig/Assembly ProteinLOC474504PREDICTED: similar to 60S ribosomal protein L3 (L4) isoform 8 [Canis familiaris]. 441e-124O
Contig/Assembly ProteinLOC490065PREDICTED: similar to 60S ribosomal protein L3-like [Canis familiaris]. 400e-111
Contig/Assembly ProteinLOC475009PREDICTED: similar to 60S ribosomal protein L3 (L4) isoform 7 [Canis familiaris]. 3561e-98O
Contig/Assembly ProteinLOC474504PREDICTED: similar to ribosomal protein L3 isoform 7 [Canis familiaris]. 2991e-81O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRPL360S ribosomal protein L3 [Bos taurus]. 606e-174O
Contig/Assembly ProteinRPL3L60S ribosomal protein L3-like [Bos taurus]. 509e-144O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC396768PREDICTED: 60S ribosomal protein L3 [Sus scrofa]. 611e-175O


Assembly Members: 377      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010005E04ADR01_0005_E04.bDB781969 
ADR010005G12ADR01_0005_G12.bDB782001 
ADR010008C01ADR01_0008_C01.bDB782212 
ADR010011D07ADR01_0011_D07.bDB782497 
ADR010017C01ADR01_0017_C01.bDB782999 
ADR010021A10ADR01_0021_A10.bDB783302 
ADR010022A05ADR01_0022_A05.bDB783388 
ADR010024A11ADR01_0024_A11.bDB783575 
ADR010043F04ADR01_0043_F04.bDB785334 
ADR010044A08ADR01_0044_A08.bDB785373 
ADR010047C08ADR01_0047_C08.bDB785665 
ADR010053H03ADR01_0053_H03.bDB786255 
ADR010056B05ADR01_0056_B05.bDB786458 
ADR010059B03ADR01_0059_B03.bDB786725 
ADR010060E05ADR01_0060_E05.bDB786858 
ADR010073F06ADR01_0073_F06.bDB788000 
ADR010076A06ADR01_0076_A06.bDB788212 
BFLT10015E02BFLT1_0015_E02.bFS641215 
BFLT10082C01BFLT1_0082_C01.bFS646462 
BFLT10093D09BFLT1_0093_D09.bFS647385 
BFLT10098H04BFLT1_0098_H04.bFS647853 
BFLT10122F01BFLT1_0122_F01.bHX203572 
BMWN10013B11BMWN1_0013_B11.bHX206390 
BMWN10014D05BMWN1_0014_D05.bHX206460 
BMWN10080G01BMWN1_0080_G01.bHX210511 
BMWN10095E01BMWN1_0095_E01.bHX211442 
CBLT10041D05CBLT1_0041_D05.bHX214602 
CLNT10004D03CLNT1_0004_D03.bFS657349 
CLNT10007G12CLNT1_0007_G12.bFS657628 
CLNT10012G11CLNT1_0012_G11.bFS658049 
CLNT10013B06CLNT1_0013_B06.bFS658075 
CLNT10013G11CLNT1_0013_G11.bFS658129 
CLNT10019D12CLNT1_0019_D12.bFS658560 
CLNT10026G06CLNT1_0026_G06.bFS659125 
CLNT10027B12CLNT1_0027_B12.bFS659161 
CLNT10028E11CLNT1_0028_E11.b  
CLNT10037C10CLNT1_0037_C10.bFS659935 
CLNT10072C07CLNT1_0072_C07.bFS662744 
CLNT10078H02CLNT1_0078_H02.b  
CLNT10083C04CLNT1_0083_C04.b  
CLNT10089F07CLNT1_0089_F07.bFS663497 
CLNT10107C04CLNT1_0107_C04.bHX219680 
CLNT10108F07CLNT1_0108_F07.bHX219791 
CLNT10108G02CLNT1_0108_G02.bHX219797 
CLNT10108G05CLNT1_0108_G05.bHX219800 
CLNT10109F07CLNT1_0109_F07.bHX219862 
CLNT10110H11CLNT1_0110_H11.bHX219964 
CLNT10114D09CLNT1_0114_D09.bHX220234 
CLNT10115H11CLNT1_0115_H11.bHX220354 
CLNT10116F08CLNT1_0116_F08.bHX220411 
CLNT10117B11CLNT1_0117_B11.bHX220448 
CLNT10117G11CLNT1_0117_G11.bHX220492 
CLNT10120F12CLNT1_0120_F12.bHX220717 
CLNT10120H03CLNT1_0120_H03.bHX220730 
CLNT10122H10CLNT1_0122_H10.bHX220890 
CLNT10126F08CLNT1_0126_F08.bHX221164 
CLNT10129A12CLNT1_0129_A12.bHX221350 
CLNT10133H10CLNT1_0133_H10.bHX221723 
CLNT10134C06CLNT1_0134_C06.bHX221751 
CLNT10138E10CLNT1_0138_E10.bHX222072 
CLNT10139C09CLNT1_0139_C09.bHX222135 
CLNT10143H07CLNT1_0143_H07.bHX222491 
CLNT10145C03CLNT1_0145_C03.bHX222603 
CLNT10152B07CLNT1_0152_B07.bHX223148 
HTMT10013D11HTMT1_0013_D11.bFS665135 
HTMT10118H03HTMT1_0118_H03.bHX224468 
ILNT10014E12ILNT1_0014_E12.bHX227821 
ILNT10031A06ILNT1_0031_A06.bHX229090 
ILNT10056A01ILNT1_0056_A01.bHX231125 
ILNT10071H04ILNT1_0071_H04.bHX232445 
ILNT10076B07ILNT1_0076_B07.bHX232793 
ITT010002G06ITT01_0002_G06.bBW976201 
ITT010003C06ITT01_0003_C06.bBW976248 
ITT010006B01ITT01_0006_B01.bBW976504 
ITT010008A03ITT01_0008_A03.bBW976680 
ITT010010E04ITT01_0010_E04.bBW976910 
ITT010021A07ITT01_0021_A07.bBW977855 
ITT010048E08ITT01_0048_E08.bBW980252 
ITT010053H02ITT01_0053_H02.bBW980741 
ITT010056C09ITT01_0056_C09.bBW980967 
ITT010061H08ITT01_0061_H08.bBW981466 
ITT010067B10ITT01_0067_B10.bBW981942 
ITT010095A09ITT01_0095_A09.bBW984407 
LNG010010E05LNG01_0010_E05.bBP437265 
LNG010021C01LNG01_0021_C01.bBP434973 
LNG010023F02LNG01_0023_F02.bBP438056 
LNG010027H02LNG01_0027_H02.bBP440055 
LNG010029H01LNG01_0029_H01.bBP439973 
LNG010031D09LNG01_0031_D09.bBP436614 
LNG010031F12LNG01_0031_F12.bBP438899 
LNG010062D05LNG01_0062_D05.bBP436317 
LNG010068D01LNG01_0068_D01.bBP435986 
LNG010076F03LNG01_0076_F03.bBP438172 
LNG010082H04LNG01_0082_H04.bBP440266 
LNG010092F11LNG01_0092_F11.bBP438857 
LNG010093H12LNG01_0093_H12.bBP440924 
LNG010096D03LNG01_0096_D03.bBP436178 
LNG010109G07LNG01_0109_G07.bBP439530 
LVR010003E06LVR01_0003_E06.bBP444934 
LVR010021H11LVR01_0021_H11.bBP448005 
LVR010041G01LVR01_0041_G01.bBP446337 
LVR010078H12LVR01_0078_H12.bBP448130 
LVR010087E05LVR01_0087_E05.bCJ000383 
LVRM10001C05LVRM1_0001_C05.bBP138567 
LVRM10135B01LVRM1_0135_B01.bBP448968 
LVRM10157C06LVRM1_0157_C06.bBP450108 
LVRM10200H02LVRM1_0200_H02.bCJ007045 
MLN010005E02MLN01_0005_E02.bCJ008074 
MLN010030G03MLN01_0030_G03.bCJ010000 
MLN010042D07MLN01_0042_D07.bCJ010952 
MLN010049G02MLN01_0049_G02.bCJ011473 
MLN010060G09MLN01_0060_G09.bBW963669 
MLN010083A09MLN01_0083_A09.bCJ014234 
OVR010004D04OVR01_0004_D04.bBP142702 
OVR010005C11OVR01_0005_C11.bBP142514 
OVR010005G08OVR01_0005_G08.bBP144208 
OVR010008A07OVR01_0008_A07.bBP141475 
OVR010011G06OVR01_0011_G06.bBP144139 
OVR010019A12OVR01_0019_A12.bBP141672 
OVR010020C11OVR01_0020_C11.bBP142525 
OVR010021D01OVR01_0021_D01.bBP142601 
OVR010025B01OVR01_0025_B01.bBP141708 
OVR010026B05OVR01_0026_B05.bBP141851 
OVR010026D03OVR01_0026_D03.bBP142678 
OVR010028C06OVR01_0028_C06.bBP142342 
OVR010029H03OVR01_0029_H03.bBP144485 
OVR010030F07OVR01_0030_F07.bBP143730 
OVR010031G07OVR01_0031_G07.bBP144190 
OVR010031G10OVR01_0031_G10.bBP144301 
OVR010033G07OVR01_0033_G07.bBP144192 
OVR010036A03OVR01_0036_A03.bBP141343 
OVR010041G10OVR01_0041_G10.b  
OVR010042D07OVR01_0042_D07.bBP142844 
OVR010044E05OVR01_0044_E05.bBP143217 
OVR010049G12OVR01_0049_G12.bBW964011 
OVR010052D11OVR01_0052_D11.bBW964252 
OVR010053F03OVR01_0053_F03.bBW964358 
OVR010054E03OVR01_0054_E03.bBW964437 
OVR010056D11OVR01_0056_D11.bBW964608 
OVR010057H03OVR01_0057_H03.bBW964736 
OVR010058F01OVR01_0058_F01.bBW964800 
OVR010060F10OVR01_0060_F10.bBW964992 
OVR010061D01OVR01_0061_D01.bBW965052 
OVR010064F03OVR01_0064_F03.bBW965337 
OVR010067A02OVR01_0067_A02.bBW965545 
OVR010069C07OVR01_0069_C07.bBW965752 
OVR010071A12OVR01_0071_A12.bBW965915 
OVR010074A12OVR01_0074_A12.bBW966170 
OVR010074D08OVR01_0074_D08.bBW966201 
OVR010076G05OVR01_0076_G05.bBW966413 
OVR010077F05OVR01_0077_F05.bBW966485 
OVR010079E08OVR01_0079_E08.bBW966618 
OVR010081A07OVR01_0081_A07.bBW966730 
OVR010081C05OVR01_0081_C05.bBW966749 
OVR010089F10OVR01_0089_F10.bBW967318 
OVR010092E09OVR01_0092_E09.bBW967548 
OVR010093C08OVR01_0093_C08.bBW967600 
OVR010095B08OVR01_0095_B08.bBW967736 
OVR010096H05OVR01_0096_H05.b  
OVR010097G11OVR01_0097_G11.bBW967937 
OVR010098B12OVR01_0098_B12.bBW967969 
OVR010099A12OVR01_0099_A12.bBW968041 
OVR010101E05OVR01_0101_E05.bBW968233 
OVR010101G08OVR01_0101_G08.bBW968258 
OVR010101H10OVR01_0101_H10.bBW968269 
OVR010103F12OVR01_0103_F12.bBW968429 
OVR010104A07OVR01_0104_A07.bBW968460 
OVRM10002F03OVRM1_0002_F03.bBP459566 
OVRM10010D09OVRM1_0010_D09.bBP149489 
OVRM10016C03OVRM1_0016_C03.bBP147595 
OVRM10024H09OVRM1_0024_H09.bBP461986 
OVRM10025D12OVRM1_0025_D12.bBP149832 
OVRM10028H06OVRM1_0028_H06.bBP154232 
OVRM10029H10OVRM1_0029_H10.bBP154680 
OVRM10033B10OVRM1_0033_B10.bBP147104 
OVRM10040D11OVRM1_0040_D11.bBP458296 
OVRM10049A11OVRM1_0049_A11.bBP145939 AK395084
OVRM10074E09OVRM1_0074_E09.bBP150753 
OVRM10083E06OVRM1_0083_E06.bBP150458 
OVRM10090E03OVRM1_0090_E03.bBP150169 
OVRM10099F04OVRM1_0099_F04.bBP151511 
OVRM10102B01OVRM1_0102_B01.bBP146202 
OVRM10106B06OVRM1_0106_B06.bBP146730 
OVRM10118B06OVRM1_0118_B06.bBP146741 
OVRM10119A08OVRM1_0119_A08.bBP145668 
OVRM10157A10OVRM1_0157_A10.bBP455345 
OVRM10169G02OVRM1_0169_G02.bBP460513 
OVRM10181H08OVRM1_0181_H08.bBP461942 
OVRM10184G01OVRM1_0184_G01.bBP460441 
OVRM10187H10OVRM1_0187_H10.bBP462107 
OVRM10193C07OVRM1_0193_C07.bBP457061 
OVRM10194D09OVRM1_0194_D09.bBP458174 
OVRM10196H08OVRM1_0196_H08.bBP461955 
OVRM10202G02OVRM1_0202_G02.bBP460540 
OVRM10210G08OVRM1_0210_G08.bBP461024 
OVRM10213B03OVRM1_0213_B03.bBP455782 
OVRM10219B01OVRM1_0219_B01.bBP455623 
OVRT10002C08OVRT1_0002_C08.bFS686523 
OVRT10057E12OVRT1_0057_E12.bFS691068 
OVRT10063B04OVRT1_0063_B04.bFS691526 
OVRT10079C01OVRT1_0079_C01.bFS692830 
OVRT10100H08OVRT1_0100_H08.bFS694610 
OVRT10105H05OVRT1_0105_H05.bHX235231 
OVRT10124A07OVRT1_0124_A07.bHX236706 
OVRT10138D06OVRT1_0138_D06.bHX237858 
OVRT10142D04OVRT1_0142_D04.bHX238186 
PBL010005G12PBL01_0005_G12.bBW968784 
PBL010015E06PBL01_0015_E06.bBW969452 
PBL010020B02PBL01_0020_B02.bBP462367 
PBL010028B04PBL01_0028_B04.bBW970006 
PBL010028H06PBL01_0028_H06.bBP156527 
PBL010052B07PBL01_0052_B07.bBW971128 
PBL010064E04PBL01_0064_E04.bBW971935 
PBL010068H04PBL01_0068_H04.bBW972295 
PBL010077H08PBL01_0077_H08.bBW973049 
PBL010078D04PBL01_0078_D04.bBW973088 
PBL010102B06PBL01_0102_B06.bBW975118 
PBL010105B08PBL01_0105_B08.bBW975398 
PCT010003H04PCT01_0003_H04.bFS694823 
PCT010006C08PCT01_0006_C08.bFS695001 
PCT010011A10PCT01_0011_A10.bFS695363 
PCT010018B11PCT01_0018_B11.bFS695828 
PCT010027H12PCT01_0027_H12.bFS696476 
PST010015A04PST01_0015_A04.bFS698138 
PTG010004H04PTG01_0004_H04.bFS705064 
PTG010013A01PTG01_0013_A01.bFS705506 
PTG010038B11PTG01_0038_B11.bFS707734 
PTG010042F12PTG01_0042_F12.bFS708140 
PTG010044F12PTG01_0044_F12.bFS708319 
PTG010046H03PTG01_0046_H03.bFS708516 
PTG010047D10PTG01_0047_D10.bFS708567 
PTG010049B02PTG01_0049_B02.bFS708708 
PTG010049H05PTG01_0049_H05.bFS708778 
PTG010052G11PTG01_0052_G11.bFS709039 
PTG010070E04PTG01_0070_E04.bFS710406 
PTG010109F08PTG01_0109_F08.bFS713248 
SKNB10006E08SKNB1_0006_E08.bDB800442 
SKNB10040B02SKNB1_0040_B02.bDB802190 
SKNB10041C01SKNB1_0041_C01.b  
SMG010003H07SMG01_0003_H07.bFS713732 
SMG010014C04SMG01_0014_C04.bFS714452 
SMG010023A10SMG01_0023_A10.bFS715242 
SMG010023D02SMG01_0023_D02.bFS715268 
SMG010026F07SMG01_0026_F07.bFS715572 
SMG010033A02SMG01_0033_A02.bFS716132 
SMG010036E10SMG01_0036_E10.bFS716445 
SMG010045C12SMG01_0045_C12.bFS717187 
SMG010048C07SMG01_0048_C07.bFS717448 
SMG010056B08SMG01_0056_B08.bFS718096 
SMG010060H02SMG01_0060_H02.bFS718489 
SMG010060H07SMG01_0060_H07.bHX239260 
SMG010064E06SMG01_0064_E06.bFS718800 
SMG010076E02SMG01_0076_E02.bFS719842 
SMG010081C08SMG01_0081_C08.bFS720262 
SMG010083C02SMG01_0083_C02.bFS720421 
SMG010084H11SMG01_0084_H11.bFS720570 
SMG010085C09SMG01_0085_C09.bFS720602 
SMG010090E01SMG01_0090_E01.bFS721048 
SMG010090G05SMG01_0090_G05.bFS721074 
SMG010092H11SMG01_0092_H11.bFS721271 
SMG010103E03SMG01_0103_E03.bFS722104 
SPL010010B01SPL01_0010_B01.bBP156997 
SPL010010B12SPL01_0010_B12.bBP157300 
SPL010023B07SPL01_0023_B07.bBP157176 
SPL010023D10SPL01_0023_D10.bBP157945 
SPL010030A10SPL01_0030_A10.bCJ016301 
SPL010039G10SPL01_0039_G10.bBP158986 
SPL010045D03SPL01_0045_D03.bCJ017062 
SPL010048D12SPL01_0048_D12.bCJ017345 
SPL010058D06SPL01_0058_D06.bCJ018234 
SPL010065G08SPL01_0065_G08.bCJ018904 
SPL010069F12SPL01_0069_F12.bCJ019252 
SPL010077G09SPL01_0077_G09.bCJ019987 
SPL010090F10SPL01_0090_F10.bCJ021143 
SPL010092F09SPL01_0092_F09.bCJ021320 
SPL010098D10SPL01_0098_D10.bCJ021840 
SPL010101F06SPL01_0101_F06.bCJ022115 
SPL010103A05SPL01_0103_A05.bCJ022226 
SPL010104F07SPL01_0104_F07.bCJ022368 
SPLT10037A12SPLT1_0037_A12.bHX242042 
SPLT10049D01SPLT1_0049_D01.bHX243007 
SPLT10050B12SPLT1_0050_B12.bHX243063 
SPLT10061F05SPLT1_0061_F05.bHX243941 
TCH010018C11TCH01_0018_C11.bCJ023757 
TCH010024F10TCH01_0024_F10.bCJ024225 
TCH010039G05TCH01_0039_G05.bCJ025367 
TCH010040G05TCH01_0040_G05.bCJ025448 
TCH010048H01TCH01_0048_H01.bCJ026053 
TCH010054H10TCH01_0054_H10.bBW975950 
TCH010055E11TCH01_0055_E11.bBW975994 
TCH010057C09TCH01_0057_C09.bCJ026474 
TCH010060F12TCH01_0060_F12.bCJ026724 
TCH010074F02TCH01_0074_F02.bCJ027785 
TCH010079D07TCH01_0079_D07.bCJ028144 
TES010007G01TES01_0007_G01.bCJ030479 
TES010023A10TES01_0023_A10.bCJ031519 
TES010026F03TES01_0026_F03.bCJ031742 
TES010029G10TES01_0029_G10.bCJ031939 
TES010033G01TES01_0033_G01.bCJ032195 
TES010042H11TES01_0042_H11.bCJ032754 
TES010051C01TES01_0051_C01.bCJ033248 
TES010052E05TES01_0052_E05.bCJ033336 
TES010052G09TES01_0052_G09.bCJ033358 
TES010060F05TES01_0060_F05.b  
TES010062B07TES01_0062_B07.bCJ033960 
TES010064D12TES01_0064_D12.bCJ034127 
TES010067H08TES01_0067_H08.bCJ034353 
TES010069B03TES01_0069_B03.bCJ034442 
TES010070A09TES01_0070_A09.bCJ034493 
TES010070E03TES01_0070_E03.bCJ034526 
TES010072B12TES01_0072_B12.bFS722243 
TES010083B11TES01_0083_B11.bCJ035339 
TES010094E05TES01_0094_E05.bCJ036112 
TES010096D07TES01_0096_D07.bCJ036259 
TES010100A06TES01_0100_A06.bCJ036532 
TES010102G02TES01_0102_G02.bCJ036728 
TES010109F11TES01_0109_F11.bCJ037220 
TES010111C02TES01_0111_C02.bCJ037308 
THY010001F05THY01_0001_F05.bBP166011 
THY010002H02THY01_0002_H02.bBP168205 
THY010006F02THY01_0006_F02.bBP165684 
THY010014E04THY01_0014_E04.bBP164657 
THY010015B01THY01_0015_B01.bBP160587 
THY010020G12THY01_0020_G12.bBP168004 
THY010023D06THY01_0023_D06.bBP163613 
THY010023E02THY01_0023_E02.bBP164452 
THY010027G10THY01_0027_G10.bBP167799 
THY010034C09THY01_0034_C09.bBP162686 
THY010038C12THY01_0038_C12.bBP163005 
THY010044C09THY01_0044_C09.bBP162696 
THY010049B09THY01_0049_B09.bBP161449 
THY010050G02THY01_0050_G02.bBP166971 
THY010051C03THY01_0051_C03.bBP162082 
THY010051F12THY01_0051_F12.bBP166761 
THY010052D10THY01_0052_D10.bBP164041 
THY010057G12THY01_0057_G12.bBP168035 
THY010061D11THY01_0061_D11.bBP164161 
THY010065B01THY01_0065_B01.bBP160629 
THY010066C08THY01_0066_C08.bBP162610 
THY010079D12THY01_0079_D12.bBP164280 
THY010090F03THY01_0090_F03.bBP165864 
THY010204D03THY01_0204_D03.bBP163387 
THY010204G09THY01_0204_G09.bBP167774 
THY010205E02THY01_0205_E02.bBP164541 
UTR010003F05UTR01_0003_F05.bBP172207 
UTR010003F06UTR01_0003_F06.bBP172250 
UTR010008D05UTR01_0008_D05.bBP171151 
UTR010013D08UTR01_0013_D08.bBP171290 
UTR010015B03UTR01_0015_B03.bBP169985 
UTR010018A07UTR01_0018_A07.bBP169634 
UTR010020G05UTR01_0020_G05.bBP172752 
UTR010022B06UTR01_0022_B06.bBP170128 
UTR010023D09UTR01_0023_D09.bBP171343 
UTR010024H04UTR01_0024_H04.bBP173251 
UTR010029D06UTR01_0029_D06.bBP171213 
UTR010032A04UTR01_0032_A04.bBP169513 
UTR010032B08UTR01_0032_B08.bBP170226 
UTR010038E03UTR01_0038_E03.bBP171619 
UTR010040A05UTR01_0040_A05.bBP169563 
UTR010040F06UTR01_0040_F06.bBP172285 
UTR010040F12UTR01_0040_F12.bBP172547 
UTR010044F01UTR01_0044_F01.bBP172062 
UTR010045B02UTR01_0045_B02.bBP169969 
UTR010052B09UTR01_0052_B09.bBP463156 
UTR010055E12UTR01_0055_E12.bBP464092 
UTR010055G11UTR01_0055_G11.bBP464646 
UTR010058G05UTR01_0058_G05.bBP464505 
UTR010060E05UTR01_0060_E05.bBP463933 
UTR010064H05UTR01_0064_H05.bBP464801 
UTR010070B09UTR01_0070_B09.bBP463170 
UTR010087G09UTR01_0087_G09.bCJ038065 
UTR010089A02UTR01_0089_A02.bCJ038174 
UTR010095E09UTR01_0095_E09.bCJ038776 
UTR010099G12UTR01_0099_G12.bCJ039086 
UTR010102F01UTR01_0102_F01.b  
UTR010103B05UTR01_0103_B05.bCJ039389 
UTR010103H04UTR01_0103_H04.bCJ039458 

  

SNPs: 6      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
298A6900.185WSACA/T
G270330.815ACG/T
313C62320.265WSATC/I
T26100.735ATT/I
331C70330.283WSTAC/Y
T26100.717TAT/Y
418C342220.978MSAAC/N
T080.022AAT/N
628C42230.210WSGCC/A
T24400.790GCT/A
721C2900.109WSGTC/V
G224140.891GTG/V


Alignment:      TOP

20110601C-000998 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRM1_0049_A11.b : agttgacxxxxxxx
OVRM1_0106_B06.b : tagttgtcxxxxxxxxxxxxx
TES01_0029_G10.b :
OVR01_0041_G10.b : ggggcattttggxxxxxxxxxxxxxxxxx
LNG01_0031_D09.b : attgttttnggcatagtgatat
OVRM1_0016_C03.b :
OVRM1_0024_H09.b :
SMG01_0083_C02.b : nnn
SMG01_0060_H07.b : nnn
OVRM1_0169_G02.b :
THY01_0006_F02.b : tgacxxx
OVRM1_0074_E09.b :
OVR01_0060_F10.b : tggcttgtgactatg
OVR01_0101_E05.b : ngggctag
TCH01_0055_E11.b : nnnnggcttgtga
TES01_0067_H08.b :
MLN01_0060_G09.b :
ADR01_0021_A10.b :
ILNT1_0056_A01.b :
THY01_0015_B01.b : ggcaxxxxxxxxxxxxxx
THY01_0051_C03.b : xxxxxxxxxxxxxxxxx
SMG01_0033_A02.b : n
OVR01_0092_E09.b : nggataggact
UTR01_0040_A05.b : ttttggcggcxxxxxxx
LNG01_0023_F02.b : ggcxxxxxxxxxxxxxx
SPL01_0069_F12.b : nnnggctagtgac
PTG01_0046_H03.b :
TCH01_0060_F12.b : ctagtgac
LVR01_0021_H11.b : cttttggttgxxxxxxxx
OVR01_0071_A12.b : nnnggcttggact
TCH01_0024_F10.b : ngttgtgact
BFLT1_0122_F01.b : nnccccgt
CLNT1_0122_H10.b : nntt
SPL01_0077_G09.b : ngggctaggact
THY01_0038_C12.b : xxxxxxxxxxxxxxxxx
OVR01_0097_G11.b : nnggcttgtgac
PBL01_0077_H08.b :
ITT01_0061_H08.b :
ITT01_0008_A03.b :
BMWN1_0080_G01.b :
LVRM1_0001_C05.b :
BMWN1_0014_D05.b :
BMWN1_0095_E01.b :
UTR01_0045_B02.b : gggagaactxxxxxxxxxxxxxx
TCH01_0040_G05.b : tttctgctaggac
UTR01_0044_F01.b : ttttggagccxx
LNG01_0031_F12.b : gggccnancggattgcgac
CLNT1_0117_G11.b : nggggttnnnnnnnn
SPLT1_0050_B12.b :
SPLT1_0049_D01.b :
PTG01_0070_E04.b :
BMWN1_0013_B11.b :
ILNT1_0031_A06.b :
OVRT1_0063_B04.b : nnnnnnnnnnnnnnn
ILNT1_0014_E12.b :
CLNT1_0134_C06.b : naaa
CBLT1_0041_D05.b :
SPLT1_0037_A12.b : nnnna
TCH01_0057_C09.b : nnnggcta
LNG01_0082_H04.b : gcgnnnngggctg
THY01_0027_G10.b : ggggcccct
PBL01_0105_B08.b :
TCH01_0039_G05.b : nnnnggctt
LNG01_0062_D05.b : nttagggg
OVR01_0081_A07.b : gcaxxxxxxxxxxxxxx
TES01_0102_G02.b :
OVR01_0081_C05.b : cxxxxxxxxxxxx
OVR01_0076_G05.b : gcttttagtgcxx
OVRM1_0181_H08.b :
LVRM1_0200_H02.b :
OVRM1_0193_C07.b :
OVRM1_0196_H08.b :
OVR01_0067_A02.b : ttgcttgtga
LVRM1_0157_C06.b :
OVR01_0074_A12.b : gctxxxxxxxxxxx
OVRM1_0194_D09.b :
TES01_0070_E03.b :
OVRM1_0219_B01.b :
OVRM1_0099_F04.b :
OVRM1_0002_F03.b :
SMG01_0003_H07.b :
OVRM1_0213_B03.b :
OVRM1_0090_E03.b :
OVR01_0101_H10.b : ngcttgga
OVRM1_0210_G08.b :
OVRM1_0033_B10.b :
OVRM1_0083_E06.b :
OVRM1_0102_B01.b :
OVRM1_0202_G02.b :
OVR01_0077_F05.b : ngcttagga
OVRM1_0187_H10.b :
PBL01_0005_G12.b :
OVRM1_0040_D11.b :
OVR01_0103_F12.b : gcttggc
OVR01_0099_A12.b : gcttgt
OVR01_0101_G08.b : nggcttgga
OVRM1_0119_A08.b :
TCH01_0054_H10.b : nggggcatgtgac
OVR01_0089_F10.b : ggcttggc
OVR01_0079_E08.b : gattgtg
OVRM1_0028_H06.b :
SPL01_0023_D10.b : ttttgagtgxxxxxxx
SPL01_0010_B12.b : ctttaxxxxxxxxxxx
OVR01_0096_H05.b : ggttgtga
OVR01_0057_H03.b : agtannnntgcatgtga
OVR01_0056_D11.b : tttgcttggact
OVRM1_0029_H10.b :
SPL01_0090_F10.b : nntttgctaggac
THY01_0051_F12.b : cttttgcgtgxxxxxxx
PBL01_0020_B02.b :
UTR01_0013_D08.b : gxxxxxxxxxxx
LNG01_0029_H01.b : gggggcttagcgncnxxx
PTG01_0049_B02.b :
CLNT1_0120_F12.b : ntttt
ADR01_0024_A11.b :
ADR01_0005_G12.b :
ADR01_0043_F04.b :
SMG01_0085_C09.b :
UTR01_0040_F12.b : ctttttggcggcxxxxx
SPL01_0010_B01.b : atxxxxxxxxxxxxxx
UTR01_0024_H04.b : gggttgaxxxxxx
THY01_0052_D10.b : tttgcgtgxxxxxxx
SMG01_0048_C07.b :
OVRT1_0138_D06.b : nnntgtaaaaccnnn
PTG01_0049_H05.b :
PTG01_0038_B11.b :
CLNT1_0115_H11.b : nnn
CLNT1_0133_H10.b : nnat
ILNT1_0071_H04.b :
SPLT1_0061_F05.b :
OVRT1_0105_H05.b : n
CLNT1_0138_E10.b : n
CLNT1_0108_F07.b : nnn
UTR01_0023_D09.b : ggggggxxxxxxx
CLNT1_0110_H11.b : ntttt
UTR01_0008_D05.b : cttttggtggcxxxx
UTR01_0099_G12.b : ntttttgcttgga
TES01_0094_E05.b :
SPL01_0058_D06.b : nnnggcttggact
SMG01_0081_C08.b :
UTR01_0029_D06.b : tgggatgacxxxxx
CLNT1_0139_C09.b : nnnn
THY01_0020_G12.b : gcaxxxxxxxxxxxx
THY01_0001_F05.b :
THY01_0014_E04.b : ggcaxxxxxxxxxxxx
OVRT1_0142_D04.b : nnngggcgcnnnnnnnnn
UTR01_0003_F05.b : ttxxxxxxxxxxxxxxxxx
UTR01_0087_G09.b : nttgctagga
CLNT1_0117_B11.b : ttttcccttctgcgnacgagtgxxxxxxxxxxxxxxxxxxx
CLNT1_0108_G02.b : nnnn
CLNT1_0107_C04.b : nnn
BFLT1_0082_C01.b : n
SMG01_0045_C12.b :
SMG01_0103_E03.b :
UTR01_0040_F06.b : ggtggacxxxxx
SMG01_0090_G05.b :
SMG01_0092_H11.b :
OVR01_0093_C08.b : nnggatagga
PTG01_0047_D10.b :
THY01_0079_D12.b : gcccxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0021_D01.b : gggctxxxxxxxxxxxxx
SPL01_0039_G10.b : aaggcttxxxxxxxxxxxxx
UTR01_0020_G05.b : ggggggcacctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0015_B03.b : ggtggacxxxx
SPL01_0098_D10.b : nnggctagtga
UTR01_0018_A07.b : gggtggccctat
CLNT1_0108_G05.b : nnn
LVR01_0087_E05.b : cttttgggtgactac
CLNT1_0114_D09.b : nnn
UTR01_0003_F06.b : txxxxxxxxxxxxxxxxxx
MLN01_0030_G03.b : nnnntgcatgga
CLNT1_0109_F07.b : nn
SMG01_0076_E02.b :
OVR01_0053_F03.b : nnggggattctnggcatg
THY01_0023_E02.b : ctttttxxxxxxxx
OVR01_0104_A07.b : tggctagga
PTG01_0013_A01.b :
TES01_0062_B07.b :
UTR01_0102_F01.b : nnnnggctagtg
UTR01_0103_H04.b : nnnggcttgga
UTR01_0032_A04.b : catatggcgccxxxxx
CLNT1_0145_C03.b : nnn
OVR01_0044_E05.b : xxxxxxxxxxxxxxxxxxxx
PTG01_0044_F12.b :
CLNT1_0126_F08.b : ngatcttnnnnnnn
SMG01_0084_H11.b :
OVR01_0054_E03.b : nnnnggctagga
MLN01_0005_E02.b : nnnttttgcttgg
OVR01_0061_D01.b : nnnnnggcatggac
OVR01_0095_B08.b : nnggctag
ADR01_0053_H03.b :
PTG01_0004_H04.b :
THY01_0204_D03.b : ctxxxxxxxxxxxxx
UTR01_0103_B05.b : nnttggctagtga
CLNT1_0143_H07.b : nnnn
UTR01_0060_E05.b : ccxxxxxxxxxxxxxxx
UTR01_0038_E03.b : gggaggacxxxxx
SPL01_0030_A10.b : nnnnggcttggac
SMG01_0023_A10.b :
LVR01_0003_E06.b : tttgggtgxxxxxx
MLN01_0083_A09.b : nggctagt
OVR01_0028_C06.b : gggcxxxxxxxxxxxxxxx
PTG01_0042_F12.b :
LVR01_0078_H12.b : gggtcaxxxxxxxxxxxx
OVR01_0031_G10.b : gggctxxxxxxxxxxxxx
SMG01_0090_E01.b :
ADR01_0044_A08.b :
SMG01_0023_D02.b :
SKNB1_0006_E08.b :
CLNT1_0013_G11.b : gcgctttnngggact
UTR01_0095_E09.b : nnggcttgga
CLNT1_0116_F08.b : nn
THY01_0034_C09.b : tttttgtgaacxxxxx
UTR01_0052_B09.b : gcttttggttgacxxxxx
OVR01_0052_D11.b : nntttgcttggact
OVR01_0005_C11.b : ggggggccctatcttacxxxxxxxxxxxx
SMG01_0014_C04.b :
OVR01_0064_F03.b : nnnnggcttgga
SPL01_0092_F09.b : nnngggttgga
THY01_0204_G09.b : cttttgggtgxxxxxx
OVR01_0020_C11.b : attggggggcactat
OVR01_0026_B05.b : gggactxxxxxxxxxxxxx
LVR01_0041_G01.b : ggggtcaggcatagtgacta
OVR01_0033_G07.b : gaggacxxxxxxxxxxxxxxx
CLNT1_0152_B07.b : nn
UTR01_0055_G11.b : gcctttggggtgxxxxx
CLNT1_0120_H03.b : nnnt
PBL01_0015_E06.b :
THY01_0023_D06.b : tttttgttggacxxxx
CLNT1_0013_B06.b : gg
SPL01_0103_A05.b : nnntggcttgtg
UTR01_0089_A02.b : nnnnggctagtg
OVR01_0029_H03.b : aggggxxxxxxxxxxxxxxx
THY01_0205_E02.b : cttttacgtggcxxxxx
OVR01_0008_A07.b : aggggccctaatxxxxxxxxxxxxxxxx
OVR01_0005_G08.b : tggggggccctattxxxxxxxxxxxxxxxx
TCH01_0074_F02.b : nnnngggtagga
SPL01_0048_D12.b : nntttagctaggac
OVR01_0098_B12.b : nnnnggctagta
SPL01_0045_D03.b : nnnnggctagtg
CLNT1_0089_F07.b : nnggggctttnnnngc
PTG01_0052_G11.b :
SMG01_0060_H02.b :
THY01_0065_B01.b : ccatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0015_E02.b : a
PCT01_0006_C08.b :
MLN01_0042_D07.b : nnnntcttgg
UTR01_0064_H05.b : ggccaxxxxxxxxxxxxxx
THY01_0061_D11.b : ctxxxxxxxxxxxxxxx
OVRT1_0057_E12.b : nnngggcttnnnnntnn
THY01_0090_F03.b : cxxxxxxxxxxxxxxxx
PBL01_0064_E04.b :
ITT01_0021_A07.b :
LNG01_0027_H02.b : ccxxxxxxxxxxxxxxx
PBL01_0028_H06.b :
ITT01_0002_G06.b :
PBL01_0078_D04.b :
ITT01_0067_B10.b :
PBL01_0028_B04.b :
OVR01_0011_G06.b : agaaaattgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0093_D09.b : gga
PBL01_0052_B07.b :
PBL01_0068_H04.b :
BFLT1_0098_H04.b : ggat
ITT01_0003_C06.b :
ITT01_0010_E04.b :
ITT01_0006_B01.b :
ADR01_0047_C08.b :
ADR01_0060_E05.b :
ADR01_0056_B05.b :
SPL01_0065_G08.b : nnnaagctagga
CLNT1_0012_G11.b : ggaat
SMG01_0064_E06.b :
LNG01_0109_G07.b : nnnttagttg
CLNT1_0072_C07.b : nggg
TCH01_0079_D07.b : nnnnggc
LNG01_0076_F03.b : nnnngggct
CLNT1_0037_C10.b : nntt
LNG01_0092_F11.b : nnnt
ADR01_0076_A06.b :
CLNT1_0007_G12.b : nnggctttnnnggga
LNG01_0068_D01.b : nnnntttgctg
MLN01_0049_G02.b : nnntggctagtg
ITT01_0056_C09.b :
ITT01_0053_H02.b :
TES01_0064_D12.b :
TES01_0033_G01.b :
TES01_0070_A09.b :
THY01_0044_C09.b : ctxxxxxxxxxxxx
SMG01_0036_E10.b :
OVR01_0036_A03.b : ggggatttggggac
OVRT1_0079_C01.b : ngggt
SMG01_0026_F07.b :
SKNB1_0041_C01.b :
CLNT1_0026_G06.b : ngg
CLNT1_0004_D03.b : ng
OVR01_0069_C07.b : attgtgxx
OVRM1_0118_B06.b :
TES01_0100_A06.b :
UTR01_0070_B09.b : cxxxxxxxxx
UTR01_0022_B06.b : ggggaaxx
THY01_0057_G12.b : cxxxxxxxxxxxxxx
OVRT1_0100_H08.b :
OVR01_0031_G07.b : aggagcxxxxxxxxxx
SPL01_0101_F06.b : nnttg
OVRT1_0002_C08.b :
OVR01_0026_D03.b : gagacatctgggtgx
TES01_0052_G09.b :
LNG01_0021_C01.b : ccggcggctgctacccgccagcat
ADR01_0059_B03.b :
TCH01_0048_H01.b : tggggg
PCT01_0018_B11.b :
ILNT1_0076_B07.b :
HTMT1_0118_H03.b :
PCT01_0027_H12.b :
HTMT1_0013_D11.b :
CLNT1_0028_E11.b :
THY01_0066_C08.b : tgxxxxxxxxx
PCT01_0011_A10.b :
OVR01_0025_B01.b : gtgggcxxxxxxxxxxxxx
CLNT1_0027_B12.b :
LNG01_0096_D03.b : nnnnngg
PBL01_0102_B06.b :
SPL01_0104_F07.b : nnnnggctagga
OVR01_0074_D08.b : agcxxxxxxx
SPL01_0023_B07.b : xxxxxxxxxx
SMG01_0056_B08.b :
CLNT1_0083_C04.b : nnnnnnnnnnn
TES01_0023_A10.b :
UTR01_0058_G05.b : ggcattatxxxx
TCH01_0018_C11.b : ttcatttn
ADR01_0017_C01.b :
OVRM1_0157_A10.b :
OVRM1_0184_G01.b :
TES01_0060_F05.b :
OVRM1_0010_D09.b :
OVR01_0049_G12.b : nttttttgct
ADR01_0011_D07.b :
THY01_0050_G02.b : gcatctacgtgaxx
ADR01_0022_A05.b :
OVRM1_0025_D12.b :
ADR01_0008_C01.b :
LNG01_0010_E05.b : cttttggtgga
THY01_0049_B09.b : cttttggxxxxxx
CLNT1_0129_A12.b :
OVR01_0030_F07.b : aagggttttatggtgx
UTR01_0032_B08.b : cttttgctgac
OVR01_0058_F01.b : nnnnnggatg
OVR01_0042_D07.b : gxxxxxxxxxxxxxxx
UTR01_0055_E12.b : gccttttgggtgxx
TES01_0042_H11.b :
OVRT1_0124_A07.b :
ITT01_0095_A09.b :
LNG01_0093_H12.b : nggttc
CLNT1_0019_D12.b :
OVR01_0019_A12.b : ttttgggtggac
ADR01_0005_E04.b :
ITT01_0048_E08.b :
ADR01_0073_F06.b :
THY01_0002_H02.b :
SKNB1_0040_B02.b :
PCT01_0003_H04.b :
PST01_0015_A04.b :
TES01_0109_F11.b :
TES01_0052_E05.b :
TES01_0026_F03.b :
TES01_0007_G01.b :
PTG01_0109_F08.b : nnnnnnnn
TES01_0096_D07.b :
TES01_0072_B12.b :
TES01_0111_C02.b :
TES01_0083_B11.b :
TES01_0069_B03.b :
TES01_0051_C01.b :
CLNT1_0078_H02.b : nnnggcc
OVR01_0004_D04.b : gggacct
LVRM1_0135_B01.b :
20110601C-000998 : .......................................ATATATCGCACGCCTAGACCA
---------+---------+---------+---------+---------+---------+ 21
OVRM1_0049_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATATATCGCACGTCTAGACCA
OVRM1_0106_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtATATCGCACGCCTAGACCA
TES01_0029_G10.b : cgctgtG
OVR01_0041_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccccgttcaact
LNG01_0031_D09.b : gnnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0016_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0024_H09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0083_C02.b : ngggattnnnnnnggagtaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0060_H07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0169_G02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0006_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0074_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0060_F10.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0101_E05.b : gactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0055_E11.b : cttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0067_H08.b : nttctgcag
MLN01_0060_G09.b : gtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0021_A10.b : aaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0056_A01.b : nncgacggtacgacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0015_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0051_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0033_A02.b : ngggtgatannnnnaggtcaagcagcggnaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0092_E09.b : atgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0040_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0023_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0069_F12.b : ttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0046_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
TCH01_0060_F12.b : ttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0021_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0071_A12.b : tagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0024_F10.b : tgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0122_F01.b : cagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0122_H10.b : ttcgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0077_G09.b : ataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0038_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0097_G11.b : ttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0077_H08.b : nnnnaatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0061_H08.b : nnnttgtgaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0008_A03.b : nnnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0080_G01.b : tttttagagagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0001_C05.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0014_D05.b : ttttggacagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0095_E01.b : tttttggacggtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0045_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgt
TCH01_0040_G05.b : tatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0044_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0031_F12.b : ntatagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0117_G11.b : cccttagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0050_B12.b : nnnngggcggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0049_D01.b : nnntcgcgagtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0070_E04.b : ggtttattnnnnnggagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0013_B11.b : tttttcgacggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0031_A06.b : nnnnccgaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0063_B04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0014_E12.b : ttttacgacggaagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0134_C06.b : acgttcgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0041_D05.b : nnnggacggtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0037_A12.b : agtattntnntatggcagtacnacgcagtcgtaxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0057_C09.b : ggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0082_H04.b : gacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0027_G10.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0105_B08.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0039_G05.b : ggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0062_D05.b : catggacatgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0081_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0102_G02.b : ntcg
OVR01_0081_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0076_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0181_H08.b : tagttgtcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_H02.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0193_C07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0196_H08.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0067_A02.b : ttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_C06.b : tcagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0074_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0194_D09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0070_E03.b : tttttcctgctg
OVRM1_0219_B01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0099_F04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0002_F03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0003_H07.b : nnnttggtgtnnnttaagagagagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0213_B03.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0090_E03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0101_H10.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0210_G08.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0033_B10.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0083_E06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0102_B01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0202_G02.b : tcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0077_F05.b : cttacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0187_H10.b : gcagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0005_G12.b : nggggttnnntaggatacagagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0040_D11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0103_F12.b : acttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0099_A12.b : gacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0101_G08.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0119_A08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0054_H10.b : ttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0089_F10.b : acttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0079_E08.b : attagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0028_H06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0023_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0010_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0096_H05.b : cttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0057_H03.b : cttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0056_D11.b : ataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0029_H10.b : catxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0090_F10.b : tatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0051_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0020_B02.b : aaaggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0013_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0029_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0049_B02.b : tattttggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0120_F12.b : ccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0024_A11.b : caxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0005_G12.b : ntatcatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0043_F04.b : nggtgtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0085_C09.b : ttttngggcgtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0040_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0010_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0024_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0052_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0048_C07.b : ngggttactnntnnggctaaagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0138_D06.b : nnnnccgtttgcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0049_H05.b : tttttttgagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0038_B11.b : tttttgcgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0115_H11.b : nccgtttgctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0133_H10.b : tcctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0071_H04.b : nnnnggagagtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0061_F05.b : nnncgcgagtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0105_H05.b : nnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0138_E10.b : nnccgtagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0108_F07.b : nccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0023_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0110_H11.b : cccgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0008_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0099_G12.b : ctatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0094_E05.b : tttttactcacg
SPL01_0058_D06.b : atnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0081_C08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxx
UTR01_0029_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0139_C09.b : nccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0020_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0001_F05.b : gccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0014_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0142_D04.b : ccgttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0003_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0087_G09.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0117_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttgatgttgatgcattccaccagtgttac
CLNT1_0108_G02.b : ccgtacagcgtaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0107_C04.b : nccgtcagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0082_C01.b : tacgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0045_C12.b : nggggcttnnnatttgctaaagcagcggtccgxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0103_E03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxx
UTR01_0040_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0090_G05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxx
SMG01_0092_H11.b : nnngggtttnnntttagagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0093_C08.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0047_D10.b : cgcttaaannnnggcgtaagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0079_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctg
OVR01_0021_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0039_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0020_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0015_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0098_D10.b : ctttacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0018_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0108_G05.b : nccgtctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_E05.b : tagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0114_D09.b : nccgttcgcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0003_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0030_G03.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0109_F07.b : nnnacttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0076_E02.b : nggcgtttnanntntgagtaaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0053_F03.b : gacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0023_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0104_A07.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0013_A01.b : atttttgagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0062_B07.b : tttttatacgtt
UTR01_0102_F01.b : acttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0103_H04.b : ctattacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0032_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0145_C03.b : nccgtcagctgtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0044_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0044_F12.b : nccgcttaaanntnagatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0126_F08.b : nccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0084_H11.b : nncgttttnnnnttagagtaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0054_E03.b : ctatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0005_E02.b : agtatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0061_D01.b : tatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0095_B08.b : gacttagacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0053_H03.b : nnnnaatgannnnagagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0004_H04.b : nnnggggattnnnnngggagtaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0204_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0103_B05.b : cttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0143_H07.b : ccgttcagcgtacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0060_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0038_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0030_A10.b : tatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0023_A10.b : nggcaaaannnnnggactaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0083_A09.b : gctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0028_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0042_F12.b : nggcgtttnnnnttgactaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0031_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0090_E01.b : cgcatctnttttagagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0044_A08.b : nnaatgaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0023_D02.b : nnccggctctnnnnnnggctaaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0006_E08.b : nccaaggnnnnnccccacg
CLNT1_0013_G11.b : tccgttagcgttcgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0095_E09.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0116_F08.b : ncctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0034_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0052_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0052_D11.b : atgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0005_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0014_C04.b : nggagtaatannnnggagtaagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0064_F03.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0092_F09.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0204_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0020_C11.b : tagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0026_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0041_G01.b : gtagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0033_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0152_B07.b : nnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0055_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0120_H03.b : tacgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0015_E06.b : nggactacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0023_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0013_B06.b : gtccgtctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0103_A05.b : acttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0089_A02.b : acttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0029_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0205_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0008_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0005_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0074_F02.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0048_D12.b : ttanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0098_B12.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0045_D03.b : acttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0089_F07.b : ttccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0052_G11.b : nggggttaannnntgcgtaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0060_H02.b : nnggggtttaannnnggagtaaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0065_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0015_E02.b : ttccgtcagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0006_C08.b : nnnnttgattaaannnnncctgcg
MLN01_0042_D07.b : actatgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0064_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0061_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0057_E12.b : nccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0090_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0064_E04.b : natgaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0021_A07.b : nnnggtgaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0027_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0028_H06.b : nnaaagtgcaagaggcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0002_G06.b : nnnaagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0078_D04.b : nnngatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0067_B10.b : nnnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0028_B04.b : nnnggagcaagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0011_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0093_D09.b : tccgtttgctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0052_B07.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0068_H04.b : nnnnggagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0098_H04.b : ccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0003_C06.b : nnnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0010_E04.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0006_B01.b : nnnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0047_C08.b : nnnnaagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0060_E05.b : nnnnnnaatgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0056_B05.b : gaaaannggatgaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0065_G08.b : ctatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0012_G11.b : ccgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0064_E06.b : nnnnccgctannnnnnngggtaaagcagcggnxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0109_G07.b : gacatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0072_C07.b : cccgtcagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0079_D07.b : taggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0076_F03.b : ggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0037_C10.b : tacgttagctgtcgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0092_F11.b : ttgctggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0076_A06.b : nnnaaagagatgaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0007_G12.b : tccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0068_D01.b : gacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0049_G02.b : acttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0056_C09.b : nnnggcattnnnnnngggtaacagctggaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0053_H02.b : nnnggatgaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0064_D12.b : tttttcctact
TES01_0033_G01.b : cgc
TES01_0070_A09.b : tttttcctgct
THY01_0044_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0036_E10.b : ncggtgaaaannnggataaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0036_A03.b : nxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0079_C01.b : ccaatcttctgcatgagtgtgcgacagctcaaaagcgtgaggxxxxxxxxxxxxxxxxxx
SMG01_0026_F07.b : nnnggccttatnnnnnggacgtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0041_C01.b : nnnnncccact
CLNT1_0026_G06.b : gccgtttgctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0004_D03.b : gacacgttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0069_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0118_B06.b : taatttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0100_A06.b : ttttcctacg
UTR01_0070_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0022_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0057_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0100_H08.b : nttttccgtcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0031_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0101_F06.b : gcttgtgacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0002_C08.b : nncccccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0026_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0052_G09.b : nggttccctgc
LNG01_0021_C01.b : aggacntatagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0059_B03.b : nnnnnngctgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0048_H01.b : gctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0018_B11.b : nnngggaataaannnnnngctgcgt
ILNT1_0076_B07.b : nnnnggacggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0118_H03.b : ttttggatggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0027_H12.b : nnnggcggcttaatnnnnncctgcgg
HTMT1_0013_D11.b : ttttccgagagtagacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0028_E11.b : tcagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0066_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0011_A10.b : ngcgaannnnnnnncctgaggg
OVR01_0025_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0027_B12.b : ttagttcagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0096_D03.b : ctggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0102_B06.b : nnnngggtgacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0104_F07.b : ctatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0074_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0023_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0056_B08.b : nccgtttnnnnngggagtaagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0083_C04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0023_A10.b : ttcct
UTR01_0058_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0018_C11.b : nactggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0017_C01.b : tgtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0157_A10.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0184_G01.b : gaattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0060_F05.b : ntcg
OVRM1_0010_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0049_G12.b : tggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0011_D07.b : nnaaatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0050_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0022_A05.b : taaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0025_D12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0008_C01.b : nnnaatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0010_E05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0049_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0129_A12.b : nnnnnccgtcagcgtacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0030_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0032_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0058_F01.b : ggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0042_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0055_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0042_H11.b : tttttactgctgttg
OVRT1_0124_A07.b : nnnnccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0095_A09.b : nnggtgatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0093_H12.b : gatggtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0019_D12.b : atacgttcagcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0019_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0005_E04.b : nnnnncctgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0048_E08.b : nnnnggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0073_F06.b : nnnccctaaaannnggacaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0002_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0040_B02.b : nnnncct
PCT01_0003_H04.b : ngggatgcttnnnncctac
PST01_0015_A04.b : nnccgcatnnnnnnncctgc
TES01_0109_F11.b : tc
TES01_0052_E05.b : nnnnncc
TES01_0026_F03.b : ttcc
TES01_0007_G01.b : ntt
PTG01_0109_F08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0096_D07.b : tttactac
TES01_0072_B12.b : ttttcctg
TES01_0111_C02.b : nttggctac
TES01_0083_B11.b : ttttacta
TES01_0069_B03.b : tttttcctg
TES01_0051_C01.b : ntttcct
CLNT1_0078_H02.b : ttcnnngcacacgtctgcgacgagtgtcttcgctctxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0004_D04.b : ttggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0135_B01.b : nagttgtcxxxxxxxxxxxxx
20110601C-000998 : GCCCGGCGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
---------+---------+---------+---------+---------+---------+ 76
OVRM1_0049_A11.b : GCCCGAC*CTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0106_B06.b : GCCCGAC*CTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTAC
TES01_0029_G10.b : GCTCTGG*CTCTATC*GGCA*GCTTC*GACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0041_G10.b : ggACTGG*CTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LNG01_0031_D09.b : xxxtGGCTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0016_C03.b : xxxxxGGGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0024_H09.b : xxxxxTGGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SMG01_0083_C02.b : xxxxgGGGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SMG01_0060_H07.b : xxtggTGGCTCTATC*CACT*TCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0169_G02.b : xxxxxxCTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0006_F02.b : xxxxxxAGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0074_E09.b : xxxxxxCTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0060_F10.b : xxxxxcTGGTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0101_E05.b : xxxxxxGGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TCH01_0055_E11.b : xxxxxcGGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TES01_0067_H08.b : ttgctcTGCTCTATC*GGCA*GCTTC*GACCGC*GGGATGTCTCACAGG**AAGTTCTCC
MLN01_0060_G09.b : xxxxxxCTCTCTATC*GGCA*GCTTCCGACCGC*CGGATGTCTCACAGG**AAGTTCTCC
ADR01_0021_A10.b : xxxxxxCTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ILNT1_0056_A01.b : xxxxxtTGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0015_B01.b : xxxxxxCTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0051_C03.b : xxxxxxCTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SMG01_0033_A02.b : xxxxxxCTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0092_E09.b : xxxxxxGGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0040_A05.b : xxxxxxCTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LNG01_0023_F02.b : xxxxxxAGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SPL01_0069_F12.b : xxxxxxCTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PTG01_0046_H03.b : xxxxxxGGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TCH01_0060_F12.b : xxxxxxCTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LVR01_0021_H11.b : xxxxxxCTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0071_A12.b : xxxxxxCTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TCH01_0024_F10.b : xxxxxxCTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
BFLT1_0122_F01.b : xxxxctCTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0122_H10.b : xxxxxcGGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SPL01_0077_G09.b : xxxxxxCTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0038_C12.b : xxxxxxCTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0097_G11.b : xxxxxxCTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PBL01_0077_H08.b : xxxxxxGGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ITT01_0061_H08.b : xxxxxxCTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ITT01_0008_A03.b : xxxxxxCTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
BMWN1_0080_G01.b : xxxxxxxGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LVRM1_0001_C05.b : xxxxxxxTGGCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
BMWN1_0014_D05.b : xxxxxxxGCTCTATC*GCCA*TTTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
BMWN1_0095_E01.b : xxxxxxxGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0045_B02.b : ttgcctaGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TCH01_0040_G05.b : xxxxxxxGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0044_F01.b : xxxxxxcTGGCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LNG01_0031_F12.b : xxxxxxtGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0117_G11.b : xxxxxxcGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SPLT1_0050_B12.b : xxxxxxxGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SPLT1_0049_D01.b : xxxxxxxGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PTG01_0070_E04.b : xxxxxxxGCTCTATC*GGCA*GCTTCCGACCGCGGGNATGTCTCACAGG**AAGTTCTCC
BMWN1_0013_B11.b : xxxxxxxGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ILNT1_0031_A06.b : xxxxxxxGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRT1_0063_B04.b : xxxxxxxTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ILNT1_0014_E12.b : xxxxxxxGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0134_C06.b : xxxxxxtGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CBLT1_0041_D05.b : xxxxxxxGCTCTATC*GGCACGCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SPLT1_0037_A12.b : xxxxxxxGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TCH01_0057_C09.b : xxxxxxxTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LNG01_0082_H04.b : xxxxxxxACTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0027_G10.b : xxxxxxxGCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PBL01_0105_B08.b : xxxxxxxTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TCH01_0039_G05.b : xxxxxxxTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LNG01_0062_D05.b : xxxxxxxTCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0081_A07.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TES01_0102_G02.b : cgctggctCTGGATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0081_C05.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0076_G05.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0181_H08.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LVRM1_0200_H02.b : xxxxxxxxCTCTATC*GGCA*GCCTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0193_C07.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0196_H08.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0067_A02.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LVRM1_0157_C06.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0074_A12.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0194_D09.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TES01_0070_E03.b : tggctctgGCTCTTC*NGCA*GCTTC*GACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0219_B01.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0099_F04.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0002_F03.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SMG01_0003_H07.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0213_B03.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0090_E03.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0101_H10.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0210_G08.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0033_B10.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0083_E06.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTCCTCC
OVRM1_0102_B01.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0202_G02.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0077_F05.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0187_H10.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PBL01_0005_G12.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0040_D11.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0103_F12.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0099_A12.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0101_G08.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0119_A08.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TCH01_0054_H10.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0089_F10.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0079_E08.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0028_H06.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SPL01_0023_D10.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SPL01_0010_B12.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0096_H05.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGCGGGACGCTTTAAGAGG**AAGTTCTCC
OVR01_0057_H03.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0056_D11.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0029_H10.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SPL01_0090_F10.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0051_F12.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PBL01_0020_B02.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0013_D08.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LNG01_0029_H01.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PTG01_0049_B02.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0120_F12.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ADR01_0024_A11.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ADR01_0005_G12.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ADR01_0043_F04.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SMG01_0085_C09.b : xxxxxxxxCTCTATC*AGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0040_F12.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SPL01_0010_B01.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0024_H04.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0052_D10.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SMG01_0048_C07.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRT1_0138_D06.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PTG01_0049_H05.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PTG01_0038_B11.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0115_H11.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0133_H10.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ILNT1_0071_H04.b : xxxxggacCTCTCTC*TGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SPLT1_0061_F05.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRT1_0105_H05.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0138_E10.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0108_F07.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0023_D09.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0110_H11.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0008_D05.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0099_G12.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TES01_0094_E05.b : ttggcacgGCTCTTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SPL01_0058_D06.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SMG01_0081_C08.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0029_D06.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0139_C09.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0020_G12.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0001_F05.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0014_E04.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRT1_0142_D04.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0003_F05.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0087_G09.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0117_B11.b : gtgcactaCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0108_G02.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0107_C04.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
BFLT1_0082_C01.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SMG01_0045_C12.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SMG01_0103_E03.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0040_F06.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SMG01_0090_G05.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SMG01_0092_H11.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0093_C08.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PTG01_0047_D10.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0079_D12.b : gaaaaaaaCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0021_D01.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SPL01_0039_G10.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0020_G05.b : xxxxxxxxCTCTATCCGGCA*GCTTCCGACCGCGGGGATGTCTCACAGG**AAGTTCTCC
UTR01_0015_B03.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SPL01_0098_D10.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0018_A07.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0108_G05.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LVR01_0087_E05.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0114_D09.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0003_F06.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
MLN01_0030_G03.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0109_F07.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SMG01_0076_E02.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0053_F03.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0023_E02.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0104_A07.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PTG01_0013_A01.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TES01_0062_B07.b : gctatgggGCTCTTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0102_F01.b : xxxxxxxxCTCTATC*TGCA*GCTTCCGACCAC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0103_H04.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0032_A04.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0145_C03.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0044_E05.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PTG01_0044_F12.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0126_F08.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SMG01_0084_H11.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0054_E03.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
MLN01_0005_E02.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0061_D01.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0095_B08.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ADR01_0053_H03.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PTG01_0004_H04.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0204_D03.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0103_B05.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0143_H07.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0060_E05.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACTGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0038_E03.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SPL01_0030_A10.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SMG01_0023_A10.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LVR01_0003_E06.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
MLN01_0083_A09.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0028_C06.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PTG01_0042_F12.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LVR01_0078_H12.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0031_G10.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SMG01_0090_E01.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ADR01_0044_A08.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SMG01_0023_D02.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SKNB1_0006_E08.b : ttggctacGCTCATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0013_G11.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0095_E09.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0116_F08.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0034_C09.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0052_B09.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0052_D11.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0005_C11.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SMG01_0014_C04.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0064_F03.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SPL01_0092_F09.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0204_G09.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0020_C11.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0026_B05.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LVR01_0041_G01.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0033_G07.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0152_B07.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0055_G11.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0120_H03.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PBL01_0015_E06.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0023_D06.b : xxxxxxxxCTCTATC*GGCA*GCTTCCAACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0013_B06.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SPL01_0103_A05.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGCCTCACAGG**AAGTTCTCC
UTR01_0089_A02.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0029_H03.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0205_E02.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0008_A07.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0005_G08.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TCH01_0074_F02.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SPL01_0048_D12.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0098_B12.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SPL01_0045_D03.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0089_F07.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PTG01_0052_G11.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SMG01_0060_H02.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0065_B01.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
BFLT1_0015_E02.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PCT01_0006_C08.b : ggtgcangGGCTCTACGGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
MLN01_0042_D07.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0064_H05.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0061_D11.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRT1_0057_E12.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0090_F03.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PBL01_0064_E04.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ITT01_0021_A07.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LNG01_0027_H02.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PBL01_0028_H06.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ITT01_0002_G06.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PBL01_0078_D04.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ITT01_0067_B10.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PBL01_0028_B04.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0011_G06.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
BFLT1_0093_D09.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PBL01_0052_B07.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PBL01_0068_H04.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
BFLT1_0098_H04.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ITT01_0003_C06.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ITT01_0010_E04.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ITT01_0006_B01.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ADR01_0047_C08.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ADR01_0060_E05.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ADR01_0056_B05.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SPL01_0065_G08.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0012_G11.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SMG01_0064_E06.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LNG01_0109_G07.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0072_C07.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TCH01_0079_D07.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LNG01_0076_F03.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0037_C10.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LNG01_0092_F11.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ADR01_0076_A06.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0007_G12.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LNG01_0068_D01.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
MLN01_0049_G02.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ITT01_0056_C09.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ITT01_0053_H02.b : xxxxxxxxCTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TES01_0064_D12.b : gttgctatgGCTCTACGGCA*GCTTC*GACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TES01_0033_G01.b : agttggctaTGGATC*GGCA*GCTT*CGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TES01_0070_A09.b : gttgctatgGCTCTTCGGCA*GCTTC*GACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0044_C09.b : xxxxxxxxxTGGATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SMG01_0036_E10.b : xxxxxxxxtTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0036_A03.b : xccgtttacTGGATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRT1_0079_C01.b : xxxxxxxxxTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SMG01_0026_F07.b : xxxxxxxxxTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SKNB1_0041_C01.b : gtggctctgGCTCTTCGGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0026_G06.b : xxxxxxxttTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0004_D03.b : xxxxxxxxaTCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0069_C07.b : xxxxxxxxxxCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0118_B06.b : xxxxxxxxxxCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TES01_0100_A06.b : tggctctggcCTATC*GGCA*GCTTC*GACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0070_B09.b : xxxxxxxxxxCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0022_B06.b : xxxxxxxxxxCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0057_G12.b : xxxxxxxxxxCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRT1_0100_H08.b : xxxxxxxxxxCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0031_G07.b : xxcgttctacTGATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SPL01_0101_F06.b : xxxxxxxxxxGGATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRT1_0002_C08.b : xxxxxxxxxxCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0026_D03.b : xxxxxxxxxxCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TES01_0052_G09.b : tgttgctatgGGATC*GGCA*GCTTCC*ACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LNG01_0021_C01.b : xxxxxxxxxxCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ADR01_0059_B03.b : xxxxxxxxxxGGATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TCH01_0048_H01.b : xxxxxxxxxxCTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PCT01_0018_B11.b : ttggcactggcCTTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ILNT1_0076_B07.b : xxxxxxxxxxxGATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
HTMT1_0118_H03.b : xxxxxxxxxxxGATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PCT01_0027_H12.b : tgtgcacgtgcCTTC*GGCA*GCTTCCGACCGC*GGGAAGTCTCACAGG**AAGTTCTCC
HTMT1_0013_D11.b : xxxxxxxxxxxGATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0028_E11.b : xxxcctttttcGATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0066_C08.b : xxxxxxxxxxxTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PCT01_0011_A10.b : tgctcgtgctcCTTC*GGCA*GCTTCCGACCGC*GGGAAGTCTCACAGG**AAGTTCTCC
OVR01_0025_B01.b : xxxxxxxxxxxTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0027_B12.b : xxxxxxxxxxxTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LNG01_0096_D03.b : xxxxxxxxxxxTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PBL01_0102_B06.b : xxxxxxxxxxxGATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SPL01_0104_F07.b : xxxxxxxxtggTATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0074_D08.b : xxxxxxxxxcggTTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SPL01_0023_B07.b : xxxxxxxxxxxxATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SMG01_0056_B08.b : xxxxxxxxxxxgTTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0083_C04.b : xxxacctaactaATC*GGCA*GNTTCCGACCGC*GGGATGTCTCACAGG**CCTTTAAAC
TES01_0023_A10.b : acgttgctatggATC*GGCA**CTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0058_G05.b : xxxxxxxxxxxxATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TCH01_0018_C11.b : xxxxxxxxxxxxATC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ADR01_0017_C01.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCCACTGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0157_A10.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0184_G01.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TES01_0060_F05.b : cggtggctatggaTC*GGCA*C**TTCCACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0010_D09.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0049_G12.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ADR01_0011_D07.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0050_G02.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ADR01_0022_A05.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRM1_0025_D12.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ADR01_0008_C01.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LNG01_0010_E05.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0049_B09.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0129_A12.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0030_F07.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACCGG**AAGTTCTCC
UTR01_0032_B08.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0058_F01.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0042_D07.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
UTR01_0055_E12.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TES01_0042_H11.b : ctatggcctacttTC*GGC**GCTTC*GACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVRT1_0124_A07.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ITT01_0095_A09.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
LNG01_0093_H12.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0019_D12.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
OVR01_0019_A12.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ADR01_0005_E04.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ITT01_0048_E08.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
ADR01_0073_F06.b : xxxxxxxxxxxxxTC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
THY01_0002_H02.b : xxxxxxxxxxxxxxC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
SKNB1_0040_B02.b : gactgtggctatctT*CGGC*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PCT01_0003_H04.b : gttgtgcacggctaC*GGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PST01_0015_A04.b : gttggctcggctctT*CGGC*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TES01_0109_F11.b : tacgttggctatggatGGCA*GCTTC*GACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TES01_0052_E05.b : tactgttgctatggatGGCA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TES01_0026_F03.b : tgcggtggctctggatGGCA*GCTTC*GACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TES01_0007_G01.b : tcgacgtggcatggatGGCA*GCTTCC*ACCGC*GGGATGTCTCACAGG**AAGTTCTCC
PTG01_0109_F08.b : nnnnnnnctctatcgnnGCA*GCTTCCGACCGC*GGGATGTCTCACAGGNNAAGTTCTCC
TES01_0096_D07.b : ggtggctatggctcttcaGA*GCTTCCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TES01_0072_B12.b : cggtggctctggctcttcnG*CGCTTCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TES01_0111_C02.b : tgtggctctggctcttcngA*GCTTC*GACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TES01_0083_B11.b : cggttgctctggctcttcnG*CGCTTCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TES01_0069_B03.b : ctgttgctctggctcttcnG*CGCTTCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
TES01_0051_C01.b : gctgtggctatggctcttcngAGCTTCGACCGC*GGGATGTCTCACAGG**AAGTTCTCC
CLNT1_0078_H02.b : xxxxxxxxctcctccactagggnagnttnntanngngggatgtntnanaggaccctcaaa
OVR01_0004_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctctatcgacagcttccgacc
LVRM1_0135_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctctatcggcagcttccgacc
20110601C-000998 : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
---------+---------+---------+---------+---------+---------+ 135
OVRM1_0049_A11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0106_B06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TES01_0029_G10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCATCCGGCACCGCGG
OVR01_0041_G10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LNG01_0031_D09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0016_C03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0024_H09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTANCAGCCGGCACCGCGG
SMG01_0083_C02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SMG01_0060_H07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0169_G02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0006_F02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0074_E09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0060_F10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0101_E05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TCH01_0055_E11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TES01_0067_H08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
MLN01_0060_G09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ADR01_0021_A10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ILNT1_0056_A01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0015_B01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0051_C03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SMG01_0033_A02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0092_E09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0040_A05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LNG01_0023_F02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SPL01_0069_F12.b : GCTCCCAGGCACGAGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PTG01_0046_H03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TCH01_0060_F12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LVR01_0021_H11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0071_A12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TCH01_0024_F10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
BFLT1_0122_F01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0122_H10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SPL01_0077_G09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0038_C12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0097_G11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PBL01_0077_H08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ITT01_0061_H08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ITT01_0008_A03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
BMWN1_0080_G01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LVRM1_0001_C05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
BMWN1_0014_D05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
BMWN1_0095_E01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0045_B02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TCH01_0040_G05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0044_F01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LNG01_0031_F12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0117_G11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SPLT1_0050_B12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SPLT1_0049_D01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PTG01_0070_E04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
BMWN1_0013_B11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ILNT1_0031_A06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRT1_0063_B04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ILNT1_0014_E12.b : GCTCCCACGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0134_C06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CBLT1_0041_D05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SPLT1_0037_A12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TCH01_0057_C09.b : GCTCCCAGGCACGGGTCCCCGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LNG01_0082_H04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0027_G10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PBL01_0105_B08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TCH01_0039_G05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LNG01_0062_D05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0081_A07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TES01_0102_G02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0081_C05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0076_G05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0181_H08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LVRM1_0200_H02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0193_C07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0196_H08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0067_A02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LVRM1_0157_C06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0074_A12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0194_D09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TES01_0070_E03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0219_B01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0099_F04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0002_F03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SMG01_0003_H07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0213_B03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0090_E03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0101_H10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0210_G08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0033_B10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0083_E06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0102_B01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0202_G02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0077_F05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0187_H10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PBL01_0005_G12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0040_D11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0103_F12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0099_A12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0101_G08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0119_A08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TCH01_0054_H10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0089_F10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0079_E08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0028_H06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SPL01_0023_D10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SPL01_0010_B12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0096_H05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCCCGG
OVR01_0057_H03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0056_D11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0029_H10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SPL01_0090_F10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0051_F12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PBL01_0020_B02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0013_D08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTGGCAGCCGGCACCGCGG
LNG01_0029_H01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PTG01_0049_B02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0120_F12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ADR01_0024_A11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ADR01_0005_G12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ADR01_0043_F04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SMG01_0085_C09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0040_F12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SPL01_0010_B01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0024_H04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0052_D10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SMG01_0048_C07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRT1_0138_D06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PTG01_0049_H05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PTG01_0038_B11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0115_H11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0133_H10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ILNT1_0071_H04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SPLT1_0061_F05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRT1_0105_H05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0138_E10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0108_F07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0023_D09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0110_H11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0008_D05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0099_G12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TES01_0094_E05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SPL01_0058_D06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SMG01_0081_C08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0029_D06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0139_C09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0020_G12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0001_F05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0014_E04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRT1_0142_D04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0003_F05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0087_G09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0117_B11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0108_G02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0107_C04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
BFLT1_0082_C01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SMG01_0045_C12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SMG01_0103_E03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0040_F06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SMG01_0090_G05.b : GCTCCCAGGCACGGGTCCCTGG*GCCTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SMG01_0092_H11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0093_C08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PTG01_0047_D10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0079_D12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0021_D01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SPL01_0039_G10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0020_G05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0015_B03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SPL01_0098_D10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0018_A07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0108_G05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LVR01_0087_E05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0114_D09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0003_F06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
MLN01_0030_G03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0109_F07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SMG01_0076_E02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0053_F03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0023_E02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGCAGCAGCCGGCACCGCGG
OVR01_0104_A07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PTG01_0013_A01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCAGAAGCGTAGCAGCCGGCACCGCGG
TES01_0062_B07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0102_F01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAACCGGCACCGCGG
UTR01_0103_H04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0032_A04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0145_C03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0044_E05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PTG01_0044_F12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0126_F08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SMG01_0084_H11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0054_E03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
MLN01_0005_E02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0061_D01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0095_B08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ADR01_0053_H03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PTG01_0004_H04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0204_D03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0103_B05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0143_H07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0060_E05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0038_E03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SPL01_0030_A10.b : GCTCCCAGGCACGGGTCCCCGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SMG01_0023_A10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LVR01_0003_E06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
MLN01_0083_A09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0028_C06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PTG01_0042_F12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LVR01_0078_H12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0031_G10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SMG01_0090_E01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ADR01_0044_A08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SMG01_0023_D02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SKNB1_0006_E08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0013_G11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0095_E09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0116_F08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0034_C09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0052_B09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0052_D11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0005_C11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SMG01_0014_C04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0064_F03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SPL01_0092_F09.b : GCTCCCAGGCATGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0204_G09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0020_C11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0026_B05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LVR01_0041_G01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0033_G07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0152_B07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0055_G11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0120_H03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PBL01_0015_E06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0023_D06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0013_B06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SPL01_0103_A05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0089_A02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0029_H03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0205_E02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0008_A07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0005_G08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TCH01_0074_F02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SPL01_0048_D12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0098_B12.b : GCTCCCGGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SPL01_0045_D03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0089_F07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PTG01_0052_G11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SMG01_0060_H02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0065_B01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
BFLT1_0015_E02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PCT01_0006_C08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAACGTAGCAGCCGGCACCGCGG
MLN01_0042_D07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0064_H05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0061_D11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRT1_0057_E12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0090_F03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PBL01_0064_E04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ITT01_0021_A07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LNG01_0027_H02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PBL01_0028_H06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ITT01_0002_G06.b : GCTCCCAGGCACGGGTCCCTGA*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PBL01_0078_D04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ITT01_0067_B10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PBL01_0028_B04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0011_G06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
BFLT1_0093_D09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PBL01_0052_B07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PBL01_0068_H04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
BFLT1_0098_H04.b : GCTCCCAGGCACGGGTCCCT*G*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ITT01_0003_C06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ITT01_0010_E04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ITT01_0006_B01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ADR01_0047_C08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ADR01_0060_E05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ADR01_0056_B05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SPL01_0065_G08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0012_G11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SMG01_0064_E06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LNG01_0109_G07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0072_C07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TCH01_0079_D07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LNG01_0076_F03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0037_C10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LNG01_0092_F11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ADR01_0076_A06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCGCCGCGG
CLNT1_0007_G12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LNG01_0068_D01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
MLN01_0049_G02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ITT01_0056_C09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ITT01_0053_H02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TES01_0064_D12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TES01_0033_G01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TES01_0070_A09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0044_C09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SMG01_0036_E10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0036_A03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRT1_0079_C01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SMG01_0026_F07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SKNB1_0041_C01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0026_G06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0004_D03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0069_C07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0118_B06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGTAGCCGGCACCGCGG
TES01_0100_A06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0070_B09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0022_B06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0057_G12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRT1_0100_H08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0031_G07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SPL01_0101_F06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRT1_0002_C08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0026_D03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TES01_0052_G09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LNG01_0021_C01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ADR01_0059_B03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TCH01_0048_H01.b : GCTCCCAGGCACGGGCCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PCT01_0018_B11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAACGTAGCAGCCGGCACCGCGG
ILNT1_0076_B07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
HTMT1_0118_H03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PCT01_0027_H12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAACGTAGCAGCCGGCACCGCGG
HTMT1_0013_D11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0028_E11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0066_C08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PCT01_0011_A10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAACGTAGCAGCCGGCACCGCGG
OVR01_0025_B01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0027_B12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LNG01_0096_D03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PBL01_0102_B06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SPL01_0104_F07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0074_D08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SPL01_0023_B07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SMG01_0056_B08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0083_C04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TES01_0023_A10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0058_G05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TCH01_0018_C11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ADR01_0017_C01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0157_A10.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0184_G01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TES01_0060_F05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0010_D09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0049_G12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ADR01_0011_D07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0050_G02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ADR01_0022_A05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRM1_0025_D12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ADR01_0008_C01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LNG01_0010_E05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0049_B09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0129_A12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0030_F07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0032_B08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0058_F01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0042_D07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
UTR01_0055_E12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TES01_0042_H11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVRT1_0124_A07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ITT01_0095_A09.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LNG01_0093_H12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0019_D12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCCGCACCGCGG
OVR01_0019_A12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ADR01_0005_E04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ITT01_0048_E08.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
ADR01_0073_F06.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
THY01_0002_H02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
SKNB1_0040_B02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PCT01_0003_H04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAACGTAGCAGCCGGCACCGCGG
PST01_0015_A04.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TES01_0109_F11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TES01_0052_E05.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGGAGCGTAGCAGCCGGCACCGCGG
TES01_0026_F03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TES01_0007_G01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
PTG01_0109_F08.b : GCTCCCAGGCACGGGTCCCTGGGGCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TES01_0096_D07.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TES01_0072_B12.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TES01_0111_C02.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TES01_0083_B11.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TES01_0069_B03.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
TES01_0051_C01.b : GCTCCCAGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
CLNT1_0078_H02.b : GCTCCCAGGNACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
OVR01_0004_D04.b : gcgggaTGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
LVRM1_0135_B01.b : gcgggatGGCACGGGTCCCTGG*GCTTCCTGCCTCGGAAGCGTAGCAGCCGGCACCGCGG
20110601C-000998 : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
---------+---------+---------+---------+---------+---------+ 194
OVRM1_0049_A11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCNAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0106_B06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0029_G10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0041_G10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LNG01_0031_D09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0016_C03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0024_H09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SMG01_0083_C02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SMG01_0060_H07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0169_G02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0006_F02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0074_E09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0060_F10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0101_E05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TCH01_0055_E11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0067_H08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
MLN01_0060_G09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ADR01_0021_A10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ILNT1_0056_A01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0015_B01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0051_C03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SMG01_0033_A02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0092_E09.b : GAAGGTGAAGAGTTACCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0040_A05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LNG01_0023_F02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SPL01_0069_F12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PTG01_0046_H03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TCH01_0060_F12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LVR01_0021_H11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0071_A12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TCH01_0024_F10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
BFLT1_0122_F01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0122_H10.b : GAAGGTGAGGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SPL01_0077_G09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0038_C12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0097_G11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PBL01_0077_H08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ITT01_0061_H08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ITT01_0008_A03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
BMWN1_0080_G01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LVRM1_0001_C05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
BMWN1_0014_D05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
BMWN1_0095_E01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0045_B02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TCH01_0040_G05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0044_F01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LNG01_0031_F12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0117_G11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SPLT1_0050_B12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SPLT1_0049_D01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PTG01_0070_E04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
BMWN1_0013_B11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ILNT1_0031_A06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRT1_0063_B04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ILNT1_0014_E12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0134_C06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CBLT1_0041_D05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SPLT1_0037_A12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TCH01_0057_C09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LNG01_0082_H04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0027_G10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PBL01_0105_B08.b : GAAGGTGAAGAGCTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TCH01_0039_G05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LNG01_0062_D05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0081_A07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0102_G02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0081_C05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0076_G05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0181_H08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LVRM1_0200_H02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0193_C07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0196_H08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0067_A02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LVRM1_0157_C06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0074_A12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0194_D09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0070_E03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0219_B01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0099_F04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0002_F03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SMG01_0003_H07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0213_B03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0090_E03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0101_H10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0210_G08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0033_B10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0083_E06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0102_B01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0202_G02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0077_F05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCGAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0187_H10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PBL01_0005_G12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0040_D11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0103_F12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0099_A12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0101_G08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0119_A08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TCH01_0054_H10.b : GAAGGTGAAGAGTTTCCCC*TAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0089_F10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0079_E08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCGAGGCCGTGCACCTCACCGCCTTCC
OVRM1_0028_H06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SPL01_0023_D10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SPL01_0010_B12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0096_H05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGATTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0057_H03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0056_D11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0029_H10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SPL01_0090_F10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0051_F12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PBL01_0020_B02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0013_D08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LNG01_0029_H01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PTG01_0049_B02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0120_F12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ADR01_0024_A11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ADR01_0005_G12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ADR01_0043_F04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SMG01_0085_C09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0040_F12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SPL01_0010_B01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0024_H04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0052_D10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SMG01_0048_C07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRT1_0138_D06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PTG01_0049_H05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PTG01_0038_B11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0115_H11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0133_H10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ILNT1_0071_H04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SPLT1_0061_F05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRT1_0105_H05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0138_E10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0108_F07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0023_D09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0110_H11.b : GAAGGTGAAGAGTCTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0008_D05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0099_G12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0094_E05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SPL01_0058_D06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SMG01_0081_C08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0029_D06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0139_C09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0020_G12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0001_F05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0014_E04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRT1_0142_D04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0003_F05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0087_G09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0117_B11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0108_G02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0107_C04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
BFLT1_0082_C01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SMG01_0045_C12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SMG01_0103_E03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0040_F06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SMG01_0090_G05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SMG01_0092_H11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0093_C08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PTG01_0047_D10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0079_D12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0021_D01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SPL01_0039_G10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0020_G05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0015_B03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SPL01_0098_D10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0018_A07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0108_G05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LVR01_0087_E05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0114_D09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGGCTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0003_F06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
MLN01_0030_G03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0109_F07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SMG01_0076_E02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0053_F03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0023_E02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0104_A07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PTG01_0013_A01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0062_B07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0102_F01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0103_H04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0032_A04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0145_C03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0044_E05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PTG01_0044_F12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0126_F08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SMG01_0084_H11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0054_E03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
MLN01_0005_E02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0061_D01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0095_B08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ADR01_0053_H03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PTG01_0004_H04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0204_D03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0103_B05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0143_H07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0060_E05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0038_E03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SPL01_0030_A10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SMG01_0023_A10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LVR01_0003_E06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
MLN01_0083_A09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0028_C06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PTG01_0042_F12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LVR01_0078_H12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0031_G10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SMG01_0090_E01.b : GAAGGTGAAGAGTTCCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ADR01_0044_A08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SMG01_0023_D02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SKNB1_0006_E08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0013_G11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCACCTTCC
UTR01_0095_E09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0116_F08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCACCTTCC
THY01_0034_C09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0052_B09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0052_D11.b : GAAGGTGAAGAGTTTCCCCCAAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0005_C11.b : GAAGGTGAAGAGTTTCCCC*AGGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SMG01_0014_C04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0064_F03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SPL01_0092_F09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0204_G09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0020_C11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0026_B05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LVR01_0041_G01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0033_G07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0152_B07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0055_G11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0120_H03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PBL01_0015_E06.b : GAAGGTGAAGAGTTTCACC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0023_D06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0013_B06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SPL01_0103_A05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0089_A02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0029_H03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0205_E02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0008_A07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0005_G08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TCH01_0074_F02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SPL01_0048_D12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0098_B12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SPL01_0045_D03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0089_F07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PTG01_0052_G11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SMG01_0060_H02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0065_B01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
BFLT1_0015_E02.b : GAAGGCGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PCT01_0006_C08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
MLN01_0042_D07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0064_H05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0061_D11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRT1_0057_E12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0090_F03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PBL01_0064_E04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ITT01_0021_A07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LNG01_0027_H02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PBL01_0028_H06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGGACCTCACCGCCTTCC
ITT01_0002_G06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PBL01_0078_D04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ITT01_0067_B10.b : GAAAGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PBL01_0028_B04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0011_G06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
BFLT1_0093_D09.b : GAAGGTGAAGAATTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCATCTCACCGCCTTCC
PBL01_0052_B07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PBL01_0068_H04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
BFLT1_0098_H04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ITT01_0003_C06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ITT01_0010_E04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ITT01_0006_B01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ADR01_0047_C08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ADR01_0060_E05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ADR01_0056_B05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SPL01_0065_G08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0012_G11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SMG01_0064_E06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LNG01_0109_G07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0072_C07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TCH01_0079_D07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LNG01_0076_F03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0037_C10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LNG01_0092_F11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ADR01_0076_A06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0007_G12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LNG01_0068_D01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
MLN01_0049_G02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ITT01_0056_C09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ITT01_0053_H02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0064_D12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0033_G01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0070_A09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0044_C09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SMG01_0036_E10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0036_A03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRT1_0079_C01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SMG01_0026_F07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SKNB1_0041_C01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0026_G06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0004_D03.b : GAAGGTGAAGAGCTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0069_C07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0118_B06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0100_A06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0070_B09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0022_B06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0057_G12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRT1_0100_H08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0031_G07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SPL01_0101_F06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRT1_0002_C08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0026_D03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0052_G09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LNG01_0021_C01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ADR01_0059_B03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACCCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TCH01_0048_H01.b : GAAGGTGAAGAGCTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PCT01_0018_B11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ILNT1_0076_B07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
HTMT1_0118_H03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PCT01_0027_H12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
HTMT1_0013_D11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0028_E11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0066_C08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PCT01_0011_A10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0025_B01.b : GAAGGTGATGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0027_B12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGTACCTCACCGCCTTCC
LNG01_0096_D03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PBL01_0102_B06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SPL01_0104_F07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0074_D08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SPL01_0023_B07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SMG01_0056_B08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0083_C04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0023_A10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCATCGCCTTCC
UTR01_0058_G05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TCH01_0018_C11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ADR01_0017_C01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0157_A10.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0184_G01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0060_F05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0010_D09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0049_G12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ADR01_0011_D07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0050_G02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ADR01_0022_A05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRM1_0025_D12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ADR01_0008_C01.b : GAAGGTGAAGAGTTTCCCC*AAGGGTGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LNG01_0010_E05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0049_B09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0129_A12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0030_F07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0032_B08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0058_F01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0042_D07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
UTR01_0055_E12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0042_H11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVRT1_0124_A07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ITT01_0095_A09.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LNG01_0093_H12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0019_D12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0019_A12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ADR01_0005_E04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ITT01_0048_E08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
ADR01_0073_F06.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
THY01_0002_H02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
SKNB1_0040_B02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCCCACCGCCTTCC
PCT01_0003_H04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
PST01_0015_A04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0109_F11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0052_E05.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0026_F03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCATCGCCTTCC
TES01_0007_G01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCATCGCCTTCC
PTG01_0109_F08.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0096_D07.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0072_B12.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0111_C02.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0083_B11.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0069_B03.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
TES01_0051_C01.b : GAAGGTGAGGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
CLNT1_0078_H02.b : GAAGGGGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
OVR01_0004_D04.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
LVRM1_0135_B01.b : GAAGGTGAAGAGTTTCCCC*AAGGATGACTCTTCCAAGCCCGTGCACCTCACCGCCTTCC
20110601C-000998 : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
---------+---------+---------+---------+---------+---------+ 254
OVRM1_0049_A11.b : TTGGCTACNAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0106_B06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0029_G10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0041_G10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
LNG01_0031_D09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0016_C03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0024_H09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SMG01_0083_C02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SMG01_0060_H07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0169_G02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0006_F02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0074_E09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0060_F10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0101_E05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TCH01_0055_E11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0067_H08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
MLN01_0060_G09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ADR01_0021_A10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ILNT1_0056_A01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0015_B01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0051_C03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SMG01_0033_A02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0092_E09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0040_A05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
LNG01_0023_F02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SPL01_0069_F12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PTG01_0046_H03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TCH01_0060_F12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
LVR01_0021_H11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0071_A12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TCH01_0024_F10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
BFLT1_0122_F01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0122_H10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SPL01_0077_G09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0038_C12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0097_G11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PBL01_0077_H08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ITT01_0061_H08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ITT01_0008_A03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
BMWN1_0080_G01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
LVRM1_0001_C05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
BMWN1_0014_D05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
BMWN1_0095_E01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0045_B02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TCH01_0040_G05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0044_F01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCTAAGG
LNG01_0031_F12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0117_G11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SPLT1_0050_B12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SPLT1_0049_D01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PTG01_0070_E04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
BMWN1_0013_B11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ILNT1_0031_A06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRT1_0063_B04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ILNT1_0014_E12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0134_C06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CBLT1_0041_D05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SPLT1_0037_A12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TCH01_0057_C09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
LNG01_0082_H04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0027_G10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PBL01_0105_B08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TCH01_0039_G05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
LNG01_0062_D05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0081_A07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0102_G02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0081_C05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0076_G05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCTAAGG
OVRM1_0181_H08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
LVRM1_0200_H02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGG*TCCAAGG
OVRM1_0193_C07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0196_H08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0067_A02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
LVRM1_0157_C06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0074_A12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0194_D09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0070_E03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0219_B01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0099_F04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0002_F03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SMG01_0003_H07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0213_B03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0090_E03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0101_H10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0210_G08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0033_B10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0083_E06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0102_B01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0202_G02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0077_F05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0187_H10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PBL01_0005_G12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0040_D11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0103_F12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0099_A12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0101_G08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0119_A08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TCH01_0054_H10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0089_F10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0079_E08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0028_H06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SPL01_0023_D10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SPL01_0010_B12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0096_H05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0057_H03.b : TTGGCTACAAGGCTGGCATGAGCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0056_D11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0029_H10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SPL01_0090_F10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0051_F12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PBL01_0020_B02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0013_D08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
LNG01_0029_H01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PTG01_0049_B02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0120_F12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ADR01_0024_A11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ADR01_0005_G12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ADR01_0043_F04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SMG01_0085_C09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0040_F12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SPL01_0010_B01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0024_H04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0052_D10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SMG01_0048_C07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRT1_0138_D06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PTG01_0049_H05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PTG01_0038_B11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0115_H11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0133_H10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ILNT1_0071_H04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SPLT1_0061_F05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRT1_0105_H05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0138_E10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0108_F07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0023_D09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0110_H11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0008_D05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0099_G12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0094_E05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SPL01_0058_D06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SMG01_0081_C08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0029_D06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0139_C09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0020_G12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0001_F05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0014_E04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRT1_0142_D04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0003_F05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0087_G09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0117_B11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0108_G02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0107_C04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
BFLT1_0082_C01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SMG01_0045_C12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SMG01_0103_E03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0040_F06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SMG01_0090_G05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SMG01_0092_H11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0093_C08.b : TTGGCTACAAGACTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PTG01_0047_D10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0079_D12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0021_D01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SPL01_0039_G10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0020_G05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0015_B03.b : TTGGCTACNAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SPL01_0098_D10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0018_A07.b : TTGGCTACNAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0108_G05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
LVR01_0087_E05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0114_D09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0003_F06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
MLN01_0030_G03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0109_F07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SMG01_0076_E02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0053_F03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0023_E02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0104_A07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PTG01_0013_A01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0062_B07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0102_F01.b : TTGGCTACAAGGCTGGCATGACCCATATTGTGAGGGAGGTCCATAGGCCTGGGTCCACGG
UTR01_0103_H04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0032_A04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0145_C03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0044_E05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PTG01_0044_F12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0126_F08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SMG01_0084_H11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0054_E03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
MLN01_0005_E02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0061_D01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0095_B08.b : TTGGCTACAATGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ADR01_0053_H03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PTG01_0004_H04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0204_D03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0103_B05.b : TTGGCTACAAGGCTGGCATGACCCACATT*TGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0143_H07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0060_E05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0038_E03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SPL01_0030_A10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SMG01_0023_A10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
LVR01_0003_E06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
MLN01_0083_A09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0028_C06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PTG01_0042_F12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
LVR01_0078_H12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0031_G10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SMG01_0090_E01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ADR01_0044_A08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SMG01_0023_D02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SKNB1_0006_E08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0013_G11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0095_E09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTAAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0116_F08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0034_C09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0052_B09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0052_D11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0005_C11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SMG01_0014_C04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0064_F03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SPL01_0092_F09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0204_G09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0020_C11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0026_B05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
LVR01_0041_G01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0033_G07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0152_B07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0055_G11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0120_H03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PBL01_0015_E06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0023_D06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0013_B06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SPL01_0103_A05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0089_A02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0029_H03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0205_E02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0008_A07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0005_G08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TCH01_0074_F02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SPL01_0048_D12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0098_B12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SPL01_0045_D03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0089_F07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PTG01_0052_G11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SMG01_0060_H02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0065_B01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
BFLT1_0015_E02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PCT01_0006_C08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
MLN01_0042_D07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0064_H05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0061_D11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAGGG
OVRT1_0057_E12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0090_F03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PBL01_0064_E04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ITT01_0021_A07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
LNG01_0027_H02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PBL01_0028_H06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ITT01_0002_G06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PBL01_0078_D04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ITT01_0067_B10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PBL01_0028_B04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0011_G06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
BFLT1_0093_D09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PBL01_0052_B07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PBL01_0068_H04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
BFLT1_0098_H04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ITT01_0003_C06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ITT01_0010_E04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ITT01_0006_B01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ADR01_0047_C08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ADR01_0060_E05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ADR01_0056_B05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SPL01_0065_G08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0012_G11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SMG01_0064_E06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
LNG01_0109_G07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0072_C07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCGAGG
TCH01_0079_D07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
LNG01_0076_F03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0037_C10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
LNG01_0092_F11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ADR01_0076_A06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0007_G12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
LNG01_0068_D01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
MLN01_0049_G02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ITT01_0056_C09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ITT01_0053_H02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0064_D12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0033_G01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0070_A09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0044_C09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SMG01_0036_E10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0036_A03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRT1_0079_C01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SMG01_0026_F07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SKNB1_0041_C01.b : TTGGCTACAAGGCTGGCATGATCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0026_G06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0004_D03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0069_C07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0118_B06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0100_A06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0070_B09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0022_B06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0057_G12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRT1_0100_H08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0031_G07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SPL01_0101_F06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRT1_0002_C08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0026_D03.b : TTGGCTACNAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0052_G09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
LNG01_0021_C01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ADR01_0059_B03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TCH01_0048_H01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PCT01_0018_B11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ILNT1_0076_B07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
HTMT1_0118_H03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PCT01_0027_H12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
HTMT1_0013_D11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0028_E11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0066_C08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PCT01_0011_A10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0025_B01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0027_B12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
LNG01_0096_D03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PBL01_0102_B06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SPL01_0104_F07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0074_D08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SPL01_0023_B07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SMG01_0056_B08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0083_C04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0023_A10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0058_G05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TCH01_0018_C11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ADR01_0017_C01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0157_A10.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0184_G01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0060_F05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0010_D09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0049_G12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ADR01_0011_D07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0050_G02.b : TTGGCTACAAGGCTGGCACGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ADR01_0022_A05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRM1_0025_D12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ADR01_0008_C01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
LNG01_0010_E05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0049_B09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0129_A12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0030_F07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0032_B08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0058_F01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0042_D07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
UTR01_0055_E12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0042_H11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVRT1_0124_A07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ITT01_0095_A09.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGGGGTCGATAGACCTGGGTCCAAGG
LNG01_0093_H12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0019_D12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0019_A12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ADR01_0005_E04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ITT01_0048_E08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
ADR01_0073_F06.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
THY01_0002_H02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
SKNB1_0040_B02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PCT01_0003_H04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PST01_0015_A04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0109_F11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0052_E05.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0026_F03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0007_G01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
PTG01_0109_F08.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0096_D07.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0072_B12.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0111_C02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0083_B11.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0069_B03.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
TES01_0051_C01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
CLNT1_0078_H02.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
OVR01_0004_D04.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
LVRM1_0135_B01.b : TTGGCTACAAGGCTGGCATGACCCACATTGTGAGGGAGGTCGATAGGCCTGGGTCCAAGG
20110601C-000998 : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
---------+---------+---------+---------+---------+---------+ 314
OVRM1_0049_A11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
OVRM1_0106_B06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
TES01_0029_G10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0041_G10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
LNG01_0031_D09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
OVRM1_0016_C03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
OVRM1_0024_H09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
SMG01_0083_C02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SMG01_0060_H07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVRM1_0169_G02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
THY01_0006_F02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVRM1_0074_E09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
OVR01_0060_F10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
OVR01_0101_E05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
TCH01_0055_E11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
TES01_0067_H08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
MLN01_0060_G09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ADR01_0021_A10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ILNT1_0056_A01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
THY01_0015_B01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
THY01_0051_C03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SMG01_0033_A02.b : TGAACAAGAAGGAAGTTGTGGAGACTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0092_E09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
UTR01_0040_A05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
LNG01_0023_F02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
SPL01_0069_F12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
PTG01_0046_H03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TCH01_0060_F12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
LVR01_0021_H11.b : TGAACAAGAAGGAAGTTGTGGAGGTTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0071_A12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TCH01_0024_F10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
BFLT1_0122_F01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0122_H10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SPL01_0077_G09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
THY01_0038_C12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0097_G11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATTG
PBL01_0077_H08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ITT01_0061_H08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ITT01_0008_A03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
BMWN1_0080_G01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
LVRM1_0001_C05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
BMWN1_0014_D05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
BMWN1_0095_E01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
UTR01_0045_B02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TCH01_0040_G05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
UTR01_0044_F01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
LNG01_0031_F12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
CLNT1_0117_G11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SPLT1_0050_B12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SPLT1_0049_D01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
PTG01_0070_E04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
BMWN1_0013_B11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
ILNT1_0031_A06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVRT1_0063_B04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ILNT1_0014_E12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0134_C06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CBLT1_0041_D05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SPLT1_0037_A12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TCH01_0057_C09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
LNG01_0082_H04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
THY01_0027_G10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
PBL01_0105_B08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TCH01_0039_G05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
LNG01_0062_D05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0081_A07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TES01_0102_G02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0081_C05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
OVR01_0076_G05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVRM1_0181_H08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
LVRM1_0200_H02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
OVRM1_0193_C07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
OVRM1_0196_H08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
OVR01_0067_A02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
LVRM1_0157_C06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
OVR01_0074_A12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
OVRM1_0194_D09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
TES01_0070_E03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVRM1_0219_B01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
OVRM1_0099_F04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
OVRM1_0002_F03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
SMG01_0003_H07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVRM1_0213_B03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
OVRM1_0090_E03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGTCACCCATGGTGATCG
OVR01_0101_H10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
OVRM1_0210_G08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
OVRM1_0033_B10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
OVRM1_0083_E06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
OVRM1_0102_B01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
OVRM1_0202_G02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
OVR01_0077_F05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVRM1_0187_H10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
PBL01_0005_G12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVRM1_0040_D11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
OVR01_0103_F12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0099_A12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0101_G08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
OVRM1_0119_A08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
TCH01_0054_H10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
OVR01_0089_F10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
OVR01_0079_E08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
OVRM1_0028_H06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
SPL01_0023_D10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SPL01_0010_B12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0096_H05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
OVR01_0057_H03.b : TGAACAAGAAGGAAGTTGTGGTGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0056_D11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
OVRM1_0029_H10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
SPL01_0090_F10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
THY01_0051_F12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
PBL01_0020_B02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
UTR01_0013_D08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
LNG01_0029_H01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
PTG01_0049_B02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0120_F12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ADR01_0024_A11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ADR01_0005_G12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ADR01_0043_F04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SMG01_0085_C09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
UTR01_0040_F12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SPL01_0010_B01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
UTR01_0024_H04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
THY01_0052_D10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SMG01_0048_C07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVRT1_0138_D06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
PTG01_0049_H05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
PTG01_0038_B11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0115_H11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0133_H10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ILNT1_0071_H04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SPLT1_0061_F05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVRT1_0105_H05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0138_E10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0108_F07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
UTR01_0023_D09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0110_H11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
UTR01_0008_D05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
UTR01_0099_G12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TES01_0094_E05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SPL01_0058_D06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SMG01_0081_C08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
UTR01_0029_D06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0139_C09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
THY01_0020_G12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
THY01_0001_F05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
THY01_0014_E04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVRT1_0142_D04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
UTR01_0003_F05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
UTR01_0087_G09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
CLNT1_0117_B11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0108_G02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0107_C04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
BFLT1_0082_C01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SMG01_0045_C12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SMG01_0103_E03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
UTR01_0040_F06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
SMG01_0090_G05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SMG01_0092_H11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0093_C08.b : TGAACAAGAAGGAGGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
PTG01_0047_D10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
THY01_0079_D12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0021_D01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
SPL01_0039_G10.b : CGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
UTR01_0020_G05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
UTR01_0015_B03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
SPL01_0098_D10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
UTR01_0018_A07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
CLNT1_0108_G05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
LVR01_0087_E05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0114_D09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
UTR01_0003_F06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
MLN01_0030_G03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0109_F07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SMG01_0076_E02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0053_F03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
THY01_0023_E02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0104_A07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
PTG01_0013_A01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TES01_0062_B07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
UTR01_0102_F01.b : TGAACAAGAGGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
UTR01_0103_H04.b : TGAACAAGAAGGAAGTTGCGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
UTR01_0032_A04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
CLNT1_0145_C03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0044_E05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
PTG01_0044_F12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0126_F08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SMG01_0084_H11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0054_E03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
MLN01_0005_E02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0061_D01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0095_B08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
ADR01_0053_H03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
PTG01_0004_H04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
THY01_0204_D03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
UTR01_0103_B05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
CLNT1_0143_H07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
UTR01_0060_E05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
UTR01_0038_E03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
SPL01_0030_A10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SMG01_0023_A10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
LVR01_0003_E06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
MLN01_0083_A09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0028_C06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
PTG01_0042_F12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
LVR01_0078_H12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0031_G10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SMG01_0090_E01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ADR01_0044_A08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SMG01_0023_D02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SKNB1_0006_E08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0013_G11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
UTR01_0095_E09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
CLNT1_0116_F08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
THY01_0034_C09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
UTR01_0052_B09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0052_D11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0005_C11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
SMG01_0014_C04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0064_F03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
SPL01_0092_F09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
THY01_0204_G09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0020_C11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
OVR01_0026_B05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
LVR01_0041_G01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0033_G07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
CLNT1_0152_B07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGGCACCCATGGTGATTG
UTR01_0055_G11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0120_H03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
PBL01_0015_E06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
THY01_0023_D06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0013_B06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SPL01_0103_A05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
UTR01_0089_A02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
OVR01_0029_H03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
THY01_0205_E02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0008_A07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
OVR01_0005_G08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
TCH01_0074_F02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
SPL01_0048_D12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0098_B12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
SPL01_0045_D03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0089_F07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
PTG01_0052_G11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SMG01_0060_H02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
THY01_0065_B01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGACTG
BFLT1_0015_E02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
PCT01_0006_C08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
MLN01_0042_D07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
UTR01_0064_H05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
THY01_0061_D11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVRT1_0057_E12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
THY01_0090_F03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
PBL01_0064_E04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ITT01_0021_A07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
LNG01_0027_H02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
PBL01_0028_H06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ITT01_0002_G06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
PBL01_0078_D04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ITT01_0067_B10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
PBL01_0028_B04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0011_G06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
BFLT1_0093_D09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
PBL01_0052_B07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
PBL01_0068_H04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
BFLT1_0098_H04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ITT01_0003_C06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ITT01_0010_E04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ITT01_0006_B01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ADR01_0047_C08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGGCTATTGTGGAGACGCCACCCATGGTGATTG
ADR01_0060_E05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ADR01_0056_B05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SPL01_0065_G08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAAACGCCACCCATGGTGATTG
CLNT1_0012_G11.b : TGAACAAGAAGGAAGTTGTGGAAGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SMG01_0064_E06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
LNG01_0109_G07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0072_C07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TCH01_0079_D07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
LNG01_0076_F03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
CLNT1_0037_C10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
LNG01_0092_F11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
ADR01_0076_A06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0007_G12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
LNG01_0068_D01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
MLN01_0049_G02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ITT01_0056_C09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ITT01_0053_H02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TES01_0064_D12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TES01_0033_G01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TES01_0070_A09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
THY01_0044_C09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SMG01_0036_E10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0036_A03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVRT1_0079_C01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SMG01_0026_F07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SKNB1_0041_C01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0026_G06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0004_D03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0069_C07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVRM1_0118_B06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
TES01_0100_A06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
UTR01_0070_B09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
UTR01_0022_B06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
THY01_0057_G12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVRT1_0100_H08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0031_G07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
SPL01_0101_F06.b : TGAACAAGAAGGAAGTTGTGGGGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVRT1_0002_C08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0026_D03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TES01_0052_G09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
LNG01_0021_C01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGATGCCACCCATGGTGATTG
ADR01_0059_B03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TCH01_0048_H01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
PCT01_0018_B11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
ILNT1_0076_B07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
HTMT1_0118_H03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
PCT01_0027_H12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
HTMT1_0013_D11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0028_E11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
THY01_0066_C08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
PCT01_0011_A10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
OVR01_0025_B01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
CLNT1_0027_B12.b : TGAACA*GAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
LNG01_0096_D03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
PBL01_0102_B06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SPL01_0104_F07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0074_D08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
SPL01_0023_B07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SMG01_0056_B08.b : TGAACCAGAAGGAAGTTGTGGAAGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0083_C04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TES01_0023_A10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
UTR01_0058_G05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TCH01_0018_C11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ADR01_0017_C01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVRM1_0157_A10.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
OVRM1_0184_G01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
TES01_0060_F05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVRM1_0010_D09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
OVR01_0049_G12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
ADR01_0011_D07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
THY01_0050_G02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ADR01_0022_A05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVRM1_0025_D12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
ADR01_0008_C01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
LNG01_0010_E05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
THY01_0049_B09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0129_A12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0030_F07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
UTR01_0032_B08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
OVR01_0058_F01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
OVR01_0042_D07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
UTR01_0055_E12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
TES01_0042_H11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGGTTG
OVRT1_0124_A07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ITT01_0095_A09.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
LNG01_0093_H12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
CLNT1_0019_D12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0019_A12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
ADR01_0005_E04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ITT01_0048_E08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
ADR01_0073_F06.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
THY01_0002_H02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
SKNB1_0040_B02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
PCT01_0003_H04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
PST01_0015_A04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGGCTATTGTGGAGACGCCACCCATGGTGATTG
TES01_0109_F11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TES01_0052_E05.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TES01_0026_F03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TES01_0007_G01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
PTG01_0109_F08.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TES01_0096_D07.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TES01_0072_B12.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TES01_0111_C02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TES01_0083_B11.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TES01_0069_B03.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
TES01_0051_C01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
CLNT1_0078_H02.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATTG
OVR01_0004_D04.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACACCACCCATGGTGATCG
LVRM1_0135_B01.b : TGAACAAGAAGGAAGTTGTGGAGGCTGTGACTATTGTGGAGACGCCACCCATGGTGATCG
20110601C-000998 : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
---------+---------+---------+---------+---------+---------+ 374
OVRM1_0049_A11.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0106_B06.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0029_G10.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0041_G10.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LNG01_0031_D09.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTCTAAGACCATCTTCG
OVRM1_0016_C03.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0024_H09.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SMG01_0083_C02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SMG01_0060_H07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0169_G02.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCCCCGGACCTTTAAGACCATCTTCG
THY01_0006_F02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0074_E09.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCAGACCTTTAAGACCATCTTCG
OVR01_0060_F10.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0101_E05.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TCH01_0055_E11.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0067_H08.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
MLN01_0060_G09.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ADR01_0021_A10.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ILNT1_0056_A01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0015_B01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0051_C03.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SMG01_0033_A02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0092_E09.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0040_A05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LNG01_0023_F02.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SPL01_0069_F12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PTG01_0046_H03.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TCH01_0060_F12.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LVR01_0021_H11.b : TGGGCATCGTGGGCTATGTGGAAACCCCCCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0071_A12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TCH01_0024_F10.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
BFLT1_0122_F01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0122_H10.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SPL01_0077_G09.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0038_C12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0097_G11.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PBL01_0077_H08.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ITT01_0061_H08.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ITT01_0008_A03.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
BMWN1_0080_G01.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LVRM1_0001_C05.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
BMWN1_0014_D05.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
BMWN1_0095_E01.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0045_B02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TCH01_0040_G05.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0044_F01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LNG01_0031_F12.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0117_G11.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SPLT1_0050_B12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SPLT1_0049_D01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PTG01_0070_E04.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
BMWN1_0013_B11.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ILNT1_0031_A06.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRT1_0063_B04.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ILNT1_0014_E12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0134_C06.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CBLT1_0041_D05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SPLT1_0037_A12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TCH01_0057_C09.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LNG01_0082_H04.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0027_G10.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PBL01_0105_B08.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TCH01_0039_G05.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LNG01_0062_D05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0081_A07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0102_G02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0081_C05.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0076_G05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0181_H08.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LVRM1_0200_H02.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0193_C07.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0196_H08.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0067_A02.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LVRM1_0157_C06.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0074_A12.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0194_D09.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0070_E03.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0219_B01.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0099_F04.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0002_F03.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SMG01_0003_H07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0213_B03.b : CGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0090_E03.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0101_H10.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0210_G08.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0033_B10.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0083_E06.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0102_B01.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0202_G02.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0077_F05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGGCCATCTTCT
OVRM1_0187_H10.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PBL01_0005_G12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0040_D11.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0103_F12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0099_A12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0101_G08.b : TGGGCACCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0119_A08.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TCH01_0054_H10.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0089_F10.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0079_E08.b : TGGGCATCGTGGGCTACGTGGAAGCCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0028_H06.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SPL01_0023_D10.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SPL01_0010_B12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0096_H05.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0057_H03.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0056_D11.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0029_H10.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SPL01_0090_F10.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0051_F12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PBL01_0020_B02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0013_D08.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LNG01_0029_H01.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PTG01_0049_B02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0120_F12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ADR01_0024_A11.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ADR01_0005_G12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ADR01_0043_F04.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SMG01_0085_C09.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0040_F12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SPL01_0010_B01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0024_H04.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0052_D10.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SMG01_0048_C07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRT1_0138_D06.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PTG01_0049_H05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PTG01_0038_B11.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0115_H11.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0133_H10.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ILNT1_0071_H04.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SPLT1_0061_F05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRT1_0105_H05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0138_E10.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0108_F07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0023_D09.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0110_H11.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0008_D05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0099_G12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0094_E05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SPL01_0058_D06.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SMG01_0081_C08.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0029_D06.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0139_C09.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0020_G12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0001_F05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0014_E04.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRT1_0142_D04.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAATACCATCTTCG
UTR01_0003_F05.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0087_G09.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0117_B11.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0108_G02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0107_C04.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
BFLT1_0082_C01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SMG01_0045_C12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SMG01_0103_E03.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0040_F06.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SMG01_0090_G05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SMG01_0092_H11.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0093_C08.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PTG01_0047_D10.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0079_D12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0021_D01.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SPL01_0039_G10.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0020_G05.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0015_B03.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SPL01_0098_D10.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0018_A07.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0108_G05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LVR01_0087_E05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0114_D09.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0003_F06.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
MLN01_0030_G03.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0109_F07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SMG01_0076_E02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0053_F03.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0023_E02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0104_A07.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PTG01_0013_A01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0062_B07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0102_F01.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAACATCATCTTCG
UTR01_0103_H04.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0032_A04.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0145_C03.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0044_E05.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PTG01_0044_F12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0126_F08.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SMG01_0084_H11.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0054_E03.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
MLN01_0005_E02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0061_D01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0095_B08.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ADR01_0053_H03.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PTG01_0004_H04.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0204_D03.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0103_B05.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0143_H07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0060_E05.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0038_E03.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SPL01_0030_A10.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SMG01_0023_A10.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LVR01_0003_E06.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
MLN01_0083_A09.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0028_C06.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PTG01_0042_F12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LVR01_0078_H12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0031_G10.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SMG01_0090_E01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ADR01_0044_A08.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SMG01_0023_D02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCTGGACCTTTAAGACCATCTTCG
SKNB1_0006_E08.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0013_G11.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0095_E09.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0116_F08.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0034_C09.b : TGGGCATCGCGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0052_B09.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0052_D11.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0005_C11.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SMG01_0014_C04.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0064_F03.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SPL01_0092_F09.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0204_G09.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0020_C11.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0026_B05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LVR01_0041_G01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0033_G07.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0152_B07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0055_G11.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0120_H03.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PBL01_0015_E06.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0023_D06.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0013_B06.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SPL01_0103_A05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0089_A02.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0029_H03.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0205_E02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0008_A07.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0005_G08.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TCH01_0074_F02.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SPL01_0048_D12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0098_B12.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SPL01_0045_D03.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0089_F07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PTG01_0052_G11.b : TGGGCATCGTGGGCTATGTGGAGACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SMG01_0060_H02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0065_B01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
BFLT1_0015_E02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PCT01_0006_C08.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
MLN01_0042_D07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0064_H05.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0061_D11.b : TGGGCATCGTGGGCTATGTGAAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRT1_0057_E12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0090_F03.b : TGGGCATCGTGGCCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PBL01_0064_E04.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ITT01_0021_A07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LNG01_0027_H02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PBL01_0028_H06.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ITT01_0002_G06.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PBL01_0078_D04.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ITT01_0067_B10.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PBL01_0028_B04.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0011_G06.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
BFLT1_0093_D09.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PBL01_0052_B07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PBL01_0068_H04.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
BFLT1_0098_H04.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ITT01_0003_C06.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAAACCATCTTCG
ITT01_0010_E04.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ITT01_0006_B01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ADR01_0047_C08.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ADR01_0060_E05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ADR01_0056_B05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SPL01_0065_G08.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0012_G11.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SMG01_0064_E06.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LNG01_0109_G07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGGCCATCTTCG
CLNT1_0072_C07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TCH01_0079_D07.b : TGGGCATCGTAGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LNG01_0076_F03.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0037_C10.b : TGGGCATCGTGGGCTATGTGGGAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LNG01_0092_F11.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ADR01_0076_A06.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0007_G12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LNG01_0068_D01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
MLN01_0049_G02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ITT01_0056_C09.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ITT01_0053_H02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0064_D12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0033_G01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0070_A09.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0044_C09.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SMG01_0036_E10.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0036_A03.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRT1_0079_C01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SMG01_0026_F07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SKNB1_0041_C01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCATTAAGACCATCTTCG
CLNT1_0026_G06.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0004_D03.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0069_C07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0118_B06.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0100_A06.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0070_B09.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0022_B06.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0057_G12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRT1_0100_H08.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0031_G07.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SPL01_0101_F06.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRT1_0002_C08.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0026_D03.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0052_G09.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCCTTAAGACCATCTTCG
LNG01_0021_C01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ADR01_0059_B03.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TCH01_0048_H01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PCT01_0018_B11.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ILNT1_0076_B07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
HTMT1_0118_H03.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PCT01_0027_H12.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
HTMT1_0013_D11.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0028_E11.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0066_C08.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PCT01_0011_A10.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0025_B01.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0027_B12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LNG01_0096_D03.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PBL01_0102_B06.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SPL01_0104_F07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0074_D08.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SPL01_0023_B07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SMG01_0056_B08.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0083_C04.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0023_A10.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0058_G05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TCH01_0018_C11.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ADR01_0017_C01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0157_A10.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0184_G01.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0060_F05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0010_D09.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0049_G12.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ADR01_0011_D07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0050_G02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ADR01_0022_A05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRM1_0025_D12.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ADR01_0008_C01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LNG01_0010_E05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0049_B09.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0129_A12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0030_F07.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0032_B08.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0058_F01.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0042_D07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
UTR01_0055_E12.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0042_H11.b : TGGGCATCGTGGACTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVRT1_0124_A07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ITT01_0095_A09.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LNG01_0093_H12.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0019_D12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0019_A12.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ADR01_0005_E04.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ITT01_0048_E08.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
ADR01_0073_F06.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
THY01_0002_H02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
SKNB1_0040_B02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PCT01_0003_H04.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PST01_0015_A04.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0109_F11.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0052_E05.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0026_F03.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0007_G01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
PTG01_0109_F08.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0096_D07.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0072_B12.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0111_C02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0083_B11.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0069_B03.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
TES01_0051_C01.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
CLNT1_0078_H02.b : TGGGCATCGTGGGCTATGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
OVR01_0004_D04.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
LVRM1_0135_B01.b : TGGGCATCGTGGGCTACGTGGAAACCCCTCGGGGCCTCCGGACCTTTAAGACCATCTTCG
20110601C-000998 : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
---------+---------+---------+---------+---------+---------+ 434
OVRM1_0049_A11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTNAGA
OVRM1_0106_B06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAATTGGCATAAATCTAAGA
TES01_0029_G10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0041_G10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
LNG01_0031_D09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0016_C03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0024_H09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAATTGGCATAAATCTAAGA
SMG01_0083_C02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SMG01_0060_H07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0169_G02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0006_F02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0074_E09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAATTGGCATAAATCTAAGA
OVR01_0060_F10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0101_E05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TCH01_0055_E11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TES01_0067_H08.b : CGGAGCACATCAGCGATGAGTGCAAGAAGCGCTTCTATAAGAACTGGCATAAATCTAAGA
MLN01_0060_G09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ADR01_0021_A10.b : CGGAGCACATCAGCGACGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ILNT1_0056_A01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0015_B01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0051_C03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SMG01_0033_A02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0092_E09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0040_A05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
LNG01_0023_F02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SPL01_0069_F12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PTG01_0046_H03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TCH01_0060_F12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
LVR01_0021_H11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0071_A12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TCH01_0024_F10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
BFLT1_0122_F01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0122_H10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SPL01_0077_G09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0038_C12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0097_G11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PBL01_0077_H08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ITT01_0061_H08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ITT01_0008_A03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
BMWN1_0080_G01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
LVRM1_0001_C05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
BMWN1_0014_D05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
BMWN1_0095_E01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0045_B02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TCH01_0040_G05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0044_F01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGTGCTTCTATAAGAACTGGCATAAATCTAAGA
LNG01_0031_F12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0117_G11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SPLT1_0050_B12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SPLT1_0049_D01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PTG01_0070_E04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
BMWN1_0013_B11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ILNT1_0031_A06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRT1_0063_B04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ILNT1_0014_E12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0134_C06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CBLT1_0041_D05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SPLT1_0037_A12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TCH01_0057_C09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
LNG01_0082_H04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0027_G10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PBL01_0105_B08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TCH01_0039_G05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
LNG01_0062_D05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0081_A07.b : CGGAGCACATCGGCGATGAGTGCAAGAGGCGCTTCTGTAAGAACTGGCATAGATCTAAGA
TES01_0102_G02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0081_C05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0076_G05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0181_H08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
LVRM1_0200_H02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAATTGGCATAAATCTAAGA
OVRM1_0193_C07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGGACTGGCATAAATCTAAGA
OVRM1_0196_H08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAATTGGCATAAATCTAAGA
OVR01_0067_A02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
LVRM1_0157_C06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAATTGGCATAAATCTAAGA
OVR01_0074_A12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0194_D09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TES01_0070_E03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0219_B01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTTTATAAGAACTGGCATAAATCTAAGA
OVRM1_0099_F04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAATTGGCATAAATCTAAGA
OVRM1_0002_F03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SMG01_0003_H07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0213_B03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0090_E03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0101_H10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0210_G08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0033_B10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0083_E06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0102_B01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0202_G02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0077_F05.b : CGGAGCACATCAACGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0187_H10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAATTGGCATAAATCTAAGA
PBL01_0005_G12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0040_D11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAATTGGCATAAATCTAAGA
OVR01_0103_F12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0099_A12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0101_G08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0119_A08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TCH01_0054_H10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0089_F10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0079_E08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0028_H06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAATTGGCATAAATCTAAGA
SPL01_0023_D10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SPL01_0010_B12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0096_H05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0057_H03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0056_D11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0029_H10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAATTGGCATAAATCTAAGA
SPL01_0090_F10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0051_F12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PBL01_0020_B02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0013_D08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
LNG01_0029_H01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PTG01_0049_B02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0120_F12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ADR01_0024_A11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ADR01_0005_G12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ADR01_0043_F04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SMG01_0085_C09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0040_F12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SPL01_0010_B01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0024_H04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCCTCTATAAGAACTGGCATAAATCTAAGA
THY01_0052_D10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SMG01_0048_C07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRT1_0138_D06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PTG01_0049_H05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PTG01_0038_B11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0115_H11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0133_H10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ILNT1_0071_H04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SPLT1_0061_F05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRT1_0105_H05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0138_E10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0108_F07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0023_D09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0110_H11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0008_D05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0099_G12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TES01_0094_E05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SPL01_0058_D06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SMG01_0081_C08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0029_D06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0139_C09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0020_G12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0001_F05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0014_E04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRT1_0142_D04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0003_F05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0087_G09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0117_B11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0108_G02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0107_C04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
BFLT1_0082_C01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGGACTGGCATAAATCTAAGA
SMG01_0045_C12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SMG01_0103_E03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0040_F06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SMG01_0090_G05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SMG01_0092_H11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0093_C08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PTG01_0047_D10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0079_D12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0021_D01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SPL01_0039_G10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0020_G05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0015_B03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SPL01_0098_D10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0018_A07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0108_G05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
LVR01_0087_E05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0114_D09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0003_F06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
MLN01_0030_G03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0109_F07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SMG01_0076_E02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0053_F03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0023_E02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0104_A07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PTG01_0013_A01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TES01_0062_B07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0102_F01.b : CGGAGCATATCAGCGATGATTGCCAGAGGCGCTTCTATGAAAACTGGCATAAATATAATA
UTR01_0103_H04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0032_A04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0145_C03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0044_E05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PTG01_0044_F12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0126_F08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SMG01_0084_H11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0054_E03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
MLN01_0005_E02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0061_D01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0095_B08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ADR01_0053_H03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PTG01_0004_H04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0204_D03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0103_B05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0143_H07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0060_E05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0038_E03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SPL01_0030_A10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SMG01_0023_A10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
LVR01_0003_E06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
MLN01_0083_A09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0028_C06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PTG01_0042_F12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
LVR01_0078_H12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0031_G10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SMG01_0090_E01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ADR01_0044_A08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SMG01_0023_D02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SKNB1_0006_E08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0013_G11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0095_E09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0116_F08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0034_C09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0052_B09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0052_D11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0005_C11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SMG01_0014_C04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0064_F03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SPL01_0092_F09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0204_G09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0020_C11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0026_B05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCCATAAGAACTGGCATAAATCTAAGA
LVR01_0041_G01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0033_G07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0152_B07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0055_G11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0120_H03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAGATCTAAGA
PBL01_0015_E06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0023_D06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0013_B06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SPL01_0103_A05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0089_A02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0029_H03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0205_E02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0008_A07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0005_G08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TCH01_0074_F02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SPL01_0048_D12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0098_B12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SPL01_0045_D03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0089_F07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PTG01_0052_G11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SMG01_0060_H02.b : CGGAGCACATCAGCGGTGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0065_B01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAAAACTGGCATAAATCTAAGA
BFLT1_0015_E02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PCT01_0006_C08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
MLN01_0042_D07.b : CGGAGCACATCAGCGATGGGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0064_H05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0061_D11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRT1_0057_E12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0090_F03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PBL01_0064_E04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ITT01_0021_A07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
LNG01_0027_H02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PBL01_0028_H06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ITT01_0002_G06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PBL01_0078_D04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ITT01_0067_B10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PBL01_0028_B04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0011_G06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
BFLT1_0093_D09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PBL01_0052_B07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PBL01_0068_H04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
BFLT1_0098_H04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ITT01_0003_C06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ITT01_0010_E04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ITT01_0006_B01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ADR01_0047_C08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ADR01_0060_E05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ADR01_0056_B05.b : CGGAGCACATCAGCGATGAGTGCTAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SPL01_0065_G08.b : CGGAGCACATCAGCGGTGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0012_G11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SMG01_0064_E06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
LNG01_0109_G07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0072_C07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TCH01_0079_D07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
LNG01_0076_F03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0037_C10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
LNG01_0092_F11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ADR01_0076_A06.b : CGGAGCACATCAGCGATGAGTGCGAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0007_G12.b : CGGAGCACATCAGCGATGAGTGCAGGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
LNG01_0068_D01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
MLN01_0049_G02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ITT01_0056_C09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ITT01_0053_H02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TES01_0064_D12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TES01_0033_G01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TES01_0070_A09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0044_C09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SMG01_0036_E10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0036_A03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRT1_0079_C01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SMG01_0026_F07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SKNB1_0041_C01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0026_G06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0004_D03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0069_C07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0118_B06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TES01_0100_A06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0070_B09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0022_B06.b : CGAAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0057_G12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRT1_0100_H08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0031_G07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SPL01_0101_F06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRT1_0002_C08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0026_D03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TES01_0052_G09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
LNG01_0021_C01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ADR01_0059_B03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TCH01_0048_H01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PCT01_0018_B11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ILNT1_0076_B07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
HTMT1_0118_H03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PCT01_0027_H12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCCAAGA
HTMT1_0013_D11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0028_E11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0066_C08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PCT01_0011_A10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0025_B01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0027_B12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
LNG01_0096_D03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PBL01_0102_B06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACCGGCATAAATCTAAGA
SPL01_0104_F07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0074_D08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SPL01_0023_B07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SMG01_0056_B08.b : CGGAGCACATCAGCGATGAGTGCAAGAAGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0083_C04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TES01_0023_A10.b : CGGAGCACATCAGGGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0058_G05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TCH01_0018_C11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ADR01_0017_C01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0157_A10.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0184_G01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TES01_0060_F05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0010_D09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAATTGGCATAAATCTAAGA
OVR01_0049_G12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ADR01_0011_D07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0050_G02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ADR01_0022_A05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRM1_0025_D12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ADR01_0008_C01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
LNG01_0010_E05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0049_B09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0129_A12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0030_F07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0032_B08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0058_F01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0042_D07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
UTR01_0055_E12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TES01_0042_H11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVRT1_0124_A07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ITT01_0095_A09.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
LNG01_0093_H12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0019_D12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0019_A12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ADR01_0005_E04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ITT01_0048_E08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
ADR01_0073_F06.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
THY01_0002_H02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
SKNB1_0040_B02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PCT01_0003_H04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PST01_0015_A04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TES01_0109_F11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TES01_0052_E05.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TES01_0026_F03.b : CGGAGCACATCAGGGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TES01_0007_G01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
PTG01_0109_F08.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TES01_0096_D07.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TES01_0072_B12.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TES01_0111_C02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TES01_0083_B11.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TES01_0069_B03.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
TES01_0051_C01.b : CGGAGCACATCAGCGTTGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
CLNT1_0078_H02.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
OVR01_0004_D04.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
LVRM1_0135_B01.b : CGGAGCACATCAGCGATGAGTGCAAGAGGCGCTTCTATAAGAACTGGCATAAATCTAAGA
20110601C-000998 : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
---------+---------+---------+---------+---------+---------+ 494
OVRM1_0049_A11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0106_B06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0029_G10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0041_G10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LNG01_0031_D09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0016_C03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0024_H09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SMG01_0083_C02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SMG01_0060_H07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0169_G02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0006_F02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0074_E09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0060_F10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0101_E05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TCH01_0055_E11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0067_H08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
MLN01_0060_G09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ADR01_0021_A10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ILNT1_0056_A01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0015_B01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0051_C03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SMG01_0033_A02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0092_E09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0040_A05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LNG01_0023_F02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SPL01_0069_F12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PTG01_0046_H03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TCH01_0060_F12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LVR01_0021_H11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0071_A12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TCH01_0024_F10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
BFLT1_0122_F01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0122_H10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SPL01_0077_G09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0038_C12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0097_G11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PBL01_0077_H08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ITT01_0061_H08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ITT01_0008_A03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
BMWN1_0080_G01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LVRM1_0001_C05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
BMWN1_0014_D05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
BMWN1_0095_E01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0045_B02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TCH01_0040_G05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0044_F01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LNG01_0031_F12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0117_G11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SPLT1_0050_B12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SPLT1_0049_D01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PTG01_0070_E04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
BMWN1_0013_B11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ILNT1_0031_A06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRT1_0063_B04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ILNT1_0014_E12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0134_C06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CBLT1_0041_D05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SPLT1_0037_A12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TCH01_0057_C09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LNG01_0082_H04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0027_G10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PBL01_0105_B08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TCH01_0039_G05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LNG01_0062_D05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0081_A07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCATGAAGCAGTTGG
TES01_0102_G02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0081_C05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0076_G05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0181_H08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LVRM1_0200_H02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0193_C07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0196_H08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0067_A02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LVRM1_0157_C06.b : AGAAGGCCTTCACCAAATACTGCACGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0074_A12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0194_D09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0070_E03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0219_B01.b : AGAAGGCCCTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0099_F04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0002_F03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SMG01_0003_H07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0213_B03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0090_E03.b : AGAAGGCCCTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGATGG
OVR01_0101_H10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0210_G08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0033_B10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0083_E06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0102_B01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0202_G02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0077_F05.b : AGAAGGCCTTCGCCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0187_H10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PBL01_0005_G12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0040_D11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0103_F12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGGAGCAGTTGG
OVR01_0099_A12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0101_G08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0119_A08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TCH01_0054_H10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0089_F10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0079_E08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0028_H06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SPL01_0023_D10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SPL01_0010_B12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0096_H05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0057_H03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0056_D11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0029_H10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SPL01_0090_F10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGAGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0051_F12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PBL01_0020_B02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0013_D08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LNG01_0029_H01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PTG01_0049_B02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0120_F12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ADR01_0024_A11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ADR01_0005_G12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ADR01_0043_F04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SMG01_0085_C09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0040_F12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGGAGATGGCAAGAAGCAGTTGG
SPL01_0010_B01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0024_H04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0052_D10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SMG01_0048_C07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRT1_0138_D06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PTG01_0049_H05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PTG01_0038_B11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0115_H11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0133_H10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ILNT1_0071_H04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SPLT1_0061_F05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRT1_0105_H05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0138_E10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0108_F07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0023_D09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0110_H11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0008_D05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0099_G12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0094_E05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SPL01_0058_D06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SMG01_0081_C08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0029_D06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0139_C09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0020_G12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAAATGGCAAGAAGCAGTTGG
THY01_0001_F05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0014_E04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRT1_0142_D04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0003_F05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0087_G09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0117_B11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0108_G02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0107_C04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
BFLT1_0082_C01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SMG01_0045_C12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SMG01_0103_E03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0040_F06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SMG01_0090_G05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SMG01_0092_H11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0093_C08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PTG01_0047_D10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0079_D12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0021_D01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SPL01_0039_G10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0020_G05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0015_B03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SPL01_0098_D10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0018_A07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0108_G05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LVR01_0087_E05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0114_D09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0003_F06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
MLN01_0030_G03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0109_F07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SMG01_0076_E02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0053_F03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0023_E02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0104_A07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PTG01_0013_A01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0062_B07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0102_F01.b : GGAATGACTTCACCAAATACTGCGAGAAGTGGCTTGATGAAGATGGCAAGAATCACTTGG
UTR01_0103_H04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0032_A04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0145_C03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0044_E05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PTG01_0044_F12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0126_F08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SMG01_0084_H11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0054_E03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
MLN01_0005_E02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0061_D01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0095_B08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ADR01_0053_H03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGGAGATGGCAAGAAGCAGTTGG
PTG01_0004_H04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0204_D03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0103_B05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0143_H07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0060_E05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0038_E03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SPL01_0030_A10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SMG01_0023_A10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LVR01_0003_E06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
MLN01_0083_A09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0028_C06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PTG01_0042_F12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LVR01_0078_H12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0031_G10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SMG01_0090_E01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ADR01_0044_A08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SMG01_0023_D02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SKNB1_0006_E08.b : AGAAGGCCTTCACCAAATACTGCAACAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0013_G11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0095_E09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0116_F08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0034_C09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0052_B09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0052_D11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0005_C11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SMG01_0014_C04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0064_F03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SPL01_0092_F09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0204_G09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0020_C11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0026_B05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LVR01_0041_G01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0033_G07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0152_B07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0055_G11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0120_H03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PBL01_0015_E06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0023_D06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0013_B06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SPL01_0103_A05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0089_A02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0029_H03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCGGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0205_E02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0008_A07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0005_G08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TCH01_0074_F02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SPL01_0048_D12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0098_B12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SPL01_0045_D03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0089_F07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PTG01_0052_G11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SMG01_0060_H02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0065_B01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGGTGGCAAGAAGCAGTTGG
BFLT1_0015_E02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PCT01_0006_C08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
MLN01_0042_D07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0064_H05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0061_D11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRT1_0057_E12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0090_F03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PBL01_0064_E04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ITT01_0021_A07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGACGAAGATGGCAAGAAGCAGTTGG
LNG01_0027_H02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PBL01_0028_H06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ITT01_0002_G06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PBL01_0078_D04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ITT01_0067_B10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PBL01_0028_B04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0011_G06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGACGAGGATGGCAAGAAGCAGTTGG
BFLT1_0093_D09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PBL01_0052_B07.b : AGAAGGCCTTCACCTAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PBL01_0068_H04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
BFLT1_0098_H04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ITT01_0003_C06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ITT01_0010_E04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ITT01_0006_B01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ADR01_0047_C08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ADR01_0060_E05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGCCAGGATGAAGATGGCAAGAAGCAGTTGG
ADR01_0056_B05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SPL01_0065_G08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0012_G11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SMG01_0064_E06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LNG01_0109_G07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0072_C07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TCH01_0079_D07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LNG01_0076_F03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0037_C10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LNG01_0092_F11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ADR01_0076_A06.b : AGAAGGCCTTCACCGAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0007_G12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LNG01_0068_D01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
MLN01_0049_G02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ITT01_0056_C09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ITT01_0053_H02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0064_D12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0033_G01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0070_A09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0044_C09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SMG01_0036_E10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0036_A03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRT1_0079_C01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SMG01_0026_F07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SKNB1_0041_C01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0026_G06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0004_D03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0069_C07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAAGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0118_B06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0100_A06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0070_B09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0022_B06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0057_G12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRT1_0100_H08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0031_G07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SPL01_0101_F06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRT1_0002_C08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0026_D03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0052_G09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LNG01_0021_C01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ADR01_0059_B03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TCH01_0048_H01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PCT01_0018_B11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ILNT1_0076_B07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
HTMT1_0118_H03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PCT01_0027_H12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
HTMT1_0013_D11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0028_E11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0066_C08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PCT01_0011_A10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0025_B01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0027_B12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LNG01_0096_D03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PBL01_0102_B06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SPL01_0104_F07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0074_D08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SPL01_0023_B07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SMG01_0056_B08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0083_C04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0023_A10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0058_G05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TCH01_0018_C11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ADR01_0017_C01.b : AGAAGGCCTTCATCAAATACTGCCAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0157_A10.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTTG
OVRM1_0184_G01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0060_F05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0010_D09.b : AGAAGGCCTTCACCAAATACTGCAAGGAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0049_G12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ADR01_0011_D07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0050_G02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ADR01_0022_A05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRM1_0025_D12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ADR01_0008_C01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LNG01_0010_E05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0049_B09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0129_A12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0030_F07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0032_B08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0058_F01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0042_D07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
UTR01_0055_E12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0042_H11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVRT1_0124_A07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ITT01_0095_A09.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LNG01_0093_H12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0019_D12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0019_A12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ADR01_0005_E04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ITT01_0048_E08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
ADR01_0073_F06.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
THY01_0002_H02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
SKNB1_0040_B02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PCT01_0003_H04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PST01_0015_A04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0109_F11.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0052_E05.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0026_F03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0007_G01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
PTG01_0109_F08.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0096_D07.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0072_B12.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0111_C02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0083_B11.b : AGAGGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0069_B03.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
TES01_0051_C01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
CLNT1_0078_H02.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
OVR01_0004_D04.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
LVRM1_0135_B01.b : AGAAGGCCTTCACCAAATACTGCAAGAAGTGGCAGGATGAAGATGGCAAGAAGCAGTTGG
20110601C-000998 : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
---------+---------+---------+---------+---------+---------+ 552
OVRM1_0049_A11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0106_B06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TES01_0029_G10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0041_G10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LNG01_0031_D09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0016_C03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0024_H09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SMG01_0083_C02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SMG01_0060_H07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACGC
OVRM1_0169_G02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0006_F02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGCCATTGCCCACAC
OVRM1_0074_E09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0060_F10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0101_E05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TCH01_0055_E11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TES01_0067_H08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
MLN01_0060_G09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ADR01_0021_A10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ILNT1_0056_A01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0015_B01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0051_C03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SMG01_0033_A02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0092_E09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0040_A05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LNG01_0023_F02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SPL01_0069_F12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PTG01_0046_H03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TCH01_0060_F12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LVR01_0021_H11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0071_A12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TCH01_0024_F10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
BFLT1_0122_F01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0122_H10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SPL01_0077_G09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0038_C12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0097_G11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PBL01_0077_H08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ITT01_0061_H08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ITT01_0008_A03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
BMWN1_0080_G01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LVRM1_0001_C05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
BMWN1_0014_D05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
BMWN1_0095_E01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0045_B02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TCH01_0040_G05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0044_F01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LNG01_0031_F12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0117_G11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SPLT1_0050_B12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SPLT1_0049_D01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PTG01_0070_E04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
BMWN1_0013_B11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ILNT1_0031_A06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRT1_0063_B04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ILNT1_0014_E12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0134_C06.b : CGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CBLT1_0041_D05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SPLT1_0037_A12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TCH01_0057_C09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LNG01_0082_H04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0027_G10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PBL01_0105_B08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TCH01_0039_G05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LNG01_0062_D05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0081_A07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTGCTGCCGAG*TCATCGGGGTCATTGCCCGCAC
TES01_0102_G02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCTCACAC
OVR01_0081_C05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0076_G05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0181_H08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LVRM1_0200_H02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0193_C07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0196_H08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0067_A02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LVRM1_0157_C06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0074_A12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0194_D09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TES01_0070_E03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0219_B01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0099_F04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0002_F03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SMG01_0003_H07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0213_B03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0090_E03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0101_H10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0210_G08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0033_B10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0083_E06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0102_B01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0202_G02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0077_F05.b : AGAGGGACT*TCAGTAGCATGAAAAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0187_H10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PBL01_0005_G12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0040_D11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0103_F12.b : AGAGGGACC*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0099_A12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0101_G08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0119_A08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TCH01_0054_H10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0089_F10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0079_E08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0028_H06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SPL01_0023_D10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SPL01_0010_B12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0096_H05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCGCAC
OVR01_0057_H03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0056_D11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0029_H10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SPL01_0090_F10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0051_F12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PBL01_0020_B02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0013_D08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LNG01_0029_H01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PTG01_0049_B02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0120_F12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ADR01_0024_A11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ADR01_0005_G12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ADR01_0043_F04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SMG01_0085_C09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0040_F12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SPL01_0010_B01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0024_H04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0052_D10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SMG01_0048_C07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRT1_0138_D06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PTG01_0049_H05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PTG01_0038_B11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0115_H11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0133_H10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ILNT1_0071_H04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SPLT1_0061_F05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRT1_0105_H05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0138_E10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0108_F07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0023_D09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0110_H11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0008_D05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0099_G12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TES01_0094_E05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SPL01_0058_D06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SMG01_0081_C08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0029_D06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0139_C09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0020_G12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0001_F05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0014_E04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRT1_0142_D04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0003_F05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0087_G09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0117_B11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0108_G02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0107_C04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
BFLT1_0082_C01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SMG01_0045_C12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SMG01_0103_E03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0040_F06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SMG01_0090_G05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATTCGGGTCATTGCCCACAC
SMG01_0092_H11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0093_C08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PTG01_0047_D10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0079_D12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0021_D01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SPL01_0039_G10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0020_G05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0015_B03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SPL01_0098_D10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0018_A07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0108_G05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LVR01_0087_E05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0114_D09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0003_F06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
MLN01_0030_G03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0109_F07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SMG01_0076_E02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0053_F03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0023_E02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0104_A07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PTG01_0013_A01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TES01_0062_B07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0102_F01.b : AGAGGGACT*TCTGTAGCATGACTAACTACTGCCAGG*TCATCCGGGTCATTGCCTACAG
UTR01_0103_H04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0032_A04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0145_C03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0044_E05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PTG01_0044_F12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0126_F08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SMG01_0084_H11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0054_E03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
MLN01_0005_E02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0061_D01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0095_B08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ADR01_0053_H03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PTG01_0004_H04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0204_D03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0103_B05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0143_H07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0060_E05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0038_E03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SPL01_0030_A10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SMG01_0023_A10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LVR01_0003_E06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
MLN01_0083_A09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0028_C06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PTG01_0042_F12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LVR01_0078_H12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0031_G10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SMG01_0090_E01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ADR01_0044_A08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SMG01_0023_D02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SKNB1_0006_E08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0013_G11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0095_E09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0116_F08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0034_C09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0052_B09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0052_D11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0005_C11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SMG01_0014_C04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0064_F03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SPL01_0092_F09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0204_G09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0020_C11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0026_B05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LVR01_0041_G01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0033_G07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0152_B07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0055_G11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0120_H03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PBL01_0015_E06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0023_D06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCGTCCGGGTCATTGCCCACAC
CLNT1_0013_B06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SPL01_0103_A05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0089_A02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0029_H03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0205_E02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0008_A07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0005_G08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TCH01_0074_F02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SPL01_0048_D12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0098_B12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SPL01_0045_D03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0089_F07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PTG01_0052_G11.b : AGAGGGACT*TCAGTAGCATGAAGAAGAACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SMG01_0060_H02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0065_B01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
BFLT1_0015_E02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PCT01_0006_C08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
MLN01_0042_D07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0064_H05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0061_D11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRT1_0057_E12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0090_F03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PBL01_0064_E04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTATTGCCAGG*TCATCCGGGTCATTGCCCACAC
ITT01_0021_A07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LNG01_0027_H02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTTCTGCCAGG*TCATCCGGGTCATTGCCCACAC
PBL01_0028_H06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ITT01_0002_G06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PBL01_0078_D04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ITT01_0067_B10.b : AGAGGGACT*TCAGTAGCGTGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PBL01_0028_B04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0011_G06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
BFLT1_0093_D09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PBL01_0052_B07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PBL01_0068_H04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
BFLT1_0098_H04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ITT01_0003_C06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ITT01_0010_E04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ITT01_0006_B01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ADR01_0047_C08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ADR01_0060_E05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ADR01_0056_B05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SPL01_0065_G08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0012_G11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SMG01_0064_E06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LNG01_0109_G07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0072_C07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TCH01_0079_D07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LNG01_0076_F03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0037_C10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LNG01_0092_F11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ADR01_0076_A06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0007_G12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LNG01_0068_D01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
MLN01_0049_G02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ITT01_0056_C09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ITT01_0053_H02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TES01_0064_D12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TES01_0033_G01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TES01_0070_A09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0044_C09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SMG01_0036_E10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0036_A03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRT1_0079_C01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SMG01_0026_F07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SKNB1_0041_C01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0026_G06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0004_D03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0069_C07.b : AGAGGGACT*TCAGTAGCATGAAAAAATCCTGCCAGG*TCATCCGGGTCATTGCCCCCAC
OVRM1_0118_B06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TES01_0100_A06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0070_B09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0022_B06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0057_G12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRT1_0100_H08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0031_G07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SPL01_0101_F06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRT1_0002_C08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0026_D03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCGTCCGGGTCATTGCCCACAC
TES01_0052_G09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LNG01_0021_C01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ADR01_0059_B03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TCH01_0048_H01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PCT01_0018_B11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ILNT1_0076_B07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
HTMT1_0118_H03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PCT01_0027_H12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
HTMT1_0013_D11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0028_E11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0066_C08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PCT01_0011_A10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0025_B01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0027_B12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LNG01_0096_D03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PBL01_0102_B06.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SPL01_0104_F07.b : AGAGGGACT*TCAGTAGCATGAAGAGGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0074_D08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SPL01_0023_B07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SMG01_0056_B08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0083_C04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TES01_0023_A10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0058_G05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TCH01_0018_C11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ADR01_0017_C01.b : AGAGGGACT*TCATTAGCATGAAGAAGTACTGCCAGGGTCATCCGGGTCATTGCCCACAC
OVRM1_0157_A10.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0184_G01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TES01_0060_F05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0010_D09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0049_G12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ADR01_0011_D07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0050_G02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ADR01_0022_A05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRM1_0025_D12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ADR01_0008_C01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LNG01_0010_E05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0049_B09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0129_A12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0030_F07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0032_B08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0058_F01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0042_D07.b : AGAGGGACTCTCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
UTR01_0055_E12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TES01_0042_H11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVRT1_0124_A07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ITT01_0095_A09.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LNG01_0093_H12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0019_D12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0019_A12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ADR01_0005_E04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ITT01_0048_E08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
ADR01_0073_F06.b : GGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
THY01_0002_H02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
SKNB1_0040_B02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PCT01_0003_H04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PST01_0015_A04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TES01_0109_F11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TES01_0052_E05.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TES01_0026_F03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TES01_0007_G01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
PTG01_0109_F08.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TES01_0096_D07.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TES01_0072_B12.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TES01_0111_C02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TES01_0083_B11.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TES01_0069_B03.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
TES01_0051_C01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
CLNT1_0078_H02.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
OVR01_0004_D04.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
LVRM1_0135_B01.b : AGAGGGACT*TCAGTAGCATGAAGAAGTACTGCCAGG*TCATCCGGGTCATTGCCCACAC
20110601C-000998 : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
---------+---------+---------+---------+---------+---------+ 609
OVRM1_0049_A11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0106_B06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TES01_0029_G10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AAGT
OVR01_0041_G10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
LNG01_0031_D09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0016_C03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0024_H09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SMG01_0083_C02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SMG01_0060_H07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0169_G02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0006_F02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCCCAGGT
OVRM1_0074_E09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCGGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0060_F10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0101_E05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TCH01_0055_E11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TES01_0067_H08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
MLN01_0060_G09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ADR01_0021_A10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ILNT1_0056_A01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0015_B01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0051_C03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SMG01_0033_A02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0092_E09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0040_A05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
LNG01_0023_F02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SPL01_0069_F12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PTG01_0046_H03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TCH01_0060_F12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
LVR01_0021_H11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0071_A12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TCH01_0024_F10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
BFLT1_0122_F01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0122_H10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SPL01_0077_G09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0038_C12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0097_G11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PBL01_0077_H08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ITT01_0061_H08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ITT01_0008_A03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
BMWN1_0080_G01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
LVRM1_0001_C05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
BMWN1_0014_D05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
BMWN1_0095_E01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0045_B02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TCH01_0040_G05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0044_F01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
LNG01_0031_F12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0117_G11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SPLT1_0050_B12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SPLT1_0049_D01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PTG01_0070_E04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
BMWN1_0013_B11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ILNT1_0031_A06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRT1_0063_B04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ILNT1_0014_E12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0134_C06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CBLT1_0041_D05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SPLT1_0037_A12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TCH01_0057_C09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
LNG01_0082_H04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0027_G10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PBL01_0105_B08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TCH01_0039_G05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
LNG01_0062_D05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0081_A07.b : CCATATGCGCCTGCT*TCCTCTCCGCCTGAAGAAAGC*CCACCTCATGGAGATGC*AAGT
TES01_0102_G02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0081_C05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0076_G05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0181_H08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
LVRM1_0200_H02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0193_C07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0196_H08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0067_A02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*CGGT
LVRM1_0157_C06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAA*GC*CCACCTCCTGGAGATCC*AGGT
OVR01_0074_A12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0194_D09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TES01_0070_E03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0219_B01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0099_F04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0002_F03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SMG01_0003_H07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0213_B03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*TGGT
OVRM1_0090_E03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0101_H10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0210_G08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0033_B10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0083_E06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0102_B01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0202_G02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0077_F05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCCTGGAGATCC*ACGT
OVRM1_0187_H10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PBL01_0005_G12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0040_D11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0103_F12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAAGC*CCACCTCATGGAGATCC*AGGT
OVR01_0099_A12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0101_G08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0119_A08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TCH01_0054_H10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0089_F10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0079_E08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0028_H06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SPL01_0023_D10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SPL01_0010_B12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0096_H05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0057_H03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0056_D11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0029_H10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SPL01_0090_F10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0051_F12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PBL01_0020_B02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0013_D08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
LNG01_0029_H01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PTG01_0049_B02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0120_F12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ADR01_0024_A11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ADR01_0005_G12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ADR01_0043_F04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SMG01_0085_C09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0040_F12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SPL01_0010_B01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0024_H04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0052_D10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SMG01_0048_C07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRT1_0138_D06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PTG01_0049_H05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PTG01_0038_B11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0115_H11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0133_H10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ILNT1_0071_H04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SPLT1_0061_F05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRT1_0105_H05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0138_E10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0108_F07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0023_D09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0110_H11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0008_D05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0099_G12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TES01_0094_E05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SPL01_0058_D06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SMG01_0081_C08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0029_D06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0139_C09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0020_G12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0001_F05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0014_E04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRT1_0142_D04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0003_F05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGCCCCACCTCATGGAGATCC*AGGT
UTR01_0087_G09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0117_B11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0108_G02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0107_C04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
BFLT1_0082_C01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SMG01_0045_C12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SMG01_0103_E03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0040_F06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SMG01_0090_G05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SMG01_0092_H11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0093_C08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PTG01_0047_D10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0079_D12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0021_D01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SPL01_0039_G10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0020_G05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0015_B03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SPL01_0098_D10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0018_A07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0108_G05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
LVR01_0087_E05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0114_D09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0003_F06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
MLN01_0030_G03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGAC*CCACCTCATGGAGATCC*AGGT
CLNT1_0109_F07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SMG01_0076_E02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0053_F03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0023_E02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0104_A07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PTG01_0013_A01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TES01_0062_B07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0102_F01.b : CCAGATGCGACTGCT*TCCTCTCCGCCAGAAGAAGGA*CCACCTCATGGAGATCC*AGGT
UTR01_0103_H04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0032_A04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0145_C03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0044_E05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PTG01_0044_F12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0126_F08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SMG01_0084_H11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0054_E03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
MLN01_0005_E02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0061_D01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0095_B08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ADR01_0053_H03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PTG01_0004_H04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0204_D03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0103_B05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0143_H07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0060_E05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0038_E03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SPL01_0030_A10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SMG01_0023_A10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
LVR01_0003_E06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
MLN01_0083_A09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0028_C06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PTG01_0042_F12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
LVR01_0078_H12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0031_G10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SMG01_0090_E01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ADR01_0044_A08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SMG01_0023_D02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SKNB1_0006_E08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0013_G11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0095_E09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0116_F08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0034_C09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0052_B09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0052_D11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0005_C11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SMG01_0014_C04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0064_F03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SPL01_0092_F09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0204_G09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0020_C11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0026_B05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGGGATCC*AGGT
LVR01_0041_G01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0033_G07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0152_B07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0055_G11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0120_H03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PBL01_0015_E06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0023_D06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0013_B06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SPL01_0103_A05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0089_A02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0029_H03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0205_E02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0008_A07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0005_G08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TCH01_0074_F02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SPL01_0048_D12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0098_B12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SPL01_0045_D03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0089_F07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PTG01_0052_G11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SMG01_0060_H02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0065_B01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
BFLT1_0015_E02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PCT01_0006_C08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
MLN01_0042_D07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0064_H05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0061_D11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRT1_0057_E12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0090_F03.b : CCAGATGCGCCCGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PBL01_0064_E04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ITT01_0021_A07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
LNG01_0027_H02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PBL01_0028_H06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ITT01_0002_G06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PBL01_0078_D04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ITT01_0067_B10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PBL01_0028_B04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0011_G06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
BFLT1_0093_D09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PBL01_0052_B07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PBL01_0068_H04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
BFLT1_0098_H04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ITT01_0003_C06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ITT01_0010_E04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ITT01_0006_B01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ADR01_0047_C08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ADR01_0060_E05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ADR01_0056_B05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SPL01_0065_G08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0012_G11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SMG01_0064_E06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
LNG01_0109_G07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0072_C07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TCH01_0079_D07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
LNG01_0076_F03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0037_C10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
LNG01_0092_F11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ADR01_0076_A06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0007_G12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
LNG01_0068_D01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
MLN01_0049_G02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ITT01_0056_C09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ITT01_0053_H02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TES01_0064_D12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TES01_0033_G01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TES01_0070_A09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0044_C09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SMG01_0036_E10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0036_A03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRT1_0079_C01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SMG01_0026_F07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SKNB1_0041_C01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0026_G06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0004_D03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0069_C07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAAGC*CCCCCTCATGGAGATCCCGGTG
OVRM1_0118_B06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TES01_0100_A06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0070_B09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0022_B06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0057_G12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRT1_0100_H08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0031_G07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SPL01_0101_F06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRT1_0002_C08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0026_D03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TES01_0052_G09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
LNG01_0021_C01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ADR01_0059_B03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TCH01_0048_H01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PCT01_0018_B11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ILNT1_0076_B07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
HTMT1_0118_H03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PCT01_0027_H12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
HTMT1_0013_D11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0028_E11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0066_C08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PCT01_0011_A10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0025_B01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0027_B12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
LNG01_0096_D03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PBL01_0102_B06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SPL01_0104_F07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0074_D08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SPL01_0023_B07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
SMG01_0056_B08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAAGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0083_C04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TES01_0023_A10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0058_G05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TCH01_0018_C11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ADR01_0017_C01.b : CCCAATGCcgccggcttcctcttccgccacaaaaaagccccacccctgggaaatccaggt
OVRM1_0157_A10.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0184_G01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TES01_0060_F05.b : CCAGATGCGCCTGCTTTCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0010_D09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0049_G12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ADR01_0011_D07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0050_G02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ADR01_0022_A05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAAGC*CCACCTCATGGAGATCC*AGGT
OVRM1_0025_D12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ADR01_0008_C01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
LNG01_0010_E05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0049_B09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0129_A12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0030_F07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0032_B08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0058_F01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0042_D07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
UTR01_0055_E12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TES01_0042_H11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVRT1_0124_A07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ITT01_0095_A09.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
LNG01_0093_H12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0019_D12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0019_A12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ADR01_0005_E04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ITT01_0048_E08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
ADR01_0073_F06.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
THY01_0002_H02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGT*CCACCTCATGGAGATCC*AGGT
SKNB1_0040_B02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PCT01_0003_H04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAAAAGGC*CCACCTCATGGAGATCC*AGGT
PST01_0015_A04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TES01_0109_F11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAAGC*CCACCTCATGGAGATCC*AGGT
TES01_0052_E05.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TES01_0026_F03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TES01_0007_G01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
PTG01_0109_F08.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TES01_0096_D07.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*CAGT
TES01_0072_B12.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TES01_0111_C02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TES01_0083_B11.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
TES01_0069_B03.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGG**CCACCTCATGGAGATCC*AGGT
TES01_0051_C01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
CLNT1_0078_H02.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
OVR01_0004_D04.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
LVRM1_0135_B01.b : CCAGATGCGCCTGCT*TCCTCTCCGCCAGAAGAAGGC*CCACCTCATGGAGATCC*AGGT
20110601C-000998 : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
---------+---------+---------+---------+---------+---------+ 666
OVRM1_0049_A11.b : GAACGGAGGCACGGTGGCC*GAANAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0106_B06.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TES01_0029_G10.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*ATAACAGCA
OVR01_0041_G10.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LNG01_0031_D09.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0016_C03.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0024_H09.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SMG01_0083_C02.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SMG01_0060_H07.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0169_G02.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0006_F02.b : GACCGGAGGCACAGCGGCTTGAAAAACTGGACTGCGGCCCGGGAGAGGTT*AGAGCAGCA
OVRM1_0074_E09.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AAAGCAGCA
OVR01_0060_F10.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0101_E05.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TCH01_0055_E11.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TES01_0067_H08.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCACCA
MLN01_0060_G09.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAACA
ADR01_0021_A10.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAAGCT*AGAGCAGCA
ILNT1_0056_A01.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0015_B01.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0051_C03.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SMG01_0033_A02.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0092_E09.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0040_A05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LNG01_0023_F02.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SPL01_0069_F12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PTG01_0046_H03.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TCH01_0060_F12.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LVR01_0021_H11.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0071_A12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TCH01_0024_F10.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
BFLT1_0122_F01.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0122_H10.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAACAGCA
SPL01_0077_G09.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0038_C12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0097_G11.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PBL01_0077_H08.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ITT01_0061_H08.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ITT01_0008_A03.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
BMWN1_0080_G01.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LVRM1_0001_C05.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
BMWN1_0014_D05.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
BMWN1_0095_E01.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAAGCT*AGAGCAGCA
UTR01_0045_B02.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TCH01_0040_G05.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0044_F01.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LNG01_0031_F12.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0117_G11.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SPLT1_0050_B12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SPLT1_0049_D01.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PTG01_0070_E04.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
BMWN1_0013_B11.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ILNT1_0031_A06.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRT1_0063_B04.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ILNT1_0014_E12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0134_C06.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CBLT1_0041_D05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SPLT1_0037_A12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TCH01_0057_C09.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LNG01_0082_H04.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0027_G10.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PBL01_0105_B08.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TCH01_0039_G05.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LNG01_0062_D05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0081_A07.b : Gtaacgaaaggacagtggatgaggaactggactgtgcccgggaaaggggtagggcaaaca
TES01_0102_G02.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCCGGA*GAAGCT*AGAGCACCA
OVR01_0081_C05.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0076_G05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0181_H08.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LVRM1_0200_H02.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0193_C07.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0196_H08.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGACT*AGAGCAGCA
OVR01_0067_A02.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LVRM1_0157_C06.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGTGCCCGGGA*GAAGCT*AGAGCAGCA
OVR01_0074_A12.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0194_D09.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TES01_0070_E03.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGN*A*GAAGCT*AGAGCAGCA
OVRM1_0219_B01.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0099_F04.b : GAACGGAGGCACAGTGGCC*GACAAACTGGACTGCGCCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0002_F03.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SMG01_0003_H07.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0213_B03.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0090_E03.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0101_H10.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAACA
OVRM1_0210_G08.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGGCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0033_B10.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0083_E06.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0102_B01.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0202_G02.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0077_F05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AAAGCAGCA
OVRM1_0187_H10.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PBL01_0005_G12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGGCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0040_D11.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0103_F12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0099_A12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCCGGA*GAGGCT*AGAGCAGCA
OVR01_0101_G08.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0119_A08.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TCH01_0054_H10.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0089_F10.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0079_E08.b : GAACGGAGGCACAGTGGCC*CAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0028_H06.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SPL01_0023_D10.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SPL01_0010_B12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0096_H05.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0057_H03.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0056_D11.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0029_H10.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SPL01_0090_F10.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0051_F12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PBL01_0020_B02.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0013_D08.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LNG01_0029_H01.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PTG01_0049_B02.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0120_F12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ADR01_0024_A11.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAAGCT*AGAGCAGCA
ADR01_0005_G12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ADR01_0043_F04.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SMG01_0085_C09.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0040_F12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SPL01_0010_B01.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0024_H04.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0052_D10.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SMG01_0048_C07.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRT1_0138_D06.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PTG01_0049_H05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PTG01_0038_B11.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0115_H11.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0133_H10.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ILNT1_0071_H04.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SPLT1_0061_F05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRT1_0105_H05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0138_E10.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0108_F07.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0023_D09.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0110_H11.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0008_D05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0099_G12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TES01_0094_E05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*AAGGCT*AGAGCAGCA
SPL01_0058_D06.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SMG01_0081_C08.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0029_D06.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0139_C09.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0020_G12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAAGCT*AGAGCAGCA
THY01_0001_F05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCTTAGAGCAGCA
THY01_0014_E04.b : G*ATGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRT1_0142_D04.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0003_F05.b : GAACGGAGGCACAGTGGCCGAAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0087_G09.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0117_B11.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0108_G02.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0107_C04.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
BFLT1_0082_C01.b : GAACGGAGGCACAGTGGCT*GANAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SMG01_0045_C12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SMG01_0103_E03.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0040_F06.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SMG01_0090_G05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SMG01_0092_H11.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAAGCT*AGAGCAGCA
OVR01_0093_C08.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PTG01_0047_D10.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0079_D12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0021_D01.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SPL01_0039_G10.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0020_G05.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0015_B03.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SPL01_0098_D10.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0018_A07.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0108_G05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LVR01_0087_E05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0114_D09.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0003_F06.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
MLN01_0030_G03.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0109_F07.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGG*GAGGCT*AGAGCAGCA
SMG01_0076_E02.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0053_F03.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0023_E02.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0104_A07.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PTG01_0013_A01.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TES01_0062_B07.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0102_F01.b : GAACAGAGGCACAGTGGCC*TATAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0103_H04.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0032_A04.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0145_C03.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0044_E05.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PTG01_0044_F12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0126_F08.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SMG01_0084_H11.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0054_E03.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
MLN01_0005_E02.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0061_D01.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0095_B08.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ADR01_0053_H03.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PTG01_0004_H04.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0204_D03.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0103_B05.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0143_H07.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0060_E05.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0038_E03.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SPL01_0030_A10.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SMG01_0023_A10.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LVR01_0003_E06.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
MLN01_0083_A09.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0028_C06.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PTG01_0042_F12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LVR01_0078_H12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0031_G10.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SMG01_0090_E01.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ADR01_0044_A08.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SMG01_0023_D02.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SKNB1_0006_E08.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0013_G11.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0095_E09.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0116_F08.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0034_C09.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0052_B09.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0052_D11.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0005_C11.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SMG01_0014_C04.b : GAACGGAGGCACAGTGGCT*GANAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0064_F03.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SPL01_0092_F09.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0204_G09.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0020_C11.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0026_B05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LVR01_0041_G01.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0033_G07.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0152_B07.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0055_G11.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0120_H03.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PBL01_0015_E06.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0023_D06.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0013_B06.b : GAACGGAGGCACAGTGGCT*GANAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SPL01_0103_A05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0089_A02.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0029_H03.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0205_E02.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0008_A07.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0005_G08.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TCH01_0074_F02.b : GAACGGAGACACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SPL01_0048_D12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0098_B12.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SPL01_0045_D03.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0089_F07.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PTG01_0052_G11.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SMG01_0060_H02.b : GAAAGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0065_B01.b : GAACGGAGGCACAGTGGTT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
BFLT1_0015_E02.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PCT01_0006_C08.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
MLN01_0042_D07.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0064_H05.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0061_D11.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRT1_0057_E12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0090_F03.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PBL01_0064_E04.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ITT01_0021_A07.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LNG01_0027_H02.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PBL01_0028_H06.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ITT01_0002_G06.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PBL01_0078_D04.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ITT01_0067_B10.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PBL01_0028_B04.b : GAACGGAGGCACAGTGGCT*GAAAAACTAGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0011_G06.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
BFLT1_0093_D09.b : GAACGGAGGCACAGTGGCT*GANAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PBL01_0052_B07.b : GAACGGAGGCACAGTGGCT*GANAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PBL01_0068_H04.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
BFLT1_0098_H04.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ITT01_0003_C06.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ITT01_0010_E04.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ITT01_0006_B01.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ADR01_0047_C08.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGG*GAGGCT*AGAGCAGCA
ADR01_0060_E05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ADR01_0056_B05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SPL01_0065_G08.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0012_G11.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SMG01_0064_E06.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LNG01_0109_G07.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0072_C07.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TCH01_0079_D07.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LNG01_0076_F03.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0037_C10.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LNG01_0092_F11.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ADR01_0076_A06.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0007_G12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LNG01_0068_D01.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
MLN01_0049_G02.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ITT01_0056_C09.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ITT01_0053_H02.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TES01_0064_D12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAAGCT*AGAGCAGCA
TES01_0033_G01.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TES01_0070_A09.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0044_C09.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SMG01_0036_E10.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0036_A03.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRT1_0079_C01.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SMG01_0026_F07.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SKNB1_0041_C01.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0026_G06.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0004_D03.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0069_C07.b : GAACGGAGGCACCGTGGCT*GAAAAACTGGACTGGGGCCCGGGAGAGGCT*AGAGCCACA
OVRM1_0118_B06.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGTAGAGGCT*AGAGCAGCA
TES01_0100_A06.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0070_B09.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0022_B06.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0057_G12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRT1_0100_H08.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0031_G07.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SPL01_0101_F06.b : GAACGGAGGCGCAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRT1_0002_C08.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0026_D03.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TES01_0052_G09.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LNG01_0021_C01.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ADR01_0059_B03.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TCH01_0048_H01.b : GAATGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PCT01_0018_B11.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ILNT1_0076_B07.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
HTMT1_0118_H03.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PCT01_0027_H12.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGG*GAGGCT*AGAGCAGCA
HTMT1_0013_D11.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0028_E11.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0066_C08.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PCT01_0011_A10.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0025_B01.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0027_B12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LNG01_0096_D03.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PBL01_0102_B06.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SPL01_0104_F07.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0074_D08.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SPL01_0023_B07.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
SMG01_0056_B08.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GA*GCT*AGAGCAACA
CLNT1_0083_C04.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TES01_0023_A10.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0058_G05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TCH01_0018_C11.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ADR01_0017_C01.b : gaaaatggaggcacagtggctgaaaaactgggattgggctcgggaaaaggctataacagc
OVRM1_0157_A10.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0184_G01.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TES01_0060_F05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0010_D09.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0049_G12.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ADR01_0011_D07.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0050_G02.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ADR01_0022_A05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRM1_0025_D12.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ADR01_0008_C01.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LNG01_0010_E05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0049_B09.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0129_A12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0030_F07.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0032_B08.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0058_F01.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0042_D07.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
UTR01_0055_E12.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TES01_0042_H11.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVRT1_0124_A07.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ITT01_0095_A09.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LNG01_0093_H12.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0019_D12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0019_A12.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ADR01_0005_E04.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ITT01_0048_E08.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
ADR01_0073_F06.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
THY01_0002_H02.b : GAACGGAGGCACAGTGGCT*GACAAACTGGACTGGGCCCGGGA*GAAGCT*AGAGCAGCA
SKNB1_0040_B02.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PCT01_0003_H04.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PST01_0015_A04.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TES01_0109_F11.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGAAGAGGCT*AGAGCAACA
TES01_0052_E05.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TES01_0026_F03.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TES01_0007_G01.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
PTG01_0109_F08.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TES01_0096_D07.b : GAACGGAAGCACAGTGGCT*GAAAAACTGGACTGGGCCCG*GA*GAGGCT*AGAAGCACA
TES01_0072_B12.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TES01_0111_C02.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TES01_0083_B11.b : GAACGGAGGCACAGTGGTT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TES01_0069_B03.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
TES01_0051_C01.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
CLNT1_0078_H02.b : GAACGGAGGCACAGTGGCT*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
OVR01_0004_D04.b : GAACGGAGGCACAGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
LVRM1_0135_B01.b : GAACGGAGGCACGGTGGCC*GAAAAACTGGACTGGGCCCGGGA*GAGGCT*AGAGCAGCA
20110601C-000998 : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
---------+---------+---------+---------+---------+---------+ 722
OVRM1_0049_A11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
OVRM1_0106_B06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
TES01_0029_G10.b : GGT*CCCTGTGAACCAAGTGTTTGGG*CACGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0041_G10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
LNG01_0031_D09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
OVRM1_0016_C03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
OVRM1_0024_H09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
SMG01_0083_C02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SMG01_0060_H07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVRM1_0169_G02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGCC*TGGA
THY01_0006_F02.b : GGT*CCCTGTGAACCCCGTGTTTGGG*CAGGACGAGATGACT*GATGCCACTGGC*GTGA
OVRM1_0074_E09.b : AGT*CCCTGAGAACCAGGTGTTTAGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
OVR01_0060_F10.b : GGT*CCTTGTGAACCAGGTGTTTGGG*CAGGAAGAGATGATT*GATGTCATTGGC*GTCA
OVR01_0101_E05.b : GGT*CCCTGTGAACCACGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
TCH01_0055_E11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
TES01_0067_H08.b : TGT*CCCTGTGTACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
MLN01_0060_G09.b : GGT*CCCTGTGAACCATGTGTTTGGG*CCCGATGAGATGATT*GATGTCATTGGC*GCGA
ADR01_0021_A10.b : GGT*CCCTGTGAACCANGTGTTTTGG*CANGATGAGATGATT*GATGTCATTGGC*GTGA
ILNT1_0056_A01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
THY01_0015_B01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCACTGGC*GTGA
THY01_0051_C03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SMG01_0033_A02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0092_E09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
UTR01_0040_A05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
LNG01_0023_F02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
SPL01_0069_F12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
PTG01_0046_H03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
TCH01_0060_F12.b : GGT*CCCTGTGAACCANGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
LVR01_0021_H11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0071_A12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
TCH01_0024_F10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
BFLT1_0122_F01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0122_H10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SPL01_0077_G09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
THY01_0038_C12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0097_G11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
PBL01_0077_H08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ITT01_0061_H08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ITT01_0008_A03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
BMWN1_0080_G01.b : GGT*CCCTGTGAACCANGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
LVRM1_0001_C05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
BMWN1_0014_D05.b : GGT*CCCTGTGAACCANGTGTTTGGGGCAAGATGAGATGATT*GATGTCATTGGC*GTCA
BMWN1_0095_E01.b : GGT*CCCTGTGAACCANGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
UTR01_0045_B02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
TCH01_0040_G05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
UTR01_0044_F01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
LNG01_0031_F12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
CLNT1_0117_G11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SPLT1_0050_B12.b : GGT*CCCTGTGAACCANGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SPLT1_0049_D01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
PTG01_0070_E04.b : GGT*CCCTGTGAAACAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
BMWN1_0013_B11.b : CGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
ILNT1_0031_A06.b : GGT*CCCTGTGAACCANGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVRT1_0063_B04.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ILNT1_0014_E12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0134_C06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CBLT1_0041_D05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SPLT1_0037_A12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
TCH01_0057_C09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
LNG01_0082_H04.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
THY01_0027_G10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
PBL01_0105_B08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
TCH01_0039_G05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
LNG01_0062_D05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0081_A07.b : gtcccggtgaaccaggttgattggtgcagatgatatgattgcaggtcatgggccagaccc
TES01_0102_G02.b : TGT*CCCTGTGAACCAGGGGTTTGGG*CAGGATGAGAAGATT*GATGTTATTGGC*GTGA
OVR01_0081_C05.b : GGT*CCCTGTGGACCAGGTGTTTAGG*CAGGATGAGATGATT*GATGTCATTGGC*G
OVR01_0076_G05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CACGATGAGATGATT*GATGTCATTGGC*GTGA
OVRM1_0181_H08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
LVRM1_0200_H02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
OVRM1_0193_C07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
OVRM1_0196_H08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
OVR01_0067_A02.b : AGT*CCCTGTGAACCATGTGTTTTGGGCAGGATGAGATGATT*GATGTCATTGGC*GTTC
LVRM1_0157_C06.b : GGG*TCCTGTATACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGG*GTCA
OVR01_0074_A12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
OVRM1_0194_D09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
TES01_0070_E03.b : GGT*CCCTGTGAACCANGTGTTTGGG*CAGGATGAGATGATT*GCTGTCATTGNC*GTGA
OVRM1_0219_B01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
OVRM1_0099_F04.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
OVRM1_0002_F03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
SMG01_0003_H07.b : GGT*CCCTGTGAACCANGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVRM1_0213_B03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
OVRM1_0090_E03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
OVR01_0101_H10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*GCAGATGAGATGATT*GATGTCATTGGCGTCCA
OVRM1_0210_G08.b : GGT*CCCTGTGTACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
OVRM1_0033_B10.b : GGT*CCCTGTGAACCAAGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
OVRM1_0083_E06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
OVRM1_0102_B01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
OVRM1_0202_G02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
OVR01_0077_F05.b : CGT*CCCTGTGAAACCAGTGTTTGGGCCAGGATGA*ATGATT*GATGTCATTGGC*GTGA
OVRM1_0187_H10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
PBL01_0005_G12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATAAGC*GTGA
OVRM1_0040_D11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
OVR01_0103_F12.b : GGT*CCCTGTGAACCAAGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0099_A12.b : GGT*CCCTGTGAACCCAGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0101_G08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
OVRM1_0119_A08.b : GGTCCCCTGTGAAC*AGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
TCH01_0054_H10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
OVR01_0089_F10.b : TGT*CCCTGTGAAACAAGTGTTTGGG*CAGGATGAGATGAAT*GATGTCATTGGC*GTCA
OVR01_0079_E08.b : GGT*GCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
OVRM1_0028_H06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
SPL01_0023_D10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SPL01_0010_B12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0096_H05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCTTTGGC*GTCA
OVR01_0057_H03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0056_D11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
OVRM1_0029_H10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
SPL01_0090_F10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
THY01_0051_F12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGGTGATT*GATGTCATTGGC*GTGA
PBL01_0020_B02.b : GGT*CCCTGTGAACCANGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
UTR01_0013_D08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
LNG01_0029_H01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
PTG01_0049_B02.b : GGT*CCCTGTGAACCANGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0120_F12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ADR01_0024_A11.b : GGT*CCCTGTGAACCANGTGTTTGGG*CAGGGTGAGATGATT*GATGTCATTGGC*GTGA
ADR01_0005_G12.b : GGT*CCCTGTGAACCANGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ADR01_0043_F04.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SMG01_0085_C09.b : GGT*CCCTGTGAACCANGTGTTGGGG*CAGGATGAGATGATT*GATGTCATGGGC*GTGA
UTR01_0040_F12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SPL01_0010_B01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
UTR01_0024_H04.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
THY01_0052_D10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SMG01_0048_C07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVRT1_0138_D06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
PTG01_0049_H05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
PTG01_0038_B11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0115_H11.b : GGT*CCCTGTGAACCANGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0133_H10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ILNT1_0071_H04.b : GGT*CCCTGTGAACCANGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SPLT1_0061_F05.b : GGT*CCCTGTGAACCANGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVRT1_0105_H05.b : GGT*CCCTGTGAGCCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0138_E10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0108_F07.b : GGT*CCCTGTGAACCANGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
UTR01_0023_D09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0110_H11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
UTR01_0008_D05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGTTGAGATGATT*GATGTCATTGGC*GTGA
UTR01_0099_G12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
TES01_0094_E05.b : GGT*CCCTGTGAACCANGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SPL01_0058_D06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SMG01_0081_C08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
UTR01_0029_D06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0139_C09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
THY01_0020_G12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
THY01_0001_F05.b : GGT*CCCTGTGAACCACGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
THY01_0014_E04.b : GGT*CCCTGTTGACCAGGTGTTTGGG*CAGGATG**ATGATT*GATGTCATTGGC*GTGA
OVRT1_0142_D04.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
UTR01_0003_F05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
UTR01_0087_G09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
CLNT1_0117_B11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0108_G02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0107_C04.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CANGATGAGATGATT*GATGTCATTGGC*GTGA
BFLT1_0082_C01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SMG01_0045_C12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SMG01_0103_E03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
UTR01_0040_F06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
SMG01_0090_G05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SMG01_0092_H11.b : GGT*CCCTGTGAACCANNGTGTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0093_C08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
PTG01_0047_D10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
THY01_0079_D12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0021_D01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
SPL01_0039_G10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
UTR01_0020_G05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
UTR01_0015_B03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
SPL01_0098_D10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GAGGTCATTGGC*GTGA
UTR01_0018_A07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
CLNT1_0108_G05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
LVR01_0087_E05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0114_D09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
UTR01_0003_F06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
MLN01_0030_G03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0109_F07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SMG01_0076_E02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0053_F03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
THY01_0023_E02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0104_A07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
PTG01_0013_A01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
TES01_0062_B07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
UTR01_0102_F01.b : AGT*CCCTGTGAACCACGTGTTTGCG*GCGGATGAGATGATT*GATGTCATTGGC*GTCA
UTR01_0103_H04.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
UTR01_0032_A04.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
CLNT1_0145_C03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0044_E05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
PTG01_0044_F12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0126_F08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SMG01_0084_H11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0054_E03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
MLN01_0005_E02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0061_D01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0095_B08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
ADR01_0053_H03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
PTG01_0004_H04.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
THY01_0204_D03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
UTR01_0103_B05.b : GGT*CCCTGTGAACCANGTGTTTGGG*CANGATGAGATGATT*GATGTCATTGGC*GTCA
CLNT1_0143_H07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
UTR01_0060_E05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGGTGATT*GATGTCATTGGC*GTCA
UTR01_0038_E03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
SPL01_0030_A10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SMG01_0023_A10.b : GGT*CCCTGTGAACCANGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
LVR01_0003_E06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
MLN01_0083_A09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0028_C06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
PTG01_0042_F12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
LVR01_0078_H12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0031_G10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SMG01_0090_E01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ADR01_0044_A08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SMG01_0023_D02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SKNB1_0006_E08.b : GGT*CCCTGTGAACCANGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0013_G11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
UTR01_0095_E09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
CLNT1_0116_F08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
THY01_0034_C09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
UTR01_0052_B09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0052_D11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0005_C11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
SMG01_0014_C04.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0064_F03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
SPL01_0092_F09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
THY01_0204_G09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0020_C11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
OVR01_0026_B05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
LVR01_0041_G01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0033_G07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
CLNT1_0152_B07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
UTR01_0055_G11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0120_H03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
PBL01_0015_E06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
THY01_0023_D06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0013_B06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SPL01_0103_A05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
UTR01_0089_A02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
OVR01_0029_H03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
THY01_0205_E02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0008_A07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
OVR01_0005_G08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
TCH01_0074_F02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
SPL01_0048_D12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0098_B12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
SPL01_0045_D03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0089_F07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
PTG01_0052_G11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SMG01_0060_H02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
THY01_0065_B01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
BFLT1_0015_E02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
PCT01_0006_C08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
MLN01_0042_D07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
UTR01_0064_H05.b : GAT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
THY01_0061_D11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVRT1_0057_E12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
THY01_0090_F03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
PBL01_0064_E04.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ITT01_0021_A07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
LNG01_0027_H02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
PBL01_0028_H06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ITT01_0002_G06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
PBL01_0078_D04.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ITT01_0067_B10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
PBL01_0028_B04.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0011_G06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
BFLT1_0093_D09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
PBL01_0052_B07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGGTGAGATGATT*GATGTCATTGGC*GTGA
PBL01_0068_H04.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
BFLT1_0098_H04.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ITT01_0003_C06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ITT01_0010_E04.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ITT01_0006_B01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ADR01_0047_C08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ADR01_0060_E05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ADR01_0056_B05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SPL01_0065_G08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0012_G11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SMG01_0064_E06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
LNG01_0109_G07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0072_C07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
TCH01_0079_D07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
LNG01_0076_F03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
CLNT1_0037_C10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
LNG01_0092_F11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
ADR01_0076_A06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0007_G12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
LNG01_0068_D01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
MLN01_0049_G02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ITT01_0056_C09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ITT01_0053_H02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
TES01_0064_D12.b : GGT*CCCTGTGAAACAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*TTGA
TES01_0033_G01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
TES01_0070_A09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
THY01_0044_C09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SMG01_0036_E10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0036_A03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVRT1_0079_C01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SMG01_0026_F07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SKNB1_0041_C01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0026_G06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0004_D03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0069_C07.b : AGTCCCCTGTGAACCAAGTGTTTGGGGCGGGATGAAATGA*T*GATGTCCTTGGG*GTGA
OVRM1_0118_B06.b : GGT*CCCTGTGTACCAGGTGTTTGGGCCAGGATGAGATGATC*GATGTCATTGGC*GTGA
TES01_0100_A06.b : GGT*CCCTGTGAACCANGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
UTR01_0070_B09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATTTGATGTCATTGGC*GTCA
UTR01_0022_B06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
THY01_0057_G12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVRT1_0100_H08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0031_G07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
SPL01_0101_F06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVRT1_0002_C08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0026_D03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
TES01_0052_G09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
LNG01_0021_C01.b : GGT*CTCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ADR01_0059_B03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
TCH01_0048_H01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
PCT01_0018_B11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
ILNT1_0076_B07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
HTMT1_0118_H03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
PCT01_0027_H12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
HTMT1_0013_D11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0028_E11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
THY01_0066_C08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
PCT01_0011_A10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
OVR01_0025_B01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
CLNT1_0027_B12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
LNG01_0096_D03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
PBL01_0102_B06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SPL01_0104_F07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0074_D08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
SPL01_0023_B07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
SMG01_0056_B08.b : GGT*CCCTGTGAAACANGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGCC*GTGA
CLNT1_0083_C04.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
TES01_0023_A10.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
UTR01_0058_G05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
TCH01_0018_C11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ADR01_0017_C01.b : aggtccctatgaacaagtggatttgggcgcgataaaagaatggagtccattgggcgtgac
OVRM1_0157_A10.b : GGT*CCCTGTGAACCAAGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
OVRM1_0184_G01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
TES01_0060_F05.b : AGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVRM1_0010_D09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
OVR01_0049_G12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
ADR01_0011_D07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
THY01_0050_G02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ADR01_0022_A05.b : GGT*CCCTGTGAACCANGTGGTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVRM1_0025_D12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
ADR01_0008_C01.b : GGT*CCCTGTGAACCANGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
LNG01_0010_E05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
THY01_0049_B09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0129_A12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0030_F07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
UTR01_0032_B08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
OVR01_0058_F01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
OVR01_0042_D07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
UTR01_0055_E12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
TES01_0042_H11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVRT1_0124_A07.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ITT01_0095_A09.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
LNG01_0093_H12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
CLNT1_0019_D12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0019_A12.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
ADR01_0005_E04.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CANGATGAGATGATT*GATGTCATTGGC*GTGA
ITT01_0048_E08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
ADR01_0073_F06.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
THY01_0002_H02.b : GGT*CCCTGTGAACCACGTGTTTGGG*CAGGATGAGATGATT*GATGCCATTGGC*GTGA
SKNB1_0040_B02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
PCT01_0003_H04.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
PST01_0015_A04.b : GGT*CCCCGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
TES01_0109_F11.b : GGT*CCCTGTGAAACAAGTGTTTGGG*CAGGATGAGATGAAT*GATGTCATTGGCCGTGA
TES01_0052_E05.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
TES01_0026_F03.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
TES01_0007_G01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
PTG01_0109_F08.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
TES01_0096_D07.b : G*T*CCCTGTGAACCCAGTGTTTGGG*CAGGATGA*ATGATT*GATGTCTTTGGG*GTGA
TES01_0072_B12.b : GGT*CCCTGTGAACCANGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
TES01_0111_C02.b : GGT*CCCTGTGAAACAGGTGTTTGGG*CANGATGAGATGATT*GATGTCATTGGC*GTGA
TES01_0083_B11.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CANGATGGGATGATT*GATGTCATTGGC*GTGA
TES01_0069_B03.b : GGT*CCCTGTGAACCANNGTGTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
TES01_0051_C01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
CLNT1_0078_H02.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTGA
OVR01_0004_D04.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATT*GATGTCATTGGC*GTCA
LVRM1_0135_B01.b : GGT*CCCTGTGAACCAGGTGTTTGGG*CAGGATGAGATGATC*GATGTCATTGGC*GTGA
20110601C-000998 : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
---------+---------+---------+---------+---------+---------+ 775
OVRM1_0049_A11.b : CC*AAGGGCNAGGG*CTACNAA**GGGGTCACCAG*CCGTTGGCA*TA*CCAG*AAGCTG
OVRM1_0106_B06.b : CC*AAGGGCAAGGG*CTTACAA**GGGGTCACCAG*CCGTTGGCA*TA*CAAG*AAGCTG
TES01_0029_G10.b : CC*AAGGGCCAAGG*CCTTCAAAGGGGTTCACCTG*CCGTTTGCA*TACCAAA*AAGCTG
OVR01_0041_G10.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
LNG01_0031_D09.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
OVRM1_0016_C03.b : CC*ATAGGCAAGGG*CTACTAA**GGGGTCACCAG*CTCGTTGCA*TACCCAG*AAGCTG
OVRM1_0024_H09.b : CC*AGGGGC*AGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
SMG01_0083_C02.b : CC*AAGGNCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCCAG*AAGCTG
SMG01_0060_H07.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AA*CTG
OVRM1_0169_G02.b : CC*A*GGGCAAGGG*CTAaaagggggccaccccgcttggggatccaaaaagatg
THY01_0006_F02.b : CC*CAGGGCAATGT*CTACAAA**GGGGTCcccacccttggcatcccagaagccgccccg
OVRM1_0074_E09.b : CC*AAGAGCAAAGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TAC*AAG*AAGCTG
OVR01_0060_F10.b : CC*AAGGGCAAGGGGCTACAAA**GGGGTCACCCACCCTTTGGCA*TACCAAG*AAACTG
OVR01_0101_E05.b : CC*AAAGGCAAAGG*CTACAAA**GGGGTCACCAG*CCGTTGTCA*TACCAAGAAAGCTG
TCH01_0055_E11.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
TES01_0067_H08.b : CC*AAGGGCAAGGG*CCTACAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
MLN01_0060_G09.b : CC*AAAGGCAAGGG*CTACAA***GGGGTCACCAG*CCGTTGGCA*TTCCAAG*AAACTG
ADR01_0021_A10.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCNACAG*CCGTTGGCA*TACCA*G*AAGCTG
ILNT1_0056_A01.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCCAG*AAGCTG
THY01_0015_B01.b : CC*CAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACAAAG*AAGCTG
THY01_0051_C03.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
SMG01_0033_A02.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
OVR01_0092_E09.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
UTR01_0040_A05.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
LNG01_0023_F02.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
SPL01_0069_F12.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
PTG01_0046_H03.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
TCH01_0060_F12.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
LVR01_0021_H11.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
OVR01_0071_A12.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
TCH01_0024_F10.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
BFLT1_0122_F01.b : CC*ANGGGGCAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
CLNT1_0122_H10.b : CC*AAAGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
SPL01_0077_G09.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
THY01_0038_C12.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCG*TACCAAG*AAGCTG
OVR01_0097_G11.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
PBL01_0077_H08.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
ITT01_0061_H08.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
ITT01_0008_A03.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
BMWN1_0080_G01.b : CC*AAGGGCAAGGC*CTACAAA**GGGGTCACCAG*CCGTTTGGC*TACCAAG*AAGCTG
LVRM1_0001_C05.b : CC*AAGGGGCAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
BMWN1_0014_D05.b : CC*AAGGGGCAGGG*CTACAAA**GGGGTCA*CAG*CCGTTGGCA*TACCAAG*AAGCTG
BMWN1_0095_E01.b : CC*CAGGGCAAAGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
UTR01_0045_B02.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
TCH01_0040_G05.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAACTG
UTR01_0044_F01.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
LNG01_0031_F12.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
CLNT1_0117_G11.b : CC*AAGGGGCAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCCAG*AAGCTG
SPLT1_0050_B12.b : CC*ANGGGCAGGGN*CTACA*A**GGGGTCACCAG*CCGTTGGCA*TACCAAG*A*GCTG
SPLT1_0049_D01.b : CC*AAAGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
PTG01_0070_E04.b : CC*AAGGGCAAGGG*CTACAAG**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
BMWN1_0013_B11.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
ILNT1_0031_A06.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCCGTGGCA*TACCAAG*AAGCTG
OVRT1_0063_B04.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
ILNT1_0014_E12.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
CLNT1_0134_C06.b : CC*AAGGGTAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
CBLT1_0041_D05.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
SPLT1_0037_A12.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
TCH01_0057_C09.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
LNG01_0082_H04.b : CC*AAGG*CAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCCAG*AAGCTG
THY01_0027_G10.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
PBL01_0105_B08.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
TCH01_0039_G05.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
LNG01_0062_D05.b : CC*AAGGGCAAGGG*CTACAAA**GGGGTCACCAG*CCGTTGGCA*TACCAAG*AAGCTG
OVR01_0081_A07.b : atgggcctggcctacaaggggttc
TES01_0102_G02.b : CC*AAGGGCAAGGGGCTCCAAA**GGGGTCccccacccgtttggcataccaagaaacctg
OVR01_0081_C05.b :
OVR01_0076_G05.b : CC**AGGGCAAGGG
OVRM1_0181_H08.b : CC*NANNGGCAGGG*CTNACAA**GGGGTCACCAG
LVRM1_0200_H02.b : CC*AAGGGCCAGGGGCTACAAA**GGG*TCACCAG*CCGTTGGCA*Tg
OVRM1_0193_C07.b : CC*AAGAGGCAGGG*CTACAAA**GGAGTCACCAG*CCGTTGGCA*TAC
OVRM1_0196_H08.b : CC