
[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-000998

Length: 1,129

Sequence [FASTA format sequence]

SNP mapping information
SNP IDRel.Chr.Location (cM)

Assembly Overview:      TOP
Change score limit to  

BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRPL360S ribosomal protein L3 isoform a [Homo sapiens]. 607e-174O
Contig/Assembly ProteinRPL3L60S ribosomal protein L3-like [Homo sapiens]. 505e-143O
Contig/Assembly ProteinRPL360S ribosomal protein L3 isoform b [Homo sapiens]. 484e-137O

BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRpl360S ribosomal protein L3 [Mus musculus]. 602e-172O
Contig/Assembly ProteinGm12816PREDICTED: 60S ribosomal protein L3-like [Mus musculus]. 571e-163O
Contig/Assembly ProteinLOC674810PREDICTED: 60S ribosomal protein L3-like [Mus musculus]. 550e-157O
Contig/Assembly ProteinRpl3lribosomal protein L3-like isoform 1 [Mus musculus]. 507e-144O
Contig/Assembly ProteinRpl3lribosomal protein L3-like isoform 2 [Mus musculus]. 2172e-56O
Contig/Assembly ProteinGm12816PREDICTED: 60S ribosomal protein L3-like, partial [Mus musculus]. 1602e-39O

BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC474504PREDICTED: similar to 60S ribosomal protein L3 (L4) isoform 2 [Canis familiaris]. 607e-174O
Contig/Assembly ProteinLOC475009PREDICTED: similar to 60S ribosomal protein L3 (L4) isoform 1 [Canis familiaris]. 606e-173O
Contig/Assembly ProteinLOC475009PREDICTED: similar to 60S ribosomal protein L3 (L4) isoform 9 [Canis familiaris]. 595e-170O
Contig/Assembly ProteinLOC475009PREDICTED: similar to 60S ribosomal protein L3 (L4) isoform 8 [Canis familiaris]. 571e-163O
Contig/Assembly ProteinLOC475009PREDICTED: similar to 60S ribosomal protein L3 (L4) isoform 6 [Canis familiaris]. 493e-140O
Contig/Assembly ProteinLOC475009PREDICTED: similar to ribosomal protein L3 isoform 5 [Canis familiaris]. 485e-137O
Contig/Assembly ProteinLOC474504PREDICTED: similar to 60S ribosomal protein L3 (L4) isoform 8 [Canis familiaris]. 441e-124O
Contig/Assembly ProteinLOC490065PREDICTED: similar to 60S ribosomal protein L3-like [Canis familiaris]. 400e-111
Contig/Assembly ProteinLOC475009PREDICTED: similar to 60S ribosomal protein L3 (L4) isoform 7 [Canis familiaris]. 3561e-98O
Contig/Assembly ProteinLOC474504PREDICTED: similar to ribosomal protein L3 isoform 7 [Canis familiaris]. 2991e-81O

BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRPL360S ribosomal protein L3 [Bos taurus]. 606e-174O
Contig/Assembly ProteinRPL3L60S ribosomal protein L3-like [Bos taurus]. 509e-144O

BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC396768PREDICTED: 60S ribosomal protein L3 [Sus scrofa]. 611e-175O

Assembly Members: 377      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
OVRM10049A11OVRM1_0049_A11.bBP145939 AK395084


SNPs: 6      TOP
Loc.AlleleIndividualsFreq.TypeAA Change

Alignment:      TOP

20110601C-000998 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRM1_0049_A11.b : agttgacxxxxxxx
OVRM1_0106_B06.b : tagttgtcxxxxxxxxxxxxx
TES01_0029_G10.b :
OVR01_0041_G10.b : ggggcattttggxxxxxxxxxxxxxxxxx
LNG01_0031_D09.b : attgttttnggcatagtgatat
OVRM1_0016_C03.b :
OVRM1_0024_H09.b :
SMG01_0083_C02.b : nnn
SMG01_0060_H07.b : nnn
OVRM1_0169_G02.b :
THY01_0006_F02.b : tgacxxx
OVRM1_0074_E09.b :
OVR01_0060_F10.b : tggcttgtgactatg
OVR01_0101_E05.b : ngggctag
TCH01_0055_E11.b : nnnnggcttgtga
TES01_0067_H08.b :
MLN01_0060_G09.b :
ADR01_0021_A10.b :
ILNT1_0056_A01.b :
THY01_0015_B01.b : ggcaxxxxxxxxxxxxxx
THY01_0051_C03.b : xxxxxxxxxxxxxxxxx
SMG01_0033_A02.b : n
OVR01_0092_E09.b : nggataggact
UTR01_0040_A05.b : ttttggcggcxxxxxxx
LNG01_0023_F02.b : ggcxxxxxxxxxxxxxx
SPL01_0069_F12.b : nnnggctagtgac
PTG01_0046_H03.b :
TCH01_0060_F12.b : ctagtgac
LVR01_0021_H11.b : cttttggttgxxxxxxxx
OVR01_0071_A12.b : nnnggcttggact
TCH01_0024_F10.b : ngttgtgact
BFLT1_0122_F01.b : nnccccgt
CLNT1_0122_H10.b : nntt
SPL01_0077_G09.b : ngggctaggact
THY01_0038_C12.b : xxxxxxxxxxxxxxxxx
OVR01_0097_G11.b : nnggcttgtgac
PBL01_0077_H08.b :
ITT01_0061_H08.b :
ITT01_0008_A03.b :
BMWN1_0080_G01.b :
LVRM1_0001_C05.b :
BMWN1_0014_D05.b :
BMWN1_0095_E01.b :
UTR01_0045_B02.b : gggagaactxxxxxxxxxxxxxx
TCH01_0040_G05.b : tttctgctaggac
UTR01_0044_F01.b : ttttggagccxx
LNG01_0031_F12.b : gggccnancggattgcgac
CLNT1_0117_G11.b : nggggttnnnnnnnn
SPLT1_0050_B12.b :
SPLT1_0049_D01.b :
PTG01_0070_E04.b :
BMWN1_0013_B11.b :
ILNT1_0031_A06.b :
OVRT1_0063_B04.b : nnnnnnnnnnnnnnn
ILNT1_0014_E12.b :
CLNT1_0134_C06.b : naaa
CBLT1_0041_D05.b :
SPLT1_0037_A12.b : nnnna
TCH01_0057_C09.b : nnnggcta
LNG01_0082_H04.b : gcgnnnngggctg
THY01_0027_G10.b : ggggcccct
PBL01_0105_B08.b :
TCH01_0039_G05.b : nnnnggctt
LNG01_0062_D05.b : nttagggg
OVR01_0081_A07.b : gcaxxxxxxxxxxxxxx
TES01_0102_G02.b :
OVR01_0081_C05.b : cxxxxxxxxxxxx
OVR01_0076_G05.b : gcttttagtgcxx
OVRM1_0181_H08.b :
LVRM1_0200_H02.b :
OVRM1_0193_C07.b :
OVRM1_0196_H08.b :
OVR01_0067_A02.b : ttgcttgtga
LVRM1_0157_C06.b :
OVR01_0074_A12.b : gctxxxxxxxxxxx
OVRM1_0194_D09.b :
TES01_0070_E03.b :
OVRM1_0219_B01.b :
OVRM1_0099_F04.b :
OVRM1_0002_F03.b :
SMG01_0003_H07.b :
OVRM1_0213_B03.b :
OVRM1_0090_E03.b :
OVR01_0101_H10.b : ngcttgga
OVRM1_0210_G08.b :
OVRM1_0033_B10.b :
OVRM1_0083_E06.b :
OVRM1_0102_B01.b :
OVRM1_0202_G02.b :
OVR01_0077_F05.b : ngcttagga
OVRM1_0187_H10.b :
PBL01_0005_G12.b :
OVRM1_0040_D11.b :
OVR01_0103_F12.b : gcttggc
OVR01_0099_A12.b : gcttgt
OVR01_0101_G08.b : nggcttgga
OVRM1_0119_A08.b :
TCH01_0054_H10.b : nggggcatgtgac
OVR01_0089_F10.b : ggcttggc
OVR01_0079_E08.b : gattgtg
OVRM1_0028_H06.b :
SPL01_0023_D10.b : ttttgagtgxxxxxxx
SPL01_0010_B12.b : ctttaxxxxxxxxxxx
OVR01_0096_H05.b : ggttgtga
OVR01_0057_H03.b : agtannnntgcatgtga
OVR01_0056_D11.b : tttgcttggact
OVRM1_0029_H10.b :
SPL01_0090_F10.b : nntttgctaggac
THY01_0051_F12.b : cttttgcgtgxxxxxxx
PBL01_0020_B02.b :
UTR01_0013_D08.b : gxxxxxxxxxxx
LNG01_0029_H01.b : gggggcttagcgncnxxx
PTG01_0049_B02.b :
CLNT1_0120_F12.b : ntttt
ADR01_0024_A11.b :
ADR01_0005_G12.b :
ADR01_0043_F04.b :
SMG01_0085_C09.b :
UTR01_0040_F12.b : ctttttggcggcxxxxx
SPL01_0010_B01.b : atxxxxxxxxxxxxxx
UTR01_0024_H04.b : gggttgaxxxxxx
THY01_0052_D10.b : tttgcgtgxxxxxxx
SMG01_0048_C07.b :
OVRT1_0138_D06.b : nnntgtaaaaccnnn
PTG01_0049_H05.b :
PTG01_0038_B11.b :
CLNT1_0115_H11.b : nnn
CLNT1_0133_H10.b : nnat
ILNT1_0071_H04.b :
SPLT1_0061_F05.b :
OVRT1_0105_H05.b : n
CLNT1_0138_E10.b : n
CLNT1_0108_F07.b : nnn
UTR01_0023_D09.b : ggggggxxxxxxx
CLNT1_0110_H11.b : ntttt
UTR01_0008_D05.b : cttttggtggcxxxx
UTR01_0099_G12.b : ntttttgcttgga
TES01_0094_E05.b :
SPL01_0058_D06.b : nnnggcttggact
SMG01_0081_C08.b :
UTR01_0029_D06.b : tgggatgacxxxxx
CLNT1_0139_C09.b : nnnn
THY01_0020_G12.b : gcaxxxxxxxxxxxx
THY01_0001_F05.b :
THY01_0014_E04.b : ggcaxxxxxxxxxxxx
OVRT1_0142_D04.b : nnngggcgcnnnnnnnnn
UTR01_0003_F05.b : ttxxxxxxxxxxxxxxxxx
UTR01_0087_G09.b : nttgctagga
CLNT1_0117_B11.b : ttttcccttctgcgnacgagtgxxxxxxxxxxxxxxxxxxx
CLNT1_0108_G02.b : nnnn
CLNT1_0107_C04.b : nnn
BFLT1_0082_C01.b : n
SMG01_0045_C12.b :
SMG01_0103_E03.b :
UTR01_0040_F06.b : ggtggacxxxxx
SMG01_0090_G05.b :
SMG01_0092_H11.b :
OVR01_0093_C08.b : nnggatagga
PTG01_0047_D10.b :
THY01_0079_D12.b : gcccxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0021_D01.b : gggctxxxxxxxxxxxxx
SPL01_0039_G10.b : aaggcttxxxxxxxxxxxxx
UTR01_0020_G05.b : ggggggcacctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0015_B03.b : ggtggacxxxx
SPL01_0098_D10.b : nnggctagtga
UTR01_0018_A07.b : gggtggccctat
CLNT1_0108_G05.b : nnn
LVR01_0087_E05.b : cttttgggtgactac
CLNT1_0114_D09.b : nnn
UTR01_0003_F06.b : txxxxxxxxxxxxxxxxxx
MLN01_0030_G03.b : nnnntgcatgga
CLNT1_0109_F07.b : nn
SMG01_0076_E02.b :
OVR01_0053_F03.b : nnggggattctnggcatg
THY01_0023_E02.b : ctttttxxxxxxxx
OVR01_0104_A07.b : tggctagga
PTG01_0013_A01.b :
TES01_0062_B07.b :
UTR01_0102_F01.b : nnnnggctagtg
UTR01_0103_H04.b : nnnggcttgga
UTR01_0032_A04.b : catatggcgccxxxxx
CLNT1_0145_C03.b : nnn
OVR01_0044_E05.b : xxxxxxxxxxxxxxxxxxxx
PTG01_0044_F12.b :
CLNT1_0126_F08.b : ngatcttnnnnnnn
SMG01_0084_H11.b :
OVR01_0054_E03.b : nnnnggctagga
MLN01_0005_E02.b : nnnttttgcttgg
OVR01_0061_D01.b : nnnnnggcatggac
OVR01_0095_B08.b : nnggctag
ADR01_0053_H03.b :
PTG01_0004_H04.b :
THY01_0204_D03.b : ctxxxxxxxxxxxxx
UTR01_0103_B05.b : nnttggctagtga
CLNT1_0143_H07.b : nnnn
UTR01_0060_E05.b : ccxxxxxxxxxxxxxxx
UTR01_0038_E03.b : gggaggacxxxxx
SPL01_0030_A10.b : nnnnggcttggac
SMG01_0023_A10.b :
LVR01_0003_E06.b : tttgggtgxxxxxx
MLN01_0083_A09.b : nggctagt
OVR01_0028_C06.b : gggcxxxxxxxxxxxxxxx
PTG01_0042_F12.b :
LVR01_0078_H12.b : gggtcaxxxxxxxxxxxx
OVR01_0031_G10.b : gggctxxxxxxxxxxxxx
SMG01_0090_E01.b :
ADR01_0044_A08.b :
SMG01_0023_D02.b :
SKNB1_0006_E08.b :
CLNT1_0013_G11.b : gcgctttnngggact
UTR01_0095_E09.b : nnggcttgga
CLNT1_0116_F08.b : nn
THY01_0034_C09.b : tttttgtgaacxxxxx
UTR01_0052_B09.b : gcttttggttgacxxxxx
OVR01_0052_D11.b : nntttgcttggact
OVR01_0005_C11.b : ggggggccctatcttacxxxxxxxxxxxx
SMG01_0014_C04.b :
OVR01_0064_F03.b : nnnnggcttgga
SPL01_0092_F09.b : nnngggttgga
THY01_0204_G09.b : cttttgggtgxxxxxx
OVR01_0020_C11.b : attggggggcactat
OVR01_0026_B05.b : gggactxxxxxxxxxxxxx
LVR01_0041_G01.b : ggggtcaggcatagtgacta
OVR01_0033_G07.b : gaggacxxxxxxxxxxxxxxx
CLNT1_0152_B07.b : nn
UTR01_0055_G11.b : gcctttggggtgxxxxx
CLNT1_0120_H03.b : nnnt
PBL01_0015_E06.b :
THY01_0023_D06.b : tttttgttggacxxxx
CLNT1_0013_B06.b : gg
SPL01_0103_A05.b : nnntggcttgtg
UTR01_0089_A02.b : nnnnggctagtg
OVR01_0029_H03.b : aggggxxxxxxxxxxxxxxx
THY01_0205_E02.b : cttttacgtggcxxxxx
OVR01_0008_A07.b : aggggccctaatxxxxxxxxxxxxxxxx
OVR01_0005_G08.b : tggggggccctattxxxxxxxxxxxxxxxx
TCH01_0074_F02.b : nnnngggtagga
SPL01_0048_D12.b : nntttagctaggac
OVR01_0098_B12.b : nnnnggctagta
SPL01_0045_D03.b : nnnnggctagtg
CLNT1_0089_F07.b : nnggggctttnnnngc
PTG01_0052_G11.b :
SMG01_0060_H02.b :
THY01_0065_B01.b : ccatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0015_E02.b : a
PCT01_0006_C08.b :
MLN01_0042_D07.b : nnnntcttgg
UTR01_0064_H05.b : ggccaxxxxxxxxxxxxxx
THY01_0061_D11.b : ctxxxxxxxxxxxxxxx
OVRT1_0057_E12.b : nnngggcttnnnnntnn
THY01_0090_F03.b : cxxxxxxxxxxxxxxxx
PBL01_0064_E04.b :
ITT01_0021_A07.b :
LNG01_0027_H02.b : ccxxxxxxxxxxxxxxx
PBL01_0028_H06.b :
ITT01_0002_G06.b :
PBL01_0078_D04.b :
ITT01_0067_B10.b :
PBL01_0028_B04.b :
OVR01_0011_G06.b : agaaaattgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0093_D09.b : gga
PBL01_0052_B07.b :
PBL01_0068_H04.b :
BFLT1_0098_H04.b : ggat
ITT01_0003_C06.b :
ITT01_0010_E04.b :
ITT01_0006_B01.b :
ADR01_0047_C08.b :
ADR01_0060_E05.b :
ADR01_0056_B05.b :
SPL01_0065_G08.b : nnnaagctagga
CLNT1_0012_G11.b : ggaat
SMG01_0064_E06.b :
LNG01_0109_G07.b : nnnttagttg
CLNT1_0072_C07.b : nggg
TCH01_0079_D07.b : nnnnggc
LNG01_0076_F03.b : nnnngggct
CLNT1_0037_C10.b : nntt
LNG01_0092_F11.b : nnnt
ADR01_0076_A06.b :
CLNT1_0007_G12.b : nnggctttnnnggga
LNG01_0068_D01.b : nnnntttgctg
MLN01_0049_G02.b : nnntggctagtg
ITT01_0056_C09.b :
ITT01_0053_H02.b :
TES01_0064_D12.b :
TES01_0033_G01.b :
TES01_0070_A09.b :
THY01_0044_C09.b : ctxxxxxxxxxxxx
SMG01_0036_E10.b :
OVR01_0036_A03.b : ggggatttggggac
OVRT1_0079_C01.b : ngggt
SMG01_0026_F07.b :
SKNB1_0041_C01.b :
CLNT1_0026_G06.b : ngg
CLNT1_0004_D03.b : ng
OVR01_0069_C07.b : attgtgxx
OVRM1_0118_B06.b :
TES01_0100_A06.b :
UTR01_0070_B09.b : cxxxxxxxxx
UTR01_0022_B06.b : ggggaaxx
THY01_0057_G12.b : cxxxxxxxxxxxxxx
OVRT1_0100_H08.b :
OVR01_0031_G07.b : aggagcxxxxxxxxxx
SPL01_0101_F06.b : nnttg
OVRT1_0002_C08.b :
OVR01_0026_D03.b : gagacatctgggtgx
TES01_0052_G09.b :
LNG01_0021_C01.b : ccggcggctgctacccgccagcat
ADR01_0059_B03.b :
TCH01_0048_H01.b : tggggg
PCT01_0018_B11.b :
ILNT1_0076_B07.b :
HTMT1_0118_H03.b :
PCT01_0027_H12.b :
HTMT1_0013_D11.b :
CLNT1_0028_E11.b :
THY01_0066_C08.b : tgxxxxxxxxx
PCT01_0011_A10.b :
OVR01_0025_B01.b : gtgggcxxxxxxxxxxxxx
CLNT1_0027_B12.b :
LNG01_0096_D03.b : nnnnngg
PBL01_0102_B06.b :
SPL01_0104_F07.b : nnnnggctagga
OVR01_0074_D08.b : agcxxxxxxx
SPL01_0023_B07.b : xxxxxxxxxx
SMG01_0056_B08.b :
CLNT1_0083_C04.b : nnnnnnnnnnn
TES01_0023_A10.b :
UTR01_0058_G05.b : ggcattatxxxx
TCH01_0018_C11.b : ttcatttn
ADR01_0017_C01.b :
OVRM1_0157_A10.b :
OVRM1_0184_G01.b :
TES01_0060_F05.b :
OVRM1_0010_D09.b :
OVR01_0049_G12.b : nttttttgct
ADR01_0011_D07.b :
THY01_0050_G02.b : gcatctacgtgaxx
ADR01_0022_A05.b :
OVRM1_0025_D12.b :
ADR01_0008_C01.b :
LNG01_0010_E05.b : cttttggtgga
THY01_0049_B09.b : cttttggxxxxxx
CLNT1_0129_A12.b :
OVR01_0030_F07.b : aagggttttatggtgx
UTR01_0032_B08.b : cttttgctgac
OVR01_0058_F01.b : nnnnnggatg
OVR01_0042_D07.b : gxxxxxxxxxxxxxxx
UTR01_0055_E12.b : gccttttgggtgxx
TES01_0042_H11.b :
OVRT1_0124_A07.b :
ITT01_0095_A09.b :
LNG01_0093_H12.b : nggttc
CLNT1_0019_D12.b :
OVR01_0019_A12.b : ttttgggtggac
ADR01_0005_E04.b :
ITT01_0048_E08.b :
ADR01_0073_F06.b :
THY01_0002_H02.b :
SKNB1_0040_B02.b :
PCT01_0003_H04.b :
PST01_0015_A04.b :
TES01_0109_F11.b :
TES01_0052_E05.b :
TES01_0026_F03.b :
TES01_0007_G01.b :
PTG01_0109_F08.b : nnnnnnnn
TES01_0096_D07.b :
TES01_0072_B12.b :
TES01_0111_C02.b :
TES01_0083_B11.b :
TES01_0069_B03.b :
TES01_0051_C01.b :
CLNT1_0078_H02.b : nnnggcc
OVR01_0004_D04.b : gggacct
LVRM1_0135_B01.b :
20110601C-000998 : .......................................ATATATCGCACGCCTAGACCA
---------+---------+---------+---------+---------+---------+ 21
OVRM1_0049_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATATATCGCACGTCTAGACCA
OVRM1_0106_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtATATCGCACGCCTAGACCA
TES01_0029_G10.b : cgctgtG
OVR01_0041_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccccgttcaact
LNG01_0031_D09.b : gnnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0016_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0024_H09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0083_C02.b : ngggattnnnnnnggagtaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0060_H07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0169_G02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0006_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0074_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0060_F10.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0101_E05.b : gactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0055_E11.b : cttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0067_H08.b : nttctgcag
MLN01_0060_G09.b : gtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0021_A10.b : aaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0056_A01.b : nncgacggtacgacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0015_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0051_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0033_A02.b : ngggtgatannnnnaggtcaagcagcggnaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0092_E09.b : atgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0040_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0023_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0069_F12.b : ttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0046_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
TCH01_0060_F12.b : ttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0021_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0071_A12.b : tagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0024_F10.b : tgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0122_F01.b : cagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0122_H10.b : ttcgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0077_G09.b : ataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0038_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0097_G11.b : ttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0077_H08.b : nnnnaatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0061_H08.b : nnnttgtgaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0008_A03.b : nnnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0080_G01.b : tttttagagagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0001_C05.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0014_D05.b : ttttggacagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0095_E01.b : tttttggacggtacacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0045_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgt
TCH01_0040_G05.b : tatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0044_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0031_F12.b : ntatagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0117_G11.b : cccttagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0050_B12.b : nnnngggcggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0049_D01.b : nnntcgcgagtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0070_E04.b : ggtttattnnnnnggagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0013_B11.b : tttttcgacggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0031_A06.b : nnnnccgaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0063_B04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0014_E12.b : ttttacgacggaagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0134_C06.b : acgttcgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0041_D05.b : nnnggacggtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0037_A12.b : agtattntnntatggcagtacnacgcagtcgtaxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0057_C09.b : ggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0082_H04.b : gacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0027_G10.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0105_B08.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0039_G05.b : ggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0062_D05.b : catggacatgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0081_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0102_G02.b : ntcg
OVR01_0081_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0076_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0181_H08.b : tagttgtcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_H02.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0193_C07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0196_H08.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0067_A02.b : ttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_C06.b : tcagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0074_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0194_D09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0070_E03.b : tttttcctgctg
OVRM1_0219_B01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0099_F04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0002_F03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0003_H07.b : nnnttggtgtnnnttaagagagagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0213_B03.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0090_E03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0101_H10.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0210_G08.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0033_B10.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0083_E06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0102_B01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0202_G02.b : tcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0077_F05.b : cttacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0187_H10.b : gcagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0005_G12.b : nggggttnnntaggatacagagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0040_D11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0103_F12.b : acttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0099_A12.b : gacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0101_G08.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0119_A08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0054_H10.b : ttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0089_F10.b : acttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0079_E08.b : attagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0028_H06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0023_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0010_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0096_H05.b : cttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0057_H03.b : cttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0056_D11.b : ataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0029_H10.b : catxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0090_F10.b : tatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0051_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0020_B02.b : aaaggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0013_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0029_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0049_B02.b : tattttggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0120_F12.b : ccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0024_A11.b : caxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0005_G12.b : ntatcatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0043_F04.b : nggtgtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0085_C09.b : ttttngggcgtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0040_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0010_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0024_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0052_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0048_C07.b : ngggttactnntnnggctaaagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0138_D06.b : nnnnccgtttgcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0049_H05.b : tttttttgagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0038_B11.b : tttttgcgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0115_H11.b : nccgtttgctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0133_H10.b : tcctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0071_H04.b : nnnnggagagtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0061_F05.b : nnncgcgagtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0105_H05.b : nnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0138_E10.b : nnccgtagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0108_F07.b : nccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0023_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0110_H11.b : cccgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0008_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0099_G12.b : ctatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0094_E05.b : tttttactcacg
SPL01_0058_D06.b : atnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0081_C08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxx
UTR01_0029_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0139_C09.b : nccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0020_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0001_F05.b : gccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0014_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0142_D04.b : ccgttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0003_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0087_G09.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0117_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttgatgttgatgcattccaccagtgttac
CLNT1_0108_G02.b : ccgtacagcgtaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0107_C04.b : nccgtcagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0082_C01.b : tacgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0045_C12.b : nggggcttnnnatttgctaaagcagcggtccgxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0103_E03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxx
UTR01_0040_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0090_G05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxx
SMG01_0092_H11.b : nnngggtttnnntttagagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0093_C08.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0047_D10.b : cgcttaaannnnggcgtaagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0079_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctg
OVR01_0021_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0039_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0020_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0015_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0098_D10.b : ctttacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0018_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0108_G05.b : nccgtctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_E05.b : tagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0114_D09.b : nccgttcgcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0003_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0030_G03.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0109_F07.b : nnnacttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0076_E02.b : nggcgtttnanntntgagtaaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0053_F03.b : gacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0023_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0104_A07.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0013_A01.b : atttttgagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0062_B07.b : tttttatacgtt
UTR01_0102_F01.b : acttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0103_H04.b : ctattacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0032_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0145_C03.b : nccgtcagctgtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0044_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0044_F12.b : nccgcttaaanntnagatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0126_F08.b : nccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0084_H11.b : nncgttttnnnnttagagtaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0054_E03.b : ctatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0005_E02.b : agtatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0061_D01.b : tatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0095_B08.b : gacttagacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0053_H03.b : nnnnaatgannnnagagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0004_H04.b : nnnggggattnnnnngggagtaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0204_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0103_B05.b : cttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0143_H07.b : ccgttcagcgtacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0060_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0038_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0030_A10.b : tatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0023_A10.b : nggcaaaannnnnggactaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0083_A09.b : gctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0028_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0042_F12.b : nggcgtttnnnnttgactaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0031_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0090_E01.b : cgcatctnttttagagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0044_A08.b : nnaatgaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0023_D02.b : nnccggctctnnnnnnggctaaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0006_E08.b : nccaaggnnnnnccccacg
CLNT1_0013_G11.b : tccgttagcgttcgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0095_E09.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0116_F08.b : ncctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0034_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0052_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0052_D11.b : atgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0005_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0014_C04.b : nggagtaatannnnggagtaagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0064_F03.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0092_F09.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0204_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0020_C11.b : tagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0026_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0041_G01.b : gtagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0033_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0152_B07.b : nnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0055_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0120_H03.b : tacgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0015_E06.b : nggactacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0023_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0013_B06.b : gtccgtctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0103_A05.b : acttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0089_A02.b : acttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0029_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0205_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0008_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0005_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0074_F02.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0048_D12.b : ttanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0098_B12.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0045_D03.b : acttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0089_F07.b : ttccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0052_G11.b : nggggttaannnntgcgtaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0060_H02.b : nnggggtttaannnnggagtaaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0065_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0015_E02.b : ttccgtcagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0006_C08.b : nnnnttgattaaannnnncctgcg
MLN01_0042_D07.b : actatgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0064_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0061_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0057_E12.b : nccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0090_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0064_E04.b : natgaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0021_A07.b : nnnggtgaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0027_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0028_H06.b : nnaaagtgcaagaggcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0002_G06.b : nnnaagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0078_D04.b : nnngatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0067_B10.b : nnnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0028_B04.b : nnnggagcaagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0011_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0093_D09.b : tccgtttgctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0052_B07.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0068_H04.b : nnnnggagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0098_H04.b : ccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0003_C06.b : nnnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0010_E04.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0006_B01.b : nnnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0047_C08.b : nnnnaagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0060_E05.b : nnnnnnaatgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0056_B05.b : gaaaannggatgaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0065_G08.b : ctatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0012_G11.b : ccgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0064_E06.b : nnnnccgctannnnnnngggtaaagcagcggnxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0109_G07.b : gacatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0072_C07.b : cccgtcagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0079_D07.b : taggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0076_F03.b : ggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0037_C10.b : tacgttagctgtcgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0092_F11.b : ttgctggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0076_A06.b : nnnaaagagatgaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0007_G12.b : tccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0068_D01.b : gacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0049_G02.b : acttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0056_C09.b : nnnggcattnnnnnngggtaacagctggaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0053_H02.b : nnnggatgaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0064_D12.b : tttttcctact
TES01_0033_G01.b : cgc
TES01_0070_A09.b : tttttcctgct
THY01_0044_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0036_E10.b : ncggtgaaaannnggataaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0036_A03.b : nxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0079_C01.b : ccaatcttctgcatgagtgtgcgacagctcaaaagcgtgaggxxxxxxxxxxxxxxxxxx
SMG01_0026_F07.b : nnnggccttatnnnnnggacgtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0041_C01.b : nnnnncccact
CLNT1_0026_G06.b : gccgtttgctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0004_D03.b : gacacgttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0069_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0118_B06.b : taatttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0100_A06.b : ttttcctacg
UTR01_0070_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0022_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0057_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0100_H08.b : nttttccgtcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0031_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0101_F06.b : gcttgtgacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0002_C08.b : nncccccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0026_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0052_G09.b : nggttccctgc
LNG01_0021_C01.b : aggacntatagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0059_B03.b : nnnnnngctgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0048_H01.b : gctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0018_B11.b : nnngggaataaannnnnngctgcgt
ILNT1_0076_B07.b : nnnnggacggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0118_H03.b : ttttggatggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0027_H12.b : nnnggcggcttaatnnnnncctgcgg
HTMT1_0013_D11.b : ttttccgagagtagacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0028_E11.b : tcagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0066_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0011_A10.b : ngcgaannnnnnnncctgaggg
OVR01_0025_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0027_B12.b : ttagttcagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0096_D03.b : ctggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0102_B06.b : nnnngggtgacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0104_F07.b : ctatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0074_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0023_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0056_B08.b : nccgtttnnnnngggagtaagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0083_C04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0023_A10.b : ttcct
UTR01_0058_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0018_C11.b : nactggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0017_C01.b : tgtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0157_A10.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0184_G01.b : gaattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0060_F05.b : ntcg
OVRM1_0010_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0049_G12.b : tggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0011_D07.b : nnaaatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0050_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0022_A05.b : taaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0025_D12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0008_C01.b : nnnaatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0010_E05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0049_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0129_A12.b : nnnnnccgtcagcgtacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0030_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0032_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0058_F01.b : ggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0042_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0055_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0042_H11.b : tttttactgctgttg
OVRT1_0124_A07.b : nnnnccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0095_A09.b : nnggtgatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0093_H12.b : gatggtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0019_D12.b : atacgttcagcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0019_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0005_E04.b : nnnnncctgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0048_E08.b : nnnnggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0073_F06.b : nnnccctaaaannnggacaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0002_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0040_B02.b : nnnncct
PCT01_0003_H04.b : ngggatgcttnnnncctac
PST01_0015_A04.b : nnccgcatnnnnnnncctgc
TES01_0109_F11.b : tc
TES01_0052_E05.b : nnnnncc
TES01_0026_F03.b : ttcc
TES01_0007_G01.b : ntt
PTG01_0109_F08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0096_D07.b : tttactac
TES01_0072_B12.b : ttttcctg
TES01_0111_C02.b : nttggctac
TES01_0083_B11.b : ttttacta
TES01_0069_B03.b : tttttcctg
TES01_0051_C01.b : ntttcct
CLNT1_0078_H02.b : ttcnnngcacacgtctgcgacgagtgtcttcgctctxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0004_D04.b : ttggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0135_B01.b : nagttgtcxxxxxxxxxxxxx
---------+---------+---------+---------+---------+---------+ 76
CLNT1_0078_H02.b : xxxxxxxxctcctccactagggnagnttnntanngngggatgtntnanaggaccctcaaa
OVR01_0004_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctctatcgacagcttccgacc
LVRM1_0135_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctctatcggcagcttccgacc
---------+---------+---------+---------+---------+---------+ 135
---------+---------+---------+---------+---------+---------+ 194
---------+---------+---------+---------+---------+---------+ 254
---------+---------+---------+---------+---------+---------+ 314
---------+---------+---------+---------+---------+---------+ 374
---------+---------+---------+---------+---------+---------+ 434
---------+---------+---------+---------+---------+---------+ 494
---------+---------+---------+---------+---------+---------+ 552
---------+---------+---------+---------+---------+---------+ 609
ADR01_0017_C01.b : CCCAATGCcgccggcttcctcttccgccacaaaaaagccccacccctgggaaatccaggt
---------+---------+---------+---------+---------+---------+ 666
OVR01_0081_A07.b : Gtaacgaaaggacagtggatgaggaactggactgtgcccgggaaaggggtagggcaaaca
ADR01_0017_C01.b : gaaaatggaggcacagtggctgaaaaactgggattgggctcgggaaaaggctataacagc
---------+---------+---------+---------+---------+---------+ 722
OVR01_0081_A07.b : gtcccggtgaaccaggttgattggtgcagatgatatgattgcaggtcatgggccagaccc
ADR01_0017_C01.b : aggtccctatgaacaagtggatttgggcgcgataaaagaatggagtccattgggcgtgac
---------+---------+---------+---------+---------+---------+ 775
OVRM1_0169_G02.b : CC*A*GGGCAAGGG*CTAaaagggggccaccccgcttggggatccaaaaagatg
THY01_0006_F02.b : CC*CAGGGCAATGT*CTACAAA**GGGGTCcccacccttggcatcccagaagccgccccg
OVR01_0081_A07.b : atgggcctggcctacaaggggttc
TES01_0102_G02.b : CC*AAGGGCAAGGGGCTCCAAA**GGGGTCccccacccgtttggcataccaagaaacctg
OVR01_0081_C05.b :
OVR01_0076_G05.b : CC**AGGGCAAGGG
OVR01_0067_A02.b : CCCAAGGGCAAGGG*CTACAAAG*GGGGTCACCcagccgttgggcattaccaagaaactg