[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-001050

Length: 1,556

Sequence [FASTA format sequence]
CCGGGGGAGG GGGCCGGGTC GGGAGGACTT TCCAGCCACT CAGCGTGCAT TAAAAAGTTC
CCTGTACATG ACCCCAGTGG CTCATCGCAG GGAGTTTCTC TGATGAACCC GGGCGCGGGG
TTTAGGCTTC TTTTTCCCCC AGCAGAGGAC GAGGCCAGTT CTCTTTTCTG GTCTGACTGG
CTTGGAAATT CCCCGAGCTT GACCCCGCCC AGGAGAAATC CCCTGCCAGC GTTTATAGGG
CGCCGCGGCG GCGCTGCCGA CTGCACAACA GTCCGAGGCC ATCGTCCCGC CCGCCCGAGC
CACCGCGAGC AGCCAGCGCG CCGCGCAGCC TGTGGCCCGC GCACCTAGGG AGCAGCGCCC
AAGCCCTCAT CGCGCCATGT TCCAGCCCGC AGAGCCCGGC CAGGAGTGGG CCATGGAGGG
GCCCCGGGAC GCGCTCAAGA AGGAGCGGCT ACTGGACGAC CGCCACGACA GCGGCCTGGA
CTCCATGAAG GACGAGGAGT ACGAGCAGAT GGTGAAGGAG CTGCGCGAGA TCCGCCTCGA
GCCGCAGGAG GCGCCCCGCG GCGCCGAGCC CTGGAAGCAG CAGCTCACCG AGGACGGAGA
CTCGTTCCTG CACTTGGCCA TCATCCATGA AGAGAAGGCA CTGACCATGG AAGTGGTCCG
CCAAGTGAAG GGAGATCTGG CTTTTCTTAA CTTCCAGAAC AACCTGCAGC AGACTCCACT
CCACTTGGCG GTGATCACCA ACCAGCCAGA AATCGCTGAG GCACTTCTGG AAGCTGGCTG
TGATCCTGAG CTCCGAGACT TTCGAGGAAA TACCCCTCTA CACCTTGCCT GTGAGCAGGG
CTGCCTGGCC AGTGTGGGAG TCCTGACTCA GCCCCGCGGG ACCCAGCACC TCCACTCCAT
TCTGCAGGCC ACCAACTACA ATGGCCACAC ATGTCTGCAC TTAGCCTCGA TCCATGGCTA
CCTGGGCATT GTGGAGCTGT TGGTGTCTTT GGGTGCTGAT GTCAACGCTC AGGAGCCCTG
CAATGGCCGA ACCGCCCTGC ATCTTGCGGT GGACCTGCAG AATCCCGACC TGGTGTCGCT
CTTGTTGAAG TGTGGGGCTG ATGTCAACAG AGTCACCTAC CAGGGCTACT CCCCGTACCA
GCTCACCTGG GGCCGCCCAA GCACTCGGAT ACAGCAGCAG CTGGGCCAGC TGACCCTAGA
AAACCTCCAG ATGCTTCCAG AGAGCGAGGA TGAGGAGAGC TATGACACGG AGTCAGAGTT
CACAGAGGAT GAGCTGCCCT ATGACGACTG CGTGCTTGGA GGCCAGCGCC TGACGTTATG
AGCTTTGGAA AGTGTCTAAA AGACCATGGA CTTGTACATT TGTACAAAAT CAAGAGTTTT
ATTTTTCTAA AAAAAAAAAA AAAAAGAAAA AAAAAGAAAA AAGGGTATAC TTATAACCAC
ACCGCACACT GCCTGGCCTG AAACATTTTG CTCTGGTGGA TAGCCCCGAT TTTGTATTCT
TGTGAACTTT GGAAAGCGCC AGGAGGATCA TCGGAATGCA AAGAGAACCT CTTTTA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinNFKBIANF-kappa-B inhibitor alpha [Homo sapiens]. 560e-159O
Contig/Assembly ProteinNFKB1nuclear factor NF-kappa-B p105 subunit isoform 2 [Homo sapiens]. 1399e-33
Contig/Assembly ProteinNFKB1nuclear factor NF-kappa-B p105 subunit isoform 1 [Homo sapiens]. 1399e-33
Contig/Assembly ProteinNFKBIENF-kappa-B inhibitor epsilon [Homo sapiens]. 1342e-31
Contig/Assembly ProteinNFKB2nuclear factor NF-kappa-B p100 subunit isoform b [Homo sapiens]. 1134e-25
Contig/Assembly ProteinNFKB2nuclear factor NF-kappa-B p100 subunit isoform a [Homo sapiens]. 1134e-25
Contig/Assembly ProteinNFKB2nuclear factor NF-kappa-B p100 subunit isoform b [Homo sapiens]. 1134e-25
Contig/Assembly ProteinBCL3B-cell lymphoma 3 protein [Homo sapiens]. 1103e-24O
Contig/Assembly ProteinMIB1E3 ubiquitin-protein ligase MIB1 [Homo sapiens]. 921e-18
Contig/Assembly ProteinNFKBIZNF-kappa-B inhibitor zeta isoform b [Homo sapiens]. 87.43e-17


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinNfkbiaNF-kappa-B inhibitor alpha [Mus musculus]. 551e-157O
Contig/Assembly ProteinNfkbieNF-kappa-B inhibitor epsilon [Mus musculus]. 1373e-32O
Contig/Assembly ProteinNfkb1nuclear factor NF-kappa-B p105 subunit [Mus musculus]. 1359e-32
Contig/Assembly ProteinNfkb2nuclear factor NF-kappa-B p100 subunit isoform a [Mus musculus]. 1142e-25
Contig/Assembly ProteinNfkb2nuclear factor NF-kappa-B p100 subunit isoform b [Mus musculus]. 1142e-25
Contig/Assembly ProteinNfkb2nuclear factor NF-kappa-B p100 subunit isoform a [Mus musculus]. 1142e-25
Contig/Assembly ProteinBcl3B-cell lymphoma 3 protein homolog [Mus musculus]. 1135e-25O
Contig/Assembly ProteinMib1E3 ubiquitin-protein ligase MIB1 [Mus musculus]. 921e-18
Contig/Assembly ProteinNfkbizNF-kappa-B inhibitor zeta isoform b [Mus musculus]. 874e-17
Contig/Assembly ProteinNfkbizNF-kappa-B inhibitor zeta isoform a [Mus musculus]. 874e-17


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC480291PREDICTED: similar to nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha [Canis familiaris]. 5760.0
Contig/Assembly ProteinNFKB1nuclear factor NF-kappa-B p105 subunit [Canis lupus familiaris]. 1303e-30
Contig/Assembly ProteinLOC486858PREDICTED: similar to Nuclear factor NF-kappa-B p100/p49 subunits (DNA-binding factor KBF2) (H2TF1) (Lymphocyte translocation chromosome 10) (Oncogene Lyt-10) (Lyt10) isoform 1 [Canis familiaris]. 1112e-24
Contig/Assembly ProteinLOC486858PREDICTED: similar to Nuclear factor NF-kappa-B p100/p49 subunits (DNA-binding factor KBF2) (H2TF1) (Lymphocyte translocation chromosome 10) (Oncogene Lyt-10) (Lyt10) isoform 5 [Canis familiaris]. 1112e-24
Contig/Assembly ProteinLOC486858PREDICTED: similar to Nuclear factor NF-kappa-B p100/p49 subunits (DNA-binding factor KBF2) (H2TF1) (Lymphocyte translocation chromosome 10) (Oncogene Lyt-10) (Lyt10) isoform 4 [Canis familiaris]. 1112e-24
Contig/Assembly ProteinLOC486858PREDICTED: similar to Nuclear factor NF-kappa-B p100/p49 subunits (DNA-binding factor KBF2) (H2TF1) (Lymphocyte translocation chromosome 10) (Oncogene Lyt-10) (Lyt10) isoform 3 [Canis familiaris]. 1112e-24
Contig/Assembly ProteinLOC612349PREDICTED: similar to B-cell lymphoma 3-encoded protein (Bcl-3 protein) [Canis familiaris]. 94.43e-19O
Contig/Assembly ProteinLOC490521PREDICTED: similar to mindbomb homolog 1 [Canis familiaris]. 921e-18
Contig/Assembly ProteinLOC478549PREDICTED: similar to nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta isoform a [Canis familiaris]. 84.72e-16
Contig/Assembly ProteinLOC482842PREDICTED: similar to ankyrin 1 isoform 3 [Canis familiaris]. 84.72e-16


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinNFKBIANF-kappa-B inhibitor alpha [Bos taurus]. 595e-170O
Contig/Assembly ProteinNFKB1nuclear factor NF-kappa-B p105 subunit [Bos taurus]. 1358e-32
Contig/Assembly ProteinNFKBIENF-kappa-B inhibitor epsilon [Bos taurus]. 1342e-31O
Contig/Assembly ProteinNFKB2nuclear factor NF-kappa-B p100 subunit [Bos taurus]. 1135e-25
Contig/Assembly ProteinBCL3PREDICTED: B-cell CLL/lymphoma 3-like [Bos taurus]. 1104e-24O
Contig/Assembly ProteinBCL3B-cell CLL/lymphoma 3 [Bos taurus]. 1104e-24O
Contig/Assembly ProteinMIB1mindbomb homolog 1 [Bos taurus]. 921e-18
Contig/Assembly ProteinMIB1PREDICTED: mindbomb homolog 1 (Drosophila) [Bos taurus]. 921e-18
Contig/Assembly ProteinNFKBIZNF-kappa-B inhibitor zeta [Bos taurus]. 843e-16
Contig/Assembly ProteinRAI14PREDICTED: retinoic acid induced 14-like [Bos taurus]. 82.88e-16O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinNFKBIANF-kappa-B inhibitor alpha [Sus scrofa]. 598e-171O
Contig/Assembly ProteinNFKB1nuclear factor NF-kappa-B p105 subunit [Sus scrofa]. 1364e-32
Contig/Assembly ProteinLOC100621111PREDICTED: NF-kappa-B inhibitor beta-like [Sus scrofa]. 1088e-24O
Contig/Assembly ProteinMIB1PREDICTED: e3 ubiquitin-protein ligase MIB1 [Sus scrofa]. 928e-19
Contig/Assembly ProteinLOC100157679PREDICTED: ankyrin-1-like, partial [Sus scrofa]. 828e-16
Contig/Assembly ProteinANKRD35PREDICTED: ankyrin repeat domain-containing protein 35 [Sus scrofa]. 80.52e-15O
Contig/Assembly ProteinLOC100525018PREDICTED: LOW QUALITY PROTEIN: ankyrin repeat domain-containing protein 6-like [Sus scrofa]. 78.69e-15O
Contig/Assembly ProteinANK3PREDICTED: ankyrin-3 [Sus scrofa]. 78.21e-14
Contig/Assembly ProteinANK2PREDICTED: LOW QUALITY PROTEIN: ankyrin-2, partial [Sus scrofa]. 78.21e-14O
Contig/Assembly ProteinRAI14ankycorbin [Sus scrofa]. 77.42e-14O


Assembly Members: 336      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010033F05ADR01_0033_F05.bDB784442 
ADR010036D03ADR01_0036_D03.bDB784679 
ADR010051B11ADR01_0051_B11.bDB786016 
ADR010052D04ADR01_0052_D04.bDB786123 
ADR010062B08ADR01_0062_B08.bDB787005 
ADR010067F04ADR01_0067_F04.bDB787475 
ADR010076C06ADR01_0076_C06.bDB788234 
BFLT10092E03BFLT1_0092_E03.bFS647305 
CLNT10004C01CLNT1_0004_C01.bFS657336 
CLNT10004D11CLNT1_0004_D11.bFS657357 
CLNT10015B10CLNT1_0015_B10.bFS658239 
CLNT10023H04CLNT1_0023_H04.bFS658897 
CLNT10040G10CLNT1_0040_G10.bFS660229 
CLNT10041G01CLNT1_0041_G01.bFS660302 
CLNT10049C08CLNT1_0049_C08.bFS660920 
CLNT10050C08CLNT1_0050_C08.bFS661003 
CLNT10050F02CLNT1_0050_F02.bFS661028 
CLNT10065E04CLNT1_0065_E04.bFS662178 
CLNT10088D10CLNT1_0088_D10.bFS663406 
CLNT10128F12CLNT1_0128_F12.bHX221322 
CLNT10129C08CLNT1_0129_C08.bHX221367 
CLNT10144A06CLNT1_0144_A06.bHX222501 
CLNT10149A10CLNT1_0149_A10.bHX222906 
HTMT10095A01HTMT1_0095_A01.bFS670899 
ILNT10088E10ILNT1_0088_E10.bHX233802 
ITT010001E08ITT01_0001_E08.bBW976088 
ITT010009D10ITT01_0009_D10.bBW976810 
ITT010013F04ITT01_0013_F04.bBW977195 
ITT010020D05ITT01_0020_D05.bBW977797 
ITT010033A08ITT01_0033_A08.bBW978936 
ITT010033H09ITT01_0033_H09.bBW979015 
ITT010042D04ITT01_0042_D04.bBW979778 
ITT010043C06ITT01_0043_C06.bBW979858 
ITT010063H06ITT01_0063_H06.bBW981644 
ITT010074B02ITT01_0074_B02.bBW982561 
ITT010076D05ITT01_0076_D05.bBW982760 
ITT010077G12ITT01_0077_G12.bBW982878 
ITT010078E02ITT01_0078_E02.bBW982935 
ITT010088C04ITT01_0088_C04.bBW983799 
ITT010095E07ITT01_0095_E07.bBW984452 
ITT010098A12ITT01_0098_A12.bBW984683 
KDN010024C07KDN01_0024_C07.bFS672995 
KDN010061H06KDN01_0061_H06.bFS675327 
KDN010086A08KDN01_0086_A08.bFS677230 
LNG010002G07LNG01_0002_G07.bBP439451 
LNG010002H12LNG01_0002_H12.bBP440855 
LNG010004A12LNG01_0004_A12.bBP433901 
LNG010004D12LNG01_0004_D12.bBP436835 
LNG010009G03LNG01_0009_G03.bBP439125 
LNG010010H10LNG01_0010_H10.bBP440693 
LNG010012C03LNG01_0012_C03.bBP435125 
LNG010025C04LNG01_0025_C04.bBP435212 
LNG010025E05LNG01_0025_E05.bBP437278 
LNG010030F07LNG01_0030_F07.bBP438479 
LNG010033A10LNG01_0033_A10.bBP433770 
LNG010033D11LNG01_0033_D11.bBP436776 
LNG010043C04LNG01_0043_C04.bBP435223 
LNG010045H12LNG01_0045_H12.bBP440889 
LNG010069C05LNG01_0069_C05.bBP435319 
LNG010069E10LNG01_0069_E10.bBP437734 
LNG010071B05LNG01_0071_B05.bBP434352 
LNG010082E08LNG01_0082_E08.bBP437569 
LNG010087G10LNG01_0087_G10.bBP439753 
LNG010090A04LNG01_0090_A04.bBP433310 
LNG010091G06LNG01_0091_G06.bBP439431 
LNG010098D08LNG01_0098_D08.bBP436577 
LNG010101A12LNG01_0101_A12.bBP433969 
LNG010107A01LNG01_0107_A01.bBP433098 
LNG010108D12LNG01_0108_D12.bBP436911 
LNG010109F07LNG01_0109_F07.bBP438535 
LNG010110D07LNG01_0110_D07.bBP436515 
LVR010011G02LVR01_0011_G02.bBP446391 
LVR010012A08LVR01_0012_A08.bBP441493 
LVR010017B08LVR01_0017_B08.bBP442412 
LVR010018H10LVR01_0018_H10.bBP447923 
LVR010028A05LVR01_0028_A05.bBP441273 
LVR010030A04LVR01_0030_A04.bBP441197 
LVR010045F12LVR01_0045_F12.bBP446268 
LVR010047D06LVR01_0047_D06.bBP444084 
LVR010048B01LVR01_0048_B01.bBP441896 
LVR010048F04LVR01_0048_F04.bBP445687 
LVR010049G11LVR01_0049_G11.bBP447093 
LVR010050G07LVR01_0050_G07.bBP446798 
LVR010051G07LVR01_0051_G07.bBP446799 
LVR010053D05LVR01_0053_D05.bBP444017 
LVR010059D05LVR01_0059_D05.bBP444023 
LVR010061C03LVR01_0061_C03.bBP442983 
LVR010062H02LVR01_0062_H02.bBP447339 
LVR010077H10LVR01_0077_H10.bBP447972 
LVR010089A07LVR01_0089_A07.bCJ000514 
LVR010104C04LVR01_0104_C04.bBP443086 
LVR010105A02LVR01_0105_A02.bBP441092 
LVR010106A02LVR01_0106_A02.bBP441093 
LVRM10001H10LVRM1_0001_H10.bBP141114 
LVRM10018C08LVRM1_0018_C08.bBP450190 
LVRM10048G03LVRM1_0048_G03.bCJ002395 
LVRM10049B02LVRM1_0049_B02.bBP449001 
LVRM10062B12LVRM1_0062_B12.bBP138424 
LVRM10067A10LVRM1_0067_A10.bBP137859 
LVRM10077G10LVRM1_0077_G10.bBP140656 
LVRM10078H03LVRM1_0078_H03.bBP140861 
LVRM10079A04LVRM1_0079_A04.bBP137633 
LVRM10080B01LVRM1_0080_B01.bBP137984 
LVRM10087F09LVRM1_0087_F09.bCJ002985 
LVRM10089F02LVRM1_0089_F02.bCJ003147 
LVRM10091H02LVRM1_0091_H02.bCJ003331 
LVRM10101H02LVRM1_0101_H02.bBP140823 
LVRM10107C07LVRM1_0107_C07.bBP450132 
LVRM10113A05LVRM1_0113_A05.bBP448411 
LVRM10165H11LVRM1_0165_H11.bCJ004309 
LVRM10172C07LVRM1_0172_C07.bCJ004800 
LVRM10192D12LVRM1_0192_D12.bCJ006365 
LVRM10195E09LVRM1_0195_E09.bCJ006606 
LVRM10202F10LVRM1_0202_F10.bCJ007204 
LVRM10203F10LVRM1_0203_F10.bCJ007285 
MLN010007D01MLN01_0007_D01.bCJ008217 AK233732
MLN010010A01MLN01_0010_A01.bCJ008438 
MLN010018A07MLN01_0018_A07.bBW963406 
MLN010018A08MLN01_0018_A08.bBW963407 
MLN010020D03MLN01_0020_D03.bCJ009143 
MLN010025A11MLN01_0025_A11.bCJ009543 
MLN010030H11MLN01_0030_H11.bCJ010016 
MLN010033G08MLN01_0033_G08.bCJ010244 
MLN010044C12MLN01_0044_C12.bCJ011113 
MLN010045B10MLN01_0045_B10.bCJ011176 
MLN010055F09MLN01_0055_F09.bCJ011985 
MLN010056D12MLN01_0056_D12.bCJ012051 
MLN010059D12MLN01_0059_D12.bCJ012290 
MLN010060B05MLN01_0060_B05.bCJ012351 
MLN010062F06MLN01_0062_F06.bCJ012533 
MLN010064D10MLN01_0064_D10.bCJ012686 
MLN010076B10MLN01_0076_B10.bCJ013653 
MLN010077F06MLN01_0077_F06.bCJ013764 
MLN010078D08MLN01_0078_D08.bCJ013833 
MLN010078F10MLN01_0078_F10.bCJ013855 
MLN010080H03MLN01_0080_H03.bCJ014046 
MLN010102C11MLN01_0102_C11.bCJ015880 
MLN010104E06MLN01_0104_E06.bCJ016077 
OVR010006H10OVR01_0006_H10.bBP144738 
OVR010008A08OVR01_0008_A08.bBP141510 
OVR010009D05OVR01_0009_D05.bBP142746 
OVR010010G11OVR01_0010_G11.bBP144325 
OVR010015A08OVR01_0015_A08.b  
OVR010021F05OVR01_0021_F05.bBP143645 
OVR010033D12OVR01_0033_D12.bBP143018 
OVR010035B09OVR01_0035_B09.bBP142004 
OVR010043A07OVR01_0043_A07.bBP141499 
OVR010050D11OVR01_0050_D11.bBW964066 
OVR010051H10OVR01_0051_H10.bBW964206 
OVR010052B11OVR01_0052_B11.bBW964229 
OVR010053H04OVR01_0053_H04.bBW964381 
OVR010054B12OVR01_0054_B12.bBW964412 
OVR010054H06OVR01_0054_H06.bBW964471 
OVR010059A04OVR01_0059_A04.bBW964837 
OVR010065G01OVR01_0065_G01.bBW965434 
OVR010067F02OVR01_0067_F02.bBW965600 
OVR010076D08OVR01_0076_D08.bBW966381 
OVR010082H12OVR01_0082_H12.bBW966846 
OVR010083G11OVR01_0083_G11.bBW966884 
OVR010086A05OVR01_0086_A05.bBW967048 
OVR010090E09OVR01_0090_E09.bBW967389 
OVR010091D12OVR01_0091_D12.bBW967463 
OVR010093C12OVR01_0093_C12.bBW967604 
OVR010093G11OVR01_0093_G11.bBW967643 
OVR010095F04OVR01_0095_F04.bBW967774 
OVR010099B03OVR01_0099_B03.bBW968044 
OVR010104C10OVR01_0104_C10.bBW968484 
OVR010104E06OVR01_0104_E06.bBW968502 
OVRM10017A09OVRM1_0017_A09.bBP145693 
OVRM10021A12OVRM1_0021_A12.bBP146037 
OVRM10031B05OVRM1_0031_B05.bBP146568 
OVRM10037C05OVRM1_0037_C05.bBP456847 
OVRM10037F10OVRM1_0037_F10.bBP460160 
OVRM10043C03OVRM1_0043_C03.bBP456694 
OVRM10056F10OVRM1_0056_F10.bBP152101 
OVRM10067D06OVRM1_0067_D06.bBP149208 
OVRM10069G11OVRM1_0069_G11.bBP153488 
OVRM10084C03OVRM1_0084_C03.bBP147638 
OVRM10100E11OVRM1_0100_E11.bBP151001 
OVRM10110B12OVRM1_0110_B12.bBP147382 
OVRM10165B03OVRM1_0165_B03.bBP455740 
OVRM10191B03OVRM1_0191_B03.bBP455760 
OVRT10001F08OVRT1_0001_F08.bFS686473 
OVRT10004F10OVRT1_0004_F10.bFS686728 
OVRT10008A02OVRT1_0008_A02.bFS687009 
OVRT10010E11OVRT1_0010_E11.bFS687216 
OVRT10022D07OVRT1_0022_D07.bFS688193 
OVRT10030A10OVRT1_0030_A10.bFS688805 AK395569
OVRT10039H08OVRT1_0039_H08.bFS689626 
OVRT10045C09OVRT1_0045_C09.bFS690066 
OVRT10055A02OVRT1_0055_A02.bFS690858 
OVRT10060A11OVRT1_0060_A11.bFS691279 
OVRT10070H03OVRT1_0070_H03.b  
OVRT10072F09OVRT1_0072_F09.bFS692292 
OVRT10080H12OVRT1_0080_H12.bFS692970 
OVRT10090F08OVRT1_0090_F08.bFS693758 
OVRT10091G04OVRT1_0091_G04.bFS693845 
OVRT10093A05OVRT1_0093_A05.bFS693949 
OVRT10095A02OVRT1_0095_A02.bFS694115 
OVRT10095A05OVRT1_0095_A05.bFS694118 
OVRT10100D10OVRT1_0100_D10.bFS694571 
OVRT10100G09OVRT1_0100_G09.bFS694602 
OVRT10108H07OVRT1_0108_H07.bHX235479 
OVRT10112E04OVRT1_0112_E04.bHX235787 
OVRT10125D08OVRT1_0125_D08.bHX236814 
OVRT10129E03OVRT1_0129_E03.bHX237146 
OVRT10140C11OVRT1_0140_C11.bHX238016 
OVRT10146F04OVRT1_0146_F04.bHX238540 
OVRT10149E04OVRT1_0149_E04.bHX238784 
PBL010004F08PBL01_0004_F08.bBW968698 
PBL010005H04PBL01_0005_H04.bBW968787 
PBL010009H08PBL01_0009_H08.bBW969068 
PBL010038G01PBL01_0038_G01.bBP156210 
PBL010042D09PBL01_0042_D09.bBW970542 
PBL010063G05PBL01_0063_G05.bBW971874 
PBL010075E01PBL01_0075_E01.bBW972836 
PBL010087B11PBL01_0087_B11.bBW973881 
PCT010024H06PCT01_0024_H06.b  
PST010001A11PST01_0001_A11.bFS697079 
PST010033D01PST01_0033_D01.bFS699424 
PST010054B10PST01_0054_B10.bFS701085 
PST010067C11PST01_0067_C11.bFS702123 
PST010084H07PST01_0084_H07.bFS703525 
PTG010016E04PTG01_0016_E04.bFS705832 
PTG010024D08PTG01_0024_D08.bFS706513 
PTG010050H04PTG01_0050_H04.bFS708866 
PTG010064A02PTG01_0064_A02.bFS709950 
PTG010066D10PTG01_0066_D10.bFS710122 
PTG010077C06PTG01_0077_C06.bFS710921 
PTG010082C12PTG01_0082_C12.bFS711357 
PTG010083G09PTG01_0083_G09.b  
PTG010086H10PTG01_0086_H10.bFS711745 AK397107
PTG010097E07PTG01_0097_E07.bFS712316 
PTG010102C06PTG01_0102_C06.b  AK399188
SKNB10002E09SKNB1_0002_E09.bDB800174 
SKNB10033F04SKNB1_0033_F04.bDB801796 
SKNB10040A11SKNB1_0040_A11.bDB802188 
SKNB10040F06SKNB1_0040_F06.bDB802227 
SKNB10051H08SKNB1_0051_H08.bDB803008 
SKNB10059E09SKNB1_0059_E09.bDB803543 
SKNB10067G01SKNB1_0067_G01.bDB804074 
SKNB10082E09SKNB1_0082_E09.bDB804986 
SKNB10097A08SKNB1_0097_A08.bDB805809 
SMG010014D04SMG01_0014_D04.bFS714464 
SMG010015G04SMG01_0015_G04.bFS714584 
SMG010029D10SMG01_0029_D10.bFS715824 
SMG010033C08SMG01_0033_C08.bFS716160 
SMG010034A08SMG01_0034_A08.bFS716224 
SMG010037C04SMG01_0037_C04.bFS716506 
SMG010042F07SMG01_0042_F07.bFS716956 
SMG010044G03SMG01_0044_G03.bFS717137 
SMG010047F12SMG01_0047_F12.bFS717400 
SMG010054B08SMG01_0054_B08.bFS717934 
SMG010058E11SMG01_0058_E11.bFS718298 
SMG010066A01SMG01_0066_A01.bFS718929 
SMG010080E10SMG01_0080_E10.bFS720203 
SMG010081C07SMG01_0081_C07.bFS720261 
SMG010085F02SMG01_0085_F02.bFS720626 
SPL010009H04SPL01_0009_H04.bBP159130 
SPL010010B04SPL01_0010_B04.bBP157084 
SPL010034D02SPL01_0034_D02.bCJ016693 
SPL010036C03SPL01_0036_C03.bBP157405 
SPL010037H11SPL01_0037_H11.bBP159334 
SPL010038C12SPL01_0038_C12.bBP157658 
SPL010041A07SPL01_0041_A07.bBP156859 
SPL010051D06SPL01_0051_D06.bCJ017602 
SPL010064G02SPL01_0064_G02.bCJ018812 
SPL010070H08SPL01_0070_H08.bCJ019359 
SPL010079B04SPL01_0079_B04.bCJ020105 
SPL010084A10SPL01_0084_A10.bCJ020557 
SPL010086H03SPL01_0086_H03.bCJ020803 
SPL010097G06SPL01_0097_G06.bCJ021782 
SPL010103G09SPL01_0103_G09.bCJ022293 
SPL010104F04SPL01_0104_F04.bCJ022365 
SPL010105A03SPL01_0105_A03.bCJ022399 
SPLT10042H06SPLT1_0042_H06.bHX242505 
TCH010018A04TCH01_0018_A04.bCJ023731 
TCH010025D01TCH01_0025_D01.bCJ024279 
TCH010033F10TCH01_0033_F10.bCJ024902 
TCH010053C08TCH01_0053_C08.bBW975829 
TES010044A06TES01_0044_A06.bCJ032819 
TES010106A02TES01_0106_A02.bFS722278 
THY010004A06THY01_0004_A06.bBP159873 
THY010004B06THY01_0004_B06.bBP161099 
THY010005A06THY01_0005_A06.bBP159874 
THY010005B06THY01_0005_B06.bBP161100 
THY010008A05THY01_0008_A05.bBP159779 
THY010013H09THY01_0013_H09.bBP168965 
THY010014H05THY01_0014_H05.bBP168534 
THY010016C11THY01_0016_C11.bBP162879 
THY010020F12THY01_0020_F12.bBP166735 
THY010022E02THY01_0022_E02.bBP164451 
THY010030H01THY01_0030_H01.bBP168116 
THY010036H02THY01_0036_H02.bBP168232 
THY010038C05THY01_0038_C05.bBP162278 
THY010038D07THY01_0038_D07.bBP163726 
THY010038E09THY01_0038_E09.bBP165187 
THY010039D07THY01_0039_D07.bBP163727 
THY010040B07THY01_0040_B07.bBP161231 
THY010045E08THY01_0045_E08.bBP165093 
THY010061G05THY01_0061_G05.bBP167303 
THY010065C11THY01_0065_C11.bBP162924 
THY010069D03THY01_0069_D03.bBP163341 
THY010074C07THY01_0074_C07.bBP162514 
THY010090F02THY01_0090_F02.bBP165753 
THY010096A03THY01_0096_A03.bBP159637 
THY010097B06THY01_0097_B06.bBP161169 
THY010100H04THY01_0100_H04.bBP168498 
THY010112F11THY01_0112_F11.bBP166701 
THY010121D03THY01_0121_D03.bBP163379 
THY010123D12THY01_0123_D12.bBP164315 
THY010123F03THY01_0123_F03.bBP165893 
THY010125F04THY01_0125_F04.bBP166004 
THY010203H04THY01_0203_H04.bBP168518 
THY010204B06THY01_0204_B06.bBP161197 
THY010205D02THY01_0205_D02.bBP163284 
THY010205G05THY01_0205_G05.bBP167355 
UTR010009G02UTR01_0009_G02.bBP172610 
UTR010014C07UTR01_0014_C07.bBP170702 
UTR010015C12UTR01_0015_C12.bBP170925 
UTR010018A05UTR01_0018_A05.bBP169545 
UTR010021F10UTR01_0021_F10.bBP172442 
UTR010025H03UTR01_0025_H03.bBP173208 
UTR010036E01UTR01_0036_E01.bBP171529 
UTR010042A05UTR01_0042_A05.bBP169565 
UTR010042F02UTR01_0042_F02.bBP172107 
UTR010048H06UTR01_0048_H06.bBP173361 
UTR010058H12UTR01_0058_H12.bBP464964 
UTR010059A04UTR01_0059_A04.bBP462743 
UTR010060B02UTR01_0060_B02.bBP462991 
UTR010061B12UTR01_0061_B12.bBP463236 
UTR010071D04UTR01_0071_D04.bBP463630 
UTR010072D04UTR01_0072_D04.bBP463631 
UTR010082C11UTR01_0082_C11.bCJ037557 
UTR010087D11UTR01_0087_D11.bCJ038032 
UTR010106A11UTR01_0106_A11.bCJ039662 

  

SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
363A6100.189WSAAA/K
G226360.811AAG/K
457C138360.534WSGAC/D
T15200.466GAT/D
521C261150.839OSCTG/L
T32210.161TTG/L


Alignment:      TOP

20110601C-001050 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRT1_0030_A10.b : nttttccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0043_C03.b :
LNG01_0090_A04.b :
THY01_0203_H04.b :
PBL01_0009_H08.b :
PTG01_0086_H10.b :
OVRT1_0093_A05.b :
OVRM1_0084_C03.b :
SPL01_0105_A03.b :
THY01_0030_H01.b :
SMG01_0037_C04.b :
THY01_0022_E02.b :
ADR01_0033_F05.b :
MLN01_0055_F09.b :
LVRM1_0087_F09.b :
THY01_0123_D12.b :
THY01_0125_F04.b :
PTG01_0066_D10.b :
OVR01_0076_D08.b :
THY01_0013_H09.b :
UTR01_0021_F10.b :
UTR01_0082_C11.b :
TES01_0044_A06.b :
ITT01_0020_D05.b :
MLN01_0078_D08.b :
LVR01_0017_B08.b :
SPL01_0097_G06.b :
OVR01_0010_G11.b :
TCH01_0025_D01.b :
PST01_0033_D01.b :
THY01_0112_F11.b :
LVRM1_0165_H11.b :
OVR01_0104_C10.b :
MLN01_0018_A07.b :
PST01_0067_C11.b :
SKNB1_0067_G01.b :
OVRM1_0017_A09.b :
THY01_0036_H02.b :
LNG01_0045_H12.b :
TCH01_0018_A04.b :
OVRT1_0129_E03.b :
SKNB1_0082_E09.b :
OVRT1_0055_A02.b :
MLN01_0102_C11.b :
LVRM1_0062_B12.b :
PTG01_0064_A02.b :
LVRM1_0089_F02.b :
LVRM1_0192_D12.b :
LVRM1_0113_A05.b :
THY01_0020_F12.b :
OVRM1_0031_B05.b :
THY01_0069_D03.b :
SMG01_0081_C07.b :
OVRT1_0125_D08.b :
OVR01_0090_E09.b :
SMG01_0047_F12.b :
LNG01_0004_D12.b :
OVR01_0051_H10.b :
THY01_0038_D07.b :
LVR01_0048_F04.b :
SKNB1_0033_F04.b :
THY01_0097_B06.b :
SMG01_0034_A08.b :
LVR01_0030_A04.b :
MLN01_0030_H11.b :
LNG01_0004_A12.b :
OVRT1_0091_G04.b :
LVR01_0077_H10.b :
LVR01_0028_A05.b :
MLN01_0104_E06.b :
ITT01_0078_E02.b :
ILNT1_0088_E10.b :
LVR01_0012_A08.b :
MLN01_0010_A01.b :
UTR01_0106_A11.b :
PST01_0084_H07.b :
LNG01_0071_B05.b :
SKNB1_0059_E09.b :
LVRM1_0067_A10.b :
LVRM1_0172_C07.b :
THY01_0123_F03.b :
LVRM1_0079_A04.b :
LVRM1_0049_B02.b :
OVR01_0054_B12.b :
UTR01_0042_F02.b :
LVR01_0048_B01.b :
UTR01_0018_A05.b :
OVR01_0050_D11.b :
PTG01_0024_D08.b :
LNG01_0002_H12.b :
LNG01_0030_F07.b :
SMG01_0014_D04.b :
OVR01_0093_G11.b :
UTR01_0059_A04.b :
LNG01_0082_E08.b :
OVR01_0015_A08.b :
LNG01_0025_E05.b :
OVRT1_0095_A05.b :
MLN01_0025_A11.b :
MLN01_0056_D12.b :
LVRM1_0203_F10.b :
LVRM1_0048_G03.b :
PTG01_0102_C06.b :
OVRM1_0037_F10.b :
LVRM1_0101_H02.b :
SMG01_0054_B08.b :
MLN01_0018_A08.b :
SMG01_0066_A01.b :
LNG01_0101_A12.b :
LVR01_0106_A02.b :
OVR01_0086_A05.b :
LVRM1_0091_H02.b :
LVRM1_0107_C07.b :
OVR01_0082_H12.b :
OVRM1_0191_B03.b :
LVRM1_0195_E09.b :
OVRM1_0037_C05.b :
LVRM1_0202_F10.b :
LVRM1_0018_C08.b :
THY01_0005_B06.b :
LVRM1_0078_H03.b :
SPL01_0034_D02.b :
OVRM1_0110_B12.b :
OVRM1_0100_E11.b :
LVRM1_0077_G10.b :
OVR01_0083_G11.b :
OVRM1_0069_G11.b :
OVR01_0059_A04.b :
OVR01_0052_B11.b :
TCH01_0053_C08.b :
OVRM1_0021_A12.b :
UTR01_0014_C07.b :
CLNT1_0149_A10.b :
SPL01_0010_B04.b :
UTR01_0025_H03.b :
THY01_0004_B06.b :
THY01_0045_E08.b :
UTR01_0015_C12.b :
THY01_0016_C11.b :
THY01_0005_A06.b :
THY01_0004_A06.b :
THY01_0014_H05.b :
MLN01_0020_D03.b :
SMG01_0058_E11.b :
SPL01_0041_A07.b :
PBL01_0005_H04.b :
MLN01_0077_F06.b :
OVRT1_0072_F09.b :
PTG01_0016_E04.b :
UTR01_0072_D04.b :
ADR01_0036_D03.b :
PTG01_0083_G09.b :
UTR01_0087_D11.b :
OVRT1_0149_E04.b :
CLNT1_0129_C08.b :
THY01_0040_B07.b :
OVR01_0065_G01.b :
UTR01_0036_E01.b :
LNG01_0069_C05.b :
OVR01_0035_B09.b :
LVR01_0011_G02.b :
LVR01_0062_H02.b :
SPL01_0103_G09.b :
SMG01_0044_G03.b :
OVR01_0033_D12.b :
LVR01_0047_D06.b :
SPL01_0037_H11.b :
ITT01_0033_A08.b :
SPL01_0038_C12.b :
LVR01_0051_G07.b :
LNG01_0009_G03.b :
ITT01_0077_G12.b :
SMG01_0015_G04.b :
OVR01_0043_A07.b :
PTG01_0077_C06.b :
ADR01_0051_B11.b :
LVR01_0049_G11.b :
OVRT1_0112_E04.b :
OVR01_0091_D12.b :
MLN01_0033_G08.b :
SMG01_0029_D10.b :
SMG01_0033_C08.b :
CLNT1_0128_F12.b :
OVR01_0054_H06.b :
OVRT1_0108_H07.b :
MLN01_0080_H03.b :
UTR01_0058_H12.b :
OVRT1_0146_F04.b :
SMG01_0080_E10.b :
ITT01_0074_B02.b :
PBL01_0038_G01.b :
LVR01_0045_F12.b :
OVR01_0095_F04.b :
MLN01_0044_C12.b :
BFLT1_0092_E03.b :
SMG01_0085_F02.b :
PBL01_0042_D09.b :
THY01_0065_C11.b :
SPL01_0051_D06.b :
MLN01_0060_B05.b :
LVR01_0061_C03.b :
THY01_0039_D07.b :
OVR01_0053_H04.b :
THY01_0038_C05.b :
CLNT1_0065_E04.b :
SPL01_0036_C03.b :
LNG01_0002_G07.b :
LVR01_0059_D05.b :
OVR01_0099_B03.b :
OVRT1_0001_F08.b :
OVR01_0008_A08.b :
LVR01_0089_A07.b :
CLNT1_0015_B10.b :
MLN01_0078_F10.b :
OVRT1_0010_E11.b :
LNG01_0033_A10.b :
LVR01_0050_G07.b :
OVRT1_0022_D07.b :
LNG01_0069_E10.b :
SPL01_0070_H08.b :
CLNT1_0050_F02.b :
CLNT1_0050_C08.b :
OVR01_0021_F05.b :
THY01_0096_A03.b :
OVRT1_0039_H08.b :
THY01_0008_A05.b :
CLNT1_0088_D10.b :
LNG01_0010_H10.b :
THY01_0090_F02.b :
THY01_0061_G05.b :
CLNT1_0049_C08.b :
MLN01_0045_B10.b :
CLNT1_0004_D11.b :
ITT01_0095_E07.b :
PBL01_0087_B11.b :
SPL01_0104_F04.b :
PBL01_0075_E01.b :
THY01_0204_B06.b :
CLNT1_0004_C01.b :
LNG01_0043_C04.b :
ITT01_0001_E08.b :
LNG01_0012_C03.b :
SKNB1_0040_A11.b :
MLN01_0062_F06.b :
LNG01_0098_D08.b :
UTR01_0060_B02.b :
ITT01_0076_D05.b :
CLNT1_0041_G01.b :
LVRM1_0080_B01.b :
OVRM1_0056_F10.b :
ADR01_0052_D04.b :
SKNB1_0002_E09.b :
OVRT1_0140_C11.b :
LNG01_0107_A01.b :
ITT01_0033_H09.b :
OVRT1_0070_H03.b :
PST01_0001_A11.b :
CLNT1_0144_A06.b :
LNG01_0110_D07.b :
ITT01_0063_H06.b :
LNG01_0109_F07.b :
ITT01_0088_C04.b :
THY01_0121_D03.b :
PTG01_0097_E07.b :
SPL01_0064_G02.b :
LVR01_0018_H10.b :
TCH01_0033_F10.b :
THY01_0205_D02.b :
OVR01_0009_D05.b :
PBL01_0004_F08.b :
LVRM1_0001_H10.b :
OVRM1_0067_D06.b :
LVR01_0053_D05.b :
SMG01_0042_F07.b :
MLN01_0064_D10.b :
LNG01_0087_G10.b :
UTR01_0042_A05.b :
OVR01_0104_E06.b :
OVRT1_0045_C09.b :
OVR01_0093_C12.b :
CLNT1_0040_G10.b :
OVR01_0006_H10.b :
THY01_0074_C07.b :
OVRT1_0100_D10.b :
PTG01_0082_C12.b :
PTG01_0050_H04.b :
PBL01_0063_G05.b :
CLNT1_0023_H04.b :
LNG01_0108_D12.b :
OVRT1_0060_A11.b :
ITT01_0013_F04.b :
THY01_0100_H04.b :
OVRT1_0100_G09.b :
UTR01_0061_B12.b :
OVRT1_0008_A02.b :
MLN01_0059_D12.b :
LVR01_0105_A02.b :
OVRT1_0095_A02.b :
MLN01_0076_B10.b :
OVRT1_0090_F08.b :
LVR01_0104_C04.b :
UTR01_0048_H06.b :
LNG01_0025_C04.b :
THY01_0205_G05.b :
ITT01_0009_D10.b :
ITT01_0043_C06.b :
ITT01_0098_A12.b :
ADR01_0076_C06.b :
SKNB1_0051_H08.b :
SKNB1_0040_F06.b :
SKNB1_0097_A08.b :
OVRM1_0165_B03.b :
SPL01_0084_A10.b :
TES01_0106_A02.b :
SPL01_0086_H03.b :
SPL01_0079_B04.b :
THY01_0038_E09.b :
KDN01_0024_C07.b :
PST01_0054_B10.b :
KDN01_0086_A08.b :
UTR01_0009_G02.b :
OVR01_0067_F02.b :
LNG01_0033_D11.b :
KDN01_0061_H06.b :
SPL01_0009_H04.b :
ADR01_0067_F04.b :
HTMT1_0095_A01.b :
PCT01_0024_H06.b :
ITT01_0042_D04.b :
OVRT1_0004_F10.b :
UTR01_0071_D04.b :
OVRT1_0080_H12.b :
MLN01_0007_D01.b :
LNG01_0091_G06.b :
SPLT1_0042_H06.b :
ADR01_0062_B08.b :
20110601C-001050 : .............CCGGGGGAGGGGGCCGGGTCGGGAGGACTTTCCAGCCACTCAGCGTG
---------+---------+---------+---------+---------+---------+ 47
OVRT1_0030_A10.b : xxxxxxxxxxxxxCCGGGGGAGGGGGCCGGGTCGGGAGGACTTTCCAGCCACTCAGCGTG
OVRM1_0043_C03.b :
LNG01_0090_A04.b :
THY01_0203_H04.b : ct
PBL01_0009_H08.b :
PTG01_0086_H10.b :
OVRT1_0093_A05.b :
OVRM1_0084_C03.b :
SPL01_0105_A03.b :
THY01_0030_H01.b :
SMG01_0037_C04.b :
THY01_0022_E02.b :
ADR01_0033_F05.b :
MLN01_0055_F09.b :
LVRM1_0087_F09.b :
THY01_0123_D12.b :
THY01_0125_F04.b :
PTG01_0066_D10.b :
OVR01_0076_D08.b :
THY01_0013_H09.b :
UTR01_0021_F10.b :
UTR01_0082_C11.b :
TES01_0044_A06.b :
ITT01_0020_D05.b :
MLN01_0078_D08.b :
LVR01_0017_B08.b :
SPL01_0097_G06.b :
OVR01_0010_G11.b :
TCH01_0025_D01.b :
PST01_0033_D01.b :
THY01_0112_F11.b :
LVRM1_0165_H11.b :
OVR01_0104_C10.b :
MLN01_0018_A07.b :
PST01_0067_C11.b :
SKNB1_0067_G01.b :
OVRM1_0017_A09.b :
THY01_0036_H02.b :
LNG01_0045_H12.b :
TCH01_0018_A04.b :
OVRT1_0129_E03.b :
SKNB1_0082_E09.b :
OVRT1_0055_A02.b :
MLN01_0102_C11.b :
LVRM1_0062_B12.b :
PTG01_0064_A02.b :
LVRM1_0089_F02.b :
LVRM1_0192_D12.b :
LVRM1_0113_A05.b :
THY01_0020_F12.b :
OVRM1_0031_B05.b :
THY01_0069_D03.b :
SMG01_0081_C07.b :
OVRT1_0125_D08.b :
OVR01_0090_E09.b :
SMG01_0047_F12.b :
LNG01_0004_D12.b :
OVR01_0051_H10.b :
THY01_0038_D07.b :
LVR01_0048_F04.b :
SKNB1_0033_F04.b :
THY01_0097_B06.b :
SMG01_0034_A08.b :
LVR01_0030_A04.b :
MLN01_0030_H11.b :
LNG01_0004_A12.b :
OVRT1_0091_G04.b :
LVR01_0077_H10.b :
LVR01_0028_A05.b :
MLN01_0104_E06.b :
ITT01_0078_E02.b :
ILNT1_0088_E10.b :
LVR01_0012_A08.b :
MLN01_0010_A01.b :
UTR01_0106_A11.b :
PST01_0084_H07.b :
LNG01_0071_B05.b :
SKNB1_0059_E09.b :
LVRM1_0067_A10.b :
LVRM1_0172_C07.b :
THY01_0123_F03.b :
LVRM1_0079_A04.b :
LVRM1_0049_B02.b :
OVR01_0054_B12.b :
UTR01_0042_F02.b :
LVR01_0048_B01.b :
UTR01_0018_A05.b :
OVR01_0050_D11.b :
PTG01_0024_D08.b :
LNG01_0002_H12.b :
LNG01_0030_F07.b :
SMG01_0014_D04.b :
OVR01_0093_G11.b :
UTR01_0059_A04.b :
LNG01_0082_E08.b :
OVR01_0015_A08.b :
LNG01_0025_E05.b :
OVRT1_0095_A05.b :
MLN01_0025_A11.b :
MLN01_0056_D12.b :
LVRM1_0203_F10.b :
LVRM1_0048_G03.b :
PTG01_0102_C06.b :
OVRM1_0037_F10.b :
LVRM1_0101_H02.b :
SMG01_0054_B08.b :
MLN01_0018_A08.b :
SMG01_0066_A01.b :
LNG01_0101_A12.b :
LVR01_0106_A02.b :
OVR01_0086_A05.b :
LVRM1_0091_H02.b :
LVRM1_0107_C07.b :
OVR01_0082_H12.b :
OVRM1_0191_B03.b :
LVRM1_0195_E09.b :
OVRM1_0037_C05.b :
LVRM1_0202_F10.b :
LVRM1_0018_C08.b :
THY01_0005_B06.b :
LVRM1_0078_H03.b :
SPL01_0034_D02.b :
OVRM1_0110_B12.b :
OVRM1_0100_E11.b :
LVRM1_0077_G10.b :
OVR01_0083_G11.b :
OVRM1_0069_G11.b :
OVR01_0059_A04.b :
OVR01_0052_B11.b :
TCH01_0053_C08.b :
OVRM1_0021_A12.b :
UTR01_0014_C07.b :
CLNT1_0149_A10.b :
SPL01_0010_B04.b :
UTR01_0025_H03.b :
THY01_0004_B06.b :
THY01_0045_E08.b :
UTR01_0015_C12.b :
THY01_0016_C11.b :
THY01_0005_A06.b :
THY01_0004_A06.b :
THY01_0014_H05.b :
MLN01_0020_D03.b :
SMG01_0058_E11.b :
SPL01_0041_A07.b :
PBL01_0005_H04.b :
MLN01_0077_F06.b :
OVRT1_0072_F09.b :
PTG01_0016_E04.b :
UTR01_0072_D04.b :
ADR01_0036_D03.b :
PTG01_0083_G09.b :
UTR01_0087_D11.b :
OVRT1_0149_E04.b :
CLNT1_0129_C08.b :
THY01_0040_B07.b :
OVR01_0065_G01.b :
UTR01_0036_E01.b :
LNG01_0069_C05.b :
OVR01_0035_B09.b :
LVR01_0011_G02.b :
LVR01_0062_H02.b :
SPL01_0103_G09.b :
SMG01_0044_G03.b :
OVR01_0033_D12.b :
LVR01_0047_D06.b :
SPL01_0037_H11.b :
ITT01_0033_A08.b :
SPL01_0038_C12.b :
LVR01_0051_G07.b :
LNG01_0009_G03.b :
ITT01_0077_G12.b :
SMG01_0015_G04.b :
OVR01_0043_A07.b :
PTG01_0077_C06.b :
ADR01_0051_B11.b :
LVR01_0049_G11.b :
OVRT1_0112_E04.b :
OVR01_0091_D12.b :
MLN01_0033_G08.b :
SMG01_0029_D10.b :
SMG01_0033_C08.b :
CLNT1_0128_F12.b :
OVR01_0054_H06.b :
OVRT1_0108_H07.b :
MLN01_0080_H03.b :
UTR01_0058_H12.b :
OVRT1_0146_F04.b :
SMG01_0080_E10.b :
ITT01_0074_B02.b :
PBL01_0038_G01.b :
LVR01_0045_F12.b :
OVR01_0095_F04.b :
MLN01_0044_C12.b :
BFLT1_0092_E03.b :
SMG01_0085_F02.b :
PBL01_0042_D09.b :
THY01_0065_C11.b :
SPL01_0051_D06.b :
MLN01_0060_B05.b :
LVR01_0061_C03.b :
THY01_0039_D07.b :
OVR01_0053_H04.b :
THY01_0038_C05.b :
CLNT1_0065_E04.b :
SPL01_0036_C03.b :
LNG01_0002_G07.b :
LVR01_0059_D05.b :
OVR01_0099_B03.b :
OVRT1_0001_F08.b :
OVR01_0008_A08.b :
LVR01_0089_A07.b :
CLNT1_0015_B10.b :
MLN01_0078_F10.b :
OVRT1_0010_E11.b :
LNG01_0033_A10.b :
LVR01_0050_G07.b :
OVRT1_0022_D07.b :
LNG01_0069_E10.b :
SPL01_0070_H08.b :
CLNT1_0050_F02.b :
CLNT1_0050_C08.b :
OVR01_0021_F05.b :
THY01_0096_A03.b :
OVRT1_0039_H08.b :
THY01_0008_A05.b :
CLNT1_0088_D10.b :
LNG01_0010_H10.b :
THY01_0090_F02.b :
THY01_0061_G05.b :
CLNT1_0049_C08.b :
MLN01_0045_B10.b :
CLNT1_0004_D11.b :
ITT01_0095_E07.b :
PBL01_0087_B11.b :
SPL01_0104_F04.b :
PBL01_0075_E01.b :
THY01_0204_B06.b :
CLNT1_0004_C01.b :
LNG01_0043_C04.b :
ITT01_0001_E08.b :
LNG01_0012_C03.b :
SKNB1_0040_A11.b :
MLN01_0062_F06.b :
LNG01_0098_D08.b :
UTR01_0060_B02.b :
ITT01_0076_D05.b :
CLNT1_0041_G01.b :
LVRM1_0080_B01.b :
OVRM1_0056_F10.b :
ADR01_0052_D04.b :
SKNB1_0002_E09.b :
OVRT1_0140_C11.b :
LNG01_0107_A01.b :
ITT01_0033_H09.b :
OVRT1_0070_H03.b :
PST01_0001_A11.b :
CLNT1_0144_A06.b :
LNG01_0110_D07.b :
ITT01_0063_H06.b :
LNG01_0109_F07.b :
ITT01_0088_C04.b :
THY01_0121_D03.b :
PTG01_0097_E07.b :
SPL01_0064_G02.b :
LVR01_0018_H10.b :
TCH01_0033_F10.b :
THY01_0205_D02.b :
OVR01_0009_D05.b :
PBL01_0004_F08.b :
LVRM1_0001_H10.b :
OVRM1_0067_D06.b :
LVR01_0053_D05.b :
SMG01_0042_F07.b :
MLN01_0064_D10.b :
LNG01_0087_G10.b :
UTR01_0042_A05.b :
OVR01_0104_E06.b :
OVRT1_0045_C09.b :
OVR01_0093_C12.b :
CLNT1_0040_G10.b :
OVR01_0006_H10.b :
THY01_0074_C07.b :
OVRT1_0100_D10.b :
PTG01_0082_C12.b :
PTG01_0050_H04.b :
PBL01_0063_G05.b :
CLNT1_0023_H04.b :
LNG01_0108_D12.b :
OVRT1_0060_A11.b :
ITT01_0013_F04.b :
THY01_0100_H04.b :
OVRT1_0100_G09.b :
UTR01_0061_B12.b :
OVRT1_0008_A02.b :
MLN01_0059_D12.b :
LVR01_0105_A02.b :
OVRT1_0095_A02.b :
MLN01_0076_B10.b :
OVRT1_0090_F08.b :
LVR01_0104_C04.b :
UTR01_0048_H06.b :
LNG01_0025_C04.b :
THY01_0205_G05.b :
ITT01_0009_D10.b :
ITT01_0043_C06.b :
ITT01_0098_A12.b :
ADR01_0076_C06.b :
SKNB1_0051_H08.b :
SKNB1_0040_F06.b :
SKNB1_0097_A08.b :
OVRM1_0165_B03.b :
SPL01_0084_A10.b :
TES01_0106_A02.b :
SPL01_0086_H03.b :
SPL01_0079_B04.b :
THY01_0038_E09.b :
KDN01_0024_C07.b :
PST01_0054_B10.b :
KDN01_0086_A08.b :
UTR01_0009_G02.b :
OVR01_0067_F02.b :
LNG01_0033_D11.b :
KDN01_0061_H06.b :
SPL01_0009_H04.b :
ADR01_0067_F04.b :
HTMT1_0095_A01.b :
PCT01_0024_H06.b :
ITT01_0042_D04.b :
OVRT1_0004_F10.b :
UTR01_0071_D04.b :
OVRT1_0080_H12.b :
MLN01_0007_D01.b :
LNG01_0091_G06.b :
SPLT1_0042_H06.b :
ADR01_0062_B08.b :
20110601C-001050 : CATTAAAAAGTTCCCTGTACATGACCCCAGTGGCTCATCGCAGGGAGTTTCTCTGATGAA
---------+---------+---------+---------+---------+---------+ 107
OVRT1_0030_A10.b : CATTAAAAAGTTCCCTGTACATGACCCCAGTGGCTCATCGCAGGGAGTTTCTCTGATGAA
OVRM1_0043_C03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0090_A04.b : ttcggtnggatggagatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0203_H04.b : atttggctggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0009_H08.b : nnnttatgaaagcagctggaxxxxxxxxxx
PTG01_0086_H10.b :
OVRT1_0093_A05.b :
OVRM1_0084_C03.b :
SPL01_0105_A03.b :
THY01_0030_H01.b :
SMG01_0037_C04.b :
THY01_0022_E02.b :
ADR01_0033_F05.b :
MLN01_0055_F09.b :
LVRM1_0087_F09.b :
THY01_0123_D12.b :
THY01_0125_F04.b :
PTG01_0066_D10.b :
OVR01_0076_D08.b :
THY01_0013_H09.b :
UTR01_0021_F10.b :
UTR01_0082_C11.b :
TES01_0044_A06.b :
ITT01_0020_D05.b :
MLN01_0078_D08.b :
LVR01_0017_B08.b :
SPL01_0097_G06.b :
OVR01_0010_G11.b :
TCH01_0025_D01.b :
PST01_0033_D01.b :
THY01_0112_F11.b :
LVRM1_0165_H11.b :
OVR01_0104_C10.b :
MLN01_0018_A07.b :
PST01_0067_C11.b :
SKNB1_0067_G01.b :
OVRM1_0017_A09.b :
THY01_0036_H02.b :
LNG01_0045_H12.b :
TCH01_0018_A04.b :
OVRT1_0129_E03.b :
SKNB1_0082_E09.b :
OVRT1_0055_A02.b :
MLN01_0102_C11.b :
LVRM1_0062_B12.b :
PTG01_0064_A02.b :
LVRM1_0089_F02.b :
LVRM1_0192_D12.b :
LVRM1_0113_A05.b :
THY01_0020_F12.b :
OVRM1_0031_B05.b :
THY01_0069_D03.b :
SMG01_0081_C07.b :
OVRT1_0125_D08.b :
OVR01_0090_E09.b :
SMG01_0047_F12.b :
LNG01_0004_D12.b :
OVR01_0051_H10.b :
THY01_0038_D07.b :
LVR01_0048_F04.b :
SKNB1_0033_F04.b :
THY01_0097_B06.b :
SMG01_0034_A08.b :
LVR01_0030_A04.b :
MLN01_0030_H11.b :
LNG01_0004_A12.b :
OVRT1_0091_G04.b :
LVR01_0077_H10.b :
LVR01_0028_A05.b :
MLN01_0104_E06.b :
ITT01_0078_E02.b :
ILNT1_0088_E10.b :
LVR01_0012_A08.b :
MLN01_0010_A01.b :
UTR01_0106_A11.b :
PST01_0084_H07.b :
LNG01_0071_B05.b :
SKNB1_0059_E09.b :
LVRM1_0067_A10.b :
LVRM1_0172_C07.b :
THY01_0123_F03.b :
LVRM1_0079_A04.b :
LVRM1_0049_B02.b :
OVR01_0054_B12.b :
UTR01_0042_F02.b :
LVR01_0048_B01.b :
UTR01_0018_A05.b :
OVR01_0050_D11.b :
PTG01_0024_D08.b :
LNG01_0002_H12.b :
LNG01_0030_F07.b :
SMG01_0014_D04.b :
OVR01_0093_G11.b :
UTR01_0059_A04.b :
LNG01_0082_E08.b :
OVR01_0015_A08.b :
LNG01_0025_E05.b :
OVRT1_0095_A05.b :
MLN01_0025_A11.b :
MLN01_0056_D12.b :
LVRM1_0203_F10.b :
LVRM1_0048_G03.b :
PTG01_0102_C06.b :
OVRM1_0037_F10.b :
LVRM1_0101_H02.b :
SMG01_0054_B08.b :
MLN01_0018_A08.b :
SMG01_0066_A01.b :
LNG01_0101_A12.b :
LVR01_0106_A02.b :
OVR01_0086_A05.b :
LVRM1_0091_H02.b :
LVRM1_0107_C07.b :
OVR01_0082_H12.b :
OVRM1_0191_B03.b :
LVRM1_0195_E09.b :
OVRM1_0037_C05.b :
LVRM1_0202_F10.b :
LVRM1_0018_C08.b :
THY01_0005_B06.b :
LVRM1_0078_H03.b :
SPL01_0034_D02.b :
OVRM1_0110_B12.b :
OVRM1_0100_E11.b :
LVRM1_0077_G10.b :
OVR01_0083_G11.b :
OVRM1_0069_G11.b :
OVR01_0059_A04.b :
OVR01_0052_B11.b :
TCH01_0053_C08.b :
OVRM1_0021_A12.b :
UTR01_0014_C07.b :
CLNT1_0149_A10.b :
SPL01_0010_B04.b :
UTR01_0025_H03.b :
THY01_0004_B06.b :
THY01_0045_E08.b :
UTR01_0015_C12.b :
THY01_0016_C11.b :
THY01_0005_A06.b :
THY01_0004_A06.b :
THY01_0014_H05.b :
MLN01_0020_D03.b :
SMG01_0058_E11.b :
SPL01_0041_A07.b :
PBL01_0005_H04.b :
MLN01_0077_F06.b :
OVRT1_0072_F09.b :
PTG01_0016_E04.b :
UTR01_0072_D04.b :
ADR01_0036_D03.b :
PTG01_0083_G09.b :
UTR01_0087_D11.b :
OVRT1_0149_E04.b :
CLNT1_0129_C08.b :
THY01_0040_B07.b :
OVR01_0065_G01.b :
UTR01_0036_E01.b :
LNG01_0069_C05.b :
OVR01_0035_B09.b :
LVR01_0011_G02.b :
LVR01_0062_H02.b :
SPL01_0103_G09.b :
SMG01_0044_G03.b :
OVR01_0033_D12.b :
LVR01_0047_D06.b :
SPL01_0037_H11.b :
ITT01_0033_A08.b :
SPL01_0038_C12.b :
LVR01_0051_G07.b :
LNG01_0009_G03.b :
ITT01_0077_G12.b :
SMG01_0015_G04.b :
OVR01_0043_A07.b :
PTG01_0077_C06.b :
ADR01_0051_B11.b :
LVR01_0049_G11.b :
OVRT1_0112_E04.b :
OVR01_0091_D12.b :
MLN01_0033_G08.b :
SMG01_0029_D10.b :
SMG01_0033_C08.b :
CLNT1_0128_F12.b :
OVR01_0054_H06.b :
OVRT1_0108_H07.b :
MLN01_0080_H03.b :
UTR01_0058_H12.b :
OVRT1_0146_F04.b :
SMG01_0080_E10.b :
ITT01_0074_B02.b :
PBL01_0038_G01.b :
LVR01_0045_F12.b :
OVR01_0095_F04.b :
MLN01_0044_C12.b :
BFLT1_0092_E03.b :
SMG01_0085_F02.b :
PBL01_0042_D09.b :
THY01_0065_C11.b :
SPL01_0051_D06.b :
MLN01_0060_B05.b :
LVR01_0061_C03.b :
THY01_0039_D07.b :
OVR01_0053_H04.b :
THY01_0038_C05.b :
CLNT1_0065_E04.b :
SPL01_0036_C03.b :
LNG01_0002_G07.b :
LVR01_0059_D05.b :
OVR01_0099_B03.b :
OVRT1_0001_F08.b :
OVR01_0008_A08.b :
LVR01_0089_A07.b :
CLNT1_0015_B10.b :
MLN01_0078_F10.b :
OVRT1_0010_E11.b :
LNG01_0033_A10.b :
LVR01_0050_G07.b :
OVRT1_0022_D07.b :
LNG01_0069_E10.b :
SPL01_0070_H08.b :
CLNT1_0050_F02.b :
CLNT1_0050_C08.b :
OVR01_0021_F05.b :
THY01_0096_A03.b :
OVRT1_0039_H08.b :
THY01_0008_A05.b :
CLNT1_0088_D10.b :
LNG01_0010_H10.b :
THY01_0090_F02.b :
THY01_0061_G05.b :
CLNT1_0049_C08.b :
MLN01_0045_B10.b :
CLNT1_0004_D11.b :
ITT01_0095_E07.b :
PBL01_0087_B11.b :
SPL01_0104_F04.b :
PBL01_0075_E01.b :
THY01_0204_B06.b :
CLNT1_0004_C01.b :
LNG01_0043_C04.b :
ITT01_0001_E08.b :
LNG01_0012_C03.b :
SKNB1_0040_A11.b :
MLN01_0062_F06.b :
LNG01_0098_D08.b :
UTR01_0060_B02.b :
ITT01_0076_D05.b :
CLNT1_0041_G01.b :
LVRM1_0080_B01.b :
OVRM1_0056_F10.b :
ADR01_0052_D04.b :
SKNB1_0002_E09.b :
OVRT1_0140_C11.b :
LNG01_0107_A01.b :
ITT01_0033_H09.b :
OVRT1_0070_H03.b :
PST01_0001_A11.b :
CLNT1_0144_A06.b :
LNG01_0110_D07.b :
ITT01_0063_H06.b :
LNG01_0109_F07.b :
ITT01_0088_C04.b :
THY01_0121_D03.b :
PTG01_0097_E07.b :
SPL01_0064_G02.b :
LVR01_0018_H10.b :
TCH01_0033_F10.b :
THY01_0205_D02.b :
OVR01_0009_D05.b :
PBL01_0004_F08.b :
LVRM1_0001_H10.b :
OVRM1_0067_D06.b :
LVR01_0053_D05.b :
SMG01_0042_F07.b :
MLN01_0064_D10.b :
LNG01_0087_G10.b :
UTR01_0042_A05.b :
OVR01_0104_E06.b :
OVRT1_0045_C09.b :
OVR01_0093_C12.b : gggttctcttnaanat
CLNT1_0040_G10.b :
OVR01_0006_H10.b :
THY01_0074_C07.b :
OVRT1_0100_D10.b :
PTG01_0082_C12.b :
PTG01_0050_H04.b :
PBL01_0063_G05.b :
CLNT1_0023_H04.b :
LNG01_0108_D12.b :
OVRT1_0060_A11.b :
ITT01_0013_F04.b :
THY01_0100_H04.b :
OVRT1_0100_G09.b :
UTR01_0061_B12.b :
OVRT1_0008_A02.b :
MLN01_0059_D12.b :
LVR01_0105_A02.b :
OVRT1_0095_A02.b :
MLN01_0076_B10.b :
OVRT1_0090_F08.b :
LVR01_0104_C04.b :
UTR01_0048_H06.b :
LNG01_0025_C04.b :
THY01_0205_G05.b :
ITT01_0009_D10.b :
ITT01_0043_C06.b :
ITT01_0098_A12.b :
ADR01_0076_C06.b :
SKNB1_0051_H08.b :
SKNB1_0040_F06.b :
SKNB1_0097_A08.b :
OVRM1_0165_B03.b :
SPL01_0084_A10.b :
TES01_0106_A02.b :
SPL01_0086_H03.b :
SPL01_0079_B04.b :
THY01_0038_E09.b :
KDN01_0024_C07.b :
PST01_0054_B10.b :
KDN01_0086_A08.b :
UTR01_0009_G02.b :
OVR01_0067_F02.b :
LNG01_0033_D11.b :
KDN01_0061_H06.b :
SPL01_0009_H04.b :
ADR01_0067_F04.b :
HTMT1_0095_A01.b :
PCT01_0024_H06.b :
ITT01_0042_D04.b :
OVRT1_0004_F10.b :
UTR01_0071_D04.b :
OVRT1_0080_H12.b :
MLN01_0007_D01.b :
LNG01_0091_G06.b :
SPLT1_0042_H06.b :
ADR01_0062_B08.b :
20110601C-001050 : CCCGGGCGCGGGGTTTAGGCTTCTTTTTCCCCCAGCAGAGGACGAGGCCAGTTCTCTTTT
---------+---------+---------+---------+---------+---------+ 167
OVRT1_0030_A10.b : CCCGGGCGCGGGGTTTAGGCTTCTTTTTCCCCCAGCAGAGGACGAGGCCAGTTCTCTTTT
OVRM1_0043_C03.b : xxxxxxxxxxxxxxxxxxxxxxCTTTTTCCCCCAGCAGAGGACGAGGCCAGTTCTCTTTT
LNG01_0090_A04.b : xxxxxxxxxxxxxxxxxxxxxxxTTTTTCCCCCAGCAGAGGACGAGGCCAGTTCTCTTTT
THY01_0203_H04.b : xxxxxxxxxxxxxxxxxxxxxxxTTTTTCCCCCAGCAGAGGACGAGGCCAGTTCTCTTTT
PBL01_0009_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxTTTTCCCCCAGCAGAGGACGAGGCCAGTTCTCTTTT
PTG01_0086_H10.b : nnnnn
OVRT1_0093_A05.b : ngctttttnnnnnc
OVRM1_0084_C03.b :
SPL01_0105_A03.b :
THY01_0030_H01.b :
SMG01_0037_C04.b :
THY01_0022_E02.b :
ADR01_0033_F05.b :
MLN01_0055_F09.b :
LVRM1_0087_F09.b :
THY01_0123_D12.b :
THY01_0125_F04.b :
PTG01_0066_D10.b :
OVR01_0076_D08.b :
THY01_0013_H09.b :
UTR01_0021_F10.b :
UTR01_0082_C11.b :
TES01_0044_A06.b :
ITT01_0020_D05.b :
MLN01_0078_D08.b :
LVR01_0017_B08.b :
SPL01_0097_G06.b :
OVR01_0010_G11.b : ccagaattxxxxxxxx
TCH01_0025_D01.b :
PST01_0033_D01.b :
THY01_0112_F11.b :
LVRM1_0165_H11.b :
OVR01_0104_C10.b :
MLN01_0018_A07.b :
PST01_0067_C11.b :
SKNB1_0067_G01.b :
OVRM1_0017_A09.b :
THY01_0036_H02.b :
LNG01_0045_H12.b :
TCH01_0018_A04.b :
OVRT1_0129_E03.b :
SKNB1_0082_E09.b :
OVRT1_0055_A02.b :
MLN01_0102_C11.b :
LVRM1_0062_B12.b :
PTG01_0064_A02.b :
LVRM1_0089_F02.b :
LVRM1_0192_D12.b :
LVRM1_0113_A05.b :
THY01_0020_F12.b :
OVRM1_0031_B05.b :
THY01_0069_D03.b :
SMG01_0081_C07.b :
OVRT1_0125_D08.b :
OVR01_0090_E09.b :
SMG01_0047_F12.b :
LNG01_0004_D12.b :
OVR01_0051_H10.b :
THY01_0038_D07.b :
LVR01_0048_F04.b :
SKNB1_0033_F04.b :
THY01_0097_B06.b :
SMG01_0034_A08.b :
LVR01_0030_A04.b :
MLN01_0030_H11.b :
LNG01_0004_A12.b :
OVRT1_0091_G04.b :
LVR01_0077_H10.b :
LVR01_0028_A05.b :
MLN01_0104_E06.b :
ITT01_0078_E02.b :
ILNT1_0088_E10.b :
LVR01_0012_A08.b :
MLN01_0010_A01.b :
UTR01_0106_A11.b :
PST01_0084_H07.b :
LNG01_0071_B05.b :
SKNB1_0059_E09.b :
LVRM1_0067_A10.b :
LVRM1_0172_C07.b :
THY01_0123_F03.b :
LVRM1_0079_A04.b :
LVRM1_0049_B02.b :
OVR01_0054_B12.b :
UTR01_0042_F02.b :
LVR01_0048_B01.b :
UTR01_0018_A05.b :
OVR01_0050_D11.b :
PTG01_0024_D08.b :
LNG01_0002_H12.b :
LNG01_0030_F07.b :
SMG01_0014_D04.b :
OVR01_0093_G11.b :
UTR01_0059_A04.b :
LNG01_0082_E08.b :
OVR01_0015_A08.b :
LNG01_0025_E05.b :
OVRT1_0095_A05.b :
MLN01_0025_A11.b :
MLN01_0056_D12.b :
LVRM1_0203_F10.b :
LVRM1_0048_G03.b :
PTG01_0102_C06.b :
OVRM1_0037_F10.b :
LVRM1_0101_H02.b :
SMG01_0054_B08.b :
MLN01_0018_A08.b :
SMG01_0066_A01.b :
LNG01_0101_A12.b :
LVR01_0106_A02.b :
OVR01_0086_A05.b :
LVRM1_0091_H02.b :
LVRM1_0107_C07.b :
OVR01_0082_H12.b :
OVRM1_0191_B03.b :
LVRM1_0195_E09.b :
OVRM1_0037_C05.b :
LVRM1_0202_F10.b :
LVRM1_0018_C08.b :
THY01_0005_B06.b :
LVRM1_0078_H03.b :
SPL01_0034_D02.b :
OVRM1_0110_B12.b :
OVRM1_0100_E11.b :
LVRM1_0077_G10.b :
OVR01_0083_G11.b :
OVRM1_0069_G11.b :
OVR01_0059_A04.b :
OVR01_0052_B11.b :
TCH01_0053_C08.b :
OVRM1_0021_A12.b :
UTR01_0014_C07.b :
CLNT1_0149_A10.b :
SPL01_0010_B04.b :
UTR01_0025_H03.b :
THY01_0004_B06.b :
THY01_0045_E08.b :
UTR01_0015_C12.b :
THY01_0016_C11.b :
THY01_0005_A06.b :
THY01_0004_A06.b :
THY01_0014_H05.b :
MLN01_0020_D03.b :
SMG01_0058_E11.b :
SPL01_0041_A07.b : agaggacttttatgcxxxxxxxx
PBL01_0005_H04.b :
MLN01_0077_F06.b :
OVRT1_0072_F09.b :
PTG01_0016_E04.b :
UTR01_0072_D04.b :
ADR01_0036_D03.b :
PTG01_0083_G09.b :
UTR01_0087_D11.b :
OVRT1_0149_E04.b :
CLNT1_0129_C08.b :
THY01_0040_B07.b :
OVR01_0065_G01.b :
UTR01_0036_E01.b :
LNG01_0069_C05.b :
OVR01_0035_B09.b :
LVR01_0011_G02.b :
LVR01_0062_H02.b :
SPL01_0103_G09.b :
SMG01_0044_G03.b :
OVR01_0033_D12.b :
LVR01_0047_D06.b :
SPL01_0037_H11.b :
ITT01_0033_A08.b :
SPL01_0038_C12.b :
LVR01_0051_G07.b :
LNG01_0009_G03.b :
ITT01_0077_G12.b :
SMG01_0015_G04.b :
OVR01_0043_A07.b :
PTG01_0077_C06.b :
ADR01_0051_B11.b :
LVR01_0049_G11.b :
OVRT1_0112_E04.b :
OVR01_0091_D12.b :
MLN01_0033_G08.b :
SMG01_0029_D10.b :
SMG01_0033_C08.b :
CLNT1_0128_F12.b :
OVR01_0054_H06.b :
OVRT1_0108_H07.b :
MLN01_0080_H03.b :
UTR01_0058_H12.b :
OVRT1_0146_F04.b :
SMG01_0080_E10.b :
ITT01_0074_B02.b :
PBL01_0038_G01.b :
LVR01_0045_F12.b :
OVR01_0095_F04.b :
MLN01_0044_C12.b :
BFLT1_0092_E03.b :
SMG01_0085_F02.b :
PBL01_0042_D09.b :
THY01_0065_C11.b :
SPL01_0051_D06.b :
MLN01_0060_B05.b :
LVR01_0061_C03.b :
THY01_0039_D07.b :
OVR01_0053_H04.b :
THY01_0038_C05.b :
CLNT1_0065_E04.b :
SPL01_0036_C03.b :
LNG01_0002_G07.b :
LVR01_0059_D05.b :
OVR01_0099_B03.b :
OVRT1_0001_F08.b :
OVR01_0008_A08.b : ccc
LVR01_0089_A07.b :
CLNT1_0015_B10.b :
MLN01_0078_F10.b :
OVRT1_0010_E11.b :
LNG01_0033_A10.b :
LVR01_0050_G07.b :
OVRT1_0022_D07.b :
LNG01_0069_E10.b :
SPL01_0070_H08.b :
CLNT1_0050_F02.b :
CLNT1_0050_C08.b :
OVR01_0021_F05.b :
THY01_0096_A03.b :
OVRT1_0039_H08.b :
THY01_0008_A05.b :
CLNT1_0088_D10.b :
LNG01_0010_H10.b :
THY01_0090_F02.b :
THY01_0061_G05.b :
CLNT1_0049_C08.b :
MLN01_0045_B10.b :
CLNT1_0004_D11.b :
ITT01_0095_E07.b :
PBL01_0087_B11.b :
SPL01_0104_F04.b :
PBL01_0075_E01.b :
THY01_0204_B06.b :
CLNT1_0004_C01.b :
LNG01_0043_C04.b :
ITT01_0001_E08.b :
LNG01_0012_C03.b :
SKNB1_0040_A11.b :
MLN01_0062_F06.b :
LNG01_0098_D08.b :
UTR01_0060_B02.b :
ITT01_0076_D05.b :
CLNT1_0041_G01.b :
LVRM1_0080_B01.b :
OVRM1_0056_F10.b :
ADR01_0052_D04.b :
SKNB1_0002_E09.b :
OVRT1_0140_C11.b :
LNG01_0107_A01.b : ntt
ITT01_0033_H09.b :
OVRT1_0070_H03.b :
PST01_0001_A11.b :
CLNT1_0144_A06.b :
LNG01_0110_D07.b :
ITT01_0063_H06.b :
LNG01_0109_F07.b :
ITT01_0088_C04.b :
THY01_0121_D03.b :
PTG01_0097_E07.b :
SPL01_0064_G02.b :
LVR01_0018_H10.b :
TCH01_0033_F10.b :
THY01_0205_D02.b :
OVR01_0009_D05.b : gggaactatg
PBL01_0004_F08.b :
LVRM1_0001_H10.b :
OVRM1_0067_D06.b :
LVR01_0053_D05.b :
SMG01_0042_F07.b :
MLN01_0064_D10.b :
LNG01_0087_G10.b :
UTR01_0042_A05.b :
OVR01_0104_E06.b :
OVRT1_0045_C09.b :
OVR01_0093_C12.b : tnttttttattttttctttttttcatgcttctacatcctttccttttaattctttctctc
CLNT1_0040_G10.b :
OVR01_0006_H10.b :
THY01_0074_C07.b :
OVRT1_0100_D10.b :
PTG01_0082_C12.b :
PTG01_0050_H04.b :
PBL01_0063_G05.b :
CLNT1_0023_H04.b :
LNG01_0108_D12.b :
OVRT1_0060_A11.b :
ITT01_0013_F04.b :
THY01_0100_H04.b :
OVRT1_0100_G09.b :
UTR01_0061_B12.b :
OVRT1_0008_A02.b :
MLN01_0059_D12.b :
LVR01_0105_A02.b :
OVRT1_0095_A02.b :
MLN01_0076_B10.b :
OVRT1_0090_F08.b :
LVR01_0104_C04.b :
UTR01_0048_H06.b :
LNG01_0025_C04.b :
THY01_0205_G05.b :
ITT01_0009_D10.b :
ITT01_0043_C06.b :
ITT01_0098_A12.b :
ADR01_0076_C06.b :
SKNB1_0051_H08.b :
SKNB1_0040_F06.b :
SKNB1_0097_A08.b :
OVRM1_0165_B03.b :
SPL01_0084_A10.b :
TES01_0106_A02.b :
SPL01_0086_H03.b :
SPL01_0079_B04.b :
THY01_0038_E09.b :
KDN01_0024_C07.b :
PST01_0054_B10.b :
KDN01_0086_A08.b :
UTR01_0009_G02.b :
OVR01_0067_F02.b :
LNG01_0033_D11.b :
KDN01_0061_H06.b :
SPL01_0009_H04.b :
ADR01_0067_F04.b :
HTMT1_0095_A01.b :
PCT01_0024_H06.b :
ITT01_0042_D04.b :
OVRT1_0004_F10.b :
UTR01_0071_D04.b :
OVRT1_0080_H12.b :
MLN01_0007_D01.b :
LNG01_0091_G06.b :
SPLT1_0042_H06.b :
ADR01_0062_B08.b :
20110601C-001050 : CTGGTCTGACTGGCTTGGAAATTCCCCGAGCTTGACCCCGCCCAGGAGAAATCCCCTGCC
---------+---------+---------+---------+---------+---------+ 227
OVRT1_0030_A10.b : CTGGTCTGACTGGCTTGGAAATTCCCCGAGCTTGACCCCGCCCAGGAGAAATCCCCTGCC
OVRM1_0043_C03.b : CTGGTCTGACTGGCTTGGAAATTCCCCGAGCTTGACCCCGCCCAGGAGAAATCCCCTGCC
LNG01_0090_A04.b : CTGGTCTGACTGGCTTGGAAATTCCCCGAGCTTGACCCCGCCCAGGAGAAATCCCCTGCC
THY01_0203_H04.b : CTGGTCTGACTGGCTTGGAAATTCCCCGAGCTTGACCCCGCCCAGGAGAAATCCCCTGCC
PBL01_0009_H08.b : CTGGTCTGACTGGCTTGGAAATTCCCCGAGCTTGACCCCGCCCAGGAGAAATCCCCTGCC
PTG01_0086_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRT1_0093_A05.b : ccgttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0084_C03.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0105_A03.b : nnnttgcttgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0030_H01.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0037_C04.b : nnggcgctatntnggggtcaacagcggnaxxxxxxxxxx
THY01_0022_E02.b : tttttggagccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0033_F05.b : nnnnggcataaannnggagtatagcagcxxxxxxxxx
MLN01_0055_F09.b : nnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0087_F09.b : cagttgtcxxxxxxxxxxxxxxxxxxxx
THY01_0123_D12.b : gttgcaaaaacaxxxxxx
THY01_0125_F04.b : gttgtcxxxxxxxxxxxxxxxxx
PTG01_0066_D10.b : ggtaaannnnnnggagtaagcagcxxxxxxxx
OVR01_0076_D08.b : ctttagggaactatgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0013_H09.b : gtgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0021_F10.b : gtggacctattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0082_C11.b : nntttgctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0044_A06.b :
ITT01_0020_D05.b : nnggatgaacaxxxxxxxxxxx
MLN01_0078_D08.b : nngggtaggactagacagtttgtacxxxxxxxxxxxxxxxxxxx
LVR01_0017_B08.b : aatttgggtggactanntagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0097_G06.b : nnnnnggcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0010_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0025_D01.b : nttttgataggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0033_D01.b :
THY01_0112_F11.b : gttgcaaaacxxxxxxxxxx
LVRM1_0165_H11.b : gtcxxxxxxxxxxxxxxxxxx
OVR01_0104_C10.b : ngctaggactatgacagtttgacxxxxxxxxxxxxxxxxx
MLN01_0018_A07.b : cccccggcatggagttcacagtttgtxxxxxxxxxxxxxxxxx
PST01_0067_C11.b :
SKNB1_0067_G01.b :
OVRM1_0017_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0036_H02.b : gggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0045_H12.b : tgttttgagtttgcattgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0018_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRT1_0129_E03.b : nnnggcatcacccnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0082_E09.b :
OVRT1_0055_A02.b : nggctttnnnnnnntcctatagcgnacgxxxxxxxxxxxxxxxxxx
MLN01_0102_C11.b : ngggggttggactatgacxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0062_B12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0064_A02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LVRM1_0089_F02.b : tcxxxxxxxxxxxxxxxx
LVRM1_0192_D12.b : xxxxxxxxx
LVRM1_0113_A05.b : tagttgtcxxxxxxxxxxxxxxxxx
THY01_0020_F12.b : gccaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0031_B05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0069_D03.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0081_C07.b : nngggcgttnnnnnntggataaagcagcxxxxxx
OVRT1_0125_D08.b : nnccttcagcgnaggxxxxxxxxxxxxxxxxxx
OVR01_0090_E09.b : nggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0047_F12.b : nggggtttttntnggagtaagcagcxxxx
LNG01_0004_D12.b : gccattttggtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0051_H10.b : nnnttgcatggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0038_D07.b : gggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_F04.b : gggggttagtttggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0033_F04.b :
THY01_0097_B06.b : gaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0034_A08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LVR01_0030_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0030_H11.b : nnttgctaggacatgacagtttgtacxxxxxxxxxxxxxxxx
LNG01_0004_A12.b : gggatttggctgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0091_G04.b : nccggttnnnnnnccccgttagcgnacgxxxxxxxxxxxxxxxxxx
LVR01_0077_H10.b : agcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0104_E06.b : nggtaggatatagacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0078_E02.b : nnnggatgaacaxxxxxxxx
ILNT1_0088_E10.b : nnnaatcgagtagacgccgtax
LVR01_0012_A08.b : ggggttaggccatgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0010_A01.b : nnntttcctggatatgacagtttgtacxxxxxxxxxxxxxxxx
UTR01_0106_A11.b : nnnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0084_H07.b :
LNG01_0071_B05.b : nnntttgatgtacttgacagtttgtcxxxxxxxxxxxxxxxx
SKNB1_0059_E09.b :
LVRM1_0067_A10.b : cxxxxxxxxxxxxxxxxxxx
LVRM1_0172_C07.b : cagttgtacxxxxxxxxxxxxxxx
THY01_0123_F03.b : gttgcaaaacaxxx
LVRM1_0079_A04.b : cgttgacxxxxxxxxxxxxx
LVRM1_0049_B02.b : cagttgtcxxxxxxxxxxxxxx
OVR01_0054_B12.b : nnntttgatagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0042_F02.b : gggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_B01.b : gggggaattttatagcttagtgactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0018_A05.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0050_D11.b : nttggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0024_D08.b : nnggctttttnnnggataaagcagcxxxxx
LNG01_0002_H12.b : tggagcatttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0030_F07.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0014_D04.b : gagtttataannggatacagcagcx
OVR01_0093_G11.b : nnnnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0059_A04.b : cgcattatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0082_E08.b : nnnnttcagnnnnnggctggacttgacagtttgtcxxxxxxxxxxxxxxx
OVR01_0015_A08.b : ttggggagtgactattagaactagttttggacaaaaatgctggctcgtaccgg
LNG01_0025_E05.b : ccattatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0095_A05.b : nncgctttnnnnnnnnnccgttctgctcacgaagatactacagctcat
MLN01_0025_A11.b : nngggtaggacttgacagtttgtcxxxxxxxxxxxxxxx
MLN01_0056_D12.b : nnnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0203_F10.b :
LVRM1_0048_G03.b : xxxxxxxxxx
PTG01_0102_C06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0037_F10.b : nagttgtcxxxxxxxxxxxxxxx
LVRM1_0101_H02.b : cagttgtcxxxxxxxxxxxxxxxx
SMG01_0054_B08.b : nnggcttttttttngggtaaagcagcggn
MLN01_0018_A08.b : nnnnattatggacttnaagtttgtxxxxxxxxxxxxxxxx
SMG01_0066_A01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0101_A12.b : nnttgcgatggacatagnaagtttnacxxxxxxxxxxxxxxx
LVR01_0106_A02.b : ggggcttaaagcatagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0086_A05.b : nttggcttggactataacxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0091_H02.b : aagttgtcxxxxxxxxxxxxxxx
LVRM1_0107_C07.b : tagttgtcxxxxxxxxxxxxxxxx
OVR01_0082_H12.b : nggcttgtgatatgacxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0191_B03.b : cxxxxxxxxxxxxxxx
LVRM1_0195_E09.b : xxxxxxxxxxx
OVRM1_0037_C05.b : gtcxxxxxxxxxxxxxxx
LVRM1_0202_F10.b : xxxxxxx
LVRM1_0018_C08.b : gtcxxxxxxxxxxxxxxx
THY01_0005_B06.b : axxxxxxxxx
LVRM1_0078_H03.b : agttgacatxxxxxxxxxxxxx
SPL01_0034_D02.b : tttttggcatggactatnacxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0110_B12.b : cagttgtcxxxxxxxxxxxxxxx
OVRM1_0100_E11.b : nagttgtcxxxxxxxxxxxxxxx
LVRM1_0077_G10.b : agttgacatxxxxxxxxxxxxx
OVR01_0083_G11.b : gcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0069_G11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0059_A04.b : ncctgcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0052_B11.b : nncctgctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0053_C08.b : tggcttaggacttaaacxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0021_A12.b : atxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0014_C07.b : tggtggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0149_A10.b : nnnccgtcagctgagxxxxxxxxxxxxxxxxx
SPL01_0010_B04.b : cttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0025_H03.b : tgggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0004_B06.b : gccaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0045_E08.b : ttttgggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0015_C12.b : ggtggaacttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0016_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0005_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0004_A06.b : gccaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0014_H05.b : ttagcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0020_D03.b : nntttccgtggacttgacxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0058_E11.b : nnggctctannnnntgataaagcagcxx
SPL01_0041_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0005_H04.b : gcccnnncaggatacagagctg
MLN01_0077_F06.b : ngctaggacatgacxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0072_F09.b : nnnnnccgttctgcgcacgxxxxxxxxxxxxxxxxx
PTG01_0016_E04.b : nnnggacctattnnnggagtaaagcagcxxxx
UTR01_0072_D04.b : tttgggtggagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0036_D03.b : nnnggtgaaacaxxxxxx
PTG01_0083_G09.b : nnnaatgagtaaagcagc
UTR01_0087_D11.b : nnnggcttggactaaaacxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0149_E04.b : nnnnccgttagcngtaggxxxxxxxxxxxxxxxxx
CLNT1_0129_C08.b : nnnnccttcagcgtacgxxxxxxxxxxxxxxxxx
THY01_0040_B07.b : ggggggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0065_G01.b : ngggaacccnnnagctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0036_E01.b : tgggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0069_C05.b : tcgggtggatggacatgacagtttgtacxxxxxxxxxxxxxx
OVR01_0035_B09.b : agggattttggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_G02.b : attttggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_H02.b : aaaaactggcatttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0103_G09.b : nntttgctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0044_G03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVR01_0033_D12.b : tgaaagcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0047_D06.b : ggggtgtttttaagcttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0037_H11.b : acaggcattatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0033_A08.b : nnnggatgaacaxxxxxx
SPL01_0038_C12.b : agagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_G07.b : ggggagtctcttgggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0009_G03.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0077_G12.b : nnaaagagtxxxxxxxxx
SMG01_0015_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVR01_0043_A07.b : gggatctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0077_C06.b : nnnnnnnnnnnnnnnnnnnn
ADR01_0051_B11.b : ccccnnggactacacaxxxxxx
LVR01_0049_G11.b : gctttatggctgattatagtaacxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0112_E04.b : nnnnnccgtcagcgnaggxxxxxxxxxxxxxxxx
OVR01_0091_D12.b : nnnnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0033_G08.b : nnnngggtaggatatgacagtttgtacxxxxxxxxxxxxxx
SMG01_0029_D10.b : nnnnccgttaannnnggataaacagcgg
SMG01_0033_C08.b : nnggggaattnnnngggtcaacagcxxx
CLNT1_0128_F12.b : ngcgttannnnncncccgttagcgnacgxxxxxxxxxxxxxxxxx
OVR01_0054_H06.b : nnnggcttgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0108_H07.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxxxx
MLN01_0080_H03.b : nnnngattggactatgacxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0058_H12.b : aacagcatttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0146_F04.b : nnnnnccgatagcggacgxxxxxxxxxxxxxxxxx
SMG01_0080_E10.b : ngctacaannnnggagtaagcagcggt
ITT01_0074_B02.b : nnnggatgaacaxxxxxxx
PBL01_0038_G01.b : gtgaacaxxxxx
LVR01_0045_F12.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0095_F04.b : nnnggcttggactataacxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0044_C12.b : nnnggctaggacttgacagtttgtacxxxxxxxxxxxxxx
BFLT1_0092_E03.b : ngggatcgttcagctgtcngxxxxxxxxxxxxxxxxx
SMG01_0085_F02.b : ttttttgagtaagcagcgg
PBL01_0042_D09.b : nnggtgcaacaxxxxxx
THY01_0065_C11.b : cctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0051_D06.b : nnnnaagcatggactaaaacxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0060_B05.b : tgacttaaacxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_C03.b : gctaacacagcttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0039_D07.b : ggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0053_H04.b : aaaaanggataggactatgacagtttgtcxxxxxxxxxxxxxxx
THY01_0038_C05.b : ggtgacccttataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0065_E04.b : nnnccgtttgctgacgxxxxxxxxxxxxxxxxxx
SPL01_0036_C03.b : gggctctatgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0002_G07.b : gcatttggctgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0059_D05.b : tttttagcattggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0099_B03.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0001_F08.b : nnaaatctctagctgacgagtgxxxxxxxxxxxxx
OVR01_0008_A08.b : cttatagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_A07.b : gggcattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0015_B10.b : gggtccgtctgcgnacgxxxxxxxxxxxxxxxxxx
MLN01_0078_F10.b : nggctaggacttaaacxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0010_E11.b : nnnnnccgtcagcgcacgxxxxxxxxxxxxxxxx
LNG01_0033_A10.b : tgttgttttaatttgcattgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_G07.b : gggggagtcnngggcatagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0022_D07.b : nnncccctatagcgnacgxxxxxxxxxxxxxxxxxx
LNG01_0069_E10.b : acgnnnggatggatatgacagtttgtcxxxxxxxxxxxxxxx
SPL01_0070_H08.b : nnnggcttggacttaaacxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0050_F02.b : nnggcgagtnnngggganagtatagcggacgxxxxxxxxxxxxxxxxx
CLNT1_0050_C08.b : nnggcgattnnnggggnccgttagcgnacgxxxxxxxxxxxxxxxxx
OVR01_0021_F05.b : tgtggatgaacctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0096_A03.b : ggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0039_H08.b : nnntttcgttagcgnaggxxxxxxxxxxxxxxxxx
THY01_0008_A05.b : cattatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0088_D10.b : nnnggtgtnnnnggganccatcagcgnacgxxxxxxxxxxxxxxxx
LNG01_0010_H10.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0090_F02.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0061_G05.b : gggggaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0049_C08.b : nggtgtttnnnnnnnnccgttagcggacgxxxxxxxxxxxxxxxxx
MLN01_0045_B10.b : nnnnnggttgtactatgacxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0004_D11.b : gtatacgttcgcgnacgxxxxxxxxxxxxxxxxx
ITT01_0095_E07.b : nnaatgxxxxxxxxxxx
PBL01_0087_B11.b : nnaagtgxxxxxxxxx
SPL01_0104_F04.b : nnnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0075_E01.b : nngggatgaacaxxxxxx
THY01_0204_B06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0004_C01.b : nggatccgttcgctgacgxxxxxxxxxxxxxxxxx
LNG01_0043_C04.b : ccttcttcccggtttcgtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0001_E08.b : nnnnggagtaacaxxxxxx
LNG01_0012_C03.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0040_A11.b :
MLN01_0062_F06.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0098_D08.b : nnnnnaagttggacttgacagtttgtcxxxxxxxxxxxxxxx
UTR01_0060_B02.b : tttttttttttatcacgtttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0076_D05.b : nnnggatgaacaxxxxxxx
CLNT1_0041_G01.b : attccgttagcgnacgxxxxxxxxxxxxxxxxx
LVRM1_0080_B01.b : agttgacxxxxxxxxxxxxx
OVRM1_0056_F10.b : cgttgxxxxxxxxxxxxxxx
ADR01_0052_D04.b : agccnnnggatacacaxxxxx
SKNB1_0002_E09.b :
OVRT1_0140_C11.b : nnaaggcgagaccnnnnnccgttcgcgttacgatgtacttcgct
LNG01_0107_A01.b : tcgatggacttagnaagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0033_H09.b : ntttgtgaacaxxxxxx
OVRT1_0070_H03.b : nnntttcttcagcgcacgxxxxxxxxxxxxxxxxx
PST01_0001_A11.b :
CLNT1_0144_A06.b : nnnnnccgtcagcgnacgxxxxxxxxxxxxxxxx
LNG01_0110_D07.b : ttctnnggacggacttgacxxxxxxxxxxxxxxxxxxxx
ITT01_0063_H06.b : nnnnggagxxxxxxxxxx
LNG01_0109_F07.b : nnnntttgacggaatatgacxxxxxxxxxxxxxxxxxxxxx
ITT01_0088_C04.b : nnnggatgaacaxxxxx
THY01_0121_D03.b : gttgcaaaacgg
PTG01_0097_E07.b : nnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0064_G02.b : nnnnggcttgtgacttnacxxxxxxxxxxxxxxxxxxxxx
LVR01_0018_H10.b : cctttatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0033_F10.b : ngctaggactatgacxxxxxxxxxxxxxxxxxx
THY01_0205_D02.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0009_D05.b : gacattatgggctattctgggggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0004_F08.b : ccccccagagaaacaxxx
LVRM1_0001_H10.b : cxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0067_D06.b : nagtttgtcxxxxxxxxxxxxx
LVR01_0053_D05.b : gggggggattttngggcttgggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0042_F07.b : nnggcgatttnnnnnnggataaagcagcx
MLN01_0064_D10.b : ggtaggacttgacxxxxxxxxxxxxxxxxxxxxxx
LNG01_0087_G10.b : gggttgtgttcgacttgnxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0042_A05.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0104_E06.b : nttgcatggactatgacxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0045_C09.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxx
OVR01_0093_C12.b : ttnnnnnnnnnnnnnnnnnngggcattggacattcacxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0040_G10.b : gactcttctgcgtacgagtgxxxxxxxxxxx
OVR01_0006_H10.b : aggggggccctattttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0074_C07.b : tcttttggggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0100_D10.b : nggttcctactgcgcacgxxxxxxxxxxxxxxx
PTG01_0082_C12.b : ngcgtcnnnnttatgagtaagcagcxx
PTG01_0050_H04.b : nggccaaatnnnngagtaaagcagcg
PBL01_0063_G05.b : nggtgaaacaxxxx
CLNT1_0023_H04.b : ntttctatagcggacgagtgxxxxxxxxxxx
LNG01_0108_D12.b : nnntttgctggacttgacxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0060_A11.b : nggattacgttcagcgtacgagtgxxxxxxxxxxx
ITT01_0013_F04.b : nggatgaacaxxx
THY01_0100_H04.b : ggcatttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0100_G09.b : nntttccgtcagcgcacgxxxxxxxxxxxxxxx
UTR01_0061_B12.b : gggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0008_A02.b : nnattccgttagctgacgxxxxxxxxxxxxxxx
MLN01_0059_D12.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxx
LVR01_0105_A02.b : tggtgaaaaaggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0095_A02.b : nnntttcgttctgcgtacgagtgxxxxxxxxxxxx
MLN01_0076_B10.b : nnngggtaggacttgacxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0090_F08.b : nnggggttnnnnnggccccgttagcgnacgxxxxxxxxxxxxxxx
LVR01_0104_C04.b : gggcgaacctgcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0048_H06.b : cttttggatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0025_C04.b : catttatgctgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0205_G05.b : cctttatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0009_D10.b : nnnggtgxxxxxxxxxx
ITT01_0043_C06.b : nnggatgaacxxxxx
ITT01_0098_A12.b : nnnggatgaacaxxxx
ADR01_0076_C06.b : nnnaagggatgaacagc
SKNB1_0051_H08.b :
SKNB1_0040_F06.b :
SKNB1_0097_A08.b :
OVRM1_0165_B03.b : agttgtcxxxxxxxxxx
SPL01_0084_A10.b : nnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxx
TES01_0106_A02.b :
SPL01_0086_H03.b : nnnggcatggactatnacxxxxxxxxxxxxxxxxxxxx
SPL01_0079_B04.b : nnnnggctaggacttanacxxxxxxxxxxxxxxxxxxx
THY01_0038_E09.b : ggggaaatataxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0024_C07.b :
PST01_0054_B10.b :
KDN01_0086_A08.b :
UTR01_0009_G02.b : cttttcgcggcxxxxxxxxxxxxxxxxxxx
OVR01_0067_F02.b : nnnnggattgtgacttgacagtttg
LNG01_0033_D11.b : attgggtxxxxxxxxxxxxxxxxxxxxx
KDN01_0061_H06.b :
SPL01_0009_H04.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0067_F04.b :
HTMT1_0095_A01.b :
PCT01_0024_H06.b :
ITT01_0042_D04.b :
OVRT1_0004_F10.b :
UTR01_0071_D04.b : tgtgatctgacagtttgtaacaaagacgctg
OVRT1_0080_H12.b :
MLN01_0007_D01.b :
LNG01_0091_G06.b :
SPLT1_0042_H06.b :
ADR01_0062_B08.b :
20110601C-001050 : AGCGTTTATAGGGCGCCGCGGCGGCGCTGCCGACTGCACAACAGTC*CGAGGCCATCGTC
---------+---------+---------+---------+---------+---------+ 286
OVRT1_0030_A10.b : AGCGTTTATAGGGCGCCGCGGCGGCGCTGCCGAGCCCACAACAGTC*CGAGGCCATCGTC
OVRM1_0043_C03.b : AGCGTTTATAGGGCGCCGCGGCGGCGCTGCCGAGCCCACAACAGTC*CGAGGCCATCGTC
LNG01_0090_A04.b : AGCGTTTATAGGGCGCCGCGGCGGCGCTGCCGAGCCCACAACAGTC*CGAGGCCATCGTC
THY01_0203_H04.b : AGCGTTTATAGGGCGCCGCGGCGGCGCTGCCGAGCCCACAACAGTC*CGAGGCCATCGTC
PBL01_0009_H08.b : AGCGTTTATAGGGCGCCGCGGCGGCGCTGCCGAGCCCACAACAGTC*CGAGGCCATCGTC
PTG01_0086_H10.b : nnnggTTATANGGCGCCGCGGCGGCGCTGCCGAGCCCACAACAGTC*CGAGGCCATCGTC
OVRT1_0093_A05.b : xxxxxxxxTAGGGCGCCGCGGCGGCGCTGCCGAGCCCACAACAGTC*CGAGGCCATCGTC
OVRM1_0084_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxgTTGGCCTACTGGACAACAGTC*CGAGGCCATCGTC
SPL01_0105_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCCCACAACAGTC*CGAGGCCATCGTC
THY01_0030_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggACTGGACAACAGTC*CGAGGCCATCGTC
SMG01_0037_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxgtcggACTGGACAACAGTC*CGTGGCCATCGTC
THY01_0022_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcTGGACACAACAGTC*CGAGGCCATCGTC
ADR01_0033_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtACTGGATAACAGTC*CGAGGCCATCGTC
MLN01_0055_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcTGGACACAACAGTC*CGAGGCCATCGTC
LVRM1_0087_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGACAACAGTC*CGAGGCCATCGTC
THY01_0123_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGGACACAACAGTC*CGAGGCCATCGTC
THY01_0125_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGACAACAGTC*CGAGGCCATCGTC
PTG01_0066_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCCACAACAGTC*CGAGGCCATCGTC
OVR01_0076_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGACAACAGTC*CGAGGCCATCGTC
THY01_0013_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGACACAACAGTC*CGAGGCCATCGTC
UTR01_0021_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGACAACAGTC*CGAGGCCATCGTC
UTR01_0082_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCCACAACAGTC*CGAGGCCATCGTC
TES01_0044_A06.b : tgcgttggctCTGGAAAACAGTC*CGAGGCCATCGTC
ITT01_0020_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGACAACAGTC*CGAGGCCATCGTC
MLN01_0078_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGACAACAGTC*CGAGGCCATCGTC
LVR01_0017_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGACAACAGTC*CGAGGCCATCGTC
SPL01_0097_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGACAACAGTC*CGAGGCCATCGTC
OVR01_0010_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGACAACAGTC*CGAGGCCATCGTC
TCH01_0025_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGACAACAGTC*CGAGGCCATCGTC
PST01_0033_D01.b : nttactgctgtggctCTGGACCACAGTC*CGAGGCCATCGTC
THY01_0112_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcTGGAC*ACAGTC*CGAGGCCATCGTC
LVRM1_0165_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGACAACAGTC*CGAGGCCATCGTC
OVR01_0104_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggTGGACAACAGTC*CGAGGCCATCGTC
MLN01_0018_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGACAACAGTC*CGAGGCCATCGTC
PST01_0067_C11.b : tttttactgcgttggctaTGGACCACAGTC*CGAGGCCATCGTC
SKNB1_0067_G01.b : nntttccacggtggctaTGGACACAGTC*CGAGGCCATCGTC
OVRM1_0017_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACAACAGTC*CGAGGCCATCGTC
THY01_0036_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcACACAACAGTC*CGAGGCCATCGTC
LNG01_0045_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACAACAGTC*CGAGGCCATCGTC
TCH01_0018_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxTCACAACAGTC*CGAGGCCATCGTC
OVRT1_0129_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggCCACAACAGTC*CGAGGCCATCGTC
SKNB1_0082_E09.b : nnnngggaannnngnnncctgcgttggctcTGGACACAGTC*CGAGGCCATCGTC
OVRT1_0055_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACAACAGTC*CGAGGCCATCGTC
MLN01_0102_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACACAACAGTC*CGAGGCCATCGTC
LVRM1_0062_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggCACAACAGTC*CGAGGCCATCGTC
PTG01_0064_A02.b : nnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxctggCACAACANTC*CGAGGCCATCGTC
LVRM1_0089_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
LVRM1_0192_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
LVRM1_0113_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
THY01_0020_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAACAGTC*CGAGGCCATCGTC
OVRM1_0031_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
THY01_0069_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
SMG01_0081_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGAACAGTC*CGAGGCCATCGTC
OVRT1_0125_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
OVR01_0090_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
SMG01_0047_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
LNG01_0004_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
OVR01_0051_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctGACAACAGTC*CGAGGCCATCGTC
THY01_0038_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
LVR01_0048_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
SKNB1_0033_F04.b : nnnggggttnnnntnncctacgttgtgcanTGGAACAGTC*CGAGGCCATCGTC
THY01_0097_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
SMG01_0034_A08.b : nnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxTGGAACAGTC*CGAGGCCATCGTC
LVR01_0030_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
MLN01_0030_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
LNG01_0004_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGACAACAGTC*CGAGGCCATCGTC
OVRT1_0091_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGACAACAGTC*CGAGGCCATCGTC
LVR01_0077_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCAACGTC
LVR01_0028_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
MLN01_0104_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggCACAACAGTC*CGAGGCCATCGTC
ITT01_0078_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
ILNT1_0088_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAACAGTC*CGACGCCATCGTC
LVR01_0012_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
MLN01_0010_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
UTR01_0106_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
PST01_0084_H07.b : nttactgctgtggctcTGGAACAGTC*CGAGGCCATCGTC
LNG01_0071_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
SKNB1_0059_E09.b : nnnnnnctcgctgtggctaTGGAACAGTC*CGAGGCCATCGTC
LVRM1_0067_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACAGTC*CGAGGCCATCGTC
LVRM1_0172_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAACAGTC*CGAGGCCATCGTC
THY01_0123_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggGGAACAGTC*CGAGGCCATCGTC
LVRM1_0079_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtACAACAGTC*CGAGGCCATCGTC
LVRM1_0049_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACAGTC*CGAGGCCATCGTC
OVR01_0054_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACAGTC*CGAGGCCATCGTC
UTR01_0042_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACAGTC*CGAGGCCATCGTC
LVR01_0048_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCAACAGTC*CGAGGCCATCGTC
UTR01_0018_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACAGTC*CGAGGCCATCGTC
OVR01_0050_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCAACAGTC*CGAGGCCATCGTC
PTG01_0024_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtACAACAGTC*CGAGGCCATCGTC
LNG01_0002_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACAGTC*CGAGGCCATCGTC
LNG01_0030_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACAGTC*CGAGGCCATCGTC
SMG01_0014_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACAGTC*CGAGGCCATCGTC
OVR01_0093_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCAACAGTC*CGAGGCCATCGTC
UTR01_0059_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACAGTC*CGAGGCCATCGTC
LNG01_0082_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaACAACAGTC*CGAGGCCATCGTC
OVR01_0015_A08.b : ggtccgaaattcctccgtgcaccgtaggcctcctcggACAACAGTT*CGTGTGCATCGTC
LNG01_0025_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACAGTC*CGAGGCCATCGTC
OVRT1_0095_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaggTCAACAGTC*CGAGGCCATCGTC
MLN01_0025_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAACAGTC*CGAGGCCATCGTC
MLN01_0056_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACAGTC*CGAGGCCATCGTC
LVRM1_0203_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVRM1_0048_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
PTG01_0102_C06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnCAACANTC*CGAGGCCATCGTC
OVRM1_0037_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVRM1_0101_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SMG01_0054_B08.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
MLN01_0018_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SMG01_0066_A01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LNG01_0101_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVR01_0106_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0086_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVRM1_0091_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVRM1_0107_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgacCAACAGTC*CGAGGCCATCGTC
OVR01_0082_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRM1_0191_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVRM1_0195_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRM1_0037_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVRM1_0202_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVRM1_0018_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0005_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVRM1_0078_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SPL01_0034_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRM1_0110_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRM1_0100_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVRM1_0077_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0083_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRM1_0069_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0059_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0052_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
TCH01_0053_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRM1_0021_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
UTR01_0014_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0149_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SPL01_0010_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
UTR01_0025_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0004_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0045_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
UTR01_0015_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0016_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcACACAGTC*CGAGGCCATCGTC
THY01_0005_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0004_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0014_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
MLN01_0020_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SMG01_0058_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SPL01_0041_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTCTCGAGGCCATCGTC
PBL01_0005_H04.b : gaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
MLN01_0077_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRT1_0072_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
PTG01_0016_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
UTR01_0072_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
ADR01_0036_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcACACAGTC*CGAGGCCATCGTC
PTG01_0083_G09.b : ggtacggntcggaaatcctcgagcacggttggccctggACACAGTC*CGAGGCCATCGTC
UTR01_0087_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRT1_0149_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0129_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0040_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0065_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
UTR01_0036_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LNG01_0069_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0035_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVR01_0011_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVR01_0062_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SPL01_0103_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SMG01_0044_G03.b : nnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0033_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVR01_0047_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SPL01_0037_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
ITT01_0033_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SPL01_0038_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVR01_0051_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LNG01_0009_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGCC
ITT01_0077_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SMG01_0015_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0043_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
PTG01_0077_C06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
ADR01_0051_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVR01_0049_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRT1_0112_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0091_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
MLN01_0033_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SMG01_0029_D10.b : naxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SMG01_0033_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0128_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0054_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRT1_0108_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
MLN01_0080_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
UTR01_0058_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRT1_0146_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SMG01_0080_E10.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
ITT01_0074_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
PBL01_0038_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVR01_0045_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0095_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
MLN01_0044_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
BFLT1_0092_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SMG01_0085_F02.b : taxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
PBL01_0042_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0065_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SPL01_0051_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
MLN01_0060_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVR01_0061_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0039_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0053_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0038_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0065_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SPL01_0036_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LNG01_0002_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVR01_0059_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0099_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRT1_0001_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0008_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVR01_0089_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0015_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcACACAGTC*CGAGGCCATCGTC
MLN01_0078_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRT1_0010_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LNG01_0033_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVR01_0050_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRT1_0022_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LNG01_0069_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SPL01_0070_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0050_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0050_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0021_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0096_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRT1_0039_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0008_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0088_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LNG01_0010_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0090_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0061_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0049_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
MLN01_0045_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0004_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
ITT01_0095_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
PBL01_0087_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SPL01_0104_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
PBL01_0075_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CCAGGCCATCGTC
THY01_0204_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0004_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LNG01_0043_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
ITT01_0001_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LNG01_0012_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SKNB1_0040_A11.b : nnnnnccttgctgttggctACACAGTC*CGAGGCCATCGTC
MLN01_0062_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LNG01_0098_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
UTR01_0060_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
ITT01_0076_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0041_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVRM1_0080_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTC*CGAGGCCATCGTC
OVRM1_0056_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTC*CGAGGCCATCGTC
ADR01_0052_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTC*CGAGGCCATCGTC
SKNB1_0002_E09.b : ttctcgctgtggcCACAGTC*CGAGGCC*TCGTC
OVRT1_0140_C11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaaAACAGTC*CGAGGCCATCGTC
LNG01_0107_A01.b : xxxxxxxxxxxtatcgagtcagccttattggcctactggAACAGTC*CGAGGCCATCGTC
ITT01_0033_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTC*CGAGGCCATCGTC
OVRT1_0070_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgaAACAGTC*CGAGGCCATCGTC
PST01_0001_A11.b : ngcccaaatnntnnngctgacgtgtgctcggnacCACANTC*CGAGGCCATCNTC
CLNT1_0144_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccgtaAACAGTC*CGAGGCCATCGTC
LNG01_0110_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACAGTC*CGAGGCCATCGTC
ITT01_0063_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTC*CGAGGCCATCGTC
LNG01_0109_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACAGTC*CGAGGCCATCGTC
ITT01_0088_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTC*CGAGGCCATCGTC
THY01_0121_D03.b : cggtccggtccggaatcctcagcactgttggcctatggacACAGTC*CGAGGCCATCGTC
PTG01_0097_E07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxtACAGTC*CGAGGCCATCGTC
SPL01_0064_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxacgACAGTC*CGAGGCCATCGTC
LVR01_0018_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgACAGTC*CGAGGCCATCGTC
TCH01_0033_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGTC*CGAGGCCATCGTC
THY01_0205_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGTC*CGAGGCCATCGTC
OVR01_0009_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaggtACAGTC*CGAGGCCATCGTC
PBL01_0004_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
LVRM1_0001_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
OVRM1_0067_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
LVR01_0053_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
SMG01_0042_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
MLN01_0064_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
LNG01_0087_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
UTR01_0042_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
OVR01_0104_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
OVRT1_0045_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
OVR01_0093_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
CLNT1_0040_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
OVR01_0006_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
THY01_0074_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
OVRT1_0100_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
PTG01_0082_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
PTG01_0050_H04.b : gtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
PBL01_0063_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
CLNT1_0023_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
LNG01_0108_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
OVRT1_0060_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
ITT01_0013_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCTTTGTC
THY01_0100_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
OVRT1_0100_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
UTR01_0061_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
OVRT1_0008_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
MLN01_0059_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
LVR01_0105_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
OVRT1_0095_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
MLN01_0076_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
OVRT1_0090_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
LVR01_0104_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaatCAGTC*CGAGGCCATCGTC
UTR01_0048_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
LNG01_0025_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
THY01_0205_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
ITT01_0009_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
ITT01_0043_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
ITT01_0098_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
ADR01_0076_C06.b : tgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
SKNB1_0051_H08.b : nnnttttttanntnnncctgcgttgtgcttggacaAGTC*CGAGGCCATCGTC
SKNB1_0040_F06.b : nnnnnctcgctgtggcaggnaAGTC*CGAGGCCATCGTC
SKNB1_0097_A08.b : nnnncctcgctgtggctctggataAGTC*CGAGGCCATCGTC
OVRM1_0165_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTC*CGAGGCCATCGTC
SPL01_0084_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTC*CGAGGCCATCGTC
TES01_0106_A02.b : ttttcctgctgttgctctggacacGTC*CGAGGCCATCGTC
SPL01_0086_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTC*CGAGGCCATCGTC
SPL01_0079_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTC*CGAGGCCATCGTC
THY01_0038_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTC*CGAGGCCATCGTC
KDN01_0024_C07.b : nttttcctgctgtggctatggacacGTC*CGAGGCCATCGTC
PST01_0054_B10.b : nnnttcgctgtggctctggacacGTC*CGAGGCCATCGTC
KDN01_0086_A08.b : nnnnnncctgctgtggctatggacacGTC*CGAGGCCATCGTC
UTR01_0009_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGTC
OVR01_0067_F02.b : tacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGTC
LNG01_0033_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGTC
KDN01_0061_H06.b : acgttggctctggacacgtccgaggccTCGTC
SPL01_0009_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGTC
ADR01_0067_F04.b : nnnttgtaaannnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0095_A01.b : nttttgcgatagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0024_H06.b : nnnnggggctttcatannnnncgcatgcgttgtgctcgtnacacattccgaggacatctt
ITT01_0042_D04.b :
OVRT1_0004_F10.b :
UTR01_0071_D04.b : gtatccgtcccgaatttctccagcactgttggnccactggnaaatcgtcccagggcactc
OVRT1_0080_H12.b :
MLN01_0007_D01.b :
LNG01_0091_G06.b :
SPLT1_0042_H06.b :
ADR01_0062_B08.b :
20110601C-001050 : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
---------+---------+---------+---------+---------+---------+ 344
OVRT1_0030_A10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRM1_0043_C03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0090_A04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0203_H04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PBL01_0009_H08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PTG01_0086_H10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0093_A05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRM1_0084_C03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SPL01_0105_A03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0030_H01.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SMG01_0037_C04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0022_E02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ADR01_0033_F05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
MLN01_0055_F09.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVRM1_0087_F09.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0123_D12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0125_F04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PTG01_0066_D10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0076_D08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0013_H09.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
UTR01_0021_F10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
UTR01_0082_C11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
TES01_0044_A06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCT*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ITT01_0020_D05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
MLN01_0078_D08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVR01_0017_B08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SPL01_0097_G06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0010_G11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
TCH01_0025_D01.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PST01_0033_D01.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*TCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0112_F11.b : C*CGCCCGCCCGAAGCCACGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVRM1_0165_H11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0104_C10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
MLN01_0018_A07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PST01_0067_C11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SKNB1_0067_G01.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRM1_0017_A09.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0036_H02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0045_H12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
TCH01_0018_A04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0129_E03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SKNB1_0082_E09.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0055_A02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
MLN01_0102_C11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVRM1_0062_B12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PTG01_0064_A02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVRM1_0089_F02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVRM1_0192_D12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVRM1_0113_A05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0020_F12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRM1_0031_B05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0069_D03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SMG01_0081_C07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0125_D08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0090_E09.b : C*CCTTCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SMG01_0047_F12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0004_D12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0051_H10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0038_D07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVR01_0048_F04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SKNB1_0033_F04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0097_B06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SMG01_0034_A08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVR01_0030_A04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
MLN01_0030_H11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0004_A12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0091_G04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVR01_0077_H10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVR01_0028_A05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
MLN01_0104_E06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ITT01_0078_E02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ILNT1_0088_E10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVR01_0012_A08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
MLN01_0010_A01.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
UTR01_0106_A11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PST01_0084_H07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0071_B05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SKNB1_0059_E09.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVRM1_0067_A10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVRM1_0172_C07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0123_F03.b : C*CGC*CGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVRM1_0079_A04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVRM1_0049_B02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0054_B12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
UTR01_0042_F02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVR01_0048_B01.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
UTR01_0018_A05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCN*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0050_D11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PTG01_0024_D08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0002_H12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0030_F07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SMG01_0014_D04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0093_G11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
UTR01_0059_A04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0082_E08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0015_A08.b : C*CGCCCGCCCGTGCCACCGCGTGCAGCCA*GCGCGCCGCGCAGCCCGAGGCCCGCGCAC
LNG01_0025_E05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0095_A05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
MLN01_0025_A11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
MLN01_0056_D12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVRM1_0203_F10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVRM1_0048_G03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PTG01_0102_C06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRM1_0037_F10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVRM1_0101_H02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SMG01_0054_B08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
MLN01_0018_A08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SMG01_0066_A01.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0101_A12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVR01_0106_A02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0086_A05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVRM1_0091_H02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVRM1_0107_C07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0082_H12.b : C*CCCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRM1_0191_B03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVRM1_0195_E09.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRM1_0037_C05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVRM1_0202_F10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVRM1_0018_C08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0005_B06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVRM1_0078_H03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SPL01_0034_D02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRM1_0110_B12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRM1_0100_E11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVRM1_0077_G10.b : C*CGCCCGCCCGAGCCGCCGCGAGCAGCCC*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0083_G11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRM1_0069_G11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0059_A04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0052_B11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
TCH01_0053_C08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRM1_0021_A12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
UTR01_0014_C07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
CLNT1_0149_A10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SPL01_0010_B04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
UTR01_0025_H03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0004_B06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0045_E08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
UTR01_0015_C12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0016_C11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0005_A06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0004_A06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0014_H05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
MLN01_0020_D03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SMG01_0058_E11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SPL01_0041_A07.b : CGCGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PBL01_0005_H04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
MLN01_0077_F06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0072_F09.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PTG01_0016_E04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
UTR01_0072_D04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ADR01_0036_D03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PTG01_0083_G09.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
UTR01_0087_D11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0149_E04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
CLNT1_0129_C08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0040_B07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0065_G01.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
UTR01_0036_E01.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0069_C05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0035_B09.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVR01_0011_G02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVR01_0062_H02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SPL01_0103_G09.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SMG01_0044_G03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0033_D12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVR01_0047_D06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SPL01_0037_H11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ITT01_0033_A08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SPL01_0038_C12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVR01_0051_G07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0009_G03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ITT01_0077_G12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SMG01_0015_G04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0043_A07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PTG01_0077_C06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ADR01_0051_B11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVR01_0049_G11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0112_E04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0091_D12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
MLN01_0033_G08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SMG01_0029_D10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SMG01_0033_C08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
CLNT1_0128_F12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0054_H06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0108_H07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
MLN01_0080_H03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
UTR01_0058_H12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0146_F04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SMG01_0080_E10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ITT01_0074_B02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PBL01_0038_G01.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVR01_0045_F12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0095_F04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
MLN01_0044_C12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
BFLT1_0092_E03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SMG01_0085_F02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PBL01_0042_D09.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0065_C11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SPL01_0051_D06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
MLN01_0060_B05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVR01_0061_C03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0039_D07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0053_H04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0038_C05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
CLNT1_0065_E04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SPL01_0036_C03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0002_G07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVR01_0059_D05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0099_B03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0001_F08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0008_A08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVR01_0089_A07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
CLNT1_0015_B10.b : C*CGCCCGCCCGACCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
MLN01_0078_F10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0010_E11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0033_A10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVR01_0050_G07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0022_D07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0069_E10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SPL01_0070_H08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
CLNT1_0050_F02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
CLNT1_0050_C08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0021_F05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0096_A03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0039_H08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0008_A05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
CLNT1_0088_D10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0010_H10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0090_F02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0061_G05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
CLNT1_0049_C08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
MLN01_0045_B10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
CLNT1_0004_D11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ITT01_0095_E07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PBL01_0087_B11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SPL01_0104_F04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGGCCGCGCAC
PBL01_0075_E01.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCACGCACGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0204_B06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
CLNT1_0004_C01.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0043_C04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ITT01_0001_E08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0012_C03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SKNB1_0040_A11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
MLN01_0062_F06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCACGCAGCCTGTGGCCCGCGCAC
LNG01_0098_D08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
UTR01_0060_B02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ITT01_0076_D05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
CLNT1_0041_G01.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVRM1_0080_B01.b : C*CGCCCGCCCGAGCCACCGCGAG*AGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRM1_0056_F10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ADR01_0052_D04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SKNB1_0002_E09.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0140_C11.b : C*CGCCCGCCCGAGCCACCTCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0107_A01.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ITT01_0033_H09.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0070_H03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PST01_0001_A11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
CLNT1_0144_A06.b : C*CGCCCGCCCGAGCCACCGCAAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0110_D07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ITT01_0063_H06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0109_F07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ITT01_0088_C04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0121_D03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PTG01_0097_E07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SPL01_0064_G02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVR01_0018_H10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
TCH01_0033_F10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0205_D02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0009_D05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCAGTGGCCCGCGCAC
PBL01_0004_F08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVRM1_0001_H10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRM1_0067_D06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVR01_0053_D05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SMG01_0042_F07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
MLN01_0064_D10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0087_G10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
UTR01_0042_A05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0104_E06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0045_C09.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0093_C12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
CLNT1_0040_G10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0006_H10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0074_C07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0100_D10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PTG01_0082_C12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PTG01_0050_H04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PBL01_0063_G05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
CLNT1_0023_H04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0108_D12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0060_A11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ITT01_0013_F04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0100_H04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0100_G09.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
UTR01_0061_B12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0008_A02.b : C*CGCCCGCCCGAGCCTCCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
MLN01_0059_D12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVR01_0105_A02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0095_A02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
MLN01_0076_B10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRT1_0090_F08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LVR01_0104_C04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
UTR01_0048_H06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0025_C04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0205_G05.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ITT01_0009_D10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ITT01_0043_C06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ITT01_0098_A12.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ADR01_0076_C06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SKNB1_0051_H08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SKNB1_0040_F06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SKNB1_0097_A08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVRM1_0165_B03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SPL01_0084_A10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
TES01_0106_A02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SPL01_0086_H03.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SPL01_0079_B04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
THY01_0038_E09.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
KDN01_0024_C07.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PST01_0054_B10.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
KDN01_0086_A08.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
UTR01_0009_G02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
OVR01_0067_F02.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
LNG01_0033_D11.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
KDN01_0061_H06.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
SPL01_0009_H04.b : C*CGCCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ADR01_0067_F04.b : xxxxxCCGCCCGAGCCACCGCGAGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
HTMT1_0095_A01.b : xxxxxxxxxxxxxxxgACCGCGTGCAGCCA*GCGCGCCGCGCAGCCTGTGGCCCGCGCAC
PCT01_0024_H06.b : cccccccgcccgtagccaccacgtattatctGCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ITT01_0042_D04.b : nnnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0004_F10.b : nnnnccctcttgctgtcngxxxxxxxxxxxxxxxxxxxxxx
UTR01_0071_D04.b : ttccccccgtcccagncctcctcagncgtccgtgcgtcctcncgtccgtggtcccnctct
OVRT1_0080_H12.b :
MLN01_0007_D01.b :
LNG01_0091_G06.b :
SPLT1_0042_H06.b :
ADR01_0062_B08.b :
20110601C-001050 : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
---------+---------+---------+---------+---------+---------+ 404
OVRT1_0030_A10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRM1_0043_C03.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0090_A04.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0203_H04.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PBL01_0009_H08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PTG01_0086_H10.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0093_A05.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRM1_0084_C03.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SPL01_0105_A03.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0030_H01.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SMG01_0037_C04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0022_E02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
ADR01_0033_F05.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
MLN01_0055_F09.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVRM1_0087_F09.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0123_D12.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0125_F04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PTG01_0066_D10.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0076_D08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0013_H09.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
UTR01_0021_F10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
UTR01_0082_C11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGGCAGG
TES01_0044_A06.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
ITT01_0020_D05.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
MLN01_0078_D08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVR01_0017_B08.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SPL01_0097_G06.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0010_G11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
TCH01_0025_D01.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PST01_0033_D01.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0112_F11.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGGCAGG
LVRM1_0165_H11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0104_C10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
MLN01_0018_A07.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PST01_0067_C11.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SKNB1_0067_G01.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRM1_0017_A09.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0036_H02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0045_H12.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
TCH01_0018_A04.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0129_E03.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SKNB1_0082_E09.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0055_A02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
MLN01_0102_C11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVRM1_0062_B12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PTG01_0064_A02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVRM1_0089_F02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVRM1_0192_D12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVRM1_0113_A05.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0020_F12.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRM1_0031_B05.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0069_D03.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SMG01_0081_C07.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0125_D08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0090_E09.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SMG01_0047_F12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0004_D12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0051_H10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0038_D07.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVR01_0048_F04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SKNB1_0033_F04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0097_B06.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SMG01_0034_A08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVR01_0030_A04.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
MLN01_0030_H11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0004_A12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0091_G04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVR01_0077_H10.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVR01_0028_A05.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
MLN01_0104_E06.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
ITT01_0078_E02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
ILNT1_0088_E10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVR01_0012_A08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
MLN01_0010_A01.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
UTR01_0106_A11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PST01_0084_H07.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0071_B05.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SKNB1_0059_E09.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVRM1_0067_A10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVRM1_0172_C07.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0123_F03.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVRM1_0079_A04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVRM1_0049_B02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0054_B12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
UTR01_0042_F02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVR01_0048_B01.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
UTR01_0018_A05.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAAAGCCCGGCCAGG
OVR01_0050_D11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PTG01_0024_D08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0002_H12.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0030_F07.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SMG01_0014_D04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0093_G11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
UTR01_0059_A04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0082_E08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0015_A08.b : CTAGGGTGCAGCGCCCAAGCCCTCATCGCGCCACGTTCCAGCCCGCAGTGCCCGGCCAGG
LNG01_0025_E05.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0095_A05.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
MLN01_0025_A11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
MLN01_0056_D12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVRM1_0203_F10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVRM1_0048_G03.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PTG01_0102_C06.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRM1_0037_F10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVRM1_0101_H02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SMG01_0054_B08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
MLN01_0018_A08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SMG01_0066_A01.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0101_A12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVR01_0106_A02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0086_A05.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVRM1_0091_H02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVRM1_0107_C07.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0082_H12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRM1_0191_B03.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVRM1_0195_E09.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRM1_0037_C05.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVRM1_0202_F10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVRM1_0018_C08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0005_B06.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVRM1_0078_H03.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SPL01_0034_D02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRM1_0110_B12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRM1_0100_E11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVRM1_0077_G10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0083_G11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAAAGCCCGGCCAGG
OVRM1_0069_G11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0059_A04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0052_B11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
TCH01_0053_C08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRM1_0021_A12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
UTR01_0014_C07.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
CLNT1_0149_A10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SPL01_0010_B04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
UTR01_0025_H03.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0004_B06.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0045_E08.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
UTR01_0015_C12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0016_C11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0005_A06.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0004_A06.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0014_H05.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
MLN01_0020_D03.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCGGG
SMG01_0058_E11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SPL01_0041_A07.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PBL01_0005_H04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
MLN01_0077_F06.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0072_F09.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PTG01_0016_E04.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
UTR01_0072_D04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
ADR01_0036_D03.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PTG01_0083_G09.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
UTR01_0087_D11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0149_E04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
CLNT1_0129_C08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0040_B07.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0065_G01.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
UTR01_0036_E01.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0069_C05.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0035_B09.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVR01_0011_G02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVR01_0062_H02.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SPL01_0103_G09.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SMG01_0044_G03.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0033_D12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVR01_0047_D06.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SPL01_0037_H11.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
ITT01_0033_A08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SPL01_0038_C12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVR01_0051_G07.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0009_G03.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
ITT01_0077_G12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SMG01_0015_G04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0043_A07.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PTG01_0077_C06.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
ADR01_0051_B11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVR01_0049_G11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0112_E04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0091_D12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
MLN01_0033_G08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SMG01_0029_D10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SMG01_0033_C08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
CLNT1_0128_F12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0054_H06.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0108_H07.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
MLN01_0080_H03.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
UTR01_0058_H12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0146_F04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SMG01_0080_E10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
ITT01_0074_B02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PBL01_0038_G01.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVR01_0045_F12.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0095_F04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
MLN01_0044_C12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCTGCAGAGCCCGGCCAGG
BFLT1_0092_E03.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SMG01_0085_F02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PBL01_0042_D09.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0065_C11.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SPL01_0051_D06.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
MLN01_0060_B05.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVR01_0061_C03.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0039_D07.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0053_H04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0038_C05.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
CLNT1_0065_E04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SPL01_0036_C03.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0002_G07.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVR01_0059_D05.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0099_B03.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0001_F08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0008_A08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVR01_0089_A07.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
CLNT1_0015_B10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
MLN01_0078_F10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0010_E11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0033_A10.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVR01_0050_G07.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0022_D07.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0069_E10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SPL01_0070_H08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
CLNT1_0050_F02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
CLNT1_0050_C08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0021_F05.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0096_A03.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0039_H08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0008_A05.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
CLNT1_0088_D10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0010_H10.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0090_F02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0061_G05.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
CLNT1_0049_C08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
MLN01_0045_B10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
CLNT1_0004_D11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
ITT01_0095_E07.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PBL01_0087_B11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SPL01_0104_F04.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PBL01_0075_E01.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0204_B06.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
CLNT1_0004_C01.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGCGCCCGGCCAGG
LNG01_0043_C04.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
ITT01_0001_E08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0012_C03.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SKNB1_0040_A11.b : CTAGGGAGCAGCGCCCAATCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
MLN01_0062_F06.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0098_D08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
UTR01_0060_B02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
ITT01_0076_D05.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
CLNT1_0041_G01.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVRM1_0080_B01.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRM1_0056_F10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
ADR01_0052_D04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SKNB1_0002_E09.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0140_C11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0107_A01.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
ITT01_0033_H09.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0070_H03.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PST01_0001_A11.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
CLNT1_0144_A06.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0110_D07.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
ITT01_0063_H06.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0109_F07.b : CCAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
ITT01_0088_C04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0121_D03.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PTG01_0097_E07.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SPL01_0064_G02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVR01_0018_H10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
TCH01_0033_F10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0205_D02.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0009_D05.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCACGTTCCAGCCCGCAGAGCCCGGCCAGG
PBL01_0004_F08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVRM1_0001_H10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRM1_0067_D06.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVR01_0053_D05.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCTGCAGAGCCCGGCCAGG
SMG01_0042_F07.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
MLN01_0064_D10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0087_G10.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
UTR01_0042_A05.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0104_E06.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0045_C09.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0093_C12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
CLNT1_0040_G10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0006_H10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0074_C07.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0100_D10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PTG01_0082_C12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PTG01_0050_H04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PBL01_0063_G05.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
CLNT1_0023_H04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0108_D12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0060_A11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
ITT01_0013_F04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0100_H04.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0100_G09.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
UTR01_0061_B12.b : CTAGGGAGCAGCGCACAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0008_A02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
MLN01_0059_D12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVR01_0105_A02.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0095_A02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
MLN01_0076_B10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0090_F08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LVR01_0104_C04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
UTR01_0048_H06.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0025_C04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0205_G05.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
ITT01_0009_D10.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
ITT01_0043_C06.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
ITT01_0098_A12.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
ADR01_0076_C06.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SKNB1_0051_H08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SKNB1_0040_F06.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SKNB1_0097_A08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRM1_0165_B03.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SPL01_0084_A10.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
TES01_0106_A02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SPL01_0086_H03.b : CTAGGGAGCGGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SPL01_0079_B04.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
THY01_0038_E09.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
KDN01_0024_C07.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PST01_0054_B10.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
KDN01_0086_A08.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
UTR01_0009_G02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVR01_0067_F02.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
LNG01_0033_D11.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
KDN01_0061_H06.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
SPL01_0009_H04.b : CTAGGGAGCAGCGCCCAAACCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
ADR01_0067_F04.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
HTMT1_0095_A01.b : CTAGGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
PCT01_0024_H06.b : CTATGGAGCAGCGCCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCACAGCCCGGCCAGG
ITT01_0042_D04.b : xxxxxxxxxxxxxxCCAAGCCCTCATCGCGCCATGTTCCAGCCCGCAGAGCCCGGCCAGG
OVRT1_0004_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGTTCCAGCCCGCAGAGCCCGGCCAGG
UTR01_0071_D04.b : ctagggangcagcncccagtccctctcgtgnccatgttccgncccgcgagtcccggccGG
OVRT1_0080_H12.b :
MLN01_0007_D01.b :
LNG01_0091_G06.b :
SPLT1_0042_H06.b :
ADR01_0062_B08.b :
20110601C-001050 : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
---------+---------+---------+---------+---------+---------+ 463
OVRT1_0030_A10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVRM1_0043_C03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LNG01_0090_A04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
THY01_0203_H04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
PBL01_0009_H08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
PTG01_0086_H10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVRT1_0093_A05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVRM1_0084_C03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SPL01_0105_A03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
THY01_0030_H01.b : AGTGGGCCATGGGGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SMG01_0037_C04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
THY01_0022_E02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
ADR01_0033_F05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
MLN01_0055_F09.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVRM1_0087_F09.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
THY01_0123_D12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
THY01_0125_F04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
PTG01_0066_D10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVR01_0076_D08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
THY01_0013_H09.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
UTR01_0021_F10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAGGGAGCGGCTACTGGATGACCGC
UTR01_0082_C11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
TES01_0044_A06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
ITT01_0020_D05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
MLN01_0078_D08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LVR01_0017_B08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SPL01_0097_G06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVR01_0010_G11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
TCH01_0025_D01.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
PST01_0033_D01.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
THY01_0112_F11.b : AGTTGGGCATGGAGGGGCCCCGNGGACGCGCTCAAGAAGGAGCGGGTACTGGACGAACGC
LVRM1_0165_H11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVR01_0104_C10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
MLN01_0018_A07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCGAGAAGGAGCGGCTACTGGACGACCGC
PST01_0067_C11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SKNB1_0067_G01.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVRM1_0017_A09.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
THY01_0036_H02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LNG01_0045_H12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
TCH01_0018_A04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVRT1_0129_E03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SKNB1_0082_E09.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVRT1_0055_A02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
MLN01_0102_C11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LVRM1_0062_B12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
PTG01_0064_A02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LVRM1_0089_F02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVRM1_0192_D12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVRM1_0113_A05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
THY01_0020_F12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVRM1_0031_B05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
THY01_0069_D03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SMG01_0081_C07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVRT1_0125_D08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVR01_0090_E09.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
SMG01_0047_F12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LNG01_0004_D12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVR01_0051_H10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
THY01_0038_D07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVR01_0048_F04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
SKNB1_0033_F04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
THY01_0097_B06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SMG01_0034_A08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVR01_0030_A04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
MLN01_0030_H11.b : AGTGGGCCATGGAGGGGCGCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LNG01_0004_A12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTTAAGAAGGAGCGGCTACTGGATGACCGC
OVRT1_0091_G04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LVR01_0077_H10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVR01_0028_A05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
MLN01_0104_E06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
ITT01_0078_E02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
ILNT1_0088_E10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVR01_0012_A08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
MLN01_0010_A01.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
UTR01_0106_A11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
PST01_0084_H07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LNG01_0071_B05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SKNB1_0059_E09.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCGAGAAGGAGCGGCTACTGGATGACCGC
LVRM1_0067_A10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVRM1_0172_C07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
THY01_0123_F03.b : AGTGGGCCATGGAGGGGCCCTG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LVRM1_0079_A04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVRM1_0049_B02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVR01_0054_B12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
UTR01_0042_F02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LVR01_0048_B01.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
UTR01_0018_A05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVR01_0050_D11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
PTG01_0024_D08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LNG01_0002_H12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LNG01_0030_F07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SMG01_0014_D04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVR01_0093_G11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
UTR01_0059_A04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LNG01_0082_E08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVR01_0015_A08.b : TGAGGGCCAAGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LNG01_0025_E05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVRT1_0095_A05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
MLN01_0025_A11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
MLN01_0056_D12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LVRM1_0203_F10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVRM1_0048_G03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
PTG01_0102_C06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVRM1_0037_F10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVRM1_0101_H02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SMG01_0054_B08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
MLN01_0018_A08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAGGAAGGAGCGGCTACTGGATGACCGC
SMG01_0066_A01.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LNG01_0101_A12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LVR01_0106_A02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVR01_0086_A05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LVRM1_0091_H02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVRM1_0107_C07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVR01_0082_H12.b : AGGGGGCCATGGAGGGGCCCCG*GGACGCGCTCCAGAAGGAGCGGCTACTGGATGACCGC
OVRM1_0191_B03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVRM1_0195_E09.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVRM1_0037_C05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVRM1_0202_F10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVRM1_0018_C08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
THY01_0005_B06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVRM1_0078_H03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SPL01_0034_D02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVRM1_0110_B12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVRM1_0100_E11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVRM1_0077_G10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVR01_0083_G11.b : AGGGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVRM1_0069_G11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVR01_0059_A04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVR01_0052_B11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
TCH01_0053_C08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVRM1_0021_A12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
UTR01_0014_C07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
CLNT1_0149_A10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SPL01_0010_B04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
UTR01_0025_H03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
THY01_0004_B06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
THY01_0045_E08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
UTR01_0015_C12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
THY01_0016_C11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
THY01_0005_A06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
THY01_0004_A06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
THY01_0014_H05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
MLN01_0020_D03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
SMG01_0058_E11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SPL01_0041_A07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
PBL01_0005_H04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
MLN01_0077_F06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVRT1_0072_F09.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
PTG01_0016_E04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
UTR01_0072_D04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
ADR01_0036_D03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
PTG01_0083_G09.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
UTR01_0087_D11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVRT1_0149_E04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
CLNT1_0129_C08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
THY01_0040_B07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVR01_0065_G01.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
UTR01_0036_E01.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGGGCGGCTACTGGATGACCGC
LNG01_0069_C05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVR01_0035_B09.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LVR01_0011_G02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LVR01_0062_H02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SPL01_0103_G09.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SMG01_0044_G03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVR01_0033_D12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LVR01_0047_D06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
SPL01_0037_H11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
ITT01_0033_A08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SPL01_0038_C12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVR01_0051_G07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LNG01_0009_G03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
ITT01_0077_G12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SMG01_0015_G04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVR01_0043_A07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
PTG01_0077_C06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
ADR01_0051_B11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVR01_0049_G11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVRT1_0112_E04.b : AGTGGACCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVR01_0091_D12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
MLN01_0033_G08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SMG01_0029_D10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SMG01_0033_C08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
CLNT1_0128_F12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVR01_0054_H06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVRT1_0108_H07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
MLN01_0080_H03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
UTR01_0058_H12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVRT1_0146_F04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
SMG01_0080_E10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
ITT01_0074_B02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
PBL01_0038_G01.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVR01_0045_F12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVR01_0095_F04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
MLN01_0044_C12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
BFLT1_0092_E03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
SMG01_0085_F02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
PBL01_0042_D09.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
THY01_0065_C11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SPL01_0051_D06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
MLN01_0060_B05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LVR01_0061_C03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
THY01_0039_D07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVR01_0053_H04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
THY01_0038_C05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
CLNT1_0065_E04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SPL01_0036_C03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LNG01_0002_G07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVR01_0059_D05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVR01_0099_B03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVRT1_0001_F08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVR01_0008_A08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LVR01_0089_A07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
CLNT1_0015_B10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
MLN01_0078_F10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGGAGGAGCGGCTACTGGACGACCGC
OVRT1_0010_E11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LNG01_0033_A10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVR01_0050_G07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVRT1_0022_D07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LNG01_0069_E10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
SPL01_0070_H08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
CLNT1_0050_F02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
CLNT1_0050_C08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVR01_0021_F05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
THY01_0096_A03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVRT1_0039_H08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
THY01_0008_A05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
CLNT1_0088_D10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LNG01_0010_H10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
THY01_0090_F02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
THY01_0061_G05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
CLNT1_0049_C08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
MLN01_0045_B10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
CLNT1_0004_D11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
ITT01_0095_E07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
PBL01_0087_B11.b : AGTGGGCCGTGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SPL01_0104_F04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
PBL01_0075_E01.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
THY01_0204_B06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
CLNT1_0004_C01.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LNG01_0043_C04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
ITT01_0001_E08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LNG01_0012_C03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
SKNB1_0040_A11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
MLN01_0062_F06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LNG01_0098_D08.b : AGTGGGCCATGGAGGGGCCCCG*GGGCGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
UTR01_0060_B02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
ITT01_0076_D05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
CLNT1_0041_G01.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LVRM1_0080_B01.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVRM1_0056_F10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
ADR01_0052_D04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SKNB1_0002_E09.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVRT1_0140_C11.b : AGTGGACCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LNG01_0107_A01.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
ITT01_0033_H09.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVRT1_0070_H03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
PST01_0001_A11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
CLNT1_0144_A06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LNG01_0110_D07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
ITT01_0063_H06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LNG01_0109_F07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
ITT01_0088_C04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
THY01_0121_D03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
PTG01_0097_E07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
SPL01_0064_G02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVR01_0018_H10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
TCH01_0033_F10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
THY01_0205_D02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCCCAAGAAGGAGCGGCTACTGGACGACCGC
OVR01_0009_D05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
PBL01_0004_F08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LVRM1_0001_H10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVRM1_0067_D06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVR01_0053_D05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
SMG01_0042_F07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
MLN01_0064_D10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LNG01_0087_G10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
UTR01_0042_A05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVR01_0104_E06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVRT1_0045_C09.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVR01_0093_C12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
CLNT1_0040_G10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVR01_0006_H10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
THY01_0074_C07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVRT1_0100_D10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
PTG01_0082_C12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
PTG01_0050_H04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
PBL01_0063_G05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
CLNT1_0023_H04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LNG01_0108_D12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVRT1_0060_A11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
ITT01_0013_F04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
THY01_0100_H04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVRT1_0100_G09.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
UTR01_0061_B12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVRT1_0008_A02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
MLN01_0059_D12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
LVR01_0105_A02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
OVRT1_0095_A02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
MLN01_0076_B10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVRT1_0090_F08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LVR01_0104_C04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
UTR01_0048_H06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LNG01_0025_C04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
THY01_0205_G05.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
ITT01_0009_D10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
ITT01_0043_C06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
ITT01_0098_A12.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
ADR01_0076_C06.b : AGTGGGCCATGCAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SKNB1_0051_H08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
SKNB1_0040_F06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAGGGAGCGGCTACTGGATGACCGC
SKNB1_0097_A08.b : AGTGGGCCATGGAGGGGCCGCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVRM1_0165_B03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SPL01_0084_A10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCGAGAAGGAGCGGCTACTGGACGACCGC
TES01_0106_A02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SPL01_0086_H03.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SPL01_0079_B04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
THY01_0038_E09.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
KDN01_0024_C07.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
PST01_0054_B10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
KDN01_0086_A08.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
UTR01_0009_G02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVR01_0067_F02.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
LNG01_0033_D11.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
KDN01_0061_H06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
SPL01_0009_H04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
ADR01_0067_F04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
HTMT1_0095_A01.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
PCT01_0024_H06.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCACTCAATAAGGATCGGCTACTGGACGACCGC
ITT01_0042_D04.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGATGACCGC
OVRT1_0004_F10.b : AGTGGGCCATGGAGGGGCCCCG*GGACGCGCTCAAGAAGGAGCGGCTACTGGACGACCGC
UTR01_0071_D04.b : AGTGGGGCCTGGAGGGGTCCCC*GGACGCGCTCA*GAAGGAGCGGCTACTGGATGACCGC
OVRT1_0080_H12.b :
MLN01_0007_D01.b :
LNG01_0091_G06.b :
SPLT1_0042_H06.b :
ADR01_0062_B08.b :
20110601C-001050 : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
---------+---------+---------+---------+---------+---------+ 523
OVRT1_0030_A10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
OVRM1_0043_C03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
LNG01_0090_A04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0203_H04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
PBL01_0009_H08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
PTG01_0086_H10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0093_A05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
OVRM1_0084_C03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
SPL01_0105_A03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0030_H01.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SMG01_0037_C04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0022_E02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
ADR01_0033_F05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
MLN01_0055_F09.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVRM1_0087_F09.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
THY01_0123_D12.b : TACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0125_F04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
PTG01_0066_D10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0076_D08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0013_H09.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
UTR01_0021_F10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
UTR01_0082_C11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
TES01_0044_A06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
ITT01_0020_D05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
MLN01_0078_D08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVR01_0017_B08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SPL01_0097_G06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0010_G11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
TCH01_0025_D01.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
PST01_0033_D01.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0112_F11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAACAGATGGTGAAGGAGCTG
LVRM1_0165_H11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0104_C10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
MLN01_0018_A07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGGTGGTGAAGGAGCTG
PST01_0067_C11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SKNB1_0067_G01.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRM1_0017_A09.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0036_H02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LNG01_0045_H12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
TCH01_0018_A04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0129_E03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
SKNB1_0082_E09.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0055_A02.b : CACGACAGCGGCCTGGACCCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
MLN01_0102_C11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVRM1_0062_B12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
PTG01_0064_A02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVRM1_0089_F02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVRM1_0192_D12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVRM1_0113_A05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
THY01_0020_F12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRM1_0031_B05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
THY01_0069_D03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SMG01_0081_C07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0125_D08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
OVR01_0090_E09.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SMG01_0047_F12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LNG01_0004_D12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0051_H10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0038_D07.b : CACGACAGCGGCCTGGACTCCATGAGGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVR01_0048_F04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SKNB1_0033_F04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0097_B06.b : CACGACAGCGGCTTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SMG01_0034_A08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVR01_0030_A04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGATGGAGCTG
MLN01_0030_H11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LNG01_0004_A12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0091_G04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVR01_0077_H10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVR01_0028_A05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
MLN01_0104_E06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
ITT01_0078_E02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
ILNT1_0088_E10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
LVR01_0012_A08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
MLN01_0010_A01.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
UTR01_0106_A11.b : CACGACTGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
PST01_0084_H07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LNG01_0071_B05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SKNB1_0059_E09.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVRM1_0067_A10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVRM1_0172_C07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
THY01_0123_F03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVRM1_0079_A04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
LVRM1_0049_B02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
OVR01_0054_B12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
UTR01_0042_F02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVR01_0048_B01.b : CACGACAGCGGTCTGGACTCCATGAAGGACGAGGAGTACGAGTAGATGGTGAAGGAGCTG
UTR01_0018_A05.b : CACGACCGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0050_D11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
PTG01_0024_D08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LNG01_0002_H12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LNG01_0030_F07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SMG01_0014_D04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0093_G11.b : CACGACAGCGGCCTGGACTCCACGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
UTR01_0059_A04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LNG01_0082_E08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0015_A08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LNG01_0025_E05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0095_A05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
MLN01_0025_A11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
MLN01_0056_D12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVRM1_0203_F10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
LVRM1_0048_G03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
PTG01_0102_C06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRM1_0037_F10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVRM1_0101_H02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
SMG01_0054_B08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAAGAGTACCAGCAGATGGTGAAGGAACTG
MLN01_0018_A08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SMG01_0066_A01.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LNG01_0101_A12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVR01_0106_A02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0086_A05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVRM1_0091_H02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
LVRM1_0107_C07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
OVR01_0082_H12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRM1_0191_B03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVRM1_0195_E09.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
OVRM1_0037_C05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
LVRM1_0202_F10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
LVRM1_0018_C08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
THY01_0005_B06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVRM1_0078_H03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SPL01_0034_D02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRM1_0110_B12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
OVRM1_0100_E11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
LVRM1_0077_G10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
OVR01_0083_G11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRM1_0069_G11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0059_A04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0052_B11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
TCH01_0053_C08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRM1_0021_A12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
UTR01_0014_C07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
CLNT1_0149_A10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
SPL01_0010_B04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
UTR01_0025_H03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0004_B06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0045_E08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
UTR01_0015_C12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0016_C11.b : CACGACAGCGGCCTGGACCCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0005_A06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0004_A06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0014_H05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
MLN01_0020_D03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SMG01_0058_E11.b : CACGACAGCGGCCTGGACTCCATGAAGGACAAGGAGTACGAGCAGATGGTGAAGGAGCTG
SPL01_0041_A07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
PBL01_0005_H04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
MLN01_0077_F06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0072_F09.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
PTG01_0016_E04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
UTR01_0072_D04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
ADR01_0036_D03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
PTG01_0083_G09.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
UTR01_0087_D11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0149_E04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
CLNT1_0129_C08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
THY01_0040_B07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0065_G01.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
UTR01_0036_E01.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LNG01_0069_C05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0035_B09.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVR01_0011_G02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVR01_0062_H02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SPL01_0103_G09.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SMG01_0044_G03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0033_D12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVR01_0047_D06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SPL01_0037_H11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAGGGAGCTG
ITT01_0033_A08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SPL01_0038_C12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVR01_0051_G07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LNG01_0009_G03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
ITT01_0077_G12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SMG01_0015_G04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0043_A07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
PTG01_0077_C06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
ADR01_0051_B11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVR01_0049_G11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0112_E04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0091_D12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
MLN01_0033_G08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SMG01_0029_D10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACAAGCAGATGGTGAAGGAGCTG
SMG01_0033_C08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
CLNT1_0128_F12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
OVR01_0054_H06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0108_H07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
MLN01_0080_H03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
UTR01_0058_H12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0146_F04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SMG01_0080_E10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
ITT01_0074_B02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
PBL01_0038_G01.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
LVR01_0045_F12.b : CACGACAGCGGCCTGGACTCCGTGAAGGACGAGGATTACGAGCAGATGGTGAAGGAGCTG
OVR01_0095_F04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
MLN01_0044_C12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
BFLT1_0092_E03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SMG01_0085_F02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
PBL01_0042_D09.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
THY01_0065_C11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SPL01_0051_D06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
MLN01_0060_B05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVR01_0061_C03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0039_D07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0053_H04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0038_C05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
CLNT1_0065_E04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
SPL01_0036_C03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LNG01_0002_G07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVR01_0059_D05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0099_B03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0001_F08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0008_A08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVR01_0089_A07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
CLNT1_0015_B10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
MLN01_0078_F10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0010_E11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
LNG01_0033_A10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVR01_0050_G07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0022_D07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
LNG01_0069_E10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SPL01_0070_H08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
CLNT1_0050_F02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
CLNT1_0050_C08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0021_F05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0096_A03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0039_H08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
THY01_0008_A05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
CLNT1_0088_D10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
LNG01_0010_H10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0090_F02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0061_G05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
CLNT1_0049_C08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
MLN01_0045_B10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
CLNT1_0004_D11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
ITT01_0095_E07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
PBL01_0087_B11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
SPL01_0104_F04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
PBL01_0075_E01.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0204_B06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
CLNT1_0004_C01.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LNG01_0043_C04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
ITT01_0001_E08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LNG01_0012_C03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SKNB1_0040_A11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
MLN01_0062_F06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LNG01_0098_D08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
UTR01_0060_B02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
ITT01_0076_D05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
CLNT1_0041_G01.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVRM1_0080_B01.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRM1_0056_F10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
ADR01_0052_D04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SKNB1_0002_E09.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0140_C11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LNG01_0107_A01.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
ITT01_0033_H09.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0070_H03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
PST01_0001_A11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
CLNT1_0144_A06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
LNG01_0110_D07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATAGTGAAGGAGCTG
ITT01_0063_H06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LNG01_0109_F07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
ITT01_0088_C04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0121_D03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
PTG01_0097_E07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SPL01_0064_G02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVR01_0018_H10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAACTG
TCH01_0033_F10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0205_D02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0009_D05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
PBL01_0004_F08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVRM1_0001_H10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRM1_0067_D06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVR01_0053_D05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SMG01_0042_F07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
MLN01_0064_D10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LNG01_0087_G10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
UTR01_0042_A05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0104_E06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0045_C09.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
OVR01_0093_C12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
CLNT1_0040_G10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0006_H10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0074_C07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0100_D10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
PTG01_0082_C12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGGGCTG
PTG01_0050_H04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
PBL01_0063_G05.b : CACAACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
CLNT1_0023_H04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LNG01_0108_D12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0060_A11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
ITT01_0013_F04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0100_H04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0100_G09.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
UTR01_0061_B12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0008_A02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
MLN01_0059_D12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVR01_0105_A02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0095_A02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
MLN01_0076_B10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0090_F08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LVR01_0104_C04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
UTR01_0048_H06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LNG01_0025_C04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0205_G05.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
ITT01_0009_D10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
ITT01_0043_C06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
ITT01_0098_A12.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
ADR01_0076_C06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SKNB1_0051_H08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SKNB1_0040_F06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SKNB1_0097_A08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRM1_0165_B03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SPL01_0084_A10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
TES01_0106_A02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGGGTACGAGCAGATGGTGAAGGAGTTG
SPL01_0086_H03.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SPL01_0079_B04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
THY01_0038_E09.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
KDN01_0024_C07.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
PST01_0054_B10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
KDN01_0086_A08.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
UTR01_0009_G02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVR01_0067_F02.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
LNG01_0033_D11.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
KDN01_0061_H06.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
SPL01_0009_H04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
ADR01_0067_F04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
HTMT1_0095_A01.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
PCT01_0024_H06.b : CACGACAGCGGCCTGGACTCCATGAATGACCAGGAGTACGAGCAAATGGTGAATGAGCTG
ITT01_0042_D04.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGCTG
OVRT1_0004_F10.b : CACGACAGCGGCCTGGACTCCATGAAGGACGAGGAGTACGAGCAGATGGTGAAGGAGTTG
UTR01_0071_D04.b : CACGACGTCGGC*TGGACTCC*TGAAGGACGAGGAGTACGAGTAGATGGTGAAGGAGCTG
OVRT1_0080_H12.b : nnntttctttctgctgatgxx
MLN01_0007_D01.b :
LNG01_0091_G06.b :
SPLT1_0042_H06.b :
ADR01_0062_B08.b :
20110601C-001050 : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
---------+---------+---------+---------+---------+---------+ 581
OVRT1_0030_A10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRM1_0043_C03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0090_A04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGTCGAGCTCTGGAAGCAGC
THY01_0203_H04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PBL01_0009_H08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PTG01_0086_H10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0093_A05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRM1_0084_C03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SPL01_0105_A03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0030_H01.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SMG01_0037_C04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0022_E02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
ADR01_0033_F05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
MLN01_0055_F09.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVRM1_0087_F09.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0123_D12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0125_F04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PTG01_0066_D10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0076_D08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0013_H09.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
UTR01_0021_F10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
UTR01_0082_C11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
TES01_0044_A06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
ITT01_0020_D05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
MLN01_0078_D08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVR01_0017_B08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SPL01_0097_G06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0010_G11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
TCH01_0025_D01.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PST01_0033_D01.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0112_F11.b : CGCGAGATCCGCCTTCAGCCGCAG*GAG*GGGCCCCGCGGCGCCCAGCCCTGGAAGCAGC
LVRM1_0165_H11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0104_C10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
MLN01_0018_A07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PST01_0067_C11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SKNB1_0067_G01.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRM1_0017_A09.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0036_H02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0045_H12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
TCH01_0018_A04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0129_E03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SKNB1_0082_E09.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0055_A02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
MLN01_0102_C11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVRM1_0062_B12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PTG01_0064_A02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGNAAGCAGC
LVRM1_0089_F02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVRM1_0192_D12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVRM1_0113_A05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0020_F12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRM1_0031_B05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0069_D03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SMG01_0081_C07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0125_D08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0090_E09.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SMG01_0047_F12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0004_D12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0051_H10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0038_D07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVR01_0048_F04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SKNB1_0033_F04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0097_B06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SMG01_0034_A08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVR01_0030_A04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
MLN01_0030_H11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0004_A12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0091_G04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVR01_0077_H10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVR01_0028_A05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
MLN01_0104_E06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
ITT01_0078_E02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
ILNT1_0088_E10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVR01_0012_A08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
MLN01_0010_A01.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
UTR01_0106_A11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PST01_0084_H07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0071_B05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SKNB1_0059_E09.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVRM1_0067_A10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVRM1_0172_C07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0123_F03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVRM1_0079_A04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVRM1_0049_B02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0054_B12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
UTR01_0042_F02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVR01_0048_B01.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
UTR01_0018_A05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCTAGCCCTGGAAGCAGC
OVR01_0050_D11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PTG01_0024_D08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0002_H12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0030_F07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SMG01_0014_D04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0093_G11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
UTR01_0059_A04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0082_E08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0015_A08.b : CGCGAGATCCGCCTCGAGCCGCAGAGAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0025_E05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0095_A05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
MLN01_0025_A11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
MLN01_0056_D12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVRM1_0203_F10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVRM1_0048_G03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PTG01_0102_C06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRM1_0037_F10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVRM1_0101_H02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SMG01_0054_B08.b : CGCGAGATCCGCCTCGAGCCGCAA*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
MLN01_0018_A08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SMG01_0066_A01.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0101_A12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVR01_0106_A02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0086_A05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVRM1_0091_H02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVRM1_0107_C07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0082_H12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRM1_0191_B03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVRM1_0195_E09.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRM1_0037_C05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVRM1_0202_F10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVRM1_0018_C08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0005_B06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVRM1_0078_H03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SPL01_0034_D02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRM1_0110_B12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRM1_0100_E11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVRM1_0077_G10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0083_G11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRM1_0069_G11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0059_A04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGGAGCAGC
OVR01_0052_B11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
TCH01_0053_C08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRM1_0021_A12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
UTR01_0014_C07.b : CGCGAGACCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
CLNT1_0149_A10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SPL01_0010_B04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
UTR01_0025_H03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0004_B06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0045_E08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
UTR01_0015_C12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0016_C11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0005_A06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0004_A06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0014_H05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
MLN01_0020_D03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SMG01_0058_E11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SPL01_0041_A07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PBL01_0005_H04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
MLN01_0077_F06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0072_F09.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PTG01_0016_E04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
UTR01_0072_D04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
ADR01_0036_D03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PTG01_0083_G09.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
UTR01_0087_D11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0149_E04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
CLNT1_0129_C08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0040_B07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0065_G01.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
UTR01_0036_E01.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0069_C05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0035_B09.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVR01_0011_G02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVR01_0062_H02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SPL01_0103_G09.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SMG01_0044_G03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0033_D12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVR01_0047_D06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SPL01_0037_H11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
ITT01_0033_A08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SPL01_0038_C12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVR01_0051_G07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0009_G03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
ITT01_0077_G12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SMG01_0015_G04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0043_A07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PTG01_0077_C06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
ADR01_0051_B11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVR01_0049_G11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0112_E04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0091_D12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
MLN01_0033_G08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SMG01_0029_D10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SMG01_0033_C08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
CLNT1_0128_F12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0054_H06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0108_H07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
MLN01_0080_H03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
UTR01_0058_H12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0146_F04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SMG01_0080_E10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
ITT01_0074_B02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PBL01_0038_G01.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVR01_0045_F12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0095_F04.b : CGCGAGATTCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
MLN01_0044_C12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
BFLT1_0092_E03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SMG01_0085_F02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PBL01_0042_D09.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0065_C11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SPL01_0051_D06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
MLN01_0060_B05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVR01_0061_C03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0039_D07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0053_H04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0038_C05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
CLNT1_0065_E04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SPL01_0036_C03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0002_G07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVR01_0059_D05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0099_B03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0001_F08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0008_A08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVR01_0089_A07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAAC
CLNT1_0015_B10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
MLN01_0078_F10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0010_E11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0033_A10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVR01_0050_G07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0022_D07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0069_E10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SPL01_0070_H08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
CLNT1_0050_F02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
CLNT1_0050_C08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0021_F05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0096_A03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0039_H08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0008_A05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
CLNT1_0088_D10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0010_H10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0090_F02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0061_G05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
CLNT1_0049_C08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
MLN01_0045_B10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
CLNT1_0004_D11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
ITT01_0095_E07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PBL01_0087_B11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SPL01_0104_F04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PBL01_0075_E01.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0204_B06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
CLNT1_0004_C01.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0043_C04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCCCCGAGCCCTGGAAGCAGC
ITT01_0001_E08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0012_C03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SKNB1_0040_A11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
MLN01_0062_F06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0098_D08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
UTR01_0060_B02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
ITT01_0076_D05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
CLNT1_0041_G01.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVRM1_0080_B01.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRM1_0056_F10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
ADR01_0052_D04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SKNB1_0002_E09.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0140_C11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0107_A01.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
ITT01_0033_H09.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0070_H03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PST01_0001_A11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
CLNT1_0144_A06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0110_D07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
ITT01_0063_H06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0109_F07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
ITT01_0088_C04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0121_D03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCAGAGCCCTGGAAGCAGC
PTG01_0097_E07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SPL01_0064_G02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVR01_0018_H10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
TCH01_0033_F10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0205_D02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0009_D05.b : CGCGAGATCCGCCTCGAGCCGCAGAGAGAGCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PBL01_0004_F08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVRM1_0001_H10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRM1_0067_D06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVR01_0053_D05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SMG01_0042_F07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
MLN01_0064_D10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0087_G10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
UTR01_0042_A05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0104_E06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0045_C09.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0093_C12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
CLNT1_0040_G10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0006_H10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0074_C07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0100_D10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PTG01_0082_C12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PTG01_0050_H04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PBL01_0063_G05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
CLNT1_0023_H04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0108_D12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0060_A11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
ITT01_0013_F04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0100_H04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0100_G09.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
UTR01_0061_B12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0008_A02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
MLN01_0059_D12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVR01_0105_A02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0095_A02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
MLN01_0076_B10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0090_F08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LVR01_0104_C04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
UTR01_0048_H06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0025_C04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0205_G05.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
ITT01_0009_D10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
ITT01_0043_C06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
ITT01_0098_A12.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
ADR01_0076_C06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SKNB1_0051_H08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SKNB1_0040_F06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SKNB1_0097_A08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRM1_0165_B03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SPL01_0084_A10.b : CACGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
TES01_0106_A02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SPL01_0086_H03.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SPL01_0079_B04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
THY01_0038_E09.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
KDN01_0024_C07.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PST01_0054_B10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
KDN01_0086_A08.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
UTR01_0009_G02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVR01_0067_F02.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
LNG01_0033_D11.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
KDN01_0061_H06.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
SPL01_0009_H04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
ADR01_0067_F04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
HTMT1_0095_A01.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
PCT01_0024_H06.b : CACGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCACGCGGCGCCCAGCCCTGTAATCAGC
ITT01_0042_D04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0004_F10.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
UTR01_0071_D04.b : CGCGAGATCCGCCTCGAGCCGCAG*GAG*GCGCCCCGCGGCGCCGAGCCCTGGAAGCAGC
OVRT1_0080_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgccctggg
MLN01_0007_D01.b : nntttcgcctggacaagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0091_G06.b : tatnnnggctggctatgacxxxxxxxxxxxxxxxxx
SPLT1_0042_H06.b :
ADR01_0062_B08.b :
20110601C-001050 : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
---------+---------+---------+---------+---------+---------+ 639
OVRT1_0030_A10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRM1_0043_C03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0090_A04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0203_H04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PBL01_0009_H08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PTG01_0086_H10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0093_A05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRM1_0084_C03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SPL01_0105_A03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0030_H01.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SMG01_0037_C04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0022_E02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
ADR01_0033_F05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0055_F09.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVRM1_0087_F09.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0123_D12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0125_F04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PTG01_0066_D10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0076_D08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0013_H09.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
UTR01_0021_F10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
UTR01_0082_C11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
TES01_0044_A06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
ITT01_0020_D05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0078_D08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVR01_0017_B08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SPL01_0097_G06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0010_G11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
TCH01_0025_D01.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PST01_0033_D01.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0112_F11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATTCATGAAGAGAAGGC
LVRM1_0165_H11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0104_C10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0018_A07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PST01_0067_C11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SKNB1_0067_G01.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRM1_0017_A09.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CACCATCCATGAAGAGAAGGC
THY01_0036_H02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0045_H12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
TCH01_0018_A04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0129_E03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SKNB1_0082_E09.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0055_A02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0102_C11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVRM1_0062_B12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PTG01_0064_A02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVRM1_0089_F02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVRM1_0192_D12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVRM1_0113_A05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0020_F12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRM1_0031_B05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0069_D03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SMG01_0081_C07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0125_D08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0090_E09.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SMG01_0047_F12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0004_D12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0051_H10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0038_D07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVR01_0048_F04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SKNB1_0033_F04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0097_B06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SMG01_0034_A08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVR01_0030_A04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0030_H11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0004_A12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0091_G04.b : *AGCTCACCGAGGACGGGGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVR01_0077_H10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVR01_0028_A05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0104_E06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
ITT01_0078_E02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
ILNT1_0088_E10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVR01_0012_A08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0010_A01.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
UTR01_0106_A11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PST01_0084_H07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0071_B05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAGGGC
SKNB1_0059_E09.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVRM1_0067_A10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVRM1_0172_C07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0123_F03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVRM1_0079_A04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVRM1_0049_B02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0054_B12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
UTR01_0042_F02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVR01_0048_B01.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
UTR01_0018_A05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0050_D11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PTG01_0024_D08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0002_H12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0030_F07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SMG01_0014_D04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0093_G11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
UTR01_0059_A04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0082_E08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0015_A08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGG
LNG01_0025_E05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CGTCATCCATGAAGAGAAGGC
OVRT1_0095_A05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0025_A11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0056_D12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVRM1_0203_F10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTTGG*CATCATCCATGAAGAGAAAGC
LVRM1_0048_G03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PTG01_0102_C06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRM1_0037_F10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGT
LVRM1_0101_H02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SMG01_0054_B08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0018_A08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SMG01_0066_A01.b : *TGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0101_A12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCCCTTGGC*CATCATCCATGAAGAGAAGGC
LVR01_0106_A02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0086_A05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVRM1_0091_H02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVRM1_0107_C07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0082_H12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCGCGTGGGGCGGCATCCATGAAGAGAAGGC
OVRM1_0191_B03.b : *AGCTCACCGGGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVRM1_0195_E09.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRM1_0037_C05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVRM1_0202_F10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVRM1_0018_C08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0005_B06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVRM1_0078_H03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SPL01_0034_D02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRM1_0110_B12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRM1_0100_E11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVRM1_0077_G10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0083_G11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACGTGGC*CGTCATCCATGAAGAGAAGGC
OVRM1_0069_G11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0059_A04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0052_B11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
TCH01_0053_C08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRM1_0021_A12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
UTR01_0014_C07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
CLNT1_0149_A10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SPL01_0010_B04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGACGGC
UTR01_0025_H03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0004_B06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0045_E08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
UTR01_0015_C12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0016_C11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0005_A06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAAAAGGC
THY01_0004_A06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAAAAGGC
THY01_0014_H05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0020_D03.b : *AGCTCACCGGGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SMG01_0058_E11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SPL01_0041_A07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PBL01_0005_H04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0077_F06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0072_F09.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PTG01_0016_E04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
UTR01_0072_D04.b : *AGCTCACCGAGGACAGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
ADR01_0036_D03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PTG01_0083_G09.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
UTR01_0087_D11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0149_E04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
CLNT1_0129_C08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0040_B07.b : *AGCTCACCGAGGACGGGGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0065_G01.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
UTR01_0036_E01.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0069_C05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0035_B09.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVR01_0011_G02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVR01_0062_H02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SPL01_0103_G09.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SMG01_0044_G03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0033_D12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVR01_0047_D06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SPL01_0037_H11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
ITT01_0033_A08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SPL01_0038_C12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVR01_0051_G07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0009_G03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
ITT01_0077_G12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SMG01_0015_G04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0043_A07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PTG01_0077_C06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
ADR01_0051_B11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVR01_0049_G11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0112_E04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0091_D12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0033_G08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SMG01_0029_D10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SMG01_0033_C08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
CLNT1_0128_F12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0054_H06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0108_H07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0080_H03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
UTR01_0058_H12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0146_F04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SMG01_0080_E10.b : *AGCTCACCGAGGACGGAGACTCGTCCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
ITT01_0074_B02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PBL01_0038_G01.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVR01_0045_F12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0095_F04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0044_C12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
BFLT1_0092_E03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SMG01_0085_F02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PBL01_0042_D09.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0065_C11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SPL01_0051_D06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0060_B05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVR01_0061_C03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0039_D07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0053_H04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0038_C05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
CLNT1_0065_E04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SPL01_0036_C03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0002_G07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVR01_0059_D05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0099_B03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0001_F08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0008_A08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVR01_0089_A07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
CLNT1_0015_B10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0078_F10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0010_E11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0033_A10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVR01_0050_G07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0022_D07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0069_E10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SPL01_0070_H08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
CLNT1_0050_F02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
CLNT1_0050_C08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0021_F05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0096_A03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0039_H08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0008_A05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
CLNT1_0088_D10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0010_H10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0090_F02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0061_G05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
CLNT1_0049_C08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0045_B10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
CLNT1_0004_D11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
ITT01_0095_E07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PBL01_0087_B11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SPL01_0104_F04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PBL01_0075_E01.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0204_B06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
CLNT1_0004_C01.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0043_C04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
ITT01_0001_E08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0012_C03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SKNB1_0040_A11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0062_F06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0098_D08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
UTR01_0060_B02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
ITT01_0076_D05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
CLNT1_0041_G01.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVRM1_0080_B01.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRM1_0056_F10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
ADR01_0052_D04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SKNB1_0002_E09.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0140_C11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0107_A01.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
ITT01_0033_H09.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0070_H03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PST01_0001_A11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
CLNT1_0144_A06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0110_D07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
ITT01_0063_H06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0109_F07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
ITT01_0088_C04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0121_D03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PTG01_0097_E07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SPL01_0064_G02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVR01_0018_H10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
TCH01_0033_F10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0205_D02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0009_D05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGG
PBL01_0004_F08.b : CAGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCCTCCATGAAGAGAAGGC
LVRM1_0001_H10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATTCATGAAGAGAAGGC
OVRM1_0067_D06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVR01_0053_D05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SMG01_0042_F07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0064_D10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0087_G10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
UTR01_0042_A05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0104_E06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0045_C09.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0093_C12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
CLNT1_0040_G10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0006_H10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0074_C07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0100_D10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PTG01_0082_C12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PTG01_0050_H04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PBL01_0063_G05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
CLNT1_0023_H04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0108_D12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0060_A11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
ITT01_0013_F04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0100_H04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0100_G09.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
UTR01_0061_B12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0008_A02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0059_D12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVR01_0105_A02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0095_A02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0076_B10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0090_F08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LVR01_0104_C04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
UTR01_0048_H06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0025_C04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0205_G05.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
ITT01_0009_D10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
ITT01_0043_C06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
ITT01_0098_A12.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
ADR01_0076_C06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SKNB1_0051_H08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SKNB1_0040_F06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SKNB1_0097_A08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRM1_0165_B03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SPL01_0084_A10.b : *ACCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAATAGAAGGC
TES01_0106_A02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SPL01_0086_H03.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SPL01_0079_B04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
THY01_0038_E09.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
KDN01_0024_C07.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PST01_0054_B10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
KDN01_0086_A08.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGAC*CATCATCCATGAAGAGAAGGC
UTR01_0009_G02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVR01_0067_F02.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0033_D11.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
KDN01_0061_H06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
SPL01_0009_H04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
ADR01_0067_F04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
HTMT1_0095_A01.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
PCT01_0024_H06.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAATGC
ITT01_0042_D04.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0004_F10.b : *AGCTCACCGAGGACGGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
UTR01_0071_D04.b : *AGCTCACCGAGGACAGAGACTCGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
OVRT1_0080_H12.b : ggttttccctctcttcccctcagGTTCCTGCACTTGGC*CATCATCCATGAAGAGAAGGC
MLN01_0007_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0091_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATCATCCATGAAGAGAAGGC
SPLT1_0042_H06.b : nnnttgcgagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0062_B08.b : ncctgtcxxxxxx
20110601C-001050 : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
---------+---------+---------+---------+---------+---------+ 698
OVRT1_0030_A10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRM1_0043_C03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0090_A04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0203_H04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
PBL01_0009_H08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
PTG01_0086_H10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0093_A05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRM1_0084_C03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SPL01_0105_A03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0030_H01.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SMG01_0037_C04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0022_E02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ADR01_0033_F05.b : ACTGACCATGGAGGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
MLN01_0055_F09.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVRM1_0087_F09.b : ACTGACCATGGAAGTGGTCAGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAGCTTCACGA
THY01_0123_D12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0125_F04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
PTG01_0066_D10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0076_D08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0013_H09.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
UTR01_0021_F10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
UTR01_0082_C11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
TES01_0044_A06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ITT01_0020_D05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
MLN01_0078_D08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVR01_0017_B08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SPL01_0097_G06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0010_G11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
TCH01_0025_D01.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
PST01_0033_D01.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0112_F11.b : ACTGAACATGGAAGTGGTTCGGCAAGTGAAAGGGAGAT*TGGCTTTTCTTAACTTCCAGA
LVRM1_0165_H11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0104_C10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
MLN01_0018_A07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAGCTTCCAGA
PST01_0067_C11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SKNB1_0067_G01.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRM1_0017_A09.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0036_H02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0045_H12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
TCH01_0018_A04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0129_E03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SKNB1_0082_E09.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0055_A02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
MLN01_0102_C11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVRM1_0062_B12.b : ACTGACCATGGAAGTGGTCCGCCGAGTG*AAGGGAGATCTGGCTTTTCTTAACTTACATA
PTG01_0064_A02.b : ACTNGACATGAAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCNTAAACTTCAGA
LVRM1_0089_F02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVRM1_0192_D12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVRM1_0113_A05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0020_F12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRM1_0031_B05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0069_D03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SMG01_0081_C07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0125_D08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0090_E09.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SMG01_0047_F12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0004_D12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0051_H10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0038_D07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCCTAACTTCCAGA
LVR01_0048_F04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SKNB1_0033_F04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0097_B06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SMG01_0034_A08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVR01_0030_A04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
MLN01_0030_H11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0004_A12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0091_G04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVR01_0077_H10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVR01_0028_A05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
MLN01_0104_E06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ITT01_0078_E02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ILNT1_0088_E10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVR01_0012_A08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
MLN01_0010_A01.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
UTR01_0106_A11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
PST01_0084_H07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0071_B05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SKNB1_0059_E09.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVRM1_0067_A10.b : ACTGACCATGGAAGTGGATCGTCAAGTG*AAGGGATATCTGGCTTTTGTTAACTGGCAGA
LVRM1_0172_C07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTATACTTCCAGA
THY01_0123_F03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVRM1_0079_A04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVRM1_0049_B02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0054_B12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
UTR01_0042_F02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVR01_0048_B01.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
UTR01_0018_A05.b : ACTGACCATGGAAGTGGTCCGCCTAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0050_D11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
PTG01_0024_D08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0002_H12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0030_F07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SMG01_0014_D04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0093_G11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
UTR01_0059_A04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0082_E08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0015_A08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0025_E05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0095_A05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
MLN01_0025_A11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
MLN01_0056_D12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVRM1_0203_F10.b : ACTGACCATGGAAGTGGTCCGCCCAGTG*AAGGGAGATCGGGCTTTTTCTTACTTCCAGA
LVRM1_0048_G03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGGTCTGGCTTTTCTTAACTTCCAGA
PTG01_0102_C06.b : ACTNGACATGGAAGTGGTCCGCCNAGTG*AAGGNAGATCTGGGCTTTCTTAACTTCCAGA
OVRM1_0037_F10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVRM1_0101_H02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SMG01_0054_B08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTTCAGA
MLN01_0018_A08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTGTCAGA
SMG01_0066_A01.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0101_A12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVR01_0106_A02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0086_A05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVRM1_0091_H02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVRM1_0107_C07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0082_H12.b : ACTGACCATGGAGGTGGTCCGCCCAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRM1_0191_B03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVRM1_0195_E09.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRM1_0037_C05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVRM1_0202_F10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVRM1_0018_C08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0005_B06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVRM1_0078_H03.b : ACTGACCATGGAAGTGGTCCGCCNAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SPL01_0034_D02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRM1_0110_B12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRM1_0100_E11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVRM1_0077_G10.b : ACTGACCATGGAAGTGGTCCGCCNAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0083_G11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRM1_0069_G11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0059_A04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0052_B11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
TCH01_0053_C08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRM1_0021_A12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
UTR01_0014_C07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
CLNT1_0149_A10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SPL01_0010_B04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
UTR01_0025_H03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0004_B06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0045_E08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
UTR01_0015_C12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0016_C11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0005_A06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0004_A06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0014_H05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
MLN01_0020_D03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SMG01_0058_E11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SPL01_0041_A07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
PBL01_0005_H04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
MLN01_0077_F06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0072_F09.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
PTG01_0016_E04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
UTR01_0072_D04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ADR01_0036_D03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
PTG01_0083_G09.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
UTR01_0087_D11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0149_E04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
CLNT1_0129_C08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0040_B07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0065_G01.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
UTR01_0036_E01.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0069_C05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0035_B09.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVR01_0011_G02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVR01_0062_H02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SPL01_0103_G09.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SMG01_0044_G03.b : ACTGACCATGGAAGTGATCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0033_D12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVR01_0047_D06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAAGGAGATCTGGCTTTTCTTAACTTCCAGA
SPL01_0037_H11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ITT01_0033_A08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SPL01_0038_C12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVR01_0051_G07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0009_G03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ITT01_0077_G12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SMG01_0015_G04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0043_A07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
PTG01_0077_C06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ADR01_0051_B11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVR01_0049_G11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0112_E04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0091_D12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
MLN01_0033_G08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SMG01_0029_D10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SMG01_0033_C08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
CLNT1_0128_F12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0054_H06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0108_H07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
MLN01_0080_H03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
UTR01_0058_H12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0146_F04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SMG01_0080_E10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ITT01_0074_B02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
PBL01_0038_G01.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVR01_0045_F12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCTAGA
OVR01_0095_F04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
MLN01_0044_C12.b : ACTGACCATGGAAGTGATCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
BFLT1_0092_E03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SMG01_0085_F02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
PBL01_0042_D09.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0065_C11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SPL01_0051_D06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
MLN01_0060_B05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVR01_0061_C03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0039_D07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0053_H04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0038_C05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
CLNT1_0065_E04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SPL01_0036_C03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0002_G07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVR01_0059_D05.b : ACTGACCATAGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0099_B03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0001_F08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0008_A08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVR01_0089_A07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
CLNT1_0015_B10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
MLN01_0078_F10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0010_E11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0033_A10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVR01_0050_G07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0022_D07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0069_E10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SPL01_0070_H08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
CLNT1_0050_F02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
CLNT1_0050_C08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0021_F05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0096_A03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0039_H08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0008_A05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
CLNT1_0088_D10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0010_H10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0090_F02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0061_G05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
CLNT1_0049_C08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
MLN01_0045_B10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
CLNT1_0004_D11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ITT01_0095_E07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
PBL01_0087_B11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SPL01_0104_F04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
PBL01_0075_E01.b : ACTGACCATGGAAGTGGTCCGCTAAGTG*AAGGGAGATCTGGCTTTTCTTAACCTCCAGA
THY01_0204_B06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
CLNT1_0004_C01.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0043_C04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ITT01_0001_E08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0012_C03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SKNB1_0040_A11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
MLN01_0062_F06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0098_D08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
UTR01_0060_B02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ITT01_0076_D05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
CLNT1_0041_G01.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVRM1_0080_B01.b : ACTGACCATGGAAGTGGTCCGCCTAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRM1_0056_F10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ADR01_0052_D04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCTGA
SKNB1_0002_E09.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0140_C11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0107_A01.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ITT01_0033_H09.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0070_H03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
PST01_0001_A11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
CLNT1_0144_A06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0110_D07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ITT01_0063_H06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0109_F07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ITT01_0088_C04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0121_D03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
PTG01_0097_E07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SPL01_0064_G02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVR01_0018_H10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
TCH01_0033_F10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0205_D02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0009_D05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
PBL01_0004_F08.b : ACTGACCATGGAAATGGTCCGCCCAGTG*AAAGGAGATCTGGCTTTTCCTAACTTCCAGA
LVRM1_0001_H10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRM1_0067_D06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*GAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVR01_0053_D05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SMG01_0042_F07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
MLN01_0064_D10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0087_G10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
UTR01_0042_A05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0104_E06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0045_C09.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0093_C12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
CLNT1_0040_G10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0006_H10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AGGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0074_C07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0100_D10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
PTG01_0082_C12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
PTG01_0050_H04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
PBL01_0063_G05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
CLNT1_0023_H04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0108_D12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0060_A11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ITT01_0013_F04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0100_H04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0100_G09.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
UTR01_0061_B12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0008_A02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
MLN01_0059_D12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVR01_0105_A02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0095_A02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
MLN01_0076_B10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0090_F08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LVR01_0104_C04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
UTR01_0048_H06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0025_C04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0205_G05.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ITT01_0009_D10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ITT01_0043_C06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ITT01_0098_A12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ADR01_0076_C06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SKNB1_0051_H08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SKNB1_0040_F06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SKNB1_0097_A08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRM1_0165_B03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SPL01_0084_A10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGGTTTTCTTAACTTCCAGA
TES01_0106_A02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SPL01_0086_H03.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SPL01_0079_B04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
THY01_0038_E09.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
KDN01_0024_C07.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
PST01_0054_B10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
KDN01_0086_A08.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
UTR01_0009_G02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVR01_0067_F02.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0033_D11.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
KDN01_0061_H06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SPL01_0009_H04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ADR01_0067_F04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
HTMT1_0095_A01.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
PCT01_0024_H06.b : ACTGACCATGGAAGTGGTCCGCCCAGTG*AAAGGAGATCTGGCTTTTCTTAACTTCCACA
ITT01_0042_D04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0004_F10.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
UTR01_0071_D04.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
OVRT1_0080_H12.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AGGGGAGATCTGGCTTTTCTTAACTTCCAGA
MLN01_0007_D01.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
LNG01_0091_G06.b : ACTGACCATGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
SPLT1_0042_H06.b : xxxxxxxxxGGAAGTGGTCCGCCAAGTG*AAGGGAGATCTGGCTTTTCTTAACTTCCAGA
ADR01_0062_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTTAACTTCCAGA
20110601C-001050 : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
---------+---------+---------+---------+---------+---------+ 757
OVRT1_0030_A10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRM1_0043_C03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0090_A04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0203_H04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PBL01_0009_H08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PTG01_0086_H10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0093_A05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRM1_0084_C03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SPL01_0105_A03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0030_H01.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SMG01_0037_C04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0022_E02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ADR01_0033_F05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0055_F09.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVRM1_0087_F09.b : ACGACCTGCAGCAGAATCCACGCGCCTTGGgagatgagtgaatgcttaccgaaagcgctg
THY01_0123_D12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0125_F04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PTG01_0066_D10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0076_D08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0013_H09.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
UTR01_0021_F10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
UTR01_0082_C11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
TES01_0044_A06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ITT01_0020_D05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0078_D08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVR01_0017_B08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SPL01_0097_G06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0010_G11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
TCH01_0025_D01.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PST01_0033_D01.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0112_F11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVRM1_0165_H11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0104_C10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0018_A07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PST01_0067_C11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SKNB1_0067_G01.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACTAACCAGCCAGAAATCGAT
OVRM1_0017_A09.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0036_H02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0045_H12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
TCH01_0018_A04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0129_E03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SKNB1_0082_E09.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0055_A02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0102_C11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVRM1_0062_B12.b : ACAGCCTGCAGCAGACTCCACTgcacattgcggtaatcaggagcgggcacttattgtgat
PTG01_0064_A02.b : AACAACTGGAGCAAACTCAACTCCACTggcggggatccaccaccaacccaaaatccctga
LVRM1_0089_F02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVRM1_0192_D12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVRM1_0113_A05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0020_F12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRM1_0031_B05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0069_D03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SMG01_0081_C07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0125_D08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0090_E09.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SMG01_0047_F12.b : ACAACCTGCGGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0004_D12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0051_H10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0038_D07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVR01_0048_F04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SKNB1_0033_F04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0097_B06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SMG01_0034_A08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVR01_0030_A04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0030_H11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0004_A12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0091_G04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVR01_0077_H10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVR01_0028_A05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0104_E06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ITT01_0078_E02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ILNT1_0088_E10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVR01_0012_A08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0010_A01.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
UTR01_0106_A11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PST01_0084_H07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0071_B05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SKNB1_0059_E09.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVRM1_0067_A10.b : ACAAgtggtttcagattacattacgctagggggtggtgtatatagaatcgtagggggagt
LVRM1_0172_C07.b : ACAACCTGATACAGACCCCACTCCACTTGG*AGGTGATggtgaatccccccgaaatcatt
THY01_0123_F03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVRM1_0079_A04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVRM1_0049_B02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0054_B12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
UTR01_0042_F02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVR01_0048_B01.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
UTR01_0018_A05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0050_D11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PTG01_0024_D08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0002_H12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0030_F07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SMG01_0014_D04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0093_G11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
UTR01_0059_A04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0082_E08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0015_A08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0025_E05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0095_A05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0025_A11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0056_D12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVRM1_0203_F10.b : ACAACCTGCAGCAGACTCCCCTCCACTTTGGCGGTGATCACCAACCAGCCCAAAATCGCT
LVRM1_0048_G03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCGGAAATCGCT
PTG01_0102_C06.b : ACAACCTGCAGCAGACTCCACTCCACTTGGNCGGTGATCACCCACCACCCAGAAATCGCT
OVRM1_0037_F10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVRM1_0101_H02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SMG01_0054_B08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0018_A08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SMG01_0066_A01.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCNACCACCAGCCAGAAATCGCT
LNG01_0101_A12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVR01_0106_A02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCCGAAATCCCT
OVR01_0086_A05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVRM1_0091_H02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVRM1_0107_C07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0082_H12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCCCCAACCAGCCAGAAATCGCT
OVRM1_0191_B03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVRM1_0195_E09.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRM1_0037_C05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVRM1_0202_F10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVRM1_0018_C08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0005_B06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVRM1_0078_H03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SPL01_0034_D02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRM1_0110_B12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRM1_0100_E11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVRM1_0077_G10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0083_G11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRM1_0069_G11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0059_A04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0052_B11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
TCH01_0053_C08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRM1_0021_A12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
UTR01_0014_C07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
CLNT1_0149_A10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SPL01_0010_B04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
UTR01_0025_H03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0004_B06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0045_E08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
UTR01_0015_C12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0016_C11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0005_A06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0004_A06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0014_H05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0020_D03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SMG01_0058_E11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SPL01_0041_A07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PBL01_0005_H04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0077_F06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0072_F09.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PTG01_0016_E04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
UTR01_0072_D04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ADR01_0036_D03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PTG01_0083_G09.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
UTR01_0087_D11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0149_E04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
CLNT1_0129_C08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0040_B07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0065_G01.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
UTR01_0036_E01.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0069_C05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0035_B09.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVR01_0011_G02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVR01_0062_H02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SPL01_0103_G09.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SMG01_0044_G03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0033_D12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVR01_0047_D06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SPL01_0037_H11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ITT01_0033_A08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SPL01_0038_C12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVR01_0051_G07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0009_G03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ITT01_0077_G12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SMG01_0015_G04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0043_A07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PTG01_0077_C06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ADR01_0051_B11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVR01_0049_G11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0112_E04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0091_D12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0033_G08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SMG01_0029_D10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SMG01_0033_C08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
CLNT1_0128_F12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0054_H06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0108_H07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0080_H03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
UTR01_0058_H12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0146_F04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SMG01_0080_E10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ITT01_0074_B02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PBL01_0038_G01.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVR01_0045_F12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0095_F04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0044_C12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
BFLT1_0092_E03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SMG01_0085_F02.b : TCAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PBL01_0042_D09.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0065_C11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SPL01_0051_D06.b : ACAACCTGCAGCAGACTCCACTCCACCTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0060_B05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVR01_0061_C03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0039_D07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGTT
OVR01_0053_H04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0038_C05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
CLNT1_0065_E04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SPL01_0036_C03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0002_G07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVR01_0059_D05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0099_B03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0001_F08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0008_A08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVR01_0089_A07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
CLNT1_0015_B10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0078_F10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0010_E11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0033_A10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVR01_0050_G07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0022_D07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0069_E10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SPL01_0070_H08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
CLNT1_0050_F02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
CLNT1_0050_C08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0021_F05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0096_A03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0039_H08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0008_A05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
CLNT1_0088_D10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0010_H10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0090_F02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0061_G05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
CLNT1_0049_C08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0045_B10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
CLNT1_0004_D11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ITT01_0095_E07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PBL01_0087_B11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SPL01_0104_F04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PBL01_0075_E01.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0204_B06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
CLNT1_0004_C01.b : ACAACCTGCAGCGGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0043_C04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ITT01_0001_E08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0012_C03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SKNB1_0040_A11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0062_F06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0098_D08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
UTR01_0060_B02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ITT01_0076_D05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
CLNT1_0041_G01.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVRM1_0080_B01.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCCGAAATCGCT
OVRM1_0056_F10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ADR01_0052_D04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SKNB1_0002_E09.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0140_C11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0107_A01.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ITT01_0033_H09.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0070_H03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PST01_0001_A11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
CLNT1_0144_A06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0110_D07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ITT01_0063_H06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0109_F07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ITT01_0088_C04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0121_D03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PTG01_0097_E07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SPL01_0064_G02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVR01_0018_H10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
TCH01_0033_F10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0205_D02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0009_D05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PBL01_0004_F08.b : ACAACCTGCAGCAAACTCCACTCCACTTGG*CGGTGATCCCCCACCccccccgaaatcct
LVRM1_0001_H10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRM1_0067_D06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVR01_0053_D05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SMG01_0042_F07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0064_D10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0087_G10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
UTR01_0042_A05.b : ACAACCTGCAGCAGACTCCACTCCACTCGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0104_E06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0045_C09.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0093_C12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
CLNT1_0040_G10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0006_H10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0074_C07.b : ACAACCTGCAGCACACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0100_D10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PTG01_0082_C12.b : ACAACCTGCAGCAGACTCCACTCCGCTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PTG01_0050_H04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PBL01_0063_G05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
CLNT1_0023_H04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAATCAGCCAGAAATCGCT
LNG01_0108_D12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0060_A11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ITT01_0013_F04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0100_H04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0100_G09.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
UTR01_0061_B12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0008_A02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0059_D12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVR01_0105_A02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0095_A02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0076_B10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0090_F08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LVR01_0104_C04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
UTR01_0048_H06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0025_C04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0205_G05.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ITT01_0009_D10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ITT01_0043_C06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ITT01_0098_A12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ADR01_0076_C06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SKNB1_0051_H08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SKNB1_0040_F06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SKNB1_0097_A08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRM1_0165_B03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SPL01_0084_A10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
TES01_0106_A02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SPL01_0086_H03.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SPL01_0079_B04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
THY01_0038_E09.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
KDN01_0024_C07.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PST01_0054_B10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
KDN01_0086_A08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
UTR01_0009_G02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVR01_0067_F02.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0033_D11.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
KDN01_0061_H06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SPL01_0009_H04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ADR01_0067_F04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
HTMT1_0095_A01.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
PCT01_0024_H06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ITT01_0042_D04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0004_F10.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
UTR01_0071_D04.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
OVRT1_0080_H12.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
MLN01_0007_D01.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
LNG01_0091_G06.b : ACAACCTGCAGCAGACTCCACTCCATTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
SPLT1_0042_H06.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
ADR01_0062_B08.b : ACAACCTGCAGCAGACTCCACTCCACTTGG*CGGTGATCACCAACCAGCCAGAAATCGCT
20110601C-001050 : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
---------+---------+---------+---------+---------+---------+ 816
OVRT1_0030_A10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCNAGGAAATACCCC
OVRM1_0043_C03.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0090_A04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0203_H04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
PBL01_0009_H08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
PTG01_0086_H10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0093_A05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRM1_0084_C03.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SPL01_0105_A03.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0030_H01.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SMG01_0037_C04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0022_E02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
ADR01_0033_F05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
MLN01_0055_F09.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVRM1_0087_F09.b : gagatgatcaggaggacgggcgggcattagcgatacgacaagcgcaagtacaataaagcg
THY01_0123_D12.b : GAGGCACTTTTGGAAGCTGGCTGTGATCCTGAGCCtccgaaattttgaagaaatcccctc
THY01_0125_F04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
PTG01_0066_D10.b : GAAGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0076_D08.b : GAGGCACTTCTGGAAGCTGGCTGCGATCCTGAG*CCTCGAGACTTTCGAGGATATACCCC
THY01_0013_H09.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
UTR01_0021_F10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
UTR01_0082_C11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
TES01_0044_A06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
ITT01_0020_D05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
MLN01_0078_D08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVR01_0017_B08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SPL01_0097_G06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0010_G11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
TCH01_0025_D01.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
PST01_0033_D01.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0112_F11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATAC*CC
LVRM1_0165_H11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0104_C10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
MLN01_0018_A07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
PST01_0067_C11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SKNB1_0067_G01.b : GATGCACTTCTGCAATCTGTCTGTGATCCTGAC*CTCCGATACTTTCTTTGAAGTACTCC
OVRM1_0017_A09.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0036_H02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0045_H12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
TCH01_0018_A04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0129_E03.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SKNB1_0082_E09.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0055_A02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
MLN01_0102_C11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVRM1_0062_B12.b : gctcttgtgtatgctgggttgtagcctgagcgccgacgggtgtgggttatgtctgtgttt
PTG01_0064_A02.b : aggcattcgggaactggctgtgatcctaaactccaaaattttcgggaaataccctttaaa
LVRM1_0089_F02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAA*CTCCGAGACTTTCGAGGAAATAC*CC
LVRM1_0192_D12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVRM1_0113_A05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGGAATACCCC
THY01_0020_F12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRM1_0031_B05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0069_D03.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SMG01_0081_C07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0125_D08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0090_E09.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SMG01_0047_F12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0004_D12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0051_H10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0038_D07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVR01_0048_F04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SKNB1_0033_F04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0097_B06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SMG01_0034_A08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVR01_0030_A04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
MLN01_0030_H11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0004_A12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0091_G04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVR01_0077_H10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVR01_0028_A05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
MLN01_0104_E06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
ITT01_0078_E02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTCCGAGGAAATACCCC
ILNT1_0088_E10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVR01_0012_A08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
MLN01_0010_A01.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
UTR01_0106_A11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
PST01_0084_H07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0071_B05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SKNB1_0059_E09.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVRM1_0067_A10.b : agggattatcgaaacatgagtgacgtcctgaatgaggactacggaagcgaaangtcacag
LVRM1_0172_C07.b : gaggcaattcaggaagctagctcgcatactgatgtagcgatacttgcgacgaccccccct
THY01_0123_F03.b : GAGGCACTTTTGGAAGCTGGCTGTGATTCTGAG*CTCCagaatttgaggaaataccctct
LVRM1_0079_A04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVRM1_0049_B02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0054_B12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
UTR01_0042_F02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVR01_0048_B01.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
UTR01_0018_A05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0050_D11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
PTG01_0024_D08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0002_H12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0030_F07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SMG01_0014_D04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0093_G11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
UTR01_0059_A04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0082_E08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0015_A08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0025_E05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0095_A05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
MLN01_0025_A11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
MLN01_0056_D12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVRM1_0203_F10.b : GAGGCACTTCctgaaaccgggcggtgatcttgagctccaagactttcaagaaaataccct
LVRM1_0048_G03.b : GATGCAGTTCTGGAAGCTGGCTGTGATCCTGAG*CTCGGAGACTTTCGAGGAAATACCCC
PTG01_0102_C06.b : GAAGGACTTCTTGAAACTGGCTGGGATCCTGAACCTCCAAGAATTTCCAGGAAATACCCC
OVRM1_0037_F10.b : GAAGCACTTCTGGAAGCTGGCTGTGATCCTGAC*CTCCTAGACTTTCGAGGAAATACCCC
LVRM1_0101_H02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATAC*CC
SMG01_0054_B08.b : GAAGCACTTCTGGGAGCTGGCTGTGATCCTGAG*CTCCCAGACTTTCCAGGAAATACCCC
MLN01_0018_A08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SMG01_0066_A01.b : GAAGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0101_A12.b : GAGGCACTTCTGGAAACTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVR01_0106_A02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0086_A05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVRM1_0091_H02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVRM1_0107_C07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0082_H12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRM1_0191_B03.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVRM1_0195_E09.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRM1_0037_C05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVRM1_0202_F10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVRM1_0018_C08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0005_B06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVRM1_0078_H03.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SPL01_0034_D02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRM1_0110_B12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRM1_0100_E11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVRM1_0077_G10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0083_G11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRM1_0069_G11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0059_A04.b : GAGGCACTTCTGGAAGCTGGCTGTGACCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0052_B11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
TCH01_0053_C08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRM1_0021_A12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
UTR01_0014_C07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
CLNT1_0149_A10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SPL01_0010_B04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
UTR01_0025_H03.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0004_B06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0045_E08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
UTR01_0015_C12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0016_C11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0005_A06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0004_A06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0014_H05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
MLN01_0020_D03.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SMG01_0058_E11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SPL01_0041_A07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
PBL01_0005_H04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
MLN01_0077_F06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0072_F09.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
PTG01_0016_E04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
UTR01_0072_D04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
ADR01_0036_D03.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
PTG01_0083_G09.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
UTR01_0087_D11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0149_E04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
CLNT1_0129_C08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0040_B07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0065_G01.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
UTR01_0036_E01.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CCCCGAGACTTTCGAGGAAATACCCC
LNG01_0069_C05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0035_B09.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVR01_0011_G02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVR01_0062_H02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SPL01_0103_G09.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SMG01_0044_G03.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0033_D12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVR01_0047_D06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SPL01_0037_H11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
ITT01_0033_A08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SPL01_0038_C12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVR01_0051_G07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0009_G03.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
ITT01_0077_G12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SMG01_0015_G04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0043_A07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
PTG01_0077_C06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACTCC
ADR01_0051_B11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVR01_0049_G11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0112_E04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0091_D12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
MLN01_0033_G08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SMG01_0029_D10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SMG01_0033_C08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
CLNT1_0128_F12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0054_H06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0108_H07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
MLN01_0080_H03.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
UTR01_0058_H12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0146_F04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SMG01_0080_E10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
ITT01_0074_B02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
PBL01_0038_G01.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVR01_0045_F12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0095_F04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
MLN01_0044_C12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
BFLT1_0092_E03.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SMG01_0085_F02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
PBL01_0042_D09.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0065_C11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SPL01_0051_D06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
MLN01_0060_B05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVR01_0061_C03.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0039_D07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0053_H04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0038_C05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
CLNT1_0065_E04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SPL01_0036_C03.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0002_G07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVR01_0059_D05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0099_B03.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0001_F08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0008_A08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVR01_0089_A07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
CLNT1_0015_B10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
MLN01_0078_F10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0010_E11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0033_A10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVR01_0050_G07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0022_D07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0069_E10.b : GAGGCACTTCTGGAAGCTGGCTGTGACCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SPL01_0070_H08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
CLNT1_0050_F02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
CLNT1_0050_C08.b : GAGGCGCTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0021_F05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0096_A03.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0039_H08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0008_A05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
CLNT1_0088_D10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0010_H10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0090_F02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0061_G05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
CLNT1_0049_C08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
MLN01_0045_B10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAGTACCCC
CLNT1_0004_D11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
ITT01_0095_E07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
PBL01_0087_B11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SPL01_0104_F04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
PBL01_0075_E01.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0204_B06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
CLNT1_0004_C01.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0043_C04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
ITT01_0001_E08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0012_C03.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SKNB1_0040_A11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
MLN01_0062_F06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0098_D08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
UTR01_0060_B02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
ITT01_0076_D05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
CLNT1_0041_G01.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVRM1_0080_B01.b : GAGGCACTTCTGGAACCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRM1_0056_F10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
ADR01_0052_D04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SKNB1_0002_E09.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0140_C11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0107_A01.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
ITT01_0033_H09.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0070_H03.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
PST01_0001_A11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
CLNT1_0144_A06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0110_D07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
ITT01_0063_H06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0109_F07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
ITT01_0088_C04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0121_D03.b : GAGGCACTTTTGGAAGCTGGGTGTGATCCTGAG*CTCCGAGAATTTCGAGGAAATACCCC
PTG01_0097_E07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SPL01_0064_G02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVR01_0018_H10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
TCH01_0033_F10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0205_D02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0009_D05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
PBL01_0004_F08.b : tgaggcccttctggaaacctggctgtgatccctgagcttccagactttcgaggaaatacc
LVRM1_0001_H10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRM1_0067_D06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVR01_0053_D05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SMG01_0042_F07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
MLN01_0064_D10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0087_G10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
UTR01_0042_A05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0104_E06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0045_C09.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0093_C12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
CLNT1_0040_G10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCTAGGAAATACCCC
OVR01_0006_H10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0074_C07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0100_D10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
PTG01_0082_C12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
PTG01_0050_H04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
PBL01_0063_G05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
CLNT1_0023_H04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0108_D12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0060_A11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
ITT01_0013_F04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0100_H04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0100_G09.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
UTR01_0061_B12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0008_A02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
MLN01_0059_D12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVR01_0105_A02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0095_A02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
MLN01_0076_B10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0090_F08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LVR01_0104_C04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
UTR01_0048_H06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0025_C04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0205_G05.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
ITT01_0009_D10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
ITT01_0043_C06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
ITT01_0098_A12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
ADR01_0076_C06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SKNB1_0051_H08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SKNB1_0040_F06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SKNB1_0097_A08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRM1_0165_B03.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SPL01_0084_A10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGATATACCCC
TES01_0106_A02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SPL01_0086_H03.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SPL01_0079_B04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
THY01_0038_E09.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
KDN01_0024_C07.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
PST01_0054_B10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
KDN01_0086_A08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGGGACTTTCGAGGAAATACCCC
UTR01_0009_G02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVR01_0067_F02.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0033_D11.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
KDN01_0061_H06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SPL01_0009_H04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
ADR01_0067_F04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
HTMT1_0095_A01.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
PCT01_0024_H06.b : GATGCACTTCTGGAATCTGGCTGTGATCCTGAG*CTCCTAGACTTTCGAGGATATACCCC
ITT01_0042_D04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
OVRT1_0004_F10.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
UTR01_0071_D04.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CCTCCAGACTTTCGAGGAAATACCCC
OVRT1_0080_H12.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
MLN01_0007_D01.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
LNG01_0091_G06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
SPLT1_0042_H06.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
ADR01_0062_B08.b : GAGGCACTTCTGGAAGCTGGCTGTGATCCTGAG*CTCCGAGACTTTCGAGGAAATACCCC
20110601C-001050 : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
---------+---------+---------+---------+---------+---------+ 874
OVRT1_0030_A10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAACCC
OVRM1_0043_C03.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0090_A04.b : TCT*ACGCCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCANCCC
THY01_0203_H04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
PBL01_0009_H08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
PTG01_0086_H10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0093_A05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACCCAGCCC
OVRM1_0084_C03.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SPL01_0105_A03.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0030_H01.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SMG01_0037_C04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0022_E02.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ADR01_0033_F05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
MLN01_0055_F09.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVRM1_0087_F09.b : aacgtaggccggagagacgggcgcgggtaagcggcagacaaaaaacgcgacgcgagagcg
THY01_0123_D12.b : taaactttgcttgtagcagggctgctggccagtgtggagttcttaattacccccg
THY01_0125_F04.b : TCT*ACACCTTGCCTGTGAGCAGGTCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
PTG01_0066_D10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0076_D08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0013_H09.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
UTR01_0021_F10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
UTR01_0082_C11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
TES01_0044_A06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ITT01_0020_D05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
MLN01_0078_D08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVR01_0017_B08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SPL01_0097_G06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0010_G11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
TCH01_0025_D01.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
PST01_0033_D01.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0112_F11.b : TCT*ACACCTTGGCTGTGAGCAGGGttgcttgccggggtggagtctgaatancccccggg
LVRM1_0165_H11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0104_C10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
MLN01_0018_A07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
PST01_0067_C11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SKNB1_0067_G01.b : TCA*ACACCTTGCTTGTGACCAGaactacctgtttcctgtgcatctcgtgattactcccc
OVRM1_0017_A09.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCTC
THY01_0036_H02.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAACCC
LNG01_0045_H12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
TCH01_0018_A04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0129_E03.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SKNB1_0082_E09.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0055_A02.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
MLN01_0102_C11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVRM1_0062_B12.b : caggggtgtgtgagcaagctatagatggtatggatgagtatgcggacgttttctgcatgt
PTG01_0064_A02.b : cttggcgggaaaaagggctccgggccggtggggaatccggatcaccccccggggaccaaa
LVRM1_0089_F02.b : TCT*ACACCTTGCCTGTGAGCAAGGCTGCCTG*ATCCGTGTGGGAGTCCTGACTCggcct
LVRM1_0192_D12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVRM1_0113_A05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAACCC
THY01_0020_F12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRM1_0031_B05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0069_D03.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SMG01_0081_C07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0125_D08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0090_E09.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SMG01_0047_F12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0004_D12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0051_H10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0038_D07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVR01_0048_F04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SKNB1_0033_F04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0097_B06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SMG01_0034_A08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVR01_0030_A04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
MLN01_0030_H11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0004_A12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0091_G04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVR01_0077_H10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVR01_0028_A05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
MLN01_0104_E06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ITT01_0078_E02.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ILNT1_0088_E10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVR01_0012_A08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
MLN01_0010_A01.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
UTR01_0106_A11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
PST01_0084_H07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0071_B05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SKNB1_0059_E09.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVRM1_0067_A10.b : tggacgttcatggtatgaccttgaattgattttggattgggtagggtgtatatctcatgg
LVRM1_0172_C07.b : ctaagtgttagctgtgagagggggggccccggacattgtagtgcttttagtatatcccac
THY01_0123_F03.b : ataccttccgtgaggagggggcttgccgggtggaggttttaataccccc
LVRM1_0079_A04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVRM1_0049_B02.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GGCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0054_B12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
UTR01_0042_F02.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVR01_0048_B01.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
UTR01_0018_A05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0050_D11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
PTG01_0024_D08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0002_H12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0030_F07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SMG01_0014_D04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0093_G11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
UTR01_0059_A04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0082_E08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0015_A08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0025_E05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0095_A05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
MLN01_0025_A11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
MLN01_0056_D12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVRM1_0203_F10.b : ctttcacttgcctgggagcagggctccctggccaatggtggaatactgaaatcacccccc
LVRM1_0048_G03.b : TCG*ACACCTTGCCTGTGAGCAGGGTTGCCTG*Gtctgggtggggagtcctgtatcgtct
PTG01_0102_C06.b : TCT*AAACTTTGCtggtaaaaaaggctgcctgccaagggtggaatcctgaatcaaccccg
OVRM1_0037_F10.b : TCT*ACGCCTTGCCTGTGAGCAGGGCTGCCTG*GCCcatgcggtaattctggatcagcac
LVRM1_0101_H02.b : TCT*ACACTTGCCCTGTGAACAAGGCTGCCTG*GCCCGGGTGGGTATCCTGACTCAGCCC
SMG01_0054_B08.b : TCT*ACAACTTGCCTGTGAACAAGGCTGCCTG*GCCAATGTGGGAGTCCTGAATCAACCC
MLN01_0018_A08.b : TCT*ACAC*TTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAACCC
SMG01_0066_A01.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0101_A12.b : TCT*ACACCTTGCCTGTGAACAGGGCTGCCTG*GCCAGTGTGGGAGTCTTGACTCAGCCC
LVR01_0106_A02.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAATCCTGACTCATCCC
OVR01_0086_A05.b : TCT*ACACCCTGCCTGTGAGCAGGACTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVRM1_0091_H02.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVRM1_0107_C07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GGCAGTGTGGGAGTCCTGACTCAACCC
OVR01_0082_H12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRM1_0191_B03.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVRM1_0195_E09.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GGCAGTGTGGGAGTCCTGACTCAGCCC
OVRM1_0037_C05.b : TCTTACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVRM1_0202_F10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GGCAGTGTGGGAGTCCTGACTCAGCCC
LVRM1_0018_C08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0005_B06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVRM1_0078_H03.b : TCT*ACACCTTGTCTGTGAGCAGGGCTGCCTG*GTCAGTGTGGGAGTCCTGACTCAGCCC
SPL01_0034_D02.b : TCT*ACACCTTGCCTGTGAGCAAGGCTGCCTG*GGCAGTGTGGGAGTCCTGACTCAGCCC
OVRM1_0110_B12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRM1_0100_E11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVRM1_0077_G10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0083_G11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRM1_0069_G11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0059_A04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0052_B11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
TCH01_0053_C08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAACCC
OVRM1_0021_A12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
UTR01_0014_C07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
CLNT1_0149_A10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SPL01_0010_B04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
UTR01_0025_H03.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0004_B06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0045_E08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
UTR01_0015_C12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0016_C11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GNCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0005_A06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0004_A06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0014_H05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
MLN01_0020_D03.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SMG01_0058_E11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SPL01_0041_A07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
PBL01_0005_H04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
MLN01_0077_F06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0072_F09.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
PTG01_0016_E04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
UTR01_0072_D04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ADR01_0036_D03.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
PTG01_0083_G09.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
UTR01_0087_D11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0149_E04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
CLNT1_0129_C08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0040_B07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0065_G01.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
UTR01_0036_E01.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0069_C05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0035_B09.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVR01_0011_G02.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVR01_0062_H02.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SPL01_0103_G09.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SMG01_0044_G03.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0033_D12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVR01_0047_D06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SPL01_0037_H11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ITT01_0033_A08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SPL01_0038_C12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVR01_0051_G07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0009_G03.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ITT01_0077_G12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SMG01_0015_G04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0043_A07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
PTG01_0077_C06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ADR01_0051_B11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVR01_0049_G11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0112_E04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0091_D12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
MLN01_0033_G08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SMG01_0029_D10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SMG01_0033_C08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
CLNT1_0128_F12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGGGTCCTGACTCAGCCC
OVR01_0054_H06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0108_H07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
MLN01_0080_H03.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
UTR01_0058_H12.b : TCT*ACACTTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0146_F04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SMG01_0080_E10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ITT01_0074_B02.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
PBL01_0038_G01.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVR01_0045_F12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0095_F04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
MLN01_0044_C12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
BFLT1_0092_E03.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SMG01_0085_F02.b : TCT*ACACCTTGCGTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
PBL01_0042_D09.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0065_C11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SPL01_0051_D06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
MLN01_0060_B05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVR01_0061_C03.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0039_D07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0053_H04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0038_C05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
CLNT1_0065_E04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SPL01_0036_C03.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0002_G07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVR01_0059_D05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0099_B03.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0001_F08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0008_A08.b : TCT*ACACCCTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVR01_0089_A07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
CLNT1_0015_B10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
MLN01_0078_F10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0010_E11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0033_A10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVR01_0050_G07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0022_D07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0069_E10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SPL01_0070_H08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
CLNT1_0050_F02.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
CLNT1_0050_C08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0021_F05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0096_A03.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0039_H08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0008_A05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
CLNT1_0088_D10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0010_H10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0090_F02.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0061_G05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
CLNT1_0049_C08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
MLN01_0045_B10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
CLNT1_0004_D11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ITT01_0095_E07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
PBL01_0087_B11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SPL01_0104_F04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
PBL01_0075_E01.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0204_B06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
CLNT1_0004_C01.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0043_C04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ITT01_0001_E08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0012_C03.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SKNB1_0040_A11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
MLN01_0062_F06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0098_D08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
UTR01_0060_B02.b : TCT*ACGCCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ITT01_0076_D05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
CLNT1_0041_G01.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVRM1_0080_B01.b : TCT*ACCCCTTGCCctgtgaccaggctgcccgcccagggcggaagttctgactcaacccc
OVRM1_0056_F10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ADR01_0052_D04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SKNB1_0002_E09.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0140_C11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0107_A01.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ITT01_0033_H09.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0070_H03.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
PST01_0001_A11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
CLNT1_0144_A06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0110_D07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ITT01_0063_H06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0109_F07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ITT01_0088_C04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0121_D03.b : TCT*Aaacttggctgttagcagggctgcctgcccgtgtgggagtcttaataac
PTG01_0097_E07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SPL01_0064_G02.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVR01_0018_H10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
TCH01_0033_F10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0205_D02.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0009_D05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTGGGCCAGTGGGGGAGTCCTGACTCAGCCC
PBL01_0004_F08.b : ccctcaacaccttgccctgtgagccgggcttgcccggcccagtgtgggagccccggactc
LVRM1_0001_H10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRM1_0067_D06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVR01_0053_D05.b : CCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SMG01_0042_F07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
MLN01_0064_D10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0087_G10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
UTR01_0042_A05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0104_E06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0045_C09.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0093_C12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
CLNT1_0040_G10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0006_H10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0074_C07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0100_D10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
PTG01_0082_C12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
PTG01_0050_H04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
PBL01_0063_G05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
CLNT1_0023_H04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0108_D12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0060_A11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ITT01_0013_F04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0100_H04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0100_G09.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
UTR01_0061_B12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0008_A02.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
MLN01_0059_D12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVR01_0105_A02.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0095_A02.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
MLN01_0076_B10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0090_F08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LVR01_0104_C04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
UTR01_0048_H06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0025_C04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0205_G05.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ITT01_0009_D10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ITT01_0043_C06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ITT01_0098_A12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ADR01_0076_C06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SKNB1_0051_H08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SKNB1_0040_F06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SKNB1_0097_A08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRM1_0165_B03.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SPL01_0084_A10.b : TCT*ACACCTTGCCTGTGAGCATGGATGCCTG*GCCAGAGTGGGAGTCCTGACTCTACCC
TES01_0106_A02.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SPL01_0086_H03.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SPL01_0079_B04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
THY01_0038_E09.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
KDN01_0024_C07.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
PST01_0054_B10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
KDN01_0086_A08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
UTR01_0009_G02.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVR01_0067_F02.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0033_D11.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
KDN01_0061_H06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SPL01_0009_H04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ADR01_0067_F04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
HTMT1_0095_A01.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
PCT01_0024_H06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGCGAGTCCTGACTCAATCC
ITT01_0042_D04.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
OVRT1_0004_F10.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
UTR01_0071_D04.b : CTC*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCCGTGTGGGAGTCCTGACTCCGCCC
OVRT1_0080_H12.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
MLN01_0007_D01.b : TCT*ACACCTTGCCTGTGAGCGGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
LNG01_0091_G06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
SPLT1_0042_H06.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
ADR01_0062_B08.b : TCT*ACACCTTGCCTGTGAGCAGGGCTGCCTG*GCCAGTGTGGGAGTCCTGACTCAGCCC
20110601C-001050 : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
---------+---------+---------+---------+---------+---------+ 932
OVRT1_0030_A10.b : CGCGGGAACCAGCCACTCCACTCCATTCTGCAGGCCACAAACTACAtggccacccctgtc
OVRM1_0043_C03.b : CGCGGGGacccagcactcc
LNG01_0090_A04.b : CTCCGGACCCAGCACCTCCACTCCAATCTGCAGGTCCCCCACTACAATG*GCCAAACA*T
THY01_0203_H04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCCACTACAATG*GCCACACA*T
PBL01_0009_H08.b : CGCGGGACCCAGCACCCTCACTCCATTCTGCANGCCACCNACTACAATG*GCCACACA*T
PTG01_0086_H10.b : CGCGGGAACCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0093_A05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRM1_0084_C03.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SPL01_0105_A03.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0030_H01.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SMG01_0037_C04.b : CGCGGGAACCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0022_E02.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
ADR01_0033_F05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
MLN01_0055_F09.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVRM1_0087_F09.b : gggcacggaataattatgggggcgatagcgctgggaaagatgcaagcccacgtccgcctg
THY01_0123_D12.b :
THY01_0125_F04.b : gngggacccagaacctcact
PTG01_0066_D10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGGCACCAACTAACATG*GGCACACA*T
OVR01_0076_D08.b : CGCGGGAACCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACCATG*GCCACACA*T
THY01_0013_H09.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
UTR01_0021_F10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
UTR01_0082_C11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
TES01_0044_A06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
ITT01_0020_D05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
MLN01_0078_D08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVR01_0017_B08.b : CGCGGGACCCAGCACCCCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SPL01_0097_G06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0010_G11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
TCH01_0025_D01.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
PST01_0033_D01.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0112_F11.b : accnaccctcac
LVRM1_0165_H11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0104_C10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
MLN01_0018_A07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCA*CTACAATG*GCCACACA*T
PST01_0067_C11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SKNB1_0067_G01.b : ctttaactcttaacataactccattctgctgccatgaaccctaaatggccgcgttgctca
OVRM1_0017_A09.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0036_H02.b : CGCGGGACCCACCACCTCCACTCCATTCTGCAGGCCACCAACTACCATG*GCCACACA*T
LNG01_0045_H12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
TCH01_0018_A04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0129_E03.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SKNB1_0082_E09.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0055_A02.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
MLN01_0102_C11.b : CGCGGGACCCAGCACCTCCACTCCACTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVRM1_0062_B12.b : gtgtaggtttctaggttgtatgtattaggggcggtgaattggatgccaattgtggggtat
PTG01_0064_A02.b : accccccctcctttttggggggccccaattaaaaggggccaaatggggggcccttaaccc
LVRM1_0089_F02.b : ggggggactagcacctcccgtccttagtgcgggtccgaactacagtggctaccggtgtct
LVRM1_0192_D12.b : CGCGGGACCCAACACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVRM1_0113_A05.b : CGCGGGGACCAGCACCTCCACTCCAATCTGCAGGCCAGCAACTACAATG*GCCACACA*T
THY01_0020_F12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRM1_0031_B05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0069_D03.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SMG01_0081_C07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGGCACCAACTACAATG*GCCACACA*T
OVRT1_0125_D08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0090_E09.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SMG01_0047_F12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0004_D12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0051_H10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0038_D07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVR01_0048_F04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SKNB1_0033_F04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0097_B06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SMG01_0034_A08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCANGCCACCAACTACAATG*GCCACACA*T
LVR01_0030_A04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
MLN01_0030_H11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0004_A12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0091_G04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVR01_0077_H10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVR01_0028_A05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
MLN01_0104_E06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
ITT01_0078_E02.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
ILNT1_0088_E10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVR01_0012_A08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
MLN01_0010_A01.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
UTR01_0106_A11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
PST01_0084_H07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0071_B05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SKNB1_0059_E09.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVRM1_0067_A10.b : gtgattgatgacggaaagtgacgatgtgatggttttggagttggcatggggggattgttg
LVRM1_0172_C07.b : cccccgccacaggagagtgccaggtgaaagacggtaaactgcggataggccgtgtgcgat
THY01_0123_F03.b :
LVRM1_0079_A04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVRM1_0049_B02.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0054_B12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
UTR01_0042_F02.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVR01_0048_B01.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACAAT
UTR01_0018_A05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACNATG*GCCACACA*T
OVR01_0050_D11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
PTG01_0024_D08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0002_H12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0030_F07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SMG01_0014_D04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0093_G11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
UTR01_0059_A04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0082_E08.b : CGCGGGACCCAGCACCTCCACTCCGTTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0015_A08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0025_E05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0095_A05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
MLN01_0025_A11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
MLN01_0056_D12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVRM1_0203_F10.b : gggaacaaccaccccacctattttttggggccaaaaatatgagggcgacaaatgttgcgc
LVRM1_0048_G03.b : cgccatgacctgcgcctcccccccattctgcgtgcctatcaatactatgatcacatcgga
PTG01_0102_C06.b : ggggaaaccaaaaccttccctcccttttggagggccccaaattaaatgggcccaaagtgt
OVRM1_0037_F10.b : gacgggaccccgcacctccactcctattctgcgggacgccaataagatgacccgcatatc
LVRM1_0101_H02.b : CGTGGGGACCcataactcctttcctttttggcgggctacgcatctttacttggcgttccc
SMG01_0054_B08.b : CGCGGGACCCAGCACtcccctccattctgcaggccacaacttacatggccacccatgtct
MLN01_0018_A08.b : CGCGGGACCCAacaacctccctcccatccggcggccaccactacaaggccaccatgtcgg
SMG01_0066_A01.b : CGCGGGACCCAGCACCTCAACTCCATTCTGaagccacccactacaagggcaaccatggct
LNG01_0101_A12.b : TTCGGGACACAGTACCTCCACCCCATTTTGCATGCCATCAACTtacaatggccacacttt
LVR01_0106_A02.b : CACGGGACCCAACACGTCGACTCCATTCTGCAGGCGATCAACTACAATG*GGCATCCA*T
OVR01_0086_A05.b : CGCGGGGACCAGCACCTCCACTTCATTTTGCAGGCCACCAACTTAAATG*GGCACACA*T
LVRM1_0091_H02.b : CGCGGGACCCAGCACCTCCACTCCATTCTGGAGGCCACNGACTACA*TG*GGCACACA*T
LVRM1_0107_C07.b : CGCGGGACCCAGCAACTCCACTCCATTCTGCAGGGCACC*ACTACAATG*GCCACACA*T
OVR01_0082_H12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGGCACCAACTACAATG*GCCACCCA*T
OVRM1_0191_B03.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCGAGCCACCAACTACAATG*GCCACACA*T
LVRM1_0195_E09.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGGCCACCACTACAATG*GCCACACA*T
OVRM1_0037_C05.b : CGCGGGACCCAGCACTCCCACTCCATTCTGTCAGCCACCTACTACAATG*GCCATACA*T
LVRM1_0202_F10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCNAGGCCACNNACTACATG*GCNACACA*T
LVRM1_0018_C08.b : CGCGGGACGCAGCACCTCCACTCCATTCTGCNAGCCACCAACTACAATG*GCCACACA*T
THY01_0005_B06.b : CCGCGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVRM1_0078_H03.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGTCACCTACTACTATG*GCCACACA*T
SPL01_0034_D02.b : CGCGGGACCCAACACCTCCACTCCATTCTGCAGGCCACCAATTACAATG*GCCACACA*T
OVRM1_0110_B12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRM1_0100_E11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVRM1_0077_G10.b : CGCGGGACCCAGCACCTCCNCTCCNTTCTGCAGGCCACCAACTACCATG*GCCACACA*T
OVR01_0083_G11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCCACTACCATG*GCCACACA*T
OVRM1_0069_G11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0059_A04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCANGCCACCAACTACAATG*GCCACACA*T
OVR01_0052_B11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAAGCCACCAACTACAATG*GCCACACA*T
TCH01_0053_C08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRM1_0021_A12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
UTR01_0014_C07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
CLNT1_0149_A10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SPL01_0010_B04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
UTR01_0025_H03.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0004_B06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0045_E08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
UTR01_0015_C12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCGGGCCACCAACTACAATG*GCCACACA*T
THY01_0016_C11.b : CGCGGGAACCAGCACCTCCACTTCATTCTGCAGGCCCACAACTACCATG*GCCACACC*T
THY01_0005_A06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0004_A06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0014_H05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
MLN01_0020_D03.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SMG01_0058_E11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACNATG*GCCACACA*T
SPL01_0041_A07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
PBL01_0005_H04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
MLN01_0077_F06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0072_F09.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
PTG01_0016_E04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCANGCCACCAACTACAATG*GCCACACA*T
UTR01_0072_D04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
ADR01_0036_D03.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
PTG01_0083_G09.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
UTR01_0087_D11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0149_E04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
CLNT1_0129_C08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0040_B07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0065_G01.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
UTR01_0036_E01.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0069_C05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0035_B09.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVR01_0011_G02.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVR01_0062_H02.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SPL01_0103_G09.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SMG01_0044_G03.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0033_D12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVR01_0047_D06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SPL01_0037_H11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
ITT01_0033_A08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SPL01_0038_C12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVR01_0051_G07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0009_G03.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
ITT01_0077_G12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SMG01_0015_G04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0043_A07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
PTG01_0077_C06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
ADR01_0051_B11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVR01_0049_G11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0112_E04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0091_D12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
MLN01_0033_G08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCANGCCACCAACTACAATG*GCCACACA*T
SMG01_0029_D10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SMG01_0033_C08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
CLNT1_0128_F12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0054_H06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0108_H07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
MLN01_0080_H03.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
UTR01_0058_H12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0146_F04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SMG01_0080_E10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
ITT01_0074_B02.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
PBL01_0038_G01.b : CGCGGGACCCAGCACCCCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVR01_0045_F12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0095_F04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
MLN01_0044_C12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
BFLT1_0092_E03.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SMG01_0085_F02.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
PBL01_0042_D09.b : CGCGGGGCCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0065_C11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SPL01_0051_D06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
MLN01_0060_B05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVR01_0061_C03.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0039_D07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0053_H04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0038_C05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
CLNT1_0065_E04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SPL01_0036_C03.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0002_G07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVR01_0059_D05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0099_B03.b : CGCGGGAACCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0001_F08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0008_A08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVR01_0089_A07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
CLNT1_0015_B10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
MLN01_0078_F10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0010_E11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0033_A10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVR01_0050_G07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0022_D07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0069_E10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SPL01_0070_H08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
CLNT1_0050_F02.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
CLNT1_0050_C08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0021_F05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0096_A03.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0039_H08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0008_A05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
CLNT1_0088_D10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0010_H10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0090_F02.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0061_G05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
CLNT1_0049_C08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
MLN01_0045_B10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
CLNT1_0004_D11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
ITT01_0095_E07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
PBL01_0087_B11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SPL01_0104_F04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
PBL01_0075_E01.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0204_B06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
CLNT1_0004_C01.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0043_C04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
ITT01_0001_E08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0012_C03.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SKNB1_0040_A11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
MLN01_0062_F06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0098_D08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
UTR01_0060_B02.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
ITT01_0076_D05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
CLNT1_0041_G01.b : CGCAGGGCCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVRM1_0080_B01.b : gcggaaccagcgactccttccgttcctgcaggcacctctacaatggcccccatggttgag
OVRM1_0056_F10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACNATG*GCCACACA*T
ADR01_0052_D04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SKNB1_0002_E09.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0140_C11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0107_A01.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
ITT01_0033_H09.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0070_H03.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
PST01_0001_A11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
CLNT1_0144_A06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0110_D07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
ITT01_0063_H06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0109_F07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
ITT01_0088_C04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0121_D03.b :
PTG01_0097_E07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GGCACACA*T
SPL01_0064_G02.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVR01_0018_H10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
TCH01_0033_F10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0205_D02.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0009_D05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATGGGCCACACA*T
PBL01_0004_F08.b : cacccccgcgggaccccgacacctcccctcccttctggcaggccccccaactataaaggg
LVRM1_0001_H10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRM1_0067_D06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVR01_0053_D05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTATCAATGGGCACACA*T
SMG01_0042_F07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCANCAACTACAATG*GCCACACA*T
MLN01_0064_D10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0087_G10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
UTR01_0042_A05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0104_E06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0045_C09.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0093_C12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
CLNT1_0040_G10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0006_H10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0074_C07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*ACCACACA*T
OVRT1_0100_D10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
PTG01_0082_C12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCANGCCACCAACTACNATG*GCCACACA*T
PTG01_0050_H04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
PBL01_0063_G05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
CLNT1_0023_H04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0108_D12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0060_A11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
ITT01_0013_F04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0100_H04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0100_G09.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
UTR01_0061_B12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0008_A02.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
MLN01_0059_D12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVR01_0105_A02.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0095_A02.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
MLN01_0076_B10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0090_F08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LVR01_0104_C04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
UTR01_0048_H06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0025_C04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0205_G05.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
ITT01_0009_D10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
ITT01_0043_C06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
ITT01_0098_A12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
ADR01_0076_C06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SKNB1_0051_H08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SKNB1_0040_F06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SKNB1_0097_A08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRM1_0165_B03.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SPL01_0084_A10.b : CGCGGGAGCCAGCACCTCCACTCTATTCTGCAAGCCACCTAGTACAATG*GTCACACA*T
TES01_0106_A02.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGNCCACCACTACNATG*GGCACACA*T
SPL01_0086_H03.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SPL01_0079_B04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
THY01_0038_E09.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
KDN01_0024_C07.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
PST01_0054_B10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
KDN01_0086_A08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
UTR01_0009_G02.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVR01_0067_F02.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0033_D11.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
KDN01_0061_H06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SPL01_0009_H04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
ADR01_0067_F04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
HTMT1_0095_A01.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
PCT01_0024_H06.b : CGCGGGACCCAGCACCTCCACTCTATTCTGCANGCCACCAACTACAATG*ACCACACA*T
ITT01_0042_D04.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0004_F10.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
UTR01_0071_D04.b : CCCGGGACCCAGCACCTCCACTCCCTTCTGCAGGCCACCAACTACAATG*GCCACACA*T
OVRT1_0080_H12.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
MLN01_0007_D01.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
LNG01_0091_G06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
SPLT1_0042_H06.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
ADR01_0062_B08.b : CGCGGGACCCAGCACCTCCACTCCATTCTGCAGGCCACCAACTACAATG*GCCACACA*T
20110601C-001050 : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
---------+---------+---------+---------+---------+---------+ 989
OVRT1_0030_A10.b : ttgcctttaccctcgatcctggctacctgggcatggtgaacctgtggtgtctttgggtgc
OVRM1_0043_C03.b :
LNG01_0090_A04.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGAACCTGTT*TGTGTCTT
THY01_0203_H04.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
PBL01_0009_H08.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
PTG01_0086_H10.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
OVRT1_0093_A05.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
OVRM1_0084_C03.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
SPL01_0105_A03.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
THY01_0030_H01.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
SMG01_0037_C04.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
THY01_0022_E02.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
ADR01_0033_F05.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
MLN01_0055_F09.b : GTCTGCACTTAG*CCTCGACCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LVRM1_0087_F09.b : cgtgccgcgtatgcagcgacgctacggcacctgcgtatggcggnacgtcggcgc
THY01_0123_D12.b :
THY01_0125_F04.b :
PTG01_0066_D10.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGggggaactgttggtgtcct
OVR01_0076_D08.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATGGTGGAGC
THY01_0013_H09.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
UTR01_0021_F10.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
UTR01_0082_C11.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
TES01_0044_A06.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
ITT01_0020_D05.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
MLN01_0078_D08.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LVR01_0017_B08.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
SPL01_0097_G06.b : GTCTGCACTTAT*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
OVR01_0010_G11.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
TCH01_0025_D01.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
PST01_0033_D01.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
THY01_0112_F11.b :
LVRM1_0165_H11.b : GTCTGCACTTAN*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
OVR01_0104_C10.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
MLN01_0018_A07.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
PST01_0067_C11.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
SKNB1_0067_G01.b : ccattttccttcagatcatcccccctgattaactttgcaaaattctgcgctcatttcaga
OVRM1_0017_A09.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCCT
THY01_0036_H02.b : GTCTGCCCTTAG*CCTCCATCCATGGCTTAC*CGGGCATTGGGGAGCTGTT*GGTGTCTT
LNG01_0045_H12.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
TCH01_0018_A04.b : GTCTGCACTTAG*CCTTGATCCATGGCTACC*TGGGCATGGTGGAGCTGTT*GGTGTCTT
OVRT1_0129_E03.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
SKNB1_0082_E09.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
OVRT1_0055_A02.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
MLN01_0102_C11.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LVRM1_0062_B12.b : gatagattgtggatatggtttgtgttggtattgtttacgctctggtattatcgttgtctc
PTG01_0064_A02.b : cattaccggggaaccgggggattttgggaaattttggggtctttgggggcaaaggaaaac
LVRM1_0089_F02.b : gagtatggcgccatgcctgcgtagtggagcattggggaacggtgggggtttaggtgt
LVRM1_0192_D12.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LVRM1_0113_A05.b : GTCTGCACTTAG*CCTCAATCCGTGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGGCT*
THY01_0020_F12.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTG*AGTGTCTT
OVRM1_0031_B05.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGNAGCTGT*GGTGTCTT
THY01_0069_D03.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
SMG01_0081_C07.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
OVRT1_0125_D08.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
OVR01_0090_E09.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
SMG01_0047_F12.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LNG01_0004_D12.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
OVR01_0051_H10.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
THY01_0038_D07.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LVR01_0048_F04.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
SKNB1_0033_F04.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
THY01_0097_B06.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
SMG01_0034_A08.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LVR01_0030_A04.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*AGGGCATTGTGGAGCTGTT*GGTGTCTT
MLN01_0030_H11.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LNG01_0004_A12.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
OVRT1_0091_G04.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LVR01_0077_H10.b : GTCTGCACTGAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LVR01_0028_A05.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
MLN01_0104_E06.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
ITT01_0078_E02.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
ILNT1_0088_E10.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LVR01_0012_A08.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
MLN01_0010_A01.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
UTR01_0106_A11.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTTTT
PST01_0084_H07.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LNG01_0071_B05.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
SKNB1_0059_E09.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LVRM1_0067_A10.b : ttgtatagtaataggccgcttgagcgacgtatgacataggtatattgatagtgatatacg
LVRM1_0172_C07.b : gagatgttgtgccaaagatgcgcgcgcgcggtattcccgtctctatttttgtat
THY01_0123_F03.b :
LVRM1_0079_A04.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LVRM1_0049_B02.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
OVR01_0054_B12.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
UTR01_0042_F02.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LVR01_0048_B01.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
UTR01_0018_A05.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
OVR01_0050_D11.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
PTG01_0024_D08.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTNGT*GGTGTCTT
LNG01_0002_H12.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LNG01_0030_F07.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
SMG01_0014_D04.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
OVR01_0093_G11.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
UTR01_0059_A04.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LNG01_0082_E08.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
OVR01_0015_A08.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LNG01_0025_E05.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
OVRT1_0095_A05.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
MLN01_0025_A11.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
MLN01_0056_D12.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LVRM1_0203_F10.b : tttatcccccttcctggggtaccaggggattggagagcatttggttttcttgggggcaaa
LVRM1_0048_G03.b : ctgacccttattccgatcgctgtgtacccgtgccctcgcgttatcttttgtggctctcgg
PTG01_0102_C06.b : gtgcctttaacccccattccgggggcacccggggatttggggaacctttggggctttttg
OVRM1_0037_F10.b : attataaacctacgatctttgatacagggccacgcggagcatagaggtcacttcgcgtat
LVRM1_0101_H02.b : ttttcgtttttccctttacctttttatccgttgcctgcttgggttctgttaaaccttatc
SMG01_0054_B08.b : gcgcttaaccccattcaggggtacctgggcattgggaaacttttggtggctttgggggcc
MLN01_0018_A08.b : ccctaacctcaatcctggctaccgggcattgggacctgtgggggccttggggccgatgca
SMG01_0066_A01.b : ggcctaacctcgatcatggctaactggccatgggggactgttgtgtcttgggtgctaatg
LNG01_0101_A12.b : ctgcccttaacatccatcctgtcaacttgggaattgtgaactgttggttctttcgtagct
LVR01_0106_A02.b : GTCTaacactttaccctcgttccacggctacctgggcattatggaggctgtgatgtctta
OVR01_0086_A05.b : GTCTGCACTTAA*GCTCGATCCATGGCTACCctggggattgtggaactggttggggcctt
LVRM1_0091_H02.b : GTCTGCCCTTAT*CCTCGATCCGTGGCTACC*TGGGCATTGGTGAGCTGTagggggcgtt
LVRM1_0107_C07.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAACTGTT*GGTGTCTT
OVR01_0082_H12.b : GTCTGCACTTAGCCCTCGATCCATGGGTACCCTGGGCATTGTGGAGCTGTT*GGgggtcc
OVRM1_0191_B03.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LVRM1_0195_E09.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
OVRM1_0037_C05.b : GTCTGCACTTGC*CCTCGATCCATGGATACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LVRM1_0202_F10.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LVRM1_0018_C08.b : GTCTGCACTTAG*CCTCGATTCATGGCTACA*TGGGCATTGTGGAACTGTT*GGTGTCTT
THY01_0005_B06.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGAGCATTGTGGAGCTGCT*GGCGTCCT
LVRM1_0078_H03.b : GTCTGCACTTAT*CCTCGATCCATGGCTACC*TGTGCATTGTGGAGCTGTT*GGTGTCTT
SPL01_0034_D02.b : GTCTCCACTTAA*GCTTCATTCCTGGCTACT*TGGGCATTGGGGAACTGTTTGGTGCCTT
OVRM1_0110_B12.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
OVRM1_0100_E11.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
LVRM1_0077_G10.b : GTCTGCATTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
OVR01_0083_G11.b : GTCTGCACTTAG*CCTCGATCCCTGGCTACC*TGGGCATTGGGGAACTGTT*GGGGTCTT
OVRM1_0069_G11.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
OVR01_0059_A04.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
OVR01_0052_B11.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGGCATGTGGAGCTGTT*GGTGTCTT
TCH01_0053_C08.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAACTGTT*GGTGTCTT
OVRM1_0021_A12.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGNGCATTGTGGAGCTGTT*GGTGTCTT
UTR01_0014_C07.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
CLNT1_0149_A10.b : GTCTGGCCTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
SPL01_0010_B04.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
UTR01_0025_H03.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
THY01_0004_B06.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGNT*GGTGTNCT
THY01_0045_E08.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGGCTT
UTR01_0015_C12.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
THY01_0016_C11.b : GTCTGCACTTAG*CCTCGATCCAGGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCCT
THY01_0005_A06.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGCT*GGTGTCTT
THY01_0004_A06.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGNT*GGTGTCTT
THY01_0014_H05.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
MLN01_0020_D03.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
SMG01_0058_E11.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
SPL01_0041_A07.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
PBL01_0005_H04.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
MLN01_0077_F06.b : GTCTGCACTTAG*CCTCGATCCCTGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
OVRT1_0072_F09.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
PTG01_0016_E04.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
UTR01_0072_D04.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
ADR01_0036_D03.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
PTG01_0083_G09.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
UTR01_0087_D11.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT
OVRT1_0149_E04.b : GTCTGCACTTAG*CCTCGATCCATGGCTACC*TGGGCATTGTGGAGCTGTT*GGTGTCTT<