
[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-001050

Length: 1,556

Sequence [FASTA format sequence]

SNP mapping information
SNP IDRel.Chr.Location (cM)

Assembly Overview:      TOP
Change score limit to  

BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinNFKBIANF-kappa-B inhibitor alpha [Homo sapiens]. 560e-159O
Contig/Assembly ProteinNFKB1nuclear factor NF-kappa-B p105 subunit isoform 2 [Homo sapiens]. 1399e-33
Contig/Assembly ProteinNFKB1nuclear factor NF-kappa-B p105 subunit isoform 1 [Homo sapiens]. 1399e-33
Contig/Assembly ProteinNFKBIENF-kappa-B inhibitor epsilon [Homo sapiens]. 1342e-31
Contig/Assembly ProteinNFKB2nuclear factor NF-kappa-B p100 subunit isoform b [Homo sapiens]. 1134e-25
Contig/Assembly ProteinNFKB2nuclear factor NF-kappa-B p100 subunit isoform a [Homo sapiens]. 1134e-25
Contig/Assembly ProteinNFKB2nuclear factor NF-kappa-B p100 subunit isoform b [Homo sapiens]. 1134e-25
Contig/Assembly ProteinBCL3B-cell lymphoma 3 protein [Homo sapiens]. 1103e-24O
Contig/Assembly ProteinMIB1E3 ubiquitin-protein ligase MIB1 [Homo sapiens]. 921e-18
Contig/Assembly ProteinNFKBIZNF-kappa-B inhibitor zeta isoform b [Homo sapiens]. 87.43e-17

BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinNfkbiaNF-kappa-B inhibitor alpha [Mus musculus]. 551e-157O
Contig/Assembly ProteinNfkbieNF-kappa-B inhibitor epsilon [Mus musculus]. 1373e-32O
Contig/Assembly ProteinNfkb1nuclear factor NF-kappa-B p105 subunit [Mus musculus]. 1359e-32
Contig/Assembly ProteinNfkb2nuclear factor NF-kappa-B p100 subunit isoform a [Mus musculus]. 1142e-25
Contig/Assembly ProteinNfkb2nuclear factor NF-kappa-B p100 subunit isoform b [Mus musculus]. 1142e-25
Contig/Assembly ProteinNfkb2nuclear factor NF-kappa-B p100 subunit isoform a [Mus musculus]. 1142e-25
Contig/Assembly ProteinBcl3B-cell lymphoma 3 protein homolog [Mus musculus]. 1135e-25O
Contig/Assembly ProteinMib1E3 ubiquitin-protein ligase MIB1 [Mus musculus]. 921e-18
Contig/Assembly ProteinNfkbizNF-kappa-B inhibitor zeta isoform b [Mus musculus]. 874e-17
Contig/Assembly ProteinNfkbizNF-kappa-B inhibitor zeta isoform a [Mus musculus]. 874e-17

BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC480291PREDICTED: similar to nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha [Canis familiaris]. 5760.0
Contig/Assembly ProteinNFKB1nuclear factor NF-kappa-B p105 subunit [Canis lupus familiaris]. 1303e-30
Contig/Assembly ProteinLOC486858PREDICTED: similar to Nuclear factor NF-kappa-B p100/p49 subunits (DNA-binding factor KBF2) (H2TF1) (Lymphocyte translocation chromosome 10) (Oncogene Lyt-10) (Lyt10) isoform 1 [Canis familiaris]. 1112e-24
Contig/Assembly ProteinLOC486858PREDICTED: similar to Nuclear factor NF-kappa-B p100/p49 subunits (DNA-binding factor KBF2) (H2TF1) (Lymphocyte translocation chromosome 10) (Oncogene Lyt-10) (Lyt10) isoform 5 [Canis familiaris]. 1112e-24
Contig/Assembly ProteinLOC486858PREDICTED: similar to Nuclear factor NF-kappa-B p100/p49 subunits (DNA-binding factor KBF2) (H2TF1) (Lymphocyte translocation chromosome 10) (Oncogene Lyt-10) (Lyt10) isoform 4 [Canis familiaris]. 1112e-24
Contig/Assembly ProteinLOC486858PREDICTED: similar to Nuclear factor NF-kappa-B p100/p49 subunits (DNA-binding factor KBF2) (H2TF1) (Lymphocyte translocation chromosome 10) (Oncogene Lyt-10) (Lyt10) isoform 3 [Canis familiaris]. 1112e-24
Contig/Assembly ProteinLOC612349PREDICTED: similar to B-cell lymphoma 3-encoded protein (Bcl-3 protein) [Canis familiaris]. 94.43e-19O
Contig/Assembly ProteinLOC490521PREDICTED: similar to mindbomb homolog 1 [Canis familiaris]. 921e-18
Contig/Assembly ProteinLOC478549PREDICTED: similar to nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta isoform a [Canis familiaris]. 84.72e-16
Contig/Assembly ProteinLOC482842PREDICTED: similar to ankyrin 1 isoform 3 [Canis familiaris]. 84.72e-16

BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinNFKBIANF-kappa-B inhibitor alpha [Bos taurus]. 595e-170O
Contig/Assembly ProteinNFKB1nuclear factor NF-kappa-B p105 subunit [Bos taurus]. 1358e-32
Contig/Assembly ProteinNFKBIENF-kappa-B inhibitor epsilon [Bos taurus]. 1342e-31O
Contig/Assembly ProteinNFKB2nuclear factor NF-kappa-B p100 subunit [Bos taurus]. 1135e-25
Contig/Assembly ProteinBCL3PREDICTED: B-cell CLL/lymphoma 3-like [Bos taurus]. 1104e-24O
Contig/Assembly ProteinBCL3B-cell CLL/lymphoma 3 [Bos taurus]. 1104e-24O
Contig/Assembly ProteinMIB1mindbomb homolog 1 [Bos taurus]. 921e-18
Contig/Assembly ProteinMIB1PREDICTED: mindbomb homolog 1 (Drosophila) [Bos taurus]. 921e-18
Contig/Assembly ProteinNFKBIZNF-kappa-B inhibitor zeta [Bos taurus]. 843e-16
Contig/Assembly ProteinRAI14PREDICTED: retinoic acid induced 14-like [Bos taurus]. 82.88e-16O

BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinNFKBIANF-kappa-B inhibitor alpha [Sus scrofa]. 598e-171O
Contig/Assembly ProteinNFKB1nuclear factor NF-kappa-B p105 subunit [Sus scrofa]. 1364e-32
Contig/Assembly ProteinLOC100621111PREDICTED: NF-kappa-B inhibitor beta-like [Sus scrofa]. 1088e-24O
Contig/Assembly ProteinMIB1PREDICTED: e3 ubiquitin-protein ligase MIB1 [Sus scrofa]. 928e-19
Contig/Assembly ProteinLOC100157679PREDICTED: ankyrin-1-like, partial [Sus scrofa]. 828e-16
Contig/Assembly ProteinANKRD35PREDICTED: ankyrin repeat domain-containing protein 35 [Sus scrofa]. 80.52e-15O
Contig/Assembly ProteinLOC100525018PREDICTED: LOW QUALITY PROTEIN: ankyrin repeat domain-containing protein 6-like [Sus scrofa]. 78.69e-15O
Contig/Assembly ProteinANK3PREDICTED: ankyrin-3 [Sus scrofa]. 78.21e-14
Contig/Assembly ProteinANK2PREDICTED: LOW QUALITY PROTEIN: ankyrin-2, partial [Sus scrofa]. 78.21e-14O
Contig/Assembly ProteinRAI14ankycorbin [Sus scrofa]. 77.42e-14O

Assembly Members: 336      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
MLN010007D01MLN01_0007_D01.bCJ008217 AK233732
OVRT10030A10OVRT1_0030_A10.bFS688805 AK395569
PTG010086H10PTG01_0086_H10.bFS711745 AK397107
PTG010102C06PTG01_0102_C06.b  AK399188


SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change

Alignment:      TOP

20110601C-001050 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRT1_0030_A10.b : nttttccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0043_C03.b :
LNG01_0090_A04.b :
THY01_0203_H04.b :
PBL01_0009_H08.b :
PTG01_0086_H10.b :
OVRT1_0093_A05.b :
OVRM1_0084_C03.b :
SPL01_0105_A03.b :
THY01_0030_H01.b :
SMG01_0037_C04.b :
THY01_0022_E02.b :
ADR01_0033_F05.b :
MLN01_0055_F09.b :
LVRM1_0087_F09.b :
THY01_0123_D12.b :
THY01_0125_F04.b :
PTG01_0066_D10.b :
OVR01_0076_D08.b :
THY01_0013_H09.b :
UTR01_0021_F10.b :
UTR01_0082_C11.b :
TES01_0044_A06.b :
ITT01_0020_D05.b :
MLN01_0078_D08.b :
LVR01_0017_B08.b :
SPL01_0097_G06.b :
OVR01_0010_G11.b :
TCH01_0025_D01.b :
PST01_0033_D01.b :
THY01_0112_F11.b :
LVRM1_0165_H11.b :
OVR01_0104_C10.b :
MLN01_0018_A07.b :
PST01_0067_C11.b :
SKNB1_0067_G01.b :
OVRM1_0017_A09.b :
THY01_0036_H02.b :
LNG01_0045_H12.b :
TCH01_0018_A04.b :
OVRT1_0129_E03.b :
SKNB1_0082_E09.b :
OVRT1_0055_A02.b :
MLN01_0102_C11.b :
LVRM1_0062_B12.b :
PTG01_0064_A02.b :
LVRM1_0089_F02.b :
LVRM1_0192_D12.b :
LVRM1_0113_A05.b :
THY01_0020_F12.b :
OVRM1_0031_B05.b :
THY01_0069_D03.b :
SMG01_0081_C07.b :
OVRT1_0125_D08.b :
OVR01_0090_E09.b :
SMG01_0047_F12.b :
LNG01_0004_D12.b :
OVR01_0051_H10.b :
THY01_0038_D07.b :
LVR01_0048_F04.b :
SKNB1_0033_F04.b :
THY01_0097_B06.b :
SMG01_0034_A08.b :
LVR01_0030_A04.b :
MLN01_0030_H11.b :
LNG01_0004_A12.b :
OVRT1_0091_G04.b :
LVR01_0077_H10.b :
LVR01_0028_A05.b :
MLN01_0104_E06.b :
ITT01_0078_E02.b :
ILNT1_0088_E10.b :
LVR01_0012_A08.b :
MLN01_0010_A01.b :
UTR01_0106_A11.b :
PST01_0084_H07.b :
LNG01_0071_B05.b :
SKNB1_0059_E09.b :
LVRM1_0067_A10.b :
LVRM1_0172_C07.b :
THY01_0123_F03.b :
LVRM1_0079_A04.b :
LVRM1_0049_B02.b :
OVR01_0054_B12.b :
UTR01_0042_F02.b :
LVR01_0048_B01.b :
UTR01_0018_A05.b :
OVR01_0050_D11.b :
PTG01_0024_D08.b :
LNG01_0002_H12.b :
LNG01_0030_F07.b :
SMG01_0014_D04.b :
OVR01_0093_G11.b :
UTR01_0059_A04.b :
LNG01_0082_E08.b :
OVR01_0015_A08.b :
LNG01_0025_E05.b :
OVRT1_0095_A05.b :
MLN01_0025_A11.b :
MLN01_0056_D12.b :
LVRM1_0203_F10.b :
LVRM1_0048_G03.b :
PTG01_0102_C06.b :
OVRM1_0037_F10.b :
LVRM1_0101_H02.b :
SMG01_0054_B08.b :
MLN01_0018_A08.b :
SMG01_0066_A01.b :
LNG01_0101_A12.b :
LVR01_0106_A02.b :
OVR01_0086_A05.b :
LVRM1_0091_H02.b :
LVRM1_0107_C07.b :
OVR01_0082_H12.b :
OVRM1_0191_B03.b :
LVRM1_0195_E09.b :
OVRM1_0037_C05.b :
LVRM1_0202_F10.b :
LVRM1_0018_C08.b :
THY01_0005_B06.b :
LVRM1_0078_H03.b :
SPL01_0034_D02.b :
OVRM1_0110_B12.b :
OVRM1_0100_E11.b :
LVRM1_0077_G10.b :
OVR01_0083_G11.b :
OVRM1_0069_G11.b :
OVR01_0059_A04.b :
OVR01_0052_B11.b :
TCH01_0053_C08.b :
OVRM1_0021_A12.b :
UTR01_0014_C07.b :
CLNT1_0149_A10.b :
SPL01_0010_B04.b :
UTR01_0025_H03.b :
THY01_0004_B06.b :
THY01_0045_E08.b :
UTR01_0015_C12.b :
THY01_0016_C11.b :
THY01_0005_A06.b :
THY01_0004_A06.b :
THY01_0014_H05.b :
MLN01_0020_D03.b :
SMG01_0058_E11.b :
SPL01_0041_A07.b :
PBL01_0005_H04.b :
MLN01_0077_F06.b :
OVRT1_0072_F09.b :
PTG01_0016_E04.b :
UTR01_0072_D04.b :
ADR01_0036_D03.b :
PTG01_0083_G09.b :
UTR01_0087_D11.b :
OVRT1_0149_E04.b :
CLNT1_0129_C08.b :
THY01_0040_B07.b :
OVR01_0065_G01.b :
UTR01_0036_E01.b :
LNG01_0069_C05.b :
OVR01_0035_B09.b :
LVR01_0011_G02.b :
LVR01_0062_H02.b :
SPL01_0103_G09.b :
SMG01_0044_G03.b :
OVR01_0033_D12.b :
LVR01_0047_D06.b :
SPL01_0037_H11.b :
ITT01_0033_A08.b :
SPL01_0038_C12.b :
LVR01_0051_G07.b :
LNG01_0009_G03.b :
ITT01_0077_G12.b :
SMG01_0015_G04.b :
OVR01_0043_A07.b :
PTG01_0077_C06.b :
ADR01_0051_B11.b :
LVR01_0049_G11.b :
OVRT1_0112_E04.b :
OVR01_0091_D12.b :
MLN01_0033_G08.b :
SMG01_0029_D10.b :
SMG01_0033_C08.b :
CLNT1_0128_F12.b :
OVR01_0054_H06.b :
OVRT1_0108_H07.b :
MLN01_0080_H03.b :
UTR01_0058_H12.b :
OVRT1_0146_F04.b :
SMG01_0080_E10.b :
ITT01_0074_B02.b :
PBL01_0038_G01.b :
LVR01_0045_F12.b :
OVR01_0095_F04.b :
MLN01_0044_C12.b :
BFLT1_0092_E03.b :
SMG01_0085_F02.b :
PBL01_0042_D09.b :
THY01_0065_C11.b :
SPL01_0051_D06.b :
MLN01_0060_B05.b :
LVR01_0061_C03.b :
THY01_0039_D07.b :
OVR01_0053_H04.b :
THY01_0038_C05.b :
CLNT1_0065_E04.b :
SPL01_0036_C03.b :
LNG01_0002_G07.b :
LVR01_0059_D05.b :
OVR01_0099_B03.b :
OVRT1_0001_F08.b :
OVR01_0008_A08.b :
LVR01_0089_A07.b :
CLNT1_0015_B10.b :
MLN01_0078_F10.b :
OVRT1_0010_E11.b :
LNG01_0033_A10.b :
LVR01_0050_G07.b :
OVRT1_0022_D07.b :
LNG01_0069_E10.b :
SPL01_0070_H08.b :
CLNT1_0050_F02.b :
CLNT1_0050_C08.b :
OVR01_0021_F05.b :
THY01_0096_A03.b :
OVRT1_0039_H08.b :
THY01_0008_A05.b :
CLNT1_0088_D10.b :
LNG01_0010_H10.b :
THY01_0090_F02.b :
THY01_0061_G05.b :
CLNT1_0049_C08.b :
MLN01_0045_B10.b :
CLNT1_0004_D11.b :
ITT01_0095_E07.b :
PBL01_0087_B11.b :
SPL01_0104_F04.b :
PBL01_0075_E01.b :
THY01_0204_B06.b :
CLNT1_0004_C01.b :
LNG01_0043_C04.b :
ITT01_0001_E08.b :
LNG01_0012_C03.b :
SKNB1_0040_A11.b :
MLN01_0062_F06.b :
LNG01_0098_D08.b :
UTR01_0060_B02.b :
ITT01_0076_D05.b :
CLNT1_0041_G01.b :
LVRM1_0080_B01.b :
OVRM1_0056_F10.b :
ADR01_0052_D04.b :
SKNB1_0002_E09.b :
OVRT1_0140_C11.b :
LNG01_0107_A01.b :
ITT01_0033_H09.b :
OVRT1_0070_H03.b :
PST01_0001_A11.b :
CLNT1_0144_A06.b :
LNG01_0110_D07.b :
ITT01_0063_H06.b :
LNG01_0109_F07.b :
ITT01_0088_C04.b :
THY01_0121_D03.b :
PTG01_0097_E07.b :
SPL01_0064_G02.b :
LVR01_0018_H10.b :
TCH01_0033_F10.b :
THY01_0205_D02.b :
OVR01_0009_D05.b :
PBL01_0004_F08.b :
LVRM1_0001_H10.b :
OVRM1_0067_D06.b :
LVR01_0053_D05.b :
SMG01_0042_F07.b :
MLN01_0064_D10.b :
LNG01_0087_G10.b :
UTR01_0042_A05.b :
OVR01_0104_E06.b :
OVRT1_0045_C09.b :
OVR01_0093_C12.b :
CLNT1_0040_G10.b :
OVR01_0006_H10.b :
THY01_0074_C07.b :
OVRT1_0100_D10.b :
PTG01_0082_C12.b :
PTG01_0050_H04.b :
PBL01_0063_G05.b :
CLNT1_0023_H04.b :
LNG01_0108_D12.b :
OVRT1_0060_A11.b :
ITT01_0013_F04.b :
THY01_0100_H04.b :
OVRT1_0100_G09.b :
UTR01_0061_B12.b :
OVRT1_0008_A02.b :
MLN01_0059_D12.b :
LVR01_0105_A02.b :
OVRT1_0095_A02.b :
MLN01_0076_B10.b :
OVRT1_0090_F08.b :
LVR01_0104_C04.b :
UTR01_0048_H06.b :
LNG01_0025_C04.b :
THY01_0205_G05.b :
ITT01_0009_D10.b :
ITT01_0043_C06.b :
ITT01_0098_A12.b :
ADR01_0076_C06.b :
SKNB1_0051_H08.b :
SKNB1_0040_F06.b :
SKNB1_0097_A08.b :
OVRM1_0165_B03.b :
SPL01_0084_A10.b :
TES01_0106_A02.b :
SPL01_0086_H03.b :
SPL01_0079_B04.b :
THY01_0038_E09.b :
KDN01_0024_C07.b :
PST01_0054_B10.b :
KDN01_0086_A08.b :
UTR01_0009_G02.b :
OVR01_0067_F02.b :
LNG01_0033_D11.b :
KDN01_0061_H06.b :
SPL01_0009_H04.b :
ADR01_0067_F04.b :
HTMT1_0095_A01.b :
PCT01_0024_H06.b :
ITT01_0042_D04.b :
OVRT1_0004_F10.b :
UTR01_0071_D04.b :
OVRT1_0080_H12.b :
MLN01_0007_D01.b :
LNG01_0091_G06.b :
SPLT1_0042_H06.b :
ADR01_0062_B08.b :
---------+---------+---------+---------+---------+---------+ 47
OVRM1_0043_C03.b :
LNG01_0090_A04.b :
THY01_0203_H04.b : ct
PBL01_0009_H08.b :
PTG01_0086_H10.b :
OVRT1_0093_A05.b :
OVRM1_0084_C03.b :
SPL01_0105_A03.b :
THY01_0030_H01.b :
SMG01_0037_C04.b :
THY01_0022_E02.b :
ADR01_0033_F05.b :
MLN01_0055_F09.b :
LVRM1_0087_F09.b :
THY01_0123_D12.b :
THY01_0125_F04.b :
PTG01_0066_D10.b :
OVR01_0076_D08.b :
THY01_0013_H09.b :
UTR01_0021_F10.b :
UTR01_0082_C11.b :
TES01_0044_A06.b :
ITT01_0020_D05.b :
MLN01_0078_D08.b :
LVR01_0017_B08.b :
SPL01_0097_G06.b :
OVR01_0010_G11.b :
TCH01_0025_D01.b :
PST01_0033_D01.b :
THY01_0112_F11.b :
LVRM1_0165_H11.b :
OVR01_0104_C10.b :
MLN01_0018_A07.b :
PST01_0067_C11.b :
SKNB1_0067_G01.b :
OVRM1_0017_A09.b :
THY01_0036_H02.b :
LNG01_0045_H12.b :
TCH01_0018_A04.b :
OVRT1_0129_E03.b :
SKNB1_0082_E09.b :
OVRT1_0055_A02.b :
MLN01_0102_C11.b :
LVRM1_0062_B12.b :
PTG01_0064_A02.b :
LVRM1_0089_F02.b :
LVRM1_0192_D12.b :
LVRM1_0113_A05.b :
THY01_0020_F12.b :
OVRM1_0031_B05.b :
THY01_0069_D03.b :
SMG01_0081_C07.b :
OVRT1_0125_D08.b :
OVR01_0090_E09.b :
SMG01_0047_F12.b :
LNG01_0004_D12.b :
OVR01_0051_H10.b :
THY01_0038_D07.b :
LVR01_0048_F04.b :
SKNB1_0033_F04.b :
THY01_0097_B06.b :
SMG01_0034_A08.b :
LVR01_0030_A04.b :
MLN01_0030_H11.b :
LNG01_0004_A12.b :
OVRT1_0091_G04.b :
LVR01_0077_H10.b :
LVR01_0028_A05.b :
MLN01_0104_E06.b :
ITT01_0078_E02.b :
ILNT1_0088_E10.b :
LVR01_0012_A08.b :
MLN01_0010_A01.b :
UTR01_0106_A11.b :
PST01_0084_H07.b :
LNG01_0071_B05.b :
SKNB1_0059_E09.b :
LVRM1_0067_A10.b :
LVRM1_0172_C07.b :
THY01_0123_F03.b :
LVRM1_0079_A04.b :
LVRM1_0049_B02.b :
OVR01_0054_B12.b :
UTR01_0042_F02.b :
LVR01_0048_B01.b :
UTR01_0018_A05.b :
OVR01_0050_D11.b :
PTG01_0024_D08.b :
LNG01_0002_H12.b :
LNG01_0030_F07.b :
SMG01_0014_D04.b :
OVR01_0093_G11.b :
UTR01_0059_A04.b :
LNG01_0082_E08.b :
OVR01_0015_A08.b :
LNG01_0025_E05.b :
OVRT1_0095_A05.b :
MLN01_0025_A11.b :
MLN01_0056_D12.b :
LVRM1_0203_F10.b :
LVRM1_0048_G03.b :
PTG01_0102_C06.b :
OVRM1_0037_F10.b :
LVRM1_0101_H02.b :
SMG01_0054_B08.b :
MLN01_0018_A08.b :
SMG01_0066_A01.b :
LNG01_0101_A12.b :
LVR01_0106_A02.b :
OVR01_0086_A05.b :
LVRM1_0091_H02.b :
LVRM1_0107_C07.b :
OVR01_0082_H12.b :
OVRM1_0191_B03.b :
LVRM1_0195_E09.b :
OVRM1_0037_C05.b :
LVRM1_0202_F10.b :
LVRM1_0018_C08.b :
THY01_0005_B06.b :
LVRM1_0078_H03.b :
SPL01_0034_D02.b :
OVRM1_0110_B12.b :
OVRM1_0100_E11.b :
LVRM1_0077_G10.b :
OVR01_0083_G11.b :
OVRM1_0069_G11.b :
OVR01_0059_A04.b :
OVR01_0052_B11.b :
TCH01_0053_C08.b :
OVRM1_0021_A12.b :
UTR01_0014_C07.b :
CLNT1_0149_A10.b :
SPL01_0010_B04.b :
UTR01_0025_H03.b :
THY01_0004_B06.b :
THY01_0045_E08.b :
UTR01_0015_C12.b :
THY01_0016_C11.b :
THY01_0005_A06.b :
THY01_0004_A06.b :
THY01_0014_H05.b :
MLN01_0020_D03.b :
SMG01_0058_E11.b :
SPL01_0041_A07.b :
PBL01_0005_H04.b :
MLN01_0077_F06.b :
OVRT1_0072_F09.b :
PTG01_0016_E04.b :
UTR01_0072_D04.b :
ADR01_0036_D03.b :
PTG01_0083_G09.b :
UTR01_0087_D11.b :
OVRT1_0149_E04.b :
CLNT1_0129_C08.b :
THY01_0040_B07.b :
OVR01_0065_G01.b :
UTR01_0036_E01.b :
LNG01_0069_C05.b :
OVR01_0035_B09.b :
LVR01_0011_G02.b :
LVR01_0062_H02.b :
SPL01_0103_G09.b :
SMG01_0044_G03.b :
OVR01_0033_D12.b :
LVR01_0047_D06.b :
SPL01_0037_H11.b :
ITT01_0033_A08.b :
SPL01_0038_C12.b :
LVR01_0051_G07.b :
LNG01_0009_G03.b :
ITT01_0077_G12.b :
SMG01_0015_G04.b :
OVR01_0043_A07.b :
PTG01_0077_C06.b :
ADR01_0051_B11.b :
LVR01_0049_G11.b :
OVRT1_0112_E04.b :
OVR01_0091_D12.b :
MLN01_0033_G08.b :
SMG01_0029_D10.b :
SMG01_0033_C08.b :
CLNT1_0128_F12.b :
OVR01_0054_H06.b :
OVRT1_0108_H07.b :
MLN01_0080_H03.b :
UTR01_0058_H12.b :
OVRT1_0146_F04.b :
SMG01_0080_E10.b :
ITT01_0074_B02.b :
PBL01_0038_G01.b :
LVR01_0045_F12.b :
OVR01_0095_F04.b :
MLN01_0044_C12.b :
BFLT1_0092_E03.b :
SMG01_0085_F02.b :
PBL01_0042_D09.b :
THY01_0065_C11.b :
SPL01_0051_D06.b :
MLN01_0060_B05.b :
LVR01_0061_C03.b :
THY01_0039_D07.b :
OVR01_0053_H04.b :
THY01_0038_C05.b :
CLNT1_0065_E04.b :
SPL01_0036_C03.b :
LNG01_0002_G07.b :
LVR01_0059_D05.b :
OVR01_0099_B03.b :
OVRT1_0001_F08.b :
OVR01_0008_A08.b :
LVR01_0089_A07.b :
CLNT1_0015_B10.b :
MLN01_0078_F10.b :
OVRT1_0010_E11.b :
LNG01_0033_A10.b :
LVR01_0050_G07.b :
OVRT1_0022_D07.b :
LNG01_0069_E10.b :
SPL01_0070_H08.b :
CLNT1_0050_F02.b :
CLNT1_0050_C08.b :
OVR01_0021_F05.b :
THY01_0096_A03.b :
OVRT1_0039_H08.b :
THY01_0008_A05.b :
CLNT1_0088_D10.b :
LNG01_0010_H10.b :
THY01_0090_F02.b :
THY01_0061_G05.b :
CLNT1_0049_C08.b :
MLN01_0045_B10.b :
CLNT1_0004_D11.b :
ITT01_0095_E07.b :
PBL01_0087_B11.b :
SPL01_0104_F04.b :
PBL01_0075_E01.b :
THY01_0204_B06.b :
CLNT1_0004_C01.b :
LNG01_0043_C04.b :
ITT01_0001_E08.b :
LNG01_0012_C03.b :
SKNB1_0040_A11.b :
MLN01_0062_F06.b :
LNG01_0098_D08.b :
UTR01_0060_B02.b :
ITT01_0076_D05.b :
CLNT1_0041_G01.b :
LVRM1_0080_B01.b :
OVRM1_0056_F10.b :
ADR01_0052_D04.b :
SKNB1_0002_E09.b :
OVRT1_0140_C11.b :
LNG01_0107_A01.b :
ITT01_0033_H09.b :
OVRT1_0070_H03.b :
PST01_0001_A11.b :
CLNT1_0144_A06.b :
LNG01_0110_D07.b :
ITT01_0063_H06.b :
LNG01_0109_F07.b :
ITT01_0088_C04.b :
THY01_0121_D03.b :
PTG01_0097_E07.b :
SPL01_0064_G02.b :
LVR01_0018_H10.b :
TCH01_0033_F10.b :
THY01_0205_D02.b :
OVR01_0009_D05.b :
PBL01_0004_F08.b :
LVRM1_0001_H10.b :
OVRM1_0067_D06.b :
LVR01_0053_D05.b :
SMG01_0042_F07.b :
MLN01_0064_D10.b :
LNG01_0087_G10.b :
UTR01_0042_A05.b :
OVR01_0104_E06.b :
OVRT1_0045_C09.b :
OVR01_0093_C12.b :
CLNT1_0040_G10.b :
OVR01_0006_H10.b :
THY01_0074_C07.b :
OVRT1_0100_D10.b :
PTG01_0082_C12.b :
PTG01_0050_H04.b :
PBL01_0063_G05.b :
CLNT1_0023_H04.b :
LNG01_0108_D12.b :
OVRT1_0060_A11.b :
ITT01_0013_F04.b :
THY01_0100_H04.b :
OVRT1_0100_G09.b :
UTR01_0061_B12.b :
OVRT1_0008_A02.b :
MLN01_0059_D12.b :
LVR01_0105_A02.b :
OVRT1_0095_A02.b :
MLN01_0076_B10.b :
OVRT1_0090_F08.b :
LVR01_0104_C04.b :
UTR01_0048_H06.b :
LNG01_0025_C04.b :
THY01_0205_G05.b :
ITT01_0009_D10.b :
ITT01_0043_C06.b :
ITT01_0098_A12.b :
ADR01_0076_C06.b :
SKNB1_0051_H08.b :
SKNB1_0040_F06.b :
SKNB1_0097_A08.b :
OVRM1_0165_B03.b :
SPL01_0084_A10.b :
TES01_0106_A02.b :
SPL01_0086_H03.b :
SPL01_0079_B04.b :
THY01_0038_E09.b :
KDN01_0024_C07.b :
PST01_0054_B10.b :
KDN01_0086_A08.b :
UTR01_0009_G02.b :
OVR01_0067_F02.b :
LNG01_0033_D11.b :
KDN01_0061_H06.b :
SPL01_0009_H04.b :
ADR01_0067_F04.b :
HTMT1_0095_A01.b :
PCT01_0024_H06.b :
ITT01_0042_D04.b :
OVRT1_0004_F10.b :
UTR01_0071_D04.b :
OVRT1_0080_H12.b :
MLN01_0007_D01.b :
LNG01_0091_G06.b :
SPLT1_0042_H06.b :
ADR01_0062_B08.b :
---------+---------+---------+---------+---------+---------+ 107
OVRM1_0043_C03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0090_A04.b : ttcggtnggatggagatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0203_H04.b : atttggctggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0009_H08.b : nnnttatgaaagcagctggaxxxxxxxxxx
PTG01_0086_H10.b :
OVRT1_0093_A05.b :
OVRM1_0084_C03.b :
SPL01_0105_A03.b :
THY01_0030_H01.b :
SMG01_0037_C04.b :
THY01_0022_E02.b :
ADR01_0033_F05.b :
MLN01_0055_F09.b :
LVRM1_0087_F09.b :
THY01_0123_D12.b :
THY01_0125_F04.b :
PTG01_0066_D10.b :
OVR01_0076_D08.b :
THY01_0013_H09.b :
UTR01_0021_F10.b :
UTR01_0082_C11.b :
TES01_0044_A06.b :
ITT01_0020_D05.b :
MLN01_0078_D08.b :
LVR01_0017_B08.b :
SPL01_0097_G06.b :
OVR01_0010_G11.b :
TCH01_0025_D01.b :
PST01_0033_D01.b :
THY01_0112_F11.b :
LVRM1_0165_H11.b :
OVR01_0104_C10.b :
MLN01_0018_A07.b :
PST01_0067_C11.b :
SKNB1_0067_G01.b :
OVRM1_0017_A09.b :
THY01_0036_H02.b :
LNG01_0045_H12.b :
TCH01_0018_A04.b :
OVRT1_0129_E03.b :
SKNB1_0082_E09.b :
OVRT1_0055_A02.b :
MLN01_0102_C11.b :
LVRM1_0062_B12.b :
PTG01_0064_A02.b :
LVRM1_0089_F02.b :
LVRM1_0192_D12.b :
LVRM1_0113_A05.b :
THY01_0020_F12.b :
OVRM1_0031_B05.b :
THY01_0069_D03.b :
SMG01_0081_C07.b :
OVRT1_0125_D08.b :
OVR01_0090_E09.b :
SMG01_0047_F12.b :
LNG01_0004_D12.b :
OVR01_0051_H10.b :
THY01_0038_D07.b :
LVR01_0048_F04.b :
SKNB1_0033_F04.b :
THY01_0097_B06.b :
SMG01_0034_A08.b :
LVR01_0030_A04.b :
MLN01_0030_H11.b :
LNG01_0004_A12.b :
OVRT1_0091_G04.b :
LVR01_0077_H10.b :
LVR01_0028_A05.b :
MLN01_0104_E06.b :
ITT01_0078_E02.b :
ILNT1_0088_E10.b :
LVR01_0012_A08.b :
MLN01_0010_A01.b :
UTR01_0106_A11.b :
PST01_0084_H07.b :
LNG01_0071_B05.b :
SKNB1_0059_E09.b :
LVRM1_0067_A10.b :
LVRM1_0172_C07.b :
THY01_0123_F03.b :
LVRM1_0079_A04.b :
LVRM1_0049_B02.b :
OVR01_0054_B12.b :
UTR01_0042_F02.b :
LVR01_0048_B01.b :
UTR01_0018_A05.b :
OVR01_0050_D11.b :
PTG01_0024_D08.b :
LNG01_0002_H12.b :
LNG01_0030_F07.b :
SMG01_0014_D04.b :
OVR01_0093_G11.b :
UTR01_0059_A04.b :
LNG01_0082_E08.b :
OVR01_0015_A08.b :
LNG01_0025_E05.b :
OVRT1_0095_A05.b :
MLN01_0025_A11.b :
MLN01_0056_D12.b :
LVRM1_0203_F10.b :
LVRM1_0048_G03.b :
PTG01_0102_C06.b :
OVRM1_0037_F10.b :
LVRM1_0101_H02.b :
SMG01_0054_B08.b :
MLN01_0018_A08.b :
SMG01_0066_A01.b :
LNG01_0101_A12.b :
LVR01_0106_A02.b :
OVR01_0086_A05.b :
LVRM1_0091_H02.b :
LVRM1_0107_C07.b :
OVR01_0082_H12.b :
OVRM1_0191_B03.b :
LVRM1_0195_E09.b :
OVRM1_0037_C05.b :
LVRM1_0202_F10.b :
LVRM1_0018_C08.b :
THY01_0005_B06.b :
LVRM1_0078_H03.b :
SPL01_0034_D02.b :
OVRM1_0110_B12.b :
OVRM1_0100_E11.b :
LVRM1_0077_G10.b :
OVR01_0083_G11.b :
OVRM1_0069_G11.b :
OVR01_0059_A04.b :
OVR01_0052_B11.b :
TCH01_0053_C08.b :
OVRM1_0021_A12.b :
UTR01_0014_C07.b :
CLNT1_0149_A10.b :
SPL01_0010_B04.b :
UTR01_0025_H03.b :
THY01_0004_B06.b :
THY01_0045_E08.b :
UTR01_0015_C12.b :
THY01_0016_C11.b :
THY01_0005_A06.b :
THY01_0004_A06.b :
THY01_0014_H05.b :
MLN01_0020_D03.b :
SMG01_0058_E11.b :
SPL01_0041_A07.b :
PBL01_0005_H04.b :
MLN01_0077_F06.b :
OVRT1_0072_F09.b :
PTG01_0016_E04.b :
UTR01_0072_D04.b :
ADR01_0036_D03.b :
PTG01_0083_G09.b :
UTR01_0087_D11.b :
OVRT1_0149_E04.b :
CLNT1_0129_C08.b :
THY01_0040_B07.b :
OVR01_0065_G01.b :
UTR01_0036_E01.b :
LNG01_0069_C05.b :
OVR01_0035_B09.b :
LVR01_0011_G02.b :
LVR01_0062_H02.b :
SPL01_0103_G09.b :
SMG01_0044_G03.b :
OVR01_0033_D12.b :
LVR01_0047_D06.b :
SPL01_0037_H11.b :
ITT01_0033_A08.b :
SPL01_0038_C12.b :
LVR01_0051_G07.b :
LNG01_0009_G03.b :
ITT01_0077_G12.b :
SMG01_0015_G04.b :
OVR01_0043_A07.b :
PTG01_0077_C06.b :
ADR01_0051_B11.b :
LVR01_0049_G11.b :
OVRT1_0112_E04.b :
OVR01_0091_D12.b :
MLN01_0033_G08.b :
SMG01_0029_D10.b :
SMG01_0033_C08.b :
CLNT1_0128_F12.b :
OVR01_0054_H06.b :
OVRT1_0108_H07.b :
MLN01_0080_H03.b :
UTR01_0058_H12.b :
OVRT1_0146_F04.b :
SMG01_0080_E10.b :
ITT01_0074_B02.b :
PBL01_0038_G01.b :
LVR01_0045_F12.b :
OVR01_0095_F04.b :
MLN01_0044_C12.b :
BFLT1_0092_E03.b :
SMG01_0085_F02.b :
PBL01_0042_D09.b :
THY01_0065_C11.b :
SPL01_0051_D06.b :
MLN01_0060_B05.b :
LVR01_0061_C03.b :
THY01_0039_D07.b :
OVR01_0053_H04.b :
THY01_0038_C05.b :
CLNT1_0065_E04.b :
SPL01_0036_C03.b :
LNG01_0002_G07.b :
LVR01_0059_D05.b :
OVR01_0099_B03.b :
OVRT1_0001_F08.b :
OVR01_0008_A08.b :
LVR01_0089_A07.b :
CLNT1_0015_B10.b :
MLN01_0078_F10.b :
OVRT1_0010_E11.b :
LNG01_0033_A10.b :
LVR01_0050_G07.b :
OVRT1_0022_D07.b :
LNG01_0069_E10.b :
SPL01_0070_H08.b :
CLNT1_0050_F02.b :
CLNT1_0050_C08.b :
OVR01_0021_F05.b :
THY01_0096_A03.b :
OVRT1_0039_H08.b :
THY01_0008_A05.b :
CLNT1_0088_D10.b :
LNG01_0010_H10.b :
THY01_0090_F02.b :
THY01_0061_G05.b :
CLNT1_0049_C08.b :
MLN01_0045_B10.b :
CLNT1_0004_D11.b :
ITT01_0095_E07.b :
PBL01_0087_B11.b :
SPL01_0104_F04.b :
PBL01_0075_E01.b :
THY01_0204_B06.b :
CLNT1_0004_C01.b :
LNG01_0043_C04.b :
ITT01_0001_E08.b :
LNG01_0012_C03.b :
SKNB1_0040_A11.b :
MLN01_0062_F06.b :
LNG01_0098_D08.b :
UTR01_0060_B02.b :
ITT01_0076_D05.b :
CLNT1_0041_G01.b :
LVRM1_0080_B01.b :
OVRM1_0056_F10.b :
ADR01_0052_D04.b :
SKNB1_0002_E09.b :
OVRT1_0140_C11.b :
LNG01_0107_A01.b :
ITT01_0033_H09.b :
OVRT1_0070_H03.b :
PST01_0001_A11.b :
CLNT1_0144_A06.b :
LNG01_0110_D07.b :
ITT01_0063_H06.b :
LNG01_0109_F07.b :
ITT01_0088_C04.b :
THY01_0121_D03.b :
PTG01_0097_E07.b :
SPL01_0064_G02.b :
LVR01_0018_H10.b :
TCH01_0033_F10.b :
THY01_0205_D02.b :
OVR01_0009_D05.b :
PBL01_0004_F08.b :
LVRM1_0001_H10.b :
OVRM1_0067_D06.b :
LVR01_0053_D05.b :
SMG01_0042_F07.b :
MLN01_0064_D10.b :
LNG01_0087_G10.b :
UTR01_0042_A05.b :
OVR01_0104_E06.b :
OVRT1_0045_C09.b :
OVR01_0093_C12.b : gggttctcttnaanat
CLNT1_0040_G10.b :
OVR01_0006_H10.b :
THY01_0074_C07.b :
OVRT1_0100_D10.b :
PTG01_0082_C12.b :
PTG01_0050_H04.b :
PBL01_0063_G05.b :
CLNT1_0023_H04.b :
LNG01_0108_D12.b :
OVRT1_0060_A11.b :
ITT01_0013_F04.b :
THY01_0100_H04.b :
OVRT1_0100_G09.b :
UTR01_0061_B12.b :
OVRT1_0008_A02.b :
MLN01_0059_D12.b :
LVR01_0105_A02.b :
OVRT1_0095_A02.b :
MLN01_0076_B10.b :
OVRT1_0090_F08.b :
LVR01_0104_C04.b :
UTR01_0048_H06.b :
LNG01_0025_C04.b :
THY01_0205_G05.b :
ITT01_0009_D10.b :
ITT01_0043_C06.b :
ITT01_0098_A12.b :
ADR01_0076_C06.b :
SKNB1_0051_H08.b :
SKNB1_0040_F06.b :
SKNB1_0097_A08.b :
OVRM1_0165_B03.b :
SPL01_0084_A10.b :
TES01_0106_A02.b :
SPL01_0086_H03.b :
SPL01_0079_B04.b :
THY01_0038_E09.b :
KDN01_0024_C07.b :
PST01_0054_B10.b :
KDN01_0086_A08.b :
UTR01_0009_G02.b :
OVR01_0067_F02.b :
LNG01_0033_D11.b :
KDN01_0061_H06.b :
SPL01_0009_H04.b :
ADR01_0067_F04.b :
HTMT1_0095_A01.b :
PCT01_0024_H06.b :
ITT01_0042_D04.b :
OVRT1_0004_F10.b :
UTR01_0071_D04.b :
OVRT1_0080_H12.b :
MLN01_0007_D01.b :
LNG01_0091_G06.b :
SPLT1_0042_H06.b :
ADR01_0062_B08.b :
---------+---------+---------+---------+---------+---------+ 167
PTG01_0086_H10.b : nnnnn
OVRT1_0093_A05.b : ngctttttnnnnnc
OVRM1_0084_C03.b :
SPL01_0105_A03.b :
THY01_0030_H01.b :
SMG01_0037_C04.b :
THY01_0022_E02.b :
ADR01_0033_F05.b :
MLN01_0055_F09.b :
LVRM1_0087_F09.b :
THY01_0123_D12.b :
THY01_0125_F04.b :
PTG01_0066_D10.b :
OVR01_0076_D08.b :
THY01_0013_H09.b :
UTR01_0021_F10.b :
UTR01_0082_C11.b :
TES01_0044_A06.b :
ITT01_0020_D05.b :
MLN01_0078_D08.b :
LVR01_0017_B08.b :
SPL01_0097_G06.b :
OVR01_0010_G11.b : ccagaattxxxxxxxx
TCH01_0025_D01.b :
PST01_0033_D01.b :
THY01_0112_F11.b :
LVRM1_0165_H11.b :
OVR01_0104_C10.b :
MLN01_0018_A07.b :
PST01_0067_C11.b :
SKNB1_0067_G01.b :
OVRM1_0017_A09.b :
THY01_0036_H02.b :
LNG01_0045_H12.b :
TCH01_0018_A04.b :
OVRT1_0129_E03.b :
SKNB1_0082_E09.b :
OVRT1_0055_A02.b :
MLN01_0102_C11.b :
LVRM1_0062_B12.b :
PTG01_0064_A02.b :
LVRM1_0089_F02.b :
LVRM1_0192_D12.b :
LVRM1_0113_A05.b :
THY01_0020_F12.b :
OVRM1_0031_B05.b :
THY01_0069_D03.b :
SMG01_0081_C07.b :
OVRT1_0125_D08.b :
OVR01_0090_E09.b :
SMG01_0047_F12.b :
LNG01_0004_D12.b :
OVR01_0051_H10.b :
THY01_0038_D07.b :
LVR01_0048_F04.b :
SKNB1_0033_F04.b :
THY01_0097_B06.b :
SMG01_0034_A08.b :
LVR01_0030_A04.b :
MLN01_0030_H11.b :
LNG01_0004_A12.b :
OVRT1_0091_G04.b :
LVR01_0077_H10.b :
LVR01_0028_A05.b :
MLN01_0104_E06.b :
ITT01_0078_E02.b :
ILNT1_0088_E10.b :
LVR01_0012_A08.b :
MLN01_0010_A01.b :
UTR01_0106_A11.b :
PST01_0084_H07.b :
LNG01_0071_B05.b :
SKNB1_0059_E09.b :
LVRM1_0067_A10.b :
LVRM1_0172_C07.b :
THY01_0123_F03.b :
LVRM1_0079_A04.b :
LVRM1_0049_B02.b :
OVR01_0054_B12.b :
UTR01_0042_F02.b :
LVR01_0048_B01.b :
UTR01_0018_A05.b :
OVR01_0050_D11.b :
PTG01_0024_D08.b :
LNG01_0002_H12.b :
LNG01_0030_F07.b :
SMG01_0014_D04.b :
OVR01_0093_G11.b :
UTR01_0059_A04.b :
LNG01_0082_E08.b :
OVR01_0015_A08.b :
LNG01_0025_E05.b :
OVRT1_0095_A05.b :
MLN01_0025_A11.b :
MLN01_0056_D12.b :
LVRM1_0203_F10.b :
LVRM1_0048_G03.b :
PTG01_0102_C06.b :
OVRM1_0037_F10.b :
LVRM1_0101_H02.b :
SMG01_0054_B08.b :
MLN01_0018_A08.b :
SMG01_0066_A01.b :
LNG01_0101_A12.b :
LVR01_0106_A02.b :
OVR01_0086_A05.b :
LVRM1_0091_H02.b :
LVRM1_0107_C07.b :
OVR01_0082_H12.b :
OVRM1_0191_B03.b :
LVRM1_0195_E09.b :
OVRM1_0037_C05.b :
LVRM1_0202_F10.b :
LVRM1_0018_C08.b :
THY01_0005_B06.b :
LVRM1_0078_H03.b :
SPL01_0034_D02.b :
OVRM1_0110_B12.b :
OVRM1_0100_E11.b :
LVRM1_0077_G10.b :
OVR01_0083_G11.b :
OVRM1_0069_G11.b :
OVR01_0059_A04.b :
OVR01_0052_B11.b :
TCH01_0053_C08.b :
OVRM1_0021_A12.b :
UTR01_0014_C07.b :
CLNT1_0149_A10.b :
SPL01_0010_B04.b :
UTR01_0025_H03.b :
THY01_0004_B06.b :
THY01_0045_E08.b :
UTR01_0015_C12.b :
THY01_0016_C11.b :
THY01_0005_A06.b :
THY01_0004_A06.b :
THY01_0014_H05.b :
MLN01_0020_D03.b :
SMG01_0058_E11.b :
SPL01_0041_A07.b : agaggacttttatgcxxxxxxxx
PBL01_0005_H04.b :
MLN01_0077_F06.b :
OVRT1_0072_F09.b :
PTG01_0016_E04.b :
UTR01_0072_D04.b :
ADR01_0036_D03.b :
PTG01_0083_G09.b :
UTR01_0087_D11.b :
OVRT1_0149_E04.b :
CLNT1_0129_C08.b :
THY01_0040_B07.b :
OVR01_0065_G01.b :
UTR01_0036_E01.b :
LNG01_0069_C05.b :
OVR01_0035_B09.b :
LVR01_0011_G02.b :
LVR01_0062_H02.b :
SPL01_0103_G09.b :
SMG01_0044_G03.b :
OVR01_0033_D12.b :
LVR01_0047_D06.b :
SPL01_0037_H11.b :
ITT01_0033_A08.b :
SPL01_0038_C12.b :
LVR01_0051_G07.b :
LNG01_0009_G03.b :
ITT01_0077_G12.b :
SMG01_0015_G04.b :
OVR01_0043_A07.b :
PTG01_0077_C06.b :
ADR01_0051_B11.b :
LVR01_0049_G11.b :
OVRT1_0112_E04.b :
OVR01_0091_D12.b :
MLN01_0033_G08.b :
SMG01_0029_D10.b :
SMG01_0033_C08.b :
CLNT1_0128_F12.b :
OVR01_0054_H06.b :
OVRT1_0108_H07.b :
MLN01_0080_H03.b :
UTR01_0058_H12.b :
OVRT1_0146_F04.b :
SMG01_0080_E10.b :
ITT01_0074_B02.b :
PBL01_0038_G01.b :
LVR01_0045_F12.b :
OVR01_0095_F04.b :
MLN01_0044_C12.b :
BFLT1_0092_E03.b :
SMG01_0085_F02.b :
PBL01_0042_D09.b :
THY01_0065_C11.b :
SPL01_0051_D06.b :
MLN01_0060_B05.b :
LVR01_0061_C03.b :
THY01_0039_D07.b :
OVR01_0053_H04.b :
THY01_0038_C05.b :
CLNT1_0065_E04.b :
SPL01_0036_C03.b :
LNG01_0002_G07.b :
LVR01_0059_D05.b :
OVR01_0099_B03.b :
OVRT1_0001_F08.b :
OVR01_0008_A08.b : ccc
LVR01_0089_A07.b :
CLNT1_0015_B10.b :
MLN01_0078_F10.b :
OVRT1_0010_E11.b :
LNG01_0033_A10.b :
LVR01_0050_G07.b :
OVRT1_0022_D07.b :
LNG01_0069_E10.b :
SPL01_0070_H08.b :
CLNT1_0050_F02.b :
CLNT1_0050_C08.b :
OVR01_0021_F05.b :
THY01_0096_A03.b :
OVRT1_0039_H08.b :
THY01_0008_A05.b :
CLNT1_0088_D10.b :
LNG01_0010_H10.b :
THY01_0090_F02.b :
THY01_0061_G05.b :
CLNT1_0049_C08.b :
MLN01_0045_B10.b :
CLNT1_0004_D11.b :
ITT01_0095_E07.b :
PBL01_0087_B11.b :
SPL01_0104_F04.b :
PBL01_0075_E01.b :
THY01_0204_B06.b :
CLNT1_0004_C01.b :
LNG01_0043_C04.b :
ITT01_0001_E08.b :
LNG01_0012_C03.b :
SKNB1_0040_A11.b :
MLN01_0062_F06.b :
LNG01_0098_D08.b :
UTR01_0060_B02.b :
ITT01_0076_D05.b :
CLNT1_0041_G01.b :
LVRM1_0080_B01.b :
OVRM1_0056_F10.b :
ADR01_0052_D04.b :
SKNB1_0002_E09.b :
OVRT1_0140_C11.b :
LNG01_0107_A01.b : ntt
ITT01_0033_H09.b :
OVRT1_0070_H03.b :
PST01_0001_A11.b :
CLNT1_0144_A06.b :
LNG01_0110_D07.b :
ITT01_0063_H06.b :
LNG01_0109_F07.b :
ITT01_0088_C04.b :
THY01_0121_D03.b :
PTG01_0097_E07.b :
SPL01_0064_G02.b :
LVR01_0018_H10.b :
TCH01_0033_F10.b :
THY01_0205_D02.b :
OVR01_0009_D05.b : gggaactatg
PBL01_0004_F08.b :
LVRM1_0001_H10.b :
OVRM1_0067_D06.b :
LVR01_0053_D05.b :
SMG01_0042_F07.b :
MLN01_0064_D10.b :
LNG01_0087_G10.b :
UTR01_0042_A05.b :
OVR01_0104_E06.b :
OVRT1_0045_C09.b :
OVR01_0093_C12.b : tnttttttattttttctttttttcatgcttctacatcctttccttttaattctttctctc
CLNT1_0040_G10.b :
OVR01_0006_H10.b :
THY01_0074_C07.b :
OVRT1_0100_D10.b :
PTG01_0082_C12.b :
PTG01_0050_H04.b :
PBL01_0063_G05.b :
CLNT1_0023_H04.b :
LNG01_0108_D12.b :
OVRT1_0060_A11.b :
ITT01_0013_F04.b :
THY01_0100_H04.b :
OVRT1_0100_G09.b :
UTR01_0061_B12.b :
OVRT1_0008_A02.b :
MLN01_0059_D12.b :
LVR01_0105_A02.b :
OVRT1_0095_A02.b :
MLN01_0076_B10.b :
OVRT1_0090_F08.b :
LVR01_0104_C04.b :
UTR01_0048_H06.b :
LNG01_0025_C04.b :
THY01_0205_G05.b :
ITT01_0009_D10.b :
ITT01_0043_C06.b :
ITT01_0098_A12.b :
ADR01_0076_C06.b :
SKNB1_0051_H08.b :
SKNB1_0040_F06.b :
SKNB1_0097_A08.b :
OVRM1_0165_B03.b :
SPL01_0084_A10.b :
TES01_0106_A02.b :
SPL01_0086_H03.b :
SPL01_0079_B04.b :
THY01_0038_E09.b :
KDN01_0024_C07.b :
PST01_0054_B10.b :
KDN01_0086_A08.b :
UTR01_0009_G02.b :
OVR01_0067_F02.b :
LNG01_0033_D11.b :
KDN01_0061_H06.b :
SPL01_0009_H04.b :
ADR01_0067_F04.b :
HTMT1_0095_A01.b :
PCT01_0024_H06.b :
ITT01_0042_D04.b :
OVRT1_0004_F10.b :
UTR01_0071_D04.b :
OVRT1_0080_H12.b :
MLN01_0007_D01.b :
LNG01_0091_G06.b :
SPLT1_0042_H06.b :
ADR01_0062_B08.b :
---------+---------+---------+---------+---------+---------+ 227
PTG01_0086_H10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRT1_0093_A05.b : ccgttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0084_C03.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0105_A03.b : nnnttgcttgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0030_H01.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0037_C04.b : nnggcgctatntnggggtcaacagcggnaxxxxxxxxxx
THY01_0022_E02.b : tttttggagccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0033_F05.b : nnnnggcataaannnggagtatagcagcxxxxxxxxx
MLN01_0055_F09.b : nnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0087_F09.b : cagttgtcxxxxxxxxxxxxxxxxxxxx
THY01_0123_D12.b : gttgcaaaaacaxxxxxx
THY01_0125_F04.b : gttgtcxxxxxxxxxxxxxxxxx
PTG01_0066_D10.b : ggtaaannnnnnggagtaagcagcxxxxxxxx
OVR01_0076_D08.b : ctttagggaactatgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0013_H09.b : gtgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0021_F10.b : gtggacctattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0082_C11.b : nntttgctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0044_A06.b :
ITT01_0020_D05.b : nnggatgaacaxxxxxxxxxxx
MLN01_0078_D08.b : nngggtaggactagacagtttgtacxxxxxxxxxxxxxxxxxxx
LVR01_0017_B08.b : aatttgggtggactanntagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0097_G06.b : nnnnnggcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0010_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0025_D01.b : nttttgataggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0033_D01.b :
THY01_0112_F11.b : gttgcaaaacxxxxxxxxxx
LVRM1_0165_H11.b : gtcxxxxxxxxxxxxxxxxxx
OVR01_0104_C10.b : ngctaggactatgacagtttgacxxxxxxxxxxxxxxxxx
MLN01_0018_A07.b : cccccggcatggagttcacagtttgtxxxxxxxxxxxxxxxxx
PST01_0067_C11.b :
SKNB1_0067_G01.b :
OVRM1_0017_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0036_H02.b : gggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0045_H12.b : tgttttgagtttgcattgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0018_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRT1_0129_E03.b : nnnggcatcacccnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0082_E09.b :
OVRT1_0055_A02.b : nggctttnnnnnnntcctatagcgnacgxxxxxxxxxxxxxxxxxx
MLN01_0102_C11.b : ngggggttggactatgacxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0062_B12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0064_A02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LVRM1_0089_F02.b : tcxxxxxxxxxxxxxxxx
LVRM1_0192_D12.b : xxxxxxxxx
LVRM1_0113_A05.b : tagttgtcxxxxxxxxxxxxxxxxx
THY01_0020_F12.b : gccaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0031_B05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0069_D03.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0081_C07.b : nngggcgttnnnnnntggataaagcagcxxxxxx
OVRT1_0125_D08.b : nnccttcagcgnaggxxxxxxxxxxxxxxxxxx
OVR01_0090_E09.b : nggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0047_F12.b : nggggtttttntnggagtaagcagcxxxx
LNG01_0004_D12.b : gccattttggtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0051_H10.b : nnnttgcatggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0038_D07.b : gggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_F04.b : gggggttagtttggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0033_F04.b :
THY01_0097_B06.b : gaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0034_A08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LVR01_0030_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0030_H11.b : nnttgctaggacatgacagtttgtacxxxxxxxxxxxxxxxx
LNG01_0004_A12.b : gggatttggctgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0091_G04.b : nccggttnnnnnnccccgttagcgnacgxxxxxxxxxxxxxxxxxx
LVR01_0077_H10.b : agcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0104_E06.b : nggtaggatatagacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0078_E02.b : nnnggatgaacaxxxxxxxx
ILNT1_0088_E10.b : nnnaatcgagtagacgccgtax
LVR01_0012_A08.b : ggggttaggccatgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0010_A01.b : nnntttcctggatatgacagtttgtacxxxxxxxxxxxxxxxx
UTR01_0106_A11.b : nnnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0084_H07.b :
LNG01_0071_B05.b : nnntttgatgtacttgacagtttgtcxxxxxxxxxxxxxxxx
SKNB1_0059_E09.b :
LVRM1_0067_A10.b : cxxxxxxxxxxxxxxxxxxx
LVRM1_0172_C07.b : cagttgtacxxxxxxxxxxxxxxx
THY01_0123_F03.b : gttgcaaaacaxxx
LVRM1_0079_A04.b : cgttgacxxxxxxxxxxxxx
LVRM1_0049_B02.b : cagttgtcxxxxxxxxxxxxxx
OVR01_0054_B12.b : nnntttgatagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0042_F02.b : gggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_B01.b : gggggaattttatagcttagtgactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0018_A05.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0050_D11.b : nttggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0024_D08.b : nnggctttttnnnggataaagcagcxxxxx
LNG01_0002_H12.b : tggagcatttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0030_F07.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0014_D04.b : gagtttataannggatacagcagcx
OVR01_0093_G11.b : nnnnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0059_A04.b : cgcattatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0082_E08.b : nnnnttcagnnnnnggctggacttgacagtttgtcxxxxxxxxxxxxxxx
OVR01_0015_A08.b : ttggggagtgactattagaactagttttggacaaaaatgctggctcgtaccgg
LNG01_0025_E05.b : ccattatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0095_A05.b : nncgctttnnnnnnnnnccgttctgctcacgaagatactacagctcat
MLN01_0025_A11.b : nngggtaggacttgacagtttgtcxxxxxxxxxxxxxxx
MLN01_0056_D12.b : nnnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0203_F10.b :
LVRM1_0048_G03.b : xxxxxxxxxx
PTG01_0102_C06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0037_F10.b : nagttgtcxxxxxxxxxxxxxxx
LVRM1_0101_H02.b : cagttgtcxxxxxxxxxxxxxxxx
SMG01_0054_B08.b : nnggcttttttttngggtaaagcagcggn
MLN01_0018_A08.b : nnnnattatggacttnaagtttgtxxxxxxxxxxxxxxxx
SMG01_0066_A01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0101_A12.b : nnttgcgatggacatagnaagtttnacxxxxxxxxxxxxxxx
LVR01_0106_A02.b : ggggcttaaagcatagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0086_A05.b : nttggcttggactataacxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0091_H02.b : aagttgtcxxxxxxxxxxxxxxx
LVRM1_0107_C07.b : tagttgtcxxxxxxxxxxxxxxxx
OVR01_0082_H12.b : nggcttgtgatatgacxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0191_B03.b : cxxxxxxxxxxxxxxx
LVRM1_0195_E09.b : xxxxxxxxxxx
OVRM1_0037_C05.b : gtcxxxxxxxxxxxxxxx
LVRM1_0202_F10.b : xxxxxxx
LVRM1_0018_C08.b : gtcxxxxxxxxxxxxxxx
THY01_0005_B06.b : axxxxxxxxx
LVRM1_0078_H03.b : agttgacatxxxxxxxxxxxxx
SPL01_0034_D02.b : tttttggcatggactatnacxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0110_B12.b : cagttgtcxxxxxxxxxxxxxxx
OVRM1_0100_E11.b : nagttgtcxxxxxxxxxxxxxxx
LVRM1_0077_G10.b : agttgacatxxxxxxxxxxxxx
OVR01_0083_G11.b : gcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0069_G11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0059_A04.b : ncctgcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0052_B11.b : nncctgctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0053_C08.b : tggcttaggacttaaacxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0021_A12.b : atxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0014_C07.b : tggtggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0149_A10.b : nnnccgtcagctgagxxxxxxxxxxxxxxxxx
SPL01_0010_B04.b : cttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0025_H03.b : tgggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0004_B06.b : gccaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0045_E08.b : ttttgggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0015_C12.b : ggtggaacttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0016_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0005_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0004_A06.b : gccaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0014_H05.b : ttagcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0020_D03.b : nntttccgtggacttgacxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0058_E11.b : nnggctctannnnntgataaagcagcxx
SPL01_0041_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0005_H04.b : gcccnnncaggatacagagctg
MLN01_0077_F06.b : ngctaggacatgacxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0072_F09.b : nnnnnccgttctgcgcacgxxxxxxxxxxxxxxxxx
PTG01_0016_E04.b : nnnggacctattnnnggagtaaagcagcxxxx
UTR01_0072_D04.b : tttgggtggagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0036_D03.b : nnnggtgaaacaxxxxxx
PTG01_0083_G09.b : nnnaatgagtaaagcagc
UTR01_0087_D11.b : nnnggcttggactaaaacxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0149_E04.b : nnnnccgttagcngtaggxxxxxxxxxxxxxxxxx
CLNT1_0129_C08.b : nnnnccttcagcgtacgxxxxxxxxxxxxxxxxx
THY01_0040_B07.b : ggggggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0065_G01.b : ngggaacccnnnagctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0036_E01.b : tgggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0069_C05.b : tcgggtggatggacatgacagtttgtacxxxxxxxxxxxxxx
OVR01_0035_B09.b : agggattttggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_G02.b : attttggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_H02.b : aaaaactggcatttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0103_G09.b : nntttgctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0044_G03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVR01_0033_D12.b : tgaaagcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0047_D06.b : ggggtgtttttaagcttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0037_H11.b : acaggcattatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0033_A08.b : nnnggatgaacaxxxxxx
SPL01_0038_C12.b : agagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_G07.b : ggggagtctcttgggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0009_G03.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0077_G12.b : nnaaagagtxxxxxxxxx
SMG01_0015_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVR01_0043_A07.b : gggatctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0077_C06.b : nnnnnnnnnnnnnnnnnnnn
ADR01_0051_B11.b : ccccnnggactacacaxxxxxx
LVR01_0049_G11.b : gctttatggctgattatagtaacxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0112_E04.b : nnnnnccgtcagcgnaggxxxxxxxxxxxxxxxx
OVR01_0091_D12.b : nnnnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0033_G08.b : nnnngggtaggatatgacagtttgtacxxxxxxxxxxxxxx
SMG01_0029_D10.b : nnnnccgttaannnnggataaacagcgg
SMG01_0033_C08.b : nnggggaattnnnngggtcaacagcxxx
CLNT1_0128_F12.b : ngcgttannnnncncccgttagcgnacgxxxxxxxxxxxxxxxxx
OVR01_0054_H06.b : nnnggcttgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0108_H07.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxxxx
MLN01_0080_H03.b : nnnngattggactatgacxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0058_H12.b : aacagcatttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0146_F04.b : nnnnnccgatagcggacgxxxxxxxxxxxxxxxxx
SMG01_0080_E10.b : ngctacaannnnggagtaagcagcggt
ITT01_0074_B02.b : nnnggatgaacaxxxxxxx
PBL01_0038_G01.b : gtgaacaxxxxx
LVR01_0045_F12.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0095_F04.b : nnnggcttggactataacxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0044_C12.b : nnnggctaggacttgacagtttgtacxxxxxxxxxxxxxx
BFLT1_0092_E03.b : ngggatcgttcagctgtcngxxxxxxxxxxxxxxxxx
SMG01_0085_F02.b : ttttttgagtaagcagcgg
PBL01_0042_D09.b : nnggtgcaacaxxxxxx
THY01_0065_C11.b : cctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0051_D06.b : nnnnaagcatggactaaaacxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0060_B05.b : tgacttaaacxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_C03.b : gctaacacagcttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0039_D07.b : ggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0053_H04.b : aaaaanggataggactatgacagtttgtcxxxxxxxxxxxxxxx
THY01_0038_C05.b : ggtgacccttataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0065_E04.b : nnnccgtttgctgacgxxxxxxxxxxxxxxxxxx
SPL01_0036_C03.b : gggctctatgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0002_G07.b : gcatttggctgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0059_D05.b : tttttagcattggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0099_B03.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0001_F08.b : nnaaatctctagctgacgagtgxxxxxxxxxxxxx
OVR01_0008_A08.b : cttatagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_A07.b : gggcattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0015_B10.b : gggtccgtctgcgnacgxxxxxxxxxxxxxxxxxx
MLN01_0078_F10.b : nggctaggacttaaacxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0010_E11.b : nnnnnccgtcagcgcacgxxxxxxxxxxxxxxxx
LNG01_0033_A10.b : tgttgttttaatttgcattgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_G07.b : gggggagtcnngggcatagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0022_D07.b : nnncccctatagcgnacgxxxxxxxxxxxxxxxxxx
LNG01_0069_E10.b : acgnnnggatggatatgacagtttgtcxxxxxxxxxxxxxxx
SPL01_0070_H08.b : nnnggcttggacttaaacxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0050_F02.b : nnggcgagtnnngggganagtatagcggacgxxxxxxxxxxxxxxxxx
CLNT1_0050_C08.b : nnggcgattnnnggggnccgttagcgnacgxxxxxxxxxxxxxxxxx
OVR01_0021_F05.b : tgtggatgaacctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0096_A03.b : ggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0039_H08.b : nnntttcgttagcgnaggxxxxxxxxxxxxxxxxx
THY01_0008_A05.b : cattatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0088_D10.b : nnnggtgtnnnnggganccatcagcgnacgxxxxxxxxxxxxxxxx
LNG01_0010_H10.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0090_F02.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0061_G05.b : gggggaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0049_C08.b : nggtgtttnnnnnnnnccgttagcggacgxxxxxxxxxxxxxxxxx
MLN01_0045_B10.b : nnnnnggttgtactatgacxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0004_D11.b : gtatacgttcgcgnacgxxxxxxxxxxxxxxxxx
ITT01_0095_E07.b : nnaatgxxxxxxxxxxx
PBL01_0087_B11.b : nnaagtgxxxxxxxxx
SPL01_0104_F04.b : nnnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0075_E01.b : nngggatgaacaxxxxxx
THY01_0204_B06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0004_C01.b : nggatccgttcgctgacgxxxxxxxxxxxxxxxxx
LNG01_0043_C04.b : ccttcttcccggtttcgtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0001_E08.b : nnnnggagtaacaxxxxxx
LNG01_0012_C03.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0040_A11.b :
MLN01_0062_F06.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0098_D08.b : nnnnnaagttggacttgacagtttgtcxxxxxxxxxxxxxxx
UTR01_0060_B02.b : tttttttttttatcacgtttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0076_D05.b : nnnggatgaacaxxxxxxx
CLNT1_0041_G01.b : attccgttagcgnacgxxxxxxxxxxxxxxxxx
LVRM1_0080_B01.b : agttgacxxxxxxxxxxxxx
OVRM1_0056_F10.b : cgttgxxxxxxxxxxxxxxx
ADR01_0052_D04.b : agccnnnggatacacaxxxxx
SKNB1_0002_E09.b :
OVRT1_0140_C11.b : nnaaggcgagaccnnnnnccgttcgcgttacgatgtacttcgct
LNG01_0107_A01.b : tcgatggacttagnaagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0033_H09.b : ntttgtgaacaxxxxxx
OVRT1_0070_H03.b : nnntttcttcagcgcacgxxxxxxxxxxxxxxxxx
PST01_0001_A11.b :
CLNT1_0144_A06.b : nnnnnccgtcagcgnacgxxxxxxxxxxxxxxxx
LNG01_0110_D07.b : ttctnnggacggacttgacxxxxxxxxxxxxxxxxxxxx
ITT01_0063_H06.b : nnnnggagxxxxxxxxxx
LNG01_0109_F07.b : nnnntttgacggaatatgacxxxxxxxxxxxxxxxxxxxxx
ITT01_0088_C04.b : nnnggatgaacaxxxxx
THY01_0121_D03.b : gttgcaaaacgg
PTG01_0097_E07.b : nnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0064_G02.b : nnnnggcttgtgacttnacxxxxxxxxxxxxxxxxxxxxx
LVR01_0018_H10.b : cctttatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0033_F10.b : ngctaggactatgacxxxxxxxxxxxxxxxxxx
THY01_0205_D02.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0009_D05.b : gacattatgggctattctgggggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0004_F08.b : ccccccagagaaacaxxx
LVRM1_0001_H10.b : cxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0067_D06.b : nagtttgtcxxxxxxxxxxxxx
LVR01_0053_D05.b : gggggggattttngggcttgggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0042_F07.b : nnggcgatttnnnnnnggataaagcagcx
MLN01_0064_D10.b : ggtaggacttgacxxxxxxxxxxxxxxxxxxxxxx
LNG01_0087_G10.b : gggttgtgttcgacttgnxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0042_A05.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0104_E06.b : nttgcatggactatgacxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0045_C09.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxx
OVR01_0093_C12.b : ttnnnnnnnnnnnnnnnnnngggcattggacattcacxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0040_G10.b : gactcttctgcgtacgagtgxxxxxxxxxxx
OVR01_0006_H10.b : aggggggccctattttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0074_C07.b : tcttttggggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0100_D10.b : nggttcctactgcgcacgxxxxxxxxxxxxxxx
PTG01_0082_C12.b : ngcgtcnnnnttatgagtaagcagcxx
PTG01_0050_H04.b : nggccaaatnnnngagtaaagcagcg
PBL01_0063_G05.b : nggtgaaacaxxxx
CLNT1_0023_H04.b : ntttctatagcggacgagtgxxxxxxxxxxx
LNG01_0108_D12.b : nnntttgctggacttgacxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0060_A11.b : nggattacgttcagcgtacgagtgxxxxxxxxxxx
ITT01_0013_F04.b : nggatgaacaxxx
THY01_0100_H04.b : ggcatttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0100_G09.b : nntttccgtcagcgcacgxxxxxxxxxxxxxxx
UTR01_0061_B12.b : gggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0008_A02.b : nnattccgttagctgacgxxxxxxxxxxxxxxx
MLN01_0059_D12.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxx
LVR01_0105_A02.b : tggtgaaaaaggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0095_A02.b : nnntttcgttctgcgtacgagtgxxxxxxxxxxxx
MLN01_0076_B10.b : nnngggtaggacttgacxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0090_F08.b : nnggggttnnnnnggccccgttagcgnacgxxxxxxxxxxxxxxx
LVR01_0104_C04.b : gggcgaacctgcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0048_H06.b : cttttggatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0025_C04.b : catttatgctgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0205_G05.b : cctttatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0009_D10.b : nnnggtgxxxxxxxxxx
ITT01_0043_C06.b : nnggatgaacxxxxx
ITT01_0098_A12.b : nnnggatgaacaxxxx
ADR01_0076_C06.b : nnnaagggatgaacagc
SKNB1_0051_H08.b :
SKNB1_0040_F06.b :
SKNB1_0097_A08.b :
OVRM1_0165_B03.b : agttgtcxxxxxxxxxx
SPL01_0084_A10.b : nnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxx
TES01_0106_A02.b :
SPL01_0086_H03.b : nnnggcatggactatnacxxxxxxxxxxxxxxxxxxxx
SPL01_0079_B04.b : nnnnggctaggacttanacxxxxxxxxxxxxxxxxxxx
THY01_0038_E09.b : ggggaaatataxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0024_C07.b :
PST01_0054_B10.b :
KDN01_0086_A08.b :
UTR01_0009_G02.b : cttttcgcggcxxxxxxxxxxxxxxxxxxx
OVR01_0067_F02.b : nnnnggattgtgacttgacagtttg
LNG01_0033_D11.b : attgggtxxxxxxxxxxxxxxxxxxxxx
KDN01_0061_H06.b :
SPL01_0009_H04.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0067_F04.b :
HTMT1_0095_A01.b :
PCT01_0024_H06.b :
ITT01_0042_D04.b :
OVRT1_0004_F10.b :
UTR01_0071_D04.b : tgtgatctgacagtttgtaacaaagacgctg
OVRT1_0080_H12.b :
MLN01_0007_D01.b :
LNG01_0091_G06.b :
SPLT1_0042_H06.b :
ADR01_0062_B08.b :
---------+---------+---------+---------+---------+---------+ 286
OVRM1_0084_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxgTTGGCCTACTGGACAACAGTC*CGAGGCCATCGTC
SPL01_0105_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCCCACAACAGTC*CGAGGCCATCGTC
THY01_0030_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggACTGGACAACAGTC*CGAGGCCATCGTC
SMG01_0037_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxgtcggACTGGACAACAGTC*CGTGGCCATCGTC
THY01_0022_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcTGGACACAACAGTC*CGAGGCCATCGTC
ADR01_0033_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtACTGGATAACAGTC*CGAGGCCATCGTC
MLN01_0055_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcTGGACACAACAGTC*CGAGGCCATCGTC
LVRM1_0087_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGACAACAGTC*CGAGGCCATCGTC
THY01_0123_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGGACACAACAGTC*CGAGGCCATCGTC
THY01_0125_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGACAACAGTC*CGAGGCCATCGTC
PTG01_0066_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCCACAACAGTC*CGAGGCCATCGTC
OVR01_0076_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGACAACAGTC*CGAGGCCATCGTC
THY01_0013_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGACACAACAGTC*CGAGGCCATCGTC
UTR01_0021_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGACAACAGTC*CGAGGCCATCGTC
UTR01_0082_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCCACAACAGTC*CGAGGCCATCGTC
ITT01_0020_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGACAACAGTC*CGAGGCCATCGTC
MLN01_0078_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGACAACAGTC*CGAGGCCATCGTC
LVR01_0017_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGACAACAGTC*CGAGGCCATCGTC
SPL01_0097_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGACAACAGTC*CGAGGCCATCGTC
OVR01_0010_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGACAACAGTC*CGAGGCCATCGTC
TCH01_0025_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGACAACAGTC*CGAGGCCATCGTC
PST01_0033_D01.b : nttactgctgtggctCTGGACCACAGTC*CGAGGCCATCGTC
THY01_0112_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcTGGAC*ACAGTC*CGAGGCCATCGTC
LVRM1_0165_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGACAACAGTC*CGAGGCCATCGTC
OVR01_0104_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggTGGACAACAGTC*CGAGGCCATCGTC
MLN01_0018_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGACAACAGTC*CGAGGCCATCGTC
PST01_0067_C11.b : tttttactgcgttggctaTGGACCACAGTC*CGAGGCCATCGTC
SKNB1_0067_G01.b : nntttccacggtggctaTGGACACAGTC*CGAGGCCATCGTC
OVRM1_0017_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACAACAGTC*CGAGGCCATCGTC
THY01_0036_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcACACAACAGTC*CGAGGCCATCGTC
LNG01_0045_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACAACAGTC*CGAGGCCATCGTC
TCH01_0018_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxTCACAACAGTC*CGAGGCCATCGTC
OVRT1_0129_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggCCACAACAGTC*CGAGGCCATCGTC
SKNB1_0082_E09.b : nnnngggaannnngnnncctgcgttggctcTGGACACAGTC*CGAGGCCATCGTC
OVRT1_0055_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACAACAGTC*CGAGGCCATCGTC
MLN01_0102_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACACAACAGTC*CGAGGCCATCGTC
LVRM1_0062_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggCACAACAGTC*CGAGGCCATCGTC
PTG01_0064_A02.b : nnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxctggCACAACANTC*CGAGGCCATCGTC
LVRM1_0089_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
LVRM1_0192_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
LVRM1_0113_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
THY01_0020_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAACAGTC*CGAGGCCATCGTC
OVRM1_0031_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
THY01_0069_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
SMG01_0081_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGAACAGTC*CGAGGCCATCGTC
OVRT1_0125_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
OVR01_0090_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
SMG01_0047_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
LNG01_0004_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
OVR01_0051_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctGACAACAGTC*CGAGGCCATCGTC
THY01_0038_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
LVR01_0048_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
SKNB1_0033_F04.b : nnnggggttnnnntnncctacgttgtgcanTGGAACAGTC*CGAGGCCATCGTC
THY01_0097_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
SMG01_0034_A08.b : nnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxTGGAACAGTC*CGAGGCCATCGTC
LVR01_0030_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
MLN01_0030_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
LNG01_0004_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGACAACAGTC*CGAGGCCATCGTC
OVRT1_0091_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGACAACAGTC*CGAGGCCATCGTC
LVR01_0077_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCAACGTC
LVR01_0028_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
MLN01_0104_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggCACAACAGTC*CGAGGCCATCGTC
ITT01_0078_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
ILNT1_0088_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAACAGTC*CGACGCCATCGTC
LVR01_0012_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
MLN01_0010_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
UTR01_0106_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
PST01_0084_H07.b : nttactgctgtggctcTGGAACAGTC*CGAGGCCATCGTC
LNG01_0071_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAACAGTC*CGAGGCCATCGTC
SKNB1_0059_E09.b : nnnnnnctcgctgtggctaTGGAACAGTC*CGAGGCCATCGTC
LVRM1_0067_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACAGTC*CGAGGCCATCGTC
LVRM1_0172_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAACAGTC*CGAGGCCATCGTC
THY01_0123_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggGGAACAGTC*CGAGGCCATCGTC
LVRM1_0079_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtACAACAGTC*CGAGGCCATCGTC
LVRM1_0049_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACAGTC*CGAGGCCATCGTC
OVR01_0054_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACAGTC*CGAGGCCATCGTC
UTR01_0042_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACAGTC*CGAGGCCATCGTC
LVR01_0048_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCAACAGTC*CGAGGCCATCGTC
UTR01_0018_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACAGTC*CGAGGCCATCGTC
OVR01_0050_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCAACAGTC*CGAGGCCATCGTC
PTG01_0024_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtACAACAGTC*CGAGGCCATCGTC
LNG01_0002_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACAGTC*CGAGGCCATCGTC
LNG01_0030_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACAGTC*CGAGGCCATCGTC
SMG01_0014_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACAGTC*CGAGGCCATCGTC
OVR01_0093_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCAACAGTC*CGAGGCCATCGTC
UTR01_0059_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACAGTC*CGAGGCCATCGTC
LNG01_0082_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaACAACAGTC*CGAGGCCATCGTC
OVR01_0015_A08.b : ggtccgaaattcctccgtgcaccgtaggcctcctcggACAACAGTT*CGTGTGCATCGTC
LNG01_0025_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACAGTC*CGAGGCCATCGTC
OVRT1_0095_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaggTCAACAGTC*CGAGGCCATCGTC
MLN01_0025_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAACAGTC*CGAGGCCATCGTC
MLN01_0056_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAACAGTC*CGAGGCCATCGTC
LVRM1_0203_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVRM1_0048_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
PTG01_0102_C06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnCAACANTC*CGAGGCCATCGTC
OVRM1_0037_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVRM1_0101_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SMG01_0054_B08.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
MLN01_0018_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SMG01_0066_A01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LNG01_0101_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVR01_0106_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0086_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVRM1_0091_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVRM1_0107_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgacCAACAGTC*CGAGGCCATCGTC
OVR01_0082_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRM1_0191_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVRM1_0195_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRM1_0037_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVRM1_0202_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVRM1_0018_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0005_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVRM1_0078_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SPL01_0034_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRM1_0110_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRM1_0100_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVRM1_0077_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0083_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRM1_0069_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0059_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0052_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
TCH01_0053_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRM1_0021_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
UTR01_0014_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0149_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SPL01_0010_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
UTR01_0025_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0004_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0045_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
UTR01_0015_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0016_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcACACAGTC*CGAGGCCATCGTC
THY01_0005_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0004_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0014_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
MLN01_0020_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SMG01_0058_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SPL01_0041_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTCTCGAGGCCATCGTC
PBL01_0005_H04.b : gaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
MLN01_0077_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRT1_0072_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
PTG01_0016_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
UTR01_0072_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
ADR01_0036_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcACACAGTC*CGAGGCCATCGTC
PTG01_0083_G09.b : ggtacggntcggaaatcctcgagcacggttggccctggACACAGTC*CGAGGCCATCGTC
UTR01_0087_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRT1_0149_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0129_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0040_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0065_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
UTR01_0036_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LNG01_0069_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0035_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVR01_0011_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVR01_0062_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SPL01_0103_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SMG01_0044_G03.b : nnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0033_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVR01_0047_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SPL01_0037_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
ITT01_0033_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SPL01_0038_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVR01_0051_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LNG01_0009_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGCC
ITT01_0077_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SMG01_0015_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0043_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
PTG01_0077_C06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
ADR01_0051_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVR01_0049_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRT1_0112_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0091_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
MLN01_0033_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SMG01_0029_D10.b : naxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SMG01_0033_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0128_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0054_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRT1_0108_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
MLN01_0080_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
UTR01_0058_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRT1_0146_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SMG01_0080_E10.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
ITT01_0074_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
PBL01_0038_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVR01_0045_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0095_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
MLN01_0044_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
BFLT1_0092_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SMG01_0085_F02.b : taxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
PBL01_0042_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0065_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SPL01_0051_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
MLN01_0060_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVR01_0061_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0039_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0053_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0038_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0065_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SPL01_0036_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LNG01_0002_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVR01_0059_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0099_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRT1_0001_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0008_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVR01_0089_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0015_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcACACAGTC*CGAGGCCATCGTC
MLN01_0078_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRT1_0010_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LNG01_0033_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVR01_0050_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRT1_0022_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LNG01_0069_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SPL01_0070_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0050_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0050_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVR01_0021_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0096_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
OVRT1_0039_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0008_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0088_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LNG01_0010_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0090_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
THY01_0061_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0049_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
MLN01_0045_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0004_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
ITT01_0095_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
PBL01_0087_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SPL01_0104_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
PBL01_0075_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CCAGGCCATCGTC
THY01_0204_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0004_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LNG01_0043_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
ITT01_0001_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LNG01_0012_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
SKNB1_0040_A11.b : nnnnnccttgctgttggctACACAGTC*CGAGGCCATCGTC
MLN01_0062_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LNG01_0098_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
UTR01_0060_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
ITT01_0076_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
CLNT1_0041_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAACAGTC*CGAGGCCATCGTC
LVRM1_0080_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTC*CGAGGCCATCGTC
OVRM1_0056_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTC*CGAGGCCATCGTC
ADR01_0052_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTC*CGAGGCCATCGTC
SKNB1_0002_E09.b : ttctcgctgtggcCACAGTC*CGAGGCC*TCGTC
OVRT1_0140_C11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaaAACAGTC*CGAGGCCATCGTC
LNG01_0107_A01.b : xxxxxxxxxxxtatcgagtcagccttattggcctactggAACAGTC*CGAGGCCATCGTC
ITT01_0033_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTC*CGAGGCCATCGTC
OVRT1_0070_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgaAACAGTC*CGAGGCCATCGTC
PST01_0001_A11.b : ngcccaaatnntnnngctgacgtgtgctcggnacCACANTC*CGAGGCCATCNTC
CLNT1_0144_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccgtaAACAGTC*CGAGGCCATCGTC
LNG01_0110_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACAGTC*CGAGGCCATCGTC
ITT01_0063_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTC*CGAGGCCATCGTC
LNG01_0109_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACAGTC*CGAGGCCATCGTC
ITT01_0088_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAGTC*CGAGGCCATCGTC
THY01_0121_D03.b : cggtccggtccggaatcctcagcactgttggcctatggacACAGTC*CGAGGCCATCGTC
PTG01_0097_E07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxtACAGTC*CGAGGCCATCGTC
SPL01_0064_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxacgACAGTC*CGAGGCCATCGTC
LVR01_0018_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgACAGTC*CGAGGCCATCGTC
TCH01_0033_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGTC*CGAGGCCATCGTC
THY01_0205_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAGTC*CGAGGCCATCGTC
OVR01_0009_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaggtACAGTC*CGAGGCCATCGTC
PBL01_0004_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
LVRM1_0001_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
OVRM1_0067_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
LVR01_0053_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
SMG01_0042_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
MLN01_0064_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
LNG01_0087_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
UTR01_0042_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
OVR01_0104_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
OVRT1_0045_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
OVR01_0093_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
CLNT1_0040_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
OVR01_0006_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
THY01_0074_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
OVRT1_0100_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
PTG01_0082_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
PTG01_0050_H04.b : gtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
PBL01_0063_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
CLNT1_0023_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
LNG01_0108_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
OVRT1_0060_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
ITT01_0013_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCTTTGTC
THY01_0100_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
OVRT1_0100_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
UTR01_0061_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
OVRT1_0008_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
MLN01_0059_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
LVR01_0105_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
OVRT1_0095_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
MLN01_0076_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
OVRT1_0090_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
LVR01_0104_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaatCAGTC*CGAGGCCATCGTC
UTR01_0048_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
LNG01_0025_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
THY01_0205_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
ITT01_0009_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
ITT01_0043_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
ITT01_0098_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
ADR01_0076_C06.b : tgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTC*CGAGGCCATCGTC
SKNB1_0051_H08.b : nnnttttttanntnnncctgcgttgtgcttggacaAGTC*CGAGGCCATCGTC
SKNB1_0040_F06.b : nnnnnctcgctgtggcaggnaAGTC*CGAGGCCATCGTC
SKNB1_0097_A08.b : nnnncctcgctgtggctctggataAGTC*CGAGGCCATCGTC
OVRM1_0165_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTC*CGAGGCCATCGTC
SPL01_0084_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTC*CGAGGCCATCGTC
TES01_0106_A02.b : ttttcctgctgttgctctggacacGTC*CGAGGCCATCGTC
SPL01_0086_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTC*CGAGGCCATCGTC
SPL01_0079_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTC*CGAGGCCATCGTC
THY01_0038_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTC*CGAGGCCATCGTC
KDN01_0024_C07.b : nttttcctgctgtggctatggacacGTC*CGAGGCCATCGTC
PST01_0054_B10.b : nnnttcgctgtggctctggacacGTC*CGAGGCCATCGTC
KDN01_0086_A08.b : nnnnnncctgctgtggctatggacacGTC*CGAGGCCATCGTC
UTR01_0009_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGTC
OVR01_0067_F02.b : tacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGTC
LNG01_0033_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGTC
KDN01_0061_H06.b : acgttggctctggacacgtccgaggccTCGTC
SPL01_0009_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGTC
ADR01_0067_F04.b : nnnttgtaaannnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0095_A01.b : nttttgcgatagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0024_H06.b : nnnnggggctttcatannnnncgcatgcgttgtgctcgtnacacattccgaggacatctt
ITT01_0042_D04.b :
OVRT1_0004_F10.b :
UTR01_0071_D04.b : gtatccgtcccgaatttctccagcactgttggnccactggnaaatcgtcccagggcactc
OVRT1_0080_H12.b :
MLN01_0007_D01.b :
LNG01_0091_G06.b :
SPLT1_0042_H06.b :
ADR01_0062_B08.b :
---------+---------+---------+---------+---------+---------+ 344
PCT01_0024_H06.b : cccccccgcccgtagccaccacgtattatctGCGCGCCGCGCAGCCTGTGGCCCGCGCAC
ITT01_0042_D04.b : nnnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0004_F10.b : nnnnccctcttgctgtcngxxxxxxxxxxxxxxxxxxxxxx
UTR01_0071_D04.b : ttccccccgtcccagncctcctcagncgtccgtgcgtcctcncgtccgtggtcccnctct
OVRT1_0080_H12.b :
MLN01_0007_D01.b :
LNG01_0091_G06.b :
SPLT1_0042_H06.b :
ADR01_0062_B08.b :
---------+---------+---------+---------+---------+---------+ 404
OVRT1_0004_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGTTCCAGCCCGCAGAGCCCGGCCAGG
UTR01_0071_D04.b : ctagggangcagcncccagtccctctcgtgnccatgttccgncccgcgagtcccggccGG
OVRT1_0080_H12.b :
MLN01_0007_D01.b :
LNG01_0091_G06.b :
SPLT1_0042_H06.b :
ADR01_0062_B08.b :
---------+---------+---------+---------+---------+---------+ 463
OVRT1_0080_H12.b :
MLN01_0007_D01.b :
LNG01_0091_G06.b :
SPLT1_0042_H06.b :
ADR01_0062_B08.b :
---------+---------+---------+---------+---------+---------+ 523
OVRT1_0080_H12.b : nnntttctttctgctgatgxx
MLN01_0007_D01.b :
LNG01_0091_G06.b :
SPLT1_0042_H06.b :
ADR01_0062_B08.b :
---------+---------+---------+---------+---------+---------+ 581
OVRT1_0080_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgccctggg
MLN01_0007_D01.b : nntttcgcctggacaagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0091_G06.b : tatnnnggctggctatgacxxxxxxxxxxxxxxxxx
SPLT1_0042_H06.b :
ADR01_0062_B08.b :
---------+---------+---------+---------+---------+---------+ 639
MLN01_0007_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTGGC*CATCATCCATGAAGAGAAGGC
LNG01_0091_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATCATCCATGAAGAGAAGGC
SPLT1_0042_H06.b : nnnttgcgagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0062_B08.b : ncctgtcxxxxxx
---------+---------+---------+---------+---------+---------+ 698
ADR01_0062_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTTAACTTCCAGA
---------+---------+---------+---------+---------+---------+ 757
LVRM1_0087_F09.b : ACGACCTGCAGCAGAATCCACGCGCCTTGGgagatgagtgaatgcttaccgaaagcgctg
LVRM1_0062_B12.b : ACAGCCTGCAGCAGACTCCACTgcacattgcggtaatcaggagcgggcacttattgtgat
PTG01_0064_A02.b : AACAACTGGAGCAAACTCAACTCCACTggcggggatccaccaccaacccaaaatccctga
LVRM1_0067_A10.b : ACAAgtggtttcagattacattacgctagggggtggtgtatatagaatcgtagggggagt
---------+---------+---------+---------+---------+---------+ 816
LVRM1_0087_F09.b : gagatgatcaggaggacgggcgggcattagcgatacgacaagcgcaagtacaataaagcg
THY01_0123_D12.b : GAGGCACTTTTGGAAGCTGGCTGTGATCCTGAGCCtccgaaattttgaagaaatcccctc
LVRM1_0062_B12.b : gctcttgtgtatgctgggttgtagcctgagcgccgacgggtgtgggttatgtctgtgttt
PTG01_0064_A02.b : aggcattcgggaactggctgtgatcctaaactccaaaattttcgggaaataccctttaaa
LVRM1_0067_A10.b : agggattatcgaaacatgagtgacgtcctgaatgaggactacggaagcgaaangtcacag
LVRM1_0172_C07.b : gaggcaattcaggaagctagctcgcatactgatgtagcgatacttgcgacgaccccccct
LVRM1_0203_F10.b : GAGGCACTTCctgaaaccgggcggtgatcttgagctccaagactttcaagaaaataccct
PBL01_0004_F08.b : tgaggcccttctggaaacctggctgtgatccctgagcttccagactttcgaggaaatacc
---------+---------+---------+---------+---------+---------+ 874
LVRM1_0087_F09.b : aacgtaggccggagagacgggcgcgggtaagcggcagacaaaaaacgcgacgcgagagcg
THY01_0123_D12.b : taaactttgcttgtagcagggctgctggccagtgtggagttcttaattacccccg
THY01_0112_F11.b : TCT*ACACCTTGGCTGTGAGCAGGGttgcttgccggggtggagtctgaatancccccggg
SKNB1_0067_G01.b : TCA*ACACCTTGCTTGTGACCAGaactacctgtttcctgtgcatctcgtgattactcccc
LVRM1_0062_B12.b : caggggtgtgtgagcaagctatagatggtatggatgagtatgcggacgttttctgcatgt
PTG01_0064_A02.b : cttggcgggaaaaagggctccgggccggtggggaatccggatcaccccccggggaccaaa
LVRM1_0067_A10.b : tggacgttcatggtatgaccttgaattgattttggattgggtagggtgtatatctcatgg
LVRM1_0172_C07.b : ctaagtgttagctgtgagagggggggccccggacattgtagtgcttttagtatatcccac
THY01_0123_F03.b : ataccttccgtgaggagggggcttgccgggtggaggttttaataccccc
LVRM1_0203_F10.b : ctttcacttgcctgggagcagggctccctggccaatggtggaatactgaaatcacccccc
LVRM1_0048_G03.b : TCG*ACACCTTGCCTGTGAGCAGGGTTGCCTG*Gtctgggtggggagtcctgtatcgtct
PTG01_0102_C06.b : TCT*AAACTTTGCtggtaaaaaaggctgcctgccaagggtggaatcctgaatcaaccccg
OVRM1_0037_F10.b : TCT*ACGCCTTGCCTGTGAGCAGGGCTGCCTG*GCCcatgcggtaattctggatcagcac
LVRM1_0080_B01.b : TCT*ACCCCTTGCCctgtgaccaggctgcccgcccagggcggaagttctgactcaacccc
THY01_0121_D03.b : TCT*Aaacttggctgttagcagggctgcctgcccgtgtgggagtcttaataac
PBL01_0004_F08.b : ccctcaacaccttgccctgtgagccgggcttgcccggcccagtgtgggagccccggactc
---------+---------+---------+---------+---------+---------+ 932
OVRM1_0043_C03.b : CGCGGGGacccagcactcc
LVRM1_0087_F09.b : gggcacggaataattatgggggcgatagcgctgggaaagatgcaagcccacgtccgcctg
THY01_0123_D12.b :
THY01_0125_F04.b : gngggacccagaacctcact
THY01_0112_F11.b : accnaccctcac
SKNB1_0067_G01.b : ctttaactcttaacataactccattctgctgccatgaaccctaaatggccgcgttgctca
LVRM1_0062_B12.b : gtgtaggtttctaggttgtatgtattaggggcggtgaattggatgccaattgtggggtat
PTG01_0064_A02.b : accccccctcctttttggggggccccaattaaaaggggccaaatggggggcccttaaccc
LVRM1_0089_F02.b : ggggggactagcacctcccgtccttagtgcgggtccgaactacagtggctaccggtgtct
LVRM1_0067_A10.b : gtgattgatgacggaaagtgacgatgtgatggttttggagttggcatggggggattgttg
LVRM1_0172_C07.b : cccccgccacaggagagtgccaggtgaaagacggtaaactgcggataggccgtgtgcgat
THY01_0123_F03.b :
LVRM1_0203_F10.b : gggaacaaccaccccacctattttttggggccaaaaatatgagggcgacaaatgttgcgc
LVRM1_0048_G03.b : cgccatgacctgcgcctcccccccattctgcgtgcctatcaatactatgatcacatcgga
PTG01_0102_C06.b : ggggaaaccaaaaccttccctcccttttggagggccccaaattaaatgggcccaaagtgt
OVRM1_0037_F10.b : gacgggaccccgcacctccactcctattctgcgggacgccaataagatgacccgcatatc
LVRM1_0101_H02.b : CGTGGGGACCcataactcctttcctttttggcgggctacgcatctttacttggcgttccc
SMG01_0054_B08.b : CGCGGGACCCAGCACtcccctccattctgcaggccacaacttacatggccacccatgtct
MLN01_0018_A08.b : CGCGGGACCCAacaacctccctcccatccggcggccaccactacaaggccaccatgtcgg
SMG01_0066_A01.b : CGCGGGACCCAGCACCTCAACTCCATTCTGaagccacccactacaagggcaaccatggct
LVRM1_0080_B01.b : gcggaaccagcgactccttccgttcctgcaggcacctctacaatggcccccatggttgag
THY01_0121_D03.b :
PBL01_0004_F08.b : cacccccgcgggaccccgacacctcccctcccttctggcaggccccccaactataaaggg
---------+---------+---------+---------+---------+---------+ 989
OVRT1_0030_A10.b : ttgcctttaccctcgatcctggctacctgggcatggtgaacctgtggtgtctttgggtgc
OVRM1_0043_C03.b :
LVRM1_0087_F09.b : cgtgccgcgtatgcagcgacgctacggcacctgcgtatggcggnacgtcggcgc
THY01_0123_D12.b :
THY01_0125_F04.b :
THY01_0112_F11.b :
SKNB1_0067_G01.b : ccattttccttcagatcatcccccctgattaactttgcaaaattctgcgctcatttcaga
LVRM1_0062_B12.b : gatagattgtggatatggtttgtgttggtattgtttacgctctggtattatcgttgtctc
PTG01_0064_A02.b : cattaccggggaaccgggggattttgggaaattttggggtctttgggggcaaaggaaaac
LVRM1_0089_F02.b : gagtatggcgccatgcctgcgtagtggagcattggggaacggtgggggtttaggtgt
LVRM1_0067_A10.b : ttgtatagtaataggccgcttgagcgacgtatgacataggtatattgatagtgatatacg
LVRM1_0172_C07.b : gagatgttgtgccaaagatgcgcgcgcgcggtattcccgtctctatttttgtat
THY01_0123_F03.b :
LVRM1_0203_F10.b : tttatcccccttcctggggtaccaggggattggagagcatttggttttcttgggggcaaa
LVRM1_0048_G03.b : ctgacccttattccgatcgctgtgtacccgtgccctcgcgttatcttttgtggctctcgg
PTG01_0102_C06.b : gtgcctttaacccccattccgggggcacccggggatttggggaacctttggggctttttg
OVRM1_0037_F10.b : attataaacctacgatctttgatacagggccacgcggagcatagaggtcacttcgcgtat
LVRM1_0101_H02.b : ttttcgtttttccctttacctttttatccgttgcctgcttgggttctgttaaaccttatc
SMG01_0054_B08.b : gcgcttaaccccattcaggggtacctgggcattgggaaacttttggtggctttgggggcc
MLN01_0018_A08.b : ccctaacctcaatcctggctaccgggcattgggacctgtgggggccttggggccgatgca
SMG01_0066_A01.b : ggcctaacctcgatcatggctaactggccatgggggactgttgtgtcttgggtgctaatg
LNG01_0101_A12.b : ctgcccttaacatccatcctgtcaacttgggaattgtgaactgttggttctttcgtagct
LVR01_0106_A02.b : GTCTaacactttaccctcgttccacggctacctgggcattatggaggctgtgatgtctta
OVR01_0086_A05.b : GTCTGCACTTAA*GCTCGATCCATGGCTACCctggggattgtggaactggttggggcctt