[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-001062

Length: 1,085

Sequence [FASTA format sequence]
CTTACTTACT TTGCGGCAGC GCGGAGAGCC CCACCCCCTT TTCTCTGCGG AATCACCATG
GCGGCCGGGA CCCTGTACAC ATATCCTGAA AACTGGAGGG CCTTCAAAGC CCTCATTGCC
GCTCAGTACA GCGGGGCTCA GGTCCGCGTG CTCTCCGCAC CACCCCACTT CCATTTTGGC
CAAACCAACC ACACCCCCGA ATTTCTCCGT AAATTTCCTG CCGGTAAGGT TCCAGCATTT
GAGGGTGACG ATGGATTCTG TGTGTTCGAG AGCAATGCCA TTGCCTACTA CGTGAGCAAC
GAGGAGCTGC GGGGAAGTAC TCCTGAGGCA GCAGCCCAGG TGGTGCAGTG GGTGAGCTTT
GCCGATAGCG ACATCGTGCC CCCCGCCAGT ACCTGGGTGT TCCCCACCTT GGGCATCATG
CACTACAACA AGCAGGCCAC AGAGAATGCA AAGGATGAGG TGAGGCGAGT TCTGGGGCTG
CTGGATGCTC ACTTGAAGAC GAGGACTTTT CTGGTGGGCG AACGTGTGAC GCTGGCTGAC
ATCACAGTTG TCTGCACCCT GTTGTGGCTC TACAAACAGG TCCTGGAGCC TTCTTTCCGC
CAGGCCTTCC CCAATACCAA CCGCTGGTTC CTCACCTGCA TTAACCAGCC CCAGTTCCGG
GCTGTCTTGG GGGAGGTGAA GCTCTGTGAG AAGATGGCCC AGTTTGATGC TAAAAAGTTT
GCAGAGAGTC AGCCTAAAAA GGACACCCCA CGGAAAGAGA AAGGTTCTCG AGAAGAGAAG
CAGAAGCCCC AGGCTGAGCG GAAAGAGGAG AAGAAGGCAG CTGCTCCTGC TCCTGAGGAG
GAGCTGGACG AGTGTGAGCA GGCGCTGGCT GCTGAGCCCA AGGCCAAGGA TCCCTTTGCT
CACCTACCCA AGAGTACCTT TGTGTTGGAC GAATTTAAGC GCAAGTACTC CAACGAGGAC
ACACTCTCTG TGGCGCTGCC GTACTTCTGG GAGCACTTTG ATAAGGATGG CTGGTCCTTG
TGGTACTCGG AGTACGCTTC CCTGAAAAGC TCACCAGACA TTCATGAGCT GCAACCTCAT
CACTG


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinEEF1Gelongation factor 1-gamma [Homo sapiens]. 582e-167O
Contig/Assembly ProteinVARSvalyl-tRNA synthetase [Homo sapiens]. 1203e-27O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinEef1gelongation factor 1-gamma [Mus musculus]. 582e-167O
Contig/Assembly ProteinVarsvalyl-tRNA synthetase [Mus musculus]. 1142e-25O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC611396PREDICTED: similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma) isoform 1 [Canis familiaris]. 581e-166O
Contig/Assembly ProteinLOC611396PREDICTED: similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma) isoform 24 [Canis familiaris]. 581e-166O
Contig/Assembly ProteinLOC608086PREDICTED: similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma) isoform 12 [Canis familiaris]. 581e-166O
Contig/Assembly ProteinLOC608086PREDICTED: similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma) isoform 1 [Canis familiaris]. 581e-166O
Contig/Assembly ProteinLOC611396PREDICTED: similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma) isoform 20 [Canis familiaris]. 573e-164O
Contig/Assembly ProteinLOC607438PREDICTED: similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma) isoform 13 [Canis familiaris]. 573e-164O
Contig/Assembly ProteinLOC607438PREDICTED: similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma) isoform 2 [Canis familiaris]. 573e-164O
Contig/Assembly ProteinLOC606904PREDICTED: similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma) isoform 14 [Canis familiaris]. 551e-158O
Contig/Assembly ProteinLOC606904PREDICTED: similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma) isoform 3 [Canis familiaris]. 548e-157O
Contig/Assembly ProteinLOC611396PREDICTED: similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma) isoform 22 [Canis familiaris]. 537e-153O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinEEF1Gelongation factor 1-gamma [Bos taurus]. 579e-166O
Contig/Assembly ProteinVARSPREDICTED: valyl-tRNA synthetase-like [Bos taurus]. 1195e-27O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinVARSvalyl-tRNA synthetase [Sus scrofa]. 1225e-28O


Assembly Members: 402      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010069F01ADR01_0069_F01.bDB787647 
ADR010093C04ADR01_0093_C04.bDB789746 
BFLT10029F09BFLT1_0029_F09.bFS642383 
BFLT10061A02BFLT1_0061_A02.bFS644800 
BFLT10063C12BFLT1_0063_C12.bFS644996 
BFLT10066E07BFLT1_0066_E07.bFS645260 
BFLT10076D02BFLT1_0076_D02.bFS645998 
BFLT10094G03BFLT1_0094_G03.bFS647498 
BFLT10103E04BFLT1_0103_E04.bHX201987 
BFLT10113F08BFLT1_0113_F08.bHX202834 
BKFL10014F05BKFL1_0014_F05.bFS648911 
BMWN10007F06BMWN1_0007_F06.bHX206030 
BMWN10090A06BMWN1_0090_A06.bHX211094 
CBLT10038E06CBLT1_0038_E06.bHX214456 
CBLT10041G12CBLT1_0041_G12.bHX214629 
CLNT10013D09CLNT1_0013_D09.bFS658096 
CLNT10015B05CLNT1_0015_B05.bFS658235 
CLNT10015E03CLNT1_0015_E03.bFS658261 
CLNT10021E06CLNT1_0021_E06.bFS658714 
CLNT10021F12CLNT1_0021_F12.bFS658730 
CLNT10026G01CLNT1_0026_G01.bFS659120 
CLNT10027H07CLNT1_0027_H07.bFS659219 
CLNT10028D02CLNT1_0028_D02.bFS659248 
CLNT10029A07CLNT1_0029_A07.bFS659296 
CLNT10029F02CLNT1_0029_F02.bFS659342 
CLNT10040A09CLNT1_0040_A09.bFS660162 
CLNT10067G07CLNT1_0067_G07.bFS662371 
CLNT10071H03CLNT1_0071_H03.bFS662709 
CLNT10074D09CLNT1_0074_D09.bFS662919 
CLNT10075C08CLNT1_0075_C08.bFS662992 
CLNT10090F11CLNT1_0090_F11.bFS663581 
CLNT10108E06CLNT1_0108_E06.bHX219783 
CLNT10113C02CLNT1_0113_C02.bHX220138 
CLNT10132A05CLNT1_0132_A05.bHX221576 
CLNT10132B02CLNT1_0132_B02.bHX221583 
CLNT10133H04CLNT1_0133_H04.bHX221717 
CLNT10142C03CLNT1_0142_C03.bHX222369 
CLNT10147H05CLNT1_0147_H05.bHX222812 
CLNT10150C11CLNT1_0150_C11.bHX223001 
CLNT10150D11CLNT1_0150_D11.bHX223013 
DCI010008H07DCI01_0008_H07.bDB791095 
DCI010012F12DCI01_0012_F12.bDB791395 
DCI010022G09DCI01_0022_G09.bDB792294 
DCI010042F02DCI01_0042_F02.bDB793947 
DCI010074E02DCI01_0074_E02.bDB796154 
HTMT10057H02HTMT1_0057_H02.bFS668285 
ILNT10008B06ILNT1_0008_B06.bHX227312 
ILNT10025D03ILNT1_0025_D03.bHX228638 
ITT010006B11ITT01_0006_B11.bBW976513 
ITT010006E09ITT01_0006_E09.bBW976545 
ITT010014A03ITT01_0014_A03.bBW977226 
ITT010015D01ITT01_0015_D01.bBW977347 
ITT010015F05ITT01_0015_F05.bBW977374 
ITT010018H07ITT01_0018_H07.bBW977661 
ITT010020A02ITT01_0020_A02.bBW977759 
ITT010049H04ITT01_0049_H04.bBW980374 
ITT010057D07ITT01_0057_D07.bBW981063 
ITT010058E12ITT01_0058_E12.bBW981171 
ITT010058H04ITT01_0058_H04.bBW981197 
ITT010061G09ITT01_0061_G09.bBW981456 
ITT010062F12ITT01_0062_F12.bBW981537 
ITT010067D01ITT01_0067_D01.bBW981956 
ITT010070G03ITT01_0070_G03.bBW982263 
ITT010071H02ITT01_0071_H02.bBW982363 
ITT010076B09ITT01_0076_B09.bBW982740 
ITT010079B09ITT01_0079_B09.bBW983000 
ITT010083D09ITT01_0083_D09.bBW983378 
ITT010101D05ITT01_0101_D05.bBW984985 
LNG010005E12LNG01_0005_E12.bBP437864 
LNG010013B09LNG01_0013_B09.bBP434639 
LNG010016F12LNG01_0016_F12.bBP438886 
LNG010017D05LNG01_0017_D05.bBP436288 
LNG010017F03LNG01_0017_F03.bBP438130 
LNG010019G01LNG01_0019_G01.bBP438970 
LNG010021C04LNG01_0021_C04.bBP435210 
LNG010026E10LNG01_0026_E10.bBP437705 
LNG010030E11LNG01_0030_E11.bBP437798 
LNG010044G08LNG01_0044_G08.bBP439563 
LNG010056E11LNG01_0056_E11.bBP437812 
LNG010059H02LNG01_0059_H02.bBP440074 
LNG010062A09LNG01_0062_A09.bBP433702 
LNG010065F09LNG01_0065_F09.bBP438669 
LNG010088D05LNG01_0088_D05.bBP436337 
LNG010091D09LNG01_0091_D09.bBP436654 
LNG010093F11LNG01_0093_F11.bBP438858 
LNG010096F11LNG01_0096_F11.bBP438861 
LNG010102B06LNG01_0102_B06.bBP434459 
LVR010016B10LVR01_0016_B10.bBP442561 
LVR010037B05LVR01_0037_B05.bBP442197 
LVR010044F10LVR01_0044_F10.bBP446118 
LVR010082A02LVR01_0082_A02.bBP441082 
LVRM10048A07LVRM1_0048_A07.bBW962928 
LVRM10071A12LVRM1_0071_A12.bBP448874 
LVRM10079F09LVRM1_0079_F09.bBP140157 
LVRM10090E04LVRM1_0090_E04.bCJ003218 
LVRM10104D05LVRM1_0104_D05.bBP450835 
LVRM10111A10LVRM1_0111_A10.bBP448749 
LVRM10134G03LVRM1_0134_G03.b  
LVRM10135C04LVRM1_0135_C04.bBP449951 
LVRM10139C09LVRM1_0139_C09.bBP450307 
LVRM10158H09LVRM1_0158_H09.bBP454431 
LVRM10160F02LVRM1_0160_F02.bBP452306 
LVRM10163E05LVRM1_0163_E05.bCJ004104 
LVRM10167B06LVRM1_0167_B06.bBW963112 
LVRM10180E11LVRM1_0180_E11.bCJ005464 
LVRM10180H10LVRM1_0180_H10.bCJ005497 
LVRM10187F01LVRM1_0187_F01.bCJ006053 
LVRM10194G06LVRM1_0194_G06.bBW963293 
LVRM10199D03LVRM1_0199_D03.bBW963310 
MLN010004D12MLN01_0004_D12.bCJ007992 
MLN010019D06MLN01_0019_D06.bCJ009064 
MLN010034A10MLN01_0034_A10.bCJ010265 
MLN010041F02MLN01_0041_F02.bCJ010889 
MLN010044B12MLN01_0044_B12.bCJ011103 
MLN010045D05MLN01_0045_D05.bCJ011195 
MLN010054C10MLN01_0054_C10.bCJ011872 
MLN010066A09MLN01_0066_A09.bCJ012822 
MLN010067H11MLN01_0067_H11.bCJ012982 
MLN010069G07MLN01_0069_G07.bCJ013144 
MLN010084F04MLN01_0084_F04.bCJ014371 
MLN010085C09MLN01_0085_C09.bCJ014423 
MLN010085D10MLN01_0085_D10.bBW963819 
MLTL10055E02MLTL1_0055_E02.bFS683209 
MLTL10079F11MLTL1_0079_F11.bFS684487 
MLTL10083H11MLTL1_0083_H11.bFS684862 
MLTL10084E05MLTL1_0084_E05.bFS684911 
OVR010007C01OVR01_0007_C01.bBP142125 
OVR010007F02OVR01_0007_F02.bBP143515 
OVR010012H10OVR01_0012_H10.bBP144744 
OVR010015A06OVR01_0015_A06.b  
OVR010017H02OVR01_0017_H02.bBP144442 
OVR010018A03OVR01_0018_A03.bBP141328 
OVR010025D12OVR01_0025_D12.bBP143010 
OVR010030B11OVR01_0030_B11.bBP142069 
OVR010030H11OVR01_0030_H11.bBP144789 
OVR010031F10OVR01_0031_F10.bBP143842 
OVR010032H04OVR01_0032_H04.bBP144527 
OVR010033C06OVR01_0033_C06.bBP142346 
OVR010033E01OVR01_0033_E01.bBP143057 
OVR010035D09OVR01_0035_D09.bBP142910 
OVR010040E02OVR01_0040_E02.b  
OVR010040F01OVR01_0040_F01.bBP143502 
OVR010042C09OVR01_0042_C09.b  
OVR010044G08OVR01_0044_G08.bBP144237 
OVR010048E10OVR01_0048_E10.bBP143399 
OVR010049E05OVR01_0049_E05.bBW963981 
OVR010051E08OVR01_0051_E08.bBW964168 
OVR010052H01OVR01_0052_H01.bBW964289 
OVR010053C06OVR01_0053_C06.bBW964327 
OVR010053E07OVR01_0053_E07.bBW964350 
OVR010056H01OVR01_0056_H01.bBW964644 
OVR010060A07OVR01_0060_A07.bBW964932 
OVR010062H06OVR01_0062_H06.bBW965184 
OVR010063E01OVR01_0063_E01.bBW965232 
OVR010070F12OVR01_0070_F12.bBW965880 
OVR010071D11OVR01_0071_D11.bBW965950 
OVR010071H11OVR01_0071_H11.bBW965993 
OVR010072F12OVR01_0072_F12.bBW966063 
OVR010075A05OVR01_0075_A05.bBW966256 
OVR010076B11OVR01_0076_B11.bBW966360 
OVR010085C09OVR01_0085_C09.bBW966991 
OVR010086B09OVR01_0086_B09.bBW967063 
OVR010089B03OVR01_0089_B03.bBW967283 
OVR010090C03OVR01_0090_C03.bBW967363 
OVR010093C11OVR01_0093_C11.bBW967603 
OVR010095E12OVR01_0095_E12.bBW967771 
OVR010095F03OVR01_0095_F03.bBW967773 
OVR010101A05OVR01_0101_A05.bBW968187 
OVR010103B02OVR01_0103_B02.bBW968373 
OVR010104G12OVR01_0104_G12.bBW968529 
OVRM10012B08OVRM1_0012_B08.bBP146872 
OVRM10012F07OVRM1_0012_F07.bBP151757 
OVRM10015B11OVRM1_0015_B11.bBP147203 
OVRM10020C06OVRM1_0020_C06.bBP147906 
OVRM10027F02OVRM1_0027_F02.bBP151251 
OVRM10028A06OVRM1_0028_A06.bBP145380 
OVRM10031D05OVRM1_0031_D05.bBP149085 
OVRM10031G10OVRM1_0031_G10.bBP153344 
OVRM10033G10OVRM1_0033_G10.bBP153346 AK395066
OVRM10042D12OVRM1_0042_D12.bBP458382 
OVRM10046D12OVRM1_0046_D12.bBP149840 
OVRM10047B02OVRM1_0047_B02.bBP146261 
OVRM10047C06OVRM1_0047_C06.bBP147921 
OVRM10059D07OVRM1_0059_D07.bBP149306 
OVRM10062F09OVRM1_0062_F09.bBP152001 
OVRM10075H06OVRM1_0075_H06.bBP154265 
OVRM10082D01OVRM1_0082_D01.bBP148705 
OVRM10087A06OVRM1_0087_A06.bBP145423 
OVRM10089C11OVRM1_0089_C11.bBP148495 
OVRM10103H09OVRM1_0103_H09.bBP154629 
OVRM10113D10OVRM1_0113_D10.bBP149681 
OVRM10113F09OVRM1_0113_F09.bBP152046 
OVRM10118E12OVRM1_0118_E12.bBP151126 
OVRM10120B04OVRM1_0120_B04.bBP146536 
OVRM10120D07OVRM1_0120_D07.bBP149364 
OVRM10123B12OVRM1_0123_B12.bBP147394 
OVRM10134H01OVRM1_0134_H01.bBP153766 
OVRM10151F05OVRM1_0151_F05.bBP459751 
OVRM10152D07OVRM1_0152_D07.bBP457985 
OVRM10152E11OVRM1_0152_E11.bBP459258 
OVRM10156B10OVRM1_0156_B10.bBP456320 
OVRM10161H11OVRM1_0161_H11.bBP462165 
OVRM10168D11OVRM1_0168_D11.bBP458321 
OVRM10181E02OVRM1_0181_E02.bBP458570 
OVRM10182B02OVRM1_0182_B02.bBP455673 
OVRM10194A02OVRM1_0194_A02.bBP454773 
OVRM10214F08OVRM1_0214_F08.bBP460055 
OVRM10215E08OVRM1_0215_E08.bBP459084 
OVRM10216A05OVRM1_0216_A05.bBP455027 
OVRM10222E02OVRM1_0222_E02.bBP458606 
OVRM10222E12OVRM1_0222_E12.bBP459393 
OVRM10224E03OVRM1_0224_E03.bBP458691 
OVRT10001H11OVRT1_0001_H11.bFS686496 
OVRT10004B03OVRT1_0004_B03.bFS686676 
OVRT10004F01OVRT1_0004_F01.bFS686720 
OVRT10006A09OVRT1_0006_A09.bFS686838 
OVRT10008C01OVRT1_0008_C01.bFS687028 
OVRT10010B03OVRT1_0010_B03.bFS687181 
OVRT10010C05OVRT1_0010_C05.bFS687192 
OVRT10022D08OVRT1_0022_D08.bFS688194 
OVRT10022G01OVRT1_0022_G01.bFS688221 
OVRT10036D08OVRT1_0036_D08.bFS689335 
OVRT10047B06OVRT1_0047_B06.bFS690212 
OVRT10059A05OVRT1_0059_A05.bFS691189 
OVRT10067C01OVRT1_0067_C01.bFS691872 AK395813
OVRT10069G02OVRT1_0069_G02.bFS692078 
OVRT10073F02OVRT1_0073_F02.bFS692367 
OVRT10077E09OVRT1_0077_E09.bFS692689 
OVRT10080H08OVRT1_0080_H08.bFS692967 
OVRT10081G08OVRT1_0081_G08.bFS693038 
OVRT10085A02OVRT1_0085_A02.bFS693291 
OVRT10087B10OVRT1_0087_B10.bFS693476 
OVRT10091A10OVRT1_0091_A10.bFS693792 
OVRT10098A10OVRT1_0098_A10.bFS694374 
OVRT10098F08OVRT1_0098_F08.bFS694426 
OVRT10100G12OVRT1_0100_G12.bFS694605 
OVRT10108E01OVRT1_0108_E01.bHX235444 
OVRT10111G10OVRT1_0111_G10.bHX235725 
OVRT10124B11OVRT1_0124_B11.bHX236722 
OVRT10129A05OVRT1_0129_A05.bHX237106 
PBL010010D10PBL01_0010_D10.bBW969114 
PBL010016G04PBL01_0016_G04.bBW969485 
PBL010018D02PBL01_0018_D02.bBW969581 
PBL010026A10PBL01_0026_A10.bBP155193 
PBL010027A08PBL01_0027_A08.bBW969917 
PBL010028H12PBL01_0028_H12.bBP156664 
PBL010030G06PBL01_0030_G06.bBP156293 
PBL010031G01PBL01_0031_G01.bBP156205 
PBL010032G04PBL01_0032_G04.bBP156269 
PBL010042E11PBL01_0042_E11.bBP155973 
PBL010044E06PBL01_0044_E06.bBW970702 
PBL010045E08PBL01_0045_E08.bBW970769 
PBL010045F06PBL01_0045_F06.bBW970776 
PBL010046A10PBL01_0046_A10.bBP155204 
PBL010057E05PBL01_0057_E05.bBW971464 
PBL010061D06PBL01_0061_D06.bBW971683 
PBL010063C05PBL01_0063_C05.bBW971830 
PBL010064H09PBL01_0064_H09.bBW971967 
PBL010067C02PBL01_0067_C02.bBW972158 
PBL010069A01PBL01_0069_A01.bBW972300 
PBL010073F07PBL01_0073_F07.bBW972673 
PBL010081E05PBL01_0081_E05.bBW973374 
PBL010089B03PBL01_0089_B03.bBW974050 
PCT010002B09PCT01_0002_B09.bFS694718 
PCT010003C03PCT01_0003_C03.bFS694773 
PCT010020C03PCT01_0020_C03.b  
PST010042B01PST01_0042_B01.bFS700105 
SMG010016E08SMG01_0016_E08.bFS714655 
SMG010026B01SMG01_0026_B01.bFS715521 
SMG010037G08SMG01_0037_G08.bFS716554 
SMG010055G11SMG01_0055_G11.bFS718071 
SMG010066E07SMG01_0066_E07.bFS718982 
SMG010070A04SMG01_0070_A04.bFS719280 
SMG010074F03SMG01_0074_F03.bFS719678 
SMG010082A10SMG01_0082_A10.bFS720327 
SMG010084C07SMG01_0084_C07.bFS720511 
SPL010005E04SPL01_0005_E04.bBP158109 
SPL010008E12SPL01_0008_E12.bBP158335 
SPL010017A04SPL01_0017_A04.bBP156764 
SPL010047D01SPL01_0047_D01.bCJ017242 
SPL010051C05SPL01_0051_C05.bCJ017590 
SPL010052B10SPL01_0052_B10.bCJ017676 
SPL010053H09SPL01_0053_H09.bCJ017836 
SPL010055H05SPL01_0055_H05.bCJ018009 
SPL010058B04SPL01_0058_B04.bCJ018209 
SPL010058E03SPL01_0058_E03.bCJ018242 
SPL010059E06SPL01_0059_E06.bCJ018333 
SPL010065H11SPL01_0065_H11.bCJ018918 
SPL010089H09SPL01_0089_H09.bCJ021075 
SPL010092G07SPL01_0092_G07.bCJ021330 
SPL010098A05SPL01_0098_A05.bCJ021802 
SPLT10008E11SPLT1_0008_E11.bHX239838 
SPLT10050G02SPLT1_0050_G02.bHX243098 
TCH010004H07TCH01_0004_H07.bCJ022776 
TCH010006H11TCH01_0006_H11.bCJ022926 
TCH010012H01TCH01_0012_H01.bCJ023362 
TCH010033E12TCH01_0033_E12.bCJ024893 
TCH010035G02TCH01_0035_G02.bCJ025059 
TCH010057A09TCH01_0057_A09.bCJ026455 
TCH010061E07TCH01_0061_E07.bCJ026786 
TCH010086C07TCH01_0086_C07.bCJ028682 
TCH010091H09TCH01_0091_H09.bCJ029110 
TCH010093C07TCH01_0093_C07.bCJ029214 
TES010017E01TES01_0017_E01.bCJ031147 
TES010018A10TES01_0018_A10.bCJ031189 
TES010022F02TES01_0022_F02.bCJ031487 
TES010022F07TES01_0022_F07.bCJ031491 
TES010028A03TES01_0028_A03.bCJ031823 
TES010037H09TES01_0037_H09.bCJ032470 
TES010041D12TES01_0041_D12.bCJ032662 
TES010041E11TES01_0041_E11.b  
TES010044B05TES01_0044_B05.bCJ032823 
TES010053D12TES01_0053_D12.bCJ033392 
TES010058C03TES01_0058_C03.bCJ033698 
TES010060H07TES01_0060_H07.bCJ033877 
TES010061A07TES01_0061_A07.bCJ033884 
TES010062D08TES01_0062_D08.bCJ033982 
TES010069C12TES01_0069_C12.b  
TES010072A02TES01_0072_A02.bCJ034622 
TES010073F12TES01_0073_F12.bCJ034727 
TES010081G09TES01_0081_G09.b  
TES010086E10TES01_0086_E10.b  
TES010088D11TES01_0088_D11.bCJ035695 
TES010089C09TES01_0089_C09.bCJ035756 
TES010090A05TES01_0090_A05.bCJ035808 
TES010099F11TES01_0099_F11.bCJ036508 
THY010002C06THY01_0002_C06.bBP162352 
THY010002E07THY01_0002_E07.bBP164958 
THY010002E12THY01_0002_E12.bBP165466 
THY010008C12THY01_0008_C12.bBP162983 
THY010010D01THY01_0010_D01.bBP163086 
THY010013F11THY01_0013_F11.bBP166622 
THY010013G09THY01_0013_G09.bBP167684 
THY010021A04THY01_0021_A04.bBP159686 
THY010023C07THY01_0023_C07.bBP162470 
THY010026D05THY01_0026_D05.bBP163512 
THY010026E11THY01_0026_E11.bBP165389 
THY010027D07THY01_0027_D07.bBP163717 
THY010033E02THY01_0033_E02.bBP164459 
THY010033E04THY01_0033_E04.bBP164672 
THY010036G11THY01_0036_G11.bBP167912 
THY010039A03THY01_0039_A03.bBP159594 
THY010039E09THY01_0039_E09.bBP165188 
THY010041G01THY01_0041_G01.bBP166853 
THY010043B07THY01_0043_B07.bBP161234 
THY010044D01THY01_0044_D01.bBP163111 
THY010045B12THY01_0045_B12.bBP161762 
THY010045C09THY01_0045_C09.bBP162697 AK398388
THY010047D09THY01_0047_D09.bBP163939 
THY010053G03THY01_0053_G03.bBP167076 
THY010055B12THY01_0055_B12.bBP161771 
THY010055D06THY01_0055_D06.bBP163639 
THY010059B10THY01_0059_B10.bBP161564 
THY010062C06THY01_0062_C06.bBP162400 
THY010066D01THY01_0066_D01.bBP163133 
THY010068D02THY01_0068_D02.bBP163244 
THY010072B03THY01_0072_B03.bBP160844 
THY010072H04THY01_0072_H04.bBP168481 
THY010080G10THY01_0080_G10.bBP167843 
THY010081C11THY01_0081_C11.bBP162934 
THY010081D12THY01_0081_D12.bBP164282 
THY010086C02THY01_0086_C02.bBP162002 
THY010091C02THY01_0091_C02.bBP162007 
THY010091E07THY01_0091_E07.bBP165024 
THY010091E09THY01_0091_E09.bBP165228 
THY010092E02THY01_0092_E02.bBP164510 
THY010093D03THY01_0093_D03.bBP163358 
THY010094H11THY01_0094_H11.bBP169248 
THY010097B10THY01_0097_B10.bBP161594 
THY010102C11THY01_0102_C11.bBP162951 
THY010103G08THY01_0103_G08.bBP167649 
THY010108F10THY01_0108_F10.bBP166594 
THY010115E09THY01_0115_E09.bBP165244 
THY010202A03THY01_0202_A03.bBP159662 
THY010202E05THY01_0202_E05.bBP164850 
THY010202H05THY01_0202_H05.bBP168628 
THY010203A09THY01_0203_A09.bBP160267 
THY010205A01THY01_0205_A01.bBP159460 
UTR010001E09UTR01_0001_E09.bBP171851 
UTR010002F08UTR01_0002_F08.bBP172338 
UTR010006B11UTR01_0006_B11.bBP170334 
UTR010013H08UTR01_0013_H08.bBP173418 
UTR010025B09UTR01_0025_B09.bBP170266 AK240048
UTR010026F08UTR01_0026_F08.bBP172359 
UTR010033C06UTR01_0033_C06.bBP170674 
UTR010038C06UTR01_0038_C06.bBP170679 
UTR010043F04UTR01_0043_F04.bBP172199 
UTR010048E05UTR01_0048_E05.bBP171717 
UTR010063B08UTR01_0063_B08.bBP463143 
UTR010063B10UTR01_0063_B10.bBP463188 
UTR010063G05UTR01_0063_G05.bBP464509 
UTR010075H06UTR01_0075_H06.bBP464831 
UTR010076B04UTR01_0076_B04.bBP463053 
UTR010081C04UTR01_0081_C04.bCJ037460 
UTR010083E08UTR01_0083_E08.bCJ037670 
UTR010084C10UTR01_0084_C10.bCJ037739 
UTR010085E10UTR01_0085_E10.bCJ037856 
UTR010094D05UTR01_0094_D05.bCJ038669 
UTR010096A12UTR01_0096_A12.bCJ038826 
UTR010102G01UTR01_0102_G01.bCJ039350 
UTR010103E11UTR01_0103_E11.bCJ039429 
UTR010106D04UTR01_0106_D04.bCJ039690 

  

SNPs: 2      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
291C235540.745WSTAC/Y
T9900.255TAT/Y
552A8200.243WSGTA/V
C213430.757GTC/V


Alignment:      TOP

20110601C-001062 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRT1_0067_C01.b :
OVRM1_0103_H09.b :
ITT01_0058_E12.b :
LVR01_0082_A02.b :
OVR01_0089_B03.b :
OVRT1_0108_E01.b :
OVR01_0018_A03.b :
TES01_0090_A05.b :
THY01_0055_B12.b :
TES01_0081_G09.b :
TES01_0017_E01.b :
TES01_0022_F07.b :
TES01_0028_A03.b :
TES01_0022_F02.b :
OVR01_0095_E12.b :
ITT01_0101_D05.b :
OVRM1_0012_F07.b :
OVRM1_0033_G10.b :
OVR01_0086_B09.b :
THY01_0068_D02.b :
UTR01_0006_B11.b :
UTR01_0025_B09.b :
PBL01_0018_D02.b :
PBL01_0032_G04.b :
TES01_0041_D12.b :
PBL01_0042_E11.b :
THY01_0059_B10.b :
ITT01_0058_H04.b :
OVRT1_0087_B10.b :
LNG01_0091_D09.b :
SPL01_0055_H05.b :
THY01_0033_E04.b :
THY01_0072_B03.b :
TES01_0088_D11.b :
TES01_0072_A02.b :
OVR01_0056_H01.b :
OVRT1_0047_B06.b :
ITT01_0076_B09.b :
OVR01_0060_A07.b :
OVRT1_0022_G01.b :
PBL01_0028_H12.b :
OVRT1_0008_C01.b :
UTR01_0063_G05.b :
LVRM1_0167_B06.b :
OVRM1_0216_A05.b :
LVRM1_0163_E05.b :
OVRM1_0082_D01.b :
OVRM1_0161_H11.b :
LVRM1_0111_A10.b :
OVRM1_0194_A02.b :
OVRM1_0059_D07.b :
OVRM1_0123_B12.b :
OVR01_0101_A05.b :
CBLT1_0041_G12.b :
OVRM1_0168_D11.b :
OVRM1_0028_A06.b :
SMG01_0016_E08.b :
DCI01_0022_G09.b :
THY01_0041_G01.b :
OVR01_0062_H06.b :
SPL01_0058_E03.b :
OVR01_0025_D12.b :
SMG01_0066_E07.b :
BMWN1_0007_F06.b :
THY01_0097_B10.b :
BMWN1_0090_A06.b :
OVRT1_0004_B03.b :
CLNT1_0015_B05.b :
THY01_0086_C02.b :
TCH01_0033_E12.b :
OVRT1_0010_B03.b :
UTR01_0081_C04.b :
SPL01_0051_C05.b :
CLNT1_0015_E03.b :
DCI01_0074_E02.b :
TES01_0062_D08.b :
THY01_0115_E09.b :
OVRM1_0215_E08.b :
THY01_0103_G08.b :
SMG01_0082_A10.b :
OVR01_0104_G12.b :
HTMT1_0057_H02.b :
LVRM1_0194_G06.b :
OVR01_0076_B11.b :
LVRM1_0199_D03.b :
OVRM1_0075_H06.b :
OVRM1_0222_E02.b :
THY01_0081_D12.b :
OVRM1_0222_E12.b :
LVRM1_0104_D05.b :
OVR01_0071_D11.b :
OVR01_0093_C11.b :
LVR01_0037_B05.b :
OVR01_0070_F12.b :
OVRM1_0047_C06.b :
THY01_0010_D01.b :
UTR01_0013_H08.b :
OVRM1_0031_G10.b :
OVRT1_0036_D08.b :
DCI01_0012_F12.b :
THY01_0045_C09.b :
OVR01_0042_C09.b :
SPLT1_0050_G02.b :
OVR01_0053_E07.b :
PBL01_0026_A10.b :
UTR01_0038_C06.b :
PBL01_0027_A08.b :
CLNT1_0133_H04.b :
OVR01_0085_C09.b :
UTR01_0075_H06.b :
OVRT1_0010_C05.b :
THY01_0081_C11.b :
PBL01_0089_B03.b :
THY01_0094_H11.b :
PBL01_0061_D06.b :
PCT01_0003_C03.b :
THY01_0033_E02.b :
LNG01_0088_D05.b :
ITT01_0067_D01.b :
OVR01_0035_D09.b :
PBL01_0073_F07.b :
OVR01_0032_H04.b :
OVR01_0040_F01.b :
CLNT1_0027_H07.b :
MLN01_0084_F04.b :
PST01_0042_B01.b :
OVRT1_0098_A10.b :
UTR01_0084_C10.b :
CLNT1_0150_C11.b :
SPL01_0053_H09.b :
MLN01_0054_C10.b :
OVR01_0017_H02.b :
ITT01_0014_A03.b :
OVR01_0033_C06.b :
THY01_0053_G03.b :
MLTL1_0079_F11.b : nnnccggtt
OVRT1_0022_D08.b :
CLNT1_0029_F02.b :
LNG01_0065_F09.b :
DCI01_0042_F02.b :
LNG01_0019_G01.b :
THY01_0055_D06.b :
BFLT1_0066_E07.b :
MLTL1_0055_E02.b : nnnnnnnnnn
OVR01_0012_H10.b :
OVR01_0033_E01.b :
OVRT1_0004_F01.b :
THY01_0066_D01.b :
THY01_0202_A03.b :
THY01_0092_E02.b :
THY01_0039_A03.b :
LVRM1_0134_G03.b :
OVRM1_0156_B10.b :
OVRM1_0120_B04.b :
THY01_0108_F10.b :
TES01_0061_A07.b :
LVRM1_0090_E04.b :
OVRM1_0046_D12.b :
OVRM1_0214_F08.b :
THY01_0002_C06.b :
LVRM1_0180_E11.b :
OVRM1_0181_E02.b :
LVRM1_0160_F02.b :
OVRM1_0134_H01.b :
LVRM1_0071_A12.b :
OVRM1_0152_D07.b :
LVRM1_0180_H10.b :
THY01_0013_F11.b :
OVRM1_0047_B02.b :
OVR01_0103_B02.b :
THY01_0091_E07.b :
UTR01_0002_F08.b :
OVRM1_0120_D07.b :
OVRM1_0020_C06.b :
OVRM1_0087_A06.b :
THY01_0021_A04.b :
LVRM1_0158_H09.b :
OVRM1_0062_F09.b :
OVRM1_0118_E12.b :
OVRM1_0042_D12.b :
LVRM1_0139_C09.b :
OVRM1_0031_D05.b :
THY01_0047_D09.b :
OVRM1_0012_B08.b :
TES01_0089_C09.b :
UTR01_0001_E09.b :
THY01_0045_B12.b :
THY01_0044_D01.b :
UTR01_0026_F08.b :
OVR01_0051_E08.b :
SPL01_0008_E12.b :
TES01_0018_A10.b :
ITT01_0079_B09.b :
MLN01_0085_D10.b :
OVR01_0072_F12.b :
SMG01_0055_G11.b :
THY01_0036_G11.b :
TES01_0041_E11.b :
CLNT1_0075_C08.b :
UTR01_0085_E10.b :
BFLT1_0113_F08.b :
PBL01_0045_E08.b :
PBL01_0031_G01.b :
SMG01_0070_A04.b :
PBL01_0063_C05.b :
SPL01_0059_E06.b :
UTR01_0043_F04.b :
THY01_0026_E11.b :
ADR01_0093_C04.b :
UTR01_0103_E11.b :
SPL01_0098_A05.b :
BFLT1_0029_F09.b :
UTR01_0106_D04.b :
THY01_0202_E05.b :
SMG01_0037_G08.b :
SPL01_0089_H09.b :
OVRT1_0124_B11.b :
ITT01_0015_D01.b :
ITT01_0020_A02.b :
CLNT1_0113_C02.b :
MLN01_0019_D06.b :
MLN01_0085_C09.b :
ILNT1_0025_D03.b :
TCH01_0004_H07.b :
PBL01_0067_C02.b :
PBL01_0057_E05.b :
LVR01_0044_F10.b :
OVR01_0048_E10.b :
CLNT1_0040_A09.b :
PBL01_0069_A01.b :
SPLT1_0008_E11.b :
CLNT1_0090_F11.b :
UTR01_0083_E08.b :
OVRT1_0077_E09.b :
THY01_0080_G10.b :
ITT01_0071_H02.b :
PBL01_0081_E05.b :
CLNT1_0028_D02.b :
SPL01_0065_H11.b :
SPL01_0092_G07.b :
BFLT1_0061_A02.b :
LNG01_0016_F12.b :
ITT01_0062_F12.b :
OVR01_0040_E02.b :
OVRT1_0091_A10.b :
OVRT1_0100_G12.b :
ITT01_0083_D09.b :
OVR01_0063_E01.b :
MLN01_0069_G07.b :
SPL01_0058_B04.b :
THY01_0205_A01.b :
MLN01_0034_A10.b :
THY01_0039_E09.b :
TCH01_0091_H09.b :
OVR01_0044_G08.b :
OVR01_0053_C06.b :
UTR01_0048_E05.b :
MLN01_0067_H11.b :
MLN01_0066_A09.b :
UTR01_0063_B08.b :
OVR01_0049_E05.b :
OVR01_0007_F02.b :
THY01_0202_H05.b :
LNG01_0044_G08.b :
BFLT1_0076_D02.b :
THY01_0203_A09.b :
CLNT1_0021_E06.b :
OVRT1_0085_A02.b :
MLN01_0044_B12.b :
MLTL1_0083_H11.b : nnnnnnnnnn
THY01_0093_D03.b :
CLNT1_0021_F12.b :
THY01_0072_H04.b :
LVRM1_0135_C04.b :
LVRM1_0048_A07.b :
OVRM1_0027_F02.b :
OVR01_0075_A05.b :
OVRM1_0151_F05.b :
LVRM1_0187_F01.b :
THY01_0091_E09.b :
OVRM1_0152_E11.b :
OVRM1_0224_E03.b :
OVR01_0071_H11.b :
OVRM1_0089_C11.b :
OVRM1_0015_B11.b :
SPL01_0017_A04.b :
TES01_0044_B05.b :
OVR01_0090_C03.b :
THY01_0013_G09.b :
UTR01_0096_A12.b :
CLNT1_0108_E06.b :
THY01_0002_E12.b :
UTR01_0033_C06.b :
BFLT1_0103_E04.b :
OVRT1_0006_A09.b :
SMG01_0074_F03.b :
PBL01_0045_F06.b :
CLNT1_0147_H05.b :
CLNT1_0142_C03.b :
BFLT1_0063_C12.b :
PBL01_0044_E06.b :
MLN01_0004_D12.b :
OVRT1_0001_H11.b :
OVR01_0030_H11.b :
UTR01_0076_B04.b :
ITT01_0061_G09.b :
OVRT1_0129_A05.b :
OVRT1_0098_F08.b :
CLNT1_0029_A07.b :
BKFL1_0014_F05.b : nnnnnnnnnn
OVRT1_0111_G10.b :
ITT01_0018_H07.b :
PBL01_0030_G06.b :
LNG01_0096_F11.b :
MLN01_0041_F02.b :
ITT01_0049_H04.b :
OVRT1_0059_A05.b :
THY01_0062_C06.b :
MLN01_0045_D05.b :
THY01_0026_D05.b :
SMG01_0084_C07.b :
PBL01_0010_D10.b :
OVRT1_0081_G08.b :
CLNT1_0013_D09.b :
PBL01_0016_G04.b :
CLNT1_0067_G07.b :
CLNT1_0132_A05.b :
LNG01_0093_F11.b :
CLNT1_0150_D11.b :
PBL01_0064_H09.b :
OVRT1_0073_F02.b :
ITT01_0015_F05.b :
ITT01_0070_G03.b :
ADR01_0069_F01.b :
CLNT1_0132_B02.b :
SPL01_0052_B10.b :
PCT01_0020_C03.b :
ITT01_0006_B11.b :
OVR01_0052_H01.b :
UTR01_0063_B10.b :
SPL01_0047_D01.b :
OVRT1_0069_G02.b :
ITT01_0006_E09.b :
LNG01_0030_E11.b :
OVR01_0031_F10.b :
LNG01_0062_A09.b :
LNG01_0102_B06.b :
LNG01_0059_H02.b :
THY01_0023_C07.b :
LNG01_0021_C04.b :
PBL01_0046_A10.b :
CLNT1_0074_D09.b :
LNG01_0017_F03.b :
LNG01_0017_D05.b :
CLNT1_0026_G01.b :
OVRT1_0080_H08.b :
TCH01_0086_C07.b :
THY01_0027_D07.b :
THY01_0091_C02.b :
TCH01_0057_A09.b :
TCH01_0035_G02.b :
OVR01_0030_B11.b :
LNG01_0056_E11.b :
TCH01_0061_E07.b :
UTR01_0094_D05.b :
SPL01_0005_E04.b :
CLNT1_0071_H03.b :
OVR01_0007_C01.b :
BFLT1_0094_G03.b :
THY01_0102_C11.b :
TES01_0099_F11.b :
OVRM1_0182_B02.b :
OVRM1_0113_F09.b :
TES01_0037_H09.b :
TES01_0060_H07.b :
UTR01_0102_G01.b :
THY01_0008_C12.b :
LVR01_0016_B10.b :
LVRM1_0079_F09.b :
TES01_0053_D12.b :
OVR01_0095_F03.b :
PCT01_0002_B09.b :
LNG01_0026_E10.b :
TCH01_0012_H01.b :
LNG01_0005_E12.b :
LNG01_0013_B09.b :
TES01_0069_C12.b :
TES01_0073_F12.b :
SMG01_0026_B01.b :
ITT01_0057_D07.b :
TCH01_0093_C07.b :
OVRM1_0113_D10.b :
OVR01_0015_A06.b :
DCI01_0008_H07.b :
TES01_0086_E10.b :
MLTL1_0084_E05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
THY01_0043_B07.b :
ILNT1_0008_B06.b :
TCH01_0006_H11.b :
CBLT1_0038_E06.b :
TES01_0058_C03.b :
THY01_0002_E07.b :
20110601C-001062 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRT1_0067_C01.b : nggttttttnnnnnnccgt
OVRM1_0103_H09.b :
ITT01_0058_E12.b :
LVR01_0082_A02.b : nnnnnnnnnnnnnnnnnnnnnnnnn
OVR01_0089_B03.b : nggctt
OVRT1_0108_E01.b :
OVR01_0018_A03.b : tgggggggaacx
TES01_0090_A05.b :
THY01_0055_B12.b : ctxxxxxxxxxxx
TES01_0081_G09.b :
TES01_0017_E01.b :
TES01_0022_F07.b :
TES01_0028_A03.b :
TES01_0022_F02.b :
OVR01_0095_E12.b :
ITT01_0101_D05.b :
OVRM1_0012_F07.b :
OVRM1_0033_G10.b :
OVR01_0086_B09.b :
THY01_0068_D02.b :
UTR01_0006_B11.b :
UTR01_0025_B09.b : gtgggcacct
PBL01_0018_D02.b :
PBL01_0032_G04.b :
TES01_0041_D12.b :
PBL01_0042_E11.b :
THY01_0059_B10.b :
ITT01_0058_H04.b :
OVRT1_0087_B10.b :
LNG01_0091_D09.b :
SPL01_0055_H05.b :
THY01_0033_E04.b :
THY01_0072_B03.b :
TES01_0088_D11.b :
TES01_0072_A02.b :
OVR01_0056_H01.b : nnnttgctaggactatnacxxxxxxxx
OVRT1_0047_B06.b :
ITT01_0076_B09.b :
OVR01_0060_A07.b :
OVRT1_0022_G01.b :
PBL01_0028_H12.b :
OVRT1_0008_C01.b :
UTR01_0063_G05.b :
LVRM1_0167_B06.b :
OVRM1_0216_A05.b :
LVRM1_0163_E05.b :
OVRM1_0082_D01.b : ttggtaaggagtgcggaacgaaggagagac
OVRM1_0161_H11.b :
LVRM1_0111_A10.b :
OVRM1_0194_A02.b :
OVRM1_0059_D07.b :
OVRM1_0123_B12.b :
OVR01_0101_A05.b :
CBLT1_0041_G12.b :
OVRM1_0168_D11.b :
OVRM1_0028_A06.b :
SMG01_0016_E08.b :
DCI01_0022_G09.b : nnnaaagatacaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0041_G01.b :
OVR01_0062_H06.b :
SPL01_0058_E03.b :
OVR01_0025_D12.b :
SMG01_0066_E07.b :
BMWN1_0007_F06.b :
THY01_0097_B10.b :
BMWN1_0090_A06.b :
OVRT1_0004_B03.b :
CLNT1_0015_B05.b :
THY01_0086_C02.b :
TCH01_0033_E12.b :
OVRT1_0010_B03.b :
UTR01_0081_C04.b :
SPL01_0051_C05.b :
CLNT1_0015_E03.b :
DCI01_0074_E02.b : nnnttacgatactaagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0062_D08.b :
THY01_0115_E09.b :
OVRM1_0215_E08.b :
THY01_0103_G08.b :
SMG01_0082_A10.b :
OVR01_0104_G12.b :
HTMT1_0057_H02.b :
LVRM1_0194_G06.b :
OVR01_0076_B11.b :
LVRM1_0199_D03.b :
OVRM1_0075_H06.b :
OVRM1_0222_E02.b :
THY01_0081_D12.b :
OVRM1_0222_E12.b :
LVRM1_0104_D05.b :
OVR01_0071_D11.b :
OVR01_0093_C11.b :
LVR01_0037_B05.b : atttggt
OVR01_0070_F12.b :
OVRM1_0047_C06.b :
THY01_0010_D01.b :
UTR01_0013_H08.b :
OVRM1_0031_G10.b :
OVRT1_0036_D08.b :
DCI01_0012_F12.b : naatacatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0045_C09.b :
OVR01_0042_C09.b :
SPLT1_0050_G02.b :
OVR01_0053_E07.b :
PBL01_0026_A10.b :
UTR01_0038_C06.b :
PBL01_0027_A08.b :
CLNT1_0133_H04.b :
OVR01_0085_C09.b :
UTR01_0075_H06.b :
OVRT1_0010_C05.b :
THY01_0081_C11.b :
PBL01_0089_B03.b :
THY01_0094_H11.b :
PBL01_0061_D06.b :
PCT01_0003_C03.b :
THY01_0033_E02.b :
LNG01_0088_D05.b :
ITT01_0067_D01.b :
OVR01_0035_D09.b :
PBL01_0073_F07.b :
OVR01_0032_H04.b :
OVR01_0040_F01.b :
CLNT1_0027_H07.b :
MLN01_0084_F04.b :
PST01_0042_B01.b :
OVRT1_0098_A10.b :
UTR01_0084_C10.b :
CLNT1_0150_C11.b :
SPL01_0053_H09.b :
MLN01_0054_C10.b :
OVR01_0017_H02.b :
ITT01_0014_A03.b :
OVR01_0033_C06.b :
THY01_0053_G03.b :
MLTL1_0079_F11.b : nnntaaaagatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0022_D08.b :
CLNT1_0029_F02.b :
LNG01_0065_F09.b :
DCI01_0042_F02.b : nnnnccatactatagggctgctcccgcgccgxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0019_G01.b :
THY01_0055_D06.b :
BFLT1_0066_E07.b :
MLTL1_0055_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxx
OVR01_0012_H10.b : ggaaaaa
OVR01_0033_E01.b :
OVRT1_0004_F01.b :
THY01_0066_D01.b :
THY01_0202_A03.b :
THY01_0092_E02.b :
THY01_0039_A03.b :
LVRM1_0134_G03.b :
OVRM1_0156_B10.b :
OVRM1_0120_B04.b :
THY01_0108_F10.b :
TES01_0061_A07.b :
LVRM1_0090_E04.b :
OVRM1_0046_D12.b :
OVRM1_0214_F08.b :
THY01_0002_C06.b : acccctctccccccccaacatnactaatcacacctctaaac
LVRM1_0180_E11.b :
OVRM1_0181_E02.b :
LVRM1_0160_F02.b :
OVRM1_0134_H01.b :
LVRM1_0071_A12.b :
OVRM1_0152_D07.b :
LVRM1_0180_H10.b :
THY01_0013_F11.b :
OVRM1_0047_B02.b :
OVR01_0103_B02.b :
THY01_0091_E07.b :
UTR01_0002_F08.b :
OVRM1_0120_D07.b :
OVRM1_0020_C06.b :
OVRM1_0087_A06.b :
THY01_0021_A04.b :
LVRM1_0158_H09.b :
OVRM1_0062_F09.b :
OVRM1_0118_E12.b :
OVRM1_0042_D12.b :
LVRM1_0139_C09.b :
OVRM1_0031_D05.b :
THY01_0047_D09.b :
OVRM1_0012_B08.b :
TES01_0089_C09.b :
UTR01_0001_E09.b :
THY01_0045_B12.b :
THY01_0044_D01.b :
UTR01_0026_F08.b :
OVR01_0051_E08.b :
SPL01_0008_E12.b :
TES01_0018_A10.b :
ITT01_0079_B09.b : nnnnggat
MLN01_0085_D10.b :
OVR01_0072_F12.b :
SMG01_0055_G11.b :
THY01_0036_G11.b :
TES01_0041_E11.b :
CLNT1_0075_C08.b :
UTR01_0085_E10.b :
BFLT1_0113_F08.b :
PBL01_0045_E08.b :
PBL01_0031_G01.b :
SMG01_0070_A04.b :
PBL01_0063_C05.b :
SPL01_0059_E06.b :
UTR01_0043_F04.b :
THY01_0026_E11.b :
ADR01_0093_C04.b :
UTR01_0103_E11.b :
SPL01_0098_A05.b :
BFLT1_0029_F09.b :
UTR01_0106_D04.b :
THY01_0202_E05.b :
SMG01_0037_G08.b :
SPL01_0089_H09.b :
OVRT1_0124_B11.b :
ITT01_0015_D01.b :
ITT01_0020_A02.b :
CLNT1_0113_C02.b :
MLN01_0019_D06.b :
MLN01_0085_C09.b :
ILNT1_0025_D03.b :
TCH01_0004_H07.b :
PBL01_0067_C02.b :
PBL01_0057_E05.b :
LVR01_0044_F10.b :
OVR01_0048_E10.b :
CLNT1_0040_A09.b :
PBL01_0069_A01.b :
SPLT1_0008_E11.b :
CLNT1_0090_F11.b :
UTR01_0083_E08.b :
OVRT1_0077_E09.b :
THY01_0080_G10.b :
ITT01_0071_H02.b :
PBL01_0081_E05.b :
CLNT1_0028_D02.b :
SPL01_0065_H11.b :
SPL01_0092_G07.b :
BFLT1_0061_A02.b :
LNG01_0016_F12.b :
ITT01_0062_F12.b :
OVR01_0040_E02.b :
OVRT1_0091_A10.b :
OVRT1_0100_G12.b :
ITT01_0083_D09.b :
OVR01_0063_E01.b :
MLN01_0069_G07.b :
SPL01_0058_B04.b :
THY01_0205_A01.b :
MLN01_0034_A10.b :
THY01_0039_E09.b :
TCH01_0091_H09.b :
OVR01_0044_G08.b :
OVR01_0053_C06.b :
UTR01_0048_E05.b :
MLN01_0067_H11.b :
MLN01_0066_A09.b :
UTR01_0063_B08.b :
OVR01_0049_E05.b :
OVR01_0007_F02.b :
THY01_0202_H05.b :
LNG01_0044_G08.b :
BFLT1_0076_D02.b :
THY01_0203_A09.b :
CLNT1_0021_E06.b :
OVRT1_0085_A02.b :
MLN01_0044_B12.b :
MLTL1_0083_H11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxx
THY01_0093_D03.b :
CLNT1_0021_F12.b :
THY01_0072_H04.b :
LVRM1_0135_C04.b :
LVRM1_0048_A07.b :
OVRM1_0027_F02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVR01_0075_A05.b :
OVRM1_0151_F05.b :
LVRM1_0187_F01.b :
THY01_0091_E09.b :
OVRM1_0152_E11.b :
OVRM1_0224_E03.b :
OVR01_0071_H11.b :
OVRM1_0089_C11.b :
OVRM1_0015_B11.b :
SPL01_0017_A04.b :
TES01_0044_B05.b :
OVR01_0090_C03.b :
THY01_0013_G09.b :
UTR01_0096_A12.b :
CLNT1_0108_E06.b :
THY01_0002_E12.b :
UTR01_0033_C06.b :
BFLT1_0103_E04.b :
OVRT1_0006_A09.b :
SMG01_0074_F03.b :
PBL01_0045_F06.b :
CLNT1_0147_H05.b :
CLNT1_0142_C03.b :
BFLT1_0063_C12.b :
PBL01_0044_E06.b :
MLN01_0004_D12.b :
OVRT1_0001_H11.b :
OVR01_0030_H11.b :
UTR01_0076_B04.b :
ITT01_0061_G09.b :
OVRT1_0129_A05.b :
OVRT1_0098_F08.b :
CLNT1_0029_A07.b :
BKFL1_0014_F05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxx
OVRT1_0111_G10.b :
ITT01_0018_H07.b :
PBL01_0030_G06.b :
LNG01_0096_F11.b :
MLN01_0041_F02.b :
ITT01_0049_H04.b :
OVRT1_0059_A05.b :
THY01_0062_C06.b :
MLN01_0045_D05.b :
THY01_0026_D05.b :
SMG01_0084_C07.b :
PBL01_0010_D10.b :
OVRT1_0081_G08.b :
CLNT1_0013_D09.b :
PBL01_0016_G04.b :
CLNT1_0067_G07.b :
CLNT1_0132_A05.b :
LNG01_0093_F11.b :
CLNT1_0150_D11.b :
PBL01_0064_H09.b :
OVRT1_0073_F02.b :
ITT01_0015_F05.b :
ITT01_0070_G03.b :
ADR01_0069_F01.b :
CLNT1_0132_B02.b :
SPL01_0052_B10.b :
PCT01_0020_C03.b :
ITT01_0006_B11.b :
OVR01_0052_H01.b :
UTR01_0063_B10.b :
SPL01_0047_D01.b :
OVRT1_0069_G02.b :
ITT01_0006_E09.b :
LNG01_0030_E11.b : a
OVR01_0031_F10.b :
LNG01_0062_A09.b :
LNG01_0102_B06.b :
LNG01_0059_H02.b :
THY01_0023_C07.b :
LNG01_0021_C04.b :
PBL01_0046_A10.b :
CLNT1_0074_D09.b :
LNG01_0017_F03.b :
LNG01_0017_D05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0026_G01.b :
OVRT1_0080_H08.b :
TCH01_0086_C07.b :
THY01_0027_D07.b :
THY01_0091_C02.b :
TCH01_0057_A09.b :
TCH01_0035_G02.b :
OVR01_0030_B11.b :
LNG01_0056_E11.b :
TCH01_0061_E07.b :
UTR01_0094_D05.b :
SPL01_0005_E04.b :
CLNT1_0071_H03.b :
OVR01_0007_C01.b :
BFLT1_0094_G03.b :
THY01_0102_C11.b :
TES01_0099_F11.b :
OVRM1_0182_B02.b :
OVRM1_0113_F09.b :
TES01_0037_H09.b :
TES01_0060_H07.b :
UTR01_0102_G01.b :
THY01_0008_C12.b :
LVR01_0016_B10.b :
LVRM1_0079_F09.b :
TES01_0053_D12.b :
OVR01_0095_F03.b :
PCT01_0002_B09.b :
LNG01_0026_E10.b :
TCH01_0012_H01.b :
LNG01_0005_E12.b :
LNG01_0013_B09.b :
TES01_0069_C12.b :
TES01_0073_F12.b :
SMG01_0026_B01.b :
ITT01_0057_D07.b :
TCH01_0093_C07.b :
OVRM1_0113_D10.b :
OVR01_0015_A06.b :
DCI01_0008_H07.b : ccctttggcgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0086_E10.b :
MLTL1_0084_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0043_B07.b :
ILNT1_0008_B06.b :
TCH01_0006_H11.b :
CBLT1_0038_E06.b :
TES01_0058_C03.b :
THY01_0002_E07.b :
20110601C-001062 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRT1_0067_C01.b : tagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0103_H09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0058_E12.b : nnnnggtgatacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_A02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0089_B03.b : gtgactatgacagtttgtcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0108_E01.b : ntttccgtctgcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0018_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0090_A05.b : ntttggc
THY01_0055_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0081_G09.b : attattatttataataataaatttt
TES01_0017_E01.b :
TES01_0022_F07.b :
TES01_0028_A03.b :
TES01_0022_F02.b :
OVR01_0095_E12.b : ngtgcttgtgctaaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0101_D05.b : nnnnggagtaacaxxxxxx
OVRM1_0012_F07.b : agttcagacxxxxxxxxxxxxxxxxxxx
OVRM1_0033_G10.b : xxxxxxxxxxxxxxxxxxxxx
OVR01_0086_B09.b : gcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0068_D02.b : catxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0006_B11.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0025_B09.b : attaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0018_D02.b : gttttcttnggggtaacagct
PBL01_0032_G04.b : ngtcaacaxx
TES01_0041_D12.b :
PBL01_0042_E11.b : nnnggtgatacax
THY01_0059_B10.b : catxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0058_H04.b : nnggatgaacaxxxxx
OVRT1_0087_B10.b : nggcgttnnnnnnnccgttagcgnacgxxxxxxxxxxxxxx
LNG01_0091_D09.b : ttttnagctggaaatgacagxxxxxxxxxxxxxxxxx
SPL01_0055_H05.b : nnggcgctaggactaagacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0033_E04.b : tttatggttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0072_B03.b : ggcttttgggaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0088_D11.b :
TES01_0072_A02.b :
OVR01_0056_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0047_B06.b : nnttccgtcagcgnacgxxxxxxxxxxxxxx
ITT01_0076_B09.b : nnnggagtaacaxxxx
OVR01_0060_A07.b : ttgctaggactaaaacxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0022_G01.b : nntttccgttagcgnacgxxxxxxxxxxxx
PBL01_0028_H12.b : naaaagagcgacaxxxxxxxx
OVRT1_0008_C01.b : nnnncctctagcgnacgxxxxxxxxxxxxx
UTR01_0063_G05.b : gtctttatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0167_B06.b : gttgtcxxxxxxxxxxx
OVRM1_0216_A05.b : gagctgacxxxxxxxxxxxx
LVRM1_0163_E05.b : ttgtcxxxxxxxxxxxx
OVRM1_0082_D01.b : cacgaccaccccggccgcccgcggaggacagaaagaactatcattgtcxxxxxxxxxxxx
OVRM1_0161_H11.b : nagttgtcxxxxxxxxxxxxxxxxx
LVRM1_0111_A10.b : nagtttgtcxxxxxxxxxx
OVRM1_0194_A02.b : nagttgtcxxxxxxxxxxxxxxxx
OVRM1_0059_D07.b : agttgacxxxxxxxxxxx
OVRM1_0123_B12.b : nagttgacxxxxxxxx
OVR01_0101_A05.b : ttgcttgtgacttgacxxxxxxxxxxxxxxxxxxxxx
CBLT1_0041_G12.b : nnngggatagtacacgca
OVRM1_0168_D11.b : gagttgtcxxxxxxxxxxx
OVRM1_0028_A06.b : cxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0016_E08.b : nnggttaacannnnggataaagcagcx
DCI01_0022_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0041_G01.b : ctttttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0062_H06.b : nnggcttggacttagacxxxxxxxxxxxxxxxxxxxxx
SPL01_0058_E03.b : nnnggcttggactataacxxxxxxxxxxxxxxxxxxxx
OVR01_0025_D12.b : gaggcatctgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0066_E07.b : nnccaaattnnnnnggataaagcag
BMWN1_0007_F06.b : nnnnnnggagagtxxxxxxxxxx
THY01_0097_B10.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0090_A06.b : nnaaaggagagtagaggxxxxxxxxxxxxx
OVRT1_0004_B03.b : nnnnncctctagcgnacgagtgxxxxxxx
CLNT1_0015_B05.b : nnnnnccgtcagctgtacgaggxxxxxxxxx
THY01_0086_C02.b : ggggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0033_E12.b : tgctaggactatgacxxxxxxxxxxxxxxxxxxxxx
OVRT1_0010_B03.b : nnnnccgtcagctgtacgaggxxxxx
UTR01_0081_C04.b : nnnnggcatggactaanacxxxxxxxxxxxxxxxxxxxxx
SPL01_0051_C05.b : nnnnaagcttggaatatgacxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0015_E03.b : ccgtttttnnngnnnccgttcgcgnacgxxxxxxxxxxxxxx
DCI01_0074_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0062_D08.b :
THY01_0115_E09.b : gtgtaaaa
OVRM1_0215_E08.b : gagttgacxxxxxxxxxxx
THY01_0103_G08.b : gttgcaaaaca
SMG01_0082_A10.b : nnnaagcctttatttnnnggatataagcag
OVR01_0104_G12.b : tgcttggactatgacxxxxxxxxxxxxxxxxxxxxx
HTMT1_0057_H02.b : tttgtagagagtagacgxx
LVRM1_0194_G06.b : xxxxx
OVR01_0076_B11.b : cattaggtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0199_D03.b : tagttgacxxxxxxxxxxx
OVRM1_0075_H06.b : xxxxxxxxxxxxxxxxxxxxxx
OVRM1_0222_E02.b : ttgtxxxxxxxxxxxx
THY01_0081_D12.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0222_E12.b : agttgtcxxxxxxxxxxx
LVRM1_0104_D05.b : nagttgtcxxxxxxxxxxx
OVR01_0071_D11.b : ttgctaggacttagacxxxxxxxxxxxxxxxxxxxxxx
OVR01_0093_C11.b : ngggataggactaaaacxxxxxxxxxxxxxxxxxxxx
LVR01_0037_B05.b : gaactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0070_F12.b : ngcttgtgctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0047_C06.b : cxxxxxxxxxxxxxxxxxxxxxx
THY01_0010_D01.b : axxxxx
UTR01_0013_H08.b : tgggtgaactattagxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0031_G10.b : cxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0036_D08.b : nnnccccgtttgcgnacgxxxxxxxxxxxx
DCI01_0012_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0045_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0042_C09.b : ggtttctttaatatgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0050_G02.b : nnnccgcagtagaggxx
OVR01_0053_E07.b : nnnnggcataggactatgacxxxxxxxxxxxxxxxxxxxxxx
PBL01_0026_A10.b : atgaacag
UTR01_0038_C06.b : gtgaacctatxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0027_A08.b : nnnngagcaagag
CLNT1_0133_H04.b : nnntttctatagcgnacgagtgxxxxxxxxxx
OVR01_0085_C09.b : nnnggcttaggactatacacxxxxxxxxxxxxxxxxxxxx
UTR01_0075_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0010_C05.b : nnccgtcagcgnaggxxxxxxxxxxx
THY01_0081_C11.b : cttctcctcccggcttatctgcacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0089_B03.b : nnnnaatgaaca
THY01_0094_H11.b : ggagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0061_D06.b : nnnggatacacax
PCT01_0003_C03.b :
THY01_0033_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0088_D05.b : nnnntttggtggacatgacagtttgtcxxxxxxxx
ITT01_0067_D01.b : nttatgaacaxxx
OVR01_0035_D09.b : atttttttttttcccccagataggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0073_F07.b : nnnggatgaacax
OVR01_0032_H04.b : aaaagctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0040_F01.b : caggacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0027_H07.b : ntacgttcagcgacgxxxxxxxxxxxx
MLN01_0084_F04.b : nnggctaggacatgacxxxxxxxxxxxxxxxxxxxx
PST01_0042_B01.b : nttttcc
OVRT1_0098_A10.b : nnnnccttcgcgnacgnatgxxxxxx
UTR01_0084_C10.b : nnttgcttggactaagacxxxxxxxxxxxxxxxxxxxxx
CLNT1_0150_C11.b : nnnnccgtcagcgnacgxxxxxxxxxxxx
SPL01_0053_H09.b : nnggttgattggactaagacxxxxxxxxxxxxxxxxxxxx
MLN01_0054_C10.b : ggctagtgctatgacxxxxxxxxxxxxxxxxxxxxxx
OVR01_0017_H02.b : gcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0014_A03.b : nnnggatgaacaxxx
OVR01_0033_C06.b : aagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0053_G03.b : ttttatggtgcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0079_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0022_D08.b : nnaaacctatagcgnacgxxxxxxxxxxxxxx
CLNT1_0029_F02.b : cgtatttnnnnnnnacgtcgcgnacgaggxxxxxxx
LNG01_0065_F09.b : nnnaaaattnttcggggctggacttanacxxxxxxxxxxxxxx
DCI01_0042_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0019_G01.b : ttttgaggctttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0055_D06.b : tttttgggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0066_E07.b : nggatccgttagcgnacgxxxxxxxxxxx
MLTL1_0055_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0012_H10.b : tgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0033_E01.b : aggggacttttggatgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0004_F01.b : tttttccgttcagcgnacgxxxxxxxxxxxxxx
THY01_0066_D01.b : cattttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0202_A03.b : aggcattacgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0092_E02.b : gtgtggtttttcagcttcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0039_A03.b : cttttcgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0134_G03.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0156_B10.b : agtttgacxxxxxxxxxx
OVRM1_0120_B04.b : tagttgacxxxxxxxxxx
THY01_0108_F10.b : gttgcaaaaacax
TES01_0061_A07.b :
LVRM1_0090_E04.b : ttgacxxxxxxxxxx
OVRM1_0046_D12.b : cxxxxxxxxxxxxxxxxxxxxx
OVRM1_0214_F08.b : gagttgacxxxxxxxxxxx
THY01_0002_C06.b : ctcacaccccactcactagccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0180_E11.b : ttgtcxxxxxxxxxx
OVRM1_0181_E02.b : nagttgtcxxxxxxxxxx
LVRM1_0160_F02.b : nagtttgacxxxxxxxxxx
OVRM1_0134_H01.b : nagttgtcxxxxxxxxxxx
LVRM1_0071_A12.b : nagttgtcxxxxxxxxxxx
OVRM1_0152_D07.b : nagttgtcxxxxxxxxxx
LVRM1_0180_H10.b : ttgtcxxxxxxxxxx
THY01_0013_F11.b : gatxxx
OVRM1_0047_B02.b : atxxxxxxxxxxxxxxxxxxxx
OVR01_0103_B02.b : nttgcttggactataacxxxxxxxxxxxxxxxxxxxxx
THY01_0091_E07.b : tttttcgggaactaatataaxxxxxxxxxxxxxxxxxxxxx
UTR01_0002_F08.b : tttagggggactactagxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0120_D07.b : nagttgtcxxxxxxxxxx
OVRM1_0020_C06.b : xxxxxxxxxxxxxxxxxxxxx
OVRM1_0087_A06.b : agttgtcxxxxxxxxxx
THY01_0021_A04.b : atggcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0158_H09.b : nagttgacxxxxxxxxxx
OVRM1_0062_F09.b : nagttgacxxxxxxxxxx
OVRM1_0118_E12.b : nagttgacxxxxxxxxxx
OVRM1_0042_D12.b : gtcxxxxxxxxxx
LVRM1_0139_C09.b : nagttgacxxxxxxxxxx
OVRM1_0031_D05.b : cxxxxxxxxxxxxxxxxxxxxx
THY01_0047_D09.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0012_B08.b : cxxxxxxxxxxxxxxxxxxx
TES01_0089_C09.b :
UTR01_0001_E09.b : tttatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0045_B12.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0044_D01.b : ctttttggatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0026_F08.b : gggaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0051_E08.b : nnttgcttggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0008_E12.b : tggggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0018_A10.b :
ITT01_0079_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0085_D10.b : tgggacttagacxxxxxxxxxxxxxxxxxxxxx
OVR01_0072_F12.b : nnggcttggactatgacxxxxxxxxxxxxxxxxxxx
SMG01_0055_G11.b : nnccccttatttnnnggagtaagc
THY01_0036_G11.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0041_E11.b :
CLNT1_0075_C08.b : nnnccttctgcggacgagtgxxxxxxxxx
UTR01_0085_E10.b : nnnnggctaggacttaaacxxxxxxxxxxxxxxxxxxxxx
BFLT1_0113_F08.b : nnnnccgtcagcgnacgxxxxxxxxxxx
PBL01_0045_E08.b : nggtgaaacax
PBL01_0031_G01.b : ggtcaacaxx
SMG01_0070_A04.b : ncccgtattnnnnggagtxxxxxx
PBL01_0063_C05.b : nggtgaaacax
SPL01_0059_E06.b : nnnnggcttggacttacacxxxxxxxxxxxxxxxxxxxx
UTR01_0043_F04.b : gggtgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0026_E11.b : gggggaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0093_C04.b : nnccctaaannnnnggataagc
UTR01_0103_E11.b : nnggcttggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0098_A05.b : nnnnggctaggacttagacxxxxxxxxxxxxxxxxxxx
BFLT1_0029_F09.b : ncgttttnngggactccgttagcgnacgxxxxxxxxxxxx
UTR01_0106_D04.b : nnnnagctaggactatgacxxxxxxxxxxxxxxxxxxxxxxx
THY01_0202_E05.b : ctatatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0037_G08.b : nnccggttannnnnggactaagca
SPL01_0089_H09.b : ntttgctaggactatgacxxxxxxxxxxxxxxxxxxxxx
OVRT1_0124_B11.b : nnncctatagcgnaggxxxxxxxxxx
ITT01_0015_D01.b : ngataaacaxx
ITT01_0020_A02.b : ntagatgaacaxx
CLNT1_0113_C02.b : nnnnccgttagctgaggxxxxxxxxxxxx
MLN01_0019_D06.b : nggggttttcgggggataggatatgacagtttgtacxxxxxxxxx
MLN01_0085_C09.b : nggctaggactatgacxxxxxxxxxxxxxxxxxxx
ILNT1_0025_D03.b : nnnccaaagtagaxxx
TCH01_0004_H07.b : gtgttaggattaaacxxxxxxxxxxxxxxxxxxx
PBL01_0067_C02.b : nnnggatgaacax
PBL01_0057_E05.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_F10.b : tttttttgagcttggtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0048_E10.b : aaagcttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0040_A09.b : tgtttcctatagcgnacgagtgxxxxxxxx
PBL01_0069_A01.b : naagataaacaxxxxxx
SPLT1_0008_E11.b : nnnncgacagagagg
CLNT1_0090_F11.b : ggtatctnnnngcctccgtctgcgnacgagtgxxxxxxx
UTR01_0083_E08.b : nnttgcttggactataacxxxxxxxxxxxxxxxxxxxx
OVRT1_0077_E09.b : ngggtccttatagcgcacgxxxxxxxxxxxx
THY01_0080_G10.b : cccttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0071_H02.b : nnaatgaacax
PBL01_0081_E05.b : nnggatgaaca
CLNT1_0028_D02.b : gaaccgttagcgnacgxxxxxxxxxx
SPL01_0065_H11.b : ntttagctaggactaaaacxxxxxxxxxxxxxxxxxxxxx
SPL01_0092_G07.b : nnnggattggactatgacxxxxxxxxxxxxxxxxxxxx
BFLT1_0061_A02.b : nccctttttngggactccgtctgcgnacgagtgxxxxxxxx
LNG01_0016_F12.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0062_F12.b : nnnaagagaaacaxx
OVR01_0040_E02.b : gagcattatagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0091_A10.b : nggattacgttagcgnacgxxxxxxxxxxxx
OVRT1_0100_G12.b : nnttccgtcagcgnacgxxxxxxxxxxxx
ITT01_0083_D09.b : nnnggagtaacaxx
OVR01_0063_E01.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxx
MLN01_0069_G07.b : nnnttgataggactataacxxxxxxxxxxxxxxxxxxxx
SPL01_0058_B04.b : nnnnggcatggacttagacxxxxxxxxxxxxxxxxxxxxx
THY01_0205_A01.b : cctttttggtggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0034_A10.b : nnnnggataggatatgacxxxxxxxxxxxxxxxxxxxxxx
THY01_0039_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0091_H09.b : nnnggctaggacttaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0044_G08.b : cagaagctttggtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0053_C06.b : ttttnggcattggacttnacxxxxxxxxxxxxxxxxxxxxx
UTR01_0048_E05.b : cattacgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0067_H11.b : ntttgctaggactataacxxxxxxxxxxxxxxxxxxx
MLN01_0066_A09.b : nggacttggactatgacagtttgtacxxxxxxxxx
UTR01_0063_B08.b : gctcatttagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0049_E05.b : nnnnggcatggactatgacxxxxxxxxxxxxxxxxxxxx
OVR01_0007_F02.b : ggggggccctattttacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0202_H05.b : ggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0044_G08.b : gcattatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0076_D02.b : ggaatcgttagcgnacgxxxxxxxxxx
THY01_0203_A09.b : gcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0021_E06.b : nnttcccgttagcgnacgxxxxxxxxxxxx
OVRT1_0085_A02.b : nnnggtccccnnnnnnnccgttagcgttacgaggxxxxxxxxx
MLN01_0044_B12.b : nnnnggctaggactataacxxxxxxxxxxxxxxxxxxx
MLTL1_0083_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0093_D03.b : ggggcatgcacagcattaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0021_F12.b : nggttttnnngncctacgttagcgnacgagtgxxxxxxxxx
THY01_0072_H04.b : cttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0135_C04.b : cagtttgtcxxxxxxxxxx
LVRM1_0048_A07.b : cagttgacxxxxxxxxx
OVRM1_0027_F02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVR01_0075_A05.b : caxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0151_F05.b : agttgtcxxxxxxxxx
LVRM1_0187_F01.b : ttgtcxxxxxxxxx
THY01_0091_E09.b : attaaggtgaactaataaaxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0152_E11.b : agttgtcxxxxxxxxx
OVRM1_0224_E03.b : aagttgtcxxxxxxxxx
OVR01_0071_H11.b : tttggctaggacttaaacxxxxxxxxxxxxxxxxxx
OVRM1_0089_C11.b : agttgtcxxxxxxxxx
OVRM1_0015_B11.b : xxxxxxxxxxxxxxxxxx
SPL01_0017_A04.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0044_B05.b :
OVR01_0090_C03.b : gggcttggactatgacxxxxxxxxxxxxxxxxxxx
THY01_0013_G09.b : gcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0096_A12.b : nnnggcttggactataacxxxxxxxxxxxxxxxxxx
CLNT1_0108_E06.b : nnnnccgtcagcgnaggxxxxxxxxxxxx
THY01_0002_E12.b : gccaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0033_C06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BFLT1_0103_E04.b : nnnnccgttagcgnaggxxxxxxxxx
OVRT1_0006_A09.b : naaaccatctggctgcacgxxxxxxxxxx
SMG01_0074_F03.b : ataatatgagtaacax
PBL01_0045_F06.b : nggatgaaac
CLNT1_0147_H05.b : nntttcgtcagcgnacgxxxxxxxxxxx
CLNT1_0142_C03.b : nnnccgttagctgacgxxxxxxxxxx
BFLT1_0063_C12.b : tttcttcagcgnacgxxxxxxxxxxxx
PBL01_0044_E06.b : nggtgaaaca
MLN01_0004_D12.b : nntttggtaggacatgacagtttgtacxxxxxxxx
OVRT1_0001_H11.b : tttttcctatagcgnacgxxxxxxxxxxx
OVR01_0030_H11.b : aaacaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0076_B04.b : ttttggttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0061_G09.b : nnnnggatgaacax
OVRT1_0129_A05.b : nnnccgattccnnnnnnnccgttagcgnacgxxxxxxxxxxxx
OVRT1_0098_F08.b : nnnnccgtcagcgnacgxxxxxxxxxx
CLNT1_0029_A07.b : ntttccgtcagcgnaggxxxxxxxxxx
BKFL1_0014_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0111_G10.b : nttttccgttagcgnacgxxxxxxxxxxx
ITT01_0018_H07.b : nnnggatgaacax
PBL01_0030_G06.b : nnnnggagtaa
LNG01_0096_F11.b : nnntttgctggacttgnxxxxxxxxxxxxxxxxxx
MLN01_0041_F02.b : ttttggctaggacaagacxxxxxxxxxxxxxxxxxx
ITT01_0049_H04.b : nnttgatgaacax
OVRT1_0059_A05.b : nccgtttnnnnnnnnnccgttagcgnacgagtgxxxxxxx
THY01_0062_C06.b : atgggggaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0045_D05.b : nnnnngctaggactaagacxxxxxxxxxxxxxxxxxx
THY01_0026_D05.b : gtggaactattagxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0084_C07.b : ncttactnnnnnggagtaag
PBL01_0010_D10.b : ngggtcaaannggataaa
OVRT1_0081_G08.b : nnnccgtcagcgnaggxxxxxxxxxx
CLNT1_0013_D09.b : ggatccgtcagcgnacgxxxxxxxxxx
PBL01_0016_G04.b : nnnnggactaaag
CLNT1_0067_G07.b : nnccccgttagcgnacgxxxxxxxxxxx
CLNT1_0132_A05.b : nnccccgttagcgnacgxxxxxxxxxxx
LNG01_0093_F11.b : nnttttgctggaaatgacxxxxxxxxxxxx
CLNT1_0150_D11.b : nnnnccgtcagcgnacgxxxxxxxxxx
PBL01_0064_H09.b : nggataaac
OVRT1_0073_F02.b : nnttgttnnnnnnnnnccgttagcgttacgaggxxxxxxx
ITT01_0015_F05.b : nnggatgaac
ITT01_0070_G03.b : nnnggatgaaca
ADR01_0069_F01.b : ngggtaaannnnggagtaa
CLNT1_0132_B02.b : nnnncctatagcgnacgxxxxxxxxxxxx
SPL01_0052_B10.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxx
PCT01_0020_C03.b :
ITT01_0006_B11.b : naaagatgaaca
OVR01_0052_H01.b : nnnttggcatggactatnacxxxxxxxxxxxxxxxxxxx
UTR01_0063_B10.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0047_D01.b : nnntagctaggactatnacxxxxxxxxxxxxxxxxxx
OVRT1_0069_G02.b : nnncctcaatagcgaacgxxxxxxxxxxx
ITT01_0006_E09.b : nnnggagtaacax
LNG01_0030_E11.b : ccccccgccccccctgattagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0031_F10.b : cgaggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0062_A09.b : nnnttcggggaaaggacatgacxxxxxxxxxxxx
LNG01_0102_B06.b : tttttnggctggaaatgaaagxxxxxxxxxxxxx
LNG01_0059_H02.b : ntttgggcatggatatgacxxxxxxxxxxxxxx
THY01_0023_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0021_C04.b : ccttatcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0046_A10.b : nnngatxxxxx
CLNT1_0074_D09.b : nntttcgttagctgtacgaggxxxxxx
LNG01_0017_F03.b : catttatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0017_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0026_G01.b : gggtccgttagcgnacgxxxxxxxxxx
OVRT1_0080_H08.b : ngggcttctattgcgcacgagtgxxxxx
TCH01_0086_C07.b : nnnggattggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0027_D07.b : ctttgggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0091_C02.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0057_A09.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxx
TCH01_0035_G02.b : nnggctaggactatgacxxxxxxxxxxxxxxxxxx
OVR01_0030_B11.b : agggcattaggctgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0056_E11.b : nggccaattnnttcggctaggacttgacxxxxxxxxxxxxxxxxxxxx
TCH01_0061_E07.b : nnnaagatagtactatnacxxxxxxxxxxxxxxxxx
UTR01_0094_D05.b : nnnnggctaggactataacxxxxxxxxxxxxxxxxxx
SPL01_0005_E04.b : ggactacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0071_H03.b : nccggtttnnnggggnnggctcagcgnacgxxxxxxxxxxx
OVR01_0007_C01.b : gggcaccatctagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0094_G03.b : gatacgttcgcgnacgxxxxxxxxxxx
THY01_0102_C11.b :
TES01_0099_F11.b :
OVRM1_0182_B02.b : nagttgtcxxxxxxxx
OVRM1_0113_F09.b : cagttgacxxxxxxxx
TES01_0037_H09.b :
TES01_0060_H07.b : nncctgcgctggctatggcttc
UTR01_0102_G01.b : nnnnggctaggactaanacxxxxxxxxxxxxxxxxx
THY01_0008_C12.b : ttatggaggcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_B10.b : ccaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0079_F09.b : agttgxxxxx
TES01_0053_D12.b :
OVR01_0095_F03.b : nnnccgcatggactatgacxxxxxxxxxxxxxxxxx
PCT01_0002_B09.b :
LNG01_0026_E10.b : caatttttaggtgagxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0012_H01.b : nnnttgcatgtactatnacxxxxxxxxxxxx
LNG01_0005_E12.b : ggtgtcccctgattcgtgaaxxxxxxxxxxxxxxxxxxxxx
LNG01_0013_B09.b : ctttttggtgaaxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0069_C12.b :
TES01_0073_F12.b :
SMG01_0026_B01.b : naagattaannnnagatcxx
ITT01_0057_D07.b : nnnggtga
TCH01_0093_C07.b : nnggctaggactaagacxxxxxxxxxxxxxxxx
OVRM1_0113_D10.b : cagttgacxxxxxxxx
OVR01_0015_A06.b : gctctttatgaggacttatagaatagtttggaaaaaaagctggg
DCI01_0008_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0086_E10.b :
MLTL1_0084_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttgctca
THY01_0043_B07.b : tag
ILNT1_0008_B06.b :
TCH01_0006_H11.b :
CBLT1_0038_E06.b :
TES01_0058_C03.b :
THY01_0002_E07.b :
20110601C-001062 : .....CTTACTTACTTTGCGGCAGCGCGGAGAGCCCCACCCCCTTTTCTCTGCG*GAATC
---------+---------+---------+---------+---------+---------+ 54
OVRT1_0067_C01.b : xxxxxCTTACTTACTTTGCGGCAGCGCAGAGAGCCCCACCCCCT*TTCTCTGCG*GAATC
OVRM1_0103_H09.b : xxxxxxxxxcTTACTTTGCGGCAGCGCGGAGAGCCCCACCCCCT*TTCTCTGCG*GAATC
ITT01_0058_E12.b : xxxxxxxxctTTACTTTGCGGCAGCGCGGAGAGCCCCACCCCCT*TTCTCTGCG*GAATC
LVR01_0082_A02.b : xxxxxxxxxxxTACTTTGCGGCAGCGCAGAGAGCCCCACCCCTT*TTCTCTGCG*GAATC
OVR01_0089_B03.b : xxxxxxxxxxxxxCTTTGCGGCAGCGCGGAGAGCCCCACCCCCT*TTCTCTGCG*GAATC
OVRT1_0108_E01.b : xxxxxxxxxxxxxCTTTGCGGCAGCGCAGAGAGCCCCACCCCCT*TTCTCTGCG*GAATC
OVR01_0018_A03.b : xxxxxxxxxxxxxCTTTGCGGCAGCGCGGAGAGCCCCACCCCCT*TTCTCTGCG*GAATC
TES01_0090_A05.b : tacgttggcactggaTTGCGGCAGCGCAGAGAGCCCCACCCCCT*TTCTCTGCG*GAATC
THY01_0055_B12.b : xxxxxxxxxxxxxcttcGCGGCAGCGCGGAGAGCCCCACCCCCT*TTCTCTGCG*GAATC
TES01_0081_G09.b : tgctacgttgctatggattgcggcacgcaaagaCCCCACCCCCT*TTCTCTGCG*GAATC
TES01_0017_E01.b : gTGGCTATGGCTTTTC*CTGCG*GA*TC
TES01_0022_F07.b : cgctgTGGCTATGGCTTTCTCTGCG*GA*TC
TES01_0028_A03.b : cgctgTGGCTATGGCTTTCTCTGCG*GA*TC
TES01_0022_F02.b : cgcgttgGCTACGGCTTTCTCTGCG*GA*TC
OVR01_0095_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttgttctTTTTTTTTTTCTCTGCG*GAATC
ITT01_0101_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTTTTCTTCTCTGCG*GAATC
OVRM1_0012_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctaCTGGCT*TTCTCTGCG*GAATC
OVRM1_0033_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGGGCTTTCTCTGCG*GAATC
OVR01_0086_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGCTTTTCTCTGCG*GAATC
THY01_0068_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggCTTTTTTTTCTCTGCG*GAATC
UTR01_0006_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGCCTTTCTCTGCG*GAATC
UTR01_0025_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTTTTCTCTGCG*GAATC
PBL01_0018_D02.b : ggacgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTT*TTCTCTGCG*GAATC
PBL01_0032_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTTTTTCTCTGCG*GAATC
TES01_0041_D12.b : tgtggctacTGGCCCTTTTCCTGCG*GAA*C
PBL01_0042_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTTT*TTCTCTGCG*GAATC
THY01_0059_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCCCTTTCTCTGCG*GAATC
ITT01_0058_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGCT*TTCTCTGCG*GAATC
OVRT1_0087_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggCCCCTT*TTCTCTGCG*GAATC
LNG01_0091_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTT*TTCTCTGCG*GAATC
SPL01_0055_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcctacTGGGCT*TTCTCTGCG*GAATC
THY01_0033_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGAT*TTCTCTGCG*GAATC
THY01_0072_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGCCCTTTTCTCTGCG*GAATC
TES01_0088_D11.b : tgcagtggctatGGCCTTTCCT**GCG*GA*TC
TES01_0072_A02.b : tttcccgcggtggctaTGGCCTTTTNCTGCG*GAATC
OVR01_0056_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTTTCTCTGCG*GAATC
OVRT1_0047_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTTTCTCTGCG*GAATC
ITT01_0076_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCCT*TTCTCTGCG*GAATC
OVR01_0060_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTT*TTCTCTGCG*GAATC
OVRT1_0022_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGGGCT*TTCTCTGCG*GAATC
PBL01_0028_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgagtggTGGCTTTTCTCTGCG*GAATT
OVRT1_0008_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCT*TTCTCTGCG*TAATC
UTR01_0063_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTTTCTCTGCG*GAATC
LVRM1_0167_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggGGCTTTTCTCTGCG*GAATC
OVRM1_0216_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTT*TTCTCTGCG*GAATC
LVRM1_0163_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTTCTCTGCG*GAATC
OVRM1_0082_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggGGCTTTTCTCTGCG*GAATC
OVRM1_0161_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggCTTTTTTCTCTGCG*GAATC
LVRM1_0111_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTTTCTCTGCG*GAATC
OVRM1_0194_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtactGGCTTTTCTCTGCG*GAATC
OVRM1_0059_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCCTTTCTCTGCG*GAATC
OVRM1_0123_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTTTCTCTGCG*GAATC
OVR01_0101_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTTCTCTGCG*GAATC
CBLT1_0041_G12.b : gtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCCCTTTTCTCCGCT*GAATC
OVRM1_0168_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGGCTTTTCTCTGCG*GAATC
OVRM1_0028_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCCTTTCTCTGCG*GAATC
SMG01_0016_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCCTTTCTCTGCG*GAATC
DCI01_0022_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTTCTCTGCG*GAATC
THY01_0041_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTTCTCTGCG*GAATC
OVR01_0062_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTTCTCTGCG*GAATC
SPL01_0058_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtactCCCTTTTCTCTGCG*GAATC
OVR01_0025_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTTCTCTGCG*GAATC
SMG01_0066_E07.b : cggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTTCTCTGCG*GAATC
BMWN1_0007_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCCTTTCTCTGCG*GAATC
THY01_0097_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTTCTCTGCG*GAATC
BMWN1_0090_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCCTTTCTCTGCG*GAATC
OVRT1_0004_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTTTCTCTGCG*GAATC
CLNT1_0015_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTTCTCTGCG*GAATC
THY01_0086_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTTCTCTGCG*GAATC
TCH01_0033_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTTTTCTCTGCG*GAATC
OVRT1_0010_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTTTCTCTGCG*GAATC
UTR01_0081_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTTCTCTGCG*GAATC
SPL01_0051_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTTCTCTGCG*GAATC
CLNT1_0015_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTTCTCTGCG*GAATC
DCI01_0074_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCCTTTCTCTGCG*GAATC
TES01_0062_D08.b : ntcgcgtggctatACCTTTCTCTGCG*GA*TC
THY01_0115_E09.b : cagctggtacggtcggaattctcagcactgttggctactggCCCTTTCTCTGCG*GAAT*
OVRM1_0215_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggaCTTTTTCTCTGCG*GAATC
THY01_0103_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgtGCTTTTCTCTGCG*GAATC
SMG01_0082_A10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTTTTCTCTGCG*GAATC
OVR01_0104_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCCCTGCG*GAATC
HTMT1_0057_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTTTTCTCTGCG*GAATC
LVRM1_0194_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
OVR01_0076_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
LVRM1_0199_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
OVRM1_0075_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
OVRM1_0222_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
THY01_0081_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
OVRM1_0222_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
LVRM1_0104_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
OVR01_0071_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTTCTCTGCG*GAATC
OVR01_0093_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
LVR01_0037_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTTCTCTGCG*GAATC
OVR01_0070_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtggtTCTTTTCTCTGCG*GAATC
OVRM1_0047_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
THY01_0010_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
UTR01_0013_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTTTCTCTGCG*GAATC
OVRM1_0031_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
OVRT1_0036_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
DCI01_0012_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
THY01_0045_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
OVR01_0042_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccgtaaactGCTTTTCTCTGCG*GAATC
SPLT1_0050_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTTTTCTCTGCG*CAATC
OVR01_0053_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
PBL01_0026_A10.b : ctggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
UTR01_0038_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTTCTCTGCG*GAATC
PBL01_0027_A08.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
CLNT1_0133_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
OVR01_0085_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTTCTCTGCG*GAATC
UTR01_0075_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTTTCTCTGCG*GAATC
OVRT1_0010_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcGGCTTTCTCTGCG*GAATC
THY01_0081_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
PBL01_0089_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
THY01_0094_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
PBL01_0061_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
PCT01_0003_C03.b : nnnttcttatannnnnnccagcgggtgcacggCCTTTTCCGC****GGATC
THY01_0033_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTTTCTCTGCG*GAATC
LNG01_0088_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
ITT01_0067_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
OVR01_0035_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
PBL01_0073_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
OVR01_0032_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTTCTCTGCG*GAATC
OVR01_0040_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
CLNT1_0027_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgTTTTTTCTCTGCG*GAATC
MLN01_0084_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
PST01_0042_B01.b : agacggttggcactggaaaaaaaaaaaaaaaaaaaaaaaaaCCTTTTCTCTGCG*GAATC
OVRT1_0098_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcGGCTTTCTCTGCG*GAATC
UTR01_0084_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTTCTCTGCG*GAATC
CLNT1_0150_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
SPL01_0053_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
MLN01_0054_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
OVR01_0017_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTTTCTCTGCG*GAATC
ITT01_0014_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
OVR01_0033_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
THY01_0053_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
MLTL1_0079_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
OVRT1_0022_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
CLNT1_0029_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
LNG01_0065_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
DCI01_0042_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
LNG01_0019_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCTTTCTCTGCG*GAATC
THY01_0055_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTTCTCTGCG*GAATC
BFLT1_0066_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
MLTL1_0055_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
OVR01_0012_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
OVR01_0033_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTTCTCTGCG*GAATC
OVRT1_0004_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
THY01_0066_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
THY01_0202_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTCTCTGCG*GAATC
THY01_0092_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
THY01_0039_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTCTCTGCG*GAATC
LVRM1_0134_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxtatcttcaaatgaaaCTTTTCTCTGCG*GAATC
OVRM1_0156_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVRM1_0120_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
THY01_0108_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTCTCTGCG*GAATC
TES01_0061_A07.b : ttttcctgcgtggccacggcCTTTTTCCTGCG*G*ATC
LVRM1_0090_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVRM1_0046_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVRM1_0214_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
THY01_0002_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAA*C
LVRM1_0180_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVRM1_0181_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
LVRM1_0160_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVRM1_0134_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
LVRM1_0071_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVRM1_0152_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
LVRM1_0180_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
THY01_0013_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVRM1_0047_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVR01_0103_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
THY01_0091_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
UTR01_0002_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVRM1_0120_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVRM1_0020_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVRM1_0087_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCTCTGCG*GAATC
THY01_0021_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
LVRM1_0158_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVRM1_0062_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVRM1_0118_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCTCTGCG*GAATC
OVRM1_0042_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
LVRM1_0139_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVRM1_0031_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCTCTGCG*GAATC
THY01_0047_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVRM1_0012_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTACTCTGCG*GAATC
TES01_0089_C09.b : nncctcacgtggctatGGCTTTTCCTCG*GAATC
UTR01_0001_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
THY01_0045_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
THY01_0044_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
UTR01_0026_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVR01_0051_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
SPL01_0008_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
TES01_0018_A10.b : ctgtggctacGCTTTTCCTGCG*GAATC
ITT01_0079_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCTCTGCG*AAATC
MLN01_0085_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVR01_0072_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
SMG01_0055_G11.b : agcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCTCTGCG*GAATC
THY01_0036_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
TES01_0041_E11.b : ttggctatggtatggCCTTTCTCTGCG*GAA*C
CLNT1_0075_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCTCTGCG*GAATC
UTR01_0085_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
BFLT1_0113_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCTCTGCG*GAATC
PBL01_0045_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCTCTGCG*GAATC
PBL01_0031_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
SMG01_0070_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
PBL01_0063_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCTCTGCG*GAATC
SPL01_0059_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
UTR01_0043_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
THY01_0026_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
ADR01_0093_C04.b : ggcggnaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
UTR01_0103_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
SPL01_0098_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
BFLT1_0029_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
UTR01_0106_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctGCTTTCTCTGCG*GAATC
THY01_0202_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
SMG01_0037_G08.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCTCTGCG*GAATC
SPL01_0089_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVRT1_0124_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcGCTTTCTCTGCG*GAATC
ITT01_0015_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCTCTGCC*GATTC
ITT01_0020_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
CLNT1_0113_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCTCTGCG*GAATC
MLN01_0019_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
MLN01_0085_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
ILNT1_0025_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCTCTGCG*GAATC
TCH01_0004_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTTCTCTGCG*GAATC
PBL01_0067_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
PBL01_0057_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTTTCTCTGCG*GAATC
LVR01_0044_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVR01_0048_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
CLNT1_0040_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
PBL01_0069_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
SPLT1_0008_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTTTCTCTGCG*GAATC
CLNT1_0090_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
UTR01_0083_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVRT1_0077_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
THY01_0080_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
ITT01_0071_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
PBL01_0081_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCTCTGCG*GAATC
CLNT1_0028_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTTCTCTGCG*GAATC
SPL01_0065_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
SPL01_0092_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
BFLT1_0061_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
LNG01_0016_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCTCTGCG*GAATC
ITT01_0062_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVR01_0040_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccctttaactggTTTTTCTCTGCG*GAATC
OVRT1_0091_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVRT1_0100_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCTCTGCG*GAATC
ITT01_0083_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVR01_0063_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
MLN01_0069_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
SPL01_0058_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
THY01_0205_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
MLN01_0034_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
THY01_0039_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
TCH01_0091_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVR01_0044_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVR01_0053_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
UTR01_0048_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCTCTGCG*GAATC
MLN01_0067_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
MLN01_0066_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCTCTGCG*GAATC
UTR01_0063_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
OVR01_0049_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTTCTCTGCG*GAATC
OVR01_0007_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
THY01_0202_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
LNG01_0044_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcGCTTTCTCTGCG*GAATC
BFLT1_0076_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxactgTCTTTCTCTGCG*GAATC
THY01_0203_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
CLNT1_0021_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTCTCTGCG*GAATC
OVRT1_0085_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
MLN01_0044_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
MLTL1_0083_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
THY01_0093_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
CLNT1_0021_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
THY01_0072_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTCTCTGCG*GAATC
LVRM1_0135_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCTTTCTCTGCG*GAATC
LVRM1_0048_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
OVRM1_0027_F02.b : nnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
OVR01_0075_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
OVRM1_0151_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
LVRM1_0187_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
THY01_0091_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
OVRM1_0152_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
OVRM1_0224_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
OVR01_0071_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
OVRM1_0089_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
OVRM1_0015_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
SPL01_0017_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
TES01_0044_B05.b : gacgtggctacgCTTTTCCTGCG*GAATC
OVR01_0090_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
THY01_0013_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTCTCTGCG*GAATC
UTR01_0096_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
CLNT1_0108_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
THY01_0002_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
UTR01_0033_C06.b : nnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxgTTTTCTCTGCG*GAATC
BFLT1_0103_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
OVRT1_0006_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
SMG01_0074_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
PBL01_0045_F06.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
CLNT1_0147_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgtCTTTCTCTGCG*GAATC
CLNT1_0142_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
BFLT1_0063_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTCTCTGCG*GAATC
PBL01_0044_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
MLN01_0004_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
OVRT1_0001_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
OVR01_0030_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
UTR01_0076_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
ITT01_0061_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
OVRT1_0129_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
OVRT1_0098_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
CLNT1_0029_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
BKFL1_0014_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
OVRT1_0111_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
ITT01_0018_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
PBL01_0030_G06.b : caxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
LNG01_0096_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
MLN01_0041_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
ITT01_0049_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
OVRT1_0059_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
THY01_0062_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
MLN01_0045_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
THY01_0026_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
SMG01_0084_C07.b : cagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
PBL01_0010_D10.b : cagctggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
OVRT1_0081_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
CLNT1_0013_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
PBL01_0016_G04.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
CLNT1_0067_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
CLNT1_0132_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
LNG01_0093_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
CLNT1_0150_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
PBL01_0064_H09.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
OVRT1_0073_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
ITT01_0015_F05.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GACTT
ITT01_0070_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
ADR01_0069_F01.b : cagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
CLNT1_0132_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
SPL01_0052_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
PCT01_0020_C03.b : nngggagatatttntnnngcagacgttgtgcacgtgCTTTCTCTGCG***AAT
ITT01_0006_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
OVR01_0052_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
UTR01_0063_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
SPL01_0047_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
OVRT1_0069_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
ITT01_0006_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
LNG01_0030_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtcgagtgaTTTTCTCTGCG*GAATC
OVR01_0031_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
LNG01_0062_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
LNG01_0102_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
LNG01_0059_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
THY01_0023_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
LNG01_0021_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
PBL01_0046_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
CLNT1_0074_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
LNG01_0017_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
LNG01_0017_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
CLNT1_0026_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
OVRT1_0080_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaaCTTTCTCTGCG*GAATC
TCH01_0086_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtcggccttgttCTTTCTCTGCG*GAATC
THY01_0027_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTCTCTGCG*GAATC
THY01_0091_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
TCH01_0057_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
TCH01_0035_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
OVR01_0030_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
LNG01_0056_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
TCH01_0061_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
UTR01_0094_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
SPL01_0005_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
CLNT1_0071_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
OVR01_0007_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
BFLT1_0094_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCTGCG*GAATC
THY01_0102_C11.b : cggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTCTCTGCG*GAATC
TES01_0099_F11.b : nttcccacgtggctctGCTTTCCGCG*GAA*C
OVRM1_0182_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCTCTGCG*GAATC
OVRM1_0113_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggTTTCTCTGCG*GAATC
TES01_0037_H09.b : ggcgttgcacgGCTTTCCGCG*G*ATC
TES01_0060_H07.b : ctccctgacggctactttgcggcagcgcggagagccccacccccTTTCTCTGCG*GAATC
UTR01_0102_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCTCTGCG*GAATC
THY01_0008_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCTCTGCG*GAATC
LVR01_0016_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCTCTGCG*GAATC
LVRM1_0079_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCTCTGCG*GAATC
TES01_0053_D12.b : tatcacgtggcacggggTTCTCTGCG*G*ATC
OVR01_0095_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCTCTGCG*GAATC
PCT01_0002_B09.b : nnnccgctaannnnnncctgcgggtgcaGGCTTTCCGCGGATC
LNG01_0026_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctgTTCTCTGCG*GAATC
TCH01_0012_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCTCTGCG*GAATC
LNG01_0005_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCTCTGCG*GAATA
LNG01_0013_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCTCTGCG*GAATC
TES01_0069_C12.b : ttttgcagattgtgcacggcTTTCCGCG*GAATC
TES01_0073_F12.b : ctgtggctatgGCTCTGCG*GAATC
SMG01_0026_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTCTCTGCG*GAATC
ITT01_0057_D07.b : aacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCTGCG*GAATC
TCH01_0093_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTCTCTGCG*GAATC
OVRM1_0113_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggCTGCG*GAATC
OVR01_0015_A06.b : acggaaccggtccgggatttcctcgagcaccttcggcctcccggctttctccgGCGGTTC
DCI01_0008_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAATC
TES01_0086_E10.b : nntataacggtggctatgga
MLTL1_0084_E05.b : ggggagtcattttctgatagcatttaggactgggacccttctggtcattaacgttttccc
THY01_0043_B07.b : gggaaacttaatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0008_B06.b : nnnnnggcgagtagaxxxxxxxxxxxxxxxxxx
TCH01_0006_H11.b : ggttgtgataagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0038_E06.b : ttttccacagtacgaxxxxxxxxxxxxxxxx
TES01_0058_C03.b :
THY01_0002_E07.b : gatxxxxx
20110601C-001062 : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
---------+---------+---------+---------+---------+---------+ 111
OVRT1_0067_C01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0103_H09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ITT01_0058_E12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LVR01_0082_A02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0089_B03.b : ACCAGGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0108_E01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0018_A03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCCTCAAAGCC
TES01_0090_A05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0055_B12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TES01_0081_G09.b : ACCATGC*CGGCCGGGACCCTGTTCACAT*ATCCTGAAAACTGGAG*GGCCCTCAAAGCC
TES01_0017_E01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TES01_0022_F07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TES01_0028_A03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TES01_0022_F02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0095_E12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ITT01_0101_D05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0012_F07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0033_G10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0086_B09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0068_D02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0006_B11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0025_B09.b : ACCATGGCCGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0018_D02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0032_G04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TES01_0041_D12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0042_E11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0059_B10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ITT01_0058_H04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0087_B10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LNG01_0091_D09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SPL01_0055_H05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0033_E04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0072_B03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCNAAGCC
TES01_0088_D11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TES01_0072_A02.b : *CCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0056_H01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0047_B06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ITT01_0076_B09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0060_A07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0022_G01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0028_H12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0008_C01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0063_G05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LVRM1_0167_B06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0216_A05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LVRM1_0163_E05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0082_D01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0161_H11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LVRM1_0111_A10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0194_A02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0059_D07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0123_B12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0101_A05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CBLT1_0041_G12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0168_D11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0028_A06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SMG01_0016_E08.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
DCI01_0022_G09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0041_G01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0062_H06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SPL01_0058_E03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0025_D12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SMG01_0066_E07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
BMWN1_0007_F06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0097_B10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
BMWN1_0090_A06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0004_B03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0015_B05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0086_C02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TCH01_0033_E12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0010_B03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0081_C04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SPL01_0051_C05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0015_E03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
DCI01_0074_E02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TES01_0062_D08.b : ACCATGG*CGGCCGGGGCCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0115_E09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0215_E08.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0103_G08.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SMG01_0082_A10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0104_G12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
HTMT1_0057_H02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LVRM1_0194_G06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0076_B11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LVRM1_0199_D03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0075_H06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0222_E02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0081_D12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGGC
OVRM1_0222_E12.b : ACCATGG*CGACCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LVRM1_0104_D05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0071_D11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0093_C11.b : ACCATGG*CCGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LVR01_0037_B05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0070_F12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAGAACTGGAG*GGCCTTCAAAGCC
OVRM1_0047_C06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0010_D01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0013_H08.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0031_G10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0036_D08.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
DCI01_0012_F12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0045_C09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0042_C09.b : ACCATGG*CGGCCGGCCATCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SPLT1_0050_G02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTCGAG*GGCCTTCAAAGCC
OVR01_0053_E07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0026_A10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0038_C06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0027_A08.b : *CCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0133_H04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0085_C09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0075_H06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0010_C05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0081_C11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0089_B03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0094_H11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0061_D06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PCT01_0003_C03.b : ACCATGG*CGGCCGGGACCCTGTAC*CAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0033_E02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LNG01_0088_D05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ITT01_0067_D01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0035_D09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0073_F07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0032_H04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0040_F01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0027_H07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
MLN01_0084_F04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PST01_0042_B01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0098_A10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0084_C10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0150_C11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SPL01_0053_H09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
MLN01_0054_C10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0017_H02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ITT01_0014_A03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0033_C06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0053_G03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
MLTL1_0079_F11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0022_D08.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0029_F02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LNG01_0065_F09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
DCI01_0042_F02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LNG01_0019_G01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0055_D06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
BFLT1_0066_E07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
MLTL1_0055_E02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0012_H10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0033_E01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0004_F01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0066_D01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0202_A03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0092_E02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0039_A03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LVRM1_0134_G03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0156_B10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0120_B04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0108_F10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TES01_0061_A07.b : ACCATGG*CGGCCGGGACCCTGTA*ACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LVRM1_0090_E04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0046_D12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0214_F08.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0002_C06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LVRM1_0180_E11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0181_E02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LVRM1_0160_F02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0134_H01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LVRM1_0071_A12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0152_D07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LVRM1_0180_H10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0013_F11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0047_B02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0103_B02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0091_E07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0002_F08.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0120_D07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0020_C06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0087_A06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0021_A04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LVRM1_0158_H09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0062_F09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0118_E12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0042_D12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LVRM1_0139_C09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0031_D05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0047_D09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0012_B08.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TES01_0089_C09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0001_E09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0045_B12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0044_D01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0026_F08.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0051_E08.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SPL01_0008_E12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TES01_0018_A10.b : ACCATGG*CGGCCGGGACCCTGTA*ACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ITT01_0079_B09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
MLN01_0085_D10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0072_F12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SMG01_0055_G11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0036_G11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TES01_0041_E11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0075_C08.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0085_E10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
BFLT1_0113_F08.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0045_E08.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0031_G01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SMG01_0070_A04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0063_C05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SPL01_0059_E06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0043_F04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0026_E11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ADR01_0093_C04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0103_E11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SPL01_0098_A05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
BFLT1_0029_F09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0106_D04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0202_E05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SMG01_0037_G08.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATTCTGAAAACTGGAG*GGCCTTCAAAGCC
SPL01_0089_H09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0124_B11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ITT01_0015_D01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ITT01_0020_A02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0113_C02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
MLN01_0019_D06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
MLN01_0085_C09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ILNT1_0025_D03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TCH01_0004_H07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0067_C02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0057_E05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LVR01_0044_F10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0048_E10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0040_A09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0069_A01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SPLT1_0008_E11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0090_F11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0083_E08.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0077_E09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0080_G10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ITT01_0071_H02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0081_E05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0028_D02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SPL01_0065_H11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SPL01_0092_G07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
BFLT1_0061_A02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LNG01_0016_F12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ITT01_0062_F12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0040_E02.b : ACCATGG*CGGCCGGCATCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0091_A10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0100_G12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ITT01_0083_D09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATTCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0063_E01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
MLN01_0069_G07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SPL01_0058_B04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0205_A01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
MLN01_0034_A10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0039_E09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TCH01_0091_H09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0044_G08.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0053_C06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0048_E05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
MLN01_0067_H11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
MLN01_0066_A09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0063_B08.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0049_E05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0007_F02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0202_H05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LNG01_0044_G08.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
BFLT1_0076_D02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0203_A09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0021_E06.b : ACCATGG*CGGCCGGGACTCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0085_A02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
MLN01_0044_B12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
MLTL1_0083_H11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0093_D03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0021_F12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0072_H04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LVRM1_0135_C04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LVRM1_0048_A07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0027_F02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0075_A05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0151_F05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LVRM1_0187_F01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0091_E09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0152_E11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAGAACTGGAG*GGCCTTCAAAGCC
OVRM1_0224_E03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0071_H11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0089_C11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0015_B11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SPL01_0017_A04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TES01_0044_B05.b : *CCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAGAGGCCTTCAAAGCC
OVR01_0090_C03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0013_G09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0096_A12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0108_E06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0002_E12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0033_C06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
BFLT1_0103_E04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0006_A09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SMG01_0074_F03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0045_F06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0147_H05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0142_C03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
BFLT1_0063_C12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0044_E06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
MLN01_0004_D12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0001_H11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0030_H11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0076_B04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ITT01_0061_G09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0129_A05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0098_F08.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0029_A07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
BKFL1_0014_F05.b : ACCATGG*CGGCCTGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0111_G10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ITT01_0018_H07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0030_G06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LNG01_0096_F11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
MLN01_0041_F02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ITT01_0049_H04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0059_A05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0062_C06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
MLN01_0045_D05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0026_D05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SMG01_0084_C07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0010_D10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0081_G08.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0013_D09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0016_G04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0067_G07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0132_A05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LNG01_0093_F11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0150_D11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0064_H09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0073_F02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ITT01_0015_F05.b : *CCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ITT01_0070_G03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ADR01_0069_F01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0132_B02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SPL01_0052_B10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PCT01_0020_C03.b : CCCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ITT01_0006_B11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0052_H01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0063_B10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SPL01_0047_D01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0069_G02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ITT01_0006_E09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LNG01_0030_E11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0031_F10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LNG01_0062_A09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LNG01_0102_B06.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LNG01_0059_H02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0023_C07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LNG01_0021_C04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PBL01_0046_A10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0074_D09.b : ACCATGG*CGGCCGGGACCCCGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LNG01_0017_F03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LNG01_0017_D05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0026_G01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRT1_0080_H08.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TCH01_0086_C07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0027_D07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0091_C02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TCH01_0057_A09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TCH01_0035_G02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0030_B11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LNG01_0056_E11.b : ACCATGG*CGGCCGGGACCCCGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TCH01_0061_E07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0094_D05.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SPL01_0005_E04.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CLNT1_0071_H03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0007_C01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
BFLT1_0094_G03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0102_C11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TES01_0099_F11.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0182_B02.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGTAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0113_F09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TES01_0037_H09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TES01_0060_H07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
UTR01_0102_G01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0008_C12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LVR01_0016_B10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LVRM1_0079_F09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TES01_0053_D12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0095_F03.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
PCT01_0002_B09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LNG01_0026_E10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TCH01_0012_H01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LNG01_0005_E12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
LNG01_0013_B09.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TES01_0069_C12.b : ACCATGG*CGGCCGGGACCCTGTATACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TES01_0073_F12.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
SMG01_0026_B01.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ITT01_0057_D07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TCH01_0093_C07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVRM1_0113_D10.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
OVR01_0015_A06.b : ACCACGG*CGGCCGGGACCCCGTACACATCATCCCGAAAACCGGGTGGGCCTTCAAAGCC
DCI01_0008_H07.b : ACCATGG*CGGCCGGGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TES01_0086_E10.b : CACATGG*CGGCCGGGACCCTGTA*ACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
MLTL1_0084_E05.b : catcttctccctgcaGACCCTGTACACAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
THY01_0043_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxggCAT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
ILNT1_0008_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
TCH01_0006_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxT*ATCCTGAAAACTGGAG*GGCCTTCAAAGCC
CBLT1_0038_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATCCTGAAAACTGCAT*TGCCTTCAAAGCC
TES01_0058_C03.b : ntcgcgttggctactggctgAACTGGAG*GGCCTTCA*AGCC
THY01_0002_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGAG*GGCCTTCAAAGCC
20110601C-001062 : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
---------+---------+---------+---------+---------+---------+ 171
OVRT1_0067_C01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0103_H09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
ITT01_0058_E12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LVR01_0082_A02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0089_B03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0108_E01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0018_A03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0090_A05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0055_B12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0081_G09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0017_E01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0022_F07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0028_A03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0022_F02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0095_E12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
ITT01_0101_D05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0012_F07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0033_G10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0086_B09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0068_D02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
UTR01_0006_B11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
UTR01_0025_B09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0018_D02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0032_G04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0041_D12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0042_E11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0059_B10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
ITT01_0058_H04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0087_B10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LNG01_0091_D09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SPL01_0055_H05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0033_E04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0072_B03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0088_D11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0072_A02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0056_H01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0047_B06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
ITT01_0076_B09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0060_A07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0022_G01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0028_H12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0008_C01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
UTR01_0063_G05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LVRM1_0167_B06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0216_A05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LVRM1_0163_E05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0082_D01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0161_H11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LVRM1_0111_A10.b : CTCATTGCCGCTCAGTACGGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0194_A02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0059_D07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0123_B12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0101_A05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CBLT1_0041_G12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0168_D11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTGCGCACCACCCCACTTC
OVRM1_0028_A06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SMG01_0016_E08.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
DCI01_0022_G09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0041_G01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0062_H06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SPL01_0058_E03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0025_D12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SMG01_0066_E07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
BMWN1_0007_F06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0097_B10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
BMWN1_0090_A06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0004_B03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0015_B05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0086_C02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TCH01_0033_E12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0010_B03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
UTR01_0081_C04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTACGCACCACCCCACTTC
SPL01_0051_C05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0015_E03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
DCI01_0074_E02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0062_D08.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0115_E09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTTCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0215_E08.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0103_G08.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SMG01_0082_A10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0104_G12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
HTMT1_0057_H02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LVRM1_0194_G06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0076_B11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LVRM1_0199_D03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0075_H06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0222_E02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0081_D12.b : CTCATTGCCGCTCACTACAGCGGGACTCAGGTCCGCGTGCTCTCGGCACCACCCCACTTC
OVRM1_0222_E12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LVRM1_0104_D05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0071_D11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0093_C11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LVR01_0037_B05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0070_F12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0047_C06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0010_D01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
UTR01_0013_H08.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0031_G10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0036_D08.b : CTCATTGCCGCTCAGTATAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
DCI01_0012_F12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0045_C09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0042_C09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SPLT1_0050_G02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0053_E07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0026_A10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
UTR01_0038_C06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0027_A08.b : CTCATCGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0133_H04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0085_C09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
UTR01_0075_H06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0010_C05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0081_C11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0089_B03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0094_H11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0061_D06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PCT01_0003_C03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0033_E02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LNG01_0088_D05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
ITT01_0067_D01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0035_D09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0073_F07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0032_H04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0040_F01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0027_H07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
MLN01_0084_F04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PST01_0042_B01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTCC
OVRT1_0098_A10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
UTR01_0084_C10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0150_C11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SPL01_0053_H09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
MLN01_0054_C10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0017_H02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
ITT01_0014_A03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0033_C06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0053_G03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
MLTL1_0079_F11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCACGTGCTCTCCGCACCACCCCACTTC
OVRT1_0022_D08.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0029_F02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LNG01_0065_F09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
DCI01_0042_F02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LNG01_0019_G01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0055_D06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
BFLT1_0066_E07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
MLTL1_0055_E02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTTCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0012_H10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0033_E01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0004_F01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0066_D01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0202_A03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0092_E02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0039_A03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LVRM1_0134_G03.b : CTCATTGCCGCTCAGTATAGCGGGGCTCAGTTCCGtttgtcctcttctccctccctcttc
OVRM1_0156_B10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0120_B04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0108_F10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0061_A07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LVRM1_0090_E04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0046_D12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0214_F08.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0002_C06.b : CTCATTGCCGCTCAGCACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LVRM1_0180_E11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0181_E02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LVRM1_0160_F02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0134_H01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LVRM1_0071_A12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0152_D07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LVRM1_0180_H10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0013_F11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0047_B02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0103_B02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0091_E07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
UTR01_0002_F08.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0120_D07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0020_C06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0087_A06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0021_A04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LVRM1_0158_H09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0062_F09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0118_E12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0042_D12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LVRM1_0139_C09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0031_D05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0047_D09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0012_B08.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0089_C09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
UTR01_0001_E09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0045_B12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0044_D01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
UTR01_0026_F08.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0051_E08.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SPL01_0008_E12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0018_A10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCGCCCCACTTC
ITT01_0079_B09.b : CTCATTGCCGCTCATTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCATTTC
MLN01_0085_D10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0072_F12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SMG01_0055_G11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0036_G11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0041_E11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0075_C08.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
UTR01_0085_E10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
BFLT1_0113_F08.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0045_E08.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0031_G01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SMG01_0070_A04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0063_C05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SPL01_0059_E06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
UTR01_0043_F04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0026_E11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
ADR01_0093_C04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGAGCTCTCCGCACCACCCCACTTC
UTR01_0103_E11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SPL01_0098_A05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
BFLT1_0029_F09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
UTR01_0106_D04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0202_E05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SMG01_0037_G08.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SPL01_0089_H09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0124_B11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCATCACCCCACTTC
ITT01_0015_D01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
ITT01_0020_A02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0113_C02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
MLN01_0019_D06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
MLN01_0085_C09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
ILNT1_0025_D03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TCH01_0004_H07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0067_C02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0057_E05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LVR01_0044_F10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0048_E10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0040_A09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0069_A01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SPLT1_0008_E11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0090_F11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
UTR01_0083_E08.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0077_E09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0080_G10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
ITT01_0071_H02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0081_E05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0028_D02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SPL01_0065_H11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SPL01_0092_G07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
BFLT1_0061_A02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LNG01_0016_F12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
ITT01_0062_F12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0040_E02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0091_A10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0100_G12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
ITT01_0083_D09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0063_E01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
MLN01_0069_G07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SPL01_0058_B04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0205_A01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
MLN01_0034_A10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0039_E09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TCH01_0091_H09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0044_G08.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0053_C06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
UTR01_0048_E05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
MLN01_0067_H11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
MLN01_0066_A09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
UTR01_0063_B08.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0049_E05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0007_F02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0202_H05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LNG01_0044_G08.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
BFLT1_0076_D02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0203_A09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0021_E06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0085_A02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
MLN01_0044_B12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
MLTL1_0083_H11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCGCTTC
THY01_0093_D03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0021_F12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0072_H04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LVRM1_0135_C04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LVRM1_0048_A07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACCTC
OVRM1_0027_F02.b : CTCATTGACGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0075_A05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0151_F05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LVRM1_0187_F01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0091_E09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0152_E11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0224_E03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0071_H11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0089_C11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0015_B11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SPL01_0017_A04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0044_B05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0090_C03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0013_G09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
UTR01_0096_A12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0108_E06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0002_E12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
UTR01_0033_C06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCATGTCCGCGTGCTCTCCGCACCACCCCACTTC
BFLT1_0103_E04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0006_A09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SMG01_0074_F03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0045_F06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0147_H05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0142_C03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
BFLT1_0063_C12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0044_E06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
MLN01_0004_D12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0001_H11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0030_H11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCCCCGCACCACCCCACTTC
UTR01_0076_B04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
ITT01_0061_G09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0129_A05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0098_F08.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0029_A07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
BKFL1_0014_F05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0111_G10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
ITT01_0018_H07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0030_G06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LNG01_0096_F11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
MLN01_0041_F02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
ITT01_0049_H04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0059_A05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCATCCCACTTC
THY01_0062_C06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
MLN01_0045_D05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0026_D05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SMG01_0084_C07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0010_D10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0081_G08.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0013_D09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0016_G04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0067_G07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0132_A05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LNG01_0093_F11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0150_D11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0064_H09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0073_F02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
ITT01_0015_F05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
ITT01_0070_G03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
ADR01_0069_F01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0132_B02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTTCGCGTGCTCTCCGCACCACCCCACTTC
SPL01_0052_B10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PCT01_0020_C03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
ITT01_0006_B11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0052_H01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
UTR01_0063_B10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SPL01_0047_D01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0069_G02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
ITT01_0006_E09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LNG01_0030_E11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0031_F10.b : CTCATCGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LNG01_0062_A09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LNG01_0102_B06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LNG01_0059_H02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0023_C07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LNG01_0021_C04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PBL01_0046_A10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CLNT1_0074_D09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LNG01_0017_F03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LNG01_0017_D05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGGGCTCTCCGCACCACCCCACTTC
CLNT1_0026_G01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRT1_0080_H08.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TCH01_0086_C07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0027_D07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0091_C02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TCH01_0057_A09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TCH01_0035_G02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0030_B11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LNG01_0056_E11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TCH01_0061_E07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
UTR01_0094_D05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SPL01_0005_E04.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACCTC
CLNT1_0071_H03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0007_C01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACCTC
BFLT1_0094_G03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0102_C11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0099_F11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0182_B02.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0113_F09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0037_H09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0060_H07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCACACTTC
UTR01_0102_G01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0008_C12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LVR01_0016_B10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LVRM1_0079_F09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0053_D12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0095_F03.b : CTCATTGCCGCTCGGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
PCT01_0002_B09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LNG01_0026_E10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TCH01_0012_H01.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LNG01_0005_E12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
LNG01_0013_B09.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0069_C12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0073_F12.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
SMG01_0026_B01.b : CTCATTGCCGCTCAGTACAGCGGGACTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
ITT01_0057_D07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TCH01_0093_C07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVRM1_0113_D10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
OVR01_0015_A06.b : CTCATCGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
DCI01_0008_H07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0086_E10.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
MLTL1_0084_E05.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0043_B07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
ILNT1_0008_B06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TCH01_0006_H11.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
CBLT1_0038_E06.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
TES01_0058_C03.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
THY01_0002_E07.b : CTCATTGCCGCTCAGTACAGCGGGGCTCAGGTCCGCGTGCTCTCCGCACCACCCCACTTC
20110601C-001062 : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
---------+---------+---------+---------+---------+---------+ 229
OVRT1_0067_C01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0103_H09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ITT01_0058_E12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LVR01_0082_A02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0089_B03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0108_E01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0018_A03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TES01_0090_A05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0055_B12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TES01_0081_G09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TES01_0017_E01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TES01_0022_F07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TES01_0028_A03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TES01_0022_F02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0095_E12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATT*CCT*GCCGGTAAGG
ITT01_0101_D05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0012_F07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0033_G10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0086_B09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0068_D02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0006_B11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0025_B09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTACCT*GCCGGTAAGG
PBL01_0018_D02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PBL01_0032_G04.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TES01_0041_D12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PBL01_0042_E11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0059_B10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ITT01_0058_H04.b : CATTCT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0087_B10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LNG01_0091_D09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SPL01_0055_H05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0033_E04.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0072_B03.b : CATTTT*GGGCAAACCAACCACACCCCCCGATTTCTCCGTAAATTTTCT*GCCGGTAAGG
TES01_0088_D11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TES01_0072_A02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0056_H01.b : CATTTT*GGCCAAACCAACCACACCCCCAAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0047_B06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ITT01_0076_B09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0060_A07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0022_G01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PBL01_0028_H12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0008_C01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0063_G05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LVRM1_0167_B06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0216_A05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LVRM1_0163_E05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0082_D01.b : CATTTT*GGCCAAACCAACCACACCCCCAAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0161_H11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTCCCT*GCCGGTAAGG
LVRM1_0111_A10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0194_A02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0059_D07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0123_B12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0101_A05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CBLT1_0041_G12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0168_D11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0028_A06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SMG01_0016_E08.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
DCI01_0022_G09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0041_G01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0062_H06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SPL01_0058_E03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0025_D12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SMG01_0066_E07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
BMWN1_0007_F06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0097_B10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
BMWN1_0090_A06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0004_B03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0015_B05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0086_C02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TCH01_0033_E12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0010_B03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0081_C04.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SPL01_0051_C05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0015_E03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
DCI01_0074_E02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TES01_0062_D08.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0115_E09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0215_E08.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0103_G08.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SMG01_0082_A10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0104_G12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
HTMT1_0057_H02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LVRM1_0194_G06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0076_B11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LVRM1_0199_D03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0075_H06.b : CATTTT*GGCCAGACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0222_E02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCC*GCCGGTAAGG
THY01_0081_D12.b : CATTTT*GGCCAGACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCCGTAAGG
OVRM1_0222_E12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LVRM1_0104_D05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0071_D11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0093_C11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LVR01_0037_B05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0070_F12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0047_C06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0010_D01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0013_H08.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0031_G10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0036_D08.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
DCI01_0012_F12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0045_C09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0042_C09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SPLT1_0050_G02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0053_E07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PBL01_0026_A10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0038_C06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PBL01_0027_A08.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0133_H04.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0085_C09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0075_H06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0010_C05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0081_C11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PBL01_0089_B03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0094_H11.b : CATTTT*GGCCAAACCAACCACACCCCCNAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PBL01_0061_D06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PCT01_0003_C03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0033_E02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LNG01_0088_D05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ITT01_0067_D01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0035_D09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PBL01_0073_F07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0032_H04.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0040_F01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0027_H07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
MLN01_0084_F04.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PST01_0042_B01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0098_A10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0084_C10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0150_C11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SPL01_0053_H09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
MLN01_0054_C10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0017_H02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ITT01_0014_A03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0033_C06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0053_G03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
MLTL1_0079_F11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0022_D08.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0029_F02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LNG01_0065_F09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
DCI01_0042_F02.b : CATTTT*GGCCAAATCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LNG01_0019_G01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0055_D06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
BFLT1_0066_E07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
MLTL1_0055_E02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0012_H10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0033_E01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0004_F01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0066_D01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0202_A03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0092_E02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0039_A03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LVRM1_0134_G03.b : cacttctgacattacaacactctctcctaaatttttcgttttattttctgctttcccccc
OVRM1_0156_B10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0120_B04.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0108_F10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TES01_0061_A07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LVRM1_0090_E04.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0046_D12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0214_F08.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0002_C06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LVRM1_0180_E11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0181_E02.b : CATTTT*GGCCAA*CCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LVRM1_0160_F02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0134_H01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LVRM1_0071_A12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0152_D07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LVRM1_0180_H10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0013_F11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0047_B02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0103_B02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0091_E07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0002_F08.b : CATTTG*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0120_D07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0020_C06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0087_A06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0021_A04.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LVRM1_0158_H09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0062_F09.b : CATTTT*GGCCAAACCAACCACACCCCCNAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0118_E12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0042_D12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LVRM1_0139_C09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0031_D05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0047_D09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0012_B08.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TES01_0089_C09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0001_E09.b : CATTTT*GGGCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0045_B12.b : CATTCT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0044_D01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0026_F08.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0051_E08.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SPL01_0008_E12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TES01_0018_A10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ITT01_0079_B09.b : CATTTT*GGCCAAACCAACCACACCCCCAAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
MLN01_0085_D10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0072_F12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SMG01_0055_G11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0036_G11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TES01_0041_E11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0075_C08.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0085_E10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
BFLT1_0113_F08.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PBL01_0045_E08.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PBL01_0031_G01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATCTCTCCGTAAATTTCCT*GCCGGTAAGG
SMG01_0070_A04.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PBL01_0063_C05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SPL01_0059_E06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0043_F04.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0026_E11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ADR01_0093_C04.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0103_E11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SPL01_0098_A05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
BFLT1_0029_F09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0106_D04.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0202_E05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SMG01_0037_G08.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SPL01_0089_H09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0124_B11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ITT01_0015_D01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ITT01_0020_A02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0113_C02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
MLN01_0019_D06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
MLN01_0085_C09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ILNT1_0025_D03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TCH01_0004_H07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PBL01_0067_C02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PBL01_0057_E05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LVR01_0044_F10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0048_E10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0040_A09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PBL01_0069_A01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SPLT1_0008_E11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0090_F11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0083_E08.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0077_E09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0080_G10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ITT01_0071_H02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PBL01_0081_E05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0028_D02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SPL01_0065_H11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SPL01_0092_G07.b : CATTTT*GGCCAAACCAACCACACCCC*GAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
BFLT1_0061_A02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LNG01_0016_F12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ITT01_0062_F12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0040_E02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0091_A10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0100_G12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ITT01_0083_D09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0063_E01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
MLN01_0069_G07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SPL01_0058_B04.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0205_A01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
MLN01_0034_A10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0039_E09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TCH01_0091_H09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0044_G08.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0053_C06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0048_E05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
MLN01_0067_H11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
MLN01_0066_A09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0063_B08.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0049_E05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0007_F02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0202_H05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LNG01_0044_G08.b : CATTTT*GGCCAAACCAACCACACCCTCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
BFLT1_0076_D02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0203_A09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0021_E06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0085_A02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
MLN01_0044_B12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
MLTL1_0083_H11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0093_D03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0021_F12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0072_H04.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LVRM1_0135_C04.b : CATTTT*GGCCAAATCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCCGTAAGG
LVRM1_0048_A07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0027_F02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0075_A05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0151_F05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LVRM1_0187_F01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0091_E09.b : CATTTG*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0152_E11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0224_E03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0071_H11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0089_C11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0015_B11.b : CATTTT*GGCCAAACCAACCACACCCCCNAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SPL01_0017_A04.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TES01_0044_B05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0090_C03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0013_G09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0096_A12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0108_E06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0002_E12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0033_C06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
BFLT1_0103_E04.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0006_A09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SMG01_0074_F03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PBL01_0045_F06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0147_H05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0142_C03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
BFLT1_0063_C12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PBL01_0044_E06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
MLN01_0004_D12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0001_H11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0030_H11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0076_B04.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ITT01_0061_G09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0129_A05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0098_F08.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0029_A07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
BKFL1_0014_F05.b : CATTTT*GGCCAAATCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0111_G10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ITT01_0018_H07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PBL01_0030_G06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LNG01_0096_F11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
MLN01_0041_F02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ITT01_0049_H04.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0059_A05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0062_C06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
MLN01_0045_D05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0026_D05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SMG01_0084_C07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PBL01_0010_D10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0081_G08.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0013_D09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PBL01_0016_G04.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0067_G07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0132_A05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LNG01_0093_F11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0150_D11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PBL01_0064_H09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0073_F02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ITT01_0015_F05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ITT01_0070_G03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ADR01_0069_F01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0132_B02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SPL01_0052_B10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PCT01_0020_C03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ITT01_0006_B11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0052_H01.b : CATTTT*GGCCAAACCAACCACGCCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0063_B10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SPL01_0047_D01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0069_G02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ITT01_0006_E09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LNG01_0030_E11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0031_F10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LNG01_0062_A09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LNG01_0102_B06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LNG01_0059_H02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0023_C07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LNG01_0021_C04.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PBL01_0046_A10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0074_D09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LNG01_0017_F03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LNG01_0017_D05.b : CATTTT*GGCCAAACCAACCACACCCCCAAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0026_G01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRT1_0080_H08.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TCH01_0086_C07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0027_D07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0091_C02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TCH01_0057_A09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TCH01_0035_G02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0030_B11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LNG01_0056_E11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TCH01_0061_E07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0094_D05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SPL01_0005_E04.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CLNT1_0071_H03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0007_C01.b : CATTTT*GGCAAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
BFLT1_0094_G03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0102_C11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TES01_0099_F11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0182_B02.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0113_F09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TES01_0037_H09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TES01_0060_H07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
UTR01_0102_G01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0008_C12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LVR01_0016_B10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LVRM1_0079_F09.b : CATTTT*GGCCAAACCAACCACACCCCCNAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TES01_0053_D12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0095_F03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
PCT01_0002_B09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LNG01_0026_E10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TCH01_0012_H01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LNG01_0005_E12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
LNG01_0013_B09.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TES01_0069_C12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TES01_0073_F12.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
SMG01_0026_B01.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ITT01_0057_D07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TCH01_0093_C07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVRM1_0113_D10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
OVR01_0015_A06.b : CATTTTCGGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCTAGCCGGTAAGG
DCI01_0008_H07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TES01_0086_E10.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
MLTL1_0084_E05.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0043_B07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
ILNT1_0008_B06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TCH01_0006_H11.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
CBLT1_0038_E06.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
TES01_0058_C03.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
THY01_0002_E07.b : CATTTT*GGCCAAACCAACCACACCCCCGAATTTCTCCGTAAATTTCCT*GCCGGTAAGG
20110601C-001062 : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
---------+---------+---------+---------+---------+---------+ 288
OVRT1_0067_C01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0103_H09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ITT01_0058_E12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LVR01_0082_A02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0089_B03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0108_E01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0018_A03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TES01_0090_A05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0055_B12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TES01_0081_G09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCAAGAGCAAT*GCCATTGCCTAC
TES01_0017_E01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TES01_0022_F07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TES01_0028_A03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TES01_0022_F02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0095_E12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ITT01_0101_D05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0012_F07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0033_G10.b : TTCCAGCATTTGAGGGTGACAATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0086_B09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0068_D02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0006_B11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0025_B09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0018_D02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0032_G04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TES01_0041_D12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0042_E11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0059_B10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ITT01_0058_H04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0087_B10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LNG01_0091_D09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SPL01_0055_H05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0033_E04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0072_B03.b : TTC*AGCATTTGAGGNTGACGATGGATTCTGGGTGTCCAAAAGCAtgcctttgctactac
TES01_0088_D11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TES01_0072_A02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0056_H01.b : TTCCAGCATTTGAGGGTGACAATGGATTCTGTGTGTTCAAAAGCAAT*GCCATTGCCTAC
OVRT1_0047_B06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ITT01_0076_B09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0060_A07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*ACCATTGCCTAC
OVRT1_0022_G01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0028_H12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0008_C01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0063_G05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LVRM1_0167_B06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0216_A05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LVRM1_0163_E05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0082_D01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCGTTGCCTAC
OVRM1_0161_H11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LVRM1_0111_A10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0194_A02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0059_D07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0123_B12.b : TTCCAGCATTTGAGGGTGTCGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0101_A05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CBLT1_0041_G12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0168_D11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0028_A06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SMG01_0016_E08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
DCI01_0022_G09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0041_G01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0062_H06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SPL01_0058_E03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0025_D12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SMG01_0066_E07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
BMWN1_0007_F06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0097_B10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
BMWN1_0090_A06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0004_B03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0015_B05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0086_C02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TCH01_0033_E12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0010_B03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0081_C04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SPL01_0051_C05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0015_E03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
DCI01_0074_E02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TES01_0062_D08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0115_E09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0215_E08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0103_G08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAA*GCCATTGCCTAC
SMG01_0082_A10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0104_G12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
HTMT1_0057_H02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LVRM1_0194_G06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0076_B11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LVRM1_0199_D03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0075_H06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0222_E02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0081_D12.b : TCCCAGCATTTGAGGGTGACGATGGATTCTGTGGGTTCGAGAGCAAT*GCCGTTGCCTAC
OVRM1_0222_E12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LVRM1_0104_D05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0071_D11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0093_C11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LVR01_0037_B05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0070_F12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0047_C06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0010_D01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0013_H08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0031_G10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0036_D08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
DCI01_0012_F12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0045_C09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0042_C09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SPLT1_0050_G02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0053_E07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0026_A10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0038_C06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0027_A08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0133_H04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0085_C09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0075_H06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0010_C05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0081_C11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0089_B03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0094_H11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0061_D06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PCT01_0003_C03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0033_E02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LNG01_0088_D05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ITT01_0067_D01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0035_D09.b : TTCCAGCATTTGAGGGTGACGATGAATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0073_F07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0032_H04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0040_F01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0027_H07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
MLN01_0084_F04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PST01_0042_B01.b : TTCCAGCATTTGAGGGTGACAATGGATTCTGTGTGTTCAAAAGCAAT*GCCATTGCCTAC
OVRT1_0098_A10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0084_C10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0150_C11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SPL01_0053_H09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
MLN01_0054_C10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0017_H02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ITT01_0014_A03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0033_C06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0053_G03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
MLTL1_0079_F11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0022_D08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0029_F02.b : TTCCAGCGTTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LNG01_0065_F09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
DCI01_0042_F02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LNG01_0019_G01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0055_D06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
BFLT1_0066_E07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
MLTL1_0055_E02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0012_H10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0033_E01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0004_F01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0066_D01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0202_A03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0092_E02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0039_A03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LVRM1_0134_G03.b : taccgcttttctctttcacttatttccctttttccttaatctacttttttctctcgtctc
OVRM1_0156_B10.b : TTCCAGCATTTGAGGGTGACTATGGATTCTGTGTGTTCAAGAGCAGT*GCCATTGCCTAC
OVRM1_0120_B04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0108_F10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TES01_0061_A07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LVRM1_0090_E04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0046_D12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGAGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0214_F08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0002_C06.b : TTCCAGCATTTGAGGGCGACGATGGATTCTGCGTGTTCGAGAGCAAT*GCCATTGCCTAC
LVRM1_0180_E11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0181_E02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LVRM1_0160_F02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0134_H01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LVRM1_0071_A12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0152_D07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LVRM1_0180_H10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0013_F11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0047_B02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0103_B02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0091_E07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0002_F08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0120_D07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0020_C06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0087_A06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0021_A04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LVRM1_0158_H09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0062_F09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCNTTGCCTAC
OVRM1_0118_E12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0042_D12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LVRM1_0139_C09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0031_D05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0047_D09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0012_B08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TES01_0089_C09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0001_E09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0045_B12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0044_D01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0026_F08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCAAGAGCAAT*GCCATTGCCTAC
OVR01_0051_E08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SPL01_0008_E12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TES01_0018_A10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ITT01_0079_B09.b : TTCCACCATTTGAGGGTGACAATGGATTCTGTGTGTTCAAAAGCAAT*GCCATTGCCTAC
MLN01_0085_D10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0072_F12.b : TTCCAGCATTTGAGGGTGACCATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SMG01_0055_G11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0036_G11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTCCGAGAGCAAT*GCCATTGCCTAC
TES01_0041_E11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0075_C08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0085_E10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
BFLT1_0113_F08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0045_E08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0031_G01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SMG01_0070_A04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0063_C05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SPL01_0059_E06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0043_F04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0026_E11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ADR01_0093_C04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0103_E11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SPL01_0098_A05.b : TTACAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
BFLT1_0029_F09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0106_D04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0202_E05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SMG01_0037_G08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SPL01_0089_H09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0124_B11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ITT01_0015_D01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ITT01_0020_A02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0113_C02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
MLN01_0019_D06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
MLN01_0085_C09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ILNT1_0025_D03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TCH01_0004_H07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0067_C02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0057_E05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LVR01_0044_F10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0048_E10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0040_A09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0069_A01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SPLT1_0008_E11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0090_F11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0083_E08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0077_E09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAACAAT*GCCATTGCCTAC
THY01_0080_G10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ITT01_0071_H02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0081_E05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0028_D02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATCGCCTAC
SPL01_0065_H11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SPL01_0092_G07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
BFLT1_0061_A02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LNG01_0016_F12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ITT01_0062_F12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0040_E02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0091_A10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0100_G12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ITT01_0083_D09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0063_E01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
MLN01_0069_G07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SPL01_0058_B04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0205_A01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCAAGAGCAAT*GCCATTGCCTAC
MLN01_0034_A10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0039_E09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TCH01_0091_H09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0044_G08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0053_C06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0048_E05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
MLN01_0067_H11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
MLN01_0066_A09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0063_B08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0049_E05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0007_F02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0202_H05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGCGTGTTCGAGAGCAAT*GCCATTGCCTAC
LNG01_0044_G08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
BFLT1_0076_D02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0203_A09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0021_E06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0085_A02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
MLN01_0044_B12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
MLTL1_0083_H11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0093_D03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0021_F12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0072_H04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LVRM1_0135_C04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LVRM1_0048_A07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0027_F02.b : TTCCAGCATTTGACGGTGACGATGGATTCTGTGTGTTCGAGAGCACT*GCCATTGCCTAC
OVR01_0075_A05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0151_F05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LVRM1_0187_F01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0091_E09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0152_E11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0224_E03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0071_H11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0089_C11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0015_B11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SPL01_0017_A04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TES01_0044_B05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0090_C03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0013_G09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0096_A12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0108_E06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCTAGAGCAAT*GCCATTGCCTAC
THY01_0002_E12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0033_C06.b : TTCCAGCATTTGAGGGTGACGATGGGTTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
BFLT1_0103_E04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0006_A09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SMG01_0074_F03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0045_F06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0147_H05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0142_C03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
BFLT1_0063_C12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0044_E06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
MLN01_0004_D12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0001_H11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0030_H11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0076_B04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ITT01_0061_G09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0129_A05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0098_F08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0029_A07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
BKFL1_0014_F05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0111_G10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ITT01_0018_H07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0030_G06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LNG01_0096_F11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
MLN01_0041_F02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ITT01_0049_H04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0059_A05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0062_C06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
MLN01_0045_D05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0026_D05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SMG01_0084_C07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0010_D10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0081_G08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0013_D09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0016_G04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0067_G07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0132_A05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LNG01_0093_F11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0150_D11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0064_H09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0073_F02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ITT01_0015_F05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ITT01_0070_G03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ADR01_0069_F01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0132_B02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SPL01_0052_B10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PCT01_0020_C03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ITT01_0006_B11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0052_H01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0063_B10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SPL01_0047_D01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0069_G02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ITT01_0006_E09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LNG01_0030_E11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0031_F10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LNG01_0062_A09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LNG01_0102_B06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LNG01_0059_H02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0023_C07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LNG01_0021_C04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PBL01_0046_A10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0074_D09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LNG01_0017_F03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LNG01_0017_D05.b : TTCCAGCATTTGAGGGTGACAATGGATTCTGTGTGTTCAAAAGCAAT*GCCATTGCCTAC
CLNT1_0026_G01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRT1_0080_H08.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TCH01_0086_C07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0027_D07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0091_C02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TCH01_0057_A09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TCH01_0035_G02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0030_B11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LNG01_0056_E11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TCH01_0061_E07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0094_D05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
SPL01_0005_E04.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CLNT1_0071_H03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0007_C01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
BFLT1_0094_G03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0102_C11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TES01_0099_F11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0182_B02.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0113_F09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TES01_0037_H09.b : TTCCAGCATTTGAGGGTGGCGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TES01_0060_H07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
UTR01_0102_G01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0008_C12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LVR01_0016_B10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LVRM1_0079_F09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TES01_0053_D12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0095_F03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
PCT01_0002_B09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LNG01_0026_E10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TCH01_0012_H01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LNG01_0005_E12.b : TTCCAGCATTTGGGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
LNG01_0013_B09.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TES01_0069_C12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TES01_0073_F12.b : TTCCAGCATTTGAGGGTGACGATGGATTCTATGTGTTCGAGAGCAAT*GCCATTGCCTAC
SMG01_0026_B01.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ITT01_0057_D07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TCH01_0093_C07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVRM1_0113_D10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
OVR01_0015_A06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAATAGCCATCGCCTAC
DCI01_0008_H07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TES01_0086_E10.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
MLTL1_0084_E05.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0043_B07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
ILNT1_0008_B06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TCH01_0006_H11.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
CBLT1_0038_E06.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
TES01_0058_C03.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
THY01_0002_E07.b : TTCCAGCATTTGAGGGTGACGATGGATTCTGTGTGTTCGAGAGCAAT*GCCATTGCCTAC
20110601C-001062 : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
---------+---------+---------+---------+---------+---------+ 346
OVRT1_0067_C01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0103_H09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
ITT01_0058_E12.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LVR01_0082_A02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0089_B03.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0108_E01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0018_A03.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TES01_0090_A05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0055_B12.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TES01_0081_G09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCATGTGGTGC
TES01_0017_E01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TES01_0022_F07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TES01_0028_A03.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TES01_0022_F02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0095_E12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
ITT01_0101_D05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0012_F07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0033_G10.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0086_B09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0068_D02.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0006_B11.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0025_B09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0018_D02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0032_G04.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TES01_0041_D12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0042_E11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0059_B10.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAAGTGGTGC
ITT01_0058_H04.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0087_B10.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LNG01_0091_D09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SPL01_0055_H05.b : TA*CGTGAGTAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0033_E04.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0072_B03.b : ttgaacaacaaggagctgccgggaagtactcccgaaggcaccaaccccggtggggcaatg
TES01_0088_D11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TES01_0072_A02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0056_H01.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCACCACCCCAGGTGGTGC
OVRT1_0047_B06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
ITT01_0076_B09.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0060_A07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0022_G01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0028_H12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0008_C01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0063_G05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LVRM1_0167_B06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0216_A05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LVRM1_0163_E05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0082_D01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0161_H11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LVRM1_0111_A10.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0194_A02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0059_D07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0123_B12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0101_A05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CBLT1_0041_G12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0168_D11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0028_A06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SMG01_0016_E08.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
DCI01_0022_G09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0041_G01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0062_H06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SPL01_0058_E03.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0025_D12.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SMG01_0066_E07.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
BMWN1_0007_F06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0097_B10.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
BMWN1_0090_A06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0004_B03.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0015_B05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0086_C02.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TCH01_0033_E12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0010_B03.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0081_C04.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SPL01_0051_C05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0015_E03.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
DCI01_0074_E02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TES01_0062_D08.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0115_E09.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0215_E08.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0103_G08.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SMG01_0082_A10.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0104_G12.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
HTMT1_0057_H02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LVRM1_0194_G06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0076_B11.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LVRM1_0199_D03.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0075_H06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0222_E02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0081_D12.b : TA*GGCGACCAACGAGGAACTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0222_E12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LVRM1_0104_D05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0071_D11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0093_C11.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LVR01_0037_B05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0070_F12.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0047_C06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0010_D01.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0013_H08.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0031_G10.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0036_D08.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
DCI01_0012_F12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0045_C09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0042_C09.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SPLT1_0050_G02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0053_E07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0026_A10.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0038_C06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0027_A08.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0133_H04.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0085_C09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0075_H06.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0010_C05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0081_C11.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0089_B03.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0094_H11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0061_D06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PCT01_0003_C03.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACGCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0033_E02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LNG01_0088_D05.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
ITT01_0067_D01.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0035_D09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0073_F07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0032_H04.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0040_F01.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0027_H07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCTAGGTGGTGC
MLN01_0084_F04.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PST01_0042_B01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACGCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0098_A10.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0084_C10.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0150_C11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SPL01_0053_H09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
MLN01_0054_C10.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0017_H02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
ITT01_0014_A03.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0033_C06.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0053_G03.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
MLTL1_0079_F11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0022_D08.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0029_F02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LNG01_0065_F09.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
DCI01_0042_F02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LNG01_0019_G01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0055_D06.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
BFLT1_0066_E07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
MLTL1_0055_E02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0012_H10.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0033_E01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0004_F01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0066_D01.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0202_A03.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0092_E02.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0039_A03.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LVRM1_0134_G03.b : tttccactttttattcattttttgcctttcctttccacttttttttttccttccttcgtc
OVRM1_0156_B10.b : TA*CGTGAACTACGAGGAGCTGCGGagcaattaatcatgtaagcaacacacacacgaggc
OVRM1_0120_B04.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0108_F10.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TES01_0061_A07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LVRM1_0090_E04.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0046_D12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0214_F08.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0002_C06.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGCACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LVRM1_0180_E11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0181_E02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LVRM1_0160_F02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0134_H01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LVRM1_0071_A12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0152_D07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LVRM1_0180_H10.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0013_F11.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0047_B02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0103_B02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0091_E07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0002_F08.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0120_D07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0020_C06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0087_A06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0021_A04.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LVRM1_0158_H09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTGCTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0062_F09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0118_E12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0042_D12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LVRM1_0139_C09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0031_D05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0047_D09.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0012_B08.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TES01_0089_C09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0001_E09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0045_B12.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0044_D01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0026_F08.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAACCCAAGTGGTGC
OVR01_0051_E08.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SPL01_0008_E12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TES01_0018_A10.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
ITT01_0079_B09.b : TA*TGTGACCAACAAGAACCTGCGGGAAATTACTCCTGA*GGCACCACCCCAGGTGGTGC
MLN01_0085_D10.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0072_F12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SMG01_0055_G11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0036_G11.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TES01_0041_E11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0075_C08.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0085_E10.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGCGC
BFLT1_0113_F08.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0045_E08.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0031_G01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SMG01_0070_A04.b : TA*TGTGAGCAACGAGGAACTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0063_C05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SPL01_0059_E06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0043_F04.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0026_E11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
ADR01_0093_C04.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0103_E11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SPL01_0098_A05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
BFLT1_0029_F09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0106_D04.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0202_E05.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SMG01_0037_G08.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SPL01_0089_H09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0124_B11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
ITT01_0015_D01.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
ITT01_0020_A02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0113_C02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
MLN01_0019_D06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
MLN01_0085_C09.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
ILNT1_0025_D03.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TCH01_0004_H07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0067_C02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0057_E05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LVR01_0044_F10.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0048_E10.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0040_A09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0069_A01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SPLT1_0008_E11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0090_F11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0083_E08.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0077_E09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0080_G10.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
ITT01_0071_H02.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0081_E05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0028_D02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SPL01_0065_H11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SPL01_0092_G07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
BFLT1_0061_A02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LNG01_0016_F12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
ITT01_0062_F12.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0040_E02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0091_A10.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0100_G12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
ITT01_0083_D09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0063_E01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
MLN01_0069_G07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SPL01_0058_B04.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0205_A01.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
MLN01_0034_A10.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0039_E09.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TCH01_0091_H09.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0044_G08.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0053_C06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0048_E05.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
MLN01_0067_H11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
MLN01_0066_A09.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0063_B08.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0049_E05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0007_F02.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0202_H05.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LNG01_0044_G08.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
BFLT1_0076_D02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0203_A09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0021_E06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0085_A02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
MLN01_0044_B12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
MLTL1_0083_H11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0093_D03.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0021_F12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0072_H04.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LVRM1_0135_C04.b : TA*TTTGAGCAACtcacgatttgcctttcaagcactcctgtacgcctcagtccactatgg
LVRM1_0048_A07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0027_F02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGCACTCCTGA*GGCAGCAGCCCACGTGGAGC
OVR01_0075_A05.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0151_F05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LVRM1_0187_F01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0091_E09.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0152_E11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0224_E03.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0071_H11.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0089_C11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0015_B11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SPL01_0017_A04.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TES01_0044_B05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCATGTGGTGC
OVR01_0090_C03.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0013_G09.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0096_A12.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0108_E06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCACCAGCCCAGGTGGTGC
THY01_0002_E12.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0033_C06.b : TA*CGTGAGCAACGAAGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
BFLT1_0103_E04.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0006_A09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SMG01_0074_F03.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0045_F06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0147_H05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0142_C03.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
BFLT1_0063_C12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0044_E06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
MLN01_0004_D12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0001_H11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0030_H11.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0076_B04.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
ITT01_0061_G09.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0129_A05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0098_F08.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0029_A07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
BKFL1_0014_F05.b : TA*CGTGAGCAACGAGGAGCTGGGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0111_G10.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
ITT01_0018_H07.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0030_G06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LNG01_0096_F11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
MLN01_0041_F02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
ITT01_0049_H04.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0059_A05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0062_C06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
MLN01_0045_D05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0026_D05.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SMG01_0084_C07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0010_D10.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0081_G08.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0013_D09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0016_G04.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0067_G07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0132_A05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LNG01_0093_F11.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0150_D11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0064_H09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0073_F02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
ITT01_0015_F05.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
ITT01_0070_G03.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
ADR01_0069_F01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0132_B02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SPL01_0052_B10.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PCT01_0020_C03.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACGCCTGA*GGCAGCAGCCCAGGTGGTGC
ITT01_0006_B11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0052_H01.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0063_B10.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SPL01_0047_D01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0069_G02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
ITT01_0006_E09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LNG01_0030_E11.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0031_F10.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LNG01_0062_A09.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LNG01_0102_B06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LNG01_0059_H02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0023_C07.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LNG01_0021_C04.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PBL01_0046_A10.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0074_D09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LNG01_0017_F03.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LNG01_0017_D05.b : TA*TGTGAGCAACGAGAAGCTGCGGGAAAGTACTCCTGA*GGCAGCACCCCAGGTGGTGC
CLNT1_0026_G01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRT1_0080_H08.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TCH01_0086_C07.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0027_D07.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0091_C02.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TCH01_0057_A09.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TCH01_0035_G02.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0030_B11.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LNG01_0056_E11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TCH01_0061_E07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0094_D05.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SPL01_0005_E04.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CLNT1_0071_H03.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0007_C01.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
BFLT1_0094_G03.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0102_C11.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TES01_0099_F11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0182_B02.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0113_F09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TES01_0037_H09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TES01_0060_H07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
UTR01_0102_G01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0008_C12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LVR01_0016_B10.b : TA*CGTGAGCAACGTGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGTCCAGGTGGTGC
LVRM1_0079_F09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TES01_0053_D12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0095_F03.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
PCT01_0002_B09.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACGCCTGA*GGCAGCAGCCCAGGTGGTGC
LNG01_0026_E10.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TCH01_0012_H01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LNG01_0005_E12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
LNG01_0013_B09.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TES01_0069_C12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TES01_0073_F12.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
SMG01_0026_B01.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
ITT01_0057_D07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TCH01_0093_C07.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVRM1_0113_D10.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
OVR01_0015_A06.b : TATCGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGAGGGCAGCAGCCCAGGTGGTGC
DCI01_0008_H07.b : TA*TGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TES01_0086_E10.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
MLTL1_0084_E05.b : TG*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0043_B07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
ILNT1_0008_B06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TCH01_0006_H11.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
CBLT1_0038_E06.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
TES01_0058_C03.b : TA*CGTGAGCAACGAGGAGCTGCGGGGGAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
THY01_0002_E07.b : TA*CGTGAGCAACGAGGAGCTGCGGGGAAGTACTCCTGA*GGCAGCAGCCCAGGTGGTGC
20110601C-001062 : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
---------+---------+---------+---------+---------+---------+ 405
OVRT1_0067_C01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0103_H09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ITT01_0058_E12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LVR01_0082_A02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGCT*CCCC
OVR01_0089_B03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0108_E01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0018_A03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TES01_0090_A05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0055_B12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TES01_0081_G09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTTTCCCC
TES01_0017_E01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TES01_0022_F07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TES01_0028_A03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TES01_0022_F02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0095_E12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ITT01_0101_D05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0012_F07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0033_G10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0086_B09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0068_D02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0006_B11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0025_B09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0018_D02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0032_G04.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TES01_0041_D12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0042_E11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0059_B10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ITT01_0058_H04.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0087_B10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LNG01_0091_D09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SPL01_0055_H05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0033_E04.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0072_B03.b : gggggaacttttccaaaaacaaaaatctggccccccccccgttaccggggggtttccccc
TES01_0088_D11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TES01_0072_A02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0056_H01.b : AGTGGGTGAGCTTTGCCAATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0047_B06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ITT01_0076_B09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0060_A07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0022_G01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0028_H12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0008_C01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0063_G05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LVRM1_0167_B06.b : AATGGGTGAGCTTTGCtaacagcgtaaacatgcccccacgcctgtacctgagacgttcca
OVRM1_0216_A05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LVRM1_0163_E05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0082_D01.b : ACAGGGTGAGCTTTGCCGATAGCGACATCATGCCCCCCGCCAGTACCTGACTGTT*CCCC
OVRM1_0161_H11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LVRM1_0111_A10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTACCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0194_A02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0059_D07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0123_B12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0101_A05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CBLT1_0041_G12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0168_D11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0028_A06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SMG01_0016_E08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
DCI01_0022_G09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0041_G01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0062_H06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SPL01_0058_E03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0025_D12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SMG01_0066_E07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
BMWN1_0007_F06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0097_B10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
BMWN1_0090_A06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0004_B03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0015_B05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0086_C02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TCH01_0033_E12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0010_B03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0081_C04.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SPL01_0051_C05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0015_E03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
DCI01_0074_E02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TES01_0062_D08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0115_E09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0215_E08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0103_G08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SMG01_0082_A10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*TCCC
OVR01_0104_G12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
HTMT1_0057_H02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCCGCAGTACCTGGGTG*T*CCCC
LVRM1_0194_G06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0076_B11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LVRM1_0199_D03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0075_H06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0222_E02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0081_D12.b : AGTGGGTGAGCTTTGCCGAGAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0222_E12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LVRM1_0104_D05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0071_D11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0093_C11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LVR01_0037_B05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0070_F12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0047_C06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0010_D01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0013_H08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0031_G10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGAGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0036_D08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
DCI01_0012_F12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0045_C09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0042_C09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SPLT1_0050_G02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0053_E07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0026_A10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0038_C06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0027_A08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0133_H04.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0085_C09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0075_H06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0010_C05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0081_C11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0089_B03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0094_H11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0061_D06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PCT01_0003_C03.b : AGTGGGTGAGCTTTGCTGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0033_E02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LNG01_0088_D05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ITT01_0067_D01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0035_D09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0073_F07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0032_H04.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0040_F01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0027_H07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
MLN01_0084_F04.b : AGTGGGTGAGCTTTGCCGATAGCGACATTGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PST01_0042_B01.b : AGTGGGTGAGCTTTGCTGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0098_A10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0084_C10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0150_C11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SPL01_0053_H09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
MLN01_0054_C10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0017_H02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ITT01_0014_A03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0033_C06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0053_G03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
MLTL1_0079_F11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0022_D08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0029_F02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LNG01_0065_F09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
DCI01_0042_F02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LNG01_0019_G01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0055_D06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
BFLT1_0066_E07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
MLTL1_0055_E02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0012_H10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0033_E01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0004_F01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0066_D01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0202_A03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0092_E02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0039_A03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LVRM1_0134_G03.b : accatttcctttccttctaccatattgtgcattttcctttttacctttttatcatctttt
OVRM1_0156_B10.b : agaaataataaaaatcaaagacacgatagagaacaaacgaacccacctcgaagaagactt
OVRM1_0120_B04.b : AGTGGGTGAGCTTTGCCTATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0108_F10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TES01_0061_A07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LVRM1_0090_E04.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0046_D12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0214_F08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0002_C06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LVRM1_0180_E11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0181_E02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LVRM1_0160_F02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0134_H01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LVRM1_0071_A12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0152_D07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LVRM1_0180_H10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0013_F11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0047_B02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0103_B02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0091_E07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0002_F08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0120_D07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0020_C06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0087_A06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0021_A04.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LVRM1_0158_H09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0062_F09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0118_E12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGCGTT*CCCC
OVRM1_0042_D12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LVRM1_0139_C09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0031_D05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0047_D09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0012_B08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TES01_0089_C09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0001_E09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0045_B12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0044_D01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTACCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0026_F08.b : ACTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0051_E08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SPL01_0008_E12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TES01_0018_A10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ITT01_0079_B09.b : AGTGGGTGAGCTTTGCCAATAGCAACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
MLN01_0085_D10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0072_F12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SMG01_0055_G11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0036_G11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TES01_0041_E11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0075_C08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0085_E10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
BFLT1_0113_F08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0045_E08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0031_G01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SMG01_0070_A04.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0063_C05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SPL01_0059_E06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0043_F04.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0026_E11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ADR01_0093_C04.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0103_E11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SPL01_0098_A05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
BFLT1_0029_F09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0106_D04.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0202_E05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SMG01_0037_G08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SPL01_0089_H09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0124_B11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ITT01_0015_D01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ITT01_0020_A02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0113_C02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
MLN01_0019_D06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
MLN01_0085_C09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ILNT1_0025_D03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TCH01_0004_H07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0067_C02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0057_E05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LVR01_0044_F10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0048_E10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0040_A09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0069_A01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SPLT1_0008_E11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0090_F11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0083_E08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0077_E09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0080_G10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ITT01_0071_H02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0081_E05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0028_D02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SPL01_0065_H11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SPL01_0092_G07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
BFLT1_0061_A02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LNG01_0016_F12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ITT01_0062_F12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0040_E02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0091_A10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0100_G12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ITT01_0083_D09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0063_E01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
MLN01_0069_G07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SPL01_0058_B04.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0205_A01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
MLN01_0034_A10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0039_E09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TCH01_0091_H09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0044_G08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0053_C06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0048_E05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTGCCTGGGTGTT*CCCC
MLN01_0067_H11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
MLN01_0066_A09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0063_B08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0049_E05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0007_F02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0202_H05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LNG01_0044_G08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
BFLT1_0076_D02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0203_A09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0021_E06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0085_A02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
MLN01_0044_B12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
MLTL1_0083_H11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0093_D03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0021_F12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0072_H04.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LVRM1_0135_C04.b : tgctacacgccgactttcgcactattcctacctcttgttctcacgcctgcctttcctctc
LVRM1_0048_A07.b : AGTGGGTGAGCTTTGCCAATAACGACATCTTGCCCCCCGacaccacctgagtagctccta
OVRM1_0027_F02.b : AATGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGATCCTGGGTGTT*ACCC
OVR01_0075_A05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0151_F05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LVRM1_0187_F01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0091_E09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0152_E11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0224_E03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0071_H11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0089_C11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0015_B11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SPL01_0017_A04.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TES01_0044_B05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0090_C03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0013_G09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0096_A12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0108_E06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0002_E12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0033_C06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
BFLT1_0103_E04.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0006_A09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SMG01_0074_F03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0045_F06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0147_H05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0142_C03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
BFLT1_0063_C12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0044_E06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
MLN01_0004_D12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0001_H11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0030_H11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0076_B04.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ITT01_0061_G09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0129_A05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0098_F08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0029_A07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
BKFL1_0014_F05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0111_G10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ITT01_0018_H07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0030_G06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LNG01_0096_F11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
MLN01_0041_F02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ITT01_0049_H04.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0059_A05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0062_C06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
MLN01_0045_D05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0026_D05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SMG01_0084_C07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0010_D10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0081_G08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0013_D09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0016_G04.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0067_G07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0132_A05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LNG01_0093_F11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0150_D11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0064_H09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0073_F02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ITT01_0015_F05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ITT01_0070_G03.b : AGTGGGTGAGCTTTGCTGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ADR01_0069_F01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0132_B02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SPL01_0052_B10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PCT01_0020_C03.b : AGTGGGTGAGCTTTGCTGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ITT01_0006_B11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0052_H01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0063_B10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SPL01_0047_D01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0069_G02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ITT01_0006_E09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LNG01_0030_E11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0031_F10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LNG01_0062_A09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LNG01_0102_B06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LNG01_0059_H02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0023_C07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LNG01_0021_C04.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PBL01_0046_A10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0074_D09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LNG01_0017_F03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LNG01_0017_D05.b : AGGGGGTGAGCTTTGCCAATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0026_G01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRT1_0080_H08.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TCH01_0086_C07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0027_D07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0091_C02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TCH01_0057_A09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TCH01_0035_G02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0030_B11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LNG01_0056_E11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TCH01_0061_E07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0094_D05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SPL01_0005_E04.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CLNT1_0071_H03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0007_C01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
BFLT1_0094_G03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0102_C11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TES01_0099_F11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0182_B02.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0113_F09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TES01_0037_H09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TES01_0060_H07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
UTR01_0102_G01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0008_C12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LVR01_0016_B10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LVRM1_0079_F09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TES01_0053_D12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0095_F03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
PCT01_0002_B09.b : AGTGGGTGAGCTTTGCTGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LNG01_0026_E10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGCGTT*CCCC
TCH01_0012_H01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LNG01_0005_E12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
LNG01_0013_B09.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TES01_0069_C12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TES01_0073_F12.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
SMG01_0026_B01.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ITT01_0057_D07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TCH01_0093_C07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVRM1_0113_D10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
OVR01_0015_A06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGGTTCCCC
DCI01_0008_H07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TES01_0086_E10.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
MLTL1_0084_E05.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0043_B07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
ILNT1_0008_B06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TCH01_0006_H11.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
CBLT1_0038_E06.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
TES01_0058_C03.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
THY01_0002_E07.b : AGTGGGTGAGCTTTGCCGATAGCGACATCGTGCCCCCCGCCAGTACCTGGGTGTT*CCCC
20110601C-001062 : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
---------+---------+---------+---------+---------+---------+ 462
OVRT1_0067_C01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0103_H09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ITT01_0058_E12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LVR01_0082_A02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0089_B03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0108_E01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0018_A03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TES01_0090_A05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0055_B12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TES01_0081_G09.b : ACCTTGTGCATCATGCACTACAACAAGCATGC*CACATAGAATGCTAAGG*ATGAGG*TG
TES01_0017_E01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TES01_0022_F07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TES01_0028_A03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TES01_0022_F02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAAG*ATGAGG*TG
OVR01_0095_E12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ITT01_0101_D05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0012_F07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0033_G10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0086_B09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0068_D02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0006_B11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0025_B09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0018_D02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0032_G04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TES01_0041_D12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0042_E11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0059_B10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ITT01_0058_H04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0087_B10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LNG01_0091_D09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SPL01_0055_H05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0033_E04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGGGG*TG
THY01_0072_B03.b : ccttggggtttttgggccttaaaaaaaaagggcccccaaaaaattccaaagaataggggg
TES01_0088_D11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TES01_0072_A02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0056_H01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAAAAAATGCAAAGG*ATGAGG*TG
OVRT1_0047_B06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ITT01_0076_B09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0060_A07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0022_G01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0028_H12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0008_C01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0063_G05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LVRM1_0167_B06.b : caccctgagcataatgccgtacaacactcaagcaacagataatggcaatgaccacgggag
OVRM1_0216_A05.b : ACCTTGGGCATCATGCACTACCACAAGCATGCTCAAAGACAATGCACAGG*ATGACG*TG
LVRM1_0163_E05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGATG*TG
OVRM1_0082_D01.b : ACCTTGCACATCATGCACTACAACAAGCACGC*CACAAAGAATGCAAAGG*ATGAGG*TG
OVRM1_0161_H11.b : ACCTGGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LVRM1_0111_A10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0194_A02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0059_D07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0123_B12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0101_A05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CBLT1_0041_G12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0168_D11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0028_A06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SMG01_0016_E08.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
DCI01_0022_G09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0041_G01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0062_H06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SPL01_0058_E03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0025_D12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SMG01_0066_E07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
BMWN1_0007_F06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0097_B10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
BMWN1_0090_A06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0004_B03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0015_B05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0086_C02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TCH01_0033_E12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0010_B03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0081_C04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SPL01_0051_C05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0015_E03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
DCI01_0074_E02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TES01_0062_D08.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0115_E09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0215_E08.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0103_G08.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SMG01_0082_A10.b : AC*TTGGGCATCATGCACTANCACNAGCANGC*CACAGAGAATGCAAAGG*ATGAAG*TG
OVR01_0104_G12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
HTMT1_0057_H02.b : ACTTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAAGATGCAAAGG*AATGAG*TG
LVRM1_0194_G06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0076_B11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LVRM1_0199_D03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0075_H06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0222_E02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0081_D12.b : ACCTTGGGCATCATGCACTACAACAAGCAAGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0222_E12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LVRM1_0104_D05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0071_D11.b : ACCTTGGGCATCATGCACTACAATAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0093_C11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LVR01_0037_B05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0070_F12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0047_C06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0010_D01.b : ACCTTGG*CATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0013_H08.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0031_G10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0036_D08.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
DCI01_0012_F12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0045_C09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0042_C09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SPLT1_0050_G02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0053_E07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0026_A10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0038_C06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0027_A08.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0133_H04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGT*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0085_C09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0075_H06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0010_C05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0081_C11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0089_B03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0094_H11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0061_D06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PCT01_0003_C03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0033_E02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LNG01_0088_D05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ITT01_0067_D01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0035_D09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0073_F07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0032_H04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0040_F01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0027_H07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
MLN01_0084_F04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PST01_0042_B01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0098_A10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0084_C10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0150_C11.b : ACCTTGGGCATCATGCAGTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SPL01_0053_H09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
MLN01_0054_C10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0017_H02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ITT01_0014_A03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0033_C06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGGATGCAAAGG*ATGAGG*TG
THY01_0053_G03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
MLTL1_0079_F11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGGGAATGCAAAGG*ATGAGG*TG
OVRT1_0022_D08.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0029_F02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LNG01_0065_F09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
DCI01_0042_F02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LNG01_0019_G01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0055_D06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
BFLT1_0066_E07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
MLTL1_0055_E02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0012_H10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0033_E01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0004_F01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0066_D01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0202_A03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0092_E02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0039_A03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LVRM1_0134_G03.b : tccccttcgttttcctcgtttcttttcctcatacttcctattattttcctccttaccttt
OVRM1_0156_B10.b : tagataaaaatacctacatccggcatatatatacaggttaaccccataacaggtaacatt
OVRM1_0120_B04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0108_F10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TES01_0061_A07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LVRM1_0090_E04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0046_D12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0214_F08.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0002_C06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGT*CACAGGGAATGCAAAGG*ATGAGG*TG
LVRM1_0180_E11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0181_E02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LVRM1_0160_F02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0134_H01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LVRM1_0071_A12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0152_D07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LVRM1_0180_H10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0013_F11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0047_B02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0103_B02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0091_E07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0002_F08.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0120_D07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0020_C06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0087_A06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0021_A04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LVRM1_0158_H09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0062_F09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCANAGG*ATGAGG*TG
OVRM1_0118_E12.b : ACCTTGGGCATCATGCGCTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0042_D12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LVRM1_0139_C09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0031_D05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0047_D09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0012_B08.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TES01_0089_C09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0001_E09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0045_B12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0044_D01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0026_F08.b : ACCTTGGGCATCATGCACTACAACAAAAAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0051_E08.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SPL01_0008_E12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TES01_0018_A10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ITT01_0079_B09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAAAAAATGCAAAGG*ATGAGG*TG
MLN01_0085_D10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0072_F12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SMG01_0055_G11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0036_G11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TES01_0041_E11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0075_C08.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0085_E10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
BFLT1_0113_F08.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0045_E08.b : ACCTTGGGCATCATGCACTACAGCAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0031_G01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SMG01_0070_A04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0063_C05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SPL01_0059_E06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAGTGCAAAGG*ATGAGG*TG
UTR01_0043_F04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0026_E11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ADR01_0093_C04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0103_E11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SPL01_0098_A05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
BFLT1_0029_F09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0106_D04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0202_E05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SMG01_0037_G08.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SPL01_0089_H09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0124_B11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ITT01_0015_D01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ITT01_0020_A02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0113_C02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
MLN01_0019_D06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
MLN01_0085_C09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ILNT1_0025_D03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TCH01_0004_H07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0067_C02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0057_E05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LVR01_0044_F10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0048_E10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0040_A09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0069_A01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SPLT1_0008_E11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0090_F11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0083_E08.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0077_E09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0080_G10.b : ACCTTGGGCATTATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ITT01_0071_H02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0081_E05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0028_D02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SPL01_0065_H11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SPL01_0092_G07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
BFLT1_0061_A02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LNG01_0016_F12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ITT01_0062_F12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0040_E02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0091_A10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0100_G12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ITT01_0083_D09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0063_E01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
MLN01_0069_G07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SPL01_0058_B04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0205_A01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
MLN01_0034_A10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0039_E09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TCH01_0091_H09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0044_G08.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0053_C06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0048_E05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
MLN01_0067_H11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
MLN01_0066_A09.b : ACCTTGGACATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0063_B08.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0049_E05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0007_F02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0202_H05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LNG01_0044_G08.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
BFLT1_0076_D02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0203_A09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0021_E06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0085_A02.b : ACCTTGGGCATCATGCACTACAACAAGTAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
MLN01_0044_B12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
MLTL1_0083_H11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0093_D03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0021_F12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0072_H04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LVRM1_0135_C04.b : gctactccctttccgcgttcccctttctcttttcctttgtctttccttatcccctcgccc
LVRM1_0048_A07.b : acccgggcataccgcaccacatctagctagcaacacatattgcttttgactcaccacaat
OVRM1_0027_F02.b : ACCTTGTGCTTCATGCACTACAACATGCATGC*CACAGAGAATGCCAATG*ATGACG*TG
OVR01_0075_A05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0151_F05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LVRM1_0187_F01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0091_E09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0152_E11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0224_E03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0071_H11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0089_C11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0015_B11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SPL01_0017_A04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TES01_0044_B05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0090_C03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0013_G09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0096_A12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0108_E06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACATAGAATGCAAAGG*ATGAGG*TG
THY01_0002_E12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0033_C06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
BFLT1_0103_E04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0006_A09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SMG01_0074_F03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0045_F06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0147_H05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0142_C03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
BFLT1_0063_C12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0044_E06.b : ACCTTGGGCACCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
MLN01_0004_D12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0001_H11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0030_H11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0076_B04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ITT01_0061_G09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0129_A05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0098_F08.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0029_A07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
BKFL1_0014_F05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0111_G10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ITT01_0018_H07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0030_G06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LNG01_0096_F11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
MLN01_0041_F02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ITT01_0049_H04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0059_A05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0062_C06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
MLN01_0045_D05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0026_D05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SMG01_0084_C07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0010_D10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0081_G08.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0013_D09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0016_G04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0067_G07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0132_A05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LNG01_0093_F11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0150_D11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0064_H09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0073_F02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ITT01_0015_F05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ITT01_0070_G03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ADR01_0069_F01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0132_B02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SPL01_0052_B10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PCT01_0020_C03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ITT01_0006_B11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0052_H01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0063_B10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SPL01_0047_D01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0069_G02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ITT01_0006_E09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LNG01_0030_E11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0031_F10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LNG01_0062_A09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LNG01_0102_B06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LNG01_0059_H02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0023_C07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LNG01_0021_C04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PBL01_0046_A10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0074_D09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LNG01_0017_F03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LNG01_0017_D05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAAAAAATGCAAAGG*ATGAGG*TG
CLNT1_0026_G01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRT1_0080_H08.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TCH01_0086_C07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0027_D07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0091_C02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TCH01_0057_A09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TCH01_0035_G02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0030_B11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LNG01_0056_E11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TCH01_0061_E07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0094_D05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
SPL01_0005_E04.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CLNT1_0071_H03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0007_C01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
BFLT1_0094_G03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0102_C11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TES01_0099_F11.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0182_B02.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0113_F09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TES01_0037_H09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TES01_0060_H07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
UTR01_0102_G01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0008_C12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LVR01_0016_B10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LVRM1_0079_F09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TES01_0053_D12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0095_F03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
PCT01_0002_B09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LNG01_0026_E10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TCH01_0012_H01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LNG01_0005_E12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
LNG01_0013_B09.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TES01_0069_C12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TES01_0073_F12.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGATAATGCAAAGG*ATGAGG*TG
SMG01_0026_B01.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ITT01_0057_D07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TCH01_0093_C07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVRM1_0113_D10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
OVR01_0015_A06.b : ACCTTGGGCATCATGCACTACAACAAGCAGAGCCACAGAGAATGCAAAGGGATGAGGGTG
DCI01_0008_H07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TES01_0086_E10.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
MLTL1_0084_E05.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0043_B07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
ILNT1_0008_B06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TCH01_0006_H11.b : ACCTTGGACATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
CBLT1_0038_E06.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
TES01_0058_C03.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
THY01_0002_E07.b : ACCTTGGGCATCATGCACTACAACAAGCAGGC*CACAGAGAATGCAAAGG*ATGAGG*TG
20110601C-001062 : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
---------+---------+---------+---------+---------+---------+ 519
OVRT1_0067_C01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGGGGACTTTTCTGGTGGGC
OVRM1_0103_H09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ITT01_0058_E12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LVR01_0082_A02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0089_B03.b : AGGCGAGTTCTGGGGCTGC*TGGGTGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0108_E01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0018_A03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TES01_0090_A05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0055_B12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTAGGC
TES01_0081_G09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CCAGGACTTTTCTGGTGGGC
TES01_0017_E01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TES01_0022_F07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGGGGACTTTTCTGGTGGGC
TES01_0028_A03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TES01_0022_F02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0095_E12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ITT01_0101_D05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0012_F07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0033_G10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0086_B09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0068_D02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0006_B11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0025_B09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PBL01_0018_D02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PBL01_0032_G04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TES01_0041_D12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PBL01_0042_E11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0059_B10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ITT01_0058_H04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0087_B10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LNG01_0091_D09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SPL01_0055_H05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0033_E04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0072_B03.b : ggggggttttttgggggctcctgggggcccccttttaaaaaaaaaaaatttttttttggg
TES01_0088_D11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TES01_0072_A02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0056_H01.b : AGGCAAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAAA*CAAGGACTTTTCTGGTGGGC
OVRT1_0047_B06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ITT01_0076_B09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0060_A07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0022_G01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PBL01_0028_H12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0008_C01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0063_G05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LVRM1_0167_B06.b : gcaaatactatggcaacgagatgctctcaaaaagaaagaagcttgcggatcgaaatgtag
OVRM1_0216_A05.b : AGGCGAGTTCTGAGGCTGC*TGCATGCCCTCTCG*AAGA*CGAAGACTTTTCggatagtc
LVRM1_0163_E05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGACGACTTTTCTGGTGGGC
OVRM1_0082_D01.b : ACGCGAGTTCTGAGGCTGCATGGATGCTCACTTGCAAGA*CGAGGACTTGTCTGGaggca
OVRM1_0161_H11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CAAGGACTTTTCTGGTGGGC
LVRM1_0111_A10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0194_A02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0059_D07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0123_B12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0101_A05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CBLT1_0041_G12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0168_D11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0028_A06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SMG01_0016_E08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
DCI01_0022_G09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0041_G01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0062_H06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SPL01_0058_E03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0025_D12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SMG01_0066_E07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
BMWN1_0007_F06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0097_B10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
BMWN1_0090_A06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0004_B03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0015_B05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0086_C02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TCH01_0033_E12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0010_B03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0081_C04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SPL01_0051_C05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0015_E03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
DCI01_0074_E02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TES01_0062_D08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0115_E09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0215_E08.b : AGGCGAGTTCTGGGGCTGC*CGGATGCTCACTTG*CAAA*CGAAGACTTTTCTGGTGGGC
THY01_0103_G08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SMG01_0082_A10.b : AAGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAAGACTTTTCCTGTGGGC
OVR01_0104_G12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
HTMT1_0057_H02.b : AAGCGAAGTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTCCTGGTGGGC
LVRM1_0194_G06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0076_B11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LVRM1_0199_D03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0075_H06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0222_E02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0081_D12.b : AGGCGAGCTCTGGCGCTGC*TGGATGCTCACTTG*AAGG*CGAGGACTTTTCTGGTGGGC
OVRM1_0222_E12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LVRM1_0104_D05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0071_D11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0093_C11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LVR01_0037_B05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0070_F12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0047_C06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0010_D01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0013_H08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0031_G10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0036_D08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
DCI01_0012_F12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0045_C09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0042_C09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SPLT1_0050_G02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0053_E07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PBL01_0026_A10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0038_C06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PBL01_0027_A08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0133_H04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0085_C09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0075_H06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0010_C05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0081_C11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGG*CGAGGACTTTTCTGGTGGGC
PBL01_0089_B03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0094_H11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PBL01_0061_D06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PCT01_0003_C03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0033_E02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LNG01_0088_D05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ITT01_0067_D01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0035_D09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PBL01_0073_F07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0032_H04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0040_F01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0027_H07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
MLN01_0084_F04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PST01_0042_B01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAAA*CAAGGACTTTTCTGGTGGGC
OVRT1_0098_A10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0084_C10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0150_C11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SPL01_0053_H09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
MLN01_0054_C10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0017_H02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ITT01_0014_A03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0033_C06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0053_G03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
MLTL1_0079_F11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0022_D08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0029_F02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LNG01_0065_F09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
DCI01_0042_F02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LNG01_0019_G01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0055_D06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
BFLT1_0066_E07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
MLTL1_0055_E02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0012_H10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0033_E01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0004_F01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0066_D01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0202_A03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0092_E02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0039_A03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LVRM1_0134_G03.b : ttccctttctttacccttcttttgctacctacttctcctgacctttacttcttttacttc
OVRM1_0156_B10.b : aagcaagactaattaacccaaacatgtataaacggcccaccacagcgagtatgctgacca
OVRM1_0120_B04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAAGACTTTTCTGGTGGGC
THY01_0108_F10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TES01_0061_A07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LVRM1_0090_E04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0046_D12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0214_F08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0002_C06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CCAGGACTCTTCTGGTGCGC
LVRM1_0180_E11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0181_E02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LVRM1_0160_F02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0134_H01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LVRM1_0071_A12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0152_D07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LVRM1_0180_H10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0013_F11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0047_B02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0103_B02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0091_E07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0002_F08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0120_D07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0020_C06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0087_A06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0021_A04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LVRM1_0158_H09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0062_F09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0118_E12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0042_D12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LVRM1_0139_C09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0031_D05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0047_D09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0012_B08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TES01_0089_C09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0001_E09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0045_B12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0044_D01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0026_F08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0051_E08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SPL01_0008_E12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TES01_0018_A10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ITT01_0079_B09.b : AGGCAATTTCTGGGGCTGC*TGGATGCTCACTTG*AAAA*CAAGGACTTTTCTGGTGGGC
MLN01_0085_D10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0072_F12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SMG01_0055_G11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0036_G11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TES01_0041_E11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0075_C08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0085_E10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
BFLT1_0113_F08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PBL01_0045_E08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PBL01_0031_G01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SMG01_0070_A04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PBL01_0063_C05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SPL01_0059_E06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0043_F04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTCTCTGGTGGGC
THY01_0026_E11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ADR01_0093_C04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0103_E11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SPL01_0098_A05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
BFLT1_0029_F09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGCGGGC
UTR01_0106_D04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0202_E05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SMG01_0037_G08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SPL01_0089_H09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0124_B11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ITT01_0015_D01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ITT01_0020_A02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0113_C02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
MLN01_0019_D06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
MLN01_0085_C09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ILNT1_0025_D03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TCH01_0004_H07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PBL01_0067_C02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PBL01_0057_E05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LVR01_0044_F10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0048_E10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0040_A09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PBL01_0069_A01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SPLT1_0008_E11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0090_F11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0083_E08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0077_E09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0080_G10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ITT01_0071_H02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PBL01_0081_E05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0028_D02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SPL01_0065_H11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SPL01_0092_G07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
BFLT1_0061_A02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LNG01_0016_F12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ITT01_0062_F12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0040_E02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0091_A10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0100_G12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ITT01_0083_D09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0063_E01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
MLN01_0069_G07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SPL01_0058_B04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0205_A01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
MLN01_0034_A10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0039_E09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TCH01_0091_H09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0044_G08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0053_C06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0048_E05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
MLN01_0067_H11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
MLN01_0066_A09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0063_B08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0049_E05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0007_F02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0202_H05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LNG01_0044_G08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGTGGACTTTTCTGGTGGGC
BFLT1_0076_D02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0203_A09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0021_E06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0085_A02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGAACTTTTCTGGTGGGC
MLN01_0044_B12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
MLTL1_0083_H11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0093_D03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0021_F12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0072_H04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LVRM1_0135_C04.b : acccttccgttagccctttcctttatttttccctttcacccttgttctcccttacccctg
LVRM1_0048_A07.b : gttaaccccggagaataattaatactcccattatcattcaccttcaccatcagcatctcg
OVRM1_0027_F02.b : ATGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AACA*CGAGGACTTTTCTGGCGGGC
OVR01_0075_A05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0151_F05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LVRM1_0187_F01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0091_E09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTACTGGGC
OVRM1_0152_E11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0224_E03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0071_H11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0089_C11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0015_B11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SPL01_0017_A04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TES01_0044_B05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0090_C03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0013_G09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0096_A12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0108_E06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0002_E12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0033_C06.b : AAGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
BFLT1_0103_E04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0006_A09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SMG01_0074_F03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PBL01_0045_F06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0147_H05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0142_C03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
BFLT1_0063_C12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PBL01_0044_E06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
MLN01_0004_D12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0001_H11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0030_H11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0076_B04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ITT01_0061_G09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0129_A05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0098_F08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0029_A07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
BKFL1_0014_F05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0111_G10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ITT01_0018_H07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PBL01_0030_G06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LNG01_0096_F11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
MLN01_0041_F02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ITT01_0049_H04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACCTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0059_A05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0062_C06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
MLN01_0045_D05.b : AGGCGAGTTCTGGGGCTGC*CGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0026_D05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SMG01_0084_C07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PBL01_0010_D10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0081_G08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0013_D09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PBL01_0016_G04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0067_G07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0132_A05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LNG01_0093_F11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0150_D11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PBL01_0064_H09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0073_F02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ITT01_0015_F05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ITT01_0070_G03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ADR01_0069_F01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0132_B02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SPL01_0052_B10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PCT01_0020_C03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ITT01_0006_B11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0052_H01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0063_B10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SPL01_0047_D01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0069_G02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ITT01_0006_E09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LNG01_0030_E11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0031_F10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LNG01_0062_A09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LNG01_0102_B06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LNG01_0059_H02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0023_C07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LNG01_0021_C04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PBL01_0046_A10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0074_D09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LNG01_0017_F03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LNG01_0017_D05.b : AGGCAAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAAA*CAAGAACTTTTCTGGTGGGC
CLNT1_0026_G01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRT1_0080_H08.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TCH01_0086_C07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0027_D07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0091_C02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TCH01_0057_A09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TCH01_0035_G02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0030_B11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LNG01_0056_E11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TCH01_0061_E07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0094_D05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SPL01_0005_E04.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CLNT1_0071_H03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0007_C01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
BFLT1_0094_G03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0102_C11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TES01_0099_F11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0182_B02.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0113_F09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TES01_0037_H09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TES01_0060_H07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
UTR01_0102_G01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0008_C12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LVR01_0016_B10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LVRM1_0079_F09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGG*************AC
TES01_0053_D12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0095_F03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
PCT01_0002_B09.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LNG01_0026_E10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TCH01_0012_H01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LNG01_0005_E12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
LNG01_0013_B09.b : AGGCGAGTTCTGGGGCTGC*TGGATACTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TES01_0069_C12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TES01_0073_F12.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
SMG01_0026_B01.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ITT01_0057_D07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TCH01_0093_C07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVRM1_0113_D10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
OVR01_0015_A06.b : AGGCGAGTTCTGGGGCTGGCTGGATGCCCACTTG*AAGAACGAGGACTTTTCTGGTGGGC
DCI01_0008_H07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CAATGACTTTTCTGGTGGGC
TES01_0086_E10.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
MLTL1_0084_E05.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0043_B07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
ILNT1_0008_B06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TCH01_0006_H11.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
CBLT1_0038_E06.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
TES01_0058_C03.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
THY01_0002_E07.b : AGGCGAGTTCTGGGGCTGC*TGGATGCTCACTTG*AAGA*CGAGGACTTTTCTGGTGGGC
20110601C-001062 : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
---------+---------+---------+---------+---------+---------+ 577
OVRT1_0067_C01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0103_H09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTNACAAC
ITT01_0058_E12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LVR01_0082_A02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0089_B03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0108_E01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0018_A03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TES01_0090_A05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
THY01_0055_B12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TES01_0081_G09.b : GAACGAGTGAAGCTGGC*TGAAATCATAGTTGTATGCTCCC*TGTTTTGGCTCTTACAAC
TES01_0017_E01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TES01_0022_F07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
TES01_0028_A03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TES01_0022_F02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0095_E12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
ITT01_0101_D05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0012_F07.b : GAACGTGTGACGCTGGC*TGACATCACAGCTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0033_G10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0086_B09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
THY01_0068_D02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0006_B11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0025_B09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
PBL01_0018_D02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
PBL01_0032_G04.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
TES01_0041_D12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
PBL01_0042_E11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0059_B10.b : GAACGTGTGACGCTGGC*TGACATCACAATTGTCTGCACCC*TGTTGTGGCTCTACAAAC
ITT01_0058_H04.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0087_B10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LNG01_0091_D09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
SPL01_0055_H05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0033_E04.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0072_B03.b : ggaaaaaagttgaacccccctgaaaaaccccaaattttttccccccccttggggtggtcc
TES01_0088_D11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TES01_0072_A02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0056_H01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0047_B06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
ITT01_0076_B09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0060_A07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0022_G01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTACACCC*TGTTGTGGCTCTACAAAC
PBL01_0028_H12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0008_C01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0063_G05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
LVRM1_0167_B06.b : cgaaaccggcaccatatgatatagacaagaataccgcacgaaccgagtcagatgggctac
OVRM1_0216_A05.b : caagatgtgcagatgccggacatcacagatgtccgcgaatcgacggatccccgcaagaat
LVRM1_0163_E05.b : GAACGTGTGACTCTGGC*TTACATCACAATTTACTGCACCC*GGGTGAGGATCTAAAAAC
OVRM1_0082_D01.b : caacgtgacacgcgtgatgacatcaaaattgtgctgaaccctgaatgacgctctacaacc
OVRM1_0161_H11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LVRM1_0111_A10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*CGTTGTGGCTCTACAAAC
OVRM1_0194_A02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0059_D07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0123_B12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0101_A05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
CBLT1_0041_G12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0168_D11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0028_A06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
SMG01_0016_E08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGCTGTGGCTCTACAAAC
DCI01_0022_G09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
THY01_0041_G01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0062_H06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
SPL01_0058_E03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0025_D12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
SMG01_0066_E07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
BMWN1_0007_F06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0097_B10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
BMWN1_0090_A06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0004_B03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0015_B05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0086_C02.b : GAACGTGTGACGCTGGC*TGACATCACGGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TCH01_0033_E12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0010_B03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0081_C04.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
SPL01_0051_C05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0015_E03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
DCI01_0074_E02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TES01_0062_D08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTTCAAAC
THY01_0115_E09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGgttctacaaa
OVRM1_0215_E08.b : GAACGTGTGACGCTGGC*TGACATCACACCTGTCTGCCACC*TGTTGTGGCTCTACCAAa
THY01_0103_G08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
SMG01_0082_A10.b : GAACGTGTGACCCTGGC*TGACATCACAAGTGGATGCACCCTGGTGGGGCCTCTACAACA
OVR01_0104_G12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
HTMT1_0057_H02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAA
LVRM1_0194_G06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0076_B11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LVRM1_0199_D03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0075_H06.b : GAACGTGTGACGCTGGC*TGACATCACAATTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0222_E02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0081_D12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0222_E12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LVRM1_0104_D05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTNACAAC
OVR01_0071_D11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0093_C11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LVR01_0037_B05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0070_F12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0047_C06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0010_D01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0013_H08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0031_G10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0036_D08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
DCI01_0012_F12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
THY01_0045_C09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0042_C09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
SPLT1_0050_G02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0053_E07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
PBL01_0026_A10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0038_C06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
PBL01_0027_A08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0133_H04.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0085_C09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0075_H06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0010_C05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0081_C11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
PBL01_0089_B03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0094_H11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
PBL01_0061_D06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
PCT01_0003_C03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0033_E02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
LNG01_0088_D05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
ITT01_0067_D01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0035_D09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
PBL01_0073_F07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0032_H04.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0040_F01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0027_H07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
MLN01_0084_F04.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
PST01_0042_B01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0098_A10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0084_C10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0150_C11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
SPL01_0053_H09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
MLN01_0054_C10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0017_H02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
ITT01_0014_A03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0033_C06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0053_G03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
MLTL1_0079_F11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0022_D08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0029_F02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LNG01_0065_F09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
DCI01_0042_F02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LNG01_0019_G01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0055_D06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
BFLT1_0066_E07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
MLTL1_0055_E02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0012_H10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0033_E01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0004_F01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0066_D01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0202_A03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0092_E02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0039_A03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LVRM1_0134_G03.b : ttacctttccccattcttctcacttttttctttatcttcttttctttttttcccttttct
OVRM1_0156_B10.b : gttcactggagccagaggaagtgcaccactatcgcgaagtataaacggggagaggtaccc
OVRM1_0120_B04.b : AAACGTGTGACGCTGGC*TGACATCACATTTGTCTGCACCC*TGTTGTGGCTCTACAGAC
THY01_0108_F10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TES01_0061_A07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LVRM1_0090_E04.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0046_D12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0214_F08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0002_C06.b : GAACGCGTGACGCTGGC*TGACATCACAGCTGTCCGCACCC*TGTTGTGGCTCTACCAAC
LVRM1_0180_E11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0181_E02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LVRM1_0160_F02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0134_H01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LVRM1_0071_A12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0152_D07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LVRM1_0180_H10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0013_F11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0047_B02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0103_B02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
THY01_0091_E07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0002_F08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0120_D07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0020_C06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0087_A06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0021_A04.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LVRM1_0158_H09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0062_F09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACNAAC
OVRM1_0118_E12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0042_D12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LVRM1_0139_C09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0031_D05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0047_D09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0012_B08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TES01_0089_C09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0001_E09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
THY01_0045_B12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0044_D01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0026_F08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0051_E08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
SPL01_0008_E12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TES01_0018_A10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
ITT01_0079_B09.b : AAACGTGTGACCCTGGC*TAACATCACATTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
MLN01_0085_D10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0072_F12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
SMG01_0055_G11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
THY01_0036_G11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TES01_0041_E11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0075_C08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0085_E10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
BFLT1_0113_F08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
PBL01_0045_E08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
PBL01_0031_G01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
SMG01_0070_A04.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
PBL01_0063_C05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
SPL01_0059_E06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0043_F04.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
THY01_0026_E11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
ADR01_0093_C04.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0103_E11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
SPL01_0098_A05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
BFLT1_0029_F09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0106_D04.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0202_E05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
SMG01_0037_G08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
SPL01_0089_H09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0124_B11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
ITT01_0015_D01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
ITT01_0020_A02.b : GGACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0113_C02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
MLN01_0019_D06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
MLN01_0085_C09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
ILNT1_0025_D03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TCH01_0004_H07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
PBL01_0067_C02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
PBL01_0057_E05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LVR01_0044_F10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0048_E10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0040_A09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
PBL01_0069_A01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
SPLT1_0008_E11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0090_F11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0083_E08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0077_E09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0080_G10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
ITT01_0071_H02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
PBL01_0081_E05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCCCTACAAAC
CLNT1_0028_D02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
SPL01_0065_H11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
SPL01_0092_G07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
BFLT1_0061_A02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LNG01_0016_F12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
ITT01_0062_F12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0040_E02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0091_A10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0100_G12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
ITT01_0083_D09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0063_E01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
MLN01_0069_G07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
SPL01_0058_B04.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0205_A01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
MLN01_0034_A10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
THY01_0039_E09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TCH01_0091_H09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0044_G08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0053_C06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0048_E05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
MLN01_0067_H11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
MLN01_0066_A09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0063_B08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0049_E05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0007_F02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0202_H05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LNG01_0044_G08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
BFLT1_0076_D02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0203_A09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0021_E06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0085_A02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
MLN01_0044_B12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
MLTL1_0083_H11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
THY01_0093_D03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0021_F12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0072_H04.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
LVRM1_0135_C04.b : cttcacttttgacctccttcgccgttctttccattattttttttttccctcccgtctgtt
LVRM1_0048_A07.b : caccccacacataccttacttaatgcatttccataagtcgctttttccccgaagtttttt
OVRM1_0027_F02.b : AAACATGTGACCCTGGC*TGCAATCACAGCTGTCTGCACCC*TGTTGCGGCTaatacaat
OVR01_0075_A05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0151_F05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LVRM1_0187_F01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0091_E09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCCCTGCTGTGGCTCTACAAAC
OVRM1_0152_E11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0224_E03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0071_H11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0089_C11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0015_B11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
SPL01_0017_A04.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TES01_0044_B05.b : GGACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0090_C03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0013_G09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0096_A12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0108_E06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0002_E12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0033_C06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
BFLT1_0103_E04.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0006_A09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
SMG01_0074_F03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
PBL01_0045_F06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0147_H05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0142_C03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
BFLT1_0063_C12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
PBL01_0044_E06.b : GGACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
MLN01_0004_D12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0001_H11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0030_H11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0076_B04.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
ITT01_0061_G09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0129_A05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0098_F08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0029_A07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
BKFL1_0014_F05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0111_G10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
ITT01_0018_H07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
PBL01_0030_G06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAGC
LNG01_0096_F11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
MLN01_0041_F02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
ITT01_0049_H04.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0059_A05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0062_C06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
MLN01_0045_D05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
THY01_0026_D05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
SMG01_0084_C07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
PBL01_0010_D10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0081_G08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0013_D09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
PBL01_0016_G04.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0067_G07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0132_A05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LNG01_0093_F11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0150_D11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
PBL01_0064_H09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0073_F02.b : GAGCGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
ITT01_0015_F05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
ITT01_0070_G03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
ADR01_0069_F01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0132_B02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
SPL01_0052_B10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
PCT01_0020_C03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
ITT01_0006_B11.b : GAGCGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0052_H01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0063_B10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
SPL01_0047_D01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0069_G02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
ITT01_0006_E09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
LNG01_0030_E11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0031_F10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LNG01_0062_A09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LNG01_0102_B06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
LNG01_0059_H02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0023_C07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LNG01_0021_C04.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
PBL01_0046_A10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0074_D09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LNG01_0017_F03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LNG01_0017_D05.b : AAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0026_G01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRT1_0080_H08.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TCH01_0086_C07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0027_D07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0091_C02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TCH01_0057_A09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TCH01_0035_G02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0030_B11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LNG01_0056_E11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
TCH01_0061_E07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
UTR01_0094_D05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
SPL01_0005_E04.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
CLNT1_0071_H03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0007_C01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
BFLT1_0094_G03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
THY01_0102_C11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TES01_0099_F11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0182_B02.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0113_F09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TES01_0037_H09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TES01_0060_H07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCCCTACAAAC
UTR01_0102_G01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
THY01_0008_C12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
LVR01_0016_B10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LVRM1_0079_F09.b : TTTCGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACNAAC
TES01_0053_D12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0095_F03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
PCT01_0002_B09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
LNG01_0026_E10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
TCH01_0012_H01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
LNG01_0005_E12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
LNG01_0013_B09.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TES01_0069_C12.b : GAAAGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTTCAAAC
TES01_0073_F12.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACCAAC
SMG01_0026_B01.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
ITT01_0057_D07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
TCH01_0093_C07.b : GAACGTGAGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVRM1_0113_D10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
OVR01_0015_A06.b : GAACGTGTGACGCTGGCTTGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
DCI01_0008_H07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TES01_0086_E10.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
MLTL1_0084_E05.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
THY01_0043_B07.b : GAACGTGTGACGCTGAC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
ILNT1_0008_B06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TCH01_0006_H11.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTGTGCACCC*TGTTGTGGCTCTACAAAC
CBLT1_0038_E06.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTCTGCACCC*TGTTGTGGCTCTACAAAC
TES01_0058_C03.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
THY01_0002_E07.b : GAACGTGTGACGCTGGC*TGACATCACAGTTGTATGCACCC*TGTTGTGGCTCTACAAAC
20110601C-001062 : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
---------+---------+---------+---------+---------+---------+ 634
OVRT1_0067_C01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0103_H09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ITT01_0058_E12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LVR01_0082_A02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0089_B03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0108_E01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0018_A03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TES01_0090_A05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0055_B12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TES01_0081_G09.b : ATGTCCTGGA*ACCTTCTTTTCCCCAAGTCTTCCCCAATtacataacgctggattcccca
TES01_0017_E01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TES01_0022_F07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TES01_0028_A03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TES01_0022_F02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0095_E12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ITT01_0101_D05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0012_F07.b : AGGTCCTGGA*GCCTTCTTTCCGACAGGCCTTCCCCAATACCAACC*GTTGGTTCC*TCA
OVRM1_0033_G10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0086_B09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0068_D02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0006_B11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0025_B09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0018_D02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0032_G04.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TES01_0041_D12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0042_E11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0059_B10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ITT01_0058_H04.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0087_B10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LNG01_0091_D09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTCCCCCAATACCAACC*GCTGGTTCC*TCA
SPL01_0055_H05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0033_E04.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0072_B03.b : taaaaaaaaagggttgggggggttttttttttttcccggggtttttcccaaaaaaaaaaa
TES01_0088_D11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TES01_0072_A02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGGTCC*CTC
OVR01_0056_H01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0047_B06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ITT01_0076_B09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0060_A07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0022_G01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0028_H12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0008_C01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0063_G05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LVRM1_0167_B06.b : aacgacgccagacttatgcgatgagattgtgggcgtagcccaaactgacaggacaataac
OVRM1_0216_A05.b : gacctgaattcatcattccgccataccttccccaatactatagtgtgataaactcccgta
LVRM1_0163_E05.b : AGGTCCgagaagccttctatcacgccgatgctccaccacaggagcgaccggattcccccc
OVRM1_0082_D01.b : aggaaatgaagcctgtctttccaccaggcctacccccggaagcagcgctgagctctccac
OVRM1_0161_H11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LVRM1_0111_A10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0194_A02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0059_D07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0123_B12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0101_A05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CBLT1_0041_G12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0168_D11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0028_A06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
SMG01_0016_E08.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
DCI01_0022_G09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TTC
THY01_0041_G01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0062_H06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
SPL01_0058_E03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0025_D12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
SMG01_0066_E07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
BMWN1_0007_F06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0097_B10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
BMWN1_0090_A06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0004_B03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0015_B05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0086_C02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TCH01_0033_E12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0010_B03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0081_C04.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
SPL01_0051_C05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0015_E03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
DCI01_0074_E02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TES01_0062_D08.b : AGGTCCTGGA*GCCTTCTTTTCGCCcaggccgtccccaattacaaaccgctggttcccca
THY01_0115_E09.b : caagtcctggaccctctttccgccaggcctccccataccaccgctgttcctcacctattt
OVRM1_0215_E08.b : atgtctctggagccctcttttcgccatgatttccccaaacaaattgttggttcttctccc
THY01_0103_G08.b : AGGTCCTGGA*GCCTTCTTccgccagcccttcccaataccaccgctggtttcttacctta
SMG01_0082_A10.b : GGGTCCTGGA*GCCTTCTTTCCGCAAGGCTTTCCCCAATACAAACC*GCTGTTTCCCacc
OVR01_0104_G12.b : AGGTCCTGGA*GCCTTCTTTTCGCCAGGCCTTCCCCAATACCCACC*GCTGGTTCC*TCA
HTMT1_0057_H02.b : CAGTCCTGGAAGCCTTCTTTCCGCCAGGCCTTCCCCAATACCAAC**GCTGGGTCC*TCA
LVRM1_0194_G06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0076_B11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LVRM1_0199_D03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0075_H06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0222_E02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0081_D12.b : AGGTCCTGCA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0222_E12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LVRM1_0104_D05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0071_D11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0093_C11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LVR01_0037_B05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0070_F12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0047_C06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0010_D01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0013_H08.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0031_G10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0036_D08.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
DCI01_0012_F12.b : AGGTCCTGGA*GCCTTCTTTCCNGCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0045_C09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0042_C09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
SPLT1_0050_G02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0053_E07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0026_A10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0038_C06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0027_A08.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0133_H04.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0085_C09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0075_H06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0010_C05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0081_C11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0089_B03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0094_H11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0061_D06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PCT01_0003_C03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0033_E02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LNG01_0088_D05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ITT01_0067_D01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0035_D09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0073_F07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0032_H04.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0040_F01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0027_H07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
MLN01_0084_F04.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PST01_0042_B01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0098_A10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0084_C10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0150_C11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
SPL01_0053_H09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
MLN01_0054_C10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0017_H02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ITT01_0014_A03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0033_C06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0053_G03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
MLTL1_0079_F11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0022_D08.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0029_F02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LNG01_0065_F09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
DCI01_0042_F02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LNG01_0019_G01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0055_D06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
BFLT1_0066_E07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
MLTL1_0055_E02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0012_H10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0033_E01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0004_F01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0066_D01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0202_A03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0092_E02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0039_A03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LVRM1_0134_G03.b : tccttttccctttacttctattccccttgctccccctttttctcctttatctcccatctt
OVRM1_0156_B10.b : tcaatgaatgcgcgtgccatccacacggaattaggccagacaaggtgtagaggacacaaa
OVRM1_0120_B04.b : AGGcctggatcttctttccgccaggccgtccccaatacagccgcgggttcctcatacgcg
THY01_0108_F10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCCTTCCCAATAC*AANC*GCTGGTTCt
TES01_0061_A07.b : AAGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LVRM1_0090_E04.b : AGGTCCTGGA*GCCATCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0046_D12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTTCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0214_F08.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATAACTACC*GCTGGTTCC*TCA
THY01_0002_C06.b : AGGTCCTGCA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCC
LVRM1_0180_E11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAAGCCTTCCCCAATACCAACC*GCTGGGTTC*TCA
OVRM1_0181_E02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LVRM1_0160_F02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGGTCC*TCA
OVRM1_0134_H01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCTCCATACCAACC*GCTGGTTCC*TCA
LVRM1_0071_A12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATA*CAACC*GCTGGTTCC*TCA
OVRM1_0152_D07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LVRM1_0180_H10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0013_F11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0047_B02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0103_B02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0091_E07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCCCTCA
UTR01_0002_F08.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0120_D07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0020_C06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0087_A06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0021_A04.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*CCA
LVRM1_0158_H09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0062_F09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0118_E12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0042_D12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LVRM1_0139_C09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0031_D05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0047_D09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0012_B08.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*CCTGGTTCC*TCA
TES01_0089_C09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0001_E09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0045_B12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0044_D01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0026_F08.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0051_E08.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
SPL01_0008_E12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TES01_0018_A10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ITT01_0079_B09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
MLN01_0085_D10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0072_F12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
SMG01_0055_G11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0036_G11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TES01_0041_E11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0075_C08.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0085_E10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
BFLT1_0113_F08.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0045_E08.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0031_G01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
SMG01_0070_A04.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0063_C05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
SPL01_0059_E06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0043_F04.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0026_E11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCGACC*GCTGGTTCC*TCA
ADR01_0093_C04.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0103_E11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
SPL01_0098_A05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
BFLT1_0029_F09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0106_D04.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0202_E05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
SMG01_0037_G08.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
SPL01_0089_H09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0124_B11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ITT01_0015_D01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ITT01_0020_A02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0113_C02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
MLN01_0019_D06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
MLN01_0085_C09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ILNT1_0025_D03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TCH01_0004_H07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0067_C02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0057_E05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LVR01_0044_F10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0048_E10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0040_A09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0069_A01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
SPLT1_0008_E11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0090_F11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0083_E08.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0077_E09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0080_G10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ITT01_0071_H02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0081_E05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0028_D02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
SPL01_0065_H11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCG
SPL01_0092_G07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
BFLT1_0061_A02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LNG01_0016_F12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ITT01_0062_F12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0040_E02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0091_A10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0100_G12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ITT01_0083_D09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0063_E01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
MLN01_0069_G07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
SPL01_0058_B04.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0205_A01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
MLN01_0034_A10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0039_E09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TCH01_0091_H09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0044_G08.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0053_C06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0048_E05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
MLN01_0067_H11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
MLN01_0066_A09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0063_B08.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0049_E05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0007_F02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0202_H05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LNG01_0044_G08.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
BFLT1_0076_D02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0203_A09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0021_E06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0085_A02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
MLN01_0044_B12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
MLTL1_0083_H11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0093_D03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0021_F12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0072_H04.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LVRM1_0135_C04.b : acccaaatattctccttctatcccccatttttactctcttgttttactcttaacctattt
LVRM1_0048_A07.b : aagaggcataacgaccaccccaatcaaaaaataccccgttcgtacacacctctacatgca
OVRM1_0027_F02.b : caagcccctggagcctgatttccaacaacccttccccacaccacccggtggtctcttaac
OVR01_0075_A05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0151_F05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LVRM1_0187_F01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0091_E09.b : AGGTCCTCGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0152_E11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0224_E03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0071_H11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTCCC*TCA
OVRM1_0089_C11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0015_B11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
SPL01_0017_A04.b : AAGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TES01_0044_B05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0090_C03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0013_G09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0096_A12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0108_E06.b : AGGTCCTGAA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0002_E12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0033_C06.b : AGGTCCTGGA*GCCTTCTTTCCACCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
BFLT1_0103_E04.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0006_A09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
SMG01_0074_F03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0045_F06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0147_H05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0142_C03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
BFLT1_0063_C12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0044_E06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
MLN01_0004_D12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0001_H11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0030_H11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0076_B04.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ITT01_0061_G09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0129_A05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0098_F08.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0029_A07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
BKFL1_0014_F05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0111_G10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ITT01_0018_H07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0030_G06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LNG01_0096_F11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
MLN01_0041_F02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ITT01_0049_H04.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0059_A05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0062_C06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
MLN01_0045_D05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0026_D05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
SMG01_0084_C07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0010_D10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0081_G08.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0013_D09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0016_G04.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0067_G07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0132_A05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LNG01_0093_F11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0150_D11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0064_H09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0073_F02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ITT01_0015_F05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ITT01_0070_G03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ADR01_0069_F01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0132_B02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
SPL01_0052_B10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PCT01_0020_C03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ITT01_0006_B11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0052_H01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0063_B10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
SPL01_0047_D01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0069_G02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ITT01_0006_E09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LNG01_0030_E11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0031_F10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LNG01_0062_A09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LNG01_0102_B06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LNG01_0059_H02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0023_C07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LNG01_0021_C04.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PBL01_0046_A10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0074_D09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LNG01_0017_F03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LNG01_0017_D05.b : AGGTCCTGAA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0026_G01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRT1_0080_H08.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TCH01_0086_C07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0027_D07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0091_C02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TCH01_0057_A09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TCH01_0035_G02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0030_B11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LNG01_0056_E11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TCH01_0061_E07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0094_D05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
SPL01_0005_E04.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CLNT1_0071_H03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0007_C01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
BFLT1_0094_G03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0102_C11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCC*AATACaaccgcgtgttctcacctg
TES01_0099_F11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTT*CCCAATACCAACC*GCTGGGTCC*TCA
OVRM1_0182_B02.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0113_F09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TES01_0037_H09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TES01_0060_H07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
UTR01_0102_G01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0008_C12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LVR01_0016_B10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LVRM1_0079_F09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TES01_0053_D12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0095_F03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
PCT01_0002_B09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LNG01_0026_E10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TCH01_0012_H01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LNG01_0005_E12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
LNG01_0013_B09.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TES01_0069_C12.b : AGGTCCTGTA*GCCTTCTTTCCGCCAGGCCTTTCCCAAAACCAACCTGCTGGTTCC*TCA
TES01_0073_F12.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TTC
SMG01_0026_B01.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ITT01_0057_D07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TCH01_0093_C07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVRM1_0113_D10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
OVR01_0015_A06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
DCI01_0008_H07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TES01_0086_E10.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
MLTL1_0084_E05.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCCCTTCCCATACCAACC*GCTGGTTCC*TCA
THY01_0043_B07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
ILNT1_0008_B06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TCH01_0006_H11.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
CBLT1_0038_E06.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
TES01_0058_C03.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
THY01_0002_E07.b : AGGTCCTGGA*GCCTTCTTTCCGCCAGGCCTTCCCCAATACCAACC*GCTGGTTCC*TCA
20110601C-001062 : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
---------+---------+---------+---------+---------+---------+ 688
OVRT1_0067_C01.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRM1_0103_H09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAA*GGTGAGCTC*TGTG
ITT01_0058_E12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
LVR01_0082_A02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0089_B03.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRT1_0108_E01.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0018_A03.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
TES01_0090_A05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0055_B12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
TES01_0081_G09.b : ccagaaataaaccaacaccaatttaccggacgtttttgggggaaggaaaaacctctttta
TES01_0017_E01.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
TES01_0022_F07.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
TES01_0028_A03.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
TES01_0022_F02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0095_E12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TTGGGGAG*GTGAAGCTC*TGTG
ITT01_0101_D05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRM1_0012_F07.b : C*CTGCATTAACTCAGCCCAGATCCGGACTGTC*T**TGGGGGAG*GTGAAGCTC*TGCG
OVRM1_0033_G10.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0086_B09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0068_D02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
UTR01_0006_B11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
UTR01_0025_B09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
PBL01_0018_D02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTN*C**TGGGGGAG*GTGAAGCTC*TGTG
PBL01_0032_G04.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGNGGGAG*GTGAAGCTC*TGTG
TES01_0041_D12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
PBL01_0042_E11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGNGGGAG*GTGAAGCTC*TGTG
THY01_0059_B10.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
ITT01_0058_H04.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRT1_0087_B10.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
LNG01_0091_D09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGNGGGAG*GTGAAGCTC*TGTG
SPL01_0055_H05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0033_E04.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0072_B03.b : aaagggggtgtttccctcccctttttttaaaacccccccctttcttcccgtggttttttt
TES01_0088_D11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTCTT**GAGGGGAG*GTGAAGCTC*TGTG
TES01_0072_A02.b : A*CTGCATTAACCAGCCCCAGTTCCGGGCTGTN*C**TGGGGGAA*GTGAAGCTC*TGTG
OVR01_0056_H01.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRT1_0047_B06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
ITT01_0076_B09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0060_A07.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRT1_0022_G01.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
PBL01_0028_H12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGNGGGAG*GTGAAGCTC*TGTG
OVRT1_0008_C01.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
UTR01_0063_G05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
LVRM1_0167_B06.b : tagaacctataagagacgttacagaattacgtttctatacagatacgcggaagtttatgc
OVRM1_0216_A05.b : gctgagaagcatcataacctacaaccgcacagctcatataccccatcatatgtacgcgcc
LVRM1_0163_E05.b : cttggattgaaaccaacagcatcttccggggctgtactcgcgcgaaagtggaatttctga
OVRM1_0082_D01.b : tgcattaacagacccgaattccagattgtcgggtggaaggaagaatctgtgcaacataga
OVRM1_0161_H11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
LVRM1_0111_A10.b : CCCTGCATTAA*CAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRM1_0194_A02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRM1_0059_D07.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRM1_0123_B12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0101_A05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
CBLT1_0041_G12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRM1_0168_D11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRM1_0028_A06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
SMG01_0016_E08.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
DCI01_0022_G09.b : A*CTGCATTAACCAGCCC*AGTTTCGGGCTGTC*T**TGGGGGAA*GTGAAGCTC*TGTG
THY01_0041_G01.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0062_H06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGNGGGAG*GTGAAGCTC*TGTG
SPL01_0058_E03.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGGG
OVR01_0025_D12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
SMG01_0066_E07.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
BMWN1_0007_F06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0097_B10.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
BMWN1_0090_A06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRT1_0004_B03.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
CLNT1_0015_B05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0086_C02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
TCH01_0033_E12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRT1_0010_B03.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
UTR01_0081_C04.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
SPL01_0051_C05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
CLNT1_0015_E03.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
DCI01_0074_E02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
TES01_0062_D08.b : cctggcattaaccaagccccatttctgggctgcctggggggaggtgaatctctgtgaaaa
THY01_0115_E09.b : aacacccccctctggggggttttgggggaggaaagtttggaaaaaag
OVRM1_0215_E08.b : acgattacactgcccccacatccggactgtcctgaagcaagtgcaagtctatacagaaaa
THY01_0103_G08.b : ttaaacacccagttctgggggttgtg
SMG01_0082_A10.b : cggaataacaacccccatttccggggtgcttgggggaaggtaaactctgtgaaaaaaagg
OVR01_0104_G12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGGAGGTGAACCTC*TGTG
HTMT1_0057_H02.b : C*CTGCATTAACAA*CCCCAGTTCCGGGCTGTC*T**TGGGGGAA*GGGAAACTC*TGTG
LVRM1_0194_G06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGCGGA*GGGAAGCTC*TGTG
OVR01_0076_B11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
LVRM1_0199_D03.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRM1_0075_H06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRM1_0222_E02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0081_D12.b : C*CTGCATTAACCAGCCCCAGTCCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRM1_0222_E12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAA*GTGAAGCTC*TGTG
LVRM1_0104_D05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0071_D11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0093_C11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
LVR01_0037_B05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0070_F12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRM1_0047_C06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0010_D01.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
UTR01_0013_H08.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRM1_0031_G10.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRT1_0036_D08.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
DCI01_0012_F12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAA*GTGAAGCTC*TGTG
THY01_0045_C09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0042_C09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
SPLT1_0050_G02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGNGGGAG*GTGAAGCTC*TGTG
OVR01_0053_E07.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
PBL01_0026_A10.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGNGGGAG*GTGAAGCTC*TGTG
UTR01_0038_C06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
PBL01_0027_A08.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGNGGGAG*GTGAAGCTC*TGTG
CLNT1_0133_H04.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0085_C09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
UTR01_0075_H06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRT1_0010_C05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0081_C11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
PBL01_0089_B03.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0094_H11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
PBL01_0061_D06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
PCT01_0003_C03.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0033_E02.b : C*CTGCATTAACCAGCCCCAGTCCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
LNG01_0088_D05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
ITT01_0067_D01.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0035_D09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
PBL01_0073_F07.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0032_H04.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0040_F01.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
CLNT1_0027_H07.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
MLN01_0084_F04.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
PST01_0042_B01.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRT1_0098_A10.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
UTR01_0084_C10.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
CLNT1_0150_C11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
SPL01_0053_H09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
MLN01_0054_C10.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0017_H02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
ITT01_0014_A03.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0033_C06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0053_G03.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
MLTL1_0079_F11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRT1_0022_D08.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
CLNT1_0029_F02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
LNG01_0065_F09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
DCI01_0042_F02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAA*GTGAAGCTC*TGTG
LNG01_0019_G01.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC**GTG
THY01_0055_D06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
BFLT1_0066_E07.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
MLTL1_0055_E02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0012_H10.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0033_E01.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRT1_0004_F01.b : C*CTGCATTAACTAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0066_D01.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0202_A03.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0092_E02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0039_A03.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
LVRM1_0134_G03.b : cttttctttccttataacccgttctgctatttttcttctatcattttttctttctccccg
OVRM1_0156_B10.b : gtactgtgagcaagggagacgaacaaagtaacgccctgacttagtagtcgaccacagaca
OVRM1_0120_B04.b : agaaacagccgcaaatccggcatgattgggcgacgggaaacgctgttagacgatgagcca
THY01_0108_F10.b :
TES01_0061_A07.b : C*CTGCATTAACCAGCCCCAATTCCGGGCTGTC*T**TGGGGGAG*GTGAAACTC*TGTA
LVRM1_0090_E04.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*C**TGGGGGAG*GCTTAGCAC*TGTG
OVRM1_0046_D12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGTGGGAG*GTGAAGCTC*TGCG
OVRM1_0214_F08.b : C*CTGAATTAACCAGCCCAA*TTCCGGGCTGTC*T**TGGAGGGA*GCTGAACTC*TGTG
THY01_0002_C06.b : C*CTGCATTAACCACTCCCAGTTCCGGGCTtgtttgtcgcgagcgcaacttctgtgaaaa
LVRM1_0180_E11.b : C*CTGCATTAACCAGCCCCAGTTTCCGGCTGTCCT**GGGGGGAG*GTGAAACTC*TGTA
OVRM1_0181_E02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAA*GTGAAGCTC*TGTG
LVRM1_0160_F02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRM1_0134_H01.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
LVRM1_0071_A12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTCTT**GGTGGGAG*GTGAAGCTC*TGTG
OVRM1_0152_D07.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
LVRM1_0180_H10.b : C*CTGCATTAACCAGCCCCAGTTCCAGGCTGTC*T**TGNGGGAA*GTGAAGCTC*TGTG
THY01_0013_F11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAC*GTGAAGCTC*TGTG
OVRM1_0047_B02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0103_B02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0091_E07.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTCCTGTG
UTR01_0002_F08.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRM1_0120_D07.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAA*GTGAAGCTC*TGTG
OVRM1_0020_C06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRM1_0087_A06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0021_A04.b : C*CTGCATTAACCAGCCCCAGCTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
LVRM1_0158_H09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRM1_0062_F09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRM1_0118_E12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRM1_0042_D12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
LVRM1_0139_C09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRM1_0031_D05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0047_D09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAGGGTGAAGCTC*TGTG
OVRM1_0012_B08.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
TES01_0089_C09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
UTR01_0001_E09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0045_B12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0044_D01.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
UTR01_0026_F08.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0051_E08.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
SPL01_0008_E12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
TES01_0018_A10.b : C*CTGCATTAACCAACCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
ITT01_0079_B09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAACCTC*TGTG
MLN01_0085_D10.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0072_F12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
SMG01_0055_G11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0036_G11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
TES01_0041_E11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
CLNT1_0075_C08.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
UTR01_0085_E10.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
BFLT1_0113_F08.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
PBL01_0045_E08.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
PBL01_0031_G01.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
SMG01_0070_A04.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
PBL01_0063_C05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
SPL01_0059_E06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
UTR01_0043_F04.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0026_E11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
ADR01_0093_C04.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
UTR01_0103_E11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
SPL01_0098_A05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
BFLT1_0029_F09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
UTR01_0106_D04.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0202_E05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGAGGGAG*GTGAAGCTC*TGTG
SMG01_0037_G08.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
SPL01_0089_H09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRT1_0124_B11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
ITT01_0015_D01.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
ITT01_0020_A02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
CLNT1_0113_C02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
MLN01_0019_D06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
MLN01_0085_C09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
ILNT1_0025_D03.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
TCH01_0004_H07.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
PBL01_0067_C02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
PBL01_0057_E05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
LVR01_0044_F10.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0048_E10.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
CLNT1_0040_A09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
PBL01_0069_A01.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
SPLT1_0008_E11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
CLNT1_0090_F11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
UTR01_0083_E08.b : C*CTCCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRT1_0077_E09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0080_G10.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
ITT01_0071_H02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
PBL01_0081_E05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
CLNT1_0028_D02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
SPL01_0065_H11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
SPL01_0092_G07.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
BFLT1_0061_A02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
LNG01_0016_F12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
ITT01_0062_F12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0040_E02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRT1_0091_A10.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRT1_0100_G12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGAGAG*GTGAAGCTC*TGTG
ITT01_0083_D09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0063_E01.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
MLN01_0069_G07.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
SPL01_0058_B04.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGNGGGAG*GTGAAGCTC*TGTG
THY01_0205_A01.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
MLN01_0034_A10.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0039_E09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
TCH01_0091_H09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0044_G08.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0053_C06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
UTR01_0048_E05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
MLN01_0067_H11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
MLN01_0066_A09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
UTR01_0063_B08.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0049_E05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0007_F02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0202_H05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
LNG01_0044_G08.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
BFLT1_0076_D02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0203_A09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
CLNT1_0021_E06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRT1_0085_A02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
MLN01_0044_B12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
MLTL1_0083_H11.b : C*CTGCATTAACCAGCCCCAGTCCGGGGCTGTC*T**TGGGGGAA*GTGAAGCTC*TGTG
THY01_0093_D03.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
CLNT1_0021_F12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0072_H04.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
LVRM1_0135_C04.b : atcccctttctctcccacttattaccccctgcctacttttctcgtttcttccatcctctt
LVRM1_0048_A07.b : caattagttattataatccgttacagttaaaccatttgcccatatatagcatacacacca
OVRM1_0027_F02.b : tgtgttatccagcctccaacaccaggctgacaacgagcaggagaacctctgcgacaccat
OVR01_0075_A05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGTAGCTC*TGTG
OVRM1_0151_F05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
LVRM1_0187_F01.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0091_E09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGCC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRM1_0152_E11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRM1_0224_E03.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0071_H11.b : C*CTGCATTAACCAGCCCCAGTTCCCGGCTGTC*C**TGGGGGAA*GTGAAGCTC*TGTG
OVRM1_0089_C11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRM1_0015_B11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
SPL01_0017_A04.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
TES01_0044_B05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGTGGGAG*GTGAAGCTC*TGTG
OVR01_0090_C03.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0013_G09.b : C*CTGCATTAACCAGCTCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
UTR01_0096_A12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGAGGGAG*GTGAAGCTC*TGTG
CLNT1_0108_E06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAATCTC*TGTG
THY01_0002_E12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAA*GTGAAGCTC*TGTG
UTR01_0033_C06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGAGGGAG*GTGAAGCTC*TGTG
BFLT1_0103_E04.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRT1_0006_A09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
SMG01_0074_F03.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
PBL01_0045_F06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
CLNT1_0147_H05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
CLNT1_0142_C03.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
BFLT1_0063_C12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
PBL01_0044_E06.b : C*CTGCAATAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
MLN01_0004_D12.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGNGGGAG*GTGAAGCTC*TGTG
OVRT1_0001_H11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVR01_0030_H11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
UTR01_0076_B04.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
ITT01_0061_G09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRT1_0129_A05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRT1_0098_F08.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
CLNT1_0029_A07.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
BKFL1_0014_F05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRT1_0111_G10.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
ITT01_0018_H07.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
PBL01_0030_G06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
LNG01_0096_F11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
MLN01_0041_F02.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGNGGGAG*GTGAAGCTC*TGTG
ITT01_0049_H04.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRT1_0059_A05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0062_C06.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
MLN01_0045_D05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
THY01_0026_D05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
SMG01_0084_C07.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
PBL01_0010_D10.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
OVRT1_0081_G08.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
CLNT1_0013_D09.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
PBL01_0016_G04.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
CLNT1_0067_G07.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
CLNT1_0132_A05.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
LNG01_0093_F11.b : C*CTGCATTAACCAGCCCCAGTTCCGGGCTGTC*T**TGGGGGAG*GTGAAGCTC*TGTG
CLNT1_0150_D11.b : C*CTGCATTAACCAGCCCCA