[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-001078

Length: 1,255

Sequence [FASTA format sequence]
TTTCCAGCTT TGTGGCTTTC ACTTCCACTT CTCCCAGGTG GGCGGAGTGG CCTCCTGTGG
ACGAATCAGA TTGCTCCTCC GCCCCAACTT CAGGAGGCGA GCCCGGGGCT CTGGGTCCCA
GACGTGCCGC CGCCGCCGCC ACAGCAGCAT CCGCAGCAGC AGCAGCAGCA GGACGACTAG
GAAAGACCCC AGGCCAGAAC CATGGAGGAC CAGCGCGACC TCATCTCCAA CCATGAGCAG
CTGCCCATGC TGGGCCAGCG CCCCGGGGCC CCGGAGAGCA AGTGCAGCCG TGGAGCTCTG
TACACAGGCT TTTCTGTCCT GGTGGCTCTG CTCCTGGCTG GCCAGGCCAC CACCGCCTAC
TTCCTGTACC AGCAGCAGGG CCGGCTGGAC AAGCTGACGG TCACCTCTCA GAACTTGCAG
CTGGAGAGCC TGCGGATGAA GCTTCCCAAG CCCTCCAAGC CTTTGAGCAA GATGCGGGTT
TCCGCCCCCA TGCTGATGCA GGCCCTGCCC ATGGAAGGCC CGGAGCCTAT GCGCAACGCC
ACCAAGTACG GCAACATGAC CCAGGACCAC GTGATGCACC TGCTCCTGAA GTCTGACCCC
CTGGGAGTGT ACCCGAAGCT GAAGGGGAGC CTCCCAGAAA ACCTGAAGCA CCTCAAGAAC
ACCATGGACG GTGTGAACTG GAAGCTCTTT GAGAACTGGC TGCGTCAGTG GCTCTTGTTT
GAAATGAGCA AGAACTCGCT GGAGGAGACA CCCTTTGAGG TTCCGCCAAA AGACCCACTG
GAGACGGAGG ACCTGTCGTC CGGGCTGGGC GTGACCAAGC AGGATCTCGG CCAAGTCATC
CTGTAAGAGC AGCAGACGCC AGCCCCCAGC CCTGCGTGGC CACAGCTTGC CTGCCCCCCA
CCCTCCCTGC CGCCCCCACC TGCACCTCAT CCCATGGGCC TCTGGCACCT GGCTCGCCGT
CCTCCCTGGA CACCTCACGT CTCTTCAGAA GGCCAAGGAT GAACGACACA GGGAGGCCCT
GCTGCCCACA GCTCCATCCG CTAGCAGGGA CACAGGGCCC CGGGGACAGC CCGTGAGCGG
GGCTGGTGCC ACTCCTGACA CCTTGAGCTC CACATGGCCG GCTGTCCATG GATGAAGCGG
GCAGGTGCCT GGGGACGGGT CCGCTCGATC CCAACCCCCA AAGGACAGCT CTGCTGTCTC
TTCCCTGGTG GCCTCAGCTT TCTTGCCCGT TACCTGGGGA GACGGGCCAA GCCTT


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCD74HLA class II histocompatibility antigen gamma chain isoform b [Homo sapiens]. 3085e-84O
Contig/Assembly ProteinCD74HLA class II histocompatibility antigen gamma chain isoform a [Homo sapiens]. 2788e-75O
Contig/Assembly ProteinCD74HLA class II histocompatibility antigen gamma chain isoform c [Homo sapiens]. 1871e-47O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCd74H-2 class II histocompatibility antigen gamma chain isoform 2 [Mus musculus]. 2963e-80O
Contig/Assembly ProteinCd74H-2 class II histocompatibility antigen gamma chain isoform 1 [Mus musculus]. 2602e-69O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC479329PREDICTED: similar to HLA class II histocompatibility antigen, gamma chain (HLA-DR antigens associated invariant chain) (Ia antigen-associated invariant chain) (Ii) (p33) (CD74 antigen) [Canis familiaris]. 2894e-78O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCD74CD74 antigen [Bos taurus]. 3332e-91O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCD74CD74 antigen [Sus scrofa]. 394e-110O


Assembly Members: 356      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010006E04ADR01_0006_E04.bDB782060 
ADR010008G03ADR01_0008_G03.bDB782260 
ADR010053D04ADR01_0053_D04.bDB786212 
ADR010069H04ADR01_0069_H04.bDB787673 
ADR010070G05ADR01_0070_G05.bDB787751 
ADR010074B03ADR01_0074_B03.bDB788040 
ADR010086H06ADR01_0086_H06.bDB789179 
ADR010090E06ADR01_0090_E06.bDB789498 
CBLT10098C03CBLT1_0098_C03.bHX218956 
CBLT10099H05CBLT1_0099_H05.bHX219093 
CBLT10100B06CBLT1_0100_B06.bHX219115 
CLNT10015B01CLNT1_0015_B01.bFS658232 
CLNT10019A06CLNT1_0019_A06.bFS658527 
CLNT10020A02CLNT1_0020_A02.bFS658603 
CLNT10021F04CLNT1_0021_F04.bFS658723 
CLNT10022A10CLNT1_0022_A10.bFS658759 
CLNT10024C04CLNT1_0024_C04.bFS658928 
CLNT10035C03CLNT1_0035_C03.bFS659780 
CLNT10042D05CLNT1_0042_D05.bFS660356 
CLNT10044D02CLNT1_0044_D02.bFS660519 
CLNT10050C01CLNT1_0050_C01.bFS660998 
CLNT10054F11CLNT1_0054_F11.bFS661343 
CLNT10057E05CLNT1_0057_E05.bFS661563 
CLNT10058D02CLNT1_0058_D02.bFS661628 
CLNT10059F08CLNT1_0059_F08.bFS661730 
CLNT10060A02CLNT1_0060_A02.bFS661756 
CLNT10065G06CLNT1_0065_G06.bFS662203 
CLNT10067E07CLNT1_0067_E07.bFS662350 
CLNT10069B08CLNT1_0069_B08.bFS662488 
CLNT10071D12CLNT1_0071_D12.bFS662674 
CLNT10072A02CLNT1_0072_A02.bFS662720 
CLNT10075E01CLNT1_0075_E01.bFS663007 
CLNT10080E08CLNT1_0080_E08.b  
CLNT10086E01CLNT1_0086_E01.bFS663255 
CLNT10086G03CLNT1_0086_G03.bFS663276 
CLNT10089G10CLNT1_0089_G10.bFS663512 
CLNT10093D06CLNT1_0093_D06.bFS663790 
CLNT10100A01CLNT1_0100_A01.bFS664306 
CLNT10104B09CLNT1_0104_B09.bHX219435 
CLNT10113F10CLNT1_0113_F10.bHX220180 
CLNT10116G06CLNT1_0116_G06.bHX220418 
CLNT10125D03CLNT1_0125_D03.bHX221070 
CLNT10140C04CLNT1_0140_C04.bHX222212 
CLNT10140D04CLNT1_0140_D04.bHX222224 
CLNT10141G09CLNT1_0141_G09.bHX222335 
CLNT10143B07CLNT1_0143_B07.bHX222437 
HTMT10058B09HTMT1_0058_B09.bFS668306 
ILNT10005B01ILNT1_0005_B01.bHX227076 
ILNT10007C06ILNT1_0007_C06.bHX227252 
ILNT10011E07ILNT1_0011_E07.bHX227577 
ILNT10013D01ILNT1_0013_D01.bHX227717 
ILNT10018A07ILNT1_0018_A07.b  
ILNT10020G06ILNT1_0020_G06.bHX228279 
ILNT10020H06ILNT1_0020_H06.bHX228287 
ILNT10037B12ILNT1_0037_B12.bHX229609 
ILNT10043G04ILNT1_0043_G04.bHX230141 
ILNT10044B06ILNT1_0044_B06.bHX230173 
ILNT10044B10ILNT1_0044_B10.bHX230176 
ILNT10046G08ILNT1_0046_G08.bHX230370 
ILNT10049G10ILNT1_0049_G10.bHX230620 
ILNT10052A10ILNT1_0052_A10.bHX230809 
ILNT10053D09ILNT1_0053_D09.bHX230919 
ILNT10066E11ILNT1_0066_E11.bHX232010 
ILNT10073E01ILNT1_0073_E01.bHX232575 
ILNT10074B10ILNT1_0074_B10.bHX232632 
ILNT10083F10ILNT1_0083_F10.bHX233394 
ILNT10085C06ILNT1_0085_C06.bHX233525 
ILNT10089E04ILNT1_0089_E04.bHX233875 
ILNT10091D11ILNT1_0091_D11.bHX234023 
ILNT10092B05ILNT1_0092_B05.bHX234077 
ILNT10092E02ILNT1_0092_E02.bHX234102 
ILNT10098D05ILNT1_0098_D05.bHX234540 
ILNT10100E07ILNT1_0100_E07.bHX234696 
ITT010001G01ITT01_0001_G01.bBW976105 
ITT010018H08ITT01_0018_H08.bBW977662 
ITT010021A03ITT01_0021_A03.bBW977852 
ITT010023E03ITT01_0023_E03.bBW978084 
ITT010027C11ITT01_0027_C11.bBW978430 
ITT010033E07ITT01_0033_E07.bBW978979 
ITT010033H12ITT01_0033_H12.bBW979018 
ITT010035H12ITT01_0035_H12.bBW979200 
ITT010036G12ITT01_0036_G12.bBW979280 
ITT010036H06ITT01_0036_H06.bBW979286 
ITT010037B10ITT01_0037_B10.bBW979312 
ITT010042D01ITT01_0042_D01.bBW979775 
ITT010045A03ITT01_0045_A03.bBW980015 
ITT010049B09ITT01_0049_B09.bBW980312 
ITT010055F06ITT01_0055_F06.bBW980907 
ITT010056H01ITT01_0056_H01.bBW981011 
ITT010057D02ITT01_0057_D02.bBW981058 
ITT010057H08ITT01_0057_H08.bBW981111 
ITT010060E07ITT01_0060_E07.bBW981346 
ITT010061E02ITT01_0061_E02.bBW981428 
ITT010064A09ITT01_0064_A09.bBW981659 
ITT010064A12ITT01_0064_A12.bBW981662 
ITT010070D01ITT01_0070_D01.bBW982229 
ITT010074C03ITT01_0074_C03.bBW982574 
ITT010075A10ITT01_0075_A10.bBW982648 
ITT010075C06ITT01_0075_C06.bBW982663 
ITT010078H07ITT01_0078_H07.bBW982976 
ITT010079G09ITT01_0079_G09.bBW983053 
ITT010081E12ITT01_0081_E12.bBW983214 
ITT010081F09ITT01_0081_F09.bBW983222 
ITT010081G04ITT01_0081_G04.bBW983229 
ITT010083B12ITT01_0083_B12.bBW983361 
ITT010086A02ITT01_0086_A02.bBW983591 
ITT010086H12ITT01_0086_H12.bBW983677 
ITT010087D08ITT01_0087_D08.bBW983720 
ITT010087G05ITT01_0087_G05.bBW983753 
ITT010090C09ITT01_0090_C09.bBW983981 
ITT010090F07ITT01_0090_F07.bBW984014 
ITT010092D12ITT01_0092_D12.bBW984177 
ITT010095F05ITT01_0095_F05.bBW984461 
ITT010096C01ITT01_0096_C01.bBW984513 
ITT010097C08ITT01_0097_C08.bBW984611 
ITT010100A12ITT01_0100_A12.bBW984867 
KDN010042A10KDN01_0042_A10.bFS674101 
LNG010002H03LNG01_0002_H03.bBP440118 
LNG010005G11LNG01_0005_G11.bBP439779 
LNG010006F01LNG01_0006_F01.bBP437951 
LNG010010D04LNG01_0010_D04.bBP436201 
LNG010017D07LNG01_0017_D07.bBP436444 
LNG010020G01LNG01_0020_G01.bBP438971 
LNG010027A11LNG01_0027_A11.bBP433844 
LNG010034H06LNG01_0034_H06.bBP440396 
LNG010036G11LNG01_0036_G11.bBP439807 
LNG010046C07LNG01_0046_C07.bBP435479 
LNG010047D07LNG01_0047_D07.bBP436469 
LNG010058C05LNG01_0058_C05.bBP435309 
LNG010060G03LNG01_0060_G03.bBP439159 
LNG010064F06LNG01_0064_F06.bBP438411 
LNG010066A11LNG01_0066_A11.bBP433869 
LNG010075C12LNG01_0075_C12.bBP435913 
LNG010079F03LNG01_0079_F03.bBP438175 
LNG010084H05LNG01_0084_H05.bBP440349 
LNG010087F06LNG01_0087_F06.bBP438431 
LNG010101D09LNG01_0101_D09.bBP436661 
LVR010036A08LVR01_0036_A08.bBP441512 
LVR010046C03LVR01_0046_C03.bBP442971 
LVRM10085B11LVRM1_0085_B11.bCJ002781 
LVRM10161H01LVRM1_0161_H01.bBP453873 
MLN010001G09MLN01_0001_G09.bCJ007792 
MLN010011B01MLN01_0011_B01.bCJ008537 
MLN010011G03MLN01_0011_G03.b  
MLN010014D04MLN01_0014_D04.bCJ008795 
MLN010017C11MLN01_0017_C11.bBW963392 
MLN010019B06MLN01_0019_B06.bCJ009042 
MLN010021H08MLN01_0021_H08.bCJ009276 
MLN010025G09MLN01_0025_G09.bCJ009597 
MLN010029C02MLN01_0029_C02.b  
MLN010031F06MLN01_0031_F06.bCJ010071 
MLN010033H02MLN01_0033_H02.bCJ010249 
MLN010034H12MLN01_0034_H12.bCJ010340 
MLN010036F12MLN01_0036_F12.b  
MLN010037B09MLN01_0037_B09.bCJ010516 
MLN010039C03MLN01_0039_C03.bCJ010686 
MLN010043F08MLN01_0043_F08.bCJ011060 
MLN010043G11MLN01_0043_G11.bCJ011072 
MLN010045C08MLN01_0045_C08.bCJ011186 
MLN010048E02MLN01_0048_E02.bCJ011363 
MLN010049B07MLN01_0049_B07.bCJ011423 
MLN010051B12MLN01_0051_B12.bCJ011592 
MLN010052G09MLN01_0052_G09.bCJ011737 
MLN010056D04MLN01_0056_D04.bCJ012044 
MLN010062G02MLN01_0062_G02.bCJ012540 
MLN010067G10MLN01_0067_G10.bBW963717 
MLN010069A11MLN01_0069_A11.bCJ013085 
MLN010071C05MLN01_0071_C05.bBW963729 
MLN010075H06MLN01_0075_H06.b  
MLN010078A04MLN01_0078_A04.bCJ013794 
MLN010082E11MLN01_0082_E11.bCJ014190 
MLN010084C06MLN01_0084_C06.bCJ014340 
MLN010085E10MLN01_0085_E10.bCJ014446 
MLN010087B09MLN01_0087_B09.bCJ014584 
MLN010087F07MLN01_0087_F07.bCJ014627 
MLN010095G11MLN01_0095_G11.b  
MLN010096D10MLN01_0096_D10.bBW963885 
MLN010097G12MLN01_0097_G12.bCJ015474 
MLN010098A08MLN01_0098_A08.bCJ015494 
MLN010101D07MLN01_0101_D07.bCJ015796 
MLN010101H07MLN01_0101_H07.bCJ015842 
OVR010007C08OVR01_0007_C08.bBP142402 
OVR010013D06OVR01_0013_D06.bBP142784 
OVR010031H02OVR01_0031_H02.bBP144454 
OVR010049G08OVR01_0049_G08.bBW964007 
OVR010055D08OVR01_0055_D08.bBW964516 
OVR010089F04OVR01_0089_F04.bBW967315 
OVR010097H09OVR01_0097_H09.bBW967944 
OVR010099F05OVR01_0099_F05.bBW968085 
OVR010100D11OVR01_0100_D11.bBW968150 
OVR010101B02OVR01_0101_B02.bBW968196 
OVRM10039G04OVRM1_0039_G04.bBP460650 
OVRM10086G02OVRM1_0086_G02.bBP152519 
OVRM10129D04OVRM1_0129_D04.bBP149060 
OVRM10216F09OVRM1_0216_F09.bBP460142 
OVRT10087D04OVRT1_0087_D04.bFS693489 
OVRT10096D07OVRT1_0096_D07.bFS694234 AK400647
OVRT10119G03OVRT1_0119_G03.b  
PBL010008H04PBL01_0008_H04.bBW968993 
PBL010008H08PBL01_0008_H08.bBW968996 
PBL010010H06PBL01_0010_H06.bBW969154 
PBL010012B05PBL01_0012_B05.bBW969257 
PBL010012F07PBL01_0012_F07.bBW969288 
PBL010017A10PBL01_0017_A10.bBP462328 
PBL010019G12PBL01_0019_G12.bBW969688 
PBL010021D06PBL01_0021_D06.bBW969781 
PBL010023D05PBL01_0023_D05.bBP155721 
PBL010025B02PBL01_0025_B02.bBP155292 
PBL010026B05PBL01_0026_B05.bBP155346 
PBL010027B12PBL01_0027_B12.bBW969932 
PBL010032D04PBL01_0032_D04.bBP155718 
PBL010034C06PBL01_0034_C06.bBW970113 
PBL010038D12PBL01_0038_D12.bBP155818 
PBL010038G07PBL01_0038_G07.bBW970313 
PBL010053A03PBL01_0053_A03.bBW971162 
PBL010053B05PBL01_0053_B05.bBW971176 
PBL010055D03PBL01_0055_D03.bBW971358 
PBL010057E06PBL01_0057_E06.bBW971465 
PBL010065C06PBL01_0065_C06.bBW971996 
PBL010071E09PBL01_0071_E09.bBW972492 
PBL010083A12PBL01_0083_A12.bBW973516 
PBL010083F07PBL01_0083_F07.bBW973565 
PBL010090A04PBL01_0090_A04.bBW974131 
PBL010092H03PBL01_0092_H03.bBW974335 
PBL010092H10PBL01_0092_H10.bBW974339 
PBL010099G09PBL01_0099_G09.bBW974909 
PBL010103F07PBL01_0103_F07.bBW975258 
PBL010107H05PBL01_0107_H05.bBW975649 
PST010018C10PST01_0018_C10.bFS698385 
PST010039E03PST01_0039_E03.bFS699892 
PST010058C01PST01_0058_C01.bFS701404 
PST010088B10PST01_0088_B10.bFS703791 
PTG010047C08PTG01_0047_C08.bFS708554 
PTG010048H09PTG01_0048_H09.bFS708692 
PTG010080H11PTG01_0080_H11.b  
PTG010098F02PTG01_0098_F02.bFS712408 
PTG010108B11PTG01_0108_B11.bFS713124 
SKNB10010G12SKNB1_0010_G12.b  
SKNB10027C10SKNB1_0027_C10.bDB801429 
SKNB10049F03SKNB1_0049_F03.bDB802844 
SKNB10053E02SKNB1_0053_E02.bDB803128 
SKNB10056D03SKNB1_0056_D03.bDB803332 
SKNB10060A09SKNB1_0060_A09.bDB803578 
SKNB10062D01SKNB1_0062_D01.bDB803744 
SKNB10096G07SKNB1_0096_G07.bDB805791 
SMG010021G12SMG01_0021_G12.bFS715127 
SMG010041D10SMG01_0041_D10.bFS716861 
SMG010068H01SMG01_0068_H01.bFS719176 
SMG010080C07SMG01_0080_C07.bFS720177 
SMG010090A08SMG01_0090_A08.bFS721011 
SPL010004A12SPL01_0004_A12.bBP156968 
SPL010005D08SPL01_0005_D08.bBP157878 
SPL010008A05SPL01_0008_A05.bBP156784 
SPL010009D10SPL01_0009_D10.bBP157933 
SPL010016E09SPL01_0016_E09.bBP158256 
SPL010022C04SPL01_0022_C04.bBP157427 
SPL010030F09SPL01_0030_F09.bCJ016359 
SPL010030H11SPL01_0030_H11.bCJ016383 
SPL010034B02SPL01_0034_B02.bCJ016669 
SPL010037E04SPL01_0037_E04.bBP158133 
SPL010045C04SPL01_0045_C04.bCJ017051 
SPL010045C10SPL01_0045_C10.bCJ017057 
SPL010054H05SPL01_0054_H05.bCJ017917 
SPL010055B03SPL01_0055_B03.bCJ017937 
SPL010056B10SPL01_0056_B10.bCJ018034 
SPL010060D05SPL01_0060_D05.bCJ018409 
SPL010064H03SPL01_0064_H03.bCJ018825 
SPL010068G02SPL01_0068_G02.bCJ019162 
SPL010073B03SPL01_0073_B03.bCJ019557 
SPL010074G04SPL01_0074_G04.bCJ019707 
SPL010074H11SPL01_0074_H11.bCJ019725 
SPL010078E10SPL01_0078_E10.bCJ020053 
SPL010078H08SPL01_0078_H08.bCJ020087 
SPL010085H06SPL01_0085_H06.bCJ020713 
SPL010089F03SPL01_0089_F03.bCJ021048 
SPL010090G02SPL01_0090_G02.bCJ021147 
SPL010093H09SPL01_0093_H09.bCJ021432 
SPL010095A01SPL01_0095_A01.bCJ021528 
SPL010096E06SPL01_0096_E06.bCJ021669 
SPL010096E10SPL01_0096_E10.bCJ021673 
SPL010104F01SPL01_0104_F01.bCJ022362 
SPL010105C04SPL01_0105_C04.bCJ022423 
SPLT10004E02SPLT1_0004_E02.bHX239534 
SPLT10006E02SPLT1_0006_E02.bHX239682 
SPLT10009F05SPLT1_0009_F05.bHX239913 
SPLT10011G01SPLT1_0011_G01.bHX240073 
SPLT10012D07SPLT1_0012_D07.bHX240127 
SPLT10015G09SPLT1_0015_G09.bHX240379 
SPLT10032G07SPLT1_0032_G07.bHX241690 
SPLT10033A04SPLT1_0033_A04.bHX241707 
SPLT10034D05SPLT1_0034_D05.bHX241825 
SPLT10035C10SPLT1_0035_C10.bHX241903 
SPLT10039H04SPLT1_0039_H04.bHX242261 
SPLT10051F01SPLT1_0051_F01.bHX243157 
SPLT10054F06SPLT1_0054_F06.bHX243383 
SPLT10061E04SPLT1_0061_E04.bHX243931 
SPLT10069F02SPLT1_0069_F02.bHX244579 
SPLT10070F04SPLT1_0070_F04.bHX244659 
SPLT10071C03SPLT1_0071_C03.bHX244712 
SPLT10072D07SPLT1_0072_D07.bHX244801 
SPLT10074G05SPLT1_0074_G05.bHX244980 
SPLT10076B01SPLT1_0076_B01.bHX245089 
SPLT10079C09SPLT1_0079_C09.bHX245342 
SPLT10080H01SPLT1_0080_H01.b  
SPLT10081B08SPLT1_0081_B08.bHX245494 
SPLT10081D07SPLT1_0081_D07.bHX245515 
SPLT10090E10SPLT1_0090_E10.bHX246222 
SPLT10098E04SPLT1_0098_E04.bHX246850 
SPLT10099G09SPLT1_0099_G09.bHX246958 
TCH010009F12TCH01_0009_F12.bCJ023139 
TCH010021G01TCH01_0021_G01.bCJ024008 
TCH010051B10TCH01_0051_B10.bCJ026237 
TCH010063E12TCH01_0063_E12.bCJ026942 
TCH010068H04TCH01_0068_H04.bCJ027334 
TCH010076C07TCH01_0076_C07.bCJ027902 
TCH010080F07TCH01_0080_F07.bCJ028233 
TCH010090D04TCH01_0090_D04.bCJ028991 
TCH010092A11TCH01_0092_A11.bCJ029122 
TES010001E06TES01_0001_E06.bCJ030057 
TES010041F03TES01_0041_F03.bCJ032669 
TES010075G07TES01_0075_G07.bCJ034847 
TES010094D12TES01_0094_D12.bCJ036108 
THY010007E11THY01_0007_E11.bBP165375 
THY010009A01THY01_0009_A01.bBP159367 
THY010016F01THY01_0016_F01.bBP165587 
THY010018A10THY01_0018_A10.bBP160283 
THY010022C04THY01_0022_C04.bBP162160 
THY010031G06THY01_0031_G06.bBP167377 
THY010037B12THY01_0037_B12.bBP161754 
THY010040D10THY01_0040_D10.bBP164032 
THY010045G10THY01_0045_G10.bBP167816 
THY010048H11THY01_0048_H11.bBP169212 
THY010053C06THY01_0053_C06.bBP162391 
THY010056D06THY01_0056_D06.bBP163640 
THY010059B07THY01_0059_B07.bBP161249 
THY010061H11THY01_0061_H11.bBP169224 
THY010064D01THY01_0064_D01.bBP163131 
THY010066G06THY01_0066_G06.bBP167409 
THY010083D08THY01_0083_D08.bBP163862 
THY010086B06THY01_0086_B06.bBP161160 
THY010090B07THY01_0090_B07.bBP161269 
THY010090C02THY01_0090_C02.bBP162006 
THY010093E04THY01_0093_E04.bBP164721 
THY010096B09THY01_0096_B09.bBP161480 
THY010098B10THY01_0098_B10.bBP161595 
THY010104H11THY01_0104_H11.bBP169258 
THY010108D07THY01_0108_D07.bBP163781 
THY010109C02THY01_0109_C02.bBP162021 
THY010110D08THY01_0110_D08.bBP163885 
THY010111E03THY01_0111_E03.bBP164630 
THY010121D01THY01_0121_D01.bBP163173 
UTR010003G07UTR01_0003_G07.bBP172828 
UTR010052G01UTR01_0052_G01.bBP464400 
UTR010055B08UTR01_0055_B08.bBP463136 
UTR010091C09UTR01_0091_C09.bCJ038391 
UTR010094F02UTR01_0094_F02.bCJ038688 

  

SNPs: 4      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
273C14240.427OSCCC/P
G19420.573CCG/P
642C24710.752OSAAC/N
T8020.248AAT/N
849C6400.320W-
G13600.680
926C8600.593W-
T5900.407


Alignment:      TOP

20110601C-001078 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRT1_0096_D07.b : nnnccccatatggctgcacgagtgtacgacagctcaatxxxxxxxxxxxxxxxxxxxxxx
ITT01_0061_E02.b :
MLN01_0031_F06.b :
OVRM1_0216_F09.b :
OVRM1_0086_G02.b :
UTR01_0003_G07.b :
MLN01_0014_D04.b :
ITT01_0036_H06.b :
PBL01_0083_F07.b :
SMG01_0080_C07.b :
CLNT1_0024_C04.b :
ILNT1_0053_D09.b :
ILNT1_0073_E01.b :
SPLT1_0039_H04.b :
ILNT1_0011_E07.b :
SPLT1_0034_D05.b :
ILNT1_0007_C06.b :
ILNT1_0066_E11.b :
SPLT1_0061_E04.b :
SPL01_0030_H11.b :
ILNT1_0005_B01.b :
SPLT1_0071_C03.b :
ILNT1_0052_A10.b :
ILNT1_0085_C06.b :
ILNT1_0020_G06.b :
SPLT1_0009_F05.b :
SPLT1_0004_E02.b :
ILNT1_0049_G10.b :
ILNT1_0089_E04.b :
SPLT1_0054_F06.b :
ILNT1_0020_H06.b :
ILNT1_0083_F10.b :
ILNT1_0092_E02.b :
ILNT1_0092_B05.b :
ILNT1_0098_D05.b :
TCH01_0051_B10.b :
SPLT1_0051_F01.b :
SPLT1_0011_G01.b :
SPLT1_0070_F04.b :
SPL01_0055_B03.b :
TCH01_0076_C07.b :
HTMT1_0058_B09.b :
ILNT1_0100_E07.b :
ILNT1_0046_G08.b :
ILNT1_0044_B06.b :
THY01_0108_D07.b :
SPL01_0034_B02.b :
MLN01_0036_F12.b :
THY01_0018_A10.b :
ADR01_0006_E04.b :
SPL01_0022_C04.b :
PTG01_0108_B11.b :
THY01_0064_D01.b :
ITT01_0086_H12.b :
PBL01_0034_C06.b :
PBL01_0038_G07.b :
MLN01_0001_G09.b :
CLNT1_0140_D04.b :
MLN01_0067_G10.b :
PBL01_0027_B12.b :
PBL01_0012_B05.b :
CLNT1_0072_A02.b :
CLNT1_0140_C04.b :
CLNT1_0116_G06.b :
CLNT1_0057_E05.b :
CLNT1_0042_D05.b :
LNG01_0084_H05.b :
ITT01_0095_F05.b :
MLN01_0034_H12.b :
CLNT1_0015_B01.b :
LNG01_0066_A11.b :
SPL01_0068_G02.b :
PTG01_0048_H09.b :
MLN01_0084_C06.b :
CLNT1_0141_G09.b :
LNG01_0034_H06.b :
ITT01_0064_A09.b :
LNG01_0046_C07.b :
SPL01_0056_B10.b :
CLNT1_0054_F11.b :
THY01_0066_G06.b :
LNG01_0010_D04.b :
OVR01_0007_C08.b :
LNG01_0020_G01.b :
CLNT1_0143_B07.b :
CLNT1_0100_A01.b :
CLNT1_0089_G10.b :
PBL01_0071_E09.b :
ITT01_0001_G01.b :
ITT01_0081_F09.b :
PBL01_0083_A12.b :
PBL01_0032_D04.b :
CLNT1_0044_D02.b :
ITT01_0078_H07.b :
ITT01_0081_E12.b :
MLN01_0048_E02.b :
PBL01_0099_G09.b :
ITT01_0036_G12.b :
SPL01_0096_E06.b :
LNG01_0027_A11.b :
LNG01_0060_G03.b :
SPL01_0105_C04.b :
THY01_0061_H11.b :
CLNT1_0059_F08.b :
CLNT1_0058_D02.b :
CLNT1_0035_C03.b :
CLNT1_0071_D12.b :
MLN01_0011_B01.b :
LNG01_0075_C12.b :
CLNT1_0050_C01.b :
THY01_0037_B12.b :
SPL01_0085_H06.b :
THY01_0056_D06.b :
SPL01_0096_E10.b :
THY01_0016_F01.b :
THY01_0048_H11.b :
LNG01_0036_G11.b :
ITT01_0045_A03.b :
PBL01_0057_E06.b :
ITT01_0075_C06.b :
ILNT1_0074_B10.b :
PTG01_0080_H11.b :
PBL01_0012_F07.b :
THY01_0093_E04.b :
ITT01_0056_H01.b :
SPL01_0074_G04.b :
MLN01_0101_D07.b :
ILNT1_0091_D11.b :
ILNT1_0037_B12.b :
CLNT1_0020_A02.b :
MLN01_0021_H08.b :
MLN01_0095_G11.b :
MLN01_0071_C05.b :
SKNB1_0010_G12.b :
SKNB1_0096_G07.b :
CBLT1_0100_B06.b :
MLN01_0049_B07.b :
CBLT1_0098_C03.b :
SPL01_0095_A01.b :
SPL01_0045_C10.b :
ITT01_0057_H08.b :
ITT01_0090_C09.b :
ITT01_0081_G04.b :
SPLT1_0015_G09.b :
MLN01_0011_G03.b :
SPLT1_0032_G07.b :
ILNT1_0018_A07.b :
SPLT1_0098_E04.b :
SPLT1_0012_D07.b :
SPLT1_0006_E02.b :
TES01_0041_F03.b :
SPLT1_0090_E10.b :
SPLT1_0081_D07.b :
SPLT1_0074_G05.b :
LNG01_0005_G11.b :
ITT01_0096_C01.b :
CLNT1_0075_E01.b :
SPLT1_0069_F02.b :
CBLT1_0099_H05.b :
PST01_0018_C10.b :
SPLT1_0081_B08.b :
PST01_0058_C01.b :
THY01_0111_E03.b :
PBL01_0026_B05.b :
OVR01_0031_H02.b :
TCH01_0021_G01.b :
ITT01_0097_C08.b :
LNG01_0079_F03.b :
TCH01_0090_D04.b :
CLNT1_0019_A06.b :
MLN01_0101_H07.b :
TCH01_0009_F12.b :
LNG01_0047_D07.b :
THY01_0104_H11.b :
SMG01_0041_D10.b :
OVR01_0099_F05.b :
LVRM1_0161_H01.b :
THY01_0040_D10.b :
LVRM1_0085_B11.b :
OVRM1_0039_G04.b :
OVRM1_0129_D04.b :
THY01_0007_E11.b :
OVR01_0101_B02.b :
PBL01_0038_D12.b :
ITT01_0033_H12.b :
SMG01_0021_G12.b :
MLN01_0017_C11.b :
PTG01_0098_F02.b :
CLNT1_0104_B09.b :
PTG01_0047_C08.b :
PBL01_0019_G12.b :
SKNB1_0053_E02.b :
PBL01_0017_A10.b :
PBL01_0055_D03.b :
ADR01_0053_D04.b :
PBL01_0053_B05.b :
ITT01_0086_A02.b :
CLNT1_0113_F10.b :
TCH01_0063_E12.b :
PBL01_0008_H04.b :
ITT01_0092_D12.b :
SMG01_0090_A08.b :
LNG01_0101_D09.b :
CLNT1_0065_G06.b :
SPL01_0037_E04.b :
MLN01_0043_G11.b :
CLNT1_0067_E07.b :
MLN01_0051_B12.b :
MLN01_0033_H02.b :
THY01_0053_C06.b :
OVR01_0055_D08.b :
CLNT1_0086_E01.b :
SPL01_0054_H05.b :
THY01_0009_A01.b :
PBL01_0023_D05.b :
SPL01_0004_A12.b :
UTR01_0091_C09.b :
THY01_0031_G06.b :
OVR01_0097_H09.b :
ITT01_0027_C11.b :
UTR01_0094_F02.b :
ITT01_0064_A12.b :
UTR01_0055_B08.b :
MLN01_0087_B09.b :
MLN01_0082_E11.b :
LNG01_0006_F01.b :
SPL01_0008_A05.b :
MLN01_0097_G12.b :
CLNT1_0060_A02.b :
LNG01_0002_H03.b :
MLN01_0085_E10.b :
ITT01_0060_E07.b :
ITT01_0090_F07.b :
ITT01_0087_D08.b :
UTR01_0052_G01.b :
MLN01_0056_D04.b :
SPL01_0093_H09.b :
PBL01_0021_D06.b :
ITT01_0057_D02.b :
ITT01_0074_C03.b :
PBL01_0107_H05.b :
ADR01_0086_H06.b :
CLNT1_0022_A10.b :
ITT01_0075_A10.b :
ADR01_0074_B03.b :
ITT01_0021_A03.b :
ITT01_0037_B10.b :
ITT01_0055_F06.b :
PBL01_0092_H03.b :
ITT01_0049_B09.b :
PBL01_0065_C06.b :
PBL01_0092_H10.b :
PBL01_0103_F07.b :
ITT01_0018_H08.b :
SPL01_0078_E10.b :
SPL01_0089_F03.b :
ADR01_0070_G05.b :
ITT01_0083_B12.b :
SPL01_0104_F01.b :
MLN01_0087_F07.b :
ADR01_0090_E06.b :
SPL01_0030_F09.b :
SPL01_0074_H11.b :
THY01_0086_B06.b :
OVRT1_0087_D04.b :
MLN01_0045_C08.b :
OVR01_0013_D06.b :
MLN01_0098_A08.b :
SPL01_0078_H08.b :
MLN01_0025_G09.b :
MLN01_0078_A04.b :
MLN01_0062_G02.b :
THY01_0090_B07.b :
MLN01_0069_A11.b :
LNG01_0058_C05.b :
SPL01_0045_C04.b :
MLN01_0019_B06.b :
CLNT1_0021_F04.b :
TCH01_0080_F07.b :
THY01_0098_B10.b :
LVR01_0046_C03.b :
LNG01_0017_D07.b :
OVR01_0089_F04.b :
THY01_0109_C02.b :
OVRT1_0119_G03.b :
OVR01_0049_G08.b :
ITT01_0042_D01.b :
TES01_0075_G07.b :
TES01_0094_D12.b :
MLN01_0075_H06.b :
KDN01_0042_A10.b :
SKNB1_0060_A09.b :
CLNT1_0069_B08.b :
PST01_0039_E03.b :
SKNB1_0056_D03.b :
PST01_0088_B10.b :
SKNB1_0027_C10.b :
TES01_0001_E06.b :
SPL01_0090_G02.b :
PBL01_0008_H08.b :
LNG01_0087_F06.b :
SKNB1_0062_D01.b :
SKNB1_0049_F03.b :
OVR01_0100_D11.b :
THY01_0110_D08.b :
SPLT1_0099_G09.b :
SPLT1_0079_C09.b :
ILNT1_0013_D01.b :
SPLT1_0072_D07.b :
SPLT1_0076_B01.b :
LNG01_0064_F06.b :
ADR01_0069_H04.b :
SPL01_0060_D05.b :
SPL01_0064_H03.b :
THY01_0096_B09.b :
SPL01_0009_D10.b :
MLN01_0029_C02.b :
LVR01_0036_A08.b :
THY01_0045_G10.b :
TCH01_0068_H04.b :
MLN01_0039_C03.b :
PBL01_0010_H06.b :
PBL01_0025_B02.b :
PBL01_0090_A04.b :
ITT01_0023_E03.b :
ITT01_0079_G09.b :
MLN01_0043_F08.b :
MLN01_0052_G09.b :
SPL01_0073_B03.b :
SPL01_0005_D08.b :
THY01_0083_D08.b :
CLNT1_0080_E08.b :
TCH01_0092_A11.b :
SPL01_0016_E09.b :
ITT01_0035_H12.b :
THY01_0059_B07.b :
ITT01_0070_D01.b :
THY01_0022_C04.b :
PBL01_0053_A03.b :
CLNT1_0093_D06.b :
CLNT1_0125_D03.b : tttttttttaccc
CLNT1_0086_G03.b :
MLN01_0037_B09.b :
ILNT1_0044_B10.b :
THY01_0121_D01.b :
ITT01_0100_A12.b :
SPLT1_0080_H01.b :
ADR01_0008_G03.b :
SPLT1_0033_A04.b :
THY01_0090_C02.b :
SMG01_0068_H01.b :
MLN01_0096_D10.b :
ILNT1_0043_G04.b :
SPLT1_0035_C10.b :
ITT01_0087_G05.b :
ITT01_0033_E07.b :
20110601C-001078 : ................TTTCCAGCTTTGTGGCTTTCACTTCCACTTCTCCCAGGTGGGCG
---------+---------+---------+---------+---------+---------+ 44
OVRT1_0096_D07.b : xxxxxxxxxxxxxxxxTTTCCAGCTTTGTGGCTTTCACTTCCACTTCTCCCAGGTGGGCG
ITT01_0061_E02.b : nnttaatcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0031_F06.b : nnnnggctaggacttgacagtttgtacxxxx
OVRM1_0216_F09.b :
OVRM1_0086_G02.b :
UTR01_0003_G07.b : axxxxxxxxxxxxxxxxxxx
MLN01_0014_D04.b : nntttgg
ITT01_0036_H06.b :
PBL01_0083_F07.b :
SMG01_0080_C07.b :
CLNT1_0024_C04.b :
ILNT1_0053_D09.b :
ILNT1_0073_E01.b :
SPLT1_0039_H04.b :
ILNT1_0011_E07.b :
SPLT1_0034_D05.b :
ILNT1_0007_C06.b :
ILNT1_0066_E11.b :
SPLT1_0061_E04.b :
SPL01_0030_H11.b : ttttagctagg
ILNT1_0005_B01.b :
SPLT1_0071_C03.b :
ILNT1_0052_A10.b :
ILNT1_0085_C06.b :
ILNT1_0020_G06.b :
SPLT1_0009_F05.b :
SPLT1_0004_E02.b :
ILNT1_0049_G10.b :
ILNT1_0089_E04.b :
SPLT1_0054_F06.b :
ILNT1_0020_H06.b :
ILNT1_0083_F10.b :
ILNT1_0092_E02.b : nnn
ILNT1_0092_B05.b :
ILNT1_0098_D05.b :
TCH01_0051_B10.b : nnggctag
SPLT1_0051_F01.b :
SPLT1_0011_G01.b :
SPLT1_0070_F04.b :
SPL01_0055_B03.b : nnnnnggct
TCH01_0076_C07.b : nnnnggctg
HTMT1_0058_B09.b :
ILNT1_0100_E07.b :
ILNT1_0046_G08.b :
ILNT1_0044_B06.b :
THY01_0108_D07.b :
SPL01_0034_B02.b : nnnttgcatgt
MLN01_0036_F12.b : nttggctagt
THY01_0018_A10.b : tagcaxxxxxxxx
ADR01_0006_E04.b :
SPL01_0022_C04.b : cxxxxxxxxxxxxxx
PTG01_0108_B11.b :
THY01_0064_D01.b : cctttttggggcacctgxx
ITT01_0086_H12.b :
PBL01_0034_C06.b :
PBL01_0038_G07.b :
MLN01_0001_G09.b : aaaanggcatg
CLNT1_0140_D04.b : n
MLN01_0067_G10.b : nnggctagtgactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0027_B12.b :
PBL01_0012_B05.b :
CLNT1_0072_A02.b : ng
CLNT1_0140_C04.b : n
CLNT1_0116_G06.b : n
CLNT1_0057_E05.b :
CLNT1_0042_D05.b :
LNG01_0084_H05.b : nnnt
ITT01_0095_F05.b :
MLN01_0034_H12.b : nnntttgct
CLNT1_0015_B01.b : nngggcgttnnngg
LNG01_0066_A11.b : ntttgnagctg
SPL01_0068_G02.b : nnnnggctag
PTG01_0048_H09.b :
MLN01_0084_C06.b : nnggcta
CLNT1_0141_G09.b : n
LNG01_0034_H06.b : gcctttggctgxxx
ITT01_0064_A09.b :
LNG01_0046_C07.b : tgggtgtttttttagcaaa
SPL01_0056_B10.b : nnnnggctagt
CLNT1_0054_F11.b : a
THY01_0066_G06.b : attttgggtgxxxx
LNG01_0010_D04.b : gctxxxxxxxxxxx
OVR01_0007_C08.b : aggggxxxxxxxxxxxxxxxxxxxxxx
LNG01_0020_G01.b : ttttgccggacttgtgac
CLNT1_0143_B07.b : nn
CLNT1_0100_A01.b : ng
CLNT1_0089_G10.b :
PBL01_0071_E09.b :
ITT01_0001_G01.b :
ITT01_0081_F09.b :
PBL01_0083_A12.b :
PBL01_0032_D04.b :
CLNT1_0044_D02.b :
ITT01_0078_H07.b :
ITT01_0081_E12.b :
MLN01_0048_E02.b : nnnngggctgt
PBL01_0099_G09.b :
ITT01_0036_G12.b :
SPL01_0096_E06.b : nnnnnggctag
LNG01_0027_A11.b : gggcattatgtgxxxx
LNG01_0060_G03.b : nccccttnnnccgcgca
SPL01_0105_C04.b : nnnnnggcttg
THY01_0061_H11.b : tgggtggaacxxx
CLNT1_0059_F08.b : n
CLNT1_0058_D02.b : nn
CLNT1_0035_C03.b : g
CLNT1_0071_D12.b : tg
MLN01_0011_B01.b : nnnnttag
LNG01_0075_C12.b : nnnnnggtt
CLNT1_0050_C01.b : ncgcttttnnnn
THY01_0037_B12.b : ctxxxxxxxxxxx
SPL01_0085_H06.b : nnnggctag
THY01_0056_D06.b : gggtggacxxx
SPL01_0096_E10.b : nntttgcatgg
THY01_0016_F01.b : ctgac
THY01_0048_H11.b : gggtgaaccta
LNG01_0036_G11.b : gcatttgggggcx
ITT01_0045_A03.b :
PBL01_0057_E06.b :
ITT01_0075_C06.b :
ILNT1_0074_B10.b :
PTG01_0080_H11.b :
PBL01_0012_F07.b :
THY01_0093_E04.b : gcctttagg
ITT01_0056_H01.b :
SPL01_0074_G04.b : nnnggct
MLN01_0101_D07.b : nnnggt
ILNT1_0091_D11.b :
ILNT1_0037_B12.b :
CLNT1_0020_A02.b :
MLN01_0021_H08.b : n
MLN01_0095_G11.b :
MLN01_0071_C05.b : nnnnggcta
SKNB1_0010_G12.b :
SKNB1_0096_G07.b :
CBLT1_0100_B06.b :
MLN01_0049_B07.b : ttttngggttgtg
CBLT1_0098_C03.b :
SPL01_0095_A01.b : nnnt
SPL01_0045_C10.b : nnnnaagca
ITT01_0057_H08.b :
ITT01_0090_C09.b :
ITT01_0081_G04.b :
SPLT1_0015_G09.b :
MLN01_0011_G03.b : nnnn
SPLT1_0032_G07.b :
ILNT1_0018_A07.b :
SPLT1_0098_E04.b :
SPLT1_0012_D07.b :
SPLT1_0006_E02.b :
TES01_0041_F03.b :
SPLT1_0090_E10.b :
SPLT1_0081_D07.b :
SPLT1_0074_G05.b :
LNG01_0005_G11.b : gtgtttttttagc
ITT01_0096_C01.b :
CLNT1_0075_E01.b : nggccttn
SPLT1_0069_F02.b :
CBLT1_0099_H05.b :
PST01_0018_C10.b :
SPLT1_0081_B08.b :
PST01_0058_C01.b :
THY01_0111_E03.b :
PBL01_0026_B05.b :
OVR01_0031_H02.b : ggggatcxxx
TCH01_0021_G01.b :
ITT01_0097_C08.b :
LNG01_0079_F03.b : tttttn
TCH01_0090_D04.b : nnnn
CLNT1_0019_A06.b :
MLN01_0101_H07.b : n
TCH01_0009_F12.b : nntt
LNG01_0047_D07.b : cc
THY01_0104_H11.b :
SMG01_0041_D10.b :
OVR01_0099_F05.b :
LVRM1_0161_H01.b :
THY01_0040_D10.b : ttttgggggxxxxxxxxx
LVRM1_0085_B11.b :
OVRM1_0039_G04.b :
OVRM1_0129_D04.b :
THY01_0007_E11.b :
OVR01_0101_B02.b : nnng
PBL01_0038_D12.b :
ITT01_0033_H12.b :
SMG01_0021_G12.b :
MLN01_0017_C11.b : ccccc
PTG01_0098_F02.b :
CLNT1_0104_B09.b :
PTG01_0047_C08.b :
PBL01_0019_G12.b :
SKNB1_0053_E02.b :
PBL01_0017_A10.b :
PBL01_0055_D03.b :
ADR01_0053_D04.b :
PBL01_0053_B05.b :
ITT01_0086_A02.b :
CLNT1_0113_F10.b :
TCH01_0063_E12.b : ng
PBL01_0008_H04.b :
ITT01_0092_D12.b :
SMG01_0090_A08.b :
LNG01_0101_D09.b : nnnn
CLNT1_0065_G06.b :
SPL01_0037_E04.b : aaggttttggt
MLN01_0043_G11.b : nnnng
CLNT1_0067_E07.b :
MLN01_0051_B12.b : nnt
MLN01_0033_H02.b : aaa
THY01_0053_C06.b : cxxxxxxxx
OVR01_0055_D08.b : nng
CLNT1_0086_E01.b :
SPL01_0054_H05.b : nnnnaa
THY01_0009_A01.b : ctxxxxxxx
PBL01_0023_D05.b :
SPL01_0004_A12.b : catttgggt
UTR01_0091_C09.b : nnnt
THY01_0031_G06.b : gggxxx
OVR01_0097_H09.b : nnnn
ITT01_0027_C11.b :
UTR01_0094_F02.b : nnnng
ITT01_0064_A12.b :
UTR01_0055_B08.b : gcxxxxxxx
MLN01_0087_B09.b :
MLN01_0082_E11.b : n
LNG01_0006_F01.b : ggttttttttgcatt
SPL01_0008_A05.b : cttttgggt
MLN01_0097_G12.b : nnnng
CLNT1_0060_A02.b : ncgttt
LNG01_0002_H03.b : gacttttgng
MLN01_0085_E10.b : ng
ITT01_0060_E07.b :
ITT01_0090_F07.b :
ITT01_0087_D08.b :
UTR01_0052_G01.b : ggcattagt
MLN01_0056_D04.b : nnngg
SPL01_0093_H09.b : nnttt
PBL01_0021_D06.b :
ITT01_0057_D02.b :
ITT01_0074_C03.b :
PBL01_0107_H05.b :
ADR01_0086_H06.b :
CLNT1_0022_A10.b :
ITT01_0075_A10.b :
ADR01_0074_B03.b :
ITT01_0021_A03.b :
ITT01_0037_B10.b :
ITT01_0055_F06.b :
PBL01_0092_H03.b :
ITT01_0049_B09.b :
PBL01_0065_C06.b :
PBL01_0092_H10.b :
PBL01_0103_F07.b :
ITT01_0018_H08.b :
SPL01_0078_E10.b : nnng
SPL01_0089_F03.b : nnng
ADR01_0070_G05.b :
ITT01_0083_B12.b :
SPL01_0104_F01.b : nnnttggcttaggacttanxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0087_F07.b :
ADR01_0090_E06.b :
SPL01_0030_F09.b : tttta
SPL01_0074_H11.b : nnnng
THY01_0086_B06.b : txxxxxxxx
OVRT1_0087_D04.b :
MLN01_0045_C08.b : nnn
OVR01_0013_D06.b : tttgggtgc
MLN01_0098_A08.b : nnnng
SPL01_0078_H08.b : nnngg
MLN01_0025_G09.b :
MLN01_0078_A04.b : nn
MLN01_0062_G02.b : nng
THY01_0090_B07.b : ttxxxxxxx
MLN01_0069_A11.b : ngggg
LNG01_0058_C05.b : nntt
SPL01_0045_C04.b : nnnna
MLN01_0019_B06.b : nttaggg
CLNT1_0021_F04.b : ggggct
TCH01_0080_F07.b : nng
THY01_0098_B10.b : ggcxxxxxxx
LVR01_0046_C03.b : gcattatxx
LNG01_0017_D07.b : cctatggc
OVR01_0089_F04.b : n
THY01_0109_C02.b :
OVRT1_0119_G03.b :
OVR01_0049_G08.b : nn
ITT01_0042_D01.b :
TES01_0075_G07.b :
TES01_0094_D12.b :
MLN01_0075_H06.b :
KDN01_0042_A10.b :
SKNB1_0060_A09.b :
CLNT1_0069_B08.b :
PST01_0039_E03.b :
SKNB1_0056_D03.b :
PST01_0088_B10.b :
SKNB1_0027_C10.b :
TES01_0001_E06.b :
SPL01_0090_G02.b : n
PBL01_0008_H08.b :
LNG01_0087_F06.b :
SKNB1_0062_D01.b :
SKNB1_0049_F03.b :
OVR01_0100_D11.b : ggcattgtgac
THY01_0110_D08.b :
SPLT1_0099_G09.b :
SPLT1_0079_C09.b :
ILNT1_0013_D01.b :
SPLT1_0072_D07.b :
SPLT1_0076_B01.b :
LNG01_0064_F06.b :
ADR01_0069_H04.b : nnnnccggagtaacaxx
SPL01_0060_D05.b :
SPL01_0064_H03.b :
THY01_0096_B09.b :
SPL01_0009_D10.b :
MLN01_0029_C02.b :
LVR01_0036_A08.b :
THY01_0045_G10.b :
TCH01_0068_H04.b :
MLN01_0039_C03.b :
PBL01_0010_H06.b :
PBL01_0025_B02.b :
PBL01_0090_A04.b :
ITT01_0023_E03.b :
ITT01_0079_G09.b :
MLN01_0043_F08.b :
MLN01_0052_G09.b :
SPL01_0073_B03.b :
SPL01_0005_D08.b :
THY01_0083_D08.b :
CLNT1_0080_E08.b : nnngg
TCH01_0092_A11.b :
SPL01_0016_E09.b :
ITT01_0035_H12.b :
THY01_0059_B07.b :
ITT01_0070_D01.b :
THY01_0022_C04.b :
PBL01_0053_A03.b :
CLNT1_0093_D06.b :
CLNT1_0125_D03.b : cttcttttcgccttctgttaatttttaacttctctttccctctgctcctttacccatttt
CLNT1_0086_G03.b :
MLN01_0037_B09.b :
ILNT1_0044_B10.b :
THY01_0121_D01.b :
ITT01_0100_A12.b :
SPLT1_0080_H01.b :
ADR01_0008_G03.b :
SPLT1_0033_A04.b :
THY01_0090_C02.b :
SMG01_0068_H01.b :
MLN01_0096_D10.b :
ILNT1_0043_G04.b :
SPLT1_0035_C10.b :
ITT01_0087_G05.b :
ITT01_0033_E07.b :
20110601C-001078 : GAGTGGCCTCCTGTGGACGAATCAGATTGCTCCTCCGCCCCAACTTCAGGAGGCGAGCCC
---------+---------+---------+---------+---------+---------+ 104
OVRT1_0096_D07.b : GAGTGGCCTCCTGTGGACGAATCAGATTGCTCCTCCGCCCCAACTTCAGGAGGCGAGCCC
ITT01_0061_E02.b : xxxxxxxxxxxxxxxxxxtAATCAGATTGCTCCTCCGCCCCAACTTCAGGAGGCAAGCCC
MLN01_0031_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAGGCGAGCCC
OVRM1_0216_F09.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0086_G02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0003_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0014_D04.b : cttggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0036_H06.b : nnnggagcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0083_F07.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0080_C07.b : nccgaaatnnnnnggataaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0024_C04.b : nnggttctgctgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0053_D09.b : nnnggacggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0073_E01.b : nnnncgacggtaagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0039_H04.b : nnnttgcaggttagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0011_E07.b : nnnncgctagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0034_D05.b : nnnncgcgagtacgacgccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0007_C06.b : nnnnncgcagagagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0066_E11.b : nnnaagtcggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0061_E04.b : nnccgcgagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0030_H11.b : actatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0005_B01.b : nnnttcgacagagacgcagtagtattaaxxxxxxxxxxxxxxxxxxxxx
SPLT1_0071_C03.b : nnnccgcggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0052_A10.b : nnnccgaggtacgacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0085_C06.b : nnnnncctagttagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0020_G06.b : nnccgaagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0009_F05.b : nnttctagttagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0004_E02.b : nnnnggcaattagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0049_G10.b : nnnccgatggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0089_E04.b : nnnnnggcgagtagaggccgtagtattaaxxxxxxxxxxxxxxxxxxxxx
SPLT1_0054_F06.b : nnnccgcgagtagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0020_H06.b : ntttggtagagagaggccgtagtattxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0083_F10.b : nnnttcccagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0092_E02.b : aagcaagtagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0092_B05.b : nnnggggacagtagacgcagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0098_D05.b : nnccgcagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0051_B10.b : gactattacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0051_F01.b : nttttcgacagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0011_G01.b : nnnnggcgagtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0070_F04.b : nncccgggtagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0055_B03.b : aggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0076_C07.b : tgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0058_B09.b : ttttnggacggtagaggccatxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0100_E07.b : nnnaatgaggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0046_G08.b : nnngggagacggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0044_B06.b : nnnnaacgagagaagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0108_D07.b : gttgcaaaaagcagtggtcgggtcgaaxxxxxxxxxxxxxxx
SPL01_0034_B02.b : gacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0036_F12.b : gacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0018_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0006_E04.b : nnnnggactgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0022_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0108_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxx
THY01_0064_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0086_H12.b : nnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0034_C06.b : aaggggaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0038_G07.b : ngatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0001_G09.b : gtctatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0140_D04.b : nnnccgttcgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0067_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0027_B12.b : aaaagagacaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0012_B05.b : nnnnggtgcaagcggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0072_A02.b : tatccgttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0140_C04.b : nnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0116_G06.b : nnnccgttagctgtagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0057_E05.b : nnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0042_D05.b : nnccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0084_H05.b : tttgttggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0095_F05.b : nnggctacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0034_H12.b : aggacatnacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0015_B01.b : gatcccgtcgcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0066_A11.b : gacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0068_G02.b : tgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0048_H09.b : nncccacannnngggagtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0084_C06.b : ggactatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0141_G09.b : nnnccgtctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0034_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0064_A09.b : nnngggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0046_C07.b : cgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0056_B10.b : gacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0054_F11.b : attccgtttgcggacggaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0066_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0010_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0007_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0020_G01.b : ntatagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0143_B07.b : nnnccgtcagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0100_A01.b : attacgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0089_G10.b : nttttccgtcagcgncggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0071_E09.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0001_G01.b : nnttggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0081_F09.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0083_A12.b : aaaggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0032_D04.b : nnggtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0044_D02.b : nnccgttcgcgnacggaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0078_H07.b : nnngggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0081_E12.b : nnnnggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0048_E02.b : gacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0099_G09.b : nngggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0036_G12.b : nttaagagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0096_E06.b : gactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0027_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0060_G03.b : tggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0105_C04.b : tgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0061_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0059_F08.b : tttccgtcagctgtcggaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0058_D02.b : ntttcgtcagcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0035_C03.b : gatccgtttgctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0071_D12.b : tatccgttagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0011_B01.b : tggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0075_C12.b : ggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0050_C01.b : nnnccgttagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0037_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0085_H06.b : gactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0056_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0096_E10.b : actatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0016_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0048_H11.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0036_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0045_A03.b : nnnggtgatacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0057_E06.b : nnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0075_C06.b : nnnggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0074_B10.b : nnnnncgatgtgaagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0080_H11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PBL01_0012_F07.b : nnnttgtgcaagcggcgtgaxxxxxxxxxxxxxxxxxxxxxxx
THY01_0093_E04.b : gtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0056_H01.b : nnttttgagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0074_G04.b : aggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0101_D07.b : tgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0091_D11.b : nnnnggcgagtagacgccntagtaxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0037_B12.b : nnnnnccgacggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0020_A02.b : attggttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0021_H08.b : nnnggtaggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0095_G11.b : ggctaggctatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0071_C05.b : ggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0010_G12.b : aataatcctcacgttg
SKNB1_0096_G07.b : nnnncccac
CBLT1_0100_B06.b : tttccgacgttagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0049_B07.b : acttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0098_C03.b : ttccgcgtgagaggccgtagtatttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0095_A01.b : ttgattggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0045_C10.b : tgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0057_H08.b : nnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0090_C09.b : nnnnggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0081_G04.b : nnnaatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0015_G09.b : nnnnggcaagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0011_G03.b : ttactggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0032_G07.b : nnnccgcgagtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0018_A07.b : tgtagtacgaggcagtagtaxxxxxxxxxxxxxxxxxxxxx
SPLT1_0098_E04.b : nnncgcagtagacgccgtagtaxxxxxxxxxxxxxxxxxxxxx
SPLT1_0012_D07.b : nnnnggctagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0006_E02.b : nnnttgcgagtagaggccgtagtaxxxxxxxxxxxxxxxxxxxxx
TES01_0041_F03.b : cg
SPLT1_0090_E10.b : nnncccgggtacgcggccgtaxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0081_D07.b : nnnggagcgagtagacgccgtaxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0074_G05.b : nnnccctggtacgacgccgtaxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0005_G11.b : ataggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0096_C01.b : nagtgatacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0075_E01.b : nnnggnnnccgttagcggacggaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0069_F02.b : nnnnccgcgagtagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0099_H05.b : nttcgctatgagaggccgtaxxxxxxxxxxxxxxxxxxxxxxx
PST01_0018_C10.b :
SPLT1_0081_B08.b : nnnttcgccgagtagacgccgtaxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0058_C01.b : nnaactac
THY01_0111_E03.b : gttgtcaaaaacaxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0026_B05.b : nnggtgaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0031_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0021_G01.b : nttnggcttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0097_C08.b : nnnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0079_F03.b : ggatggtacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0090_D04.b : ggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0019_A06.b : aatccgttcagcgtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0101_H07.b : nggtgctaggaatatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0009_F12.b : tggtagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0047_D07.b : tttaggtgagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0104_H11.b : gttgcaaaaacaxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0041_D10.b : ncccctttaataggactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0099_F05.b : gcttggcattagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0161_H01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0040_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0085_B11.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0039_G04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0129_D04.b : tcagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0007_E11.b : gaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0101_B02.b : gcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0038_D12.b : aagtgcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0033_H12.b : nttaagatatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0021_G12.b : nggcgttttttatttggctaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0017_C11.b : ttcgtggccttgnaagntttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0098_F02.b : nttttggataaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0104_B09.b : nnnnccgtcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0047_C08.b : nggatatacagcaggtxxxxxxxxxxxxxxxxxxxxxx
PBL01_0019_G12.b : aaaaggctgaagagcxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0053_E02.b : nnnnnnttag
PBL01_0017_A10.b : nnnnggtgcaagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0055_D03.b : nnngggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0053_D04.b : nnnnaaagannnnnggatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0053_B05.b : nnaagtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0086_A02.b : nttgacaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0113_F10.b : nnnnccgtttgctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0063_E12.b : ggttggcatatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0008_H04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxx
ITT01_0092_D12.b : nntttgatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0090_A08.b : ncccgcccannnnnggactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0101_D09.b : naagctggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0065_G06.b : nnnccttctgctgtacgatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0037_E04.b : ggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0043_G11.b : gctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0067_E07.b : gtttccgttctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0051_B12.b : tagctaggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0033_H02.b : anggttggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0053_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0055_D08.b : ggttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0086_E01.b : tgtttcccctcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0054_H05.b : gctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0009_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0023_D05.b : nggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0004_A12.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0091_C09.b : tgctaggacttanacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0031_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0097_H09.b : ggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0027_C11.b : nnggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0094_F02.b : gctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0064_A12.b : nnnnggtgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0055_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0087_B09.b : ggtaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0082_E11.b : nggctaggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0006_F01.b : agtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0008_A05.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0097_G12.b : gctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0060_A02.b : ttnnnnntccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0002_H03.b : ncnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0085_E10.b : ggtagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0060_E07.b : nnnggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0090_F07.b : nnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0087_D08.b : nnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0052_G01.b : gtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0056_D04.b : ctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0093_H09.b : gctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0021_D06.b : gatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0057_D02.b : nnggtgatacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0074_C03.b : nnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0107_H05.b : naaagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0086_H06.b : nnnaaacggagtaacaxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0022_A10.b : ggttccgttcagcgtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0075_A10.b : nnnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0074_B03.b : ccccnggatcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0021_A03.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0037_B10.b : nnnggagaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0055_F06.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0092_H03.b : nnnngatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0049_B09.b : nnnnggagaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0065_C06.b : nnnggtgaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0092_H10.b : nnaaagataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0103_F07.b : nnnaagataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0018_H08.b : nnnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0078_E10.b : gctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0089_F03.b : gcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0070_G05.b : naaaagggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0083_B12.b : nnnnggagcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0104_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0087_F07.b : ctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0090_E06.b : nnnaacgaaannnnnggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0030_F09.b : gctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0074_H11.b : gcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0086_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0087_D04.b : nnnnnccgtcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0045_C08.b : ngggtaggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0013_D06.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0098_A08.b : gcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0078_H08.b : ctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0025_G09.b : ngctaggacatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0078_A04.b : nggctaggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0062_G02.b : ggttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0090_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0069_A11.b : gctaggcctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0058_C05.b : cggctaggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0045_C04.b : gctaggacttanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0019_B06.b : ggcttgtgacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0021_F04.b : tnnnnnnnccgttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0080_F07.b : gctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0098_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0017_D07.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0089_F04.b : gctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0109_C02.b : gttgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0119_G03.b : ctctgctgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0049_G08.b : nttgcttgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0042_D01.b : nnggtgatacaxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0075_G07.b : t
TES01_0094_D12.b : ttag
MLN01_0075_H06.b : ttggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0042_A10.b : ntt
SKNB1_0060_A09.b : nnnnnccgaannnnnnn
CLNT1_0069_B08.b : nttccgtcagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0039_E03.b :
SKNB1_0056_D03.b : nnggggcnnnnnnnn
PST01_0088_B10.b : nnnn
SKNB1_0027_C10.b : nnnggggtannnnnnncc
TES01_0001_E06.b : ttt
SPL01_0090_G02.b : nnttgctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0008_H08.b : acctttcgggatacacaxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0087_F06.b : ggnnggggatggacttgnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0062_D01.b : nnngggaannnnnnn
SKNB1_0049_F03.b : nnnnttctaaa
OVR01_0100_D11.b : ttgaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0110_D08.b : ttgtcaaacagctggtacggtccggaatcc
SPLT1_0099_G09.b : nnnaagtcagtagacxxxxxxxxx
SPLT1_0079_C09.b : nnnccgcgattagaxxxxxxxxxxx
ILNT1_0013_D01.b : ttttacgacggtagacxxxxxxxxxxx
SPLT1_0072_D07.b : nnnaacgcagtxxxxxxxxxxxxxxx
SPLT1_0076_B01.b : nnnnccgcgagtagacgxxxxxxxx
LNG01_0064_F06.b : nnnnggcatggacttgacxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0069_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0060_D05.b : nnngggcttggacttagacxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0064_H03.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0096_B09.b : ttttactagcattcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0009_D10.b : cctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0029_C02.b : nnnnggcatgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0036_A08.b : tgggggccctttaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0045_G10.b : cttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0068_H04.b : nnccgtttnnnnggctaggacttgacxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0039_C03.b : nttcaaggcttggactatnacagtttgtacxxxxxxxxxxxxxxx
PBL01_0010_H06.b : nnnggactttnnnggctacacaxxxxx
PBL01_0025_B02.b : nnggtgaaacxxxxxxxx
PBL01_0090_A04.b : nnnggatgaacaxxxxxxxx
ITT01_0023_E03.b : nnnggtgcaacaxxxxxx
ITT01_0079_G09.b : nnnnggactaacaxxxxxxxx
MLN01_0043_F08.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0052_G09.b : tttttggctaggcgtataacagtttgtacxxxxxxxxxxxxxxx
SPL01_0073_B03.b : ttttggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0005_D08.b : gcagttggtgccntatanngacxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0083_D08.b : cacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0080_E08.b : gtcatnnnnnnaccctcagcgacggaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0092_A11.b : nnnggctaggactataacxxxxxxxxxxxxxxxxxxxxxx
SPL01_0016_E09.b : cattttggtggactatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0035_H12.b : nnnggatgaacaxxxx
THY01_0059_B07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0070_D01.b : nnggatgaacaxx
THY01_0022_C04.b : ttttggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0053_A03.b : nnnggtgaaacaxx
CLNT1_0093_D06.b : ncgtttttnngggccccctcagcgnacgxxxxxxxxxxxxx
CLNT1_0125_D03.b : tcatttttatntntttnccctttttnnngnnnncccttagcgtatgnanxxxxxxxxxxx
CLNT1_0086_G03.b : nnttttcgtcagcgnacgxxxxxxxxxxxxx
MLN01_0037_B09.b : nnnnggctaggactatgacagtttgtacxxxxxxx
ILNT1_0044_B10.b : nnnnnacgcgagtaga
THY01_0121_D01.b : agttgtcaaaag
ITT01_0100_A12.b : nnnggagt
SPLT1_0080_H01.b : nnnnccgcgagtagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0008_G03.b :
SPLT1_0033_A04.b :
THY01_0090_C02.b :
SMG01_0068_H01.b :
MLN01_0096_D10.b :
ILNT1_0043_G04.b :
SPLT1_0035_C10.b :
ITT01_0087_G05.b :
ITT01_0033_E07.b :
20110601C-001078 : GGGGCTCTGGGTCCCAGACGTGCCGCCGCCGCCGCCACAGCAGCATCCGCAGCAGCAGCA
---------+---------+---------+---------+---------+---------+ 164
OVRT1_0096_D07.b : GGGGCTTGGGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0061_E02.b : GGGGCTTGGGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0031_F06.b : GGGGCTTGGGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
OVRM1_0216_F09.b : xxxxxxCTGGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
OVRM1_0086_G02.b : xxxxxxCTGGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
UTR01_0003_G07.b : xxxctaCTGGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0014_D04.b : xxxxxxCTGGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0036_H06.b : xxxxxxCTGGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0083_F07.b : xxxxxxCTGGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SMG01_0080_C07.b : xxxxxxxTGGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0024_C04.b : xxxxcatTGGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0053_D09.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0073_E01.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPLT1_0039_H04.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0011_E07.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPLT1_0034_D05.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0007_C06.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0066_E11.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPLT1_0061_E04.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0030_H11.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0005_B01.b : xxxxxxxxxGGTCCCAGACGTGCCCCCTCCGCCGCCAcagcagcatccgcagcagcagca
SPLT1_0071_C03.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0052_A10.b : xxxxxxxxxGGTCCCAGACCTGTCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0085_C06.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0020_G06.b : xxxxxxxxxGGTCCCAGACGTGCCGTCGCCGCCGCCAcagcagcatccgcagcagcagca
SPLT1_0009_F05.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPLT1_0004_E02.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0049_G10.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0089_E04.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPLT1_0054_F06.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0020_H06.b : xxxxxxxxxGGTCCCAGACGTGCCGTCGCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0083_F10.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0092_E02.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0092_B05.b : xxxxxxxxxGGTCCCAGACGTCTCTCCGCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0098_D05.b : xxxxxxxxxGGTCCCAGACGTGCCCCTTACGCCGCCAcagcagcatccgcagcagcagca
TCH01_0051_B10.b : xxxxxxxxaGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPLT1_0051_F01.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPLT1_0011_G01.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPLT1_0070_F04.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0055_B03.b : xxxxxxxxtGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
TCH01_0076_C07.b : xxxxxxxxaGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
HTMT1_0058_B09.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0100_E07.b : xxxxxxxxxGGTCCCAGACGTGCCGCTTCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0046_G08.b : xxxxxxxxxGGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0044_B06.b : xxxxxxxxxGGTCCCAGACGTGTCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
THY01_0108_D07.b : xxxxxxxxxxGTCCCAAA*GTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0034_B02.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0036_F12.b : xxxxxxxxxxGTCGCAGACATGCCGCCGCCGCCTCCTCAGCATCATCCGCAGCAGCAGAC
THY01_0018_A10.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ADR01_0006_E04.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0022_C04.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PTG01_0108_B11.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
THY01_0064_D01.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0086_H12.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0034_C06.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0038_G07.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0001_G09.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0140_D04.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0067_G10.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0027_B12.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0012_B05.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0072_A02.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0140_C04.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0116_G06.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0057_E05.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0042_D05.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
LNG01_0084_H05.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0095_F05.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0034_H12.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0015_B01.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
LNG01_0066_A11.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0068_G02.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PTG01_0048_H09.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0084_C06.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0141_G09.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
LNG01_0034_H06.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0064_A09.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
LNG01_0046_C07.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0056_B10.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0054_F11.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
THY01_0066_G06.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
LNG01_0010_D04.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
OVR01_0007_C08.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
LNG01_0020_G01.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0143_B07.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0100_A01.b : xxxxxxxxxtGTCCCAGACGTGCCGCCGCCGCCGCCACAGCAGCATCCGCAGCAG***CA
CLNT1_0089_G10.b : xxxxxxxxxcGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0071_E09.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0001_G01.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0081_F09.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0083_A12.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0032_D04.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0044_D02.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0078_H07.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0081_E12.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0048_E02.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0099_G09.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0036_G12.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0096_E06.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
LNG01_0027_A11.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
LNG01_0060_G03.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0105_C04.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
THY01_0061_H11.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0059_F08.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0058_D02.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcacccgcagcagcagca
CLNT1_0035_C03.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0071_D12.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0011_B01.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
LNG01_0075_C12.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0050_C01.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
THY01_0037_B12.b : xxxxxxxxxxGTCCCAGACGTgccgccgccgccgccacagcagcatccgcagcagcagca
SPL01_0085_H06.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
THY01_0056_D06.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0096_E10.b : xxxxxxxxxxGTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
THY01_0016_F01.b : xxxxxxxxxxxTCCCAGACGTgccgccgccgccgccacagcatcatccgcagcagcagca
THY01_0048_H11.b : xxxxxxxxxxxTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
LNG01_0036_G11.b : xxxxxxxxxxxTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0045_A03.b : xxxxxxxxxxxTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0057_E06.b : xxxxxxxxxxxTCCCAGACGTGCCGCCGCCGCCGCCACAGCAGCATCCGCA***GCAGCA
ITT01_0075_C06.b : xxxxxxxxxxxTCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0074_B10.b : xxxxxxxxxxxgCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PTG01_0080_H11.b : nnnnnnnnnnggTCCAAACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0012_F07.b : xxxxxxxxxxxxGGAAGACGTGCCGTCGCCGCCGCCAcagcagcatccgcagcagcagca
THY01_0093_E04.b : xxxxxxxxxxxxTGGAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0056_H01.b : xxxxxxxxxxxxCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0074_G04.b : xxxxxxxxxxxxCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0101_D07.b : xxxxxxxxxxxxCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0091_D11.b : xxxxxxxxxxxgCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0037_B12.b : xxxxxxxxxxxgCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0020_A02.b : xxxxxxxxxxctTGGAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0021_H08.b : xxxxxxxxxxxxTGGAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0095_G11.b : xxctttaaatacTGGAGACGTGCCGCCGCCGCCGCCACAGCCCCTTCCGCAGCAGCAGCA
MLN01_0071_C05.b : xxxxxxxxxxxcCCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SKNB1_0010_G12.b : gctctggctgggtCCAGACGTGCCGCCGTCGCCGCCACAGCAGCATCCGCAGCACTTTTA
SKNB1_0096_G07.b : agtggctacgggtCCAGACGTGCCGCCGCCGCCGCC*cagcagcatccgcagcagcagca
CBLT1_0100_B06.b : xxxxxxxxxxxxgCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0049_B07.b : xxxxxxxxcctacTGAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CBLT1_0098_C03.b : xxxxxxxxxxxxgCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0095_A01.b : xxxxxxxxxxxacTGAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0045_C10.b : xxxxxxxxxxxxxCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0057_H08.b : xxxxxxxxxxxxxGGAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0090_C09.b : xxxxxxxxxxxxgGGAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0081_G04.b : xxxxxxxxxxxxxCCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPLT1_0015_G09.b : xxxxxxxxxxxxxxGAGACGTGCCGCCTCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0011_G03.b : xxxxxxxxxxxxxxGAGACGTGCCGCCGCCGCCGCCACAGCAACATCCGCACCAGCAGCA
SPLT1_0032_G07.b : xxxxxxxxxxxxxxGAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ILNT1_0018_A07.b : xxxxxxxxxxxxxxGAGACGTGCCGCCCCCTTTGCCAcagcagcatccgcagcagcagca
SPLT1_0098_E04.b : xxxxxxxxxxxxxxGAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPLT1_0012_D07.b : xxxxxxxxxxxxxxGAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPLT1_0006_E02.b : xxxxxxxxxxxxxxGAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
TES01_0041_F03.b : cgttggctatggggCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPLT1_0090_E10.b : xxxxxxxxxxxxxxGAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPLT1_0081_D07.b : xxxxxxxxxxxxxxGAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPLT1_0074_G05.b : xxxxxxxxxxxxxxGAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
LNG01_0005_G11.b : xxxxxxxxxxxxxxGAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0096_C01.b : xxxxxxxxxxxxxxCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0075_E01.b : xxxxxxxxxxxxxaGAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPLT1_0069_F02.b : xxxxxxxxxxxxxxGAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CBLT1_0099_H05.b : xxxxxxxxxxxxxxGAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PST01_0018_C10.b : gctctggCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPLT1_0081_B08.b : xxxxxxxxxxxxxxGAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PST01_0058_C01.b : tgtggctactgggtCAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
THY01_0111_E03.b : xxxxxxxxxxxxxxxAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0026_B05.b : xxxxxxxxxxxxxxxAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
OVR01_0031_H02.b : xxxxxxxxxxxxxxxAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
TCH01_0021_G01.b : xxxxxxxxxxxxxxxAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0097_C08.b : xxxxxxxxxxxxxxxAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
LNG01_0079_F03.b : xxxxxxxxxxxxxxxAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
TCH01_0090_D04.b : xxxxxxxxxxxxxxxAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0019_A06.b : xxxxxxxxxxcctatAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0101_H07.b : xxxxxxxxxxxxxxxAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
TCH01_0009_F12.b : xxxxxxxxxxxxxxxAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
LNG01_0047_D07.b : xxxxxxxxxxxxxxxAGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
THY01_0104_H11.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SMG01_0041_D10.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
OVR01_0099_F05.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
LVRM1_0161_H01.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
THY01_0040_D10.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
LVRM1_0085_B11.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
OVRM1_0039_G04.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
OVRM1_0129_D04.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
THY01_0007_E11.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
OVR01_0101_B02.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0038_D12.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0033_H12.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SMG01_0021_G12.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0017_C11.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PTG01_0098_F02.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0104_B09.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PTG01_0047_C08.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0019_G12.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SKNB1_0053_E02.b : cgctggctatgggtccGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0017_A10.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0055_D03.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ADR01_0053_D04.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0053_B05.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0086_A02.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0113_F10.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
TCH01_0063_E12.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0008_H04.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0092_D12.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SMG01_0090_A08.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
LNG01_0101_D09.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0065_G06.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0037_E04.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0043_G11.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0067_E07.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0051_B12.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0033_H02.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
THY01_0053_C06.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
OVR01_0055_D08.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0086_E01.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0054_H05.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
THY01_0009_A01.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0023_D05.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0004_A12.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
UTR01_0091_C09.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
THY01_0031_G06.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
OVR01_0097_H09.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0027_C11.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
UTR01_0094_F02.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0064_A12.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
UTR01_0055_B08.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0087_B09.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0082_E11.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
LNG01_0006_F01.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0008_A05.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0097_G12.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0060_A02.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
LNG01_0002_H03.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0085_E10.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0060_E07.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0090_F07.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0087_D08.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
UTR01_0052_G01.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0056_D04.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0093_H09.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagtagcagca
PBL01_0021_D06.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0057_D02.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0074_C03.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0107_H05.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ADR01_0086_H06.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0022_A10.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0075_A10.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ADR01_0074_B03.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0021_A03.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0037_B10.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0055_F06.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0092_H03.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0049_B09.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0065_C06.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0092_H10.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0103_F07.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0018_H08.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0078_E10.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0089_F03.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ADR01_0070_G05.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0083_B12.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0104_F01.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0087_F07.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ADR01_0090_E06.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0030_F09.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0074_H11.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
THY01_0086_B06.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
OVRT1_0087_D04.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0045_C08.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
OVR01_0013_D06.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0098_A08.b : xxxxxxxxxxxxxxxxGATGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0078_H08.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0025_G09.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0078_A04.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0062_G02.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
THY01_0090_B07.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0069_A11.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
LNG01_0058_C05.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0045_C04.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGTCGCCAcagcagcatccgcagcagcagca
MLN01_0019_B06.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0021_F04.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
TCH01_0080_F07.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
THY01_0098_B10.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
LVR01_0046_C03.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
LNG01_0017_D07.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
OVR01_0089_F04.b : xxxxxxxxxxxxxxxxGACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
THY01_0109_C02.b : xxxxxxxxxxxxgagtaACGTGCCGC*GCCGCCGCCAcagcagcatccgcagcagcagca
OVRT1_0119_G03.b : xxxxxxxxxxgcctttaACGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
OVR01_0049_G08.b : xxxxxxxxxxxxxxxxxxCGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
ITT01_0042_D01.b : xxxxxxxxxxxxxxxxxgCGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
TES01_0075_G07.b : tctggcgttggctctgagaGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
TES01_0094_D12.b : tggcggtggctatggcaaaGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
MLN01_0075_H06.b : xxxxxxxxxxxxxxxxxagGTgccgccgccgccgccacagcagcatccgctgcagcagca
KDN01_0042_A10.b : cctgctgtggctctggagaGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SKNB1_0060_A09.b : tactacgtttgctaggagaGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
CLNT1_0069_B08.b : xxxxxxxxxxxxxxxxcatGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PST01_0039_E03.b : gtgacgttggctctggagaGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SKNB1_0056_D03.b : cctacgttggctacggagaGTGCCGCCGCCGCCGCCACAGCAGCATCCGCAGCAGCAGCA
PST01_0088_B10.b : cctgaggttgctactggaaGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SKNB1_0027_C10.b : tgacgttgtgcttgggagaGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
TES01_0001_E06.b : cctactgtggctatggagaGTGCCACCGCCGCCGCCAcagcagcatccgcagcagcagca
SPL01_0090_G02.b : xxxxxxxxxxxxxxxxxxxGTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
PBL01_0008_H08.b : xxxxxxxxxxxxxxxxgaccTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
LNG01_0087_F06.b : xxxxxxxxxxxxxxxxxxxxTGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SKNB1_0062_D01.b : ncctgacgttgtgcacagagnGCCGCCGCCGCCGCCAcagcagcatccgcagcagcagca
SKNB1_0049_F03.b : antccaacgttggccggagagtaCGCCGCCGCCGCC*cagcagcatccgcagcagcagca
OVR01_0100_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxctttcCCGCCACCCCAGCATCCGCAGCAGCAGCA
THY01_0110_D08.b : tcagcactgtggctactggagactgcgcgccgCGCCAcagcagcatccgcagcagcagca
SPLT1_0099_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAcagcagcatccgcagcagcagca
SPLT1_0079_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAcagcagcatccgcagcagcagca
ILNT1_0013_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAcagcagcatccgcagcagcagca
SPLT1_0072_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAcagcagcatccgcagcagcagca
SPLT1_0076_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAcagcagcatccgcagcagcagca
LNG01_0064_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGAcagcagcatccgcagcagcagca
ADR01_0069_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxcctcctgGAcagcagcatccgcagcagcagca
SPL01_0060_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAcagcagcatccgcagcagcagca
SPL01_0064_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAcagcagcatccgcagcagcagca
THY01_0096_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAcagcagcatccgcagcagcagca
SPL01_0009_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAcagcagcatccgcagcagcagca
MLN01_0029_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcagtagcatccgcagcagcagca
LVR01_0036_A08.b : xxxxxxxxxxxxxxxxxxxxxxcccgtttctactggtcagcagcatccgcagcagcagca
THY01_0045_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcagcagcatccgcagcagcagca
TCH01_0068_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcagcagcatccgcagcagcagca
MLN01_0039_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcagcagcatccgcagcagcagca
PBL01_0010_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcagcagcatccgcagcagcagca
PBL01_0025_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcagcagcatccgcagcagcagca
PBL01_0090_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcagcagcatccgcagcagcagca
ITT01_0023_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcagcagcatccgcagcagcagca
ITT01_0079_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcagcagcatccgcagcagcagca
MLN01_0043_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcagcagcatccgcagcagcagca
MLN01_0052_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcagcagcatccgcagcagcagca
SPL01_0073_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcagcagcatccgcagcagcagca
SPL01_0005_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcagcagcatccgcagcagcagca
THY01_0083_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcagcagcatccgcagcagcagca
CLNT1_0080_E08.b : xxxxxxxxxxxxxxctccacgtgctgggggngnngnanAGNAGCATCCGCAGCACCTTCA
TCH01_0092_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggagcagcatccgcagcagcagca
SPL01_0016_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcagcatccgcagcagcagca
ITT01_0035_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcagcatccgcagcagcagca
THY01_0059_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctgcagcatccgcagcagcagca
ITT01_0070_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATCCGCAGCAGCAGCA
THY01_0022_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATCCGCAGCAGCAGCA
PBL01_0053_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATCCGCAGCAGCAGCA
CLNT1_0093_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATCCGCAGCAGCAGCA
CLNT1_0125_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATCCGCAGCAGCAGCA
CLNT1_0086_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCATCCGCAGCAGCAGCA
MLN01_0037_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCCGCAGCAGCAGCA
ILNT1_0044_B10.b : ggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCCGCAGCAGCAGCA
THY01_0121_D01.b : agcggtacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcacatCGCAGCAGCAGCA
ITT01_0100_A12.b : aacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGCAGCAGCAGCA
SPLT1_0080_H01.b : xxxxxxxxggtcccaaacgtgccgcctccgcctccatcatcttgttcttctggtGCAGCA
ADR01_0008_G03.b : nnnnaatgaacaxxxxxxxxxxxx
SPLT1_0033_A04.b :
THY01_0090_C02.b : ct
SMG01_0068_H01.b :
MLN01_0096_D10.b :
ILNT1_0043_G04.b :
SPLT1_0035_C10.b :
ITT01_0087_G05.b :
ITT01_0033_E07.b :
20110601C-001078 : GCAGCAGGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
---------+---------+---------+---------+---------+---------+ 224
OVRT1_0096_D07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0061_E02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0031_F06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
OVRM1_0216_F09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
OVRM1_0086_G02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
UTR01_0003_G07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0014_D04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0036_H06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0083_F07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SMG01_0080_C07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0024_C04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0053_D09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0073_E01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0039_H04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0011_E07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0034_D05.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0007_C06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0066_E11.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0061_E04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0030_H11.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0005_B01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0071_C03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0052_A10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0085_C06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0020_G06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0009_F05.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0004_E02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0049_G10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0089_E04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0054_F06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0020_H06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0083_F10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0092_E02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0092_B05.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0098_D05.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
TCH01_0051_B10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0051_F01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0011_G01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0070_F04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0055_B03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
TCH01_0076_C07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
HTMT1_0058_B09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0100_E07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0046_G08.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0044_B06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0108_D07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0034_B02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0036_F12.b : TCAGACGGACTACTAGGAAAGACCCCAGGCCAGGACCATGGATGACCATCGCGACCTCAT
THY01_0018_A10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ADR01_0006_E04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0022_C04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PTG01_0108_B11.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0064_D01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0086_H12.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0034_C06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0038_G07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0001_G09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0140_D04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0067_G10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0027_B12.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0012_B05.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0072_A02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0140_C04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0116_G06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0057_E05.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0042_D05.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LNG01_0084_H05.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0095_F05.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0034_H12.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGGACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0015_B01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LNG01_0066_A11.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAATCATGGAGGACCAGCGCGACCTCAT
SPL01_0068_G02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PTG01_0048_H09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0084_C06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0141_G09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LNG01_0034_H06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0064_A09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LNG01_0046_C07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0056_B10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0054_F11.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0066_G06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LNG01_0010_D04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
OVR01_0007_C08.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LNG01_0020_G01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0143_B07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0100_A01.b : GCAGCAGGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0089_G10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0071_E09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0001_G01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0081_F09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0083_A12.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0032_D04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0044_D02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0078_H07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0081_E12.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0048_E02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0099_G09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0036_G12.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0096_E06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LNG01_0027_A11.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LNG01_0060_G03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0105_C04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0061_H11.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0059_F08.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0058_D02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0035_C03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0071_D12.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0011_B01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LNG01_0075_C12.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0050_C01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0037_B12.b : gcaggagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0085_H06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0056_D06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0096_E10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0016_F01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0048_H11.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LNG01_0036_G11.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0045_A03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0057_E06.b : GCAGCAGGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0075_C06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0074_B10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PTG01_0080_H11.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0012_F07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0093_E04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0056_H01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0074_G04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0101_D07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0091_D11.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0037_B12.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0020_A02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0021_H08.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0095_G11.b : GCAGCAGGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0071_C05.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SKNB1_0010_G12.b : AGCCCAGGACGACTAGGAAAGACCCCAGGCCAGACCTTTGGAGGACCAGCGCGACCTCAT
SKNB1_0096_G07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CBLT1_0100_B06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0049_B07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CBLT1_0098_C03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0095_A01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0045_C10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0057_H08.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0090_C09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0081_G04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0015_G09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0011_G03.b : GCAGCAGGACGACTAGGAAAGACGCCTCGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0032_G07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0018_A07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0098_E04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0012_D07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0006_E02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
TES01_0041_F03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0090_E10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0081_D07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0074_G05.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LNG01_0005_G11.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0096_C01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0075_E01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0069_F02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CBLT1_0099_H05.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PST01_0018_C10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0081_B08.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PST01_0058_C01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0111_E03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCGGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0026_B05.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
OVR01_0031_H02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
TCH01_0021_G01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0097_C08.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LNG01_0079_F03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
TCH01_0090_D04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0019_A06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0101_H07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
TCH01_0009_F12.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LNG01_0047_D07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0104_H11.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SMG01_0041_D10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
OVR01_0099_F05.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LVRM1_0161_H01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0040_D10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LVRM1_0085_B11.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
OVRM1_0039_G04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
OVRM1_0129_D04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0007_E11.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
OVR01_0101_B02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0038_D12.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0033_H12.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SMG01_0021_G12.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0017_C11.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PTG01_0098_F02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0104_B09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCCCAT
PTG01_0047_C08.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0019_G12.b : gcagcGGGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SKNB1_0053_E02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0017_A10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0055_D03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ADR01_0053_D04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0053_B05.b : gcagcagGACGACTGGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0086_A02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0113_F10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
TCH01_0063_E12.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0008_H04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0092_D12.b : gcagcagGACGACTAGGGAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SMG01_0090_A08.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LNG01_0101_D09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0065_G06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0037_E04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0043_G11.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0067_E07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0051_B12.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0033_H02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0053_C06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
OVR01_0055_D08.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0086_E01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0054_H05.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0009_A01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0023_D05.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0004_A12.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCCCAT
UTR01_0091_C09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0031_G06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
OVR01_0097_H09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0027_C11.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
UTR01_0094_F02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0064_A12.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
UTR01_0055_B08.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0087_B09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0082_E11.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LNG01_0006_F01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0008_A05.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0097_G12.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0060_A02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LNG01_0002_H03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0085_E10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0060_E07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0090_F07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0087_D08.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
UTR01_0052_G01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0056_D04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0093_H09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0021_D06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0057_D02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0074_C03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0107_H05.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ADR01_0086_H06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0022_A10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0075_A10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ADR01_0074_B03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0021_A03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0037_B10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0055_F06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0092_H03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0049_B09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0065_C06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0092_H10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0103_F07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0018_H08.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0078_E10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0089_F03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ADR01_0070_G05.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0083_B12.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0104_F01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0087_F07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ADR01_0090_E06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0030_F09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0074_H11.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0086_B06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
OVRT1_0087_D04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0045_C08.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
OVR01_0013_D06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0098_A08.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0078_H08.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0025_G09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0078_A04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0062_G02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0090_B07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0069_A11.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LNG01_0058_C05.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0045_C04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0019_B06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0021_F04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
TCH01_0080_F07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0098_B10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LVR01_0046_C03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LNG01_0017_D07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
OVR01_0089_F04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0109_C02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
OVRT1_0119_G03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
OVR01_0049_G08.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0042_D01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
TES01_0075_G07.b : gcagcaCGACTACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
TES01_0094_D12.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGATCTCAT
MLN01_0075_H06.b : gcagcagGACGACTAGGAAAGACCCCCTGCCAGAACCATGGAGGACCAGCGCGACCTCAT
KDN01_0042_A10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SKNB1_0060_A09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0069_B08.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PST01_0039_E03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SKNB1_0056_D03.b : GCACCATTACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCATCGCGACCTCAT
PST01_0088_B10.b : gcagcaCGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SKNB1_0027_C10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
TES01_0001_E06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0090_G02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0008_H08.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LNG01_0087_F06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SKNB1_0062_D01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SKNB1_0049_F03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
OVR01_0100_D11.b : GCAGCAGGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0110_D08.b : gcagcagGACGACTAGGAAAGA*CCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0099_G09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0079_C09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0013_D01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0072_D07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0076_B01.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
LNG01_0064_F06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ADR01_0069_H04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAAAACCATGGAGGACCAGCGCGACCTCTT
SPL01_0060_D05.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0064_H03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0096_B09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0009_D10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0029_C02.b : gcagcagGACGACTAGGAAAGACCCCACGCCAGAACCATGGAGGACCGGCGCGACCTCAT
LVR01_0036_A08.b : gcagcaCGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0045_G10.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
TCH01_0068_H04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0039_C03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0010_H06.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0025_B02.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0090_A04.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0023_E03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0079_G09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0043_F08.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0052_G09.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0073_B03.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0005_D08.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0083_D08.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0080_E08.b : GAGGCAGGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
TCH01_0092_A11.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPL01_0016_E09.b : gcagcagGACGACTAGGAATGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0035_H12.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0059_B07.b : gcagcagGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ITT01_0070_D01.b : GCAGCAGGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0022_C04.b : GCAGCAGGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
PBL01_0053_A03.b : GCAGCAGGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0093_D06.b : GCAGCAGGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
CLNT1_0125_D03.b : GCAGCAGGACGACTAGGAAAGACCCCAGGCCAGAACCGTGGAGGACCAGCGCGACCTCAT
CLNT1_0086_G03.b : GCAGCAGGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
MLN01_0037_B09.b : GCAGCAGGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ILNT1_0044_B10.b : GCAGCAGGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
THY01_0121_D01.b : GCAGCAGGACGAATAGGAAAGA*CCCAGGCCAGAACCATGGAGGACCAGCGCGAACTCAT
ITT01_0100_A12.b : GCAGCAGGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0080_H01.b : GCAGCAGGACGACTAGGAAAGACCCCAGGCCAGAACCATGGAGGACCAGCGCGACCTCAT
ADR01_0008_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACCATGGAGGACCAGCGCGACCTCAT
SPLT1_0033_A04.b : nnnnttgacagtagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0090_C02.b : ttttcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0068_H01.b :
MLN01_0096_D10.b :
ILNT1_0043_G04.b :
SPLT1_0035_C10.b :
ITT01_0087_G05.b :
ITT01_0033_E07.b :
20110601C-001078 : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
---------+---------+---------+---------+---------+---------+ 283
OVRT1_0096_D07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ITT01_0061_E02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
MLN01_0031_F06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
OVRM1_0216_F09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
OVRM1_0086_G02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
UTR01_0003_G07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
MLN01_0014_D04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ITT01_0036_H06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
PBL01_0083_F07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SMG01_0080_C07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0024_C04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0053_D09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0073_E01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPLT1_0039_H04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0011_E07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPLT1_0034_D05.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0007_C06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0066_E11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPLT1_0061_E04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPL01_0030_H11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0005_B01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPLT1_0071_C03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0052_A10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0085_C06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0020_G06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPLT1_0009_F05.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPLT1_0004_E02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0049_G10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0089_E04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPLT1_0054_F06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0020_H06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0083_F10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0092_E02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0092_B05.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0098_D05.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
TCH01_0051_B10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SPLT1_0051_F01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPLT1_0011_G01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPLT1_0070_F04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPL01_0055_B03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
TCH01_0076_C07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
HTMT1_0058_B09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0100_E07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0046_G08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0044_B06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
THY01_0108_D07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SPL01_0034_B02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
MLN01_0036_F12.b : CTCCAGCCATGATCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
THY01_0018_A10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ADR01_0006_E04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPL01_0022_C04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
PTG01_0108_B11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
THY01_0064_D01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ITT01_0086_H12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
PBL01_0034_C06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
PBL01_0038_G07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
MLN01_0001_G09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0140_D04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
MLN01_0067_G10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
PBL01_0027_B12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
PBL01_0012_B05.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0072_A02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0140_C04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0116_G06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0057_E05.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0042_D05.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
LNG01_0084_H05.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ITT01_0095_F05.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
MLN01_0034_H12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0015_B01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
LNG01_0066_A11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SPL01_0068_G02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
PTG01_0048_H09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
MLN01_0084_C06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0141_G09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
LNG01_0034_H06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ITT01_0064_A09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
LNG01_0046_C07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SPL01_0056_B10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
CLNT1_0054_F11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
THY01_0066_G06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
LNG01_0010_D04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
OVR01_0007_C08.b : CTCCAACCATGAGCAGGTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
LNG01_0020_G01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
CLNT1_0143_B07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0100_A01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0089_G10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
PBL01_0071_E09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ITT01_0001_G01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ITT01_0081_F09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
PBL01_0083_A12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
PBL01_0032_D04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0044_D02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ITT01_0078_H07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ITT01_0081_E12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
MLN01_0048_E02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
PBL01_0099_G09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ITT01_0036_G12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPL01_0096_E06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
LNG01_0027_A11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
LNG01_0060_G03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SPL01_0105_C04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
THY01_0061_H11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
CLNT1_0059_F08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0058_D02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0035_C03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0071_D12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
MLN01_0011_B01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
LNG01_0075_C12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
CLNT1_0050_C01.b : CTCCAACCATGAGCGGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
THY01_0037_B12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SPL01_0085_H06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
THY01_0056_D06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SPL01_0096_E10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
THY01_0016_F01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
THY01_0048_H11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
LNG01_0036_G11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ITT01_0045_A03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
PBL01_0057_E06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ITT01_0075_C06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0074_B10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
PTG01_0080_H11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
PBL01_0012_F07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
THY01_0093_E04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ITT01_0056_H01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPL01_0074_G04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
MLN01_0101_D07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ILNT1_0091_D11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0037_B12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0020_A02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
MLN01_0021_H08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
MLN01_0095_G11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
MLN01_0071_C05.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SKNB1_0010_G12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SKNB1_0096_G07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
CBLT1_0100_B06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
MLN01_0049_B07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CBLT1_0098_C03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPL01_0095_A01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPL01_0045_C10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ITT01_0057_H08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ITT01_0090_C09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ITT01_0081_G04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPLT1_0015_G09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
MLN01_0011_G03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SPLT1_0032_G07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0018_A07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPLT1_0098_E04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPLT1_0012_D07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPLT1_0006_E02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
TES01_0041_F03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPLT1_0090_E10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPLT1_0081_D07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPLT1_0074_G05.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
LNG01_0005_G11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ITT01_0096_C01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0075_E01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPLT1_0069_F02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CBLT1_0099_H05.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
PST01_0018_C10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPLT1_0081_B08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
PST01_0058_C01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
THY01_0111_E03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
PBL01_0026_B05.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
OVR01_0031_H02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
TCH01_0021_G01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ITT01_0097_C08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
LNG01_0079_F03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
TCH01_0090_D04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
CLNT1_0019_A06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
MLN01_0101_H07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
TCH01_0009_F12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
LNG01_0047_D07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
THY01_0104_H11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SMG01_0041_D10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
OVR01_0099_F05.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGACCCCC*GAGAGCAAGT
LVRM1_0161_H01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
THY01_0040_D10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
LVRM1_0085_B11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
OVRM1_0039_G04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
OVRM1_0129_D04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
THY01_0007_E11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
OVR01_0101_B02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGACCCCC*GAGAGCAAGT
PBL01_0038_D12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ITT01_0033_H12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SMG01_0021_G12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
MLN01_0017_C11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
PTG01_0098_F02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
CLNT1_0104_B09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
PTG01_0047_C08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
PBL01_0019_G12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SKNB1_0053_E02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
PBL01_0017_A10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
PBL01_0055_D03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ADR01_0053_D04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
PBL01_0053_B05.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ITT01_0086_A02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0113_F10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
TCH01_0063_E12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
PBL01_0008_H04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ITT01_0092_D12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SMG01_0090_A08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
LNG01_0101_D09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCC**GAGAGCAAGT
CLNT1_0065_G06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPL01_0037_E04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
MLN01_0043_G11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
CLNT1_0067_E07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
MLN01_0051_B12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
MLN01_0033_H02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
THY01_0053_C06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
OVR01_0055_D08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
CLNT1_0086_E01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPL01_0054_H05.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
THY01_0009_A01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
PBL01_0023_D05.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPL01_0004_A12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
UTR01_0091_C09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
THY01_0031_G06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
OVR01_0097_H09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ITT01_0027_C11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
UTR01_0094_F02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ITT01_0064_A12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
UTR01_0055_B08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
MLN01_0087_B09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
MLN01_0082_E11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
LNG01_0006_F01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SPL01_0008_A05.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
MLN01_0097_G12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0060_A02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
LNG01_0002_H03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
MLN01_0085_E10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ITT01_0060_E07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ITT01_0090_F07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ITT01_0087_D08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
UTR01_0052_G01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
MLN01_0056_D04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SPL01_0093_H09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
PBL01_0021_D06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ITT01_0057_D02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ITT01_0074_C03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
PBL01_0107_H05.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ADR01_0086_H06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0022_A10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ITT01_0075_A10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ADR01_0074_B03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ITT01_0021_A03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ITT01_0037_B10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ITT01_0055_F06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
PBL01_0092_H03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ITT01_0049_B09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
PBL01_0065_C06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
PBL01_0092_H10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
PBL01_0103_F07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ITT01_0018_H08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SPL01_0078_E10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPL01_0089_F03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ADR01_0070_G05.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ITT01_0083_B12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPL01_0104_F01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
MLN01_0087_F07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ADR01_0090_E06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPL01_0030_F09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPL01_0074_H11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
THY01_0086_B06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
OVRT1_0087_D04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
MLN01_0045_C08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAACGCCCCGGGGCCCCC*GAGAGCAAGT
OVR01_0013_D06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
MLN01_0098_A08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GGGAGCAAGT
SPL01_0078_H08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
MLN01_0025_G09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
MLN01_0078_A04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
MLN01_0062_G02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
THY01_0090_B07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
MLN01_0069_A11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
LNG01_0058_C05.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SPL01_0045_C04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
MLN01_0019_B06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
CLNT1_0021_F04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCTGGGGCCCCG*GAGAGCAAGT
TCH01_0080_F07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
THY01_0098_B10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
LVR01_0046_C03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
LNG01_0017_D07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
OVR01_0089_F04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
THY01_0109_C02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
OVRT1_0119_G03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
OVR01_0049_G08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ITT01_0042_D01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
TES01_0075_G07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
TES01_0094_D12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
MLN01_0075_H06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
KDN01_0042_A10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SKNB1_0060_A09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
CLNT1_0069_B08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
PST01_0039_E03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SKNB1_0056_D03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
PST01_0088_B10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SKNB1_0027_C10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
TES01_0001_E06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SPL01_0090_G02.b : CTCCAACCATGAGCAGCTGCCCATGCCGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
PBL01_0008_H08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
LNG01_0087_F06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SKNB1_0062_D01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SKNB1_0049_F03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
OVR01_0100_D11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
THY01_0110_D08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SPLT1_0099_G09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPLT1_0079_C09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0013_D01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPLT1_0072_D07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPLT1_0076_B01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
LNG01_0064_F06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ADR01_0069_H04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAAAGCAAGT
SPL01_0060_D05.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPL01_0064_H03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
THY01_0096_B09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SPL01_0009_D10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
MLN01_0029_C02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCCCGAGAGCAAGT
LVR01_0036_A08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
THY01_0045_G10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
TCH01_0068_H04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
MLN01_0039_C03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
PBL01_0010_H06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
PBL01_0025_B02.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
PBL01_0090_A04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ITT01_0023_E03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ITT01_0079_G09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
MLN01_0043_F08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
MLN01_0052_G09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPL01_0073_B03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
SPL01_0005_D08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
THY01_0083_D08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
CLNT1_0080_E08.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGN
TCH01_0092_A11.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SPL01_0016_E09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ITT01_0035_H12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
THY01_0059_B07.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ITT01_0070_D01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
THY01_0022_C04.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
PBL01_0053_A03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0093_D06.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0125_D03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
CLNT1_0086_G03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
MLN01_0037_B09.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ILNT1_0044_B10.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
THY01_0121_D01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
ITT01_0100_A12.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SPLT1_0080_H01.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
ADR01_0008_G03.b : CTCCAACCATGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SPLT1_0033_A04.b : xxxxxxxxxxGAGCAGCTGCCCATGCTGGGCCAGCGCCCCGGGGCCCCG*GAGAGCAAGT
THY01_0090_C02.b : xxxxxxxxxxxxxxxxxxxxxxxTGCTGGGCCAGCGCCCCGGGGCCCCC*GAGAGCAAGT
SMG01_0068_H01.b : tttttgctaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
MLN01_0096_D10.b : nggctaggcacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0043_G04.b :
SPLT1_0035_C10.b :
ITT01_0087_G05.b :
ITT01_0033_E07.b :
20110601C-001078 : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
---------+---------+---------+---------+---------+---------+ 340
OVRT1_0096_D07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0061_E02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0031_F06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
OVRM1_0216_F09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
OVRM1_0086_G02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
UTR01_0003_G07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0014_D04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0036_H06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTATCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0083_F07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SMG01_0080_C07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0024_C04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0053_D09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0073_E01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0039_H04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0011_E07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0034_D05.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0007_C06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0066_E11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0061_E04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0030_H11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0005_B01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0071_C03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0052_A10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0085_C06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0020_G06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0009_F05.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0004_E02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0049_G10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0089_E04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0054_F06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0020_H06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0083_F10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0092_E02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0092_B05.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0098_D05.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
TCH01_0051_B10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0051_F01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0011_G01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0070_F04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0055_B03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
TCH01_0076_C07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
HTMT1_0058_B09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0100_E07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0046_G08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0044_B06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0108_D07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0034_B02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0036_F12.b : GCTTCCTGTTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGATG
THY01_0018_A10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ADR01_0006_E04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0022_C04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PTG01_0108_B11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0064_D01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0086_H12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0034_C06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0038_G07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0001_G09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGTTCTGCTCCTGGCTG
CLNT1_0140_D04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0067_G10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0027_B12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0012_B05.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0072_A02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0140_C04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0116_G06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0057_E05.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0042_D05.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LNG01_0084_H05.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0095_F05.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0034_H12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0015_B01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LNG01_0066_A11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0068_G02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PTG01_0048_H09.b : GCAGCC**GTGGAGCTCTG*TACATAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0084_C06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0141_G09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LNG01_0034_H06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0064_A09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LNG01_0046_C07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0056_B10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTCTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0054_F11.b : GCAGCC**GTGGAGCTCTG*TACACAAGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0066_G06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LNG01_0010_D04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
OVR01_0007_C08.b : GCTGCC**GTGGAGCTATG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LNG01_0020_G01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0143_B07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0100_A01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0089_G10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0071_E09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0001_G01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTCTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0081_F09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0083_A12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0032_D04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0044_D02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0078_H07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0081_E12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0048_E02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0099_G09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0036_G12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0096_E06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LNG01_0027_A11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LNG01_0060_G03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0105_C04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0061_H11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0059_F08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0058_D02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0035_C03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0071_D12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0011_B01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LNG01_0075_C12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0050_C01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0037_B12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0085_H06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0056_D06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0096_E10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0016_F01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0048_H11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LNG01_0036_G11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0045_A03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0057_E06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0075_C06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0074_B10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PTG01_0080_H11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0012_F07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0093_E04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0056_H01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0074_G04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0101_D07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0091_D11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0037_B12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0020_A02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0021_H08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0095_G11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0071_C05.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SKNB1_0010_G12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SKNB1_0096_G07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CBLT1_0100_B06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0049_B07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CBLT1_0098_C03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0095_A01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0045_C10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0057_H08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0090_C09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0081_G04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0015_G09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0011_G03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0032_G07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0018_A07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0098_E04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0012_D07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0006_E02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
TES01_0041_F03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0090_E10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0081_D07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0074_G05.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LNG01_0005_G11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0096_C01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0075_E01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0069_F02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CBLT1_0099_H05.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PST01_0018_C10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0081_B08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PST01_0058_C01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0111_E03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0026_B05.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
OVR01_0031_H02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
TCH01_0021_G01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0097_C08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LNG01_0079_F03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
TCH01_0090_D04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0019_A06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0101_H07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
TCH01_0009_F12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LNG01_0047_D07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0104_H11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SMG01_0041_D10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
OVR01_0099_F05.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LVRM1_0161_H01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0040_D10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LVRM1_0085_B11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
OVRM1_0039_G04.b : GCAGCC**GTGGAGCTCTG*TACACAAGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
OVRM1_0129_D04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0007_E11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
OVR01_0101_B02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0038_D12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0033_H12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SMG01_0021_G12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0017_C11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PTG01_0098_F02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0104_B09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PTG01_0047_C08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0019_G12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SKNB1_0053_E02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0017_A10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0055_D03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ADR01_0053_D04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0053_B05.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0086_A02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0113_F10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
TCH01_0063_E12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0008_H04.b : GCAGCC**ATGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0092_D12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SMG01_0090_A08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LNG01_0101_D09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0065_G06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0037_E04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0043_G11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0067_E07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0051_B12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0033_H02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0053_C06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
OVR01_0055_D08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0086_E01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0054_H05.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0009_A01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0023_D05.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0004_A12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
UTR01_0091_C09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0031_G06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGGTG
OVR01_0097_H09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0027_C11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
UTR01_0094_F02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0064_A12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
UTR01_0055_B08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0087_B09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0082_E11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LNG01_0006_F01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0008_A05.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0097_G12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0060_A02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LNG01_0002_H03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0085_E10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0060_E07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0090_F07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0087_D08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
UTR01_0052_G01.b : GCAGCC**GTGGAGCCCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0056_D04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0093_H09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0021_D06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0057_D02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0074_C03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0107_H05.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ADR01_0086_H06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0022_A10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0075_A10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ADR01_0074_B03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0021_A03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0037_B10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0055_F06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0092_H03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0049_B09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0065_C06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0092_H10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0103_F07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0018_H08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0078_E10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0089_F03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ADR01_0070_G05.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0083_B12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0104_F01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0087_F07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ADR01_0090_E06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0030_F09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0074_H11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0086_B06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
OVRT1_0087_D04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0045_C08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
OVR01_0013_D06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0098_A08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0078_H08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0025_G09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0078_A04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0062_G02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0090_B07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0069_A11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LNG01_0058_C05.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0045_C04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0019_B06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0021_F04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
TCH01_0080_F07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0098_B10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LVR01_0046_C03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LNG01_0017_D07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
OVR01_0089_F04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0109_C02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
OVRT1_0119_G03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
OVR01_0049_G08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0042_D01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
TES01_0075_G07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
TES01_0094_D12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0075_H06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
KDN01_0042_A10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SKNB1_0060_A09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0069_B08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PST01_0039_E03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SKNB1_0056_D03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PST01_0088_B10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SKNB1_0027_C10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
TES01_0001_E06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0090_G02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0008_H08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LNG01_0087_F06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SKNB1_0062_D01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SKNB1_0049_F03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
OVR01_0100_D11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0110_D08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0099_G09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0079_C09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0013_D01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0072_D07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0076_B01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LNG01_0064_F06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ADR01_0069_H04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCGGGGGGCTCTGCTCCTGGCTG
SPL01_0060_D05.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0064_H03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0096_B09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0009_D10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0029_C02.b : GCAGCC**GTGGAGCTCTGATACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
LVR01_0036_A08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0045_G10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
TCH01_0068_H04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0039_C03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0010_H06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0025_B02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0090_A04.b : GCAGCC**GTGGA*CTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0023_E03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0079_G09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0043_F08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0052_G09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0073_B03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0005_D08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0083_D08.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0080_E08.b : GCAGCC**GGGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
TCH01_0092_A11.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPL01_0016_E09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0035_H12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0059_B07.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0070_D01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0022_C04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
PBL01_0053_A03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0093_D06.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0125_D03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
CLNT1_0086_G03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0037_B09.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0044_B10.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0121_D01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ITT01_0100_A12.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0080_H01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
ADR01_0008_G03.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SPLT1_0033_A04.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
THY01_0090_C02.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
SMG01_0068_H01.b : GCAGCC**GTGGAGCTCTG*TACACAGGCTTTTCTGTCCTGGTGGCTCTGCTCCTGGCTG
MLN01_0096_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGTCCTGGTGGCTCTGCTCCTGGCTG
ILNT1_0043_G04.b : nnnntttgcgagtagacgccgtaxxxxxxxxxx
SPLT1_0035_C10.b :
ITT01_0087_G05.b :
ITT01_0033_E07.b :
20110601C-001078 : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
---------+---------+---------+---------+---------+---------+ 400
OVRT1_0096_D07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0061_E02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0031_F06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
OVRM1_0216_F09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
OVRM1_0086_G02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
UTR01_0003_G07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0014_D04.b : GCCAGGCCACTACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0036_H06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0083_F07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SMG01_0080_C07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0024_C04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0053_D09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0073_E01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0039_H04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0011_E07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0034_D05.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0007_C06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0066_E11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0061_E04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0030_H11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0005_B01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0071_C03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0052_A10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0085_C06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0020_G06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0009_F05.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0004_E02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0049_G10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0089_E04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0054_F06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0020_H06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0083_F10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0092_E02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0092_B05.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0098_D05.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
TCH01_0051_B10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0051_F01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0011_G01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0070_F04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0055_B03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
TCH01_0076_C07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
HTMT1_0058_B09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0100_E07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0046_G08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0044_B06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0108_D07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0034_B02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0036_F12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCATCGTCATGGCCGGCTGGACAAGCTGACGG
THY01_0018_A10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ADR01_0006_E04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0022_C04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PTG01_0108_B11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0064_D01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0086_H12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0034_C06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0038_G07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0001_G09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0140_D04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0067_G10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0027_B12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0012_B05.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0072_A02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0140_C04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0116_G06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0057_E05.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0042_D05.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LNG01_0084_H05.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0095_F05.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0034_H12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0015_B01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LNG01_0066_A11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0068_G02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PTG01_0048_H09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0084_C06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0141_G09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LNG01_0034_H06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0064_A09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LNG01_0046_C07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0056_B10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0054_F11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0066_G06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LNG01_0010_D04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
OVR01_0007_C08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LNG01_0020_G01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0143_B07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0100_A01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0089_G10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0071_E09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0001_G01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0081_F09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0083_A12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0032_D04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0044_D02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0078_H07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0081_E12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0048_E02.b : GC*AGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0099_G09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGAACAAGCTGACGG
ITT01_0036_G12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0096_E06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LNG01_0027_A11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LNG01_0060_G03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0105_C04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0061_H11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0059_F08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0058_D02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0035_C03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAGGCTGACGG
CLNT1_0071_D12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0011_B01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LNG01_0075_C12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0050_C01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0037_B12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGGCAAGCTGACGG
SPL01_0085_H06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0056_D06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0096_E10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0016_F01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0048_H11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LNG01_0036_G11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0045_A03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0057_E06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0075_C06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0074_B10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PTG01_0080_H11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0012_F07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0093_E04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0056_H01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0074_G04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0101_D07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0091_D11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0037_B12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0020_A02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0021_H08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0095_G11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0071_C05.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SKNB1_0010_G12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SKNB1_0096_G07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CBLT1_0100_B06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0049_B07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CBLT1_0098_C03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0095_A01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0045_C10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0057_H08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0090_C09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0081_G04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0015_G09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0011_G03.b : GCCAGGCCACCAACGCCTACTTCCTGTACCAGCTGCACGGACGGCTGGACAAGCTGACGG
SPLT1_0032_G07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0018_A07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0098_E04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0012_D07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0006_E02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
TES01_0041_F03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0090_E10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0081_D07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0074_G05.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LNG01_0005_G11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0096_C01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0075_E01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0069_F02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CBLT1_0099_H05.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PST01_0018_C10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0081_B08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PST01_0058_C01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0111_E03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCAGCTGGACAAGCTGACGG
PBL01_0026_B05.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
OVR01_0031_H02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
TCH01_0021_G01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0097_C08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LNG01_0079_F03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
TCH01_0090_D04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0019_A06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0101_H07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
TCH01_0009_F12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LNG01_0047_D07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0104_H11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SMG01_0041_D10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
OVR01_0099_F05.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LVRM1_0161_H01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0040_D10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LVRM1_0085_B11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
OVRM1_0039_G04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
OVRM1_0129_D04.b : GC*AGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0007_E11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
OVR01_0101_B02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0038_D12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0033_H12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SMG01_0021_G12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0017_C11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PTG01_0098_F02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0104_B09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PTG01_0047_C08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0019_G12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SKNB1_0053_E02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0017_A10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0055_D03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ADR01_0053_D04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0053_B05.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0086_A02.b : GCCAGGCCACCACCGCCCACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0113_F10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
TCH01_0063_E12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0008_H04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0092_D12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SMG01_0090_A08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LNG01_0101_D09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0065_G06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0037_E04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0043_G11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0067_E07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0051_B12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0033_H02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0053_C06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
OVR01_0055_D08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0086_E01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0054_H05.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0009_A01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0023_D05.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0004_A12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
UTR01_0091_C09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0031_G06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
OVR01_0097_H09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0027_C11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
UTR01_0094_F02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0064_A12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
UTR01_0055_B08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0087_B09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0082_E11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LNG01_0006_F01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0008_A05.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0097_G12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0060_A02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LNG01_0002_H03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0085_E10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0060_E07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0090_F07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0087_D08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAAGGCCGGCTGGACAAGCTGACGG
UTR01_0052_G01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0056_D04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0093_H09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0021_D06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0057_D02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0074_C03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0107_H05.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ADR01_0086_H06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0022_A10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0075_A10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ADR01_0074_B03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0021_A03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0037_B10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0055_F06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0092_H03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0049_B09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0065_C06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0092_H10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0103_F07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0018_H08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0078_E10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0089_F03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ADR01_0070_G05.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0083_B12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0104_F01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0087_F07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ADR01_0090_E06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0030_F09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0074_H11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0086_B06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
OVRT1_0087_D04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0045_C08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
OVR01_0013_D06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0098_A08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0078_H08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0025_G09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0078_A04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0062_G02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0090_B07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0069_A11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LNG01_0058_C05.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0045_C04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0019_B06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCTGGCTGGACAAGCTGACGG
CLNT1_0021_F04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
TCH01_0080_F07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0098_B10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LVR01_0046_C03.b : GCCAGGCCACCACCGCCTACTCCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LNG01_0017_D07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
OVR01_0089_F04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0109_C02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGGCGGCTGGACAAGCTGACGG
OVRT1_0119_G03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
OVR01_0049_G08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0042_D01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
TES01_0075_G07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
TES01_0094_D12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0075_H06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
KDN01_0042_A10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SKNB1_0060_A09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0069_B08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PST01_0039_E03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SKNB1_0056_D03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PST01_0088_B10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SKNB1_0027_C10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
TES01_0001_E06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0090_G02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCGGGGCCGGCTGGACAAGCTGACGG
PBL01_0008_H08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LNG01_0087_F06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SKNB1_0062_D01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SKNB1_0049_F03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
OVR01_0100_D11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0110_D08.b : GCCAGGCCACCACCGNCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0099_G09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0079_C09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0013_D01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0072_D07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0076_B01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LNG01_0064_F06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ADR01_0069_H04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0060_D05.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0064_H03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0096_B09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0009_D10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0029_C02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
LVR01_0036_A08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCCGACGG
THY01_0045_G10.b : GCCAGGCCACCACCGCCTGCTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
TCH01_0068_H04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0039_C03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0010_H06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0025_B02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0090_A04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0023_E03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0079_G09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0043_F08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0052_G09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0073_B03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0005_D08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0083_D08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0080_E08.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
TCH01_0092_A11.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPL01_0016_E09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0035_H12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0059_B07.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0070_D01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0022_C04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
PBL01_0053_A03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0093_D06.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0125_D03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
CLNT1_0086_G03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
MLN01_0037_B09.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0044_B10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0121_D01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ITT01_0100_A12.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0080_H01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ADR01_0008_G03.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0033_A04.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
THY01_0090_C02.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SMG01_0068_H01.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGA
MLN01_0096_D10.b : GCCAGGCCACCACCGCCTACTTCCTGTACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
ILNT1_0043_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxACCAGCAGCAGGGCCGGCTGGACAAGCTGACGG
SPLT1_0035_C10.b : nnnn
ITT01_0087_G05.b :
ITT01_0033_E07.b :
20110601C-001078 : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
---------+---------+---------+---------+---------+---------+ 460
OVRT1_0096_D07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0061_E02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0031_F06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
OVRM1_0216_F09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
OVRM1_0086_G02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
UTR01_0003_G07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0014_D04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0036_H06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0083_F07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SMG01_0080_C07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0024_C04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0053_D09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0073_E01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0039_H04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0011_E07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0034_D05.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0007_C06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0066_E11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0061_E04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0030_H11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0005_B01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0071_C03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0052_A10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0085_C06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0020_G06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0009_F05.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0004_E02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0049_G10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0089_E04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0054_F06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0020_H06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0083_F10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0092_E02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0092_B05.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0098_D05.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
TCH01_0051_B10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0051_F01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0011_G01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0070_F04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0055_B03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
TCH01_0076_C07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTACGGATGAAGCTTCCCAAGCCCTCCAAGC
HTMT1_0058_B09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0100_E07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0046_G08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0044_B06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0108_D07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0034_B02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0036_F12.b : TCACCTCTCATAACTTGCTTCTGGAGAGCCTGCGGATGAATCTTCCCAAGCCCTCCGAGC
THY01_0018_A10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ADR01_0006_E04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0022_C04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PTG01_0108_B11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0064_D01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0086_H12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0034_C06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0038_G07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0001_G09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0140_D04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0067_G10.b : TCACCTCTCAAAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0027_B12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0012_B05.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0072_A02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0140_C04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0116_G06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0057_E05.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0042_D05.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LNG01_0084_H05.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0095_F05.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0034_H12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0015_B01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LNG01_0066_A11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0068_G02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PTG01_0048_H09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0084_C06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0141_G09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGGAGCTTCCCAAGCCCTCCAAGC
LNG01_0034_H06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0064_A09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LNG01_0046_C07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0056_B10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0054_F11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0066_G06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LNG01_0010_D04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
OVR01_0007_C08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LNG01_0020_G01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0143_B07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0100_A01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0089_G10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0071_E09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0001_G01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0081_F09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0083_A12.b : TCACCTCTCAGAACTTCCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0032_D04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0044_D02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0078_H07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0081_E12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0048_E02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0099_G09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0036_G12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0096_E06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LNG01_0027_A11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LNG01_0060_G03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0105_C04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0061_H11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0059_F08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0058_D02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0035_C03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0071_D12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0011_B01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LNG01_0075_C12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0050_C01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0037_B12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0085_H06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0056_D06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0096_E10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0016_F01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0048_H11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LNG01_0036_G11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0045_A03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0057_E06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0075_C06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0074_B10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PTG01_0080_H11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0012_F07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0093_E04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0056_H01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0074_G04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0101_D07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0091_D11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0037_B12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0020_A02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0021_H08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0095_G11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0071_C05.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SKNB1_0010_G12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SKNB1_0096_G07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CBLT1_0100_B06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0049_B07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CBLT1_0098_C03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0095_A01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0045_C10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0057_H08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0090_C09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0081_G04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0015_G09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0011_G03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCTAGCCCTCCAAGC
SPLT1_0032_G07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0018_A07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0098_E04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0012_D07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0006_E02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
TES01_0041_F03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0090_E10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0081_D07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0074_G05.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LNG01_0005_G11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0096_C01.b : TCACCTCTCAGGACTTGCAGCTGGAGAGCTTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0075_E01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0069_F02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CBLT1_0099_H05.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PST01_0018_C10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0081_B08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PST01_0058_C01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0111_E03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0026_B05.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
OVR01_0031_H02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
TCH01_0021_G01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0097_C08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LNG01_0079_F03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
TCH01_0090_D04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0019_A06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0101_H07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
TCH01_0009_F12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LNG01_0047_D07.b : TCACCTCTCGGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0104_H11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SMG01_0041_D10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
OVR01_0099_F05.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LVRM1_0161_H01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0040_D10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LVRM1_0085_B11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
OVRM1_0039_G04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
OVRM1_0129_D04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0007_E11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
OVR01_0101_B02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0038_D12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0033_H12.b : TCACCTCTCAGAACTTGTAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SMG01_0021_G12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0017_C11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PTG01_0098_F02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0104_B09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PTG01_0047_C08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0019_G12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SKNB1_0053_E02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0017_A10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0055_D03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ADR01_0053_D04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0053_B05.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0086_A02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0113_F10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
TCH01_0063_E12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0008_H04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0092_D12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SMG01_0090_A08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LNG01_0101_D09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0065_G06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0037_E04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0043_G11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0067_E07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0051_B12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0033_H02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0053_C06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
OVR01_0055_D08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0086_E01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0054_H05.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0009_A01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0023_D05.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0004_A12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
UTR01_0091_C09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0031_G06.b : ACACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
OVR01_0097_H09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0027_C11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
UTR01_0094_F02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0064_A12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
UTR01_0055_B08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0087_B09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0082_E11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LNG01_0006_F01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0008_A05.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0097_G12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0060_A02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LNG01_0002_H03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0085_E10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0060_E07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0090_F07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0087_D08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
UTR01_0052_G01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0056_D04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0093_H09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCCGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0021_D06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0057_D02.b : TCACCTCTCAGAACTTGCAGCTAGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0074_C03.b : TCACCTCTCAGAACTTGCAGCCGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0107_H05.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ADR01_0086_H06.b : TTACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAGGC
CLNT1_0022_A10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0075_A10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ADR01_0074_B03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0021_A03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0037_B10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0055_F06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCCTCCCAAGCCCTCCAAGC
PBL01_0092_H03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0049_B09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0065_C06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0092_H10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0103_F07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0018_H08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0078_E10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0089_F03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ADR01_0070_G05.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0083_B12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0104_F01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0087_F07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ADR01_0090_E06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0030_F09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0074_H11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0086_B06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
OVRT1_0087_D04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0045_C08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTTCAAGC
OVR01_0013_D06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0098_A08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0078_H08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAGGC
MLN01_0025_G09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0078_A04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0062_G02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0090_B07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0069_A11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LNG01_0058_C05.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0045_C04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0019_B06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0021_F04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
TCH01_0080_F07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0098_B10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LVR01_0046_C03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LNG01_0017_D07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
OVR01_0089_F04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0109_C02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
OVRT1_0119_G03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
OVR01_0049_G08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0042_D01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
TES01_0075_G07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
TES01_0094_D12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0075_H06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
KDN01_0042_A10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SKNB1_0060_A09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0069_B08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PST01_0039_E03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SKNB1_0056_D03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PST01_0088_B10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SKNB1_0027_C10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
TES01_0001_E06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0090_G02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0008_H08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LNG01_0087_F06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SKNB1_0062_D01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SKNB1_0049_F03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
OVR01_0100_D11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0110_D08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0099_G09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0079_C09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0013_D01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0072_D07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0076_B01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LNG01_0064_F06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ADR01_0069_H04.b : TCACCTCTCAAAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0060_D05.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0064_H03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0096_B09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0009_D10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0029_C02.b : TCACCTCTCATAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
LVR01_0036_A08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0045_G10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
TCH01_0068_H04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0039_C03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0010_H06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0025_B02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0090_A04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0023_E03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0079_G09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0043_F08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0052_G09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0073_B03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0005_D08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0083_D08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0080_E08.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
TCH01_0092_A11.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPL01_0016_E09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0035_H12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0059_B07.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0070_D01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0022_C04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
PBL01_0053_A03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0093_D06.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0125_D03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
CLNT1_0086_G03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0037_B09.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0044_B10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0121_D01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ITT01_0100_A12.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0080_H01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ADR01_0008_G03.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0033_A04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
THY01_0090_C02.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SMG01_0068_H01.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
MLN01_0096_D10.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
ILNT1_0043_G04.b : TCACCTCTCAGAACTTGCAGCTGGAGAGCCTGCGGATGAAGCTTCCCAAGCCCTCCAAGC
SPLT1_0035_C10.b : ccgacggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC
ITT01_0087_G05.b : naagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0033_E07.b : nnnnggagtxx
20110601C-001078 : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
---------+---------+---------+---------+---------+---------+ 520
OVRT1_0096_D07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0061_E02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0031_F06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
OVRM1_0216_F09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
OVRM1_0086_G02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
UTR01_0003_G07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0014_D04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0036_H06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0083_F07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SMG01_0080_C07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0024_C04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0053_D09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0073_E01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0039_H04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0011_E07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0034_D05.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0007_C06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0066_E11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0061_E04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0030_H11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0005_B01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0071_C03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0052_A10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0085_C06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0020_G06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0009_F05.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0004_E02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0049_G10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0089_E04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0054_F06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0020_H06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0083_F10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0092_E02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0092_B05.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0098_D05.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
TCH01_0051_B10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0051_F01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0011_G01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0070_F04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0055_B03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
TCH01_0076_C07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
HTMT1_0058_B09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0100_E07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0046_G08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0044_B06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0108_D07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0034_B02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0036_F12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCATGCCCTGCCCATGGAATGCC
THY01_0018_A10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ADR01_0006_E04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0022_C04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PTG01_0108_B11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0064_D01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0086_H12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0034_C06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0038_G07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0001_G09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0140_D04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0067_G10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0027_B12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0012_B05.b : CTTTGAGCGAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0072_A02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0140_C04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0116_G06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0057_E05.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0042_D05.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LNG01_0084_H05.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0095_F05.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0034_H12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0015_B01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LNG01_0066_A11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0068_G02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PTG01_0048_H09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0084_C06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0141_G09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LNG01_0034_H06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0064_A09.b : CTTCGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LNG01_0046_C07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0056_B10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0054_F11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0066_G06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LNG01_0010_D04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
OVR01_0007_C08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LNG01_0020_G01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0143_B07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0100_A01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0089_G10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0071_E09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0001_G01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0081_F09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0083_A12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0032_D04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0044_D02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0078_H07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0081_E12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0048_E02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0099_G09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0036_G12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0096_E06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LNG01_0027_A11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LNG01_0060_G03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0105_C04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0061_H11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0059_F08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0058_D02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0035_C03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0071_D12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0011_B01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LNG01_0075_C12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0050_C01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0037_B12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0085_H06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCTTGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0056_D06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0096_E10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0016_F01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0048_H11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LNG01_0036_G11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0045_A03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0057_E06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0075_C06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0074_B10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PTG01_0080_H11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0012_F07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0093_E04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0056_H01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0074_G04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0101_D07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0091_D11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0037_B12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0020_A02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0021_H08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0095_G11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0071_C05.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SKNB1_0010_G12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SKNB1_0096_G07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CBLT1_0100_B06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0049_B07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CBLT1_0098_C03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0095_A01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0045_C10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0057_H08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0090_C09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0081_G04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0015_G09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0011_G03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCGATGCCGATGCAAGCCCTGCCCATGGAAGGCC
SPLT1_0032_G07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0018_A07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0098_E04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0012_D07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0006_E02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
TES01_0041_F03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0090_E10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0081_D07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0074_G05.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LNG01_0005_G11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0096_C01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0075_E01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0069_F02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CBLT1_0099_H05.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PST01_0018_C10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0081_B08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PST01_0058_C01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0111_E03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0026_B05.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
OVR01_0031_H02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
TCH01_0021_G01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0097_C08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LNG01_0079_F03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
TCH01_0090_D04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0019_A06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0101_H07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
TCH01_0009_F12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LNG01_0047_D07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0104_H11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SMG01_0041_D10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
OVR01_0099_F05.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LVRM1_0161_H01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0040_D10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LVRM1_0085_B11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
OVRM1_0039_G04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
OVRM1_0129_D04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0007_E11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
OVR01_0101_B02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0038_D12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0033_H12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SMG01_0021_G12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0017_C11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PTG01_0098_F02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0104_B09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PTG01_0047_C08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0019_G12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SKNB1_0053_E02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0017_A10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0055_D03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ADR01_0053_D04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0053_B05.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0086_A02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0113_F10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
TCH01_0063_E12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0008_H04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0092_D12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SMG01_0090_A08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LNG01_0101_D09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0065_G06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0037_E04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0043_G11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0067_E07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0051_B12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0033_H02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0053_C06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
OVR01_0055_D08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0086_E01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0054_H05.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0009_A01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0023_D05.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0004_A12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
UTR01_0091_C09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0031_G06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
OVR01_0097_H09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0027_C11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
UTR01_0094_F02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0064_A12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
UTR01_0055_B08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0087_B09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0082_E11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LNG01_0006_F01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0008_A05.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0097_G12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0060_A02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LNG01_0002_H03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0085_E10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0060_E07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0090_F07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0087_D08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
UTR01_0052_G01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0056_D04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0093_H09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0021_D06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0057_D02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0074_C03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0107_H05.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ADR01_0086_H06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0022_A10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0075_A10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ADR01_0074_B03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0021_A03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0037_B10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0055_F06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0092_H03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0049_B09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0065_C06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0092_H10.b : CCTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0103_F07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0018_H08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0078_E10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0089_F03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ADR01_0070_G05.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0083_B12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0104_F01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0087_F07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGGTGCAGGCCCTGCCCATGGAAGGCC
ADR01_0090_E06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0030_F09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0074_H11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCT
THY01_0086_B06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
OVRT1_0087_D04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0045_C08.b : CTTTGAGCAAGACGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
OVR01_0013_D06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0098_A08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0078_H08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0025_G09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0078_A04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0062_G02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0090_B07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0069_A11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LNG01_0058_C05.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0045_C04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0019_B06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0021_F04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
TCH01_0080_F07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0098_B10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LVR01_0046_C03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LNG01_0017_D07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
OVR01_0089_F04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0109_C02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
OVRT1_0119_G03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
OVR01_0049_G08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0042_D01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
TES01_0075_G07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCCATGGAAGCC
TES01_0094_D12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0075_H06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
KDN01_0042_A10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SKNB1_0060_A09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0069_B08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCTTGGAAGGCC
PST01_0039_E03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SKNB1_0056_D03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PST01_0088_B10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SKNB1_0027_C10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
TES01_0001_E06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0090_G02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0008_H08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LNG01_0087_F06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SKNB1_0062_D01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SKNB1_0049_F03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
OVR01_0100_D11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0110_D08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0099_G09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0079_C09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0013_D01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0072_D07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0076_B01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
LNG01_0064_F06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ADR01_0069_H04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0060_D05.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0064_H03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0096_B09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCAATGGAAGGCC
SPL01_0009_D10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0029_C02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCATGCCCTGCCCATGGAAGGCC
LVR01_0036_A08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0045_G10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
TCH01_0068_H04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0039_C03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0010_H06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0025_B02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0090_A04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0023_E03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0079_G09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0043_F08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0052_G09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0073_B03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0005_D08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0083_D08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0080_E08.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
TCH01_0092_A11.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPL01_0016_E09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0035_H12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0059_B07.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0070_D01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0022_C04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
PBL01_0053_A03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0093_D06.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGTTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0125_D03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
CLNT1_0086_G03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0037_B09.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0044_B10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0121_D01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0100_A12.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0080_H01.b : CCTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ADR01_0008_G03.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0033_A04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
THY01_0090_C02.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCT
SMG01_0068_H01.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
MLN01_0096_D10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ILNT1_0043_G04.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
SPLT1_0035_C10.b : CTTTGAGCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0087_G05.b : xxxxxxxCAAGATGCGGGTTTCCGCCCCCATGCTGATGCAGGCCCTGCCCATGGAAGGCC
ITT01_0033_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGCCCATGGAAGGCC
20110601C-001078 : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
---------+---------+---------+---------+---------+---------+ 579
OVRT1_0096_D07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0061_E02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0031_F06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
OVRM1_0216_F09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
OVRM1_0086_G02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
UTR01_0003_G07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0014_D04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0036_H06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0083_F07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SMG01_0080_C07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0024_C04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0053_D09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0073_E01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0039_H04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0011_E07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0034_D05.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0007_C06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0066_E11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0061_E04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0030_H11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0005_B01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0071_C03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0052_A10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0085_C06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0020_G06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0009_F05.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0004_E02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0049_G10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0089_E04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0054_F06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0020_H06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0083_F10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0092_E02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0092_B05.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0098_D05.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
TCH01_0051_B10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0051_F01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0011_G01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0070_F04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0055_B03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
TCH01_0076_C07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
HTMT1_0058_B09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0100_E07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0046_G08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0044_B06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0108_D07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0034_B02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0036_F12.b : CGGAGCCTATGCGCGACTCCACCGAGTACGGCAACATGACC*CATGACCACATGATGCAC
THY01_0018_A10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ADR01_0006_E04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0022_C04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PTG01_0108_B11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0064_D01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0086_H12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0034_C06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0038_G07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0001_G09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0140_D04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0067_G10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0027_B12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0012_B05.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0072_A02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0140_C04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0116_G06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0057_E05.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0042_D05.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
LNG01_0084_H05.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0095_F05.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0034_H12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0015_B01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
LNG01_0066_A11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0068_G02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PTG01_0048_H09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0084_C06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0141_G09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
LNG01_0034_H06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0064_A09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
LNG01_0046_C07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0056_B10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0054_F11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0066_G06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
LNG01_0010_D04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
OVR01_0007_C08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
LNG01_0020_G01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0143_B07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0100_A01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0089_G10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0071_E09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0001_G01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0081_F09.b : CGGAGCCTATGCGCAACGCCGCCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0083_A12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0032_D04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0044_D02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0078_H07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0081_E12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0048_E02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0099_G09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0036_G12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0096_E06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
LNG01_0027_A11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
LNG01_0060_G03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0105_C04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0061_H11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0059_F08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0058_D02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0035_C03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0071_D12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0011_B01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
LNG01_0075_C12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0050_C01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0037_B12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0085_H06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0056_D06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0096_E10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0016_F01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0048_H11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
LNG01_0036_G11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0045_A03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0057_E06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0075_C06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0074_B10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PTG01_0080_H11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0012_F07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0093_E04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0056_H01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0074_G04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0101_D07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0091_D11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0037_B12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0020_A02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0021_H08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0095_G11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0071_C05.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGGCCACGTGATGCAC
SKNB1_0010_G12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SKNB1_0096_G07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CBLT1_0100_B06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0049_B07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CBLT1_0098_C03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0095_A01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0045_C10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0057_H08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0090_C09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0081_G04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0015_G09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0011_G03.b : CGGAGCCTATGCGCGACGCCACCTAGTACGGCTACATGACC*CATGACCACGTGATGCAC
SPLT1_0032_G07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0018_A07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0098_E04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0012_D07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0006_E02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
TES01_0041_F03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0090_E10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0081_D07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0074_G05.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
LNG01_0005_G11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0096_C01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0075_E01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0069_F02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CBLT1_0099_H05.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PST01_0018_C10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0081_B08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PST01_0058_C01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0111_E03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGAACACGTGATGCAC
PBL01_0026_B05.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
OVR01_0031_H02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
TCH01_0021_G01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0097_C08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
LNG01_0079_F03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGTAACATGACC*CAGGACCACGTGATGCAC
TCH01_0090_D04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0019_A06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0101_H07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
TCH01_0009_F12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
LNG01_0047_D07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0104_H11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SMG01_0041_D10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
OVR01_0099_F05.b : CGGAGCCTATGCGCTACGCCACCAAGTACTGCAACATGACCCCAGGACCACGTGATGCAC
LVRM1_0161_H01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0040_D10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
LVRM1_0085_B11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
OVRM1_0039_G04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
OVRM1_0129_D04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0007_E11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
OVR01_0101_B02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0038_D12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0033_H12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SMG01_0021_G12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0017_C11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PTG01_0098_F02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0104_B09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PTG01_0047_C08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0019_G12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SKNB1_0053_E02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0017_A10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0055_D03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ADR01_0053_D04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0053_B05.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0086_A02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0113_F10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
TCH01_0063_E12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0008_H04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0092_D12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SMG01_0090_A08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
LNG01_0101_D09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0065_G06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0037_E04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0043_G11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0067_E07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0051_B12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0033_H02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0053_C06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
OVR01_0055_D08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0086_E01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0054_H05.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0009_A01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0023_D05.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0004_A12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
UTR01_0091_C09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0031_G06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
OVR01_0097_H09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0027_C11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
UTR01_0094_F02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0064_A12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
UTR01_0055_B08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0087_B09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0082_E11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
LNG01_0006_F01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0008_A05.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0097_G12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0060_A02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
LNG01_0002_H03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0085_E10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0060_E07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0090_F07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0087_D08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
UTR01_0052_G01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0056_D04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0093_H09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0021_D06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0057_D02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0074_C03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0107_H05.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ADR01_0086_H06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0022_A10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0075_A10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ADR01_0074_B03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0021_A03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0037_B10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0055_F06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0092_H03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0049_B09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0065_C06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0092_H10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0103_F07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0018_H08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0078_E10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0089_F03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ADR01_0070_G05.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0083_B12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0104_F01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0087_F07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ADR01_0090_E06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0030_F09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0074_H11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0086_B06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
OVRT1_0087_D04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0045_C08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
OVR01_0013_D06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0098_A08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0078_H08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0025_G09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0078_A04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0062_G02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0090_B07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0069_A11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
LNG01_0058_C05.b : CGGAGCCTGTGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0045_C04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0019_B06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0021_F04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
TCH01_0080_F07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0098_B10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
LVR01_0046_C03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
LNG01_0017_D07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
OVR01_0089_F04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0109_C02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
OVRT1_0119_G03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
OVR01_0049_G08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0042_D01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
TES01_0075_G07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
TES01_0094_D12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0075_H06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
KDN01_0042_A10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SKNB1_0060_A09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0069_B08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PST01_0039_E03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SKNB1_0056_D03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PST01_0088_B10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SKNB1_0027_C10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
TES01_0001_E06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0090_G02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0008_H08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
LNG01_0087_F06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SKNB1_0062_D01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SKNB1_0049_F03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
OVR01_0100_D11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0110_D08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0099_G09.b : CGGAGCCTATGCGCAACGCCACC*AGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0079_C09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0013_D01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0072_D07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0076_B01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
LNG01_0064_F06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ADR01_0069_H04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGGCC*CAGGACCACGTGATGCAC
SPL01_0060_D05.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0064_H03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0096_B09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0009_D10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0029_C02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGAACACGTGATGCAC
LVR01_0036_A08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0045_G10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
TCH01_0068_H04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0039_C03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0010_H06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0025_B02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0090_A04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0023_E03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0079_G09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0043_F08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0052_G09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0073_B03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0005_D08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0083_D08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0080_E08.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
TCH01_0092_A11.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPL01_0016_E09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0035_H12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0059_B07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0070_D01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0022_C04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
PBL01_0053_A03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0093_D06.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0125_D03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
CLNT1_0086_G03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0037_B09.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0044_B10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0121_D01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0100_A12.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0080_H01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ADR01_0008_G03.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0033_A04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
THY01_0090_C02.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SMG01_0068_H01.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
MLN01_0096_D10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ILNT1_0043_G04.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
SPLT1_0035_C10.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0087_G05.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
ITT01_0033_E07.b : CGGAGCCTATGCGCAACGCCACCAAGTACGGCAACATGACC*CAGGACCACGTGATGCAC
20110601C-001078 : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
---------+---------+---------+---------+---------+---------+ 638
OVRT1_0096_D07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0061_E02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0031_F06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
OVRM1_0216_F09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAA*GGGAGCCTACCA*A
OVRM1_0086_G02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
UTR01_0003_G07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0014_D04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0036_H06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0083_F07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SMG01_0080_C07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0024_C04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0053_D09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0073_E01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0039_H04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0011_E07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0034_D05.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0007_C06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0066_E11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0061_E04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0030_H11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0005_B01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0071_C03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0052_A10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0085_C06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0020_G06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0009_F05.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0004_E02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0049_G10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0089_E04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0054_F06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0020_H06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0083_F10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0092_E02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0092_B05.b : CTGCTCCGGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0098_D05.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
TCH01_0051_B10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0051_F01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0011_G01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0070_F04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0055_B03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
TCH01_0076_C07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
HTMT1_0058_B09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0100_E07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0046_G08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0044_B06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0108_D07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0034_B02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0036_F12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0018_A10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ADR01_0006_E04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0022_C04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PTG01_0108_B11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTGCCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0064_D01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0086_H12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0034_C06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0038_G07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0001_G09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0140_D04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0067_G10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0027_B12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0012_B05.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0072_A02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0140_C04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0116_G06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0057_E05.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0042_D05.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
LNG01_0084_H05.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0095_F05.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0034_H12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0015_B01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
LNG01_0066_A11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0068_G02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PTG01_0048_H09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0084_C06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0141_G09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
LNG01_0034_H06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0064_A09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
LNG01_0046_C07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0056_B10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0054_F11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0066_G06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
LNG01_0010_D04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
OVR01_0007_C08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
LNG01_0020_G01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0143_B07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0100_A01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0089_G10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0071_E09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0001_G01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0081_F09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0083_A12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0032_D04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0044_D02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0078_H07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0081_E12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0048_E02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0099_G09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0036_G12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0096_E06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
LNG01_0027_A11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
LNG01_0060_G03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0105_C04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0061_H11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0059_F08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0058_D02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0035_C03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0071_D12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0011_B01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
LNG01_0075_C12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0050_C01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0037_B12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0085_H06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0056_D06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0096_E10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAAA
THY01_0016_F01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0048_H11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
LNG01_0036_G11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0045_A03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0057_E06.b : CTACTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0075_C06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0074_B10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PTG01_0080_H11.b : CTGCTCCTGAAGTCTGACCCCCTGGGTGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0012_F07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0093_E04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0056_H01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0074_G04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0101_D07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0091_D11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0037_B12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0020_A02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0021_H08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0095_G11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0071_C05.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SKNB1_0010_G12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SKNB1_0096_G07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CBLT1_0100_B06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0049_B07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CBLT1_0098_C03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0095_A01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0045_C10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0057_H08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0090_C09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0081_G04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0015_G09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0011_G03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAC*GGGAGCCTCCCAGA
SPLT1_0032_G07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0018_A07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0098_E04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0012_D07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0006_E02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
TES01_0041_F03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0090_E10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0081_D07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0074_G05.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
LNG01_0005_G11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0096_C01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0075_E01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0069_F02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CBLT1_0099_H05.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PST01_0018_C10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0081_B08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PST01_0058_C01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0111_E03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAGG*GGGAGCCTCCCAGA
PBL01_0026_B05.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
OVR01_0031_H02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
TCH01_0021_G01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0097_C08.b : CCGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
LNG01_0079_F03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
TCH01_0090_D04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0019_A06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAGGCTGAAG*GGGAGCCTCCCAGA
MLN01_0101_H07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
TCH01_0009_F12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
LNG01_0047_D07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0104_H11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCACA
SMG01_0041_D10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
OVR01_0099_F05.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCACA
LVRM1_0161_H01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0040_D10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
LVRM1_0085_B11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
OVRM1_0039_G04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
OVRM1_0129_D04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0007_E11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
OVR01_0101_B02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0038_D12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0033_H12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SMG01_0021_G12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0017_C11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PTG01_0098_F02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0104_B09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PTG01_0047_C08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0019_G12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SKNB1_0053_E02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0017_A10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0055_D03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ADR01_0053_D04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0053_B05.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0086_A02.b : CTGCTCCTGAAGTCTGACCCTCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0113_F10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
TCH01_0063_E12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0008_H04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0092_D12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SMG01_0090_A08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
LNG01_0101_D09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0065_G06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0037_E04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0043_G11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0067_E07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0051_B12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0033_H02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0053_C06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
OVR01_0055_D08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0086_E01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0054_H05.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0009_A01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0023_D05.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0004_A12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
UTR01_0091_C09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0031_G06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
OVR01_0097_H09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0027_C11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
UTR01_0094_F02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0064_A12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
UTR01_0055_B08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0087_B09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0082_E11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
LNG01_0006_F01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0008_A05.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0097_G12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0060_A02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
LNG01_0002_H03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0085_E10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0060_E07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0090_F07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0087_D08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
UTR01_0052_G01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0056_D04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0093_H09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0021_D06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0057_D02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0074_C03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0107_H05.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ADR01_0086_H06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0022_A10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0075_A10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ADR01_0074_B03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0021_A03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0037_B10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0055_F06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0092_H03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0049_B09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0065_C06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0092_H10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0103_F07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0018_H08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0078_E10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0089_F03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ADR01_0070_G05.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0083_B12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0104_F01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0087_F07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ADR01_0090_E06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0030_F09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0074_H11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0086_B06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
OVRT1_0087_D04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0045_C08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
OVR01_0013_D06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0098_A08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0078_H08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0025_G09.b : CTGCTCCTGAAGTCTGGCCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0078_A04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0062_G02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0090_B07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0069_A11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
LNG01_0058_C05.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0045_C04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0019_B06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0021_F04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
TCH01_0080_F07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0098_B10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
LVR01_0046_C03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
LNG01_0017_D07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
OVR01_0089_F04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAAA
THY01_0109_C02.b : CTGCTCCTGAAGTCTGACCCCCTGGGA*TGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
OVRT1_0119_G03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
OVR01_0049_G08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0042_D01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
TES01_0075_G07.b : CTGCTCCTGAATTCTGACCCCCTGGGAGTGTACCCGAGGCTAAAG*GGGAGCCTCCCAAA
TES01_0094_D12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0075_H06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCATA
KDN01_0042_A10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SKNB1_0060_A09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0069_B08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PST01_0039_E03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SKNB1_0056_D03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PST01_0088_B10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SKNB1_0027_C10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
TES01_0001_E06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0090_G02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0008_H08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCCGAACTGAAGGGGGAGCCTCCCAGA
LNG01_0087_F06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SKNB1_0062_D01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SKNB1_0049_F03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
OVR01_0100_D11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0110_D08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0099_G09.b : CTGCTTCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0079_C09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0013_D01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0072_D07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0076_B01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
LNG01_0064_F06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ADR01_0069_H04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCAAAGCTGAAG*GGGAGCCTCCCAAA
SPL01_0060_D05.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0064_H03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0096_B09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0009_D10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0029_C02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
LVR01_0036_A08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0045_G10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
TCH01_0068_H04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0039_C03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0010_H06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0025_B02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0090_A04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0023_E03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0079_G09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0043_F08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0052_G09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0073_B03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0005_D08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0083_D08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0080_E08.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
TCH01_0092_A11.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPL01_0016_E09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0035_H12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0059_B07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0070_D01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0022_C04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
PBL01_0053_A03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0093_D06.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0125_D03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
CLNT1_0086_G03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0037_B09.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0044_B10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0121_D01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0100_A12.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0080_H01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ADR01_0008_G03.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0033_A04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
THY01_0090_C02.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SMG01_0068_H01.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
MLN01_0096_D10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ILNT1_0043_G04.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
SPLT1_0035_C10.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0087_G05.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
ITT01_0033_E07.b : CTGCTCCTGAAGTCTGACCCCCTGGGAGTGTACCCGAAGCTGAAG*GGGAGCCTCCCAGA
20110601C-001078 : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
---------+---------+---------+---------+---------+---------+ 695
OVRT1_0096_D07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0061_E02.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0031_F06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
OVRM1_0216_F09.b : AAATCTGAA*GCACCTCCAGAACCCCATGGACGGTGTT*GACTGGAAACT*CTTTGAGAA
OVRM1_0086_G02.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
UTR01_0003_G07.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0014_D04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0036_H06.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0083_F07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SMG01_0080_C07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0024_C04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0053_D09.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0073_E01.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0039_H04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0011_E07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0034_D05.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0007_C06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0066_E11.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0061_E04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0030_H11.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGGAGCT*CTTTGAGAA
ILNT1_0005_B01.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0071_C03.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0052_A10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0085_C06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0020_G06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0009_F05.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0004_E02.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0049_G10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0089_E04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0054_F06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0020_H06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0083_F10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0092_E02.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0092_B05.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0098_D05.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
TCH01_0051_B10.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0051_F01.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0011_G01.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0070_F04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0055_B03.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
TCH01_0076_C07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
HTMT1_0058_B09.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0100_E07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0046_G08.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0044_B06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0108_D07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0034_B02.b : AAACCTGAA*GCACCTCAAGAACACCATGGACCGTGTG*AAATGGAAGCT*CTTTGAAAA
MLN01_0036_F12.b : AAACCTGAA*TCTCCTCTGGAACACCATGGACGGTGTG*AACTGTAAGCT*CTTTGAGAA
THY01_0018_A10.b : ANATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ADR01_0006_E04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0022_C04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PTG01_0108_B11.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0064_D01.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0086_H12.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0034_C06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0038_G07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0001_G09.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0140_D04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0067_G10.b : AAATCTGAA*GCACCTCTAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0027_B12.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0012_B05.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0072_A02.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0140_C04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0116_G06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0057_E05.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0042_D05.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
LNG01_0084_H05.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0095_F05.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0034_H12.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0015_B01.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
LNG01_0066_A11.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0068_G02.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PTG01_0048_H09.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0084_C06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0141_G09.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
LNG01_0034_H06.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0064_A09.b : AAACCTGAA*GCATCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
LNG01_0046_C07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0056_B10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0054_F11.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0066_G06.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
LNG01_0010_D04.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
OVR01_0007_C08.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
LNG01_0020_G01.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0143_B07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0100_A01.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0089_G10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0071_E09.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0001_G01.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0081_F09.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0083_A12.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0032_D04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0044_D02.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0078_H07.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0081_E12.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0048_E02.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0099_G09.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0036_G12.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0096_E06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
LNG01_0027_A11.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
LNG01_0060_G03.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0105_C04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGGAGCT*CTTTGAGAA
THY01_0061_H11.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0059_F08.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0058_D02.b : AAACCTGAA*GCGCCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0035_C03.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0071_D12.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0011_B01.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
LNG01_0075_C12.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0050_C01.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0037_B12.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0085_H06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0056_D06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0096_E10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0016_F01.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0048_H11.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
LNG01_0036_G11.b : AAACCTGAA*GCACCTCAAGAACACCACGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0045_A03.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0057_E06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0075_C06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0074_B10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PTG01_0080_H11.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0012_F07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0093_E04.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0056_H01.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0074_G04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0101_D07.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0091_D11.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0037_B12.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0020_A02.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0021_H08.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0095_G11.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0071_C05.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SKNB1_0010_G12.b : AAACCTGAA*GCGCCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SKNB1_0096_G07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CBLT1_0100_B06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0049_B07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CBLT1_0098_C03.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0095_A01.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0045_C10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0057_H08.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0090_C09.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0081_G04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0015_G09.b : NAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0011_G03.b : AGATCTGAA*ACGTCACATGAACACGATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0032_G07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0018_A07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0098_E04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0012_D07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0006_E02.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
TES01_0041_F03.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0090_E10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0081_D07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0074_G05.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
LNG01_0005_G11.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0096_C01.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0075_E01.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0069_F02.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CBLT1_0099_H05.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PST01_0018_C10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0081_B08.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PST01_0058_C01.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0111_E03.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0026_B05.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
OVR01_0031_H02.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
TCH01_0021_G01.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0097_C08.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
LNG01_0079_F03.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
TCH01_0090_D04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0019_A06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0101_H07.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
TCH01_0009_F12.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
LNG01_0047_D07.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0104_H11.b : AAATCTGAA*GCACCTCAAGAAAACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SMG01_0041_D10.b : *AATCTGAA*GCACCCTCAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
OVR01_0099_F05.b : AAATCTGAA*GCACCTCCAGAACACCCTGGACCGGGTGAAACTGGAAGCTCCTTTGAGAA
LVRM1_0161_H01.b : AAATCTGAAAGCACCTCA*GAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0040_D10.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
LVRM1_0085_B11.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
OVRM1_0039_G04.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
OVRM1_0129_D04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0007_E11.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
OVR01_0101_B02.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0038_D12.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0033_H12.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SMG01_0021_G12.b : ANATCTGAA*GCACCTNCAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0017_C11.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PTG01_0098_F02.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0104_B09.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PTG01_0047_C08.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0019_G12.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SKNB1_0053_E02.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0017_A10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0055_D03.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ADR01_0053_D04.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0053_B05.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0086_A02.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0113_F10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
TCH01_0063_E12.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0008_H04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0092_D12.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SMG01_0090_A08.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
LNG01_0101_D09.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0065_G06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0037_E04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0043_G11.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0067_E07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0051_B12.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0033_H02.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0053_C06.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
OVR01_0055_D08.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0086_E01.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0054_H05.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0009_A01.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0023_D05.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0004_A12.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
UTR01_0091_C09.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0031_G06.b : AAATCTGAA*GCACCTCAGGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
OVR01_0097_H09.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0027_C11.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
UTR01_0094_F02.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0064_A12.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
UTR01_0055_B08.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0087_B09.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0082_E11.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
LNG01_0006_F01.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0008_A05.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0097_G12.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0060_A02.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
LNG01_0002_H03.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0085_E10.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0060_E07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0090_F07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0087_D08.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
UTR01_0052_G01.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0056_D04.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0093_H09.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0021_D06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0057_D02.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0074_C03.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0107_H05.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTG*G*A*CTGGAAGCT*CTTTGAGAA
ADR01_0086_H06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0022_A10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0075_A10.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ADR01_0074_B03.b : AAACCTGAA*GCACCTCAAGAACGCCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0021_A03.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0037_B10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0055_F06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0092_H03.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0049_B09.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0065_C06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0092_H10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0103_F07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0018_H08.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0078_E10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0089_F03.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ADR01_0070_G05.b : AAACCTGAA*GCACCTCAAGAACACCATGGATGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0083_B12.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0104_F01.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0087_F07.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ADR01_0090_E06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0030_F09.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0074_H11.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0086_B06.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
OVRT1_0087_D04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0045_C08.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
OVR01_0013_D06.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0098_A08.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0078_H08.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0025_G09.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0078_A04.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0062_G02.b : AAATCCGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0090_B07.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0069_A11.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
LNG01_0058_C05.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0045_C04.b : AAACCTGAA*GCGCCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0019_B06.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0021_F04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
TCH01_0080_F07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0098_B10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
LVR01_0046_C03.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
LNG01_0017_D07.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
OVR01_0089_F04.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0109_C02.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTG*G*AACTGGAAGCT*CTTTGAGAc
OVRT1_0119_G03.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
OVR01_0049_G08.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0042_D01.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
TES01_0075_G07.b : AAACCTGAA*GCACCTTCAGAcccaccatgaacggggtgaactggagcccccttggaaac
TES01_0094_D12.b : AAATCTGAA*GCACCTCAAGAACACCCTGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0075_H06.b : AGATCTGAA*GCACCTCATGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
KDN01_0042_A10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SKNB1_0060_A09.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGGGAA
CLNT1_0069_B08.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PST01_0039_E03.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SKNB1_0056_D03.b : AAACCTGGA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PST01_0088_B10.b : AAACCTGGA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SKNB1_0027_C10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
TES01_0001_E06.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0090_G02.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0008_H08.b : AAACCTGAA*GCACCTTCAGAACACCAGGGACGGTGTGGACCGGGAAGCT*CTTTGAGAA
LNG01_0087_F06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SKNB1_0062_D01.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SKNB1_0049_F03.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
OVR01_0100_D11.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0110_D08.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGGGTtaaatggaaaccctttgaaaaat
SPLT1_0099_G09.b : AAACCTGAA*GCACCTCAAGAACCCCATGGACGGTGTG*AACTGGAACCT*CTTTGAAAA
SPLT1_0079_C09.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0013_D01.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0072_D07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0076_B01.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
LNG01_0064_F06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ADR01_0069_H04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0060_D05.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0064_H03.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0096_B09.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0009_D10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0029_C02.b : TAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGACAA
LVR01_0036_A08.b : AAACCTGAA*GCACCTCAAGAACTCCATGGACGGCGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0045_G10.b : AAATCTGAA*ACACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
TCH01_0068_H04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0039_C03.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0010_H06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0025_B02.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0090_A04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0023_E03.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0079_G09.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0043_F08.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0052_G09.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0073_B03.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0005_D08.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0083_D08.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0080_E08.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
TCH01_0092_A11.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPL01_0016_E09.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0035_H12.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0059_B07.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0070_D01.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0022_C04.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
PBL01_0053_A03.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0093_D06.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0125_D03.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
CLNT1_0086_G03.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0037_B09.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0044_B10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0121_D01.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAaaa
ITT01_0100_A12.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0080_H01.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ADR01_0008_G03.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0033_A04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
THY01_0090_C02.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SMG01_0068_H01.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
MLN01_0096_D10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ILNT1_0043_G04.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
SPLT1_0035_C10.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0087_G05.b : AAATCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
ITT01_0033_E07.b : AAACCTGAA*GCACCTCAAGAACACCATGGACGGTGTG*AACTGGAAGCT*CTTTGAGAA
20110601C-001078 : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
---------+---------+---------+---------+---------+---------+ 750
OVRT1_0096_D07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0061_E02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0031_F06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGTAAGAACTC*GCTGGAG*GAGACA
OVRM1_0216_F09.b : *ATGGCTGCCTC*AGTGGCTCTctgttgtaatgcaccagaactctctggaagaaacaccc
OVRM1_0086_G02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
UTR01_0003_G07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0014_D04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0036_H06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0083_F07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SMG01_0080_C07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0024_C04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0053_D09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0073_E01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGGAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0039_H04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGNCAGAACTC*GCTGGAG*GAGACA
ILNT1_0011_E07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0034_D05.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0007_C06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0066_E11.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0061_E04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0030_H11.b : *CTGGCTGCGTC*AGTGGCTCT*TGGTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0005_B01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0071_C03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0052_A10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0085_C06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0020_G06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0009_F05.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0004_E02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0049_G10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0089_E04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0054_F06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0020_H06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0083_F10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0092_E02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0092_B05.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0098_D05.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
TCH01_0051_B10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0051_F01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0011_G01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0070_F04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0055_B03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
TCH01_0076_C07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
HTMT1_0058_B09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0100_E07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0046_G08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0044_B06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0108_D07.b : *CTGGCTGggtttgtggccttgtt
SPL01_0034_B02.b : *CTGGCTTGCTC*AGGGGCTCT*TGGTTGGAATGAGCAtaactccctggaaggaaaaccc
MLN01_0036_F12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAGCTC*GCTGGAA*GAGACA
THY01_0018_A10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ADR01_0006_E04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0022_C04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PTG01_0108_B11.b : *CTGGCTGCGTC*AGTGGCTCT*TGGTTTGAATGAGNCAGAACTC*GCTGGNA*GAGACA
THY01_0064_D01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0086_H12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0034_C06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAN*GAGACA
PBL01_0038_G07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0001_G09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAAACA
CLNT1_0140_D04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0067_G10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACC
PBL01_0027_B12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0012_B05.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0072_A02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0140_C04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0116_G06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0057_E05.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0042_D05.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
LNG01_0084_H05.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0095_F05.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0034_H12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0015_B01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
LNG01_0066_A11.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0068_G02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PTG01_0048_H09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0084_C06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0141_G09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
LNG01_0034_H06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0064_A09.b : *CTGCCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
LNG01_0046_C07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0056_B10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0054_F11.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0066_G06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
LNG01_0010_D04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
OVR01_0007_C08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
LNG01_0020_G01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0143_B07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0100_A01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0089_G10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0071_E09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0001_G01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0081_F09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0083_A12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0032_D04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0044_D02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0078_H07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0081_E12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0048_E02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0099_G09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0036_G12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0096_E06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCCGGAG*GAGACA
LNG01_0027_A11.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
LNG01_0060_G03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0105_C04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0061_H11.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0059_F08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0058_D02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0035_C03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0071_D12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0011_B01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
LNG01_0075_C12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0050_C01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0037_B12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0085_H06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0056_D06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0096_E10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0016_F01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0048_H11.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
LNG01_0036_G11.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0045_A03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0057_E06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0075_C06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0074_B10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PTG01_0080_H11.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0012_F07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0093_E04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0056_H01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0074_G04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0101_D07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0091_D11.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0037_B12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0020_A02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0021_H08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0095_G11.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0071_C05.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SKNB1_0010_G12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SKNB1_0096_G07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CBLT1_0100_B06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0049_B07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CBLT1_0098_C03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0095_A01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0045_C10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0057_H08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0090_C09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0081_G04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0015_G09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0011_G03.b : *CTGGCTGCGCC*AGTGGCTCT*TGTTTGAAATGAGGCTGAGCTC*GCTGGAG*GAGACA
SPLT1_0032_G07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGGA*GAGACA
ILNT1_0018_A07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0098_E04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0012_D07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0006_E02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
TES01_0041_F03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0090_E10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0081_D07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0074_G05.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
LNG01_0005_G11.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0096_C01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0075_E01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0069_F02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CBLT1_0099_H05.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PST01_0018_C10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0081_B08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PST01_0058_C01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0111_E03.b : *CTGGCTGCGTC**GTGGGTCT*TGTTTGAAATGAGCAAGAAatccctgagggacacctt
PBL01_0026_B05.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTNGAATGAGCAAGAACTC*GCTGGAG*GAGACA
OVR01_0031_H02.b : *CTGGCCGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
TCH01_0021_G01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0097_C08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
LNG01_0079_F03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
TCH01_0090_D04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0019_A06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0101_H07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
TCH01_0009_F12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
LNG01_0047_D07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0104_H11.b : *ATGGCTGgctcgtgggtcttgtttgaattaacaaaaactcccggaggaaaacccc
SMG01_0041_D10.b : *CTGGCTGCGTC*AGTGGCTCT*TGGTTTGAATGAGCA*GAACTC*GCTGGAG*AAGACA
OVR01_0099_F05.b : *CTGGCTGCGTCCACTGGCTCT*TGTTTGAAATGAGCCAGAACTCTGCTGGAG*GAGACA
LVRM1_0161_H01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAAATGAGCAGAACTC*GCTGGAG*GAGACA
THY01_0040_D10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAA*GAGACA
LVRM1_0085_B11.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
OVRM1_0039_G04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
OVRM1_0129_D04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0007_E11.b : CCTGGCTGCGTC*AGTGGCTCTTTGTTTGATATGAGCAAGAACTC*GCTGGAG*GAGACA
OVR01_0101_B02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0038_D12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAA*GAGACA
ITT01_0033_H12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SMG01_0021_G12.b : *CTGGCTGCGTC*AGTGGCTCT*TGGGTTGAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0017_C11.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTNGAATGAGGCAGAACTC*GCTGGAG*GAGACA
PTG01_0098_F02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0104_B09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PTG01_0047_C08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGGG*GAGACA
PBL01_0019_G12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SKNB1_0053_E02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0017_A10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0055_D03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ADR01_0053_D04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0053_B05.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0086_A02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0113_F10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
TCH01_0063_E12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0008_H04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAACAAGAACTC*GCTGGAG*GAGACA
ITT01_0092_D12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SMG01_0090_A08.b : *CTGGCCGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
LNG01_0101_D09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0065_G06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0037_E04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0043_G11.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0067_E07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0051_B12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0033_H02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0053_C06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
OVR01_0055_D08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0086_E01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0054_H05.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0009_A01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0023_D05.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0004_A12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
UTR01_0091_C09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0031_G06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
OVR01_0097_H09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0027_C11.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
UTR01_0094_F02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0064_A12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
UTR01_0055_B08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0087_B09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGANATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0082_E11.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
LNG01_0006_F01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0008_A05.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0097_G12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0060_A02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
LNG01_0002_H03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0085_E10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0060_E07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0090_F07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0087_D08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
UTR01_0052_G01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0056_D04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0093_H09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0021_D06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0057_D02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0074_C03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0107_H05.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAG*AAGAACTG*GCTGGAG*GAGACA
ADR01_0086_H06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0022_A10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0075_A10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ADR01_0074_B03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0021_A03.b : *CTGGCTGCGTC*AATGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0037_B10.b : *CTGGCTGCATC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0055_F06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0092_H03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0049_B09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0065_C06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0092_H10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0103_F07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0018_H08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0078_E10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0089_F03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ADR01_0070_G05.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0083_B12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0104_F01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0087_F07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ADR01_0090_E06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCGAGAACTC*GCTGGAG*GAGACA
SPL01_0030_F09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGNCAGAACTC*GCTGGAN*GAGACA
SPL01_0074_H11.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0086_B06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
OVRT1_0087_D04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACG
MLN01_0045_C08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
OVR01_0013_D06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0098_A08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0078_H08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0025_G09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0078_A04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0062_G02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0090_B07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0069_A11.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
LNG01_0058_C05.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0045_C04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0019_B06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAGTGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0021_F04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
TCH01_0080_F07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0098_B10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
LVR01_0046_C03.b : *CTGGTTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
LNG01_0017_D07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
OVR01_0089_F04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGGAATGAGCAAGAACTC*GCTGGAG*GAGGCA
THY01_0109_C02.b : tggctgcgtngtgggtttgtttgaatgacaaaaactcctggaggaaaacctt
OVRT1_0119_G03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
OVR01_0049_G08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0042_D01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
TES01_0075_G07.b : ggcctggctccatgcgccctggtttgaatggaaccaaacctccctgaaggaaaacacctt
TES01_0094_D12.b : ACTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0075_H06.b : *CTGGCTGCGTA*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*TCTGGAG*GAGACA
KDN01_0042_A10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SKNB1_0060_A09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0069_B08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PST01_0039_E03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SKNB1_0056_D03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PST01_0088_B10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SKNB1_0027_C10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
TES01_0001_E06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0090_G02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0008_H08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAA*TGAACCAGAACTC*CCTGGAG*GAAACC
LNG01_0087_F06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SKNB1_0062_D01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SKNB1_0049_F03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
OVR01_0100_D11.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0110_D08.b : ggctgggttgttggtctgtttgaaagagcaaaaatcgcgggggga
SPLT1_0099_G09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGACCAAAAACTC*CCTGGgaggaaacc
SPLT1_0079_C09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0013_D01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0072_D07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0076_B01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
LNG01_0064_F06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ADR01_0069_H04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0060_D05.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0064_H03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0096_B09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0009_D10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0029_C02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTGTGACATGAGCATGAACTC*GCTGGAG*GAGACA
LVR01_0036_A08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCCAGAACTC*GCTGGAGGGAGACA
THY01_0045_G10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
TCH01_0068_H04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0039_C03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0010_H06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0025_B02.b : *CTGACTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0090_A04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0023_E03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0079_G09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0043_F08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0052_G09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0073_B03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0005_D08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0083_D08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0080_E08.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
TCH01_0092_A11.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPL01_0016_E09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0035_H12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0059_B07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0070_D01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0022_C04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
PBL01_0053_A03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0093_D06.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0125_D03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
CLNT1_0086_G03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCCGGAG*GAGACA
MLN01_0037_B09.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0044_B10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0121_D01.b : acggctgcgtggttgctcttgtttgaaataaccagaacccc
ITT01_0100_A12.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0080_H01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ADR01_0008_G03.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0033_A04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
THY01_0090_C02.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SMG01_0068_H01.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
MLN01_0096_D10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ILNT1_0043_G04.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
SPLT1_0035_C10.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0087_G05.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
ITT01_0033_E07.b : *CTGGCTGCGTC*AGTGGCTCT*TGTTTGAAATGAGCAAGAACTC*GCTGGAG*GAGACA
20110601C-001078 : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
---------+---------+---------+---------+---------+---------+ 806
OVRT1_0096_D07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0061_E02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0031_F06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
OVRM1_0216_F09.b : ttctgagctcgtgcaacacacccatggaaaacaaccactgtcctcccggctgattgatac
OVRM1_0086_G02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
UTR01_0003_G07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0014_D04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0036_H06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0083_F07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SMG01_0080_C07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0024_C04.b : C*CCTTTGAGGTTCCGCC*AAAGGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0053_D09.b : C*CCTTTGAGGTTCCGCC*AAAAGgtagagaattggtgccggggtggggtggggtgggga
ILNT1_0073_E01.b : C*CCTTTGAGGTTCCGCC*AAAAAGACCACTG*GAGAAGGAGGACCTGTCTTCCGGG*CT
SPLT1_0039_H04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCGGGG*CT
ILNT1_0011_E07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPLT1_0034_D05.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0007_C06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0066_E11.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGANGACCTGTCGTCCGGG*CT
SPLT1_0061_E04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0030_H11.b : C*CCTTTTGAGGTTCGCC*CAAAAGACCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0005_B01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPLT1_0071_C03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0052_A10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0085_C06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0020_G06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPLT1_0009_F05.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPLT1_0004_E02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0049_G10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0089_E04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPLT1_0054_F06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0020_H06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0083_F10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0092_E02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0092_B05.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0098_D05.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
TCH01_0051_B10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPLT1_0051_F01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPLT1_0011_G01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPLT1_0070_F04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0055_B03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
TCH01_0076_C07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
HTMT1_0058_B09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0100_E07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0046_G08.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0044_B06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0108_D07.b :
SPL01_0034_B02.b : tttgaaggttccgccaaaagaaccacctggaaacggaagaactgttctctccggctgggc
MLN01_0036_F12.b : C*CCTTTGAGGTTCCGCC*TAAAGACCCACTG*GAGACGGATGACCTGTCGTCGGGG*CT
THY01_0018_A10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ADR01_0006_E04.b : C*CCTTTGNAGTTCCGCC*AAAAGACCCACTG*GAGACGGANGACCTGTCGTCCGGG*CT
SPL01_0022_C04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PTG01_0108_B11.b : C*CCTTTTGAGTTCCGCC*AAAAGACCCACTG*GAGACGGANGACCTGTCGTCCGGG*CT
THY01_0064_D01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACCGAGGACCTGTCGTCCGGG*CT
ITT01_0086_H12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0034_C06.b : C*CCTTTGAGGTTCCGC**AAAAGA*CCACTG*GAGACNGANGACCTGTCGTCGGGG*CT
PBL01_0038_G07.b : C*CCTTTGAGGTTCCCGC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0001_G09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCNTCCGGG*CT
CLNT1_0140_D04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCATTG*GAGACGGANGACCTGTCGTCCGGG*CT
MLN01_0067_G10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGCCCGGG*CT
PBL01_0027_B12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0012_B05.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0072_A02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0140_C04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0116_G06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0057_E05.b : C*CCCTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0042_D05.b : C*CCCTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
LNG01_0084_H05.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0095_F05.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0034_H12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0015_B01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
LNG01_0066_A11.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0068_G02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PTG01_0048_H09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0084_C06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGGCGGAGGACCTGTCGTCCGGG*CT
CLNT1_0141_G09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
LNG01_0034_H06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0064_A09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
LNG01_0046_C07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0056_B10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0054_F11.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0066_G06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
LNG01_0010_D04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
OVR01_0007_C08.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
LNG01_0020_G01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0143_B07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0100_A01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0089_G10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0071_E09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0001_G01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0081_F09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0083_A12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0032_D04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0044_D02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0078_H07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0081_E12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0048_E02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0099_G09.b : C*CCTTTGAAGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0036_G12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0096_E06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCGCTG*GAGACGGAGGACCTGTCGTCCGGG*CT
LNG01_0027_A11.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
LNG01_0060_G03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0105_C04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0061_H11.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0059_F08.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0058_D02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0035_C03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0071_D12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0011_B01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
LNG01_0075_C12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0050_C01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0037_B12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0085_H06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0056_D06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0096_E10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0016_F01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGCCCGGG*CT
THY01_0048_H11.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
LNG01_0036_G11.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0045_A03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0057_E06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0075_C06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0074_B10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTGGGAGACGGAGGACCTGTCGTCCGGG*CT
PTG01_0080_H11.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0012_F07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGGNCT
THY01_0093_E04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0056_H01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*TT
SPL01_0074_G04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0101_D07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0091_D11.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0037_B12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0020_A02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0021_H08.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0095_G11.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0071_C05.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SKNB1_0010_G12.b : C*CCTTTGAGGTTCCGCC*CAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SKNB1_0096_G07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CBLT1_0100_B06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0049_B07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CBLT1_0098_C03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0095_A01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0045_C10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0057_H08.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0090_C09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0081_G04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPLT1_0015_G09.b : C*CCTTTTGAGTTCCGCC*AAAAGACCCACTG*GAGAACGAGGACCTGTCGTCCGGG*CT
MLN01_0011_G03.b : C*CCTTTGAGGATGCGCC*GAAAGACCCTCTG*GAGACGGATGACCTGTCGTCCGGG*CT
SPLT1_0032_G07.b : C*CCTTTGAGGTTCCGCC*AAAAGAACCACTG*GAGACGGAAGACCTGTCGTCCGGG*CT
ILNT1_0018_A07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPLT1_0098_E04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGANGACCTGTCGTCCGGG*CT
SPLT1_0012_D07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPLT1_0006_E02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
TES01_0041_F03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPLT1_0090_E10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPLT1_0081_D07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPLT1_0074_G05.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
LNG01_0005_G11.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0096_C01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0075_E01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPLT1_0069_F02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CBLT1_0099_H05.b : C*CCTTCGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PST01_0018_C10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPLT1_0081_B08.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PST01_0058_C01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0111_E03.b : ttg
PBL01_0026_B05.b : C*TCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
OVR01_0031_H02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
TCH01_0021_G01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0097_C08.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
LNG01_0079_F03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
TCH01_0090_D04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0019_A06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0101_H07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
TCH01_0009_F12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
LNG01_0047_D07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0104_H11.b :
SMG01_0041_D10.b : C*Ctttgaggtccgcaaaagaccnactggaaaccgagactgtcntccgggctgggcgtga
OVR01_0099_F05.b : CCCCTTTGAGGTTCCCCC*CAAAAAACCCCTG*GAAACCGAGGACCTGTCTCCCGGG*Cc
LVRM1_0161_H01.b : C*CCTTTGAGGTTCCGCC*AAA*GACCCACTG*GAGACNGAGGAACTGTCGTCCGGG*CT
THY01_0040_D10.b : CCCCTTTGAGGTTCCGCC*AAAAGACCCCCTG*GAAACGGAGGACCTGTCGTCGGGGtgg
LVRM1_0085_B11.b : C*CCTTTGAGGTTCCGCC*AAGAGACCCACTG*GAGACTGAGGACCTGTCGTCCGGG*GT
OVRM1_0039_G04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGATGACCTGTCGTCCGGG*CT
OVRM1_0129_D04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0007_E11.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGACGACCTGTCGTCCGGG*CT
OVR01_0101_B02.b : C*CCTTTGAGGTTCCGCC*AAAAAACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0038_D12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAAGACCTGTCGTCCGGG*CT
ITT01_0033_H12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SMG01_0021_G12.b : C*CCTTTGAGGGT*CGCC*AAAAGACCCACTG*GAGACGGANGACCTGTCGTCCGGG*CT
MLN01_0017_C11.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PTG01_0098_F02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0104_B09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PTG01_0047_C08.b : C*CCTTTGAGGTTCCGCCAAAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0019_G12.b : C*CCTTTGAGGTTCCGCC*AAAAGANCCACTG*GAGACGGAGGAACTGTCGTCCGGG*CT
SKNB1_0053_E02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0017_A10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0055_D03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ADR01_0053_D04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCAGG*CT
PBL01_0053_B05.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0086_A02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0113_F10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
TCH01_0063_E12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0008_H04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0092_D12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SMG01_0090_A08.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
LNG01_0101_D09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0065_G06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0037_E04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0043_G11.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0067_E07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0051_B12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0033_H02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0053_C06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
OVR01_0055_D08.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0086_E01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0054_H05.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0009_A01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0023_D05.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACAG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0004_A12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
UTR01_0091_C09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0031_G06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
OVR01_0097_H09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0027_C11.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
UTR01_0094_F02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0064_A12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
UTR01_0055_B08.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0087_B09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0082_E11.b : C*CCTTTGAGGTTCCGCC*AGAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
LNG01_0006_F01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0008_A05.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0097_G12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0060_A02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
LNG01_0002_H03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0085_E10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0060_E07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0090_F07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0087_D08.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
UTR01_0052_G01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0056_D04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCCCTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0093_H09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0021_D06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0057_D02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0074_C03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0107_H05.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ADR01_0086_H06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0022_A10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0075_A10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ADR01_0074_B03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGATCTGTCGTCCGGG*CT
ITT01_0021_A03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0037_B10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0055_F06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0092_H03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0049_B09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0065_C06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0092_H10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0103_F07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0018_H08.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0078_E10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0089_F03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ADR01_0070_G05.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0083_B12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0104_F01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0087_F07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ADR01_0090_E06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0030_F09.b : C*CCTTTGAGGGTCCGCC*AAAAGACCCACTG*GAGACGGANGACCTGTCGTCCGGG*CT
SPL01_0074_H11.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0086_B06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
OVRT1_0087_D04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0045_C08.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
OVR01_0013_D06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0098_A08.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGA*CT
SPL01_0078_H08.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0025_G09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0078_A04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0062_G02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0090_B07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0069_A11.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
LNG01_0058_C05.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0045_C04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0019_B06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0021_F04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
TCH01_0080_F07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0098_B10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
LVR01_0046_C03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
LNG01_0017_D07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
OVR01_0089_F04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0109_C02.b :
OVRT1_0119_G03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTTGTCCGGG*CT
OVR01_0049_G08.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0042_D01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
TES01_0075_G07.b : tgaggtccccccaaaaaacccttggaaaaaggaggactttccccccgggtgtgggcgtac
TES01_0094_D12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*TAGACGGAGGACCTGTCCTCCGGG*CT
MLN01_0075_H06.b : C*CCTTTGAAGTTCCGCC*AAAAGACCCGCTG*GAAACCGAGGACCTGTCTTCCGGG*CT
KDN01_0042_A10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SKNB1_0060_A09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCTGGG*CT
CLNT1_0069_B08.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PST01_0039_E03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SKNB1_0056_D03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PST01_0088_B10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SKNB1_0027_C10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
TES01_0001_E06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0090_G02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0008_H08.b : C*CCTTTGAGGTccgcccaaaatacctgaccaagtgcccggaaaaggtcgcctggtcccc
LNG01_0087_F06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SKNB1_0062_D01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SKNB1_0049_F03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
OVR01_0100_D11.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0110_D08.b :
SPLT1_0099_G09.b : ccttttaggtttccccaaaaaaacccctggaaaccggagacctgttcttccgggtggggg
SPLT1_0079_C09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0013_D01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPLT1_0072_D07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPLT1_0076_B01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
LNG01_0064_F06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ADR01_0069_H04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0060_D05.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0064_H03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0096_B09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0009_D10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0029_C02.b : C*CCTTTGAGGTTCCGCC*GAAAGACCCACTG*GAGACGGAGGACCTGTCATCCGGG*CT
LVR01_0036_A08.b : CCCTTTTGAGGTTCCGCC*CAAAGACCCACTG*GAGACGGAGGGACTGTCGTCCGGG*CT
THY01_0045_G10.b : C*CCTTTGAGGTTCCGCC*CAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
TCH01_0068_H04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0039_C03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0010_H06.b : C*CCTTTGAGGTTCCGCC*NAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0025_B02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0090_A04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0023_E03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0079_G09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0043_F08.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0052_G09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0073_B03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0005_D08.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0083_D08.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0080_E08.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
TCH01_0092_A11.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPL01_0016_E09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0035_H12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0059_B07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0070_D01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0022_C04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
PBL01_0053_A03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGCCCGGG*CT
CLNT1_0093_D06.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0125_D03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
CLNT1_0086_G03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0037_B09.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0044_B10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0121_D01.b :
ITT01_0100_A12.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPLT1_0080_H01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ADR01_0008_G03.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPLT1_0033_A04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
THY01_0090_C02.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SMG01_0068_H01.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
MLN01_0096_D10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ILNT1_0043_G04.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
SPLT1_0035_C10.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0087_G05.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
ITT01_0033_E07.b : C*CCTTTGAGGTTCCGCC*AAAAGACCCACTG*GAGACGGAGGACCTGTCGTCCGGG*CT
20110601C-001078 : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
---------+---------+---------+---------+---------+---------+ 864
OVRT1_0096_D07.b : GGGCGTGACCAAGC*AGGATCTCGGGCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ITT01_0061_E02.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
MLN01_0031_F06.b : GGGCGTGACCAAGC*AGGATCTCNGGCCAGTCATCCTGTAAGAGCAGCAGAACGCCAGCC
OVRM1_0216_F09.b : caactagaatttactaagcacccctgacataacgaagactccgcccccccccttaattat
OVRM1_0086_G02.b : GGGCGTGACCAAGC*AGGATCTCGGCCCAGTCATCCTGTAAGACCAGNNAGACGCCAGCC
UTR01_0003_G07.b : GGGCGTGACCAAGC*AAGATCTCGGCCAAGTCATCCCTGTAAGACAGC*AGACGCCAGCC
MLN01_0014_D04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ITT01_0036_H06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
PBL01_0083_F07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
SMG01_0080_C07.b : GGGCGTGACCNAGC*AGGATCTCGGCCAAGTCATCCCTGTAGAGCAGC*AGACGCCAGCC
CLNT1_0024_C04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ILNT1_0053_D09.b : tncnncntttctnggnnnccngn
ILNT1_0073_E01.b : GGGCGTGAaccaaccaggttttggccaaatcatcctgtaaaagcaccaaaagcagccccc
SPLT1_0039_H04.b : GGGCGTGACCNAGC*AGGATCTCGGCCAAGTCATCCTGTANGAGCAGC*AAACGCCAGCC
ILNT1_0011_E07.b : GGGCGTGACAAAGC*AGGATCTCGGCCAAGTCATCTTGTAAGAACAGC*AGACGCCAGCC
SPLT1_0034_D05.b : GGGCGTGACCAAGC*AAGATCTCGGCCAAGTCATCCTGTANGAGCAGC*AGACGCCAGCC
ILNT1_0007_C06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ILNT1_0066_E11.b : GGGCGTGAACAAGC*AGGATCTCGGCCAAGTCATCCTGTAGGAGCAGC*AGAAGCCAGCC
SPLT1_0061_E04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPL01_0030_H11.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ILNT1_0005_B01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPLT1_0071_C03.b : GGGCGTGACCAAGC*ANGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ILNT1_0052_A10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ILNT1_0085_C06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ILNT1_0020_G06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPLT1_0009_F05.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGNTAGAGCAGC*AGACGCCAGCC
SPLT1_0004_E02.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ILNT1_0049_G10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ILNT1_0089_E04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPLT1_0054_F06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ILNT1_0020_H06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ILNT1_0083_F10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ILNT1_0092_E02.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ILNT1_0092_B05.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCT
ILNT1_0098_D05.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
TCH01_0051_B10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
SPLT1_0051_F01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPLT1_0011_G01.b : GGGCGTGACCAAGC*AGGATCTCGGGCAAGTCATCCCTGTAGAGCAGC*AGACGCCAGCC
SPLT1_0070_F04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPL01_0055_B03.b : GGGCGTGACCAAGC*AGGATCTCGGGCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
TCH01_0076_C07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
HTMT1_0058_B09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ILNT1_0100_E07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ILNT1_0046_G08.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ILNT1_0044_B06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
THY01_0108_D07.b :
SPL01_0034_B02.b : ttgaaaaatcaggatttgggccaattattcctgttagaaatactgaacgcaacgccctag
MLN01_0036_F12.b : GGGCGTGACCAAGC*ACGATCTCTGCCGAGTCATCCTGTAAGAGCAGC*AGACGCCCGCC
THY01_0018_A10.b : GGGCGTGACCAAGC*AGGATCTTGGGCAAGTCATCCTGTAAGACCGCA*AGACGCCAG*C
ADR01_0006_E04.b : GGGCGTGACCAAGC*AGGATCTCGGCCNAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPL01_0022_C04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGCGGGACGCCAGCC
PTG01_0108_B11.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAGGAGCAGC*AGACGCCAGCC
THY01_0064_D01.b : GGGCGTGACCAAGC*ACGATCTCCGCCCAGTCATCCTGTAAGACCAGC*CGACGCCCGCC
ITT01_0086_H12.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAACAGC*AGACGCCAGCC
PBL01_0034_C06.b : GGGCGTGACCAAGC*AGGATCTCGGCCCAGTCATCCTGTANGAACAGC*AGACGCCAGCC
PBL01_0038_G07.b : GGGCGTGACCAAGC*ANGATCTCGGCCAAGTCATCCTGTAAGAACAGC*AGACGCCAGCC
MLN01_0001_G09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CLNT1_0140_D04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0067_G10.b : GGGCGTGACCAANC*CGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AAACGCCAGCC
PBL01_0027_B12.b : GGGCGTGACCAAGC*ANGATCTCGGCCAAGTCATCCCTGTAGAACAGC*AGACGCCAGCC
PBL01_0012_B05.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
CLNT1_0072_A02.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CLNT1_0140_C04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CLNT1_0116_G06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CLNT1_0057_E05.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CLNT1_0042_D05.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
LNG01_0084_H05.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ITT01_0095_F05.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0034_H12.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CLNT1_0015_B01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
LNG01_0066_A11.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
SPL01_0068_G02.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGGCAGCC
PTG01_0048_H09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
MLN01_0084_C06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CLNT1_0141_G09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
LNG01_0034_H06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ITT01_0064_A09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
LNG01_0046_C07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPL01_0056_B10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CLNT1_0054_F11.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
THY01_0066_G06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
LNG01_0010_D04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
OVR01_0007_C08.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCCAGC
LNG01_0020_G01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
CLNT1_0143_B07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CLNT1_0100_A01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGCAGAACGCCAGCC
CLNT1_0089_G10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
PBL01_0071_E09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ITT01_0001_G01.b : GGGCGTGACCAAGC*ANGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ITT01_0081_F09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
PBL01_0083_A12.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
PBL01_0032_D04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
CLNT1_0044_D02.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ITT01_0078_H07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ITT01_0081_E12.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
MLN01_0048_E02.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
PBL01_0099_G09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ITT01_0036_G12.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPL01_0096_E06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
LNG01_0027_A11.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
LNG01_0060_G03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPL01_0105_C04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
THY01_0061_H11.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CLNT1_0059_F08.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CLNT1_0058_D02.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CLNT1_0035_C03.b : GGGCGTGATCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CLNT1_0071_D12.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0011_B01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
LNG01_0075_C12.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
CLNT1_0050_C01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
THY01_0037_B12.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGCAGAACGCCAGCC
SPL01_0085_H06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
THY01_0056_D06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPL01_0096_E10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
THY01_0016_F01.b : GGNCGTGACCA*GC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAAG*AAACGACAGCC
THY01_0048_H11.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCCAGC
LNG01_0036_G11.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ITT01_0045_A03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
PBL01_0057_E06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ITT01_0075_C06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ILNT1_0074_B10.b : GGGCGTGACCAANC*AGGATCTCGGCCAATTCATCCTGTAAGACCAGC*AGACGCCAGCC
PTG01_0080_H11.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
PBL01_0012_F07.b : GGGCGTGGGCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
THY01_0093_E04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ITT01_0056_H01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPL01_0074_G04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0101_D07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCACCCTGTAAGACCAGC*AGACGCCAGCC
ILNT1_0091_D11.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ILNT1_0037_B12.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CLNT1_0020_A02.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0021_H08.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0095_G11.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
MLN01_0071_C05.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
SKNB1_0010_G12.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SKNB1_0096_G07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CBLT1_0100_B06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0049_B07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CBLT1_0098_C03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGCAGAACGCCAGCC
SPL01_0095_A01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPL01_0045_C10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ITT01_0057_H08.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ITT01_0090_C09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ITT01_0081_G04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPLT1_0015_G09.b : GGGCGTGACCAAAC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AAAAGCCCGCC
MLN01_0011_G03.b : GGGTGTGATCCAGC*ATGATCTCGGCCTAGTCATCCTGTAAGACCAGC*GCACGCCAGCC
SPLT1_0032_G07.b : GGGCGTGACCNAGC*AGGATCTCGGCCAAGTCATCTTGTAAGAGCAGC*AGACGCCAGCC
ILNT1_0018_A07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGGAAGAGCAGC*AGACGTCCAGC
SPLT1_0098_E04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGGTAGAGCAGC*AGACGCCAGCC
SPLT1_0012_D07.b : GGGCGTGACCAAGC*AGGATCTCGGGCAAGTCATCCTGTAAGAGCAGC*AAACGCCAGCC
SPLT1_0006_E02.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
TES01_0041_F03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPLT1_0090_E10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPLT1_0081_D07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPLT1_0074_G05.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
LNG01_0005_G11.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ITT01_0096_C01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CLNT1_0075_E01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCACCCTGTAAGAGCAGC*AGACGCCAGCC
SPLT1_0069_F02.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CBLT1_0099_H05.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
PST01_0018_C10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPLT1_0081_B08.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCT
PST01_0058_C01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
THY01_0111_E03.b :
PBL01_0026_B05.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCCTGTAGAACAGC*AGACGCCAGCC
OVR01_0031_H02.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
TCH01_0021_G01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ITT01_0097_C08.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
LNG01_0079_F03.b : GGGCGTGACCAAGC*ANGATCTCGGCCCAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
TCH01_0090_D04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CLNT1_0019_A06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0101_H07.b : GGGCGTGACCAAGC*AGGATCTCGACCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
TCH01_0009_F12.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
LNG01_0047_D07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
THY01_0104_H11.b :
SMG01_0041_D10.b : ccagcaggatttccggcaattcttctgtaagacaagagacgccagcccccagccttggtt
OVR01_0099_F05.b : tgggcgtgaccaagccagattctcgcccaagccttctcgtaaacccctcaaagtccgccc
LVRM1_0161_H01.b : GGGCGTGACCAAGC*AGatctcggccagtcatcctgtaagacagcagaa
THY01_0040_D10.b : gggtgaccaacaggatctccgccaagtcatcctgtaaaaccgccaacgccagcccccccc
LVRM1_0085_B11.b : GGGCGTGGACAAGC*ACGATCTCGGCCAAGTCtcccggtagacatcagacc
OVRM1_0039_G04.b : GGGCGTGACCAAGC*AAGATCCTCGCCAAGTCATCCTGTAAAACCAGC*AGACGCCAGCC
OVRM1_0129_D04.b : GGGCGTGACCAAGC*CAGATCTCGGTCCAGTCATCCTGTAAGAGCAGC*AGACGCCAGGC
THY01_0007_E11.b : GGGCGTGACCAAGC*ACGATCTCGGTCAAGTCATCCTGTA*GACCAGC*AGACGCCAGCC
OVR01_0101_B02.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGAACGCAGCC
PBL01_0038_D12.b : GGGCGTGACCNAGC*AGGATCTCGGCCCAGTCATCCTGTAAGAACAAC*AGAACGCAGCC
ITT01_0033_H12.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
SMG01_0021_G12.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
MLN01_0017_C11.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AAACGCCAGCC
PTG01_0098_F02.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
CLNT1_0104_B09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCCAGC
PTG01_0047_C08.b : GGGCGTGACCAAGC*AGGATCTCGGGCCAATCATCCTGTAAGAGCAGC*AGACGCCAGCC
PBL01_0019_G12.b : GGGCGTGACCNAGC*AGGATCTCGGCCCAGTCATCCCTGTAGAACAGC*AGACGCCAGCC
SKNB1_0053_E02.b : GGGCGTGACCAAGC*AGGATCTCGGCCTAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
PBL01_0017_A10.b : GGGCGTGACCAAGC*ANGACCTCGGGCCAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
PBL01_0055_D03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ADR01_0053_D04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
PBL01_0053_B05.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCCTGTAGAACAGC*AGACGCCAGCC
ITT01_0086_A02.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CLNT1_0113_F10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
TCH01_0063_E12.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
PBL01_0008_H04.b : GGGCGTGACCAAGC*AAGATCTCGGCCAAGTCATCCTGGTAGAACAGC*AGACGCCAGCC
ITT01_0092_D12.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
SMG01_0090_A08.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
LNG01_0101_D09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAA*AGCAGC*AGACGCCAGCC
CLNT1_0065_G06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPL01_0037_E04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0043_G11.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
CLNT1_0067_E07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0051_B12.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
MLN01_0033_H02.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
THY01_0053_C06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
OVR01_0055_D08.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CLNT1_0086_E01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCCGTAAGAGCAGC*AGACGCCAGCC
SPL01_0054_H05.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
THY01_0009_A01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGCAGAACGCCAGCC
PBL01_0023_D05.b : GGGCGTGACCAAGC*ANGATCTCGGCCAAGTCATCCCTGTAGACCAGC*AGACGCCAGCC
SPL01_0004_A12.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
UTR01_0091_C09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
THY01_0031_G06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGCAGAACGCCAGCC
OVR01_0097_H09.b : GGGCGTGACCAAGC*AGGATCTCGGCCCAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ITT01_0027_C11.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
UTR01_0094_F02.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ITT01_0064_A12.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
UTR01_0055_B08.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0087_B09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0082_E11.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
LNG01_0006_F01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
SPL01_0008_A05.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0097_G12.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CLNT1_0060_A02.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
LNG01_0002_H03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0085_E10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ITT01_0060_E07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ITT01_0090_F07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ITT01_0087_D08.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
UTR01_0052_G01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
MLN01_0056_D04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
SPL01_0093_H09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCCGTAAGAGCAGC*AGACGCCAGCC
PBL01_0021_D06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ITT01_0057_D02.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ITT01_0074_C03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
PBL01_0107_H05.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ADR01_0086_H06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CLNT1_0022_A10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ITT01_0075_A10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ADR01_0074_B03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ITT01_0021_A03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ITT01_0037_B10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ITT01_0055_F06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
PBL01_0092_H03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ITT01_0049_B09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
PBL01_0065_C06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
PBL01_0092_H10.b : GGGCGCGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
PBL01_0103_F07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ITT01_0018_H08.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
SPL01_0078_E10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPL01_0089_F03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ADR01_0070_G05.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ITT01_0083_B12.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPL01_0104_F01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0087_F07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ADR01_0090_E06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPL01_0030_F09.b : GGGCGTGNACCAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGCAGACNGCCAGCC
SPL01_0074_H11.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
THY01_0086_B06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
OVRT1_0087_D04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0045_C08.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
OVR01_0013_D06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGCCAGACGCCAGCC
MLN01_0098_A08.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPL01_0078_H08.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0025_G09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
MLN01_0078_A04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
MLN01_0062_G02.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
THY01_0090_B07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
MLN01_0069_A11.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
LNG01_0058_C05.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPL01_0045_C04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0019_B06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
CLNT1_0021_F04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
TCH01_0080_F07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
THY01_0098_B10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
LVR01_0046_C03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
LNG01_0017_D07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
OVR01_0089_F04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
THY01_0109_C02.b :
OVRT1_0119_G03.b : GGGCGTGACCAAGC*AGGATCTCCGCCAgttatccttgttaaacagcagaggccagcccc
OVR01_0049_G08.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ITT01_0042_D01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
TES01_0075_G07.b : caaaacgggatccggccaatcttccctttaaaaaaaaaaaaaacccacccccaaccttgg
TES01_0094_D12.b : GGGCcgtgaccaaccaggatctccggcaattcttcctgtaaaaccagaaaaggcagcccc
MLN01_0075_H06.b : GGGCGTGACCCAAC*AGGATCTCGGTCAAGTCATCCTGTAAGAACACC*TGACGCCAGCC
KDN01_0042_A10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
SKNB1_0060_A09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGCAGAACGCCAGCC
CLNT1_0069_B08.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
PST01_0039_E03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SKNB1_0056_D03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAA*AGCAGCAGAACGCCAGCC
PST01_0088_B10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SKNB1_0027_C10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCACA*GAACGCCAGCC
TES01_0001_E06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
SPL01_0090_G02.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
PBL01_0008_H08.b : gccgtccccccggggcatggttcgggccagtgccgacaaggaccgccaactccttgccgt
LNG01_0087_F06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SKNB1_0062_D01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAAGCACAG*AACGGGCAGCC
SKNB1_0049_F03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGCAGAACGCCAGCC
OVR01_0100_D11.b : GGGCGTGACCAAGC*AGGATCTCGGCCCAagtcttcctgtagaaccagctgacgcccagc
THY01_0110_D08.b :
SPLT1_0099_G09.b : gggaccaaacaggaattccggccaaattctccttgtaaagcacaaaaaaccccaccccca
SPLT1_0079_C09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ILNT1_0013_D01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPLT1_0072_D07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPLT1_0076_B01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
LNG01_0064_F06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ADR01_0069_H04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPL01_0060_D05.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPL01_0064_H03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
THY01_0096_B09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
SPL01_0009_D10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0029_C02.b : GGGCGTGACTGAGC*AGGATCTCGGCCTAGTCATCCTGTAAGACCAGC*ATACGCCAGCC
LVR01_0036_A08.b : GGGCGTGACCAAGCCAGAATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCTATCC
THY01_0045_G10.b : GGGCGGGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGAAGCTAGGC
TCH01_0068_H04.b : GGGCGTGACCAAGC*AGGATCTCGGGCCAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0039_C03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGCAGAACGCCAGCC
PBL01_0010_H06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAACAGC*AGACGCCAGCC
PBL01_0025_B02.b : GGGCGTGACCAAGC*ANGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
PBL01_0090_A04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ITT01_0023_E03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ITT01_0079_G09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0043_F08.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
MLN01_0052_G09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPL01_0073_B03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPL01_0005_D08.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGNCAGACGCCAGCC
THY01_0083_D08.b : GGGCGTGACCAAGC*AAGATCTCAGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
CLNT1_0080_E08.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
TCH01_0092_A11.b : GGGCGTGACTAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPL01_0016_E09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAAGCACAGGAAACGCCAGCC
ITT01_0035_H12.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
THY01_0059_B07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ITT01_0070_D01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
THY01_0022_C04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
PBL01_0053_A03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
CLNT1_0093_D06.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CLNT1_0125_D03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
CLNT1_0086_G03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0037_B09.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ILNT1_0044_B10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
THY01_0121_D01.b :
ITT01_0100_A12.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
SPLT1_0080_H01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ADR01_0008_G03.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
SPLT1_0033_A04.b : GGGCGTGACCAAGC*ANGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
THY01_0090_C02.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
SMG01_0068_H01.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
MLN01_0096_D10.b : GGGCGTGACCAAGC*AGGATTTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ILNT1_0043_G04.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
SPLT1_0035_C10.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
ITT01_0087_G05.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGACCAGC*AGACGCCAGCC
ITT01_0033_E07.b : GGGCGTGACCAAGC*AGGATCTCGGCCAAGTCATCCTGTAAGAGCAGC*AGACGCCAGCC
20110601C-001078 : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
---------+---------+---------+---------+---------+---------+ 919
OVRT1_0096_D07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCAACCT*CCCTGCGG*CCCC*AA
ITT01_0061_E02.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCG*CCCC*CA
MLN01_0031_F06.b : CCCA*GCCCTGCGTGGGCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGGCGCCCC*CA
OVRM1_0216_F09.b : tcccttgcccgcc
OVRM1_0086_G02.b : CCNA*GCCCTG
UTR01_0003_G07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCCTGCGCCCCC*AC
MLN01_0014_D04.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*CA
ITT01_0036_H06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
PBL01_0083_F07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*CA
SMG01_0080_C07.b : CCCA*GCCCTGCGTGGGCACAGCTT*GCCTG*GCCCCCCACCT*CCCTGGCGCCCCC*AC
CLNT1_0024_C04.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCAACCT*CCCTGCCGCCCCC*AC
ILNT1_0053_D09.b :
ILNT1_0073_E01.b : caaccctgggtgagcaaggtttggctgccccccttcttcactgtaggccctaaggtgagt
SPLT1_0039_H04.b : CCCA*GCCCTGCGTGGCCACA*CTT*GCCTG*CCCCCaaccttcctggcgcccccacggg
ILNT1_0011_E07.b : CCCA*ACCCTGCGTGGCCA*AGCTT*GCCTG*CCCCCAACCCT*TCCGGCCG*CCCC*CA
SPLT1_0034_D05.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*GCCCCCAACCT*TCCTGCCGCCCCC*AC
ILNT1_0007_C06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCAACCC*TCCTGCCG*CCCC*CA
ILNT1_0066_E11.b : CCCAGCCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCAACCCT*CCTTGCCGGCCCCCAA
SPLT1_0061_E04.b : CCCA*GCCCTGCGTGGCCACAGCTT*TTGCT*GCCCCCACC*T*CCCTGGCGCCCCC*AC
SPL01_0030_H11.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCAACCTT*CC*TGGCG*GCCC*AA
ILNT1_0005_B01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCAACCT*CCCTGCCGCCCCC*AC
SPLT1_0071_C03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*TCCTGCCGCCCCC*AC
ILNT1_0052_A10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ILNT1_0085_C06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ILNT1_0020_G06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPLT1_0009_F05.b : CC*A*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*AA
SPLT1_0004_E02.b : CCCA*GCCCTGCGTGGCCACAGCTT*GGCTG*CCCCCCACCCT*CCCTGCCGCCCCC*A*
ILNT1_0049_G10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ILNT1_0089_E04.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPLT1_0054_F06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ILNT1_0020_H06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ILNT1_0083_F10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ILNT1_0092_E02.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ILNT1_0092_B05.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ILNT1_0098_D05.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCC**AC
TCH01_0051_B10.b : CCCG*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCAC*CT*CCCTGCCG*CCCC*AC
SPLT1_0051_F01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCC**AC
SPLT1_0011_G01.b : CCCA*GCCCTGCGTGGGCACAGCTT*TGCTG*CCCCCCACCCT*CCCTGGCGCCCCC*AC
SPLT1_0070_F04.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPL01_0055_B03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGGCCCC*CA
TCH01_0076_C07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*CA
HTMT1_0058_B09.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*CA
ILNT1_0100_E07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ILNT1_0046_G08.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ILNT1_0044_B06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GGCTG*CCCCCCCACCT*CCCTGCCGGCCCC*CA
THY01_0108_D07.b :
SPL01_0034_B02.b : ctctttgcttgccaacaggtttgcaggccccccaactttccttgcgattcccaatttgaa
MLN01_0036_F12.b : CGCA*GCCtgcgtggccacgcttgtctgtcccctacctccctggcgcctccaactgcatc
THY01_0018_A10.b : CCCA*GCCCTGCGTGGccccggttgcctgcccccaccttcctggcgnccccactggattc
ADR01_0006_E04.b : CCCA*GCCCTGCGTGGC*ACAGCTT*GCCTG*GCCCCCCACCT*CCTGGCGCCCCCACtg
SPL01_0022_C04.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CGCTGCCG*CCCC*C
PTG01_0108_B11.b : CCCA*GCCCTGCGTGGCCACAGTTT*GCCTG*CCCCCCANCCT*TCCTGGCGCCCCC*AA
THY01_0064_D01.b : CCCC*CCCCTGCCTGGCCACAGCTT*gcccg*cccccccccct*cccggcccccccc*AC
ITT01_0086_H12.b : CCCAAGCCCTGCGTGGCCACAGCTTTGCTTG*CCCCCAACCTT*CCCTGGCGCCCCC*AC
PBL01_0034_C06.b : CCCA*GCCCTGCGTGGNCACAGCTT*GGCTG*CCCCCAACCTT*C*CTGGCGCCCCC*CA
PBL01_0038_G07.b : CCCA*GCCCTGCGTGGNCACAGCTT*GGCTG*GCCCCCCACCT*CCCTGGCGCCCCC*CA
MLN01_0001_G09.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCTTGGCGCCCCC*AC
CLNT1_0140_D04.b : CCCA*GCCCTGCGTGGGCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
MLN01_0067_G10.b : CCCA*GCCCTGCGTGGCCACAGTTT*GCCTG*GCCCCCACCCT*CCTGGCGGCCCCC*CA
PBL01_0027_B12.b : CCCA*GCCCTGCGTGGCCACAGCTTTTGCTG*CCNNCCACCCT*CC*TGGCGCCCCC*CA
PBL01_0012_B05.b : CCCA*GCCCTGCGTGGCCACAGCTT*GGCTG*CCCCCCACCCT*CCCTGGCGCCNNN*CC
CLNT1_0072_A02.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCG*CCCC*AC
CLNT1_0140_C04.b : CCCA*GCCCTGCGTGGCCACAGCTT*TGCTG*CCCCCCACCCT*CCCTGCCCGCCCC*AC
CLNT1_0116_G06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GGCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AN
CLNT1_0057_E05.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACC*T*CCCTGCAG*CCCC*AC
CLNT1_0042_D05.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AA
LNG01_0084_H05.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*CA
ITT01_0095_F05.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
MLN01_0034_H12.b : CCCA*GCCCTGCGTGGGCACAGCTT*GCCTG*CCCCCCACCCC*TCCTGGCGCCCCC*CA
CLNT1_0015_B01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GGCTG*CCCCCCACCNN*TCCTGGCGCCCCC*CA
LNG01_0066_A11.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*AC
SPL01_0068_G02.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCCACCT*CCCTGGCGCCCCC*CA
PTG01_0048_H09.b : CCCA*GCCCTGCGTGGGCACAGCTT*GGCTG*CCCCCCACCCT*CCCTGGCGCCCCC*CA
MLN01_0084_C06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
CLNT1_0141_G09.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
LNG01_0034_H06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ITT01_0064_A09.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
LNG01_0046_C07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPL01_0056_B10.b : CCCC*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCCGCCCC*CA
CLNT1_0054_F11.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*CA
THY01_0066_G06.b : CCCA*GCCCTGCGTGGGCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
LNG01_0010_D04.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
OVR01_0007_C08.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
LNG01_0020_G01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
CLNT1_0143_B07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCGGCCCCA*AC
CLNT1_0100_A01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*AC
CLNT1_0089_G10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCCACCT*CCCTGCCGCCCCC*AC
PBL01_0071_E09.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*AC
ITT01_0001_G01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ITT01_0081_F09.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
PBL01_0083_A12.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
PBL01_0032_D04.b : CCCA*GCCCTGCGTGGCCACAGCTT*GGCTG*CCCCCCACCCT*CCTGGCGCCCCCC*CA
CLNT1_0044_D02.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*CA
ITT01_0078_H07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ITT01_0081_E12.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCCGCCCC*GC
MLN01_0048_E02.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*GCCCCCACCCT*CCCTGCCGCCCCC*CA
PBL01_0099_G09.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCCCAC
ITT01_0036_G12.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*CA
SPL01_0096_E06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*CA
LNG01_0027_A11.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
LNG01_0060_G03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*GCCCCCCACCT*CCCTGGCGCCCCC*AC
SPL01_0105_C04.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCANCCT*CCCTGGCGCCCCC*A*
THY01_0061_H11.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCC*CCCTGCCGCCCCC*AC
CLNT1_0059_F08.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCCGCCCC*AC
CLNT1_0058_D02.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
CLNT1_0035_C03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCA*A*
CLNT1_0071_D12.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCCACCT*CCCTGGCGCCCCC*CA
MLN01_0011_B01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*AC
LNG01_0075_C12.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCCACCT*CCCTGCCGCCCCC*AC
CLNT1_0050_C01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*CA
THY01_0037_B12.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPL01_0085_H06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GGCTG*GCCCCCACCCT*CCCTGCCGCCCCC*NA
THY01_0056_D06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTGCCCCCCCACCCT*CCCTGCCGCCCCC*AC
SPL01_0096_E10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
THY01_0016_F01.b : CCCA*GCCCTGGGTGGGCACAGGTT*GCCTTGCCCCCCAACCT*CCCTGCGGCCCCA*CC
THY01_0048_H11.b : CCCA*GCCCTGCGTGGCCACAGCTTTGCCTG*CCCCCCACCCT*CCCTGCCCCCCCC*AC
LNG01_0036_G11.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ITT01_0045_A03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
PBL01_0057_E06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*AC
ITT01_0075_C06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ILNT1_0074_B10.b : CCCA*CCCCTGCGTGGGCACAACTT*GCCTGCCCCCCCACCTT*CCCTGCCGCCCCC*AA
PTG01_0080_H11.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCAACCT*TCCTGGCGGCCCC*CA
PBL01_0012_F07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GGCTG*CCCCCCACCCT*CCCTGCCGCCCCC*A*
THY01_0093_E04.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ITT01_0056_H01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*CA
SPL01_0074_G04.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*GCCCCCACCCT*CCCTGGCGCCCCC*AC
MLN01_0101_D07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*AC
ILNT1_0091_D11.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*TCCTGCCGCCCCC*AC
ILNT1_0037_B12.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
CLNT1_0020_A02.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
MLN01_0021_H08.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
MLN01_0095_G11.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*AC
MLN01_0071_C05.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SKNB1_0010_G12.b : CCCA*GCCCTGCGTGGGCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGGCCCC*AC
SKNB1_0096_G07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCANCCT*CCCTGGCGCCCCC*CA
CBLT1_0100_B06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
MLN01_0049_B07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
CBLT1_0098_C03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPL01_0095_A01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCG*CCCC*AC
SPL01_0045_C10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GGCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ITT01_0057_H08.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*CA
ITT01_0090_C09.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCNNC*CA
ITT01_0081_G04.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCCACCC*TCCTGCCGCCCCC*AC
SPLT1_0015_G09.b : CCCAccctgcttgccaaagcttgccggcccccaaccttcctggcgccccacctggaattc
MLN01_0011_G03.b : tcgatcactgcatggacacagttcgtctgcgcgcaagcaatcctgcagacgacacatgca
SPLT1_0032_G07.b : CCCA*GCCCTGCGTGGGCACAGCTT*GGCTGCCCCCCAACCCT*CCTGGCCGCCCaactt
ILNT1_0018_A07.b : CCCC*GTCCTGCGTGGTCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AT
SPLT1_0098_E04.b : CCCA*GCCCTGCGTGGCCA*AGCTT*GGCTG*CCCCCCAACCT*CCTTGCCGCCCCC*A*
SPLT1_0012_D07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCAACCCT*CCCTGCCGGCCCC*AC
SPLT1_0006_E02.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCAACCTC*CCTGGCGGCCCCA***
TES01_0041_F03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPLT1_0090_E10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPLT1_0081_D07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGGCCCC*CA
SPLT1_0074_G05.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
LNG01_0005_G11.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTGCCCCCCCACCCT*CCCTGCCGCCCCC*AC
ITT01_0096_C01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*AC
CLNT1_0075_E01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GGCTG*CCCCCCACCCT*TCCTGGCGCCCCN*A*
SPLT1_0069_F02.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
CBLT1_0099_H05.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
PST01_0018_C10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPLT1_0081_B08.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCAACCCT*CCCTGCCGCCCCC*AC
PST01_0058_C01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
THY01_0111_E03.b :
PBL01_0026_B05.b : CCCA*GCCCTGCGTGGCCACAGCTT*TGCTG*GNCCCCCACCT*CCTGGCGNNCCCC*AC
OVR01_0031_H02.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
TCH01_0021_G01.b : CCCA*GCCCTGCGTGGGCACAGCTT*GGCTG*CCCCCCACCCT*CCCTGCCGCCCCC*CA
ITT01_0097_C08.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
LNG01_0079_F03.b : CCCA*GCCCTGCGTGGCCCCAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
TCH01_0090_D04.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*NA
CLNT1_0019_A06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCN*TCCTGGCCGCCCC*AC
MLN01_0101_H07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*CA
TCH01_0009_F12.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
LNG01_0047_D07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
THY01_0104_H11.b :
SMG01_0041_D10.b : ggccaagtttggtggcccccacccttctgggggccccacctgggatttttcccagggcct
OVR01_0099_F05.b : ccagcccttgtttggccaccgcttgcccgtccccccacccttcatgggctcctccacttg
LVRM1_0161_H01.b :
THY01_0040_D10.b : cccgcggggccacgcttggctggcccccccccctccttggccccccccctgcatttcatc
LVRM1_0085_B11.b :
OVRM1_0039_G04.b : CTCA*GCC
OVRM1_0129_D04.b : CCCA*GCTCTGCGTGGCCn
THY01_0007_E11.b : CCCA*GCCCTGCCTGGCCACAGCTT*GCCTG*CCCCCTAC*CT*CCCTGCCGGCCCC*AC
OVR01_0101_B02.b : CCCA*GCCCTGCGTGGGCCACGCTT*TGCTGCCCCCCAACCCT*CCCTGGCGGCCCC*AC
PBL01_0038_D12.b : CCCA*GCCCTGCGTGGGCACAGCTT*GGCTG*CCCCCAACCTC*CCTGGGCGCCCCA***
ITT01_0033_H12.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SMG01_0021_G12.b : CCCA*GCCCTGCGTGGGCACAGCTT*GCCTGGCCCCCCACCCT*CCCTGGCGCCCCC*AA
MLN01_0017_C11.b : CCCA*GCCCTGCGTGGCCACAGCTT*GGCTG*CCCCCCACCCT*CCCTGGCGCCCCC*AC
PTG01_0098_F02.b : CCCA*GCCCTGCGTGGNCACAGCTTTGCCTG*CCCCCAACCTT*CCCTGGCGCCCCC*AC
CLNT1_0104_B09.b : TCCA*GCCCTGCGTGGGCACAGCTT*GGCTG*CCCCCCAACCT*CCTGGCGG**CCC*CA
PTG01_0047_C08.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
PBL01_0019_G12.b : CCCA*GCCCTGCGTGGCCACAGCTT*TGCTG*CCCCCCNACCT*CCTGGGCGCCCCC*AC
SKNB1_0053_E02.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
PBL01_0017_A10.b : CCCA*GTCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*CA
PBL01_0055_D03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ADR01_0053_D04.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCCACCT*CCCTGGCGCCCCC*AC
PBL01_0053_B05.b : CCCA*GCCCTGCGTGGCCACAGCTT*TGCTG*CCCCCA*CCNT*CCCTGGCGCCCCC*AC
ITT01_0086_A02.b : CCCA*GCCCTGCGTGGCCCCAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
CLNT1_0113_F10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
TCH01_0063_E12.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CC*TGCCGCCCCC*AC
PBL01_0008_H04.b : CCCA*ACCCTGCGTGGGCACCAGCTTGCCTG*CCCCCCAACCT*TCCGGCCGCCCCC*AC
ITT01_0092_D12.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SMG01_0090_A08.b : CCCA*GCCCTGCGTGGNCACAGCTT*TGCTG*CCCCCCAACCT*CCCTGGCGCCCCC*AA
LNG01_0101_D09.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*AC
CLNT1_0065_G06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCA*AC
SPL01_0037_E04.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
MLN01_0043_G11.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*AC
CLNT1_0067_E07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GGCTG*GCCCCCACCCT*CCCTGCCGCCCCC*CA
MLN01_0051_B12.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
MLN01_0033_H02.b : CCCA*GCCCTGCGTGGGCACAGCTT*TGCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
THY01_0053_C06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCCCAC
OVR01_0055_D08.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*TCCTGCCGCCCCC*AC
CLNT1_0086_E01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPL01_0054_H05.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*AC
THY01_0009_A01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
PBL01_0023_D05.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*GCCCCCACCCT*CCCTGGCGCCCCC*CA
SPL01_0004_A12.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
UTR01_0091_C09.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
THY01_0031_G06.b : CCCA*GCACTGCGTGGTCACAGCTT*GCCTG*CCTCTCACCCT*CTCTGCCGCCCCC*AC
OVR01_0097_H09.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ITT01_0027_C11.b : CCCA*GCCCTGCGTGGCCACAGCTTGGNCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
UTR01_0094_F02.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCTT*CCCTGGCGCCCCC*AC
ITT01_0064_A12.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
UTR01_0055_B08.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCTCC*AC
MLN01_0087_B09.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
MLN01_0082_E11.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCCACCT*CCCTGCCGCCCCC*AC
LNG01_0006_F01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GGCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPL01_0008_A05.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
MLN01_0097_G12.b : CCCA*GCCCTGCGTGGCCACAGCTT*GGCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
CLNT1_0060_A02.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
LNG01_0002_H03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
MLN01_0085_E10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ITT01_0060_E07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ITT01_0090_F07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ITT01_0087_D08.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
UTR01_0052_G01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
MLN01_0056_D04.b : CCCA*GCCCTGCGTGGCCACAGCTGGCCNTGGCCCCCCACCCT*CCCTGCCGCCCCC*AC
SPL01_0093_H09.b : CCCA*GCCCTGCGTGGNCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*AC
PBL01_0021_D06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GGNCT*GCCCCCACCCT*CCCTGGCGCCCCNNNA
ITT01_0057_D02.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ITT01_0074_C03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
PBL01_0107_H05.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCC*ACCCN*TCCTGCCGCCCCC*AC
ADR01_0086_H06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCNNNCCA
CLNT1_0022_A10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*CA
ITT01_0075_A10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GGCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ADR01_0074_B03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ITT01_0021_A03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ITT01_0037_B10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ITT01_0055_F06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
PBL01_0092_H03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*CA
ITT01_0049_B09.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
PBL01_0065_C06.b : CCCA*GCCCTGCGTGGCCGCAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
PBL01_0092_H10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*CA
PBL01_0103_F07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*NA
ITT01_0018_H08.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPL01_0078_E10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GGCTG*CCCCCCCACCT*CCCTGGCGCCCCC*AC
SPL01_0089_F03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GGCTG*CCCCCCACCCT*CCCTGCCGCCCCC*CA
ADR01_0070_G05.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCCNNA
ITT01_0083_B12.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*CA
SPL01_0104_F01.b : CCCA*GCCCTGCGTGGCCACAGCTT*TGCTG*CCCCCCCACCT*TCCTGGCGCCCCC*AA
MLN01_0087_F07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ADR01_0090_E06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPL01_0030_F09.b : CCCA*GCCCTGCGTGGCCACCGCTT*GGCTG*CCCCCCACCCT*CCCTGGCGGCCCC*AA
SPL01_0074_H11.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*AC
THY01_0086_B06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCCT*GCCCCCACCCT*CCCTGCCGCCCCC*AC
OVRT1_0087_D04.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*AC
MLN01_0045_C08.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*GCCCCCACCCT*CCCTGGCGCCCCC*CA
OVR01_0013_D06.b : CCCA*GCCCTGCGTGGCCACAGCTTTGCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
MLN01_0098_A08.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*GCCCCCACCCT*CCCTGCCGCCCCC*AC
SPL01_0078_H08.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*AC
MLN01_0025_G09.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
MLN01_0078_A04.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*TCCTGGCGCCCCC*AC
MLN01_0062_G02.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CC*TGCCGCCCCC*AA
THY01_0090_B07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCTCC*AC
MLN01_0069_A11.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*CA
LNG01_0058_C05.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPL01_0045_C04.b : CCCA*GCCCTGCGTGGNCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*AC
MLN01_0019_B06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*NA
CLNT1_0021_F04.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
TCH01_0080_F07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
THY01_0098_B10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
LVR01_0046_C03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
LNG01_0017_D07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
OVR01_0089_F04.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*GCCCCCACCCT*CCCTGCCGCCCC**AC
THY01_0109_C02.b :
OVRT1_0119_G03.b : ctgccttgcttgccatgattggctgcccccatcgtacgggctgtcctttttcgaccccat
OVR01_0049_G08.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*CA
ITT01_0042_D01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*NA
TES01_0075_G07.b : ggggcccaattttgggtggccccccccccctggggggccccccctggggatcttttccag
TES01_0094_D12.b : ctaaccttgtgtgggccaagctttggctgccccccaaccttcctgtgcgcccccattttg
MLN01_0075_H06.b : CCCA*GC*CTGCATGGCCACAGCTT*GCCTG*CCCCCCACttccctgcggccccatctgc
KDN01_0042_A10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SKNB1_0060_A09.b : CCCA*GCCCTGCGTGGCCACAGCTTTGCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
CLNT1_0069_B08.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
PST01_0039_E03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SKNB1_0056_D03.b : CCCA*GCCCTGCGTGGCCACAGCTTGGCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
PST01_0088_B10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SKNB1_0027_C10.b : CCCA*GCCCTGCGTGGCC*CAGCTTTGGCTGGCCCCCCACCCT*CCCTGCCGCCCCC*CA
TES01_0001_E06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPL01_0090_G02.b : CCCA*GCCCTGCGTGGCCACAGCTT*GGCTGGNCCCCCACCCT*CC*TGGCGCCCCC*NA
PBL01_0008_H08.b : ttcctggctacggggggaccggcttccggtggggcgctctccccagcggcaccaaggtcc
LNG01_0087_F06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*GCCCCCACCCT*CCCTGGCG*CCCC*AC
SKNB1_0062_D01.b : CCCA*GCCCTGCGTGGCCACAGTTGGGCCTG*CCCCCCACCTT*CCCTGGCGCCCCCCCA
SKNB1_0049_F03.b : CCCA*GCCCTGCGTGGCCACAGCTTTGCCTG*CCCCCCACCCT*CCCTGCCGCCNNC*CA
OVR01_0100_D11.b : ccccccagccctgcggggccccagctttgcctgccctccaacccttccttgtcggccccc
THY01_0110_D08.b :
SPLT1_0099_G09.b : accctgggtggggcaaagttgggttggcccccaccttcctgggcgccccccttggatttt
SPLT1_0079_C09.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*NA
ILNT1_0013_D01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCTTGCCGCCCCC*AC
SPLT1_0072_D07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPLT1_0076_B01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
LNG01_0064_F06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ADR01_0069_H04.b : CCCA*GCCCTGCGTGGCCACAGTTT*GCTTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPL01_0060_D05.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGGCGCCCC*CA
SPL01_0064_H03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
THY01_0096_B09.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPL01_0009_D10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
MLN01_0029_C02.b : CCCA*GTGATGCGTGGtcacgcttgtctgctaccatcatccctgctgccacacatgcact
LVR01_0036_A08.b : CCCA*CCCCTGCGTGGGCACACCTT*GCCTGGCCtttatccttccctgccgccccctctt
THY01_0045_G10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCC*CCCTGCCC*CCCC*CC
TCH01_0068_H04.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCCCC*AA
MLN01_0039_C03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
PBL01_0010_H06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGGCGCCC*C*AC
PBL01_0025_B02.b : CCCA*GCCCTGCGTGGGCACAGCTT*TGCTG*CCCCCCACCCT*CCCTGCCGCCCCCCAC
PBL01_0090_A04.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCTCCCCCA
ITT01_0023_E03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ITT01_0079_G09.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
MLN01_0043_F08.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
MLN01_0052_G09.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPL01_0073_B03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPL01_0005_D08.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCTCC*AC
THY01_0083_D08.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCACCCACCCT*CCCTGCCGCCCCC*AC
CLNT1_0080_E08.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCTTGCCGCCCCC*AA
TCH01_0092_A11.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPL01_0016_E09.b : CCCA*GCCCTGCGTGGCCACAGTTTTGCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ITT01_0035_H12.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*TCCTGCCGCCCCC*AC
THY01_0059_B07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCTCCCCTGCCGCCCCC*AC
ITT01_0070_D01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
THY01_0022_C04.b : CCCA*GCCCTGCGTGGCCGCAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
PBL01_0053_A03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
CLNT1_0093_D06.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
CLNT1_0125_D03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
CLNT1_0086_G03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AN
MLN01_0037_B09.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCTCCCT*CCCTGCCGCCCCC*CA
ILNT1_0044_B10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
THY01_0121_D01.b :
ITT01_0100_A12.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPLT1_0080_H01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCGGCCCCC*AC
ADR01_0008_G03.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCCT*GCCCCCCACCC*TCCTGCCCGCCCC*CA
SPLT1_0033_A04.b : CCCA*GCCCTGCGTGGCCCACAGCT*TGCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
THY01_0090_C02.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SMG01_0068_H01.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
MLN01_0096_D10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ILNT1_0043_G04.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
SPLT1_0035_C10.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ITT01_0087_G05.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
ITT01_0033_E07.b : CCCA*GCCCTGCGTGGCCACAGCTT*GCCTG*CCCCCCACCCT*CCCTGCCGCCCCC*AC
20110601C-001078 : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
---------+---------+---------+---------+---------+---------+ 974
OVRT1_0096_D07.b : CTTGGACTTCATC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GAAAC*
ITT01_0061_E02.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
MLN01_0031_F06.b : CTGGCACTCATCC*CATGGGCCT*CTGGGCACT*GGCTCGCCG*TCCTCCCTG*GACACC
OVRM1_0216_F09.b :
OVRM1_0086_G02.b :
UTR01_0003_G07.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGGTCGCCG*TCCTCCCTGaaccctc
MLN01_0014_D04.b : CTGGCACTCATNC*CATGGGCCT*CTGGGCACT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0036_H06.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
PBL01_0083_F07.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCCTCCTG*GACACC
SMG01_0080_C07.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GGACAC
CLNT1_0024_C04.b : CTGCACCTCATCC*CATGGGCCT*CTGCCACCT*GGCTCGCCG*TCCTCCCTG*GGACAC
ILNT1_0053_D09.b :
ILNT1_0073_E01.b : ttattccagggggccttgggagtgggctagcgtgtttcgcgggagaagttgggttttttt
SPLT1_0039_H04.b : cactcatcccatgggcctcgggcactggctcgccttcctccctggaaacttagttccttc
ILNT1_0011_E07.b : CTGgaactcatccagggggccttgggcacctggctgcccttctccctggaaccctcagtt
SPLT1_0034_D05.b : CTGCACTTCATCC*CATGGGGCT*CTGGCAACT*GGCTGGCCT*TCCCcctggaaacttc
ILNT1_0007_C06.b : CTGGAACTC*TTC*CATGGGCCT*CTGGGACCT*GGCTCGCCG*TCCTCCCTGaaaactc
ILNT1_0066_E11.b : CTGCATTTCATCC*AAGGGGCCT*CTGGAACCT*GGCTCCGCG*TCCTTCCTG*GAaccc
SPLT1_0061_E04.b : *TGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACAC*
SPL01_0030_H11.b : CTGGCACTCATCC*CATGGGGCT*CTGGCACTG*GGCTCGCCG*TC*TCCCTG*GAAACC
ILNT1_0005_B01.b : CTGCACCTCATCC*CATGGGCCT*CTGGGACCT*GGCTCGGCG*TCCTCCCTG*GACCCC
SPLT1_0071_C03.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ILNT1_0052_A10.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACCCT
ILNT1_0085_C06.b : NTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ILNT1_0020_G06.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
SPLT1_0009_F05.b : CTGCAACTCATCC*CATGGGGCTTCTGCCACCT*GGCTCGCCG*TCTTCCCTG*GACACC
SPLT1_0004_E02.b : CTGCACTTCATTC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ILNT1_0049_G10.b : CTGCACTTCATCC*CATGGGCCT*CTGGGCACT*GGCTCGCCG*TCTTCCCTG*GAAACC
ILNT1_0089_E04.b : CTGCACTTCATCC*CATGGGCCT*CTGGCCACT*GGCTCGCCG*TCCTCCCTG*GACACC
SPLT1_0054_F06.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ILNT1_0020_H06.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GAACAC
ILNT1_0083_F10.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ILNT1_0092_E02.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ILNT1_0092_B05.b : CTGCACTTCATCC*CATGGGCTTCTGGGCACCT*GGCTCGCCGTCCTTCCCTG*GACACC
ILNT1_0098_D05.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCCGTCCTCCCTG*GACACC
TCH01_0051_B10.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
SPLT1_0051_F01.b : CTGCACTTCATCC*CAGGGGCCT*CTGGGCACT*GGCTCGCCG*TCCTCCCTG*GACACC
SPLT1_0011_G01.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACAAC
SPLT1_0070_F04.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCTTG*GACACC
SPL01_0055_B03.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTGGGACACC
TCH01_0076_C07.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
HTMT1_0058_B09.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ILNT1_0100_E07.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ILNT1_0046_G08.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ILNT1_0044_B06.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GAAACC
THY01_0108_D07.b :
SPL01_0034_B02.b : ctttgtccatggggccttggttgactgggtttacgtttctcctttgaagattttagttct
MLN01_0036_F12.b : ttatccgagggcctctgggactggctcgtcgtactcctgaacactcacatcttttcaaaa
THY01_0018_A10.b : atccatgggctctggaacttgattgccgcctcccggaacctcaagtccttcaaa
ADR01_0006_E04.b : catttcatccatgggctctgcacctggctcgcgtcctcctggacactcacgtctctcaga
SPL01_0022_C04.b :
PTG01_0108_B11.b : CTGAAATTCATCC*Ccatgggccttctgggactgggttccccgtcctcctggaaacctcc
THY01_0064_D01.b : CTGCACTTTCTCC*CATGGGCCTCTGTGCACcctggctccccctccctcccctggacacc
ITT01_0086_H12.b : CTGCACTTCATTC*CATGGGCCT*CTGGCACCTGGCTTCGCCG*TCCTCCCTG*GACACC
PBL01_0034_C06.b : CTGCACTCA**TC*CATGGGGCT*CTGGCA*CT*GGCTCGCCG*TCCTCCCTG*GA*ACC
PBL01_0038_G07.b : CTGCACNTCATCC*CATGGGGCT*CTGGCACCT*GNCTCGCCG*TCCTCCCT**GACACT
MLN01_0001_G09.b : TTGGAACTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCTTCCCTG*GAAACC
CLNT1_0140_D04.b : CTGCACTTCATCC*CATGGGCCT*CTGGGCACT*GGCTCGCCG*TCCTCCCTG*GACACC
MLN01_0067_G10.b : CTGCACTTCATCC*CATGGGCCT*CTGGAACCG*GGCTCGCCG*TCCTCCCGG*GAAACC
PBL01_0027_B12.b : CTGGCACTCATCC*CATGGGCCT*CTGGGCACT*GGCTCGCCG*TCCTCCCTG*GACACC
PBL01_0012_B05.b : ACTGCACTCATNC*CATGGGCCT*CTGGGCACT*GGCTCGCCG*TCCTCCCTG*GACACC
CLNT1_0072_A02.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
CLNT1_0140_C04.b : CTGCAACTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
CLNT1_0116_G06.b : CTGCACTTCATCC*CATGGGGCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTT*GAACAC
CLNT1_0057_E05.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACAC*
CLNT1_0042_D05.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACA*C
LNG01_0084_H05.b : CTGGCACTCATCC*CATGGGGCT*CTGGGCACT*GGCTCGCCG*TCCTNCCTG*GACACC
ITT01_0095_F05.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
MLN01_0034_H12.b : CTGGCACTCATCC*CATGGGCCG*CTGGGCACT*GGCTCGCCG*TCCTCCCTG*GACACC
CLNT1_0015_B01.b : CTGCACTTTCATC*CATGGGGCT*CTGGGCACT*GGCTCGCCG*TCCTCCCTG*GGACAC
LNG01_0066_A11.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
SPL01_0068_G02.b : CTGCACCTCATCC*CAGGGGCCT*CTGGCACCT*GGCTCGCCGGTCTCCCCTG*GACACC
PTG01_0048_H09.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
MLN01_0084_C06.b : CTGCACCTCATCC*CATGGGCCT*CTGGGCACT*GGCTCGCCG*TCCTCCCTG*GACACC
CLNT1_0141_G09.b : CTGCACTTCATCC*CATGGGCCT*CTGT*ACCT*GGCTCGCCG*TCCTCC*TG*GACACC
LNG01_0034_H06.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0064_A09.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
LNG01_0046_C07.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
SPL01_0056_B10.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACAAC
CLNT1_0054_F11.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
THY01_0066_G06.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCCCCG*TCCTCCCTG*GACACC
LNG01_0010_D04.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
OVR01_0007_C08.b : CTGCACCTCCATC*CATGGGCCT*CTGGCACCTGGGCTCGCCGTCCCTCCCTG*AACCCC
LNG01_0020_G01.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
CLNT1_0143_B07.b : *TGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
CLNT1_0100_A01.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GGACAC
CLNT1_0089_G10.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
PBL01_0071_E09.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0001_G01.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0081_F09.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
PBL01_0083_A12.b : CTGCACCTCATNC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACNAC
PBL01_0032_D04.b : CTGCAC*TCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
CLNT1_0044_D02.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0078_H07.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACNAC
ITT01_0081_E12.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
MLN01_0048_E02.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTNCCTG*GACACC
PBL01_0099_G09.b : CTGCAC*TCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0036_G12.b : CTGCACCTCATCC*CATGGGGCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
SPL01_0096_E06.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
LNG01_0027_A11.b : CTGCACTTCATCC*CATGGGCCT*CTGGTACCT*GGCTCGCCG*TCCTCCCTG*GACACC
LNG01_0060_G03.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
SPL01_0105_C04.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
THY01_0061_H11.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
CLNT1_0059_F08.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
CLNT1_0058_D02.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GGCACC
CLNT1_0035_C03.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
CLNT1_0071_D12.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACTT*GGCTCGCCG*TCCTCCCTG*GACACC
MLN01_0011_B01.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
LNG01_0075_C12.b : CTGCACTTCATCC*CATGGGGCT*CTGGCACCT*GGCTCGGCG*TCCTCCCTG*GACACC
CLNT1_0050_C01.b : CTGCACTTCATCC*CATGGGCCT*CTGGGCACT*GGCTCGCCG*TCCCTCCTG*GACA*C
THY01_0037_B12.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
SPL01_0085_H06.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
THY01_0056_D06.b : CTGCACCTCATCCCCATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
SPL01_0096_E10.b : CTGCACCTCATCC*CATGGGCCT*CTGGGACCT*GGCTCGCCG*TCCTCCCTG*GACACT
THY01_0016_F01.b : CTGGACCTCATCC*CTGGGGCCT*CGGGCccttgg
THY01_0048_H11.b : CTGGACCTCATCC*CATGGGGCCTCTG
LNG01_0036_G11.b : CTGCACCTCATCC*CATGGGCCT*CTGGGCACT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0045_A03.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GGACAC
PBL01_0057_E06.b : CTGCACCTCATCC*CATGGGCCT*CTGCCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0075_C06.b : CTGCACCTCATCC*CATGGGCCT*CTGGGCACT*GGCTCGCCG*TCCTCCCTG*GACACC
ILNT1_0074_B10.b : CTGGAATTTATCC*CATGGGCCT*CTGGGCACctggttcgccctcctcccctgaacccct
PTG01_0080_H11.b : CTGAAATTCATCC*CATGGGCTT*CTG*CACCT*GGCTCGCGG*TCCTC*CTG*GAAACC
PBL01_0012_F07.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
THY01_0093_E04.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GAAACC
ITT01_0056_H01.b : CTGGCACTCATCC*CATGGGCCT*CTGGGCACT*GGCTCGCCG*TCCTCCCTG*GACACC
SPL01_0074_G04.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACT
MLN01_0101_D07.b : CTGCACTTCATCC*CATGGGCCT*CTGGCAACT*GGCTCGCCG*TCCTCCCTG*GACACC
ILNT1_0091_D11.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCCTCCTG*GACACC
ILNT1_0037_B12.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
CLNT1_0020_A02.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
MLN01_0021_H08.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
MLN01_0095_G11.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
MLN01_0071_C05.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
SKNB1_0010_G12.b : CTGGACCTCATCC*CATGGGCCT*CTGGAGACT*GGGTCGCCCGTCTtccctggaaaccc
SKNB1_0096_G07.b : CTGGACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
CBLT1_0100_B06.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCCTCCTG*GACACC
MLN01_0049_B07.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
CBLT1_0098_C03.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCT*CCTG*GACACC
SPL01_0095_A01.b : CTGCACCTCATCC*CATGGGGCT*CTGGCACCT*GGCTTCGCG*TCCTCCCTG*GACACC
SPL01_0045_C10.b : CTGCACCTCATCC*CATGGGCCT*CTGGGCACT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0057_H08.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0090_C09.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0081_G04.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTC*CCG*TCCCTCCTG*GACACC
SPLT1_0015_G09.b : atcccatgggctttggcaacctgcttcccctcctcctggaaacctaagttttttcaaaag
MLN01_0011_G03.b : cttcatctcatgagactctggagcctgtcacgctgctctcactggacacatcatatcgct
SPLT1_0032_G07.b : gaatttatcccagggggcttgggcacctgctcgccctcctccctggaaacttcagttctc
ILNT1_0018_A07.b : ATGGACCTCAT*C*CAAGGGCCT*CTGGCCACT*GGCTCGCCG*ATCTTCCTG*GAAACC
SPLT1_0098_E04.b : CTGGACCTCAT*C*CATGGGGCT*CTGGCAACT*GGCTCGCCG*TCCTCCCTG*GAAACC
SPLT1_0012_D07.b : CTGCACTTCATCC*CATGGGCCC*TCTGGAACT*GGCTCGCCC*TTCTCCCTG*GAAACC
SPLT1_0006_E02.b : CTGCACCTCATCC*CATGGGCCT*CTGGGACCT*GGCTCGCCG*TTCTCCC*G*GACCCC
TES01_0041_F03.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
SPLT1_0090_E10.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
SPLT1_0081_D07.b : CTGCAACTCATCC*CATGGGGCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
SPLT1_0074_G05.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGGCG*TCCTCCCTG*GACACC
LNG01_0005_G11.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0096_C01.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCCTCCTG*GACACC
CLNT1_0075_E01.b : CTGCACTTCATCC*CATGGGCCT*CTGGCAACT*GGCTCGCCG*TCCTCCCTG*GACACT
SPLT1_0069_F02.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
CBLT1_0099_H05.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
PST01_0018_C10.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
SPLT1_0081_B08.b : CTGCACTTCATCC*CATGGGGCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
PST01_0058_C01.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
THY01_0111_E03.b :
PBL01_0026_B05.b : *TGGNACTCATCC*CATGGGCCT*CCNGGCACT*GNNCTCGCG*TCCTCCNNT*GGACAC
OVR01_0031_H02.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
TCH01_0021_G01.b : CTGCACTTCATCC*CATGGGGCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0097_C08.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
LNG01_0079_F03.b : CTGCACCTTATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*AACACC
TCH01_0090_D04.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCCTCCTG*GNACAC
CLNT1_0019_A06.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GNACAC
MLN01_0101_H07.b : CTGCACTTCATCC*CATGGGCCT*CTGGGCACT*GGCTCGCCG*TCCTCCCTG*GACACC
TCH01_0009_F12.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
LNG01_0047_D07.b : CTGCACTTTCATC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
THY01_0104_H11.b :
SMG01_0041_D10.b : ttgggaccgggccccccttcccccgggaaacctcaggttttttttaaagggcaaggaaaa
OVR01_0099_F05.b : tactttcctccctggggtcccctggaacctggctctgcccttctcccctggaactctccc
LVRM1_0161_H01.b :
THY01_0040_D10.b : catggggctctgggccctgtgctccccgttctccttggacccctcccctttctctttaaa
LVRM1_0085_B11.b :
OVRM1_0039_G04.b :
OVRM1_0129_D04.b :
THY01_0007_E11.b : CTGGACTTCActtttgggtctctgcgccctggctcaccgtcctctcggaactctaagtct
OVR01_0101_B02.b : CTGCACTTtcatcccatggggcctcttggcacctgggctggcccgtcctccctggaaaac
PBL01_0038_D12.b : CTGGAACTCATCC*CATGGGGCT*TCTGCACCT*GCCTCGGCG*TCCTCCCTGaacactc
ITT01_0033_H12.b : CTGCACTTCATCC*AATGGGCCT*CGGGCACCT*GGGTTGCCCGTCTTCCCTG*GAAACC
SMG01_0021_G12.b : CT*CACTTTATCC*CATGGGCCT*TCGGAAACT*GGCTCGCCG*TCCTTCCTG*GAACCC
MLN01_0017_C11.b : TTGGACTTCAATC*CAGGGGCCT*CTGGCACCT*GGCTCCGCG*TCCTTCCTG*GAACAC
PTG01_0098_F02.b : CTGCACTTCATCC*CATGGGGCCTCTGGCACCT*GGCTCCGCG*TCCTCCCTG*GAAACC
CLNT1_0104_B09.b : CTGCACCTCAT*C*CATGGGCCT*CTGGCACTT*GGCTCGCCG*TCCTCCCTG*GA*ACC
PTG01_0047_C08.b : CTGCACTTCATCCCAATGGGCTT*CTGGCACCT*GGGTCGCCG*TTCTCCCTG*GAAACC
PBL01_0019_G12.b : *TGCACCTCATCC*CATGGGCCT*CTGGCACCCTGGCTCGCCG*TCCTCCCTG*GACACT
SKNB1_0053_E02.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
PBL01_0017_A10.b : CTGCACCTCATCC*CATGGGCCT*CTGGGCACCTGGCTCGCCG*TCCTCCCTG*GACACC
PBL01_0055_D03.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ADR01_0053_D04.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCC*GTCTCCCTG*GACACC
PBL01_0053_B05.b : *TGNNACTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCTG*TCCTCCCTG*GNACAC
ITT01_0086_A02.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
CLNT1_0113_F10.b : CTGCACCTCATCC*CATGGGCCT*CTGGCAACT*GGCTCGGCG*TTCCTCCTG*GAACCC
TCH01_0063_E12.b : CTGCACTTCATCC*CAGGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
PBL01_0008_H04.b : CTGAACCTCATCC*CAAGGGCCT*CTGGGACCTGGCCCCGCCC*TCCCCCCCG*GACACC
ITT01_0092_D12.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*NACACC
SMG01_0090_A08.b : CTGAACCTCAATC*CATGGGGCT*CTGGCACCT*GCCTCGCCG*TCTTCCCTG*AACACC
LNG01_0101_D09.b : CTGCACCTCATCC*CATGGGGCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
CLNT1_0065_G06.b : CTGCACCTCATCC*CATGGGCCT*CTGGGCACT*GGGTCGCCG*TCCTCCCTG*GACACC
SPL01_0037_E04.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGGCGGCCCTCCCTG*GACACC
MLN01_0043_G11.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCG*G*GACACC
CLNT1_0067_E07.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
MLN01_0051_B12.b : CTGCACTTCATCC*CATGGGCCT*CTGGCGCCT*GGCTCGCCG*TCCTCCCTG*GACACC
MLN01_0033_H02.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGGCTCGCG*TCCTCCCTG*GACACC
THY01_0053_C06.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCGTCCTCCCCTG*GACACC
OVR01_0055_D08.b : CTGCACCTCATCC*CATGGGCCT*CTGGGCCTT*GGCTCGCCG*TCCTCCCTG*GAACCC
CLNT1_0086_E01.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
SPL01_0054_H05.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
THY01_0009_A01.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
PBL01_0023_D05.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACNAC
SPL01_0004_A12.b : CTGCACCTCATCC*CATGGGCCT*CTGGGCACT*GGCTCGCCG*TCCTCCCTG*GACACC
UTR01_0091_C09.b : CTGCACTTCATCC*CATGGGCCT*CTGGCCACT*GGCTCGCCG*TCCTCCCTG*GACACC
THY01_0031_G06.b : CTGCACTTCATCA*CATGGGCCT*CTGGCACCT*GCCTCGCCG*TCCTCGCTG*GACACC
OVR01_0097_H09.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0027_C11.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
UTR01_0094_F02.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0064_A12.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
UTR01_0055_B08.b : CTGCACCTCATCC*CATGGGCCT*CTGGCGCCT*GGCTCGCCG*TCCTCCCTG*GACACC
MLN01_0087_B09.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TTCTCCCTG*AACACT
MLN01_0082_E11.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
LNG01_0006_F01.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
SPL01_0008_A05.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
MLN01_0097_G12.b : CTGCACCCTCATC*CATGGGCCT*CTGGGCACT*GGCTCGCCG*TCCTCCCTG*GGACAC
CLNT1_0060_A02.b : CTGCACCTCATNC*CATGGGCCT*CTGGGCACT*GGCTCGCCG*TCCTCCCTG*GNACAC
LNG01_0002_H03.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCCTGGACACC
MLN01_0085_E10.b : CTGGACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0060_E07.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0090_F07.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0087_D08.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
UTR01_0052_G01.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
MLN01_0056_D04.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGGTCGCCG*TCCTCCCTG*GAAACC
SPL01_0093_H09.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
PBL01_0021_D06.b : CTGCAC*TCATNC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACN
ITT01_0057_D02.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0074_C03.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
PBL01_0107_H05.b : CTGCACCTCATCC*CATGGGCCT*CTGGGCACT*GGCTCGNCG*TCCTCCCTG*GNACAC
ADR01_0086_H06.b : CTGCAC*TCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GNACAC
CLNT1_0022_A10.b : CTGCACTTCATCC*CATGGGCCT*CTGGGCACT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0075_A10.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ADR01_0074_B03.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0021_A03.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0037_B10.b : CTGCACCTCATCC*CATGGGCCT*CTGGGCACT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0055_F06.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
PBL01_0092_H03.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0049_B09.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
PBL01_0065_C06.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACNAC
PBL01_0092_H10.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
PBL01_0103_F07.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0018_H08.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*CCCTCCCTG*GACACC
SPL01_0078_E10.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
SPL01_0089_F03.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ADR01_0070_G05.b : CTGCAC*TCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
ITT01_0083_B12.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCCTCCTG*GACACC
SPL01_0104_F01.b : CTGCACTTCATCC*CATGGGGCCTCGGGCACTG*GGCTCGCCG*TCCTCCCTG**AAACC
MLN01_0087_F07.b : TTGCACTTCATCC**ATGGGCCT*CTGGCACCG*GGCTCGCCG*TCCTCCCTG*GACACC
ADR01_0090_E06.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
SPL01_0030_F09.b : CTGCACCTCATCC*CATGGGCCT*CTGGCCACCTGGCTCGGCC*GTCTCCCTG*GAAA*C
SPL01_0074_H11.b : NTGGCACTCATCC*CATGGGGCT*CTGGCACCT*GGCTCGCCCGTCCTCCCTG*GACACC
THY01_0086_B06.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
OVRT1_0087_D04.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
MLN01_0045_C08.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
OVR01_0013_D06.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
MLN01_0098_A08.b : CTGCACCTCATCC*CATGGGGCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
SPL01_0078_H08.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
MLN01_0025_G09.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCTTG*GACACC
MLN01_0078_A04.b : CTGCACTTCATCC*CATGGGCCT*CTGGCNACT*GGCTCGCCG*TCCTCCCTG*GACACC
MLN01_0062_G02.b : CTGCACTTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
THY01_0090_B07.b : CTGCACTTCATNC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
MLN01_0069_A11.b : CTGGCACTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
LNG01_0058_C05.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
SPL01_0045_C04.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTCCCTG*GACACC
MLN01_0019_B06.b : CTGCACTTCATCC*CATGGGCCT*CTGGGCACT*GGCTCGCCG*TCCTCCCTG*GACACC
CLNT1_0021_F04.b : CTGCACCTCATNC*CATGGGCCT*CTGGCNACT*GGCTCGCCG*TCCTCCCTG*GACAAC
TCH01_0080_F07.b : CTGCACCTCATCC*CATGGGCCT*CTGGCACCT*GGCTCGCCG*TCCTC