
[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-001404

Length: 1,454

Sequence [FASTA format sequence]

SNP mapping information
SNP IDRel.Chr.Location (cM)

Assembly Overview:      TOP
Change score limit to  

BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinACTA2actin, aortic smooth muscle [Homo sapiens]. 7650.0O
Contig/Assembly ProteinACTA2actin, aortic smooth muscle [Homo sapiens]. 7650.0O
Contig/Assembly ProteinACTC1actin, alpha cardiac muscle 1 proprotein [Homo sapiens]. 7550.0O
Contig/Assembly ProteinACTG2actin, gamma-enteric smooth muscle isoform 1 precursor [Homo sapiens]. 7540.0O
Contig/Assembly ProteinACTA1actin, alpha skeletal muscle [Homo sapiens]. 7530.0O
Contig/Assembly ProteinACTG1actin, cytoplasmic 2 [Homo sapiens]. 7240.0O
Contig/Assembly ProteinACTG1actin, cytoplasmic 2 [Homo sapiens]. 7240.0O
Contig/Assembly ProteinACTBactin, cytoplasmic 1 [Homo sapiens]. 7240.0O
Contig/Assembly ProteinACTBL2beta-actin-like protein 2 [Homo sapiens]. 6890.0O
Contig/Assembly ProteinPOTEEPOTE ankyrin domain family member E [Homo sapiens]. 6720.0

BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinActa2actin, aortic smooth muscle [Mus musculus]. 7650.0O
Contig/Assembly ProteinActc1actin, alpha cardiac muscle 1 [Mus musculus]. 7550.0O
Contig/Assembly ProteinActg2actin, gamma-enteric smooth muscle [Mus musculus]. 7540.0O
Contig/Assembly ProteinActa1actin, alpha skeletal muscle [Mus musculus]. 7530.0O
Contig/Assembly ProteinActg1actin, cytoplasmic 2 [Mus musculus]. 7240.0O
Contig/Assembly ProteinActbactin, cytoplasmic 1 [Mus musculus]. 7240.0O
Contig/Assembly ProteinGm12715PREDICTED: actin, cytoplasmic 2-like [Mus musculus]. 7020.0O
Contig/Assembly ProteinActbl2beta-actin-like protein 2 [Mus musculus]. 6960.0O
Contig/Assembly ProteinActr1bbeta-centractin [Mus musculus]. 427e-120O
Contig/Assembly ProteinActr1aalpha-centractin [Mus musculus]. 422e-118O

BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC477587PREDICTED: similar to Actin, aortic smooth muscle (Alpha-actin 2) [Canis familiaris]. 7650.0O
Contig/Assembly ProteinACTCPREDICTED: similar to Actin, alpha cardiac (Alpha-cardiac actin) isoform 3 [Canis familiaris]. 7550.0O
Contig/Assembly ProteinLOC475792PREDICTED: similar to Actin, gamma-enteric smooth muscle (Smooth muscle gamma actin) (Alpha-actin 3) [Canis familiaris]. 7540.0O
Contig/Assembly ProteinACTBactin, cytoplasmic 1 [Canis lupus familiaris]. 7210.0O
Contig/Assembly ProteinLOC475923PREDICTED: hypothetical protein XP_533132 [Canis familiaris]. 7190.0O
Contig/Assembly ProteinACTBPREDICTED: similar to cytoplasmic beta-actin isoform 9 [Canis familiaris]. 7110.0O
Contig/Assembly ProteinLOC487218PREDICTED: similar to Actin, cytoplasmic 1 (Beta-actin 1) [Canis familiaris]. 6960.0O
Contig/Assembly ProteinLOC442937beta-actin-like [Canis lupus familiaris]. 6730.0O
Contig/Assembly ProteinACTBPREDICTED: similar to cytoplasmic beta-actin isoform 1 [Canis familiaris]. 6720.0O
Contig/Assembly ProteinLOC610787PREDICTED: similar to cytoplasmic beta-actin [Canis familiaris]. 6610.0O

BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinACTA2actin, aortic smooth muscle [Bos taurus]. 7650.0O
Contig/Assembly ProteinACTC1actin, alpha cardiac muscle 1 [Bos taurus]. 7550.0O
Contig/Assembly ProteinACTG2actin, gamma-enteric smooth muscle [Bos taurus]. 7540.0O
Contig/Assembly ProteinACTA1actin, alpha skeletal muscle [Bos taurus]. 7510.0O
Contig/Assembly ProteinACTG1actin, cytoplasmic 2 [Bos taurus]. 7240.0O
Contig/Assembly ProteinACTBactin, cytoplasmic 1 [Bos taurus]. 7240.0O
Contig/Assembly ProteinACTBL2PREDICTED: beta actin-like [Bos taurus]. 6970.0O
Contig/Assembly ProteinACTBL2PREDICTED: beta actin [Bos taurus]. 6970.0O
Contig/Assembly ProteinACTR1Bbeta-centractin [Bos taurus]. 426e-119O
Contig/Assembly ProteinACTR1Aalpha-centractin [Bos taurus]. 422e-118O

BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinACTA2actin, aortic smooth muscle [Sus scrofa]. 7650.0O
Contig/Assembly ProteinACTC1actin, alpha cardiac muscle 1 [Sus scrofa]. 7550.0O
Contig/Assembly ProteinLOC100515351PREDICTED: actin, alpha cardiac muscle 1-like isoform 1 [Sus scrofa]. 7530.0O
Contig/Assembly ProteinACTA1actin, alpha skeletal muscle [Sus scrofa]. 7530.0O
Contig/Assembly ProteinACTBPREDICTED: actin, cytoplasmic 2 [Sus scrofa]. 7240.0O
Contig/Assembly ProteinACTBPREDICTED: actin, cytoplasmic 1 [Sus scrofa]. 7240.0O
Contig/Assembly ProteinLOC100515351PREDICTED: actin, alpha cardiac muscle 1-like isoform 2 [Sus scrofa]. 6440.0O
Contig/Assembly ProteinLOC100621129PREDICTED: actin, gamma-enteric smooth muscle-like [Sus scrofa]. 493e-140O
Contig/Assembly ProteinLOC100520667PREDICTED: actin, gamma-enteric smooth muscle-like [Sus scrofa]. 451e-127O
Contig/Assembly ProteinACTR1APREDICTED: alpha-centractin [Sus scrofa]. 422e-118O

Assembly Members: 164      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
OVRM10007G08OVRM1_0007_G08.bBP153099 AK234691


SNPs: 5      TOP
Loc.AlleleIndividualsFreq.TypeAA Change

Alignment:      TOP

20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
SPL01_0090_D03.b : nnnnggctaggactatgac
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b : gctt
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b : nccgctttntnntaacgatacataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0090_D09.b :
BKFL1_0089_E09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
SPL01_0055_A11.b :
BKFL1_0020_G02.b : nnnccgagannnnnnnacgatacattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0048_C08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
MLTL1_0079_E05.b : nnnnggcatatnnnnnntgaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0119_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
BKFL1_0025_B05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
SPL01_0090_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0121_E05.b : taattgtc
SPL01_0061_F12.b : nnnggctaggactatgacxxxxxxxxxxxx
UTR01_0009_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0008_D02.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0098_C11.b : nnnggagcgat
SMG01_0045_G12.b : nggcattttanaatg
SMG01_0031_H06.b : nnccggttttnnnnnnn
SPLT1_0020_F08.b : nnnncgac
TCH01_0096_B07.b : ttttnagctaggcctatgacxxxxxxxxxx
UTR01_0099_A07.b : nnnnggctagtgacttgacagtttgtac
OVRM1_0044_H09.b : cccttgtcxx
OVRM1_0225_C04.b : ttgtc
LVRM1_0022_D01.b : cgttgac
OVRM1_0198_G10.b : cgttgtc
OVRM1_0054_C08.b : cgttga
SPL01_0022_H04.b : catttgggtggxxxxxxxxxxxxxxxxxxxxxx
SMG01_0053_G02.b : nngcgtttttnnnn
SPL01_0016_D07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0011_F10.b : ctttgggtggxxxxxxxxxxxxxxxxxxxxx
OVR01_0060_D04.b : nnggcttgtgacttgacxxxxxxxxxxx
OVR01_0066_F05.b : nnggcttgtgatatgacxxxxxxxxx
UTR01_0028_D07.b : gggtggacxxxxxxxxxxxxxxxxxxxxx
OVRT1_0141_G05.b : nnnaacctatcnnnnnnnnccgttagcgtacgxx
OVRT1_0131_A11.b : nnnaaatacccnnnnnnnccgttagcgcacgxx
UTR01_0010_D07.b : ttttttgtgaxxxxxxxxxxxxxxxxxxxxxx
UTR01_0045_E06.b : tttxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0045_C08.b : tgggttgacxxxxxxxxxxxxxxxxxxxxx
UTR01_0042_H09.b : ggtgcacctatxxxxxxxxxxxxxxxxx
OVR01_0077_C07.b : nnnnggcttggactatgacxxxxxxxxxxx
UTR01_0086_G07.b : nnnggcatgtgactttacxxxxxxxxx
OVR01_0028_E11.b : gggacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0079_F03.b : nnnnggctaggactatnacxxxxxxxxx
SPL01_0054_E02.b : nnnnggctagtgacttgacxxxxxxxxx
SPL01_0071_A08.b : nnnggctaggactatnacxxxxxxxxx
UTR01_0057_B10.b : gaggcattacgtgxxxxxxxxxxxxxxxxx
OVR01_0055_B05.b : nnttggctaggacttanacxxxxxxxxxx
OVR01_0086_B07.b : ttggcttggactatgacxxxxxxxxx
UTR01_0035_H11.b : ggggacctattagxxxxxxxxxxxxxx
CLNT1_0005_D05.b : nggcnccgtcagcgnacgna
UTR01_0034_H04.b : cctttgggtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0111_D03.b : nnccgcttnnnnnnnnncgtcagcgttcgxx
OVR01_0049_E08.b : nnnttgctagtgacttgacxxxxxxxxx
UTR01_0034_D03.b : tttttggtgccxxxxxxxxxxxxxxxxxxxxx
UTR01_0102_D01.b : nnnnggctagtgacttgacxxxxxxxxx
SPL01_0056_B11.b : nnnggcatgtgacttnacxxxxxxxxx
SPL01_0095_E05.b : nnnggctaggactataacxxxxxxxxxx
SPL01_0087_E03.b : nnnggctaggactatnacxxxxxxxxx
UTR01_0063_E03.b : cctttttggtgxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0058_E03.b : cgcttttanggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0049_B05.b : tttttggggxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0050_B07.b : nnggctaggactataacxxxx
OVR01_0062_C08.b : nnnaagctaggactatnacxxxxxxxxx
SPLT1_0009_A05.b : nnncgc
SPL01_0004_C05.b : catctggcgccnxxxxxxxxxxxxxxxxxxxx
SPL01_0066_C01.b : nnnnggctagtgacttnacxxxxxxxxx
SPL01_0068_H12.b : ttttggctagtgacttnacxxxxxxxxx
UTR01_0086_E03.b : nnnnnggctagtxxxxxxxxxxxxxxxxxx
UTR01_0088_F05.b : nnnggcttggactatcacxxxxxxxxxx
SPL01_0094_H02.b : nnnnggctagtgacttgacxxxxxxxxxx
SPL01_0009_C07.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0043_B08.b : ttxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0048_H02.b : nnntttcgtcagcgnacgxx
OVR01_0011_A12.b : cgaaaatatgnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0041_A11.b : gcctggtaatagcaxxxxxxxxxxxxxxxxxxxxxx
UTR01_0050_H11.b : tttgggtgaacctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0076_H12.b : nnnggctaggacttaaacagtttgtc
OVRT1_0020_H01.b : nntttccgttagctgtangag
SPL01_0035_C11.b : acggatctggtgxxxxxxxxxxxxxxxxxxxxxx
UTR01_0051_D10.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0060_D02.b : gcatctagxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0064_G06.b : nnnnaactaggacttaaacxxxxxxxxx
SPL01_0055_E07.b : nnnaacttggactatnacxxxxxxxxx
CLNT1_0031_B11.b : nnnccgtctgcgncggn
OVRM1_0165_G03.b : tcgtttgtcxx
SPLT1_0059_A11.b : nnnccg
SPL01_0011_F07.b : ttttatggtgxxxxxxxxxxxxxxxxxxxx
UTR01_0044_H04.b : tttttgggccxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0095_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0090_D09.b : nggcttggactataacxxxxxxxxxx
BKFL1_0089_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0055_A11.b : nnnnnggatagtgacttgacxxxxxxxxxx
BKFL1_0020_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0048_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0079_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0119_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0025_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0058_G10.b : ggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0060_A07.b : nnggcttggactatgacxxxx
BKFL1_0120_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0059_H06.b : gcataxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0076_E01.b : ttaaaat
SPL01_0004_G11.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0019_E09.b : gtxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0007_G08.b : nnncccggggttttngggcccccnntcccgttcttcgcctttttcgtgtacaxxxxxxx
OVRM1_0073_D07.b : cxxxxxxxxxx
OVRM1_0126_A07.b : nagttgt
OVRM1_0003_E03.b : xxxxxxxxx
OVRM1_0053_C07.b : cgttg
OVRM1_0025_F07.b : cxxxxxxxxxx
SPL01_0024_A09.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0061_C12.b : nnnggcttggactatnacxxxxxxxx
SPL01_0026_F08.b : catxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0028_C08.b : ttttgcgtggcctxxxxxxxxxxxxxxxxxxx
SPL01_0055_D11.b : nnnnggctaggactatnacxxxxxxxx
UTR01_0023_D08.b : gggtgacctattagxxxxxxxxxxxxxx
UTR01_0023_C06.b : gggtcacxxxxxxxxxxxxxxxxxxxx
SMG01_0015_H04.b : nggggtttttnnn
UTR01_0032_B11.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0140_B02.b : nnnnccgtttgctgtcg
SPL01_0046_H02.b : ntttggctagtgacttgacagtttgt
SPL01_0101_G06.b : nnnnggctagtgacttgacxxxxxxx
OVRT1_0122_G10.b : nttccgttcagcgtacgagt
SPL01_0053_F11.b : nnnnnggctagtgacttnacxxxxxxxx
UTR01_0074_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0092_D05.b : nnnnggctaggacttanacxxxxxxxx
ADR01_0047_F07.b : nncc
SPL01_0003_G09.b : cctttacgtgacctanntagacxxxxxxxxxx
UTR01_0063_G08.b : gtcattgggtgxxxxxxxxxxxxxxxxxxxx
UTR01_0068_H08.b : gcattttaxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0094_C01.b : nnnnnggattgtgacttgacxxxxxxxxx
OVR01_0089_A08.b : nnggctaggactataacxxxxxxxx
OVR01_0046_B03.b : gagcttagggtgxxxxxxxxxxxxxxxxxxxx
SPL01_0035_B03.b : aaagccttggggccnxxxxxxxxxxxxxxxxxx
SPL01_0100_A03.b : nnnncccgctaggactatnacxxxxxxxx
TCH01_0024_B04.b : nnnnggctaggacttgacxxxxxxxxx
SPL01_0084_A02.b : ttttggcatgtgacttnacxxxxxx
OVRM1_0095_E09.b : cagttgtc
OVRT1_0004_E08.b : nnnttcctctagctgtc
OVR01_0020_H08.b : taaagaaaacaatgttgxxx
OVRT1_0087_A10.b : nnnggttttnnnngnnnccgttcagctt
SKNB1_0027_A08.b :
SPL01_0065_G06.b : tttttggctagtactatnacxxx
CLNT1_0097_G03.b : ncctttttnngggacaacctcgcgna
PCT01_0013_D08.b :
OVRT1_0090_G01.b : ntttatccgtttgc
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b : nntttgcttgtgacttgacxxxxx
OVRM1_0213_C07.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
---------+---------+---------+---------+---------+---------+ 58
OVRM1_0121_E05.b : aatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaGGGAACACCA
SPL01_0061_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGGGAACACCA
UTR01_0009_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGGGAACACCA
UTR01_0008_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggggGGGAACACCA
SPLT1_0098_C11.b : taxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAACACCA
SMG01_0045_G12.b : gctaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAACACCA
SMG01_0031_H06.b : ggtaaagcagcggnaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAACACCA
SPLT1_0020_F08.b : ggtagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAACACCA
TCH01_0096_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaGGAACACCA
UTR01_0099_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGAACACCA
OVRM1_0044_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxnGAACACCA
OVRM1_0225_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
LVRM1_0022_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVRM1_0198_G10.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVRM1_0054_C08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0022_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SMG01_0053_G02.b : tgactaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0016_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0011_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVR01_0060_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVR01_0066_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0028_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVRT1_0141_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVRT1_0131_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0010_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0045_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0045_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0042_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVR01_0077_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0086_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVR01_0028_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0079_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0054_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0071_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0057_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVR01_0055_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVR01_0086_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0035_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
CLNT1_0005_D05.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0034_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtcgagtcggccttgtactggGAACACCA
BFLT1_0111_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVR01_0049_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0034_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0102_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0056_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0095_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0087_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0063_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0058_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggtgcttgttggcctactggGAACACCA
UTR01_0049_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
TCH01_0050_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVR01_0062_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPLT1_0009_A05.b : gagaagacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0004_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0066_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0068_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0086_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0088_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0094_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0009_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0043_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVRT1_0048_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVR01_0011_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
LNG01_0041_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxacGAACACCA
UTR01_0050_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0076_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVRT1_0020_H01.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0035_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0051_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0060_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
TCH01_0064_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0055_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
CLNT1_0031_B11.b : atgttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVRM1_0165_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggcAACACCA
SPLT1_0059_A11.b : ctggtacacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACACCA
SPL01_0011_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACACCA
UTR01_0044_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtactgGACACCA
BKFL1_0095_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACACCA
TCH01_0090_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtGACACCG
BKFL1_0089_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACACCA
SPL01_0055_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtAACACCA
BKFL1_0020_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACACCA
BKFL1_0048_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACACCA
MLTL1_0079_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACACCA
BKFL1_0119_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACACCA
BKFL1_0025_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACACCA
UTR01_0058_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggaAACACCA
TCH01_0060_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACACCA
BKFL1_0120_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACACCA
UTR01_0059_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACACCA
ADR01_0076_E01.b : tgactaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACACCA
SPL01_0004_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcatcgagtcggcctACACCA
SPL01_0019_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtACACCA
OVRM1_0007_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
OVRM1_0073_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
OVRM1_0126_A07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
OVRM1_0003_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
OVRM1_0053_C07.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
OVRM1_0025_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SPL01_0024_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SPL01_0061_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SPL01_0026_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SPL01_0028_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SPL01_0055_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
UTR01_0023_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
UTR01_0023_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SMG01_0015_H04.b : nnggtatagcagcggnaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
UTR01_0032_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
BFLT1_0140_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcggtCACCA
SPL01_0046_H02.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SPL01_0101_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
OVRT1_0122_G10.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgatCACCA
SPL01_0053_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
UTR01_0074_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
UTR01_0092_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
ADR01_0047_F07.b : aaagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SPL01_0003_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
UTR01_0063_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
UTR01_0068_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SPL01_0094_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
OVR01_0089_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
OVR01_0046_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SPL01_0035_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SPL01_0100_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
TCH01_0024_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SPL01_0084_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgACCA
OVRM1_0095_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgaacCCA
OVRT1_0004_E08.b : ngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCA
OVR01_0020_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCA
OVRT1_0087_A10.b : acgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCA
SKNB1_0027_A08.b : nnnnccgaaannnnnnnccttacgttgtgctcgggggggacCCA
SPL01_0065_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCA
CLNT1_0097_G03.b : cgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgtttCA
PCT01_0013_D08.b : nnngggcttannnnnnncctacgggtgcacgggcgacacc
OVRT1_0090_G01.b : gnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0027_G04.b : nnnngggttnnnnnnnncctcacgttgtgctcggnaaccc
SKNB1_0092_E12.b : nnnattttgcgttggctctggaac
PCT01_0007_C06.b : nnnccgtttnnnnnnncctacgggtgcacc
TES01_0054_E07.b : tttggcctgcggttgctctggaacc
SKNB1_0015_D11.b : ngggttttnnnatcctgcgttggcacacc
TES01_0003_A03.b : ttttcctgctgttgctctggacc
PST01_0059_D10.b : nnnnncctgcgttggctctgggac
PST01_0025_G09.b : nnncctgcggtggctctggga
SPL01_0101_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgacg
OVRM1_0213_C07.b : xcaccacccagagcggagaagctgagtccagagcaatcaggggatgaggacattggacga
OVR01_0045_G06.b : aagcxxxxxxxxxxxxxx
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
---------+---------+---------+---------+---------+---------+ 117
PST01_0025_G09.b : cccacccgagcggagaactgagtccGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0101_H02.b : tacggggacgtgccctctatatgaggttgggtaacGGACCCTGTGAAGCACCAGCCAGGA
OVRM1_0213_C07.b : aaatgttctctaataagccttcaatttcccaaatctGACCCTGTGAAGCACCAGCCAAGA
OVR01_0045_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0014_C08.b : naagtaatnnnnnncctgcgtgtgct
OVRM1_0055_B06.b : cgttgacxxxxxxxxxxxxx
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
---------+---------+---------+---------+---------+---------+ 177
OVRM1_0055_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAATGGTTCTGGGCTCTGTAAGG
SPL01_0035_A09.b : ggagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0072_E07.b : nnnggctaggactatnacxx
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
---------+---------+---------+---------+---------+---------+ 236
SPL01_0035_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCCCGTCCATTGTGGGACGTCCT
OVR01_0072_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
---------+---------+---------+---------+---------+---------+ 296
SPL01_0072_F11.b : ttttagcatgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0020_H08.b : gggggacxxxxxxxxxxxxxxxxxxxxxx
SPL01_0103_F06.b : nnnnggctagtgact
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
---------+---------+---------+---------+---------+---------+ 356
SPL01_0072_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAGAACACGGCATCATCACCAAC
UTR01_0020_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCACCAAC
SPL01_0103_F06.b : tgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0044_G05.b : ggggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
---------+---------+---------+---------+---------+---------+ 415
OVRM1_0044_H09.b : TGGGATGACCTGGAAAAG*ATCTGGCACCACcgctttctaaatgagcttcgtgttgcccc
UTR01_0044_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGAGCTTCGTGTTGCCCC
UTR01_0107_A10.b : ntttggcatg
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
---------+---------+---------+---------+---------+---------+ 475
OVRM1_0044_H09.b : tcaataccatccgaccccgatacacgacgaacacatagactctacggccactcgtgcgaa
OVRM1_0007_G08.b : AGACGAGCATCCGTACCTGCTCACCGTGGCAtccttgatctctaagtgtcttctggtata
UTR01_0107_A10.b : gactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
---------+---------+---------+---------+---------+---------+ 535
OVRM1_0044_H09.b : aaccactcgacattccgtctgaaatattccatcgtctaacccatggttagtggctagcgg
OVRM1_0007_G08.b : tgatgactcacattatggttagaaatttacaatgccccatacatgtatgtggcatttaat
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
---------+---------+---------+---------+---------+---------+ 595
OVRM1_0044_H09.b : cccgaataacgtcccttctatccggcccaactctccacttgcattaccccccacgaccta
OVRM1_0007_G08.b : gccgctctgatcctcttaccctctgcacgtgcgagtggtatagtcctacactttggagat
SPL01_0019_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
---------+---------+---------+---------+---------+---------+ 654
OVRM1_0044_H09.b : cccaatccgcgaaacaaatagtctagataaccctctcgaactcacctatcgctacagacc
OVRM1_0007_G08.b : ggtgtagcacacaatgaatctcatttactagggctctgtccttgacctctccattataca
SPL01_0073_A03.b : ttt
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
---------+---------+---------+---------+---------+---------+ 713
OVRM1_0044_H09.b : acaagtagttgctctggatgctccccacgcaaatccccccggtcccagcttgcccttaat
OVRM1_0007_G08.b : taagaacttgatgaatcgcgatcttcaccattatcttataatatctgcctgcatcgagta
SPL01_0073_A03.b : tggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
---------+---------+---------+---------+---------+---------+ 773
SPLT1_0098_C11.b : TACTCCTTCCTGACactgcggagcgtgagatggtccggaactcaagaaaagctgtgctat
OVRM1_0044_H09.b : acgtccgcccaccttcggtagatactgaccgttatgatagcggcagtgcattagcccagt
OVRM1_0225_C04.b : TACCCCTTCtgacccctgccgagcaggagattgtccgggcactctaggacaaccgtgctt
OVRM1_0007_G08.b : tccgatttagacagctcgcaatcgagagatgatctgacatatatgataacaacgactcta
SPLT1_0096_D06.b : nnnnttgcgagtagaggccgta
SPL01_0037_H09.b : aaggcttatggtggxxxx
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
---------+---------+---------+---------+---------+---------+ 829
SPLT1_0098_C11.b : gtaccctggacttttaaatgaaatggccctggcccctcttcctcctcctgaaaaaactac
OVRM1_0044_H09.b : cgactttgaagcgacactgcgagacggataccttatgccgacaaaaatcacagcacct
OVRM1_0225_C04.b : cgtacctccgcac
OVRM1_0165_G03.b : TACGT
OVRM1_0007_G08.b : tatcatgattttatttacaatgttattcgcgtctctattctcatttcaactctgctat
OVRM1_0126_A07.b : TACGTAGCC*TGGAACTTGG*AAATGAGAG*GGCacggccgcgtcctcctcctccctgga
SPL01_0101_H02.b : TATGACCGC*CTGGACTTTGAAAAatgaaatggcaaatgccgggatctcctccttccgga
OVRM1_0213_C07.b :
SPLT1_0096_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCG*CGTCC*TCCTCCTCCCT
SPL01_0037_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0034_G04.b : ttt
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
---------+---------+---------+---------+---------+---------+ 886
OVRM1_0121_E05.b :
SPL01_0061_F12.b : G*GAGAAGAGCTACGAGCTtgcctgacgggcaggtgaatcaccattcgggaacgaacggc
SPLT1_0098_C11.b : aaactgcctacgggcaggtattccctcgggaaaaccctttccctgccggaaaccgtttcc
SMG01_0045_G12.b : tggaaaaaaacctattaactgcctgacgggcaagtgatcaccatccgggaccgaacgctt
SMG01_0031_H06.b : T*GNAGAAAGCTATGANCTGCCTGACcggcagtgatcacatcgggaacgagcgcttcgct
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b : G*GAGA
OVRM1_0165_G03.b :
BKFL1_0095_A12.b : gaaagaactacgacttgctgacgggcaggtgatcacatccgggacgagcgcttcgctggc
BKFL1_0089_E09.b : N*A**AANAGCTACNAGCTGCCTGACGGGCAGtggtcccatcgggaacggcgccttcgct
BKFL1_0020_G02.b : G*GAGA*GAGCTACGAGCTGCCTGACGGGCAGtgatcacatcgggacgagcgcttcgctg
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b : a
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b : gaa
SPL01_0024_A09.b :
SPL01_0061_C12.b : tggaaaaaatcttacaacctgccttgaacgggcaggtgatcccccatcgtgaaacgaacg
OVRM1_0095_E09.b : ga
SPL01_0101_H02.b : aaaaaagctaacagctgcctgaagggtggctgatatctttcttaacaagagtttcttttt
OVRM1_0213_C07.b :
SPL01_0034_G04.b : ttagcatggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
---------+---------+---------+---------+---------+---------+ 943
OVRM1_0121_E05.b :
SPL01_0061_F12.b : tttccgctgtccccggaaaccctgtttcccaccccctcctttcatccggggaagggaatc
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b : gcctctttatcggatggattcggtggctctcttaacccctaaaaccttctgaatgcacct
SMG01_0045_G12.b : ccgctgcccggaaaacctgtttccaccctcctttctccgggatggaatccggctggctcc
SMG01_0031_H06.b : gccggaaaccctggtcaaccctccttatcgggaaggatctgctggatcctggaaccccct
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b : ctgcccggaaaacctggtccaccctccctcatcgggaggaagtctgctggcttcatgaaa
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b : tcccctgccccggaaacccttgttccagcccttcctttattcgggatgggaatttgcctg
OVR01_0066_F05.b : cctggcccgagaccctggttccacccttcctcctctggatggaaaccgctggcctccttg
UTR01_0028_D07.b :
OVRT1_0141_G05.b : ctgcccngaaacctgttcagccctctttctcggatggatctgctggctcatgaaccacta
OVRT1_0131_A11.b : gccttgcccgaaaccctgttcagccctcctttcttgggatggaatccgctggcatcctga
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b : CCGCTGC
OVR01_0077_C07.b : CCCTGGCCGGAAAA*CCCTGTTCagcccctctttcattgggatggaacctggctgggctc
UTR01_0086_G07.b : CCGCTGCCC*GAGA*CCCTGTTCCAGCC*CTCttcttcggatgaagtctgctggctccct
OVR01_0028_E11.b : CCGCTGCCCGGAGA*CCCTGTTTCAagccctccttcatccgggatgaagtctgctggcat
SPL01_0079_F03.b : CCGCTGCCCGGAGA**CCTGGTCCAGCC*CTCCTcatcgggatgaatctgctggctccat
SPL01_0054_E02.b : CCGCTGCCCGGGAG*ACCTGGTTCAGCC*CTCCTTtcatcgggatgggatcctggctggc
OVRM1_0165_G03.b :
SPLT1_0059_A11.b : gctggccgaagacctgttccagcctccttcatccggatggatctgctggcatcatgaaac
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b : cggaaccctgttcaggcctcttcttcggatggaatcgctggctcctggaaccccctaaaa
TCH01_0090_D09.b : CCGCTGCCTGAAGA*CCGTGTTCatccactcttcttggtgaggattctgatggctccact
BKFL1_0089_E09.b : gcccgaaacctgtttcaaccttcttcctcgggaggagccgctggcttcctggaaccccta
BKFL1_0020_G02.b : cccgagacctngtcagcctcctcatcggnatgagtcgctgcatcatgaaccactacacag
BKFL1_0048_C08.b : ctgcccggagacctgttccgncctcntcatcgggatggagtctgctgcatcatgaaacac
MLTL1_0079_E05.b : ctgcccggagaccctgtccagctttcttcatcggatgatctgctgggatcatgaaaccac
BKFL1_0119_B11.b : gctgcccggaaacctgttccagccctcttcatcgggatgaatcggctgggctcatgaaac
BKFL1_0025_B05.b : CCGCTGCCGgagaccttgtncagcctcnntcatcggatgagtctgctggcatcatgagaa
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b : gctttccccttgcccggaaaacccttgttcccagcccctcctttcattcggggatggaag
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b : CCCCTGCCCcgaaaaccctgttcccgcccctccttcatccgggatggaatcctgcttggc
UTR01_0023_D08.b : CCGCTGCCCG
SMG01_0015_H04.b : TCGCTGCCCGGA*A*ACCTGTTTCAGCCttcctcatcgggatggaacctgcctgcatcct
BFLT1_0140_B02.b : CCGCTGCCCCGAGA*CCCTGTT*CAGCC*TTCCTTatcgggatggatcggctggctccat
SPL01_0084_A02.b : ccctggcccggaaaacctgtttccacccctcctttatcgggaatgggattttgttggcct
OVRM1_0095_E09.b :
SPL01_0101_H02.b : ctggagaaccaggtccgacccctccttcttgggaaagaattatgggggtttccctgaaac
OVRM1_0213_C07.b :
SKNB1_0049_B05.b : nn
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
---------+---------+---------+---------+---------+---------+ 999
OVRM1_0121_E05.b :
SPL01_0061_F12.b : ttggctgggcattccattgaaaaacccccttaacaaacagcctttcattgaaagttgccg
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b : ttgattgggagagcctcttttaaaactcctctgggggaccccgttccccgcttgcaaccc
SMG01_0045_G12.b : atgaaaacccctaaaacgcctcttggaatgggaattttacctccgggaggacccctttgc
SMG01_0031_H06.b : acaaagcttcttaatgcgacttgtatccggaaagacccttttctaacacgcttcttgggg
SPLT1_0020_F08.b : ctgaaaccccttacacagcctcatggaatgggacttgacatcaggaaggacctctatgta
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b : ccccctacaacacctcctgaagtggcaattttactctcggaaggaccctttgctaaaacg
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b : gtttccctggaaacccccttatcacagcgattctttaaagggcgaacttttgaaattccg
OVR01_0066_F05.b : aaaccccctacaacagcctcctggagggcgacttggccttccgaaaggaccctcatgcta
UTR01_0028_D07.b :
OVRT1_0141_G05.b : cacagcttctgagtgcacattactccggaggactcttgccaacacttctctctggggccc
OVRT1_0131_A11.b : aaccccctacacagcatcatgaattgccaccttgacctccgggaggacctctttcctaca
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b : ccttaaaaccccctcccaaagcatctctgaaggggcacctttgcctccgggaagggactc
UTR01_0086_G07.b : gaagaccacctacaacagcatcttgaaatgccacttgtgcctcggaagggacttcttgct
OVR01_0028_E11.b : ccatgaagaccaccttacacagcatcctgaattgcaacttttgacttcaggaggacctct
SPL01_0079_F03.b : gagacccctacaacgcatcttaagtgcgacttgacttccggaaggaccttctttctaaca
SPL01_0054_E02.b : atccctgaaaaccacctaccacaagcctccgggaaagggcacctttgcattcccggaagg
SPL01_0071_A08.b : cctttgaaaccccctacacagcctcctggaatggccactttgacctccggaaggacctct
UTR01_0057_B10.b : catggaaaccccctaccccgccttcttaaagtggcgactttgaaatccgggaaggaccct
OVR01_0055_B05.b : tccttagaccccccttcaacaagcatcttgtaagtgcgaaatttgcattccggaagggac
OVR01_0086_B07.b : tccctggagaaccccttacaaacaggcattatgaagtggcgacatttgactttccggaaa
UTR01_0035_H11.b :
CLNT1_0005_D05.b : CCtgaaaacacctacaacagcttcttgaatgggactttgactccggaaagaaccctttgc
UTR01_0034_H04.b :
BFLT1_0111_D03.b : Catgagaacacctacaacggcttcctgaagtgcgacttgacctccgggaggaactctttg
OVR01_0049_E08.b : CCTTG*AAACCACtacaacagcatctggaaatggcactttgacttcgggaaggacttcta
UTR01_0102_D01.b : CCATG*AAACCACCTACAACgcctcttgaagtgccaccttacatcagggaaggacctcta
SPL01_0056_B11.b : CCATG*AGAACACCTTCAACAGCctcctggaatgccgacattgacttcaggaaagaccct
SPL01_0095_E05.b : CCATG*AGACCACCTTCAACAGCcttcctgaagtgccactttgacattcaggaaggacct
SPL01_0087_E03.b : CCATG*AAAACACCCTCAACAGC*ATCATGAAatggcgaacttgacctcagggaagacct
UTR01_0063_E03.b : CCATG*AAACCACCCACAACACCATCcttgaatggcaactttgacctccaggaaggaccc
UTR01_0058_E03.b : CCATG*AAACCccttacacagcctcatgaaatgcgacattgacctcagggagggactcct
UTR01_0049_B05.b : CCATG*AAACCATCTACAACAGC*ATCATGAAGTGgcaactttgacatccgggaaggacc
OVRM1_0165_G03.b :
SPLT1_0059_A11.b : acctacaacacctcctgaatgcgacttgacttcggaaggccttttgctaacacttcctct
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b : agctttgaatggggacctggactccggaggactttttgctaaacgtcctctgggggccca
TCH01_0090_D09.b : gaacaccttatacagcctcgtgaagtgcgacattccttcgggaatgaactctatgcttat
BKFL1_0089_E09.b : aacgcctctgtaggggatttgattcgggaggcccttttttaaactcccttccggggcccc
SPL01_0055_A11.b : Catgaaaccccctacaacagcttcctgaagtgcgacttttacttcggaaaggacctccta
BKFL1_0020_G02.b : ctcttgaatggacttgactcaggggacctctgctacacgtctcctggggccccctgtccc
BKFL1_0048_C08.b : ctacacagctctgaantgcacatgactcnggaggactcttgctacacgtcctccggggga
MLTL1_0079_E05.b : ttacacgcctcctaagtgcgatttgactccggaagaccccttgctaccacgtccctctgg
BKFL1_0119_B11.b : ccctacacagcatcatgaatggcgattggattcaggaagaccttttgctacaacgtccct
BKFL1_0025_B05.b : cactacacagcatcatgaatgcgacttgacctcaggaggacctcttgctaacacgtcctt
BKFL1_0120_F08.b : Catgagacacctacacagcctcatgaaatgcgacttgacctcgggaggacttcttggcta
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b : ttctgcttggccaatccaattgaaaaaccacccttacaaaaggcttatctttgaaattgg
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b : atcccttgaaaaccacccttccaaagccttcttggaattgcgaacctttgaactcccgga
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b : tgaaaccccctacaaagcttcctggaatgcgacatggacttcaggaaggacccccttgct
UTR01_0032_B11.b :
BFLT1_0140_B02.b : agacccctacaacgcctcctgagtggaacttgactcgggaggaccttttgcaacaactcc
SPL01_0046_H02.b : cctgaaaccccctaaacagcatcatgaaatgccacattgacattcggaaggaccctcttt
SPL01_0101_G06.b : catgagaccacctacacagcttcatgaatgcgacattgacctcggaagggactctatgct
OVRT1_0122_G10.b : CCATG*AAACCCCCTACAACAcctccatgaatgcgaccttgacattcggaaggacctctt
SPL01_0084_A02.b : cccttgaaaacaccttacacaacctttttgaaatgtcggatttttccttcggggagggaa
OVRM1_0095_E09.b :
SPL01_0065_G06.b : CCATG*AAACCACCTAACACAGC*TTCATGTAGTGCcaactttgaatcagggaaggacct
SPL01_0101_H02.b : aacttacaaacctttcttaaatgggaacatttaaatcaggaagggactcctatcttgaaa
OVRM1_0213_C07.b :
OVRM1_0055_B06.b :
SKNB1_0049_B05.b : nnttttnnnnnnnccaacgttggctatggagAGTGCGA*CATTGACATCAGGAAG*GACC
SKNB1_0066_A12.b : nnaaacnnnnnnnaggata
ILNT1_0023_A11.b :
---------+---------+---------+---------+---------+---------+ 1057
SPL01_0090_D03.b : tgctaccacgtcctcttggggggacaacatgtaccccgcatggcaacccatgcaaaagg
OVRM1_0121_E05.b :
SPL01_0061_F12.b : aacttttgacccttccagggaaaggggaccttccttttgccttaaaaaaagcgttccctt
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b : gtcaaaaaattaacccctgcccccccctgaaataatatttgtccccagaccaaaaccccg
SMG01_0045_G12.b : taaaaagtccctcctgggggcccacctgttcccccggtttgccaaccctggcaaaaagaa
SMG01_0031_H06.b : ccccccctgtacccggatttcaacccatgcaaaagaaatcacccctggcccccccccgaa
SPLT1_0020_F08.b : acacctccttcttggggccccccctgttacccggctttgccgacccaggcaaaggaatta
TCH01_0096_B07.b : TCTATGCTAACAACGTC*CTCTCT*GGGGGCACaacatgtacccggcattgccgacgcat
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b : ccctcttgggggcaccacctgttccccggctttcccaacccttcaaaaggattccacccc
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b : gaagggaacccttttgtgttaaaaacgttcctctttgtggggggcccccccccttgttac
OVR01_0066_F05.b : aaaaagcccttccggggggccccccctggtccccccgccttttctaacccctggcaaaag
UTR01_0028_D07.b :
OVRT1_0141_G05.b : cctttccccggtttccaccctcaaaagaatcacccctgccccccccgaaataaattttcc
OVRT1_0131_A11.b : ccttcctttctggggccccacccttttaccccggcttgcccaacccctggaaaaagaaat
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b : ttttggttacaacgttccccttttggggggcaccacctggtacccccgggatttcccaac
UTR01_0086_G07.b : aacaacgtccttcctgggggaaccccctgtaaccccgcctttgcccacacccatgcgaaa
OVR01_0028_E11.b : attctaaccacctccctctcctgggggcaccaccccttgaacccccggcatttcccaacc
SPL01_0079_F03.b : actcctctctggggcccccccatgttaccccggcattgccgaccgcttgcaaaaggagat
SPL01_0054_E02.b : gacttcattgcctaaaaacgttcctcttctggggggccccccccatggttaccccggcct
SPL01_0071_A08.b :
UTR01_0057_B10.b : ttattgctaataaaccttcctctctgggggggcaaccccctgtacccccggcttttgcca
OVR01_0055_B05.b : ctctatgtttataaaccgtccctctcttggggggcacccccaagttacccccggcttttt
OVR01_0086_B07.b : ggacctctttggctaaaaacggtcctttctgggggggtcccacttggtaaccccgggatt
UTR01_0035_H11.b :
CLNT1_0005_D05.b : taacaagtcctctctgggggcccaacctgtacccggctttgccaacccattcaaaaggaa
UTR01_0034_H04.b :
BFLT1_0111_D03.b : ctacaacgtcctcctgggggcaccacatggtcccccggcttcccaaacgctgcaaaagga
OVR01_0049_E08.b : tgcttacacgtcctttctgggggcaccacctgtaccccggcattgccgaacgcttgcaaa
UTR01_0034_D03.b :
UTR01_0102_D01.b : tgctaacaacgtcctctcggggggcaccccctggtaccccggctttgccaaccccttgca
SPL01_0056_B11.b : ccatgctaaaaaccgccctctcctggggggccccacctggtaccccgggcatttccgaac
SPL01_0095_E05.b : ccttgtctaacaaccttcttctctggggggccccccccctgtaaccccggcatttgccaa
SPL01_0087_E03.b : ctttgctaacacgtcctcctctgggggccccacctgttaccccggcattggcgacccctt
UTR01_0063_E03.b : tctttgctaaacaacgtcctctcccgggggggcccccccatggtacccccgggctttgcc
UTR01_0058_E03.b : ttgctaacaacctcctcctctggggggcccccccatgtacccccggctttgccccaccgc
UTR01_0049_B05.b : tcctattgctacaaccgtccttcttctgggggcccccccccttggtacccccccggcatt
TCH01_0050_B07.b : tttgctacaacgtcctctctgggggacccccatgttccccgggattgccgaacgcctgcc
OVR01_0062_C08.b : tatgcttacacgtcctctctggggcaaccacctgtaccccggctttgcccacgcctgcca
SPLT1_0009_A05.b : TCTTTGCTAcacctccttctgggggcaccacatgtacccggccttgcgaaccccatccaa
SPL01_0004_C05.b : ttctatgctaacaaccgtcctctctggggggcacccaccatgtacccccgggcatttgcc
SPL01_0066_C01.b : tatgctacaacgtcctctctgggggcacaccttgtaccccgcatttgccaccgc
SPL01_0068_H12.b : TCTATGCctact
UTR01_0086_E03.b : TCTATGCTAACAACttctctttgggggcaccacatgtaccccggcatgcccacgcctgca
UTR01_0088_F05.b : TCTTTGCTAACCACGTC*Cctctctgggggcaccccatgtaccccggcattgccaaccgc
SPL01_0009_C07.b : TCTATGCTAACCACGTC*CTCTCTGGGGGgcacacccttgtaccccggcatttgccaacc
UTR01_0043_B08.b : TCTATGCTAACAACGTC*CTCTCTGGGGGCACCcaccttgtacccccggcattgcccgac
OVR01_0011_A12.b : TCTATGCTAAacaccgtcctctctggggggcaccaccatgtacccccgggcatggccgac
LNG01_0041_A11.b : TCTATGCTAACAACGTC*TTCTCT*GGGGGgccccaccatggtacccccggcctttgcca
UTR01_0050_H11.b : TTTATGCaacaacgttcctctcggggggccccaccttgtaccccgggcatgcccaacccc
OVRM1_0165_G03.b :
SPLT1_0059_A11.b : tgggggcccacctgtaccccgcatgccaaccctgcaaaagaattcacccctgccccgccc
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b : cccgtccccggctttcaaccctggaaaagaaaccaccccggccccccccccggaaataaa
TCH01_0090_D09.b : aatgtccttcctgggggacccactttgtacccggaaattgccaacccaatgcgaaggaaa
BKFL1_0089_E09.b : cctttccccggctttccaccctttaaaggaattccccccggcccccccccgaaaaaattt
SPL01_0055_A11.b : tgcctacacgtcctcccctggggccaccaccctgttacccgggcttg
BKFL1_0020_G02.b : cgcttgccacctggcaaggatacgcctgcccacaccggaaataaatttgcccccgagcaa
BKFL1_0048_C08.b : ccactgtacccgctttcaacccagcaaagaatcaaccctgccccaacctaaaaaaaatat
MLTL1_0079_E05.b : ggggccccatgtacccggcattgccacccctgccaaagaatcaaacctgggcccccaccg
BKFL1_0119_B11.b : ttgggggcccacatgtacccggcatttccaccctggaaagggaatcaaccctggcccccc
BKFL1_0025_B05.b : ccgggggcccccctgtacccggcttgccaccctgcaaaagaatccaccctgccccaaccc
UTR01_0058_G10.b : ttctatgctaacaaacctccttctctggggggcccacccctgttacccccggcttttccc
TCH01_0060_A07.b : TCTATGCTA*CAACGTC*CTCTCTGGGGGCACCACatgtaccccggcatgcccaccgctg
BKFL1_0120_F08.b : cacgtccttctggggccccacatgtaccccgcattgccaccctgtgcaaaggaatccccc
SPL01_0004_G11.b : tctattgctaacaacgtccctctctggggn
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b : gccaactttttaacttcccgggaaagggaacttctttttgtcctataaaaaaggtctctc
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b : agggaccctccttggctaaaaacctcccccccccgggggggccacaccccatgtttaccc
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b : aaaacgtcctctctggggcaccccatgtaccccgctttccaacccttgcaaaagaaatca
UTR01_0032_B11.b :
BFLT1_0140_B02.b : ttcgggggcccccatttccccggcttgcgacccctgagaagaaacccccccggcccccca
SPL01_0046_H02.b : gctaaaaactccctctttgggggcaccaccatgttccccggcattttccaaccgcttgtc
SPL01_0101_G06.b : accacgtcctctctgggggcaccacatgttaccccgcattccaacccctgcaaaggaaat
OVRT1_0122_G10.b : gcctaacacgttctctcgtggggcccaccttttcccggcattgccaactcttgcaaagaa
SPL01_0053_F11.b : tctatgcctaacacgtcttctccgggggccccaccagtgtaccccggcattgccaaaccc
UTR01_0074_G07.b : ccttgccaaacacctccctcctctgggggcccccccctttacccccgggctttgcccaac
UTR01_0092_D05.b : TCTATGCTAACAcctcttctctggggcaccaccatgtaccccggcatttccaaccgctgc
ADR01_0047_F07.b : TCTATGCTAAC*ACGTC*CTCTCTGGGGGCACCACatgtacccggcatttgcgacgcatg
SPL01_0003_G09.b : TCTATGCTAACAACGTtcttctcctgggggcaccaccatgtacccccggcattgcccaac
UTR01_0063_G08.b : TCTATTCTAAACACGTC*CTCTCTGGGGGgccccaccctgttcccccgggcttgcccaac
UTR01_0068_H08.b : TCCTTTCTAACCACCTC*CTCTCTGGGGGCACCACCctggtcccccggcatttccccaac
SPL01_0084_A02.b : cttttttgctaacaaagctccttttttggggggcaccccccgtttccccccgggtttttg
OVRM1_0095_E09.b :
OVRT1_0004_E08.b : TCTATGCTAACAACtcctctcggggggcaccccatgtacctcggcttgccnaacgcatgc
OVR01_0020_H08.b : TCTATGCTAACAACGTtcctctcctgggggcaccacccatgtacccccgggctttgcccg
SPL01_0065_G06.b : tattctaacaacttcctctcttggggcaccaccatgttaccccgcctttgcccaacccat
PCT01_0013_D08.b : TCTATGCTAAC*ACGTC*CTCTCTGGGGGgcacaccatgtacccggctttgccaacgctt
SPL01_0101_H02.b : acatccccctcggggggcccacccatgtgaacccggaaatgcccaactccttaaaaaaat
OVRM1_0213_C07.b :
OVRM1_0055_B06.b :
ILNT1_0023_A11.b :
---------+---------+---------+---------+---------+---------+ 1117
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b : ccttccgggggggg
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b : ggatgtggccacgggccttttccctncnagttgttccaaaaggataaaaacgggcccttt
SMG01_0045_G12.b : ttacaccccgggcccccccccccgggaaaaaaaaaattgtgccccccgaagcaaaaaacc
SMG01_0031_H06.b : aataaaaatttgccccccgagcaaaccccgcggagttggggcccccggggccttggcccc
SPLT1_0020_F08.b : caccccgggaccccccccgggaatataaatttttccctcccaaagcaaaaacccgtcgaa
TCH01_0096_B07.b : gcaaaggaaatcacagcctgccaccaccccttgagatcagatcattgccctctgacgcaa
UTR01_0099_A07.b : CATGCAaaaagaaatcaaaccctggccccagccacatgaagataagatcattgcccctct
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b : ggcccccacccctgaaaataaatatttgcccccccgaggcaaaaaccccgcggaattggg
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b : tcccggccattttcccaacccccttttcaaaaagagaaaataaaagcccctgtgggcccc
OVR01_0066_F05.b : aaaatccaacctccggggccccgccccccgtaaaaataaaaatctttccccccccggaac
UTR01_0028_D07.b :
OVRT1_0141_G05.b : cccggggaaaaacccctggagtgggcccccggcctcttccctccnaagtgggttccaagg
OVRT1_0131_A11.b : cccgccctgcccccccccccagtaaaaaaaatatttgccccccagaagcaaaaacccccc
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b : ccctggcaaaaaggaaataccaacccttggcccccccgcccctgtaaaatctagaatctt
UTR01_0086_G07.b : ggaaaatcaagccctggcccccagcaccttgaaaaactagaatcttttccccccctaaac
OVR01_0028_E11.b : gcaatgcaaaaagggaaatcccaaccccttggcacccccaccacccattaaaaaattaaa
SPL01_0079_F03.b : taagcccttggccccggcccctgaaaattaaaattttgccccctccgaacccaaaaa
SPL01_0054_E02.b : tttgcccaaccgcctgtcaaaaagggaaatt
SPL01_0071_A08.b :
UTR01_0057_B10.b : aaccccatgtcacaaggaaaattttctgcctcttgggccccccgtccccgaaaaaaatca
OVR01_0055_B05.b : ctaaacccctttgccaaaagagaaataccaagccccctgcccc
OVR01_0086_B07.b : ggccaaccggttttctcaagggaattttcagcccctgtggccccccgccccctgtgaaga
UTR01_0035_H11.b :
CLNT1_0005_D05.b : atccaacccttggcccccgccccttgaaattaagattatggccctcctgacccgaatccc
UTR01_0034_H04.b :
BFLT1_0111_D03.b : aatcaacccctggcccccgcccctgaaaattaaatttttgcccccccggaccaaataccc
OVR01_0049_E08.b : aggaaataaagccttggcccccgcacctt
UTR01_0034_D03.b :
UTR01_0102_D01.b : aaaggaaattccagccctgaccccccgccccttgaaatcagaatcatgcccctcctgaag
SPL01_0056_B11.b : cgcctgc
SPL01_0095_E05.b : cccccatgtccaaagggaaattcccgccc
SPL01_0087_E03.b : ggaaaagaaattcaagcctgggaccccagcccctgaaaattcaaaatcttgcccctccct
UTR01_0063_E03.b : caacccccttggccaaaaggaaaatcccaaccccttggcacccccacccacccattaaaa
UTR01_0058_E03.b : atgcaaaaaaggaaattcccaacccctgggccccccacccccccagtaaaaattaaaaat
UTR01_0049_B05.b : gccccaacccccctttgcaaaaagggaaaatcaaccagccccctggccccccccaacccc
TCH01_0050_B07.b : aaaagagatccaacccctggccccccgccccatgagaatcagatcattgcccctcctgaa
OVR01_0062_C08.b : aaggaaatcaagccctggcccccagaccctgaaaattcaaatctttgcccctccggaaca
SPLT1_0009_A05.b : aggaaatcccccctggcccccgccacctgagaataaaattttgccctccggaacccataa
SPL01_0004_C05.b : caacccccatgccaaaaaaggaaatttcccaccccctgggcac
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b : aaagaaattaaaccccggccccagcaccctgaaatcagatcatggccctcctaacgcaaa
UTR01_0088_F05.b : ctgtcaaaaggaaattccagccctggcccccgcccctggaaaatcaagattattgcccct
SPL01_0094_H02.b :
SPL01_0009_C07.b : gcctgccaaaagaaaatacagccccttggcacccaacaccctttaaaaaataaaaatttt
UTR01_0043_B08.b : cgccatgcaaaaaggaaaatcacaggcccctggccaccccaccacccttgaaaaaattaa
OVRT1_0048_H02.b : catgcaaagggaaatccacgccctgggacccagcaccatgaaaatccagaatcttggccc
OVR01_0011_A12.b : cggctg
LNG01_0041_A11.b : accccatgcaaaaaggaaatcacccccccctggccccccaccacccattgaaaaaattaa
UTR01_0050_H11.b : atgcaaaaggaaattcacaccccttggcccccaccaccattaag
SPL01_0076_H12.b :
OVRT1_0020_H01.b : attgcaaaaggaaatccaacccctggcccccgccccttgaaaattaaaatcttgcccctc
SPL01_0035_C11.b : ccccatgcaaaaaggaaattcccagccccttgccaccccacccaccctttaaaaaattaa
UTR01_0051_D10.b : cccctgcaaaaggaaatcacagcccctggccccccacccccttgaaaaataaaaatcttt
UTR01_0060_D02.b : ccgcatggcaaaagggagattccaccccctgggaccccaaccacccattaaaaattaaaa
TCH01_0064_G06.b : tgcaaaagaaatcacgccctggcacccgcacctgaaaatcagatcatgccccttctggac
SPL01_0055_E07.b : Cttgcgaaagaaattccagccctgggccccagcccctgaagatcaagata
OVRM1_0165_G03.b :
SPLT1_0059_A11.b : cctgaattaaaatatttccccccgagccaaaaccccccgggagggggcccaccgggctct
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b : atttcccccccgaagaaaaacccccggggggggggcccccgggccttgtgccctccccaa
TCH01_0090_D09.b : tcacagccctgtccccctgccccttgagaatcaaattttgccccctccgacccaaatcct
BKFL1_0089_E09.b : ttcccctgaaaaaaaaccccggggagggggctccgggcctctttccccccnaaggggtca
SPL01_0055_A11.b :
BKFL1_0020_G02.b : acccgcggatggggcccccggccccgcctccccaagggaaaaaaagaaaaaacggccctt
BKFL1_0048_C08.b : tccccctgagcaaaaccgcggatgggggcccccgccccctcccttcccaagggaaaaaag
MLTL1_0079_E05.b : aaaattaaaaattgccccctagggcaaaaaccccggaggggggcccccggcctcctcccc
BKFL1_0119_B11.b : cccggaaaaaaatttggccccccgaggaaaaacccctgggaggggggccacgggcccttg
BKFL1_0025_B05.b : tgaaataaaatatggcccccgacccaaacccccggggggggcctccggcccctgcccctc
UTR01_0058_G10.b : aaacccaatggcaaaagggaaattccaaccccctgggcccccccccccccatgaaaaatt
TCH01_0060_A07.b : ccaaaggaatcacagccctgccaccagcccatgaagatcagaatctttgccctcctggac
BKFL1_0120_F08.b : cggcccgcccctgaataaaaatttggcctcccgagcaaaacccgcggatggggcccccgg
UTR01_0059_H06.b : gcattgcaaaggaaaatcacagcccctgcccacccacccccattaaaaattaaaattatt
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b : tcctcttggggggggaccacctcccatttgtttactcccctgtgcttttttttcctaaca
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b : cgcgcttttgcccaacccccctgtcccaaaagggagattcc
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b : acccttggcccccccctggaaatcaaatttttcccccccgacccaaaaacccccgggatg
UTR01_0032_B11.b :
BFLT1_0140_B02.b : ctgaaaataattttgcccccggaccaatacccgcggatggggcccaccggctcttgccct
SPL01_0046_H02.b : aaaggaaattaaacccctggcaccc
SPL01_0101_G06.b : tacgccctggcacccgccccttgaaatcagatcttgccccccgaacccaatccccctcgg
OVRT1_0122_G10.b : atcaccccttgccccaccccctgaataaaaaatattgccccccggaaccaaatctccccg
SPL01_0053_F11.b : ttgccaaaagggaaatccaacccttgccccc
UTR01_0074_G07.b : ccccttgccaaaaaggaaaataacagccccttggcccccccaccccccttaaaaaaataa
UTR01_0092_D05.b : caaaggaaatcacaccctggaacccgcaccctgaaaatcagatcttgtcccctccgagcc
ADR01_0047_F07.b : caaagagatcacgccctggccccaccccatgaaatcagatcattgccctctgacccaata
SPL01_0003_G09.b : cggcattgcaaaaggaaaa
UTR01_0063_G08.b : gccatgccaaaaggaaatccccacccctggccccccaccccccttgaaaaataaaaaatc
UTR01_0068_H08.b : cccattccaaaaggaaattcacgcccccgggcccccaccccccatgaaaaattaaaaa
SPL01_0094_C01.b : gcatgccaaaagaaatta
OVR01_0089_A08.b : cctgccaaaaggaaaatccagcccttggcacccaccaccctgaagaatcaggatttttgg
OVR01_0046_B03.b : gcatgcaaaaaggaaaatccaagccctggccccccacaacccataaaaataaaaattatt
SPL01_0035_B03.b : cgcatgccaaaaagaaacaccaccccttgccccccccccaacctttaaaaaataaaaatt
SPL01_0100_A03.b : cctgtcaaaaagaaatccaagcccctggcacccggccccctgaaaaattaaaatctttgc
SPL01_0084_A02.b : cccaaccccttgtaaaaaagaaatttataatctctggggaccccctccccatgtaaataa
OVRM1_0095_E09.b :
OVRT1_0004_E08.b : aaaggaaatccccccctggccccagcccctgaatacagaatctttgccctccgaaccaaa
OVR01_0020_H08.b : accgcatgccagaagggaaaatcccagcccctgggcccccaacaaccattgaaaaatcaa
OVRT1_0087_A10.b : atgcagaaggaaaatcaagccctgcccccacaccttgaaaatcaaatcattcccctccgg
SPL01_0065_G06.b : ggcaaagggaatccaagccctggcaact
CLNT1_0097_G03.b : tgcaaaagaaatccagccctggcaccaacaacctgaaaatcagatattgcccttccgacc
PCT01_0013_D08.b : gcaaaagaaatcaaaccctggcacccagcccatgaaaatcaaatcattgcccttcctaac
OVRT1_0090_G01.b : tgcnaaagaaataaacccttggcccccaccccagaagatcaaattcttcgcctcctgaag
SKNB1_0092_E12.b : CATGCAGAAAGAGATCACAccctgcacccagcaccatgagatcagatcttgcccctctga
PCT01_0007_C06.b : CATGCAAAAGAAAATCACAGCCCTGcacccagcacatgaagataagatcatgcccttctg
TES01_0054_E07.b : CATGCAAAAGGAGATCACAGCCTTGGCACCagcaccatgagatcagatcattgcccctct
SKNB1_0015_D11.b : CATGCAAAAAGAGATCACAGCCCTGGCACCCAccacatgaagatcaggatcattgcccc
PST01_0059_D10.b : atgcagaaggagtcacagccctggcaccagcacatgaagatcagatcattgccctctgaa
SPL01_0101_H02.b : gggttctaaacccttgcttcccgagacctggaaaataaagaatatattgccccatcttga
OVRM1_0213_C07.b :
OVR01_0045_G06.b : CATGCAAAAGGAAATCCCAGCCCTTGCACCCAGCAacctgaaaaatcaaaatctttgccc
PCT01_0014_C08.b : CATGCAAAAGGAAATCACAGCCtggcacccacaccatggaaaacaagatctttcccctct
OVRM1_0055_B06.b :
ILNT1_0023_A11.b :
---------+---------+---------+---------+---------+---------+ 1177
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b : tccccaattttaaatatccctcggttttttcacccggagattttgggaaagcttattttt
SMG01_0045_G12.b : ccccgggggggggggcctcctggggcctctttcccccttttaaaaagggggtatccaaaa
SMG01_0031_H06.b : ttccnaaagggtttcaccaaggaataaaaaacgggcgcctttcccccaaagtttaaaaat
SPLT1_0020_F08.b : tggggcccccccggcctcttgccctttcccaattggtttacaaaaggattaaaaaccggc
TCH01_0096_B07.b : tactccgtctgattgggggctcatcgggcctcttgccccttccgcaaattggattncaaa
UTR01_0099_A07.b : gaacgcaaaaatccgcccggattggtgcctcct
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b : ggcccccggggcctttttccctttccgaaatggggttctccaaaggggtataaaaaccgg
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b : tcccccccctttgaaaaaccaaagatataattgtccccccctctggaggcccaaaatatc
OVR01_0066_F05.b : caaaaactccccccgggatgggggctccctccgggccctctgttcccctttccaccaaag
UTR01_0028_D07.b :
OVRT1_0141_G05.b : attaaaaacgggcttttccccaaagtaaaaaaaccccgctgtttcaccccggagttggag
OVRT1_0131_A11.b : ggggtgggggccccctcggccctttgtcccttttcgaaaggtgttacaaaaaaggataaa
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b : gtgcctccccggagcgccaaatcccccgctccggagtggggggctccccctcggcc
UTR01_0086_G07.b : ccaaaaacccccccctggatgtgggcccccttcctgggccccctgttccccctttccaca
OVR01_0028_E11.b : aaatctttttccccccttcccgaaaccgccaaaaattccccccccccttgggggaatttg
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b : agaatctattgccccactccttagaacgcaaaaccatcctcccccgtgggtattgggggg
OVR01_0055_B05.b :
OVR01_0086_B07.b : ttaagaatttttggcccccttcttaggcacaaaatcctcccttccgatttggggtgggcc
UTR01_0035_H11.b :
CLNT1_0005_D05.b : cgccgggatggtggctccttctggcctcttgtcccctttcaaaaatgtggttcccaaaag
UTR01_0034_H04.b :
BFLT1_0111_D03.b : cgcggggatgggggcgccaccgggcccttttgccccttccgcaatgtggtcccaaaagga
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b : ccaaaaccccccctggattggggctccatccgggcctcttt
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b : gagcgcaaaaacccggcctgaatgggggggtccattcggggccctcttgtccaccttccg
UTR01_0063_E03.b : aatcaaaaatctttttgcccccccccctgaaaccccaaaaaaacctccccctcccggaat
UTR01_0058_E03.b : tctttggccccccccctggaagccccaaaaaaccccccgttctggggattgtgggggggg
UTR01_0049_B05.b : ccc
TCH01_0050_B07.b : gcaaataccccgccggaatgggtggcccatccgggccccttgtcccccttcccaaaattg
OVR01_0062_C08.b : aatatctcgccggaattgggggtccccctggggcctctgttcccctttcaaaga
SPLT1_0009_A05.b : cccgccggaatgggggccctccgggcctctttcccttcccaaagttggttcccaaaagga
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b : aaccggtcggaatggggcccctccggcctctggtcccttcccccaaggggattcccacag
UTR01_0088_F05.b : tcgggacccaaaaccccccccggaattggggggccccccctggcccccttgccccctttc
SPL01_0094_H02.b :
SPL01_0009_C07.b : tgccccctcccgaaaccccaaaaaac
UTR01_0043_B08.b : aaaattcatttgccccccttccctgaagccccaaaaaataactccccgttttctggggaa
OVRT1_0048_H02.b : ctccggaacccaaaaacccccccgggaattgggggctccctccgggcccccttgccccct
OVR01_0011_A12.b :
LNG01_0041_A11.b : aaattattttgcccccccccctggaaccccccaaaaaacctcccccttcccggggaattt
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b : ctgaacccaaaaacccccccggaatgggggctcctccgggccctttggtccccttccaca
SPL01_0035_C11.b : aaaaatcatttgccccccttccctaaaccccccaaaaattccccccccttttggggaaat
UTR01_0051_D10.b : tcccccctcccgaaagcccaaaaaaccccccttctggggatttgttgggctcccctcccc
UTR01_0060_D02.b : atacattggccccctccctgaacgccaaaattcttcccgttctggggatttggtgggggc
TCH01_0064_G06.b : gcaatactccgcctggatggtgggtccatcctggctcccgtgccactttccacaaaggt
SPL01_0055_E07.b :
CLNT1_0031_B11.b : ctcctgagcgcaaaacccccgccgggaatgggggccccatccgggcccccctggccccct
OVRM1_0165_G03.b :
SPLT1_0059_A11.b : tgtccccttcccaagtggttccaaagggtttaaaaaccgggccctttttccccccaagtt
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b : ggggttcacaagaaataaacaaaccggg
TCH01_0090_D09.b : ccttttgaatggtggtccctccggccctttgacccattctgaaaatgggtttcctataag
BKFL1_0089_E09.b : aaaaaataaaaaaggggccttttcccaaaatttaaaatcctcggcttggttccccggggg
SPL01_0055_A11.b :
BKFL1_0020_G02.b : ccccatgtaaaaaccggcggtgttcccaggggttggaagctcttttcatcccaccctctt
BKFL1_0048_C08.b : gaaaaaaaggggccctccccaatgttaaaatccgcctggttcccccgggtttggagcccc
MLTL1_0079_E05.b : tcccccaagggcccaaagagtaaaaaagggccctttccccaagtttaaaataccgccggt
BKFL1_0119_B11.b : gccctctccaaggggtctcacagggttacaaacgggcccttttcccccaaagtttaaaaa
BKFL1_0025_B05.b : cccagggttaaaaaggaaaaaaacggccccttccccaaatttaacatccgccgggtccca
UTR01_0058_G10.b : aaaaaaattatttgcccccccccctagaacccccaaaaaaaccccccgctcctgggaatt
TCH01_0060_A07.b : gcaataacccgccgggatggggggctccatcgggctctctgtccacctcccgcaaagggg
BKFL1_0120_F08.b : ccttcgcccctctccaagggacacaaagaaaaaaaacgggccctttccccaaagttaaac
UTR01_0059_H06.b : tgccccctccctgaaccccaaaacctccccttctgggatttggtggggcccccccc
ADR01_0076_E01.b : cctgaccgcaaaactcccccctggattgtgggctcatcctgggccctctgtccccttccc
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b : c
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b : ggggtcccccgggccctctggtccctttcaaaaggggttccccaaagggtaaaaaaaccg
UTR01_0032_B11.b :
BFLT1_0140_B02.b : ttccaagtgggtcaaaggaataaaaaccggcctctgtccccaagtttaaaattccggcct
SPL01_0046_H02.b :
SPL01_0101_G06.b : atgggggcccatccggcccctttcccctccgcaaatggtatcccaagagaaacaaaaaac
OVRT1_0122_G10.b : ggatgggggccctccggccccttgtccccctccccaatgggatcccaaaggattacaaac
SPL01_0053_F11.b :
UTR01_0074_G07.b : aaaaatattttgccccccctcccgggaaccccaaaaatacccccccctctgggggatttg
UTR01_0092_D05.b : aaatactccgtcggaattggggctccatcctggcctttctgtcactttcagcaaatgtga
ADR01_0047_F07.b : ctcctcgggatggtggctcatctggctcttgttcacttccgcaatgggatcacaaacgga
SPL01_0003_G09.b :
UTR01_0063_G08.b : tttgccccctccctgaaaccccaaaaaaccccccttcgggggattgtgtggggccccccc
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b : cccttcttgagcccaaatactccctcctggaatggtgggtctcctcctggccctcttgtc
OVR01_0046_B03.b : tggcccctcccggaaccccaaattcccccccttttgggaatttgggggggcttccttccc
SPL01_0035_B03.b : catttgcccccctcccgaaaaccccaaaattaccccccctctttgaattttggtgtggtt
SPL01_0100_A03.b : ccc
TCH01_0024_B04.b : TCCTGAACGCAAAactccctctgggatgggggggtcctccggggcctctcgtgccacttt
SPL01_0084_A02.b : caaataactttgtccccccctctaaa
OVRM1_0095_E09.b :
OVRT1_0004_E08.b : tcccggctggaatgggccccatctggccctggtccccttcagaaagggttctccaaaggg
OVR01_0020_H08.b : aaaaatcatttgcccccctccctgaaagccccaaaattacttcccctctctggggaattt
OVRT1_0087_A10.b : acgcaaatatccgtcggatggggggtcctcctggcctttgtcccctttccaaatggtggt
SKNB1_0027_A08.b : TCCTGAACGCAAATACCCCGCCTGGAATGGgggctcttcccggcctcttgttccactttc
SPL01_0065_G06.b :
CLNT1_0097_G03.b : gcaaaacccgtcgggtggggggcccatccggcctctttcccccttccccaatgggtttnc
PCT01_0013_D08.b : caaaaaacccgccgaatgggggtccatccggcctccttgtccccttccgcaatgtgggtt
OVRT1_0090_G01.b : ccaaaccccgctcggattggggctcatctggccctctgtccccttccccaagtgggttgc
SKNB1_0027_G04.b : cctccgaccgcaatactccgtccgggaatggtggctcatcctggcctctcct
SKNB1_0092_E12.b : acgcaataccccttccggatgntggctcatcctgcccctctgtcccttccccaaatggga
PCT01_0007_C06.b : acgcaaaaactcgtctgattgggggtcatccggctcttgtccccttccccaattgggatt
TES01_0054_E07.b : gacgcaatactcgtctggatgntggctcctccggccttctgtcactttcancaatgtgat
SKNB1_0015_D11.b :
TES01_0003_A03.b : cctgaccgcaatactccgccgggattgtgggctcttctgggctctctgtccaccttcaac
PST01_0059_D10.b : cgaatactcgtctggatggtggctccatctgcctctcgtccacttcagcaatgtgttcac
SPL01_0101_H02.b : acttaaaaaaccccaccttga
OVRM1_0213_C07.b :
OVR01_0045_G06.b : cttcccgaacgccaaatacccccttcgggaatgggtgggctccttcccgggccctctttt
PCT01_0014_C08.b : gaacccaaaactccgccgggatggtggtccatcctncctcttggtcacttccccaaatgt
OVRM1_0055_B06.b :
OVR01_0072_E07.b : ccccgaaccgcaaatcccccgtcgggattggggggctccctcctggccctcccgtccccc
ILNT1_0023_A11.b :
---------+---------+---------+---------+---------+---------+ 1237
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b : aaatttccaaacccggcttttttgtttttacccggtgtttaaaannaaaaaaaaaanana
SMG01_0045_G12.b : gggagaaaaaaaaaacggggcccctttttcccccaaagtttttaaaaaaataccggggcg
SMG01_0031_H06.b : tcctgctttgtgtttaacccgggggtttgtgaaagggtttttttaaaatttcaaaaaggg
SPLT1_0020_F08.b : ccttttttccccaaagtttaaaaaattcccggtttttttttttaacaaggggaatttggg
TCH01_0096_B07.b : aggatacacaaccgggcgtccttgtccccaaaatttttaaaacataaccggtcggttgtt
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b : ggctctctgttccccccaaattttaaaaaaatacccgggctggtgtgtttaaaacccgga
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b : tcttc
OVR01_0066_F05.b : ggggtccccaacacgaaatcc
UTR01_0028_D07.b :
OVRT1_0141_G05.b : accctttcattcccccccccctcttttttttttttttcttaaaaaaaggggggggcccaa
OVRT1_0131_A11.b : aaaaacggggccctttttccccccaaagttttaaaaaaatcccgggcgtgtgtgtttaaa
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b : caagtgggatttcaccaaag
OVR01_0028_E11.b : ggg
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b : ctctccacctctctcggctct
OVR01_0055_B05.b :
OVR01_0086_B07.b : tcccttggggttcttttgtgccacctcttctccaaagtgtgggtcttcataataaa
UTR01_0035_H11.b :
CLNT1_0005_D05.b : gaatccaaaaacccggcgcccttttcccccaaaggttttaaacctttcgcggtcgtgtgt
UTR01_0034_H04.b :
BFLT1_0111_D03.b : ttcaaaaacggggcttcttttcccccaaagttttaaaaaaataccggccgggtgttctac
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b : a
UTR01_0063_E03.b : ttggggggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0058_E03.b : ctccccccccccttgggcccccctcccttgttccccccccct
UTR01_0049_B05.b :
TCH01_0050_B07.b : gattcccaaaagggattaaaaaaaacgggcctccttgttcaccccaaaggctctaaaaaa
OVR01_0062_C08.b :
SPLT1_0009_A05.b : tttaaaaacccggcgtctttttccccccaaggtttaaaaaataccggcccgttgttttta
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b : gatca
UTR01_0088_F05.b : ccccaagtgggttccccaacgggattacaaaaaccggcccctcctttt
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b : tttggggtggggct
OVRT1_0048_H02.b : tcccaaaaagggggtttccccaaaggggattcacaaaaaccggggccctcttttcccccc
OVR01_0011_A12.b :
LNG01_0041_A11.b : gtggtgggggcccttccccctcc
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b : aattgggttccccaacagggttcaaaaaaccgggccctccttttcccccaaaggctttaa
SPL01_0035_C11.b : ttttgtggggggcttctccccttttcccctcggggcccctccttcctctttttttt
UTR01_0051_D10.b : tgggccccctttctttttcccccccccttttccccaca
UTR01_0060_D02.b : ccccctcccg
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b : tcccccaagtgggtattccccaacaggagtttcaacaaacccgggccgtccattgttccc
OVRM1_0165_G03.b :
SPLT1_0059_A11.b : taaaaaatacccgccggtgtttttaaacacggggaattggtgaaaaggctttttttttaa
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b : gaatcaaaaaaccgggcgctctttccacgccatattctaaaaattacccggcgcgtggtc
BKFL1_0089_E09.b : gtgaaaacccccctttcctccccccccccccccgtttttttttcgtccaaaaaaaaaagg
SPL01_0055_A11.b :
BKFL1_0020_G02.b : ttttattatttgaaaaaaaaagcccccctctgggcggggttnnnnnnnnncccnnnnntc
BKFL1_0048_C08.b : tttcatcccaccccccctttttattattctaaaaaaaaaaccccctcttcggnnnnnnnn
MLTL1_0079_E05.b : gtccccccggagggtgaaagcccttccctctccccccccccccttttattatttgaaaaa
BKFL1_0119_B11.b : tcccccggtggttcaccccccgggagtggggagagccttttttaattctgagacgaggcc
BKFL1_0025_B05.b : cccgagttggaggcccctttcctccccaccccccttgttttttattccgaaaaaaaagcc
UTR01_0058_G10.b : gggggggggcccccccctccccggggccccccctc
TCH01_0060_A07.b : atccccaaccgggattccaccaaccc
BKFL1_0120_F08.b : ttccggcggggtccaaccccggatttgggaagcctctttcactccccccccccccttgtt
UTR01_0059_H06.b :
ADR01_0076_E01.b : ncaaattgggtccccaacagggttaaaaaaaccgggcgttcctgtccacccaaagttttt
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b : ggctccttttccccccaaattttaaaaattacccggccgtttttttccaacaagggaatg
UTR01_0032_B11.b :
BFLT1_0140_B02.b : ttgttcacacgggtgttgggaaggctttttcaattcagaaccgccttctggtgttaacaa
SPL01_0046_H02.b :
SPL01_0101_G06.b : ggccccatttct
OVRT1_0122_G10.b : cgggccccttgtcccccaaatgttaaaaattcgtgcgggttgttctaacaaggaaagatt
SPL01_0053_F11.b :
UTR01_0074_G07.b : ggggggggccttcccctccccctggggccccctccctttgtggtcccccccccccttttt
UTR01_0092_D05.b : a
ADR01_0047_F07.b : atacaaaaaccgggcctctttgccccgcaaaactctaaaaattaccggtcggtgttgttt
SPL01_0003_G09.b :
UTR01_0063_G08.b : cccctggc
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b : cccc
OVR01_0046_B03.b : cgggccccctctcttttttcccccccccttttcccccccacaaaattgttggggaaattt
SPL01_0035_B03.b : ttcccttccccttgcccccccttttcttttcccccccccttcttccccccccaacaaaat
SPL01_0100_A03.b :
TCH01_0024_B04.b : ccgccaaagttgattaccaacag
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b : atcaaaaaccgggcctcttgtccccgcaaagtttaaaaattccgtgccgttttgtttaca
OVR01_0020_H08.b : gggggggggctttcccctttcccctggggcccccctcttcttctgttccccaccccccct
OVRT1_0087_A10.b : tcccaaaggattacaaaacccggccttcttgtgcccccaagggtttaaaatatcccgtcc
SKNB1_0027_A08.b : tagaa
SPL01_0065_G06.b :
CLNT1_0097_G03.b : caaaggattcaaaaaacgggcccttctttgtccccaaatgtttaaaaattaacgggtcgg
PCT01_0013_D08.b : cccaaaggaatccacaaaccgggccctcctttccccccaaaagtcttaaaaattcccgtc
OVRT1_0090_G01.b : aaaaggtttcaaaaaccgggcctttttttcccccaaagtctttaaaattaccggtctcgt
SKNB1_0027_G04.b :
SKNB1_0092_E12.b : tccccaacgggatacaccaaccgggcccccttgtccccccaaagctctaaaacctccc
PCT01_0007_C06.b : ccaacggattcaacaaaccggccgcttttcccccaaagttttaaaattaccggtggtttg
TES01_0054_E07.b : caccaacgggatacaaaaaccgggccgtcatgtccccccaagctttaaaacttacctgct
SKNB1_0015_D11.b :
TES01_0003_A03.b : aaagtggatcaccaacaggattacaacaaaccggccgctcattgtcacccaa
PST01_0059_D10.b : caaccggatacaaaaccggccgtcattgtcacgcaatgctttaaaacttaccgctcgtgt
PST01_0025_G09.b : CCAGCAAtgtggatcacccaaagggagtacgaccaaaccggcccgcccttgttcccgcca
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b : gtcccccccttcccacccaaatgggggaaatcaaccaaaacagggaagaaccaaaccaaa
PCT01_0014_C08.b : gatccccaacgggattcaacaaaccgggccgtctttgccccccaaagttttaaaacctta
OVRM1_0055_B06.b :
SPL01_0035_A09.b : CCACCAAATTTGGATCACCAAACAGGAttaccaaaaaacccgggccctccatttgtcccc
OVR01_0072_E07.b : ttcccgcaaaatggggatcccccaaccgggagtacaaacaaccccggcccccccattgtc
ILNT1_0023_A11.b : nnnttgcaggttagaggcantaxxxxxxxxxxxxxxxxxx
---------+---------+---------+---------+---------+---------+ 1297
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b : aannancccccccgccccctgggggttcccaaaaanatttgttccaccccgagaaacttt
SMG01_0045_G12.b : gggtgttttcaaaacaggggggagttttggaaagaggttttttttttttaaatctccaca
SMG01_0031_H06.b : ggtttttttttttaacaaagtcccgaaaaaaaaaacctgtggtgggggggcctataatca
SPLT1_0020_F08.b : gaaaagccttttttttaaatcttacaagctaaagttttttgtttttacacacaattttcg
TCH01_0096_B07.b : tctaacaacagggaagttttggaaaaagcttcaacttttccaa
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b : gagttttgggaaaaagggcttttttttttataattcaaaaaaccgcgcgtttttgtgttt
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b : accccaaattttgtnnnnntaatnnttnnnnnnnnnnnnnnnnnnnnnttcccggaccca
OVRT1_0131_A11.b : cacggagagtgttggagaaggccttttttttttattttcccacaagacgcccacttttgt
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b : tcctacaaccgggaagttttgggaaaaccctaatttttccaattcctcacaaggtgaccg
UTR01_0034_H04.b :
BFLT1_0111_D03.b : acaggggagatttgtgagaaagccttttttttcaattttcacaagcacagccccttgtgt
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b : ttaccggggtctgttggt
OVR01_0062_C08.b :
SPLT1_0009_A05.b : aacaagggaaatttttggaaaaggctttttttttcaaattttcaccaaagcgggcatttt
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b : ccaaaagctttaaaaaactttccccgtcgctggttttttccttaaaaacacgggaaaatg
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b : aaacttaccggcccgtgttggtctaacaaatggaaggttttggaaaaagccttatttttt
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b : accaaaaggtttttaaaaaccttcacggg
OVRM1_0165_G03.b :
SPLT1_0059_A11.b : atttcccaaaaccggccccccttgtttttttaaacaaatttgcccaaaaaaaaaaaaaaa
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b : ccaaacaaggaaaagttgtgaaattgcctttattttcaaattttcgcaaacttaacgggc
BKFL1_0089_E09.b : ccgccctctcttttgcg
SPL01_0055_A11.b :
BKFL1_0020_G02.b : tccctttcgccgttctaannnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0048_C08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0079_E05.b : aaaagcccccacccccgaggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0119_B11.b : tgtgtttatattattttaaaaaaa
BKFL1_0025_B05.b : cctatttccgcggannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b : ttaaaaataaaaaaaaaaaaacggccccattatttggcggaggtttttttttaaangnta
UTR01_0059_H06.b :
ADR01_0076_E01.b : aaaattacctgttcctgttgttctacacaccgcggatgtttggggaaaggcttatttttt
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b : tttggaaaaactcttttttttaaattttcaaaaaaggcggcctcctttttttttataaaa
UTR01_0032_B11.b :
BFLT1_0140_B02.b : atccgaaaaaaagggttcgggggcgccataaaacccccccaaagagggtttttgtggaga
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b : gggaaaagccttttctctaaattctcacaacctccctcctttgtttttcatcaaattccg
SPL01_0053_F11.b :
UTR01_0074_G07.b : cccccacccacaaaaatatgtgtgtggggagaaatttct
UTR01_0092_D05.b :
ADR01_0047_F07.b : taacacaggaaaagttgggaaaagcctattttttcaaattctaaccaacctgacttactt
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b : aaaaacaaaaaaaaaaaagaagaaaaaaaaat
SPL01_0035_B03.b : tttttgtgaaaattttatacccacaaaaaaaac
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b : acggtgaagttgggaaaaccttttttttaaattccaaaaaccgagcttcttggttttaaa
OVR01_0020_H08.b : ttttctcccccccccaaaaaaatatgtgtgg
OVRT1_0087_A10.b : tttttttctaaaacaaggggatttttgggaaaggcctattttttaaaaattccacaaagg
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b : tggtcttaacaaaggggaattttgggaaagctctatttttcaaatttcaaaaagccgaac
PCT01_0013_D08.b : cgtgtttgtcataaaaacggtaatgttgtggaaaaagacttattttttcaaaattcttcc
OVRT1_0090_G01.b : tttgtctaaaaaagtgtaaattttgggaaaagccttaattttccaaatttccagcaaaac
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b : ttttaaaacagggaagtttggaaaaagtttttttttcaaatctcacaaacgaagcctctt
TES01_0054_E07.b : ccgttgtcttacaacggggaagtttgggaaagccttaatttttcaaattcaacaaaccga
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b : tgtctaacccccggggagtttgggaatagcctaatttttcaaatttcaacaaactgaacg
PST01_0025_G09.b : aagcttctaaaaaattacactgttcggtgttgttccaaacaaccctggaatgtttgggga
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b : acccccgggccccgcccccctttttggccccccccccccccaaaatgttt
PCT01_0014_C08.b : ccggtcttttggtttaaaaccctgtaaagttgggaaaaagcttaatttttcaaattttcc
OVRM1_0055_B06.b :
SPL01_0035_A09.b : cccaaaatctttctaaaaaactttacccctccttcctttcttttttttttgcccacaccc
OVR01_0072_E07.b : caccgcccaaggctttctaaaacacctaccccgggctccgggcgggtccctaaacccaac
UTR01_0020_H08.b :
UTR01_0044_G05.b : CAAATG
---------+---------+---------+---------+---------+---------+ 1357
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b : tttgttggtttttttttacacaaaatacatatttttgtgggggggggttngttnngcgcc
SMG01_0045_G12.b : aancgagccatttttgtttttttaaaaa
SMG01_0031_H06.b : gggaa
SPLT1_0020_F08.b : gaaaaaaaaaaaaaaaaaaaaanacacaannnnccgcccccccccttcgtgtttctgtaa
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b : tttacaaaaaatcgccggaaaaaaaaaaaagttgtttctttggggggcccttat
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b : cctgcc
OVRT1_0131_A11.b : tttttaaaaaaatctcgcccaaaaaaaaaaaa
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b : cccttgttttttataacgcgaagttaaaaaaaaaaaagagctgttttctcgggggcgcat
UTR01_0034_H04.b :
BFLT1_0111_D03.b : ttttaaccaaggtaaaaaaaaaccgcgttcccgtggggcgccaatataaaaaaccccccc
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b : tttttttttaaaacacaaattccgaaaaaaaaaaaaa
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b : tttgggaaaaacgcc
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b : caaaattccaaaaaaactgggggtaaattgtgttttataaccgaaagtctcggaa
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b : aaaaaaaanaannnnnnnnnnnccccccccccccctctttgtgtttccccaaaatgtgga
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b : tatgttttttaaaacaa
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0079_E05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0119_B11.b :
BKFL1_0025_B05.b : nnnnnnnnnnnn
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b : ggtaatagaaacacaaaaaaat
UTR01_0059_H06.b :
ADR01_0076_E01.b : caaattctcaccaagctgaccgttcttgtgttttttataacgaagtgtccgtaaaaaaaa
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b : aaaatttccgaaaaaaaaaagcgtgttgtgggggcgccctttaatcttgggccccacccc
UTR01_0032_B11.b :
BFLT1_0140_B02.b : aaaaaaanttattttnnagtagaaaaataatttggggagagaagagctcannnnnnnnnn
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b : caaaaaaaaaaacaaaaaaaaagactctttgcgggccgcgataattaaaccccctcccta
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b : tggttttttaacagaaatttcgcgaaaaaaaaaaaaaaaaaaccctgtttgctgggggcg
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b : caaaagtcccgaaaaaaaaggctgttttctgggggcccatataaaaccccccccccaaaa
OVR01_0020_H08.b :
OVRT1_0087_A10.b : ggggggtttttgggttttaaaacaaaatatccccaaaaaaaaaggccgtggcgctcgcgg
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b : cgccttttgttttaaaccaaaggccggaaaaaaaaaaaaaaaaaagccctttctcccgcg
PCT01_0013_D08.b : aaaagtctaagcttctttgtgtttttaaaaacaagatttccgggaaaaaaaaaaaaaaac
OVRT1_0090_G01.b : gagagctccctttgtttttaaaccgaatgttaaaaaaaaaaaggg
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b : tggtttttaaccaaaatttggaaaaaaaaaaagcctgttctgtgggggccgcaataaaaa
TES01_0054_E07.b : gctccctttgtttttaaaccaaaggtcccgaaaaaaaaaaagcttttctctgggcggcca
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b : ttcttgggtttaaaacgaaatgttcggaaaaaaaaaagcccgtgcccgtggccggcctaa
PST01_0025_G09.b : aaagcctttaatcttccccaaaattccaacaaacctggacgggtccctttggtttttata
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b : aacaaacttaaaccttacttaggttttttaaaccgaaatgtccttgaaaaaaaaaaaaaa
OVRM1_0055_B06.b :
SPL01_0035_A09.b : ttttaaaatgtttttttggaaaaaaatttcccctttcaaatttttttttttcaaaaattt
OVR01_0072_E07.b : ctgggaaaggttttggggggaaaagagcccttcaaatctctttccaaatcaatccctagc
SPL01_0072_F11.b :
UTR01_0020_H08.b :
UTR01_0044_G05.b :
---------+---------+---------+---------+---------+---------+ 1403
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b : cgggagggtctggtccttctc
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b : aatagnagacagccgaaagcttgtttgtttttttttctcacacacaatatttggtggggg
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b : aaaaag
UTR01_0034_H04.b :
BFLT1_0111_D03.b : acaaaaaatattttttttttgtgatat
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b : gaacaa
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b : nnnnnn
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b : annnnnnnnnnnnannanaaaanaaggccgttgtggcccggtcctttct
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b : ctttttagaat
UTR01_0032_B11.b :
BFLT1_0140_B02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b : aattagttgttttn
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b : cttaatccagg
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b : aaaatgtggtttttttttataaaaaaaaaaaaatatttttgtggaaataggggcgaactc
OVR01_0020_H08.b :
OVRT1_0087_A10.b : ct
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b : ccccttt
PCT01_0013_D08.b : cctttttttctgggcgcccaaaatataaaaaaccccccccccacacaaaaaaaaggtttt
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b : accccccccccacaaaaaagtgttttttgttttgaaaaaaaaaaaatttatttgttattt
TES01_0054_E07.b : aaattaaaacccacccccccaaaaagaaggttttttgttagaaaaaacatcaaatctttg
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b : attaaaaaacccccccgacaaaaaaaaatgttttcttttttcttggtaaa
PST01_0025_G09.b : acccgaaaggtccgggtaaaaaaaaaaaaaggccttggtttactaggggggcgccaatat
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b : gccctgttctatgtaggcgccccttaaatttaaaaaactcccccccccaacaaaaaaaaa
OVRM1_0055_B06.b :
SPL01_0035_A09.b : ttttctcttaatccccaaaaaccctttttttaacctttccttttctctctcttttttttt
OVR01_0072_E07.b : caaaggcctgtaa
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b : accctaagtgttttttaaaaaatctgaataggttaccggttnnaaaaaaacatttaaccc
UTR01_0044_G05.b :
SPL01_0073_A03.b : TACCTTATGTGttttttaaataatctgaaatatgttaaaaaaaaaaaaaaaaaxxxxxxx
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b : ggcccct
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b : tcc
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b : tttttttttcttaataaaaaaaacacattaaattttcttttt
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b : ggggnnnnnnnnttcccttcccctctnnnnnnnnnnnnngacaattataaccttttcccc
TES01_0054_E07.b : ttctattgccgactccccccccccat
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b : taaaaaaccccacccccgccccacaaaaaatatgttgttgtttcttttttt
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b : agagtgtgtgtttttttgcccttgggcaaaaaaccccctttcaaaattttccttttgtgt
OVRM1_0055_B06.b :
SPL01_0035_A09.b : ttttttttttttttttct
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b : ccctaaaacattnaaaaacttttaaaaggggcccttggctccaacctcgggttcggcccc
UTR01_0044_G05.b :
UTR01_0107_A10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0019_C02.b : AAAAAAAAAAAAAxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0073_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxnnnnn
SPLT1_0096_D06.b : AAAAAAA
SPL01_0037_H09.b : AAAAAAAAAAAAAxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0034_G04.b : aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaagxxxxxxxxxxxx
SKNB1_0049_B05.b : AAAAAAAAAAAAAaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0066_A12.b : aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaxxxxxxxxx
ILNT1_0023_A11.b : AAAAAA
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b : ccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b : gtaccaatatatggggcggcaagaatttcccccccggccgccc
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b : tttaaaatatcctcgagggcccaagtttacgctacccgttt
UTR01_0044_G05.b :
UTR01_0107_A10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0019_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0073_A03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPLT1_0096_D06.b :
SPL01_0037_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0034_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0049_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0066_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b : xxxxxxxxxxxxxxxnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0073_A03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPLT1_0096_D06.b :
SPL01_0037_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0034_G04.b : xxxxxxxnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0049_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0066_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0073_A03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPLT1_0096_D06.b :
SPL01_0037_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0034_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0049_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0066_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b : nn
SPL01_0073_A03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPLT1_0096_D06.b :
SPL01_0037_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0034_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0049_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0066_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b : nnnnnnnnnnnnnnnnnnnnnnnnnn
SPLT1_0096_D06.b :
SPL01_0037_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0034_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0049_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0066_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0034_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0049_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0066_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b : xxxxxxggtctttttcaggggcccttcagtcccccaccggtctggtttcatgaatcaata
SPL01_0034_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0049_B05.b : xxxxnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0066_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxn
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b : atccaccccattaccccaatttttgtaaaaagggttttttattttggttttttaaaaaaa
SPL01_0034_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0049_B05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0066_A12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b : accctccccccccaccccctcccccccccctggaaaaccttgaaaaaaaaaaatataaaa
SPL01_0034_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0049_B05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0066_A12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b : aaaagggaaaaaaggtgcaaaaaattttttggggtttggtgtttgttgt
SPL01_0034_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0049_B05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0066_A12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b : nnnnnnnnnn
SKNB1_0049_B05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0066_A12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0066_A12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :