[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-001404

Length: 1,454

Sequence [FASTA format sequence]
TGTGGTGATG TGGCGCTCTC CTGGGCTTGG GCTTAAGCCG CGCCAGATGG GAACACCACC
CAGAGCGGAG AAGCTGAGTC CAGAGCAATC AGGGACCCTG TGAAGCACCA GCCAGGATGT
GTGAAGAAGA GGACAGCACT GCCCTGGTGT GTGACAATGG TTCTGGGCTC TGTAAGGCCG
GCTTTGCTGG GGACGATGCT CCCAGGGCTG TTTTCCCGTC CATTGTGGGA CGTCCTAGAC
ATCAGGGGGT GATGGTGGGA ATGGGACAAA AAGACAGCTA CGTGGGTGAC GAAGCCCAAA
GCAAAAGAGG AATCCTGACC TTGAAGTACC CAATAGAACA CGGCATCATC ACCAACTGGG
ATGACATGGA AAAGATCTGG CACCACTCTT TCTACAATGA GCTTCGTGTT GCCCCAGAAG
AGCATCCGAC CCTGCTCACC GAGGCACCCC TGAACCCCAA GGCCAACCGG GAGAAGATGA
CCCAGATTAT GTTTGAAACT TTCAATGTCC CAGCCATGTA TGTGGCTATT CAGGCGGTGC
TGTCCCTCTA CGCCTCTGGA CGTACGACTG GCATTGTGCT GGACTCTGGA GATGGTGTCA
CCCACAACGT GCCCATTTAC GAGGGCTACG CCCTGCCCCA CGCCATCATG CGTCTGGACC
TGGCGGGCCG AGATCTCACC GACTACCTCA TGAAGATCCT GACGGAGCGT GGCTACTCCT
TCGTGACCAC TGCCGAGCGT GAGATTGTCC GGGACATCAA GGAGAAGCTG TGCTATGTAG
CCCTGGACTT TGAAAATGAG ATGGCCACTG CCGCGTCCTC CTCCTCCCTG GAGAAGAGCT
ACGAGCTGCC TGACGGGCAG GTGATCACCA TCGGGAACGA GCGCTTCCGC TGCCCGGAGA
CCCTGTTCCA GCCCTCCTTC ATCGGGATGG AGTCTGCTGG CATCCATGAG ACCACCTACA
ACAGCATCAT GAAGTGCGAC ATTGACATCA GGAAGGACCT CTATGCTAAC AACGTCCTCT
CTGGGGGCAC CACCATGTAC CCCGGCATTG CCGACCGCAT GCAGAAGGAG ATCACAGCCC
TGGCACCCAG CACCATGAAG ATCAAGATCA TTGCCCCTCC TGAGCGCAAA TACTCCGTCT
GGATTGGTGG CTCCATCCTG GCCTCTCTGT CCACCTTCCA GCAAATGTGG ATCAGCAAAC
AGGAGTACGA CGAAGCCGGG CCGTCCATTG TCCACCGCAA ATGCTTCTAA AACACTTACC
CTGCTCGCTG TCTGTCTCTA GCACACACTG TGAATGTTTT GTGGAATAAT GCCTTCAATT
CTTTTCCAAA TCATTCCTAG CCAAAGCTCT GACTCGTTAC CTTATGTGTT TTTTAATAAA
TCTGAAATAT GTTACCTGTA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA AAAAAAAAAA
AAAAAAAAAA AAAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinACTA2actin, aortic smooth muscle [Homo sapiens]. 7650.0O
Contig/Assembly ProteinACTA2actin, aortic smooth muscle [Homo sapiens]. 7650.0O
Contig/Assembly ProteinACTC1actin, alpha cardiac muscle 1 proprotein [Homo sapiens]. 7550.0O
Contig/Assembly ProteinACTG2actin, gamma-enteric smooth muscle isoform 1 precursor [Homo sapiens]. 7540.0O
Contig/Assembly ProteinACTA1actin, alpha skeletal muscle [Homo sapiens]. 7530.0O
Contig/Assembly ProteinACTG1actin, cytoplasmic 2 [Homo sapiens]. 7240.0O
Contig/Assembly ProteinACTG1actin, cytoplasmic 2 [Homo sapiens]. 7240.0O
Contig/Assembly ProteinACTBactin, cytoplasmic 1 [Homo sapiens]. 7240.0O
Contig/Assembly ProteinACTBL2beta-actin-like protein 2 [Homo sapiens]. 6890.0O
Contig/Assembly ProteinPOTEEPOTE ankyrin domain family member E [Homo sapiens]. 6720.0


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinActa2actin, aortic smooth muscle [Mus musculus]. 7650.0O
Contig/Assembly ProteinActc1actin, alpha cardiac muscle 1 [Mus musculus]. 7550.0O
Contig/Assembly ProteinActg2actin, gamma-enteric smooth muscle [Mus musculus]. 7540.0O
Contig/Assembly ProteinActa1actin, alpha skeletal muscle [Mus musculus]. 7530.0O
Contig/Assembly ProteinActg1actin, cytoplasmic 2 [Mus musculus]. 7240.0O
Contig/Assembly ProteinActbactin, cytoplasmic 1 [Mus musculus]. 7240.0O
Contig/Assembly ProteinGm12715PREDICTED: actin, cytoplasmic 2-like [Mus musculus]. 7020.0O
Contig/Assembly ProteinActbl2beta-actin-like protein 2 [Mus musculus]. 6960.0O
Contig/Assembly ProteinActr1bbeta-centractin [Mus musculus]. 427e-120O
Contig/Assembly ProteinActr1aalpha-centractin [Mus musculus]. 422e-118O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC477587PREDICTED: similar to Actin, aortic smooth muscle (Alpha-actin 2) [Canis familiaris]. 7650.0O
Contig/Assembly ProteinACTCPREDICTED: similar to Actin, alpha cardiac (Alpha-cardiac actin) isoform 3 [Canis familiaris]. 7550.0O
Contig/Assembly ProteinLOC475792PREDICTED: similar to Actin, gamma-enteric smooth muscle (Smooth muscle gamma actin) (Alpha-actin 3) [Canis familiaris]. 7540.0O
Contig/Assembly ProteinACTBactin, cytoplasmic 1 [Canis lupus familiaris]. 7210.0O
Contig/Assembly ProteinLOC475923PREDICTED: hypothetical protein XP_533132 [Canis familiaris]. 7190.0O
Contig/Assembly ProteinACTBPREDICTED: similar to cytoplasmic beta-actin isoform 9 [Canis familiaris]. 7110.0O
Contig/Assembly ProteinLOC487218PREDICTED: similar to Actin, cytoplasmic 1 (Beta-actin 1) [Canis familiaris]. 6960.0O
Contig/Assembly ProteinLOC442937beta-actin-like [Canis lupus familiaris]. 6730.0O
Contig/Assembly ProteinACTBPREDICTED: similar to cytoplasmic beta-actin isoform 1 [Canis familiaris]. 6720.0O
Contig/Assembly ProteinLOC610787PREDICTED: similar to cytoplasmic beta-actin [Canis familiaris]. 6610.0O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinACTA2actin, aortic smooth muscle [Bos taurus]. 7650.0O
Contig/Assembly ProteinACTC1actin, alpha cardiac muscle 1 [Bos taurus]. 7550.0O
Contig/Assembly ProteinACTG2actin, gamma-enteric smooth muscle [Bos taurus]. 7540.0O
Contig/Assembly ProteinACTA1actin, alpha skeletal muscle [Bos taurus]. 7510.0O
Contig/Assembly ProteinACTG1actin, cytoplasmic 2 [Bos taurus]. 7240.0O
Contig/Assembly ProteinACTBactin, cytoplasmic 1 [Bos taurus]. 7240.0O
Contig/Assembly ProteinACTBL2PREDICTED: beta actin-like [Bos taurus]. 6970.0O
Contig/Assembly ProteinACTBL2PREDICTED: beta actin [Bos taurus]. 6970.0O
Contig/Assembly ProteinACTR1Bbeta-centractin [Bos taurus]. 426e-119O
Contig/Assembly ProteinACTR1Aalpha-centractin [Bos taurus]. 422e-118O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinACTA2actin, aortic smooth muscle [Sus scrofa]. 7650.0O
Contig/Assembly ProteinACTC1actin, alpha cardiac muscle 1 [Sus scrofa]. 7550.0O
Contig/Assembly ProteinLOC100515351PREDICTED: actin, alpha cardiac muscle 1-like isoform 1 [Sus scrofa]. 7530.0O
Contig/Assembly ProteinACTA1actin, alpha skeletal muscle [Sus scrofa]. 7530.0O
Contig/Assembly ProteinACTBPREDICTED: actin, cytoplasmic 2 [Sus scrofa]. 7240.0O
Contig/Assembly ProteinACTBPREDICTED: actin, cytoplasmic 1 [Sus scrofa]. 7240.0O
Contig/Assembly ProteinLOC100515351PREDICTED: actin, alpha cardiac muscle 1-like isoform 2 [Sus scrofa]. 6440.0O
Contig/Assembly ProteinLOC100621129PREDICTED: actin, gamma-enteric smooth muscle-like [Sus scrofa]. 493e-140O
Contig/Assembly ProteinLOC100520667PREDICTED: actin, gamma-enteric smooth muscle-like [Sus scrofa]. 451e-127O
Contig/Assembly ProteinACTR1APREDICTED: alpha-centractin [Sus scrofa]. 422e-118O


Assembly Members: 164      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010047F07ADR01_0047_F07.bDB785699 
ADR010076E01ADR01_0076_E01.bDB788253 
BFLT10111D03BFLT1_0111_D03.bHX202640 
BFLT10140B02BFLT1_0140_B02.bHX204881 
BKFL10020G02BKFL1_0020_G02.bFS649109 
BKFL10025B05BKFL1_0025_B05.bFS649446 
BKFL10048C08BKFL1_0048_C08.bFS651525 
BKFL10089E09BKFL1_0089_E09.bFS654301 
BKFL10095A12BKFL1_0095_A12.bFS654791 
BKFL10119B11BKFL1_0119_B11.bFS656930 
BKFL10120F08BKFL1_0120_F08.bFS657063 
CLNT10005D05CLNT1_0005_D05.bFS657429 
CLNT10031B11CLNT1_0031_B11.bFS659465 
CLNT10097G03CLNT1_0097_G03.bFS664126 
ILNT10023A11ILNT1_0023_A11.bHX228456 
LNG010041A11LNG01_0041_A11.bBP433852 
LVRM10022D01LVRM1_0022_D01.bBP138910 
MLTL10079E05MLTL1_0079_E05.bFS684470 
OVR010011A12OVR01_0011_A12.bBP141667 
OVR010020H08OVR01_0020_H08.bBP144671 
OVR010028E11OVR01_0028_E11.bBP143419 
OVR010045G06OVR01_0045_G06.bBP144163 
OVR010046B03OVR01_0046_B03.bBP141797 
OVR010049E08OVR01_0049_E08.bBW963984 
OVR010055B05OVR01_0055_B05.bBW964491 
OVR010060D04OVR01_0060_D04.bBW964964 
OVR010062C08OVR01_0062_C08.bBW965132 
OVR010066F05OVR01_0066_F05.bBW965514 
OVR010072E07OVR01_0072_E07.bBW966048 
OVR010077C07OVR01_0077_C07.bBW966457 
OVR010086B07OVR01_0086_B07.bBW967062 
OVR010089A08OVR01_0089_A08.bBW967278 
OVRM10003E03OVRM1_0003_E03.bBP150106 
OVRM10007G08OVRM1_0007_G08.bBP153099 AK234691
OVRM10025F07OVRM1_0025_F07.bBP151763 
OVRM10044H09OVRM1_0044_H09.bBP461991 
OVRM10053C07OVRM1_0053_C07.bBP148027 
OVRM10054C08OVRM1_0054_C08.bBP148134 
OVRM10055B06OVRM1_0055_B06.bBP146685 
OVRM10073D07OVRM1_0073_D07.bBP149319 
OVRM10095E09OVRM1_0095_E09.bBP150771 
OVRM10121E05OVRM1_0121_E05.bBP150394 
OVRM10126A07OVRM1_0126_A07.bBP145569 
OVRM10165G03OVRM1_0165_G03.bBP460593 
OVRM10198G10OVRM1_0198_G10.bBP461181 
OVRM10213C07OVRM1_0213_C07.bBP457080 
OVRM10225C04OVRM1_0225_C04.bBP456838 
OVRT10004E08OVRT1_0004_E08.bFS686715 
OVRT10020H01OVRT1_0020_H01.bFS688067 
OVRT10048H02OVRT1_0048_H02.bFS690356 
OVRT10087A10OVRT1_0087_A10.bFS693464 
OVRT10090G01OVRT1_0090_G01.bFS693763 
OVRT10122G10OVRT1_0122_G10.bHX236621 
OVRT10131A11OVRT1_0131_A11.bHX237272 
OVRT10141G05OVRT1_0141_G05.bHX238135 
PCT010007C06PCT01_0007_C06.bFS695078 
PCT010013D08PCT01_0013_D08.b  
PCT010014C08PCT01_0014_C08.bFS695570 
PST010025G09PST01_0025_G09.bFS698982 
PST010059D10PST01_0059_D10.b  
SKNB10015D11SKNB1_0015_D11.b  
SKNB10027A08SKNB1_0027_A08.bDB801413 
SKNB10027G04SKNB1_0027_G04.bDB801463 
SKNB10049B05SKNB1_0049_B05.bDB802809 
SKNB10066A12SKNB1_0066_A12.bDB803989 
SKNB10092E12SKNB1_0092_E12.bDB805555 
SMG010015H04SMG01_0015_H04.bFS714596 
SMG010031H06SMG01_0031_H06.bFS716039 
SMG010045G12SMG01_0045_G12.bFS717232 
SMG010053G02SMG01_0053_G02.bFS717903 
SPL010003G09SPL01_0003_G09.bBP158938 
SPL010004C05SPL01_0004_C05.bBP157442 
SPL010004G11SPL01_0004_G11.bBP158990 
SPL010009C07SPL01_0009_C07.bBP157505 
SPL010011F07SPL01_0011_F07.bBP158549 
SPL010011F10SPL01_0011_F10.bBP158632 
SPL010016D07SPL01_0016_D07.bBP157856 
SPL010019C02SPL01_0019_C02.bBP157363 
SPL010019E09SPL01_0019_E09.bBP158259 
SPL010022H04SPL01_0022_H04.b  
SPL010024A09SPL01_0024_A09.bBP156904 
SPL010026F08SPL01_0026_F08.bBP158590 
SPL010028C08SPL01_0028_C08.bBP157548 
SPL010034G04SPL01_0034_G04.bCJ016729 
SPL010035A09SPL01_0035_A09.bBP156909 
SPL010035B03SPL01_0035_B03.bBP157071 
SPL010035C11SPL01_0035_C11.bBP157626 
SPL010037H09SPL01_0037_H09.bBP159282 
SPL010046H02SPL01_0046_H02.bCJ017197 
SPL010053F11SPL01_0053_F11.bCJ017815 
SPL010054E02SPL01_0054_E02.bCJ017882 
SPL010055A11SPL01_0055_A11.bCJ017933 
SPL010055D11SPL01_0055_D11.bCJ017967 
SPL010055E07SPL01_0055_E07.bCJ017975 
SPL010056B11SPL01_0056_B11.bCJ018035 
SPL010061C12SPL01_0061_C12.bCJ018493 
SPL010061F12SPL01_0061_F12.bCJ018529 
SPL010065G06SPL01_0065_G06.bCJ018902 
SPL010066C01SPL01_0066_C01.bCJ018939 
SPL010068H12SPL01_0068_H12.bCJ019184 
SPL010071A08SPL01_0071_A08.bCJ019370 
SPL010072F11SPL01_0072_F11.bCJ019521 
SPL010073A03SPL01_0073_A03.bCJ019546 
SPL010076H12SPL01_0076_H12.bCJ019909 
SPL010079F03SPL01_0079_F03.bCJ020146 
SPL010084A02SPL01_0084_A02.bCJ020549 
SPL010087E03SPL01_0087_E03.bCJ020860 
SPL010090D03SPL01_0090_D03.bCJ021113 
SPL010094C01SPL01_0094_C01.bCJ021458 
SPL010094H02SPL01_0094_H02.bCJ021517 
SPL010095E05SPL01_0095_E05.bCJ021577 
SPL010100A03SPL01_0100_A03.bCJ021976 
SPL010101G06SPL01_0101_G06.bCJ022125 
SPL010101H02SPL01_0101_H02.b  
SPL010103F06SPL01_0103_F06.bCJ022278 
SPLT10009A05SPLT1_0009_A05.bHX239864 
SPLT10020F08SPLT1_0020_F08.bHX240763 
SPLT10059A11SPLT1_0059_A11.bHX243745 
SPLT10096D06SPLT1_0096_D06.bHX246693 
SPLT10098C11SPLT1_0098_C11.b  
TCH010024B04TCH01_0024_B04.bCJ024183 
TCH010050B07TCH01_0050_B07.bCJ026153 
TCH010060A07TCH01_0060_A07.bCJ026679 
TCH010064G06TCH01_0064_G06.bCJ027039 
TCH010090D09TCH01_0090_D09.b  
TCH010096B07TCH01_0096_B07.bCJ029440 
TES010003A03TES01_0003_A03.b  
TES010054E07TES01_0054_E07.bCJ033441 
UTR010008D02UTR01_0008_D02.bBP171013 
UTR010009H05UTR01_0009_H05.bBP173282 
UTR010010D07UTR01_0010_D07.bBP171242 
UTR010020H08UTR01_0020_H08.bBP173424 
UTR010023C06UTR01_0023_C06.bBP170665 
UTR010023D08UTR01_0023_D08.bBP171298 
UTR010028D07UTR01_0028_D07.bBP171258 
UTR010032B11UTR01_0032_B11.bBP170358 
UTR010034D03UTR01_0034_D03.bBP171084 
UTR010034H04UTR01_0034_H04.bBP173259 
UTR010035H11UTR01_0035_H11.bBP173567 
UTR010042H09UTR01_0042_H09.bBP173486 
UTR010043B08UTR01_0043_B08.bBP170237 
UTR010044G05UTR01_0044_G05.bBP172774 
UTR010044H04UTR01_0044_H04.bBP173269 
UTR010045C08UTR01_0045_C08.bBP170775 
UTR010045E06UTR01_0045_E06.bBP171756 
UTR010049B05UTR01_0049_B05.bBP170106 
UTR010050H11UTR01_0050_H11.bBP464931 
UTR010051D10UTR01_0051_D10.bBP463756 
UTR010057B10UTR01_0057_B10.bBP463184 
UTR010058E03UTR01_0058_E03.bBP463884 
UTR010058G10UTR01_0058_G10.bBP464623 
UTR010059H06UTR01_0059_H06.bBP464820 
UTR010060D02UTR01_0060_D02.bBP463572 
UTR010063E03UTR01_0063_E03.bBP463888 
UTR010063G08UTR01_0063_G08.bBP464578 
UTR010068H08UTR01_0068_H08.bBP464873 
UTR010074G07UTR01_0074_G07.bBP464562 
UTR010086E03UTR01_0086_E03.bCJ037941 
UTR010086G07UTR01_0086_G07.bCJ037969 
UTR010088F05UTR01_0088_F05.bCJ038142 
UTR010092D05UTR01_0092_D05.bCJ038485 
UTR010099A07UTR01_0099_A07.bCJ039010 
UTR010102D01UTR01_0102_D01.bCJ039316 
UTR010107A10UTR01_0107_A10.bCJ039752 

  

SNPs: 5      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
115A0130.092B-
G12800.908
482C13700.938BSACC/T
T090.062ACT/T
608C13500.951BSAAC/N
T070.049AAT/N
828C5810.843WSCTG/L
T1100.157TTG/L
842C3100.795WSTAC/Y
T800.205TAT/Y


Alignment:      TOP

20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
SPL01_0090_D03.b : nnnnggctaggactatgac
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b : gctt
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b : nccgctttntnntaacgatacataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0090_D09.b :
BKFL1_0089_E09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
SPL01_0055_A11.b :
BKFL1_0020_G02.b : nnnccgagannnnnnnacgatacattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0048_C08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxx
MLTL1_0079_E05.b : nnnnggcatatnnnnnntgaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0119_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
BKFL1_0025_B05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
SPL01_0090_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0121_E05.b : taattgtc
SPL01_0061_F12.b : nnnggctaggactatgacxxxxxxxxxxxx
UTR01_0009_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0008_D02.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0098_C11.b : nnnggagcgat
SMG01_0045_G12.b : nggcattttanaatg
SMG01_0031_H06.b : nnccggttttnnnnnnn
SPLT1_0020_F08.b : nnnncgac
TCH01_0096_B07.b : ttttnagctaggcctatgacxxxxxxxxxx
UTR01_0099_A07.b : nnnnggctagtgacttgacagtttgtac
OVRM1_0044_H09.b : cccttgtcxx
OVRM1_0225_C04.b : ttgtc
LVRM1_0022_D01.b : cgttgac
OVRM1_0198_G10.b : cgttgtc
OVRM1_0054_C08.b : cgttga
SPL01_0022_H04.b : catttgggtggxxxxxxxxxxxxxxxxxxxxxx
SMG01_0053_G02.b : nngcgtttttnnnn
SPL01_0016_D07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0011_F10.b : ctttgggtggxxxxxxxxxxxxxxxxxxxxx
OVR01_0060_D04.b : nnggcttgtgacttgacxxxxxxxxxxx
OVR01_0066_F05.b : nnggcttgtgatatgacxxxxxxxxx
UTR01_0028_D07.b : gggtggacxxxxxxxxxxxxxxxxxxxxx
OVRT1_0141_G05.b : nnnaacctatcnnnnnnnnccgttagcgtacgxx
OVRT1_0131_A11.b : nnnaaatacccnnnnnnnccgttagcgcacgxx
UTR01_0010_D07.b : ttttttgtgaxxxxxxxxxxxxxxxxxxxxxx
UTR01_0045_E06.b : tttxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0045_C08.b : tgggttgacxxxxxxxxxxxxxxxxxxxxx
UTR01_0042_H09.b : ggtgcacctatxxxxxxxxxxxxxxxxx
OVR01_0077_C07.b : nnnnggcttggactatgacxxxxxxxxxxx
UTR01_0086_G07.b : nnnggcatgtgactttacxxxxxxxxx
OVR01_0028_E11.b : gggacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0079_F03.b : nnnnggctaggactatnacxxxxxxxxx
SPL01_0054_E02.b : nnnnggctagtgacttgacxxxxxxxxx
SPL01_0071_A08.b : nnnggctaggactatnacxxxxxxxxx
UTR01_0057_B10.b : gaggcattacgtgxxxxxxxxxxxxxxxxx
OVR01_0055_B05.b : nnttggctaggacttanacxxxxxxxxxx
OVR01_0086_B07.b : ttggcttggactatgacxxxxxxxxx
UTR01_0035_H11.b : ggggacctattagxxxxxxxxxxxxxx
CLNT1_0005_D05.b : nggcnccgtcagcgnacgna
UTR01_0034_H04.b : cctttgggtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0111_D03.b : nnccgcttnnnnnnnnncgtcagcgttcgxx
OVR01_0049_E08.b : nnnttgctagtgacttgacxxxxxxxxx
UTR01_0034_D03.b : tttttggtgccxxxxxxxxxxxxxxxxxxxxx
UTR01_0102_D01.b : nnnnggctagtgacttgacxxxxxxxxx
SPL01_0056_B11.b : nnnggcatgtgacttnacxxxxxxxxx
SPL01_0095_E05.b : nnnggctaggactataacxxxxxxxxxx
SPL01_0087_E03.b : nnnggctaggactatnacxxxxxxxxx
UTR01_0063_E03.b : cctttttggtgxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0058_E03.b : cgcttttanggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0049_B05.b : tttttggggxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0050_B07.b : nnggctaggactataacxxxx
OVR01_0062_C08.b : nnnaagctaggactatnacxxxxxxxxx
SPLT1_0009_A05.b : nnncgc
SPL01_0004_C05.b : catctggcgccnxxxxxxxxxxxxxxxxxxxx
SPL01_0066_C01.b : nnnnggctagtgacttnacxxxxxxxxx
SPL01_0068_H12.b : ttttggctagtgacttnacxxxxxxxxx
UTR01_0086_E03.b : nnnnnggctagtxxxxxxxxxxxxxxxxxx
UTR01_0088_F05.b : nnnggcttggactatcacxxxxxxxxxx
SPL01_0094_H02.b : nnnnggctagtgacttgacxxxxxxxxxx
SPL01_0009_C07.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0043_B08.b : ttxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0048_H02.b : nnntttcgtcagcgnacgxx
OVR01_0011_A12.b : cgaaaatatgnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0041_A11.b : gcctggtaatagcaxxxxxxxxxxxxxxxxxxxxxx
UTR01_0050_H11.b : tttgggtgaacctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0076_H12.b : nnnggctaggacttaaacagtttgtc
OVRT1_0020_H01.b : nntttccgttagctgtangag
SPL01_0035_C11.b : acggatctggtgxxxxxxxxxxxxxxxxxxxxxx
UTR01_0051_D10.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0060_D02.b : gcatctagxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0064_G06.b : nnnnaactaggacttaaacxxxxxxxxx
SPL01_0055_E07.b : nnnaacttggactatnacxxxxxxxxx
CLNT1_0031_B11.b : nnnccgtctgcgncggn
OVRM1_0165_G03.b : tcgtttgtcxx
SPLT1_0059_A11.b : nnnccg
SPL01_0011_F07.b : ttttatggtgxxxxxxxxxxxxxxxxxxxx
UTR01_0044_H04.b : tttttgggccxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0095_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0090_D09.b : nggcttggactataacxxxxxxxxxx
BKFL1_0089_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0055_A11.b : nnnnnggatagtgacttgacxxxxxxxxxx
BKFL1_0020_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0048_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0079_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0119_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0025_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0058_G10.b : ggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0060_A07.b : nnggcttggactatgacxxxx
BKFL1_0120_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0059_H06.b : gcataxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0076_E01.b : ttaaaat
SPL01_0004_G11.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0019_E09.b : gtxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0007_G08.b : nnncccggggttttngggcccccnntcccgttcttcgcctttttcgtgtacaxxxxxxx
OVRM1_0073_D07.b : cxxxxxxxxxx
OVRM1_0126_A07.b : nagttgt
OVRM1_0003_E03.b : xxxxxxxxx
OVRM1_0053_C07.b : cgttg
OVRM1_0025_F07.b : cxxxxxxxxxx
SPL01_0024_A09.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0061_C12.b : nnnggcttggactatnacxxxxxxxx
SPL01_0026_F08.b : catxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0028_C08.b : ttttgcgtggcctxxxxxxxxxxxxxxxxxxx
SPL01_0055_D11.b : nnnnggctaggactatnacxxxxxxxx
UTR01_0023_D08.b : gggtgacctattagxxxxxxxxxxxxxx
UTR01_0023_C06.b : gggtcacxxxxxxxxxxxxxxxxxxxx
SMG01_0015_H04.b : nggggtttttnnn
UTR01_0032_B11.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0140_B02.b : nnnnccgtttgctgtcg
SPL01_0046_H02.b : ntttggctagtgacttgacagtttgt
SPL01_0101_G06.b : nnnnggctagtgacttgacxxxxxxx
OVRT1_0122_G10.b : nttccgttcagcgtacgagt
SPL01_0053_F11.b : nnnnnggctagtgacttnacxxxxxxxx
UTR01_0074_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0092_D05.b : nnnnggctaggacttanacxxxxxxxx
ADR01_0047_F07.b : nncc
SPL01_0003_G09.b : cctttacgtgacctanntagacxxxxxxxxxx
UTR01_0063_G08.b : gtcattgggtgxxxxxxxxxxxxxxxxxxxx
UTR01_0068_H08.b : gcattttaxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0094_C01.b : nnnnnggattgtgacttgacxxxxxxxxx
OVR01_0089_A08.b : nnggctaggactataacxxxxxxxx
OVR01_0046_B03.b : gagcttagggtgxxxxxxxxxxxxxxxxxxxx
SPL01_0035_B03.b : aaagccttggggccnxxxxxxxxxxxxxxxxxx
SPL01_0100_A03.b : nnnncccgctaggactatnacxxxxxxxx
TCH01_0024_B04.b : nnnnggctaggacttgacxxxxxxxxx
SPL01_0084_A02.b : ttttggcatgtgacttnacxxxxxx
OVRM1_0095_E09.b : cagttgtc
OVRT1_0004_E08.b : nnnttcctctagctgtc
OVR01_0020_H08.b : taaagaaaacaatgttgxxx
OVRT1_0087_A10.b : nnnggttttnnnngnnnccgttcagctt
SKNB1_0027_A08.b :
SPL01_0065_G06.b : tttttggctagtactatnacxxx
CLNT1_0097_G03.b : ncctttttnngggacaacctcgcgna
PCT01_0013_D08.b :
OVRT1_0090_G01.b : ntttatccgtttgc
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b : nntttgcttgtgacttgacxxxxx
OVRM1_0213_C07.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
20110601C-001404 : ..TGTGGTGATGTGGCGCTCTCCTGGGCTTGGGCTTAAGCCGCGCCAGATGGGAACACCA
---------+---------+---------+---------+---------+---------+ 58
SPL01_0090_D03.b : xxTGTGGTGATGTGGCGCTCTCCTGGGCTTGGGCTTAAGCCGCGCCAGATGAGAACACCA
OVRM1_0121_E05.b : aatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaGGGAACACCA
SPL01_0061_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGGGAACACCA
UTR01_0009_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGGGAACACCA
UTR01_0008_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggggGGGAACACCA
SPLT1_0098_C11.b : taxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAACACCA
SMG01_0045_G12.b : gctaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAACACCA
SMG01_0031_H06.b : ggtaaagcagcggnaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAACACCA
SPLT1_0020_F08.b : ggtagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAACACCA
TCH01_0096_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaGGAACACCA
UTR01_0099_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGAACACCA
OVRM1_0044_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxnGAACACCA
OVRM1_0225_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
LVRM1_0022_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVRM1_0198_G10.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVRM1_0054_C08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0022_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SMG01_0053_G02.b : tgactaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0016_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0011_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVR01_0060_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVR01_0066_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0028_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVRT1_0141_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVRT1_0131_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0010_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0045_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0045_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0042_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVR01_0077_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0086_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVR01_0028_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0079_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0054_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0071_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0057_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVR01_0055_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVR01_0086_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0035_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
CLNT1_0005_D05.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0034_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtcgagtcggccttgtactggGAACACCA
BFLT1_0111_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVR01_0049_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0034_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0102_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0056_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0095_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0087_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0063_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0058_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggtgcttgttggcctactggGAACACCA
UTR01_0049_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
TCH01_0050_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVR01_0062_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPLT1_0009_A05.b : gagaagacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0004_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0066_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0068_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0086_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0088_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0094_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0009_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0043_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVRT1_0048_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVR01_0011_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
LNG01_0041_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxacGAACACCA
UTR01_0050_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0076_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVRT1_0020_H01.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0035_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0051_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
UTR01_0060_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
TCH01_0064_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
SPL01_0055_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
CLNT1_0031_B11.b : atgttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACACCA
OVRM1_0165_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggcAACACCA
SPLT1_0059_A11.b : ctggtacacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACACCA
SPL01_0011_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACACCA
UTR01_0044_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtactgGACACCA
BKFL1_0095_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACACCA
TCH01_0090_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtGACACCG
BKFL1_0089_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACACCA
SPL01_0055_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtAACACCA
BKFL1_0020_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACACCA
BKFL1_0048_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACACCA
MLTL1_0079_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACACCA
BKFL1_0119_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACACCA
BKFL1_0025_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACACCA
UTR01_0058_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggaAACACCA
TCH01_0060_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACACCA
BKFL1_0120_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACACCA
UTR01_0059_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAACACCA
ADR01_0076_E01.b : tgactaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACACCA
SPL01_0004_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcatcgagtcggcctACACCA
SPL01_0019_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtACACCA
OVRM1_0007_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
OVRM1_0073_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
OVRM1_0126_A07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
OVRM1_0003_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
OVRM1_0053_C07.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
OVRM1_0025_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SPL01_0024_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SPL01_0061_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SPL01_0026_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SPL01_0028_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SPL01_0055_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
UTR01_0023_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
UTR01_0023_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SMG01_0015_H04.b : nnggtatagcagcggnaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
UTR01_0032_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
BFLT1_0140_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcggtCACCA
SPL01_0046_H02.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SPL01_0101_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
OVRT1_0122_G10.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgatCACCA
SPL01_0053_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
UTR01_0074_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
UTR01_0092_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
ADR01_0047_F07.b : aaagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SPL01_0003_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
UTR01_0063_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
UTR01_0068_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SPL01_0094_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
OVR01_0089_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
OVR01_0046_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SPL01_0035_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SPL01_0100_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
TCH01_0024_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACCA
SPL01_0084_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgACCA
OVRM1_0095_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgaacCCA
OVRT1_0004_E08.b : ngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCA
OVR01_0020_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCA
OVRT1_0087_A10.b : acgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCA
SKNB1_0027_A08.b : nnnnccgaaannnnnnnccttacgttgtgctcgggggggacCCA
SPL01_0065_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCA
CLNT1_0097_G03.b : cgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgtttCA
PCT01_0013_D08.b : nnngggcttannnnnnncctacgggtgcacgggcgacacc
OVRT1_0090_G01.b : gnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0027_G04.b : nnnngggttnnnnnnnncctcacgttgtgctcggnaaccc
SKNB1_0092_E12.b : nnnattttgcgttggctctggaac
PCT01_0007_C06.b : nnnccgtttnnnnnnncctacgggtgcacc
TES01_0054_E07.b : tttggcctgcggttgctctggaacc
SKNB1_0015_D11.b : ngggttttnnnatcctgcgttggcacacc
TES01_0003_A03.b : ttttcctgctgttgctctggacc
PST01_0059_D10.b : nnnnncctgcgttggctctgggac
PST01_0025_G09.b : nnncctgcggtggctctggga
SPL01_0101_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgacg
OVRM1_0213_C07.b : xcaccacccagagcggagaagctgagtccagagcaatcaggggatgaggacattggacga
OVR01_0045_G06.b : aagcxxxxxxxxxxxxxx
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
20110601C-001404 : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
---------+---------+---------+---------+---------+---------+ 117
SPL01_0090_D03.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVRM1_0121_E05.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAAGA
SPL01_0061_F12.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0009_H05.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0008_D02.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPLT1_0098_C11.b : CCCAGA*CCTTAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SMG01_0045_G12.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SMG01_0031_H06.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPLT1_0020_F08.b : CCCACA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
TCH01_0096_B07.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0099_A07.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVRM1_0044_H09.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGGCCCTGTGAAGCACCAGCCAAGA
OVRM1_0225_C04.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAAGA
LVRM1_0022_D01.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAAGA
OVRM1_0198_G10.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAAGA
OVRM1_0054_C08.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAAGA
SPL01_0022_H04.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SMG01_0053_G02.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0016_D07.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0011_F10.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVR01_0060_D04.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVR01_0066_F05.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0028_D07.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVRT1_0141_G05.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVRT1_0131_A11.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0010_D07.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0045_E06.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0045_C08.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0042_H09.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVR01_0077_C07.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0086_G07.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVR01_0028_E11.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0079_F03.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0054_E02.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCCGTGAAGCACCAGCCAGGA
SPL01_0071_A08.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0057_B10.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVR01_0055_B05.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVR01_0086_B07.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0035_H11.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAACCAGGGACCCTGTGAAGCACCAGCCAGGA
CLNT1_0005_D05.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0034_H04.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
BFLT1_0111_D03.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVR01_0049_E08.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0034_D03.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0102_D01.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0056_B11.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0095_E05.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0087_E03.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0063_E03.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0058_E03.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0049_B05.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCTAGGA
TCH01_0050_B07.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVR01_0062_C08.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPLT1_0009_A05.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0004_C05.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0066_C01.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0068_H12.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0086_E03.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0088_F05.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0094_H02.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0009_C07.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0043_B08.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVRT1_0048_H02.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVR01_0011_A12.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
LNG01_0041_A11.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0050_H11.b : CCCAGAAGCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0076_H12.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVRT1_0020_H01.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0035_C11.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0051_D10.b : CCCAGA*GCGGAGAAGCTGTGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0060_D02.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
TCH01_0064_G06.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0055_E07.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
CLNT1_0031_B11.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVRM1_0165_G03.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAAGA
SPLT1_0059_A11.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0011_F07.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0044_H04.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
BKFL1_0095_A12.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
TCH01_0090_D09.b : CCCAGA*GCGGAGAAGCTGAGTCCATACCAATCAGGGACCCTGTGAACCACCAACCACGA
BKFL1_0089_E09.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0055_A11.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
BKFL1_0020_G02.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
BKFL1_0048_C08.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
MLTL1_0079_E05.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
BKFL1_0119_B11.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
BKFL1_0025_B05.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0058_G10.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
TCH01_0060_A07.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
BKFL1_0120_F08.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0059_H06.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
ADR01_0076_E01.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0004_G11.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0019_E09.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVRM1_0007_G08.b : CCCAGA*GCGGAGAAGCTGAGACCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAAGA
OVRM1_0073_D07.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAAGA
OVRM1_0126_A07.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAAGA
OVRM1_0003_E03.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACGCTGTGAAGCACCAGCCAAGA
OVRM1_0053_C07.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAAGA
OVRM1_0025_F07.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAAGA
SPL01_0024_A09.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0061_C12.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0026_F08.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0028_C08.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0055_D11.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0023_D08.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0023_C06.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SMG01_0015_H04.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0032_B11.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
BFLT1_0140_B02.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0046_H02.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0101_G06.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVRT1_0122_G10.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0053_F11.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0074_G07.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0092_D05.b : CCCAGA*GCGGAGAAGCTGACTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
ADR01_0047_F07.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0003_G09.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0063_G08.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
UTR01_0068_H08.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0094_C01.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVR01_0089_A08.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVR01_0046_B03.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0035_B03.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0100_A03.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
TCH01_0024_B04.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCGATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0084_A02.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVRM1_0095_E09.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAAGA
OVRT1_0004_E08.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVR01_0020_H08.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVRT1_0087_A10.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SKNB1_0027_A08.b : CCCAGA*GCGGAGAAGCTGAGTCC*GAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0065_G06.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
CLNT1_0097_G03.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
PCT01_0013_D08.b : CCCAAA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
OVRT1_0090_G01.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SKNB1_0027_G04.b : CCCAGA*GCGGAGAAGCTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SKNB1_0092_E12.b : ccccgA*GCGGAGAA*CTGAGTCC*GAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
PCT01_0007_C06.b : ccccgA*GCGGAGAA*CTGAGTCC*GAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
TES01_0054_E07.b : ccccgA*GCGGAGAA*CTGAGTCC*GAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SKNB1_0015_D11.b : ccccgA*GCGGAGAA*CTGAGTCC*GAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
TES01_0003_A03.b : ccccgA*GCGGAGAA*CTGAGTCCAGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
PST01_0059_D10.b : ccacccgagcggagAGCTGAGTCC*GAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
PST01_0025_G09.b : cccacccgagcggagaactgagtccGAGCAATCAGGGACCCTGTGAAGCACCAGCCAGGA
SPL01_0101_H02.b : tacggggacgtgccctctatatgaggttgggtaacGGACCCTGTGAAGCACCAGCCAGGA
OVRM1_0213_C07.b : aaatgttctctaataagccttcaatttcccaaatctGACCCTGTGAAGCACCAGCCAAGA
OVR01_0045_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0014_C08.b : naagtaatnnnnnncctgcgtgtgct
OVRM1_0055_B06.b : cgttgacxxxxxxxxxxxxx
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
20110601C-001404 : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
---------+---------+---------+---------+---------+---------+ 177
SPL01_0090_D03.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVRM1_0121_E05.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0061_F12.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0009_H05.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0008_D02.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPLT1_0098_C11.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SMG01_0045_G12.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SMG01_0031_H06.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPLT1_0020_F08.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
TCH01_0096_B07.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0099_A07.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVRM1_0044_H09.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVRM1_0225_C04.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
LVRM1_0022_D01.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVRM1_0198_G10.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVRM1_0054_C08.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0022_H04.b : TGTGTGAAGAAAAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SMG01_0053_G02.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0016_D07.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0011_F10.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVR01_0060_D04.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVR01_0066_F05.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0028_D07.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVRT1_0141_G05.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVRT1_0131_A11.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0010_D07.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0045_E06.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0045_C08.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0042_H09.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVR01_0077_C07.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0086_G07.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVR01_0028_E11.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0079_F03.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0054_E02.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0071_A08.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0057_B10.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVR01_0055_B05.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVR01_0086_B07.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0035_H11.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGTCAATGGTTCTGGGCTCTGTAAGG
CLNT1_0005_D05.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0034_H04.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
BFLT1_0111_D03.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVR01_0049_E08.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0034_D03.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0102_D01.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0056_B11.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0095_E05.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0087_E03.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0063_E03.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0058_E03.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0049_B05.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
TCH01_0050_B07.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVR01_0062_C08.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPLT1_0009_A05.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0004_C05.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0066_C01.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0068_H12.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0086_E03.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0088_F05.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0094_H02.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0009_C07.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0043_B08.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVRT1_0048_H02.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVR01_0011_A12.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
LNG01_0041_A11.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0050_H11.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0076_H12.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVRT1_0020_H01.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0035_C11.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0051_D10.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0060_D02.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
TCH01_0064_G06.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0055_E07.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
CLNT1_0031_B11.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVRM1_0165_G03.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPLT1_0059_A11.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0011_F07.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0044_H04.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
BKFL1_0095_A12.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
TCH01_0090_D09.b : TGTGTGAACAACATGACACCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
BKFL1_0089_E09.b : TGTGTGAAGAGGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0055_A11.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
BKFL1_0020_G02.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
BKFL1_0048_C08.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
MLTL1_0079_E05.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
BKFL1_0119_B11.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
BKFL1_0025_B05.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0058_G10.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
TCH01_0060_A07.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
BKFL1_0120_F08.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0059_H06.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
ADR01_0076_E01.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0004_G11.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0019_E09.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVRM1_0007_G08.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVRM1_0073_D07.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVRM1_0126_A07.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVRM1_0003_E03.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVRM1_0053_C07.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVRM1_0025_F07.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0024_A09.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0061_C12.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0026_F08.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0028_C08.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0055_D11.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0023_D08.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0023_C06.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SMG01_0015_H04.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0032_B11.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
BFLT1_0140_B02.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0046_H02.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0101_G06.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVRT1_0122_G10.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0053_F11.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0074_G07.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0092_D05.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
ADR01_0047_F07.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0003_G09.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0063_G08.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
UTR01_0068_H08.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0094_C01.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVR01_0089_A08.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVR01_0046_B03.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0035_B03.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0100_A03.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
TCH01_0024_B04.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0084_A02.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVRM1_0095_E09.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVRT1_0004_E08.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVR01_0020_H08.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVRT1_0087_A10.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SKNB1_0027_A08.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0065_G06.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
CLNT1_0097_G03.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
PCT01_0013_D08.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVRT1_0090_G01.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SKNB1_0027_G04.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SKNB1_0092_E12.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
PCT01_0007_C06.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
TES01_0054_E07.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTAACAATGGTTCTGGGCTCTGTAAGG
SKNB1_0015_D11.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
TES01_0003_A03.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
PST01_0059_D10.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
PST01_0025_G09.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
SPL01_0101_H02.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVRM1_0213_C07.b : TGTGTGAAGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
OVR01_0045_G06.b : xxxxxxxxGAAGAGGACAGCACTGCCCTGGTGTGTGACAATGGTTCTGGGCTCTGTAAGG
PCT01_0014_C08.b : cggatggtgagagaggacGCACTGCCCTGGTGTGTGACA*TGGTTCTGGGCTCTGTAAGG
OVRM1_0055_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACAATGGTTCTGGGCTCTGTAAGG
SPL01_0035_A09.b : ggagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0072_E07.b : nnnggctaggactatnacxx
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
20110601C-001404 : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
---------+---------+---------+---------+---------+---------+ 236
SPL01_0090_D03.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVRM1_0121_E05.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCA
SPL01_0061_F12.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0009_H05.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0008_D02.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPLT1_0098_C11.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SMG01_0045_G12.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SMG01_0031_H06.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPLT1_0020_F08.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
TCH01_0096_B07.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0099_A07.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVRM1_0044_H09.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVRM1_0225_C04.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
LVRM1_0022_D01.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVRM1_0198_G10.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVRM1_0054_C08.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0022_H04.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SMG01_0053_G02.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0016_D07.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0011_F10.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVR01_0060_D04.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVR01_0066_F05.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0028_D07.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVRT1_0141_G05.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVRT1_0131_A11.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0010_D07.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0045_E06.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0045_C08.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0042_H09.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVR01_0077_C07.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0086_G07.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVR01_0028_E11.b : CCGGCTTTGCTGGG*GACGACGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0079_F03.b : CCGGCTTTGCTGGG*GACGATGCTCTCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0054_E02.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0071_A08.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0057_B10.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVR01_0055_B05.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVR01_0086_B07.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0035_H11.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
CLNT1_0005_D05.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0034_H04.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
BFLT1_0111_D03.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVR01_0049_E08.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0034_D03.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0102_D01.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0056_B11.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0095_E05.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0087_E03.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0063_E03.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0058_E03.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0049_B05.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
TCH01_0050_B07.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVR01_0062_C08.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPLT1_0009_A05.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0004_C05.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0066_C01.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0068_H12.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0086_E03.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0088_F05.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0094_H02.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0009_C07.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0043_B08.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVRT1_0048_H02.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVR01_0011_A12.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
LNG01_0041_A11.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0050_H11.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0076_H12.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVRT1_0020_H01.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0035_C11.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0051_D10.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0060_D02.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
TCH01_0064_G06.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0055_E07.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
CLNT1_0031_B11.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVRM1_0165_G03.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPLT1_0059_A11.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0011_F07.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0044_H04.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
BKFL1_0095_A12.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
TCH01_0090_D09.b : CCGGCTTTGCTGGGAGACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGCGACGTCCT
BKFL1_0089_E09.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0055_A11.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
BKFL1_0020_G02.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCGTTGTGGGACGTCCT
BKFL1_0048_C08.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
MLTL1_0079_E05.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
BKFL1_0119_B11.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
BKFL1_0025_B05.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0058_G10.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
TCH01_0060_A07.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
BKFL1_0120_F08.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0059_H06.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
ADR01_0076_E01.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0004_G11.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0019_E09.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVRM1_0007_G08.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTTCCGTCCATTGCGGGACGTCCT
OVRM1_0073_D07.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVRM1_0126_A07.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVRM1_0003_E03.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVRM1_0053_C07.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVRM1_0025_F07.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTCTCCCGTCCATTGTGGGACGTCCT
SPL01_0024_A09.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0061_C12.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0026_F08.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0028_C08.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0055_D11.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0023_D08.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0023_C06.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SMG01_0015_H04.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0032_B11.b : CCGGCTTTGGTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
BFLT1_0140_B02.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0046_H02.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0101_G06.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVRT1_0122_G10.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0053_F11.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0074_G07.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0092_D05.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
ADR01_0047_F07.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0003_G09.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0063_G08.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
UTR01_0068_H08.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0094_C01.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVR01_0089_A08.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVR01_0046_B03.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTTCT
SPL01_0035_B03.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0100_A03.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
TCH01_0024_B04.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0084_A02.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATCGTGGGACGTCCT
OVRM1_0095_E09.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVRT1_0004_E08.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVR01_0020_H08.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVRT1_0087_A10.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SKNB1_0027_A08.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0065_G06.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
CLNT1_0097_G03.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
PCT01_0013_D08.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVRT1_0090_G01.b : CCGGCTTTGCTGGG*GACGGTGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SKNB1_0027_G04.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SKNB1_0092_E12.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
PCT01_0007_C06.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
TES01_0054_E07.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SKNB1_0015_D11.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
TES01_0003_A03.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
PST01_0059_D10.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
PST01_0025_G09.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0101_H02.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVRM1_0213_C07.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVR01_0045_G06.b : CCGGCTTTGCTGGG*GGCGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
PCT01_0014_C08.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
OVRM1_0055_B06.b : CCGGCTTTGCTGGG*GACGATGCTCCCAGGGCTGTTTTCCCGTCCATTGTGGGACGTCCT
SPL01_0035_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCCCGTCCATTGTGGGACGTCCT
OVR01_0072_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
20110601C-001404 : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
---------+---------+---------+---------+---------+---------+ 296
SPL01_0090_D03.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVRM1_0121_E05.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0061_F12.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0009_H05.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0008_D02.b : AGACATCAGGGGGTGACGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPLT1_0098_C11.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SMG01_0045_G12.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SMG01_0031_H06.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPLT1_0020_F08.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
TCH01_0096_B07.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0099_A07.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVRM1_0044_H09.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACCAAGCC
OVRM1_0225_C04.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
LVRM1_0022_D01.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVRM1_0198_G10.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVRM1_0054_C08.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0022_H04.b : AGACATCATGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACTAACCC
SMG01_0053_G02.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0016_D07.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0011_F10.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVR01_0060_D04.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVR01_0066_F05.b : AGACATCAGGGGGTGATGGTGGAAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0028_D07.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVRT1_0141_G05.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVRT1_0131_A11.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0010_D07.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0045_E06.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0045_C08.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0042_H09.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVR01_0077_C07.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0086_G07.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVR01_0028_E11.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0079_F03.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0054_E02.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0071_A08.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0057_B10.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVR01_0055_B05.b : AGACATCGGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVR01_0086_B07.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0035_H11.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
CLNT1_0005_D05.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0034_H04.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
BFLT1_0111_D03.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVR01_0049_E08.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0034_D03.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0102_D01.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0056_B11.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0095_E05.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0087_E03.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0063_E03.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0058_E03.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0049_B05.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
TCH01_0050_B07.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVR01_0062_C08.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPLT1_0009_A05.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0004_C05.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0066_C01.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0068_H12.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0086_E03.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0088_F05.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0094_H02.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0009_C07.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0043_B08.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVRT1_0048_H02.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVR01_0011_A12.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
LNG01_0041_A11.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0050_H11.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0076_H12.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVRT1_0020_H01.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0035_C11.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0051_D10.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0060_D02.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
TCH01_0064_G06.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0055_E07.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
CLNT1_0031_B11.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVRM1_0165_G03.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPLT1_0059_A11.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0011_F07.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0044_H04.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
BKFL1_0095_A12.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
TCH01_0090_D09.b : AAACATCACGGAGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAACCC
BKFL1_0089_E09.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0055_A11.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
BKFL1_0020_G02.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
BKFL1_0048_C08.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
MLTL1_0079_E05.b : AGACATCAGGGGGTGATGGTGGGAGTGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
BKFL1_0119_B11.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
BKFL1_0025_B05.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0058_G10.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
TCH01_0060_A07.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
BKFL1_0120_F08.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0059_H06.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
ADR01_0076_E01.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0004_G11.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0019_E09.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVRM1_0007_G08.b : ATACATCAAGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACCTGGGCGACGAAGCC
OVRM1_0073_D07.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVRM1_0126_A07.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVRM1_0003_E03.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVRM1_0053_C07.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVRM1_0025_F07.b : AGACATCAGGGGGTGATGGAGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0024_A09.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0061_C12.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0026_F08.b : AGACATCAGGGGGTGATGGTGGGAATGGGGCAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0028_C08.b : AGACATCAGGGGGTGATGGTGGGAATGGGGCAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0055_D11.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0023_D08.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0023_C06.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SMG01_0015_H04.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0032_B11.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
BFLT1_0140_B02.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0046_H02.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0101_G06.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVRT1_0122_G10.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0053_F11.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0074_G07.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0092_D05.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
ADR01_0047_F07.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0003_G09.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0063_G08.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
UTR01_0068_H08.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0094_C01.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVR01_0089_A08.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVR01_0046_B03.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0035_B03.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0100_A03.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
TCH01_0024_B04.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0084_A02.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVRM1_0095_E09.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVRT1_0004_E08.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVR01_0020_H08.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVRT1_0087_A10.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SKNB1_0027_A08.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0065_G06.b : ATACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACATGGGTGACGAAGCC
CLNT1_0097_G03.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
PCT01_0013_D08.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVRT1_0090_G01.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SKNB1_0027_G04.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SKNB1_0092_E12.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
PCT01_0007_C06.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
TES01_0054_E07.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SKNB1_0015_D11.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
TES01_0003_A03.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
PST01_0059_D10.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
PST01_0025_G09.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0101_H02.b : ACACATCACGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACATGTGTGACAAAGCC
OVRM1_0213_C07.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVR01_0045_G06.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
PCT01_0014_C08.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVRM1_0055_B06.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0035_A09.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
OVR01_0072_E07.b : AGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCC
SPL01_0072_F11.b : ttttagcatgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0020_H08.b : gggggacxxxxxxxxxxxxxxxxxxxxxx
SPL01_0103_F06.b : nnnnggctagtgact
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
20110601C-001404 : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
---------+---------+---------+---------+---------+---------+ 356
SPL01_0090_D03.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVRM1_0121_E05.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0061_F12.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCACCATCACCAAC
UTR01_0009_H05.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0008_D02.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPLT1_0098_C11.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SMG01_0045_G12.b : CAAAGCAGAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SMG01_0031_H06.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPLT1_0020_F08.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
TCH01_0096_B07.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0099_A07.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVRM1_0044_H09.b : CAAAGCAGAAGAGGAATCCTGACCTTGAAGTACCCCATAGAACACGGCATCATCACCAGC
OVRM1_0225_C04.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
LVRM1_0022_D01.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVRM1_0198_G10.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVRM1_0054_C08.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0022_H04.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATATAACACAGCATCATCACCTAC
SMG01_0053_G02.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0016_D07.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0011_F10.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVR01_0060_D04.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVR01_0066_F05.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0028_D07.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVRT1_0141_G05.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVRT1_0131_A11.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0010_D07.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0045_E06.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0045_C08.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0042_H09.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVR01_0077_C07.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0086_G07.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVR01_0028_E11.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0079_F03.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0054_E02.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0071_A08.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0057_B10.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVR01_0055_B05.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVR01_0086_B07.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0035_H11.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
CLNT1_0005_D05.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0034_H04.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
BFLT1_0111_D03.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVR01_0049_E08.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0034_D03.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0102_D01.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0056_B11.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0095_E05.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0087_E03.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0063_E03.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0058_E03.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0049_B05.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
TCH01_0050_B07.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVR01_0062_C08.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPLT1_0009_A05.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0004_C05.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0066_C01.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0068_H12.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0086_E03.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0088_F05.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0094_H02.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0009_C07.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0043_B08.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVRT1_0048_H02.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVR01_0011_A12.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
LNG01_0041_A11.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0050_H11.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0076_H12.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVRT1_0020_H01.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0035_C11.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0051_D10.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0060_D02.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
TCH01_0064_G06.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0055_E07.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
CLNT1_0031_B11.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVRM1_0165_G03.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPLT1_0059_A11.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0011_F07.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0044_H04.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
BKFL1_0095_A12.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
TCH01_0090_D09.b : CAAAGCTAAACATGAATCCTGACCTTGAAGTACCCAATAGATCACGGCTTCGTCACCAAC
BKFL1_0089_E09.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0055_A11.b : CAAAGCAAAAGAGGAATTCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
BKFL1_0020_G02.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
BKFL1_0048_C08.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
MLTL1_0079_E05.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
BKFL1_0119_B11.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
BKFL1_0025_B05.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0058_G10.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
TCH01_0060_A07.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
BKFL1_0120_F08.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0059_H06.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
ADR01_0076_E01.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0004_G11.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0019_E09.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVRM1_0007_G08.b : CATAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACTGCATCATCACCAAC
OVRM1_0073_D07.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVRM1_0126_A07.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVRM1_0003_E03.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVRM1_0053_C07.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVRM1_0025_F07.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0024_A09.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0061_C12.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0026_F08.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0028_C08.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0055_D11.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0023_D08.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0023_C06.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SMG01_0015_H04.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0032_B11.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
BFLT1_0140_B02.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0046_H02.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0101_G06.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVRT1_0122_G10.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0053_F11.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACGCGGCATCATCACCAAC
UTR01_0074_G07.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0092_D05.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
ADR01_0047_F07.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0003_G09.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0063_G08.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
UTR01_0068_H08.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0094_C01.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAGCACGGCATCATCACCAAC
OVR01_0089_A08.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVR01_0046_B03.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0035_B03.b : CAAAACAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0100_A03.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
TCH01_0024_B04.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0084_A02.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVRM1_0095_E09.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVRT1_0004_E08.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVR01_0020_H08.b : CAGAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVRT1_0087_A10.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SKNB1_0027_A08.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0065_G06.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
CLNT1_0097_G03.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
PCT01_0013_D08.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVRT1_0090_G01.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SKNB1_0027_G04.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SKNB1_0092_E12.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
PCT01_0007_C06.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
TES01_0054_E07.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SKNB1_0015_D11.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
TES01_0003_A03.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
PST01_0059_D10.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
PST01_0025_G09.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0101_H02.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVRM1_0213_C07.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVR01_0045_G06.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
PCT01_0014_C08.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVRM1_0055_B06.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0035_A09.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
OVR01_0072_E07.b : CAAAGCAAAAGAGGAATCCTGACCTTGAAGTACCCAATAGAACACGGCATCATCACCAAC
SPL01_0072_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAGAACACGGCATCATCACCAAC
UTR01_0020_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCACCAAC
SPL01_0103_F06.b : tgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0044_G05.b : ggggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
20110601C-001404 : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
---------+---------+---------+---------+---------+---------+ 415
SPL01_0090_D03.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVRM1_0121_E05.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0061_F12.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0009_H05.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0008_D02.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPLT1_0098_C11.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SMG01_0045_G12.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SMG01_0031_H06.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPLT1_0020_F08.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
TCH01_0096_B07.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0099_A07.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVRM1_0044_H09.b : TGGGATGACCTGGAAAAG*ATCTGGCACCACcgctttctaaatgagcttcgtgttgcccc
OVRM1_0225_C04.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
LVRM1_0022_D01.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVRM1_0198_G10.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVRM1_0054_C08.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0022_H04.b : TGGGATGACATGGAAAATTATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SMG01_0053_G02.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0016_D07.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0011_F10.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVR01_0060_D04.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVR01_0066_F05.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0028_D07.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVRT1_0141_G05.b : TGGGATGATATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVRT1_0131_A11.b : TGGGATGACATGGAAAAG*ATCTGGCACTACTCTTTCTACGATGAGCTTCGTGTTGCCCC
UTR01_0010_D07.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0045_E06.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0045_C08.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0042_H09.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVR01_0077_C07.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0086_G07.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVR01_0028_E11.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0079_F03.b : CGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0054_E02.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0071_A08.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0057_B10.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVR01_0055_B05.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVR01_0086_B07.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0035_H11.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
CLNT1_0005_D05.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0034_H04.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
BFLT1_0111_D03.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVR01_0049_E08.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0034_D03.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0102_D01.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0056_B11.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0095_E05.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0087_E03.b : TGGGATGACATGGAAAAG*ATCGGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0063_E03.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0058_E03.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0049_B05.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
TCH01_0050_B07.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVR01_0062_C08.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPLT1_0009_A05.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0004_C05.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0066_C01.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0068_H12.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0086_E03.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0088_F05.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0094_H02.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0009_C07.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0043_B08.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVRT1_0048_H02.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVR01_0011_A12.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
LNG01_0041_A11.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0050_H11.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0076_H12.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVRT1_0020_H01.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0035_C11.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0051_D10.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0060_D02.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTGCAATGAGCTTCGTGTTGCCCC
TCH01_0064_G06.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0055_E07.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
CLNT1_0031_B11.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVRM1_0165_G03.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPLT1_0059_A11.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0011_F07.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0044_H04.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
BKFL1_0095_A12.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
TCH01_0090_D09.b : TGGGATGACTTGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAACTTCGTGTTGCCCC
BKFL1_0089_E09.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0055_A11.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
BKFL1_0020_G02.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
BKFL1_0048_C08.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
MLTL1_0079_E05.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
BKFL1_0119_B11.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
BKFL1_0025_B05.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0058_G10.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
TCH01_0060_A07.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
BKFL1_0120_F08.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0059_H06.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
ADR01_0076_E01.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0004_G11.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0019_E09.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVRM1_0007_G08.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAACTTCGAGTATCCCC
OVRM1_0073_D07.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVRM1_0126_A07.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVRM1_0003_E03.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVRM1_0053_C07.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVRM1_0025_F07.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0024_A09.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0061_C12.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0026_F08.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0028_C08.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0055_D11.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0023_D08.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0023_C06.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SMG01_0015_H04.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0032_B11.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
BFLT1_0140_B02.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0046_H02.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0101_G06.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVRT1_0122_G10.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0053_F11.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0074_G07.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0092_D05.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
ADR01_0047_F07.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0003_G09.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0063_G08.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0068_H08.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0094_C01.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVR01_0089_A08.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVR01_0046_B03.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0035_B03.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0100_A03.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
TCH01_0024_B04.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0084_A02.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVRM1_0095_E09.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVRT1_0004_E08.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVR01_0020_H08.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVRT1_0087_A10.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SKNB1_0027_A08.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCATGTTGCCCC
SPL01_0065_G06.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
CLNT1_0097_G03.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
PCT01_0013_D08.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVRT1_0090_G01.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SKNB1_0027_G04.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SKNB1_0092_E12.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
PCT01_0007_C06.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
TES01_0054_E07.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SKNB1_0015_D11.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
TES01_0003_A03.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
PST01_0059_D10.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
PST01_0025_G09.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0101_H02.b : TGGGATGACATGGAAAAG*ATCTGGCACCGCTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVRM1_0213_C07.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVR01_0045_G06.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
PCT01_0014_C08.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVRM1_0055_B06.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0035_A09.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
OVR01_0072_E07.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0072_F11.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0020_H08.b : TGGGATGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
SPL01_0103_F06.b : xxxxxTGACATGGAAAAG*ATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCC
UTR01_0044_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGAGCTTCGTGTTGCCCC
UTR01_0107_A10.b : ntttggcatg
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
20110601C-001404 : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
---------+---------+---------+---------+---------+---------+ 475
SPL01_0090_D03.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVRM1_0121_E05.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0061_F12.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0009_H05.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0008_D02.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPLT1_0098_C11.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SMG01_0045_G12.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SMG01_0031_H06.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPLT1_0020_F08.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
TCH01_0096_B07.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0099_A07.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVRM1_0044_H09.b : tcaataccatccgaccccgatacacgacgaacacatagactctacggccactcgtgcgaa
OVRM1_0225_C04.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
LVRM1_0022_D01.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVRM1_0198_G10.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVRM1_0054_C08.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0022_H04.b : ACAACAGCATCCTACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SMG01_0053_G02.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0016_D07.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0011_F10.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVR01_0060_D04.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVR01_0066_F05.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0028_D07.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVRT1_0141_G05.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVRT1_0131_A11.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0010_D07.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0045_E06.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0045_C08.b : GGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0042_H09.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVR01_0077_C07.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0086_G07.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVR01_0028_E11.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0079_F03.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0054_E02.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0071_A08.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACTCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0057_B10.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVR01_0055_B05.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVR01_0086_B07.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0035_H11.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
CLNT1_0005_D05.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0034_H04.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
BFLT1_0111_D03.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVR01_0049_E08.b : AGAAGAGCATCCGACCCTGCACACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0034_D03.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0102_D01.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0056_B11.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0095_E05.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0087_E03.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0063_E03.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0058_E03.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0049_B05.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
TCH01_0050_B07.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVR01_0062_C08.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPLT1_0009_A05.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0004_C05.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0066_C01.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0068_H12.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0086_E03.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0088_F05.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0094_H02.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0009_C07.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0043_B08.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVRT1_0048_H02.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVR01_0011_A12.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
LNG01_0041_A11.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0050_H11.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0076_H12.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVRT1_0020_H01.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0035_C11.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0051_D10.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0060_D02.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
TCH01_0064_G06.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0055_E07.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
CLNT1_0031_B11.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVRM1_0165_G03.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPLT1_0059_A11.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0011_F07.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0044_H04.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
BKFL1_0095_A12.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
TCH01_0090_D09.b : ACAACAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
BKFL1_0089_E09.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0055_A11.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
BKFL1_0020_G02.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
BKFL1_0048_C08.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
MLTL1_0079_E05.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
BKFL1_0119_B11.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
BKFL1_0025_B05.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0058_G10.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
TCH01_0060_A07.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
BKFL1_0120_F08.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0059_H06.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
ADR01_0076_E01.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0004_G11.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0019_E09.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVRM1_0007_G08.b : AGACGAGCATCCGTACCTGCTCACCGTGGCAtccttgatctctaagtgtcttctggtata
OVRM1_0073_D07.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVRM1_0126_A07.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVRM1_0003_E03.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVRM1_0053_C07.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVRM1_0025_F07.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGGGAA
SPL01_0024_A09.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0061_C12.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0026_F08.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0028_C08.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0055_D11.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0023_D08.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0023_C06.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SMG01_0015_H04.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0032_B11.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
BFLT1_0140_B02.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0046_H02.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0101_G06.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVRT1_0122_G10.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0053_F11.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0074_G07.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0092_D05.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
ADR01_0047_F07.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0003_G09.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0063_G08.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0068_H08.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0094_C01.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVR01_0089_A08.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVR01_0046_B03.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0035_B03.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0100_A03.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
TCH01_0024_B04.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0084_A02.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVRM1_0095_E09.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVRT1_0004_E08.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVR01_0020_H08.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVRT1_0087_A10.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SKNB1_0027_A08.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0065_G06.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
CLNT1_0097_G03.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
PCT01_0013_D08.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVRT1_0090_G01.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SKNB1_0027_G04.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SKNB1_0092_E12.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
PCT01_0007_C06.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
TES01_0054_E07.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SKNB1_0015_D11.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
TES01_0003_A03.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
PST01_0059_D10.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
PST01_0025_G09.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0101_H02.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVRM1_0213_C07.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVR01_0045_G06.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
PCT01_0014_C08.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVRM1_0055_B06.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0035_A09.b : AGAGGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
OVR01_0072_E07.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0072_F11.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0020_H08.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
SPL01_0103_F06.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0044_G05.b : AGAAGAGCATCCGACCCTGCTCACCGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAA
UTR01_0107_A10.b : gactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
20110601C-001404 : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
---------+---------+---------+---------+---------+---------+ 535
SPL01_0090_D03.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVRM1_0121_E05.b : GATGACTCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0061_F12.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0009_H05.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0008_D02.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPLT1_0098_C11.b : GATGACCCAGATTATGTTTGAAACTTTTCATGTCCCAGCCATGTATGTGGCTATTCAGGC
SMG01_0045_G12.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SMG01_0031_H06.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPLT1_0020_F08.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
TCH01_0096_B07.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0099_A07.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVRM1_0044_H09.b : aaccactcgacattccgtctgaaatattccatcgtctaacccatggttagtggctagcgg
OVRM1_0225_C04.b : GATGACTCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
LVRM1_0022_D01.b : GATGACTCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVRM1_0198_G10.b : GATGACTCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVRM1_0054_C08.b : GATGACTCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0022_H04.b : GATGACCCAAATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCATGC
SMG01_0053_G02.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0016_D07.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0011_F10.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVR01_0060_D04.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVR01_0066_F05.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0028_D07.b : GATGACCCAGATTATGTTTGAAGCTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVRT1_0141_G05.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVRT1_0131_A11.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0010_D07.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0045_E06.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0045_C08.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0042_H09.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVR01_0077_C07.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0086_G07.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVR01_0028_E11.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0079_F03.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0054_E02.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0071_A08.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0057_B10.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVR01_0055_B05.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVR01_0086_B07.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0035_H11.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
CLNT1_0005_D05.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0034_H04.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
BFLT1_0111_D03.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVR01_0049_E08.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0034_D03.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0102_D01.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0056_B11.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0095_E05.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0087_E03.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0063_E03.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0058_E03.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0049_B05.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
TCH01_0050_B07.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVR01_0062_C08.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPLT1_0009_A05.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0004_C05.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0066_C01.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0068_H12.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0086_E03.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0088_F05.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0094_H02.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0009_C07.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0043_B08.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVRT1_0048_H02.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVR01_0011_A12.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
LNG01_0041_A11.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0050_H11.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0076_H12.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVRT1_0020_H01.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0035_C11.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0051_D10.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0060_D02.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
TCH01_0064_G06.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0055_E07.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
CLNT1_0031_B11.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVRM1_0165_G03.b : GATGACTCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPLT1_0059_A11.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0011_F07.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0044_H04.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
BKFL1_0095_A12.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
TCH01_0090_D09.b : GATGACCCATATTATGTTTGAAACTTTCAATGTACCACCCATGTATGTGGCTATTCATGC
BKFL1_0089_E09.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0055_A11.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
BKFL1_0020_G02.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
BKFL1_0048_C08.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
MLTL1_0079_E05.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
BKFL1_0119_B11.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
BKFL1_0025_B05.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0058_G10.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
TCH01_0060_A07.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
BKFL1_0120_F08.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0059_H06.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
ADR01_0076_E01.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0004_G11.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0019_E09.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVRM1_0007_G08.b : tgatgactcacattatggttagaaatttacaatgccccatacatgtatgtggcatttaat
OVRM1_0073_D07.b : GATGACTCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVRM1_0126_A07.b : GATGACTCAGATTATGTTTGANACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVRM1_0003_E03.b : GATGACTCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVRM1_0053_C07.b : GATGACTCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVRM1_0025_F07.b : GATGACTCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0024_A09.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0061_C12.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0026_F08.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0028_C08.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0055_D11.b : GATGACCCAGATTATGTTTGAAACTTTCAATGCCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0023_D08.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0023_C06.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SMG01_0015_H04.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0032_B11.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
BFLT1_0140_B02.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0046_H02.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0101_G06.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVRT1_0122_G10.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0053_F11.b : GATGACCCAGATTATGTTCGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0074_G07.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0092_D05.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
ADR01_0047_F07.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0003_G09.b : GATGACCCAGATTATGTCTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0063_G08.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0068_H08.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0094_C01.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVR01_0089_A08.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVR01_0046_B03.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0035_B03.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCGCAGCCATGTATGTGGCTATTCAGGC
SPL01_0100_A03.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
TCH01_0024_B04.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0084_A02.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVRM1_0095_E09.b : GATGACTCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVRT1_0004_E08.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVR01_0020_H08.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVRT1_0087_A10.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SKNB1_0027_A08.b : GATGACCCAGATTATGCTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0065_G06.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
CLNT1_0097_G03.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
PCT01_0013_D08.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVRT1_0090_G01.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SKNB1_0027_G04.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SKNB1_0092_E12.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
PCT01_0007_C06.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
TES01_0054_E07.b : GATGACCCAGATTATGTTTGAAGCTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SKNB1_0015_D11.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
TES01_0003_A03.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
PST01_0059_D10.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
PST01_0025_G09.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0101_H02.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVRM1_0213_C07.b : GATGACTCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVR01_0045_G06.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
PCT01_0014_C08.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVRM1_0055_B06.b : GATGACTCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0035_A09.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
OVR01_0072_E07.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0072_F11.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0020_H08.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0103_F06.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0044_G05.b : GATGACCCAGATTATGTTTGAAACTTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
UTR01_0107_A10.b : xxxxxxxxxxxTTATGTTTGAAACCTTCAATGTCCCAGCCATGTATGTGGCTATTCAGGC
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
20110601C-001404 : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
---------+---------+---------+---------+---------+---------+ 595
SPL01_0090_D03.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVRM1_0121_E05.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0061_F12.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0009_H05.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0008_D02.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPLT1_0098_C11.b : GGTGCTGGTCCTCTACGCTTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SMG01_0045_G12.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SMG01_0031_H06.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPLT1_0020_F08.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
TCH01_0096_B07.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0099_A07.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVRM1_0044_H09.b : cccgaataacgtcccttctatccggcccaactctccacttgcattaccccccacgaccta
OVRM1_0225_C04.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
LVRM1_0022_D01.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVRM1_0198_G10.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVRM1_0054_C08.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0022_H04.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SMG01_0053_G02.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0016_D07.b : GGTGCTGTCCCTCTACGCCCCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0011_F10.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVR01_0060_D04.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVR01_0066_F05.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0028_D07.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVRT1_0141_G05.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVRT1_0131_A11.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0010_D07.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0045_E06.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0045_C08.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0042_H09.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVR01_0077_C07.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0086_G07.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVR01_0028_E11.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0079_F03.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0054_E02.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0071_A08.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0057_B10.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVR01_0055_B05.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGGGATGG
OVR01_0086_B07.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0035_H11.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
CLNT1_0005_D05.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0034_H04.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
BFLT1_0111_D03.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVR01_0049_E08.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0034_D03.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0102_D01.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0056_B11.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0095_E05.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0087_E03.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0063_E03.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0058_E03.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0049_B05.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
TCH01_0050_B07.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVR01_0062_C08.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPLT1_0009_A05.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0004_C05.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0066_C01.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0068_H12.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0086_E03.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0088_F05.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0094_H02.b : GGTACTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0009_C07.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0043_B08.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVRT1_0048_H02.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVR01_0011_A12.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
LNG01_0041_A11.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0050_H11.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0076_H12.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVRT1_0020_H01.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0035_C11.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0051_D10.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0060_D02.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
TCH01_0064_G06.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0055_E07.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
CLNT1_0031_B11.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVRM1_0165_G03.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPLT1_0059_A11.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0011_F07.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0044_H04.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
BKFL1_0095_A12.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
TCH01_0090_D09.b : GGTGCTGTCCCTCTACGCCTCTGGACATACAACTGGCATTGTGCTGGACTCTGGAGATGG
BKFL1_0089_E09.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0055_A11.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
BKFL1_0020_G02.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
BKFL1_0048_C08.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
MLTL1_0079_E05.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
BKFL1_0119_B11.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCCGGAGATGG
BKFL1_0025_B05.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0058_G10.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
TCH01_0060_A07.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
BKFL1_0120_F08.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0059_H06.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
ADR01_0076_E01.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0004_G11.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0019_E09.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVRM1_0007_G08.b : gccgctctgatcctcttaccctctgcacgtgcgagtggtatagtcctacactttggagat
OVRM1_0073_D07.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCCGGACTCTGGAGATGG
OVRM1_0126_A07.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVRM1_0003_E03.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVRM1_0053_C07.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVRM1_0025_F07.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0024_A09.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0061_C12.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0026_F08.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0028_C08.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0055_D11.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0023_D08.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0023_C06.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SMG01_0015_H04.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0032_B11.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
BFLT1_0140_B02.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0046_H02.b : GGTGCTATCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0101_G06.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVRT1_0122_G10.b : GGTGCTGTCCCTCTACTCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0053_F11.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0074_G07.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0092_D05.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
ADR01_0047_F07.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0003_G09.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0063_G08.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0068_H08.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0094_C01.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVR01_0089_A08.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVR01_0046_B03.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0035_B03.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0100_A03.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
TCH01_0024_B04.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0084_A02.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVRM1_0095_E09.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVRT1_0004_E08.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVR01_0020_H08.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVRT1_0087_A10.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SKNB1_0027_A08.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0065_G06.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
CLNT1_0097_G03.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
PCT01_0013_D08.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVRT1_0090_G01.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SKNB1_0027_G04.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SKNB1_0092_E12.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
PCT01_0007_C06.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
TES01_0054_E07.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SKNB1_0015_D11.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
TES01_0003_A03.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
PST01_0059_D10.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
PST01_0025_G09.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0101_H02.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVRM1_0213_C07.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVR01_0045_G06.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
PCT01_0014_C08.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVRM1_0055_B06.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0035_A09.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
OVR01_0072_E07.b : GGTGCTGTCCCTCTACGCCTCTGGACGTATGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0072_F11.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0020_H08.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0103_F06.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0044_G05.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
UTR01_0107_A10.b : GGTGCTGTCCCTCTACGCCTCTGGACGTACGACTGGCATTGTGCTGGACTCTGGAGATGG
SPL01_0019_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
20110601C-001404 : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
---------+---------+---------+---------+---------+---------+ 654
SPL01_0090_D03.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVRM1_0121_E05.b : TGTCACCCACAATGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0061_F12.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0009_H05.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0008_D02.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPLT1_0098_C11.b : TGTCACCCACAACGTGCCCATTTACGAAGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SMG01_0045_G12.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SMG01_0031_H06.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPLT1_0020_F08.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
TCH01_0096_B07.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0099_A07.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCACGCGTC
OVRM1_0044_H09.b : cccaatccgcgaaacaaatagtctagataaccctctcgaactcacctatcgctacagacc
OVRM1_0225_C04.b : TGTCACCCACAATGTGCCCATTTACGAGGGCTACNCCCTGCCCCACGC*CATCATGCGTC
LVRM1_0022_D01.b : TGTCACCCACAATGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVRM1_0198_G10.b : TGTCACCCACAATGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVRM1_0054_C08.b : TGTCACCCACAATGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0022_H04.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGCTCATCGTGCGTC
SMG01_0053_G02.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0016_D07.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0011_F10.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVR01_0060_D04.b : TGTCGCCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVR01_0066_F05.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0028_D07.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVRT1_0141_G05.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVRT1_0131_A11.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0010_D07.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0045_E06.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0045_C08.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0042_H09.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVR01_0077_C07.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0086_G07.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVR01_0028_E11.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0079_F03.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0054_E02.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0071_A08.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0057_B10.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVR01_0055_B05.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVR01_0086_B07.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0035_H11.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
CLNT1_0005_D05.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0034_H04.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
BFLT1_0111_D03.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVR01_0049_E08.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0034_D03.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0102_D01.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0056_B11.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0095_E05.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0087_E03.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0063_E03.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0058_E03.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0049_B05.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
TCH01_0050_B07.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVR01_0062_C08.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPLT1_0009_A05.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0004_C05.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0066_C01.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0068_H12.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0086_E03.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0088_F05.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0094_H02.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0009_C07.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0043_B08.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVRT1_0048_H02.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVR01_0011_A12.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
LNG01_0041_A11.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0050_H11.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0076_H12.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVRT1_0020_H01.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0035_C11.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0051_D10.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0060_D02.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
TCH01_0064_G06.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0055_E07.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
CLNT1_0031_B11.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVRM1_0165_G03.b : TGTCACCCACAATGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPLT1_0059_A11.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0011_F07.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0044_H04.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
BKFL1_0095_A12.b : TGTCACCCANCACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
TCH01_0090_D09.b : TGTCACCCACAACGTGCCCATTTACAAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
BKFL1_0089_E09.b : TGTCACCCANCACGTGCCCATTTACGGGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0055_A11.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
BKFL1_0020_G02.b : TGTCACCCANCACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
BKFL1_0048_C08.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
MLTL1_0079_E05.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
BKFL1_0119_B11.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
BKFL1_0025_B05.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0058_G10.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
TCH01_0060_A07.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
BKFL1_0120_F08.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0059_H06.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
ADR01_0076_E01.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0004_G11.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0019_E09.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVRM1_0007_G08.b : ggtgtagcacacaatgaatctcatttactagggctctgtccttgacctctccattataca
OVRM1_0073_D07.b : TGTCACCCACAATGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVRM1_0126_A07.b : TGTCACCCACAATGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVRM1_0003_E03.b : TGTCACCCACAATGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVRM1_0053_C07.b : TGTCACCCACAATGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVRM1_0025_F07.b : TGTCACCCACAATGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0024_A09.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0061_C12.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0026_F08.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0028_C08.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0055_D11.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0023_D08.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0023_C06.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SMG01_0015_H04.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0032_B11.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
BFLT1_0140_B02.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0046_H02.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0101_G06.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVRT1_0122_G10.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0053_F11.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0074_G07.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0092_D05.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
ADR01_0047_F07.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0003_G09.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0063_G08.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0068_H08.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0094_C01.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVR01_0089_A08.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVR01_0046_B03.b : TGCCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0035_B03.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0100_A03.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
TCH01_0024_B04.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0084_A02.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVRM1_0095_E09.b : TGTCACCCACAATGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVRT1_0004_E08.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVR01_0020_H08.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVRT1_0087_A10.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SKNB1_0027_A08.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0065_G06.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
CLNT1_0097_G03.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
PCT01_0013_D08.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVRT1_0090_G01.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SKNB1_0027_G04.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SKNB1_0092_E12.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
PCT01_0007_C06.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
TES01_0054_E07.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SKNB1_0015_D11.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
TES01_0003_A03.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
PST01_0059_D10.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
PST01_0025_G09.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0101_H02.b : TGTCACCCACAACGTGCCCATTTACTAGGGCTAGACCCTGCCCCACGC*CATCGTGCGTC
OVRM1_0213_C07.b : TGTCACCCACAATGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVR01_0045_G06.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
PCT01_0014_C08.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVRM1_0055_B06.b : TGTCACCCACAATGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0035_A09.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
OVR01_0072_E07.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0072_F11.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0020_H08.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0103_F06.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0044_G05.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
UTR01_0107_A10.b : TGTCACCCACAACGTGCCCATTTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0019_C02.b : xxxxxxxxxxxxxxxxxxxxxxTACGAGGGCTACGCCCTGCCCCACGC*CATCATGCGTC
SPL01_0073_A03.b : ttt
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
20110601C-001404 : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
---------+---------+---------+---------+---------+---------+ 713
SPL01_0090_D03.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVRM1_0121_E05.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGNC
SPL01_0061_F12.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGGTCCTGACGGAGCGTGGC
UTR01_0009_H05.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0008_D02.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPLT1_0098_C11.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SMG01_0045_G12.b : TGG*ACCTGNCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SMG01_0031_H06.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPLT1_0020_F08.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
TCH01_0096_B07.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0099_A07.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVRM1_0044_H09.b : acaagtagttgctctggatgctccccacgcaaatccccccggtcccagcttgcccttaat
OVRM1_0225_C04.b : TGGGACCTGGCGGGCCGAGATCTCACCTACTACCTCATGACGATCCTGACGGATCGTGGC
LVRM1_0022_D01.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVRM1_0198_G10.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVRM1_0054_C08.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0022_H04.b : TGG*ACCTGACGGGCCTAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGAC
SMG01_0053_G02.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0016_D07.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0011_F10.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVR01_0060_D04.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACCGAGCGTGGC
OVR01_0066_F05.b : TGG*ACCTGGCGGGCCCAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0028_D07.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVRT1_0141_G05.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVRT1_0131_A11.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0010_D07.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0045_E06.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0045_C08.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0042_H09.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVR01_0077_C07.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0086_G07.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVR01_0028_E11.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0079_F03.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0054_E02.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0071_A08.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0057_B10.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVR01_0055_B05.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVR01_0086_B07.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0035_H11.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
CLNT1_0005_D05.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0034_H04.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
BFLT1_0111_D03.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVR01_0049_E08.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0034_D03.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0102_D01.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0056_B11.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0095_E05.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0087_E03.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0063_E03.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0058_E03.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0049_B05.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
TCH01_0050_B07.b : TGG*ACCTGGCGGGCCGAGATCTCGCCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVR01_0062_C08.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPLT1_0009_A05.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0004_C05.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0066_C01.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0068_H12.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0086_E03.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0088_F05.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0094_H02.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0009_C07.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0043_B08.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVRT1_0048_H02.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVR01_0011_A12.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
LNG01_0041_A11.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0050_H11.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0076_H12.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVRT1_0020_H01.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0035_C11.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0051_D10.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0060_D02.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
TCH01_0064_G06.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0055_E07.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
CLNT1_0031_B11.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVRM1_0165_G03.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPLT1_0059_A11.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0011_F07.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0044_H04.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
BKFL1_0095_A12.b : TGG*ACCTGGCGGGCCGGGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
TCH01_0090_D09.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAATATCCTGACAGAGCGTGGC
BKFL1_0089_E09.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0055_A11.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
BKFL1_0020_G02.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
BKFL1_0048_C08.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
MLTL1_0079_E05.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGGGCGTGGC
BKFL1_0119_B11.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
BKFL1_0025_B05.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0058_G10.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
TCH01_0060_A07.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
BKFL1_0120_F08.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0059_H06.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
ADR01_0076_E01.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0004_G11.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0019_E09.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVRM1_0007_G08.b : taagaacttgatgaatcgcgatcttcaccattatcttataatatctgcctgcatcgagta
OVRM1_0073_D07.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVRM1_0126_A07.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVRM1_0003_E03.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGCC
OVRM1_0053_C07.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVRM1_0025_F07.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0024_A09.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0061_C12.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0026_F08.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0028_C08.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0055_D11.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0023_D08.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0023_C06.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SMG01_0015_H04.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0032_B11.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
BFLT1_0140_B02.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0046_H02.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACCACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0101_G06.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVRT1_0122_G10.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0053_F11.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0074_G07.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0092_D05.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
ADR01_0047_F07.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0003_G09.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0063_G08.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0068_H08.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0094_C01.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVR01_0089_A08.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVR01_0046_B03.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0035_B03.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0100_A03.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
TCH01_0024_B04.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0084_A02.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVRM1_0095_E09.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVRT1_0004_E08.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVR01_0020_H08.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVRT1_0087_A10.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SKNB1_0027_A08.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0065_G06.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
CLNT1_0097_G03.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
PCT01_0013_D08.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVRT1_0090_G01.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SKNB1_0027_G04.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SKNB1_0092_E12.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
PCT01_0007_C06.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
TES01_0054_E07.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGGCGGAGCGTGGC
SKNB1_0015_D11.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
TES01_0003_A03.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
PST01_0059_D10.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGTGCGTGGC
PST01_0025_G09.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0101_H02.b : TGG*ACCTGGGGGGACGAGATCTCACCGACTACCTCATGAATATACTGACTGAACGTGGC
OVRM1_0213_C07.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVR01_0045_G06.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
PCT01_0014_C08.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVRM1_0055_B06.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0035_A09.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
OVR01_0072_E07.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0072_F11.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0020_H08.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0103_F06.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0044_G05.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
UTR01_0107_A10.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0019_C02.b : TGG*ACCTGGCGGGCCGAGATCTCACCGACTACCTCATGAAGATCCTGACGGAGCGTGGC
SPL01_0073_A03.b : tggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
20110601C-001404 : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
---------+---------+---------+---------+---------+---------+ 773
SPL01_0090_D03.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATNCAGGAGAAGCTGTGC
OVRM1_0121_E05.b : TACTCCTTCNTGACCACTGACGAGCGTGAGATTGTCCGGGACATCCAGGAAAAACTGTGC
SPL01_0061_F12.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0009_H05.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0008_D02.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPLT1_0098_C11.b : TACTCCTTCCTGACactgcggagcgtgagatggtccggaactcaagaaaagctgtgctat
SMG01_0045_G12.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGNACATCAAGGAGAAACTGTGC
SMG01_0031_H06.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATNCAGGAGGAGCTGTGC
SPLT1_0020_F08.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
TCH01_0096_B07.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0099_A07.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVRM1_0044_H09.b : acgtccgcccaccttcggtagatactgaccgttatgatagcggcagtgcattagcccagt
OVRM1_0225_C04.b : TACCCCTTCtgacccctgccgagcaggagattgtccgggcactctaggacaaccgtgctt
LVRM1_0022_D01.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCNGGACATCAAGGAGAAGCTGTGC
OVRM1_0198_G10.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVRM1_0054_C08.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCCGGGACATCAGGAGAAGCTGTGC
SPL01_0022_H04.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SMG01_0053_G02.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAGGGAGAAGCTGTGC
SPL01_0016_D07.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0011_F10.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGAAGAAGCTGTGC
OVR01_0060_D04.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCCGGACATCCAGGAGAAGCTGTGC
OVR01_0066_F05.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGAATGTCCTGGACATCAAGGAGAAGCTGTGC
UTR01_0028_D07.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVRT1_0141_G05.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVRT1_0131_A11.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAAAAGCTGTGC
UTR01_0010_D07.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACCTCAAGGAGAAGCTGTGC
UTR01_0045_E06.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0045_C08.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0042_H09.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVR01_0077_C07.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCCGGACATCAAGGAGAAACTGTGC
UTR01_0086_G07.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVR01_0028_E11.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCANGGAGAAGCTGTGC
SPL01_0079_F03.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0054_E02.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCCAGGAGAAGCTGTGC
SPL01_0071_A08.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATNCAGGAGAAGCTGTGC
UTR01_0057_B10.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAAAAGCTGTGC
OVR01_0055_B05.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCCGGACATCAAGGAGAAACTGTGC
OVR01_0086_B07.b : TACTCCTTCGTGACCACTGCCGAGCGTGAAATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0035_H11.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
CLNT1_0005_D05.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0034_H04.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
BFLT1_0111_D03.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVR01_0049_E08.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0034_D03.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0102_D01.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0056_B11.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0095_E05.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0087_E03.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0063_E03.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0058_E03.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGAGACATCAAGGAGAAGCTGTGC
UTR01_0049_B05.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
TCH01_0050_B07.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVR01_0062_C08.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPLT1_0009_A05.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0004_C05.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0066_C01.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0068_H12.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0086_E03.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0088_F05.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0094_H02.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0009_C07.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0043_B08.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVRT1_0048_H02.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVR01_0011_A12.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
LNG01_0041_A11.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0050_H11.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0076_H12.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVRT1_0020_H01.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0035_C11.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0051_D10.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0060_D02.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
TCH01_0064_G06.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0055_E07.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
CLNT1_0031_B11.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVRM1_0165_G03.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCCAGGAGAAGCTGTGC
SPLT1_0059_A11.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGGACATCAGGAGAAGCTGTGC
SPL01_0011_F07.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0044_H04.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
BKFL1_0095_A12.b : TACTCTTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGNACATCAAGGANAAACTGTGC
TCH01_0090_D09.b : TACTCCTTCGTGACCACTGCCGAGCGTGATATTGTCCGGGACATCAAGGATAAGCTGTGC
BKFL1_0089_E09.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAAGAGAAGCTGTGC
SPL01_0055_A11.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
BKFL1_0020_G02.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCGGGGACATCAAGGAGAAGCTGTGC
BKFL1_0048_C08.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
MLTL1_0079_E05.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
BKFL1_0119_B11.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCGGGGACATCAAGGAGAAGCTGTGC
BKFL1_0025_B05.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0058_G10.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
TCH01_0060_A07.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
BKFL1_0120_F08.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGT
UTR01_0059_H06.b : TACTCCTTCGTGACCACTGCCGGGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
ADR01_0076_E01.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0004_G11.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0019_E09.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVRM1_0007_G08.b : tccgatttagacagctcgcaatcgagagatgatctgacatatatgataacaacgactcta
OVRM1_0073_D07.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGGATGTCCGGGACATCAGGGAGAAGCTGTGC
OVRM1_0126_A07.b : TACTC*TTCGTGACCACTGCCGAGCGTGAGATTGTCGCGGACATCAAGGAGAAGCTGTGC
OVRM1_0003_E03.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVRM1_0053_C07.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVRM1_0025_F07.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0024_A09.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0061_C12.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0026_F08.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0028_C08.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0055_D11.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0023_D08.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0023_C06.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SMG01_0015_H04.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCGGGGACATCAAGGAGAAGCTGTGC
UTR01_0032_B11.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
BFLT1_0140_B02.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCAGGACATCAAGGAGAAGCTGTGC
SPL01_0046_H02.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0101_G06.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVRT1_0122_G10.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0053_F11.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0074_G07.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0092_D05.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
ADR01_0047_F07.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0003_G09.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0063_G08.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0068_H08.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0094_C01.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVR01_0089_A08.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVR01_0046_B03.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0035_B03.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0100_A03.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
TCH01_0024_B04.b : TACTCCTTCGTGACCACTGCCAAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0084_A02.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVRM1_0095_E09.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVRT1_0004_E08.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVR01_0020_H08.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVRT1_0087_A10.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SKNB1_0027_A08.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0065_G06.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
CLNT1_0097_G03.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
PCT01_0013_D08.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVRT1_0090_G01.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SKNB1_0027_G04.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SKNB1_0092_E12.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
PCT01_0007_C06.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
TES01_0054_E07.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCAGGACATCAAGGAGAAGCTGTGC
SKNB1_0015_D11.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
TES01_0003_A03.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
PST01_0059_D10.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
PST01_0025_G09.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0101_H02.b : TACTCCTTCGTGACCACTGCCGAACGTGAGATTGTTCGGGACATCATGGAAAAGCTGTGC
OVRM1_0213_C07.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAA
OVR01_0045_G06.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
PCT01_0014_C08.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVRM1_0055_B06.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0035_A09.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
OVR01_0072_E07.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0072_F11.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0020_H08.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGGGAAGCTGTGC
SPL01_0103_F06.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0044_G05.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
UTR01_0107_A10.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0019_C02.b : TACTCCTTCGTGACCACTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPL01_0073_A03.b : xxxxxxxxxxxxxxxxxTGCCGAGCGTGAGATTGTCCGGGACATCAAGGAGAAGCTGTGC
SPLT1_0096_D06.b : nnnnttgcgagtagaggccgta
SPL01_0037_H09.b : aaggcttatggtggxxxx
SPL01_0034_G04.b :
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
20110601C-001404 : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
---------+---------+---------+---------+---------+---------+ 829
SPL01_0090_D03.b : TATGTAGCC*CTGGACTTTG*AAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCCTCCT
OVRM1_0121_E05.b : TACTTAGCC*CTGGACTTTT*AAATTGACA*GGCCCCTGCCG*CGTCt
SPL01_0061_F12.b : TATGTAGCC*CTGGACTTTTGAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
UTR01_0009_H05.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
UTR01_0008_D02.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPLT1_0098_C11.b : gtaccctggacttttaaatgaaatggccctggcccctcttcctcctcctgaaaaaactac
SMG01_0045_G12.b : TATGTANCC*CTGGACTTTGGAAATGAGAT*GGCCACTGGCG*CGTCC*Ttcctctccnt
SMG01_0031_H06.b : TATGTAGCC*CTGGACTTTGA*AATGAGAT*GGCCACTGGCG*CGTCC*TCCTCCT**CT
SPLT1_0020_F08.b : TATGTAGCC*CTGGACTTTG*AAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
TCH01_0096_B07.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
UTR01_0099_A07.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
OVRM1_0044_H09.b : cgactttgaagcgacactgcgagacggataccttatgccgacaaaaatcacagcacct
OVRM1_0225_C04.b : cgtacctccgcac
LVRM1_0022_D01.b : TACGTAGCC*CTGGACNTTG*AAATGAGAT*GGCCct
OVRM1_0198_G10.b : TACGTAGCC*CTGGACTTTG*AAATGAGAT*GGCCAt
OVRM1_0054_C08.b : TACGTANCC*CTGGACTTTGAAA*TGAGAT*GGCCACTGCCG*CGTCC
SPL01_0022_H04.b : TATGAACCC*CTGAACTTTGAAAATGACAT*GGCCACTGCCG*CGTCC*TCCTGCTCCCT
SMG01_0053_G02.b : TATGTAGCC*CTGGACTTTTAAAATGAGAT*GGCCACTGGCG*CGTCT*TCCTCCTCCTT
SPL01_0016_D07.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0011_F10.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
OVR01_0060_D04.b : TATGTACCC*CTGGACTTTGAAAATGAAAA*GGCCACTGGCG*CGTCCCTCTCCCTCCCT
OVR01_0066_F05.b : TATGTAGCCCCTGGACTTTGAAAATGAGAT*GGCCACTGGCG*CGTCC*CTCCTCTCCCT
UTR01_0028_D07.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
OVRT1_0141_G05.b : TATGTACCC*CTGGACTTTGAAA*TGAGAA*TGCCACTGCCG*CGTCC*TCCTCCTCCTG
OVRT1_0131_A11.b : TATGTAGCC*CTGGACTTTGAAAATGAAAT*GGGCACTGCCG*CGTCC*TCCTC*TTCCT
UTR01_0010_D07.b : TATGTAGCC*CTGGACTTTTGAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
UTR01_0045_E06.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
UTR01_0045_C08.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
UTR01_0042_H09.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
OVR01_0077_C07.b : TATGTACCC*CTGGACTTTGAAAATGAAAT*GGCCACTGGCG*CGTCC*CTCTCCTCCTT
UTR01_0086_G07.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCC*CGTCC*TCCTCCTCCCT
OVR01_0028_E11.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0079_F03.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0054_E02.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0071_A08.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGNCACTGCCG*CGTCC*TCCTCCTCCCT
UTR01_0057_B10.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
OVR01_0055_B05.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
OVR01_0086_B07.b : TATGTAGCC*CTGGACTTTGAAAATGAAAT*GGGCACTGCCG*CGTCC*TCCTCCTCCCT
UTR01_0035_H11.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
CLNT1_0005_D05.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
UTR01_0034_H04.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
BFLT1_0111_D03.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
OVR01_0049_E08.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCT*CTCCCT
UTR01_0034_D03.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
UTR01_0102_D01.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTTC*TCCTCCTCCCT
SPL01_0056_B11.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0095_E05.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0087_E03.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
UTR01_0063_E03.b : TATGTAGCC*CTGGACTTTGAAAATGAAAT*GGCCACTGCCG*CGTCC*TCCTCCTCCC*
UTR01_0058_E03.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
UTR01_0049_B05.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
TCH01_0050_B07.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
OVR01_0062_C08.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
SPLT1_0009_A05.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0004_C05.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0066_C01.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGGCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0068_H12.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
UTR01_0086_E03.b : TATGTAGCC*CTGGACTTTNGAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
UTR01_0088_F05.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0094_H02.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCCTCCT
SPL01_0009_C07.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
UTR01_0043_B08.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
OVRT1_0048_H02.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCCTCCT
OVR01_0011_A12.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
LNG01_0041_A11.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCTTT
UTR01_0050_H11.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
SPL01_0076_H12.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
OVRT1_0020_H01.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0035_C11.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
UTR01_0051_D10.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
UTR01_0060_D02.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
TCH01_0064_G06.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
SPL01_0055_E07.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
CLNT1_0031_B11.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
OVRM1_0165_G03.b : TACGT
SPLT1_0059_A11.b : TATGTAGCC*CTGGACTTTTGAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0011_F07.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
UTR01_0044_H04.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
BKFL1_0095_A12.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGGCG*CGTTC*TCttctccctg
TCH01_0090_D09.b : TATGTACCC*CTGAACTTTGAATATGAGAT*GGCCACTGACG*CGTCC*TCCTCCTCCTT
BKFL1_0089_E09.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCCACTGCG*CGTCC*TCCTCCTCCTG
SPL01_0055_A11.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
BKFL1_0020_G02.b : TATGTAGCC*CTGGACTTTG*AAATGAGAT*GGGCCACTGCG*CGTCC*TCCTCTC*CCT
BKFL1_0048_C08.b : TATGTAGCC*CTGGACTTTG*AAATGAGAT*GGCCACTG*CG*CGTCC*TCCTCCTCCTT
MLTL1_0079_E05.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
BKFL1_0119_B11.b : TATGTAGCC*CTGGACTTTG*AAATGAGAT*GGGCACTGCCG*CGTCC*TCCTCCTC*CT
BKFL1_0025_B05.b : TATGTAGCC*CTGGACTTTNGAAATGAGATGGGCCACTGC*G*CGTCC*TCCNTCTCCCT
UTR01_0058_G10.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCTTCCTCCTT
TCH01_0060_A07.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
BKFL1_0120_F08.b : TATGTAGCC*CTGGACTTTG*AAATGAGATGGGCCACTGC*G*CGTCC*TCCTCCTCCCT
UTR01_0059_H06.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
ADR01_0076_E01.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0004_G11.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0019_E09.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
OVRM1_0007_G08.b : tatcatgattttatttacaatgttattcgcgtctctattctcatttcaactctgctat
OVRM1_0073_D07.b : TACGTAACC*CTGGAC
OVRM1_0126_A07.b : TACGTAGCC*TGGAACTTGG*AAATGAGAG*GGCacggccgcgtcctcctcctccctgga
OVRM1_0003_E03.b : TACGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACT
OVRM1_0053_C07.b : TACGTAGCC*CTGGACTCTG*AAATGAGAT*GGCCACTGCCG*CGTCC*TCCTC
OVRM1_0025_F07.b : TACGTACCC*CTGGACCTTGAAAATGAGAT*GGCCACTGCCG*CGTAC*TCCTCtctgca
SPL01_0024_A09.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TC
SPL01_0061_C12.b : TATGTATGCCTTGGACTTTGAAAATGAGATTGGCCACTGCCGGCGTCC*TCCTCCTCCCc
SPL01_0026_F08.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0028_C08.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0055_D11.b : TATGTAGCC*CTGGACTTTGAAAATGAAAT*GGCCACTGCCG*CGTTCCTCCTCCTCCCT
UTR01_0023_D08.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
UTR01_0023_C06.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SMG01_0015_H04.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*T*CTCCTCCCT
UTR01_0032_B11.b : TATGTATCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
BFLT1_0140_B02.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0046_H02.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0101_G06.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
OVRT1_0122_G10.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0053_F11.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCCTCCT
UTR01_0074_G07.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
UTR01_0092_D05.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
ADR01_0047_F07.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0003_G09.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
UTR01_0063_G08.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
UTR01_0068_H08.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
SPL01_0094_C01.b : TATGTAGCC*CCGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
OVR01_0089_A08.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*AGCCACTGCCG*CGTCC*TCCTCCTCCCT
OVR01_0046_B03.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
SPL01_0035_B03.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0100_A03.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
TCH01_0024_B04.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
SPL01_0084_A02.b : TATGTAGCC*CTGGACTTTAAAAATGAGAT*GGCCACTTGCC*CGTCC*TCCTCCTCC*T
OVRM1_0095_E09.b : TACGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTg
OVRT1_0004_E08.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTTCTCCCT
OVR01_0020_H08.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
OVRT1_0087_A10.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTTTCTCCT
SKNB1_0027_A08.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
SPL01_0065_G06.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
CLNT1_0097_G03.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
PCT01_0013_D08.b : TATGTAGCC*CTGGACTTTGAAATTGAGAT*GG*CACTGCCG*CGTCC*TCCTCCTC*CT
OVRT1_0090_G01.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SKNB1_0027_G04.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
SKNB1_0092_E12.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
PCT01_0007_C06.b : TATGTAGCC*CTGGACTTTNGAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
TES01_0054_E07.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
SKNB1_0015_D11.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
TES01_0003_A03.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
PST01_0059_D10.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
PST01_0025_G09.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
SPL01_0101_H02.b : TATGACCGC*CTGGACTTTGAAAAatgaaatggcaaatgccgggatctcctccttccgga
OVRM1_0213_C07.b :
OVR01_0045_G06.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
PCT01_0014_C08.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
OVRM1_0055_B06.b : TACGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0035_A09.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
OVR01_0072_E07.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0072_F11.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
UTR01_0020_H08.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCTT
SPL01_0103_F06.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
UTR01_0044_G05.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
UTR01_0107_A10.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0019_C02.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPL01_0073_A03.b : TATGTAGCC*CTGGACTTTGAAAATGAGAT*GGCCACTGCCG*CGTCC*TCCTCCTCCCT
SPLT1_0096_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCG*CGTCC*TCCTCCTCCCT
SPL01_0037_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0034_G04.b : ttt
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
20110601C-001404 : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
---------+---------+---------+---------+---------+---------+ 886
SPL01_0090_D03.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
OVRM1_0121_E05.b :
SPL01_0061_F12.b : G*GAGAAGAGCTACGAGCTtgcctgacgggcaggtgaatcaccattcgggaacgaacggc
UTR01_0009_H05.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCAT
UTR01_0008_D02.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACC
SPLT1_0098_C11.b : aaactgcctacgggcaggtattccctcgggaaaaccctttccctgccggaaaccgtttcc
SMG01_0045_G12.b : tggaaaaaaacctattaactgcctgacgggcaagtgatcaccatccgggaccgaacgctt
SMG01_0031_H06.b : T*GNAGAAAGCTATGANCTGCCTGACcggcagtgatcacatcgggaacgagcgcttcgct
SPLT1_0020_F08.b : G*GAGA*GAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGGACGAGCGCTT*
TCH01_0096_B07.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
UTR01_0099_A07.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b : G*GAGA
SMG01_0053_G02.b : G*GAGAAGAGCTATGAACTGCCTGACGGGCCAGTGATCCCCATtcggaacaaccgcttcg
SPL01_0016_D07.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTG
SPL01_0011_F10.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCA
OVR01_0060_D04.b : G*GAAAAGAGCTACAAACTGCCTGACAGGCAGGTGATCACCCTCC*GGGAaacagaccct
OVR01_0066_F05.b : G*GAGAAGAGCTACCAGCTGCCTGACGGGCCAGTGATCACCATCG*GGAACGAagccttc
UTR01_0028_D07.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACa
OVRT1_0141_G05.b : GAGAGA***GCTACNAGCTGCCTGACGGGCAAGTGAT*ACCATCG*GGAcgagcgcttcg
OVRT1_0131_A11.b : G*GAAAAAAACTACNAGCTGCCTGACGGGCAGGTGATCCCCATTC*GGAACaaacccttc
UTR01_0010_D07.b : G*GAGAAAAACTATGAGCTGCCTGAACGGCAGGTGATCCCCATCG*GGAAAGAGCG
UTR01_0045_E06.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT
UTR01_0045_C08.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGGACGAGCGCTTC
UTR01_0042_H09.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
OVR01_0077_C07.b : G*GGGAAAAACTATGAGCTGCCTGACGGGCAGGGGATCCCCCTCG*GGAACCAACGCTTT
UTR01_0086_G07.b : T*GGAGAAAGCTATGAGCTGCCTGACGGGCCAGTGATCACCATCG*GGAAAGAGCGCTT*
OVR01_0028_E11.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0079_F03.b : G*GAGAAGAGCTACAAGCTGCCTGACGGGCAGGTGATCTCCATCC*GGAACGAGCGCTT*
SPL01_0054_E02.b : G*GAGAAGAACTACCAACTGCCTGACGGGCAGGTGATCACCATCG*GGAAACAACGCTT*
SPL01_0071_A08.b : G*GAGAAGAGCTACNAGCTGCCTGACGGGCAGGTGATCACCCTCC*GGGACGAGCGCTT*
UTR01_0057_B10.b : G*GAGAAAAGCTACCAACTGCCCTGACGGGCAGTGATTCCCATCG*GGAACGAGTTCTT*
OVR01_0055_B05.b : G*GAGAAGAGCTACCAGCTGCCTGAACGGGCAGTGATCACCATCC*GGGACGAACGCTTT
OVR01_0086_B07.b : GGGAGAAGAGCTTACATCTTCCTGACGGGCAGGTGATTACCATCG*GGAAACAAGCGCTT
UTR01_0035_H11.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGGACGAGCGCTT*
CLNT1_0005_D05.b : G*GAGAA*AGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAAAGAGCGCTT*
UTR01_0034_H04.b : G*GAGAGGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
BFLT1_0111_D03.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCC*GGGACGAGCGGCT*
OVR01_0049_E08.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
UTR01_0034_D03.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
UTR01_0102_D01.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCGGGGAACGAGCGCTT*
SPL01_0056_B11.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCCACATCG*GGAACGAACGCTT*
SPL01_0095_E05.b : G*GAGAAGAGCTACGAGCTGCCTGACCGGCAGGTGATCACCATCG*GGAACGAGCGCTTT
SPL01_0087_E03.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGGACGAGCGCTT*
UTR01_0063_E03.b : G*GAAAAGAGCTACAAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAAAGAGCGCTT*
UTR01_0058_E03.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
UTR01_0049_B05.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
TCH01_0050_B07.b : G*GAGAAGAGCTATGAGCTGCCTGACNGGCAGGTGATCACCATCG*GGAACGAGCGCTTC
OVR01_0062_C08.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SPLT1_0009_A05.b : G*GAGAAGAGCTACNAGCTGCCTGACGGGGCAGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0004_C05.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0066_C01.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCCAGTGATCGCCATCG*GGGACGAGCGCTT*
SPL01_0068_H12.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
UTR01_0086_E03.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
UTR01_0088_F05.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTC*
SPL01_0094_H02.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0009_C07.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
UTR01_0043_B08.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
OVRT1_0048_H02.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
OVR01_0011_A12.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
LNG01_0041_A11.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
UTR01_0050_H11.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0076_H12.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGTACGAGCGCTT*
OVRT1_0020_H01.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0035_C11.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
UTR01_0051_D10.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
UTR01_0060_D02.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
TCH01_0064_G06.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCANGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0055_E07.b : G*GAGAAGAACTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
CLNT1_0031_B11.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
OVRM1_0165_G03.b :
SPLT1_0059_A11.b : G*NAGAA*AGCTACNAGCTGCCTGACGGGCAGGTGATCACCATCG*GAAACGAGCGCTcc
SPL01_0011_F07.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GG
UTR01_0044_H04.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGC
BKFL1_0095_A12.b : gaaagaactacgacttgctgacgggcaggtgatcacatccgggacgagcgcttcgctggc
TCH01_0090_D09.b : G*GATAA*AACTATGAACTGCCTGACGGGCAGGTGATCAC*ATCG*GGAACGAGCGCTT*
BKFL1_0089_E09.b : N*A**AANAGCTACNAGCTGCCTGACGGGCAGtggtcccatcgggaacggcgccttcgct
SPL01_0055_A11.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCCACATCG*GGAACGAGCGCTTC
BKFL1_0020_G02.b : G*GAGA*GAGCTACGAGCTGCCTGACGGGCAGtgatcacatcgggacgagcgcttcgctg
BKFL1_0048_C08.b : G*GAGA*GAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*Gaacgagcgcttcg
MLTL1_0079_E05.b : G*NAGA*GAGCTATGAGCTGGCTGACGGGCAGGTGATCA*CATCG*GGAacgacgcttcg
BKFL1_0119_B11.b : G*GAGNAGAGCTATGAGCTTGCTGACGGGCAAGTGATCACCATCG*GGAACGAGCGCTTC
BKFL1_0025_B05.b : G*GAGA*GAGCTACGAGCTGCCTGACGGGNCAGTGATCNACATCG*GGAACGAGCGCTTC
UTR01_0058_G10.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
TCH01_0060_A07.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
BKFL1_0120_F08.b : G*NAGAA*AGCTACNAGCTGCCTGACGGGNCAGTGATCACCCATC*GGAACGAGCGCTT*
UTR01_0059_H06.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
ADR01_0076_E01.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0004_G11.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0019_E09.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b : a
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b : gaa
SPL01_0024_A09.b :
SPL01_0061_C12.b : tggaaaaaatcttacaacctgccttgaacgggcaggtgatcccccatcgtgaaacgaacg
SPL01_0026_F08.b : G*GAGAAGAGCTACGAGCTGCCTGACGGG
SPL01_0028_C08.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGT
SPL01_0055_D11.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCCCCATCG*GGAACCAGCGCTTT
UTR01_0023_D08.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
UTR01_0023_C06.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SMG01_0015_H04.b : G*GAGA*GAACTACGAGCTGCCTGAACGGCAGGTGATCACCATCG*G*AACCAGCGCTT*
UTR01_0032_B11.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
BFLT1_0140_B02.b : G*GAGAAGA*CTTCGAGCTGCCTGACGGGCAGGTGATCACCAATC*GGAACGAGCGCTT*
SPL01_0046_H02.b : G*AAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAAAGAGCGCTT*
SPL01_0101_G06.b : G*GAGAA*AGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
OVRT1_0122_G10.b : G*GAAAAAA*CTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0053_F11.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGGACGAGCGCTT*
UTR01_0074_G07.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGGGATCACCATCG*GGAACGAGCGCTT*
UTR01_0092_D05.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
ADR01_0047_F07.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0003_G09.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
UTR01_0063_G08.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
UTR01_0068_H08.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0094_C01.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GAAACGAGCGCTT*
OVR01_0089_A08.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGGACGAGCGCTT*
OVR01_0046_B03.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0035_B03.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0100_A03.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
TCH01_0024_B04.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0084_A02.b : G*GAAAAAAACTACCAACTTGCTGACGGGCAGGTGATtaccttcgggaaacaagcgcttc
OVRM1_0095_E09.b : ga
OVRT1_0004_E08.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
OVR01_0020_H08.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
OVRT1_0087_A10.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGGACGAGCGCTT*
SKNB1_0027_A08.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCANGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0065_G06.b : G*GAGAAGAGCTACNAACTGCCTGACGGGCAGGTGATCACCATCG*GGAAACGACGCTT*
CLNT1_0097_G03.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCANGTGATCACCATCG*GGGACGAGCGCTT*
PCT01_0013_D08.b : G*GAGAA*AGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTTC
OVRT1_0090_G01.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTTC
SKNB1_0027_G04.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCANGTGATCACCATCG*GGAACGAGCGCTTC
SKNB1_0092_E12.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
PCT01_0007_C06.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
TES01_0054_E07.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCANGTGATCACCATCG*GGAACGAGCGCTT*
SKNB1_0015_D11.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
TES01_0003_A03.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
PST01_0059_D10.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
PST01_0025_G09.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0101_H02.b : aaaaaagctaacagctgcctgaagggtggctgatatctttcttaacaagagtttcttttt
OVRM1_0213_C07.b :
OVR01_0045_G06.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
PCT01_0014_C08.b : G*GAGAAGAGCTGCGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
OVRM1_0055_B06.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0035_A09.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
OVR01_0072_E07.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGGTCACCATCG*GGAACGAGCGCTT*
SPL01_0072_F11.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
UTR01_0020_H08.b : G*GAGAAGAGCTATGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0103_F06.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
UTR01_0044_G05.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
UTR01_0107_A10.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0019_C02.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0073_A03.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SPLT1_0096_D06.b : G*GAGAAGAGCTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0037_H09.b : xxxxxxxxxggTACGAGCTGCCTGACGGGCAGGTGATCACCATCG*GGAACGAGCGCTT*
SPL01_0034_G04.b : ttagcatggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0049_B05.b :
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
20110601C-001404 : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
---------+---------+---------+---------+---------+---------+ 943
SPL01_0090_D03.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
OVRM1_0121_E05.b :
SPL01_0061_F12.b : tttccgctgtccccggaaaccctgtttcccaccccctcctttcatccggggaagggaatc
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b : gcctctttatcggatggattcggtggctctcttaacccctaaaaccttctgaatgcacct
SMG01_0045_G12.b : ccgctgcccggaaaacctgtttccaccctcctttctccgggatggaatccggctggctcc
SMG01_0031_H06.b : gccggaaaccctggtcaaccctccttatcgggaaggatctgctggatcctggaaccccct
SPLT1_0020_F08.b : TCCCTGCCCGGA*A*CCCTGGTCCAGCC*CTCCTCCATCGGatggattctgctggcatcc
TCH01_0096_B07.b : CCCGCTGCCCGAGA*CCCTGTTCCAGCC*CNTCCTCATCGGNATG*GAGTCTGCTGGCAT
UTR01_0099_A07.b : TCGCTGCCCGGAGA*CCCTGTTTCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b : ctgcccggaaaacctggtccaccctccctcatcgggaggaagtctgctggcttcatgaaa
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b : tcccctgccccggaaacccttgttccagcccttcctttattcgggatgggaatttgcctg
OVR01_0066_F05.b : cctggcccgagaccctggttccacccttcctcctctggatggaaaccgctggcctccttg
UTR01_0028_D07.b :
OVRT1_0141_G05.b : ctgcccngaaacctgttcagccctctttctcggatggatctgctggctcatgaaccacta
OVRT1_0131_A11.b : gccttgcccgaaaccctgttcagccctcctttcttgggatggaatccgctggcatcctga
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b : CCGCTGC
OVR01_0077_C07.b : CCCTGGCCGGAAAA*CCCTGTTCagcccctctttcattgggatggaacctggctgggctc
UTR01_0086_G07.b : CCGCTGCCC*GAGA*CCCTGTTCCAGCC*CTCttcttcggatgaagtctgctggctccct
OVR01_0028_E11.b : CCGCTGCCCGGAGA*CCCTGTTTCAagccctccttcatccgggatgaagtctgctggcat
SPL01_0079_F03.b : CCGCTGCCCGGAGA**CCTGGTCCAGCC*CTCCTcatcgggatgaatctgctggctccat
SPL01_0054_E02.b : CCGCTGCCCGGGAG*ACCTGGTTCAGCC*CTCCTTtcatcgggatgggatcctggctggc
SPL01_0071_A08.b : CCGCTGCCCGGA*A*CCCTGTTCCAGCC*CTTCTTCATCcgggatggattctgcttggct
UTR01_0057_B10.b : CCCCTGCCCGGAAA*ACCTGGTTCAGCC*CTTCTTCATCcgggagggaatctgcttgcat
OVR01_0055_B05.b : CCGCTGCCCCGAAA*ACCTGTTTCAGCC*CTCCTTTATCGGGAatggaatctgcttggct
OVR01_0086_B07.b : TCCCTGCCCGGAGA*CCCTGTTTCAGCCCCTCTTTCATCGGGATG*GAagtttgctgggc
UTR01_0035_H11.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GA
CLNT1_0005_D05.b : TCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCTT
UTR01_0034_H04.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCT
BFLT1_0111_D03.b : TCGCTTGCCGGAGA*CCCTGTTCC*GCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
OVR01_0049_E08.b : CCGCTGCCCGGAGA*CCCCTGTTCAGCC*CTCCTTCATCGGGATG*GAATCTGCTGGCAT
UTR01_0034_D03.b : CCGCTGCCTCGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
UTR01_0102_D01.b : CTGCTGCCCCGAGA*CCCTGGTTCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCTT
SPL01_0056_B11.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCCCCTCCTTCATCGGGATG*GAGTCTGCTGGCAT
SPL01_0095_E05.b : CGCTGGCCGGGAGA*CCCTGTTCCAGCCCTCCCTTCTTCGGGATG*AAGTCTGCTGGCAT
SPL01_0087_E03.b : CCGCTGCCCGGAGA*CCCTGTTTCAGCC*CTCCTTCCTCGGGATG*GAGTCTGCTGGCAT
UTR01_0063_E03.b : CCGCTGCCCGGAAA*CCCTGTTCCGCCC*CTCTTTCACCGGGATG*GAGTCTGCTGGCTT
UTR01_0058_E03.b : CCGCTGCCCGGAGA*CCTGGTTCAGCCC*CTCCTTTCTCGGGATG*GAGTCTGCTGGCAT
UTR01_0049_B05.b : CCGCTGCCCGGAGA*CCCTGTTTCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
TCH01_0050_B07.b : CGCTGCCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
OVR01_0062_C08.b : CCGCTGCCGGGA*A*CCCTGTTCCAGCC*CTCCCTCATCCGGATG*GAGTCTGCTGGCAT
SPLT1_0009_A05.b : CCGCTGCCCGGAAA*CCCTGTTCCAGCC*CCTCTTCATCGGGATG*GAGTCTGCTGCC*T
SPL01_0004_C05.b : CCGCTGCCCGGAGA*CCCTGTTTCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
SPL01_0066_C01.b : TCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCTTTTCTCGGGATG*GAGTCTGCTTGGCT
SPL01_0068_H12.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCNTCATCGGGATG*GAGTCTGCTGGCAT
UTR01_0086_E03.b : CCGCTGCCCCGGAG*ACCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
UTR01_0088_F05.b : CCGCTGCCCGGAGA*CCCTGGTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
SPL01_0094_H02.b : CCGCTGCCCGGAGA*CCCTGNTTCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
SPL01_0009_C07.b : CCGCTGCCCGGAGA*CCCTGTTTCAGCC*CTCTTTCATCGGGATG*GAGTCTGCTTGCAT
UTR01_0043_B08.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
OVRT1_0048_H02.b : CCGCTGCCCGGAGA*CCCTGTTTCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
OVR01_0011_A12.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
LNG01_0041_A11.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
UTR01_0050_H11.b : CCGCTGCCCGGAGA*CCCTGTT*CAGCC*CCTCTTCATCGGGATG*GAATCTGCTGGCAT
SPL01_0076_H12.b : CCGCTGCCCGGGAG*ACCCTGTTCAGCC*CNTCTTCTTCGGGATG*GAGTCTGCTGGCAT
OVRT1_0020_H01.b : CCGCTGCCCGGAGA*CCCTGTTTCAGCC*CTCCTTCATCGGGATG*GATTCTGCTGGCAT
SPL01_0035_C11.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
UTR01_0051_D10.b : CCGCTGCCCGGAGA*CCCTGTCCCCGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
UTR01_0060_D02.b : CCGCTGCCCCGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
TCH01_0064_G06.b : CCGCTGCCGGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
SPL01_0055_E07.b : CCGCTGCCCGGAGA*ACCTGTTCCAGCC*CTCCCTCATCCGGGATGGAGTCTGCTGGCAT
CLNT1_0031_B11.b : CCGCTGCCCGGAGA*ACCTGTTCCACCC*CTCCCTCATCGGGATG*GAGTCTGCTGGCAT
OVRM1_0165_G03.b :
SPLT1_0059_A11.b : gctggccgaagacctgttccagcctccttcatccggatggatctgctggcatcatgaaac
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b : cggaaccctgttcaggcctcttcttcggatggaatcgctggctcctggaaccccctaaaa
TCH01_0090_D09.b : CCGCTGCCTGAAGA*CCGTGTTCatccactcttcttggtgaggattctgatggctccact
BKFL1_0089_E09.b : gcccgaaacctgtttcaaccttcttcctcgggaggagccgctggcttcctggaaccccta
SPL01_0055_A11.b : CCCTGCCCGGGA***CCCTGTTTCCGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
BKFL1_0020_G02.b : cccgagacctngtcagcctcctcatcggnatgagtcgctgcatcatgaaccactacacag
BKFL1_0048_C08.b : ctgcccggagacctgttccgncctcntcatcgggatggagtctgctgcatcatgaaacac
MLTL1_0079_E05.b : ctgcccggagaccctgtccagctttcttcatcggatgatctgctgggatcatgaaaccac
BKFL1_0119_B11.b : gctgcccggaaacctgttccagccctcttcatcgggatgaatcggctgggctcatgaaac
BKFL1_0025_B05.b : CCGCTGCCGgagaccttgtncagcctcnntcatcggatgagtctgctggcatcatgagaa
UTR01_0058_G10.b : CCGCTGCCCGGAAA*CCCTGTTCCACCC*CTCCTTCCTCGGGATGGGAATCTGCTGGGAT
TCH01_0060_A07.b : CCGCTGCCCGGAGA*CCCTGTTNCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
BKFL1_0120_F08.b : CCGCTGCCCCGAGA*ACCTGTTCCCAGC*CTCCT*CATCGGNATG*GAGTCTGCTGGCAT
UTR01_0059_H06.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
ADR01_0076_E01.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
SPL01_0004_G11.b : CCGCTGCCCGGAAA*CCCTGTTTCAACC*CCTCTTCATCGGGATG*GAGTCTGCTGGCAT
SPL01_0019_E09.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b : gctttccccttgcccggaaaacccttgttcccagcccctcctttcattcggggatggaag
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b : CCCCTGCCCcgaaaaccctgttcccgcccctccttcatccgggatggaatcctgcttggc
UTR01_0023_D08.b : CCGCTGCCCG
UTR01_0023_C06.b : CCGCTGCCCGGA
SMG01_0015_H04.b : TCGCTGCCCGGA*A*ACCTGTTTCAGCCttcctcatcgggatggaacctgcctgcatcct
UTR01_0032_B11.b : CCGCTGCCCGGAGA*CCCTGT
BFLT1_0140_B02.b : CCGCTGCCCCGAGA*CCCTGTT*CAGCC*TTCCTTatcgggatggatcggctggctccat
SPL01_0046_H02.b : CCGCTGCCCGGAAA*CCCTTGTCCACCC*CTCCTTCTTCGGAATG*GAtctgctggcatc
SPL01_0101_G06.b : CCCCTGCCCGG*GA*CCCTGTTCCAGCC*CTCCT*CATCGGGATG*GAGTCTGCTGGgat
OVRT1_0122_G10.b : CCGCTGCCCGGA*A*ACCTGTTCCCGCC*CTCCTTCATCGG**AG*GAGTCTGCTGGCAT
SPL01_0053_F11.b : CCGCTGCCCGGAGA*CCCTGTTTCAGCC*CTCCCTTCTCGGGATG*GAGTCTGCTGGCAT
UTR01_0074_G07.b : CCGCTGCCCGGAAA*CCCTGTTCCAGCC*CCTCTTTCTCGGGATG*GAATCCGCTGGGAT
UTR01_0092_D05.b : TCGCTGCCCGGAGA*CCCTGTTCCAGCC**TCCTTCATCGGGATG*GAGTCTGCTGGCAT
ADR01_0047_F07.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
SPL01_0003_G09.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CCTCTTCATCGGGATG*GAGTCTGCTGGCAT
UTR01_0063_G08.b : CCGCTGCCCGGAGAACCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
UTR01_0068_H08.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCCCCTCCTTCATCGGGATG*GAGTCTGCTGGCAT
SPL01_0094_C01.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
OVR01_0089_A08.b : CCGCTGCCCGGAGA*CCCCTGTTCAGCC*CTCCTTCATCCGGATG*GAGTCTGCTGGCAT
OVR01_0046_B03.b : TCGCTGCCCGGAGA*CCCTGTTTCAGCC*CCTCTTCATCGGGATG*GAGTCTGCTGGCAT
SPL01_0035_B03.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
SPL01_0100_A03.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCCCCTCCTTCATCGGGGATGGAGTCTGCTGGCAT
TCH01_0024_B04.b : CCGCTGCCCGGAGA*CCCTGTT*CAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
SPL01_0084_A02.b : ccctggcccggaaaacctgtttccacccctcctttatcgggaatgggattttgttggcct
OVRM1_0095_E09.b :
OVRT1_0004_E08.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAATCTGCTGGCAT
OVR01_0020_H08.b : TCGCTGCCCCGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
OVRT1_0087_A10.b : CCGCTGCCCGGAGA*CCCTGTTTCAGCC*CCTCTTCATCGGGATG*GAGTCTGCTGGCAT
SKNB1_0027_A08.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
SPL01_0065_G06.b : CCGCTGCCCGGAGA*CCCTGTTTCAACC*CTCCTTCATCGGGATG*GAGTCCGCTGGCAT
CLNT1_0097_G03.b : CCGCTGCCCGGAGA*CCCTGTT*CAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
PCT01_0013_D08.b : CCGCTGCCCGAGA***CCTGNTTCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
OVRT1_0090_G01.b : CCGCTGCC**GAGA*CCCTGTTCCAGCC*CTCCTTCATTCGGATG*GAGTCTGCTGGCAT
SKNB1_0027_G04.b : CCGCTGCCCG*AGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
SKNB1_0092_E12.b : CCGCTGCCCGGAGA*CCCCTGTTCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
PCT01_0007_C06.b : CCGCTGCCCGGA*A*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
TES01_0054_E07.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
SKNB1_0015_D11.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
TES01_0003_A03.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTTTGCTGGCAT
PST01_0059_D10.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
PST01_0025_G09.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
SPL01_0101_H02.b : ctggagaaccaggtccgacccctccttcttgggaaagaattatgggggtttccctgaaac
OVRM1_0213_C07.b :
OVR01_0045_G06.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
PCT01_0014_C08.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
OVRM1_0055_B06.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCn
SPL01_0035_A09.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
OVR01_0072_E07.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
SPL01_0072_F11.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
UTR01_0020_H08.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
SPL01_0103_F06.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
UTR01_0044_G05.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
UTR01_0107_A10.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
SPL01_0019_C02.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
SPL01_0073_A03.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
SPLT1_0096_D06.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
SPL01_0037_H09.b : CCGCTGCCCGGAGA*CCCTGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
SPL01_0034_G04.b : xxxxxxxxxxxxxxxxxxxGTTCCAGCC*CTCCTTCATCGGGATG*GAGTCTGCTGGCAT
SKNB1_0049_B05.b : nn
SKNB1_0066_A12.b :
ILNT1_0023_A11.b :
20110601C-001404 : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GACC
---------+---------+---------+---------+---------+---------+ 999
SPL01_0090_D03.b : CCATG*AGAC*ACCTACA*CAGC*ATCATGGAGTGCGA*CATgacatcaggaagactcta
OVRM1_0121_E05.b :
SPL01_0061_F12.b : ttggctgggcattccattgaaaaacccccttaacaaacagcctttcattgaaagttgccg
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b : ttgattgggagagcctcttttaaaactcctctgggggaccccgttccccgcttgcaaccc
SMG01_0045_G12.b : atgaaaacccctaaaacgcctcttggaatgggaattttacctccgggaggacccctttgc
SMG01_0031_H06.b : acaaagcttcttaatgcgacttgtatccggaaagacccttttctaacacgcttcttgggg
SPLT1_0020_F08.b : ctgaaaccccttacacagcctcatggaatgggacttgacatcaggaaggacctctatgta
TCH01_0096_B07.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CTTTGACATTCAGGAG*GACC
UTR01_0099_A07.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAA*GACT
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b : ccccctacaacacctcctgaagtggcaattttactctcggaaggaccctttgctaaaacg
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b : gtttccctggaaacccccttatcacagcgattctttaaagggcgaacttttgaaattccg
OVR01_0066_F05.b : aaaccccctacaacagcctcctggagggcgacttggccttccgaaaggaccctcatgcta
UTR01_0028_D07.b :
OVRT1_0141_G05.b : cacagcttctgagtgcacattactccggaggactcttgccaacacttctctctggggccc
OVRT1_0131_A11.b : aaccccctacacagcatcatgaattgccaccttgacctccgggaggacctctttcctaca
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b : ccttaaaaccccctcccaaagcatctctgaaggggcacctttgcctccgggaagggactc
UTR01_0086_G07.b : gaagaccacctacaacagcatcttgaaatgccacttgtgcctcggaagggacttcttgct
OVR01_0028_E11.b : ccatgaagaccaccttacacagcatcctgaattgcaacttttgacttcaggaggacctct
SPL01_0079_F03.b : gagacccctacaacgcatcttaagtgcgacttgacttccggaaggaccttctttctaaca
SPL01_0054_E02.b : atccctgaaaaccacctaccacaagcctccgggaaagggcacctttgcattcccggaagg
SPL01_0071_A08.b : cctttgaaaccccctacacagcctcctggaatggccactttgacctccggaaggacctct
UTR01_0057_B10.b : catggaaaccccctaccccgccttcttaaagtggcgactttgaaatccgggaaggaccct
OVR01_0055_B05.b : tccttagaccccccttcaacaagcatcttgtaagtgcgaaatttgcattccggaagggac
OVR01_0086_B07.b : tccctggagaaccccttacaaacaggcattatgaagtggcgacatttgactttccggaaa
UTR01_0035_H11.b :
CLNT1_0005_D05.b : CCtgaaaacacctacaacagcttcttgaatgggactttgactccggaaagaaccctttgc
UTR01_0034_H04.b :
BFLT1_0111_D03.b : Catgagaacacctacaacggcttcctgaagtgcgacttgacctccgggaggaactctttg
OVR01_0049_E08.b : CCTTG*AAACCACtacaacagcatctggaaatggcactttgacttcgggaaggacttcta
UTR01_0034_D03.b : CCATG*AGAACACCTA
UTR01_0102_D01.b : CCATG*AAACCACCTACAACgcctcttgaagtgccaccttacatcagggaaggacctcta
SPL01_0056_B11.b : CCATG*AGAACACCTTCAACAGCctcctggaatgccgacattgacttcaggaaagaccct
SPL01_0095_E05.b : CCATG*AGACCACCTTCAACAGCcttcctgaagtgccactttgacattcaggaaggacct
SPL01_0087_E03.b : CCATG*AAAACACCCTCAACAGC*ATCATGAAatggcgaacttgacctcagggaagacct
UTR01_0063_E03.b : CCATG*AAACCACCCACAACACCATCcttgaatggcaactttgacctccaggaaggaccc
UTR01_0058_E03.b : CCATG*AAACCccttacacagcctcatgaaatgcgacattgacctcagggagggactcct
UTR01_0049_B05.b : CCATG*AAACCATCTACAACAGC*ATCATGAAGTGgcaactttgacatccgggaaggacc
TCH01_0050_B07.b : CCATG*AAAC*ACCTACAACAGC*ATCTTGAAGTGCGA*CCTTGACATCgggaggacctc
OVR01_0062_C08.b : CCATG*AGACCACCTAACACAGC*ATCATGAAGTGCGA*CTTTGACttcggaaggacctc
SPLT1_0009_A05.b : CCATG*AAACCACCTACACAGC**ATCATGAAATGCGA*CATTGACTTCAGGAAG*GACC
SPL01_0004_C05.b : CCATG*AGACCCACTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAaggacc
SPL01_0066_C01.b : CCATG*AGACCACCTACAAACAG*CTCATGAAGTGCGA*CATTTACATCAGGAAGGACtc
SPL01_0068_H12.b : CCATG*AGACCACCTACACAGC**ATCATGAAGTGCCA*CATTGACATCAGGAAA*GACC
UTR01_0086_E03.b : CCATG*ANACCATCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GACC
UTR01_0088_F05.b : CCATG*AAAACCTCTACAACAGC*ATCATGAAATTGCG*ACTTGACCTCCGGAAG*GACC
SPL01_0094_H02.b : CCATG*AGACCACCCTACACAAC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GAAC
SPL01_0009_C07.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCCA*CATTGACCTCAGGAAA*GACC
UTR01_0043_B08.b : CCATG*AGACCACCTACAACAGC*ATCATGAAATGCGA*CATTGACATCAAGAAG*GACC
OVRT1_0048_H02.b : CAATG*AAACCACCTAACACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GACC
OVR01_0011_A12.b : CCATG*AGAACACCCTACACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GACC
LNG01_0041_A11.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCCGGAAGGGACC
UTR01_0050_H11.b : CCTTG*AGACCCCCTACACAGC**ATCATGAAGTGCGA*CTTTGACATCCAGAAG*GACC
SPL01_0076_H12.b : CCTTGGAAACCACCTACCACAGC*ATCTTGAAGTGCGA*CATTGACTTCAGGAAG*GACC
OVRT1_0020_H01.b : CCATG*AGAACCACTACAACAGC*ATCATGAAGTGCCA*CATTGACTTCAGGAAA*GAAC
SPL01_0035_C11.b : CCCCCGAAACCACCTACAACAGC*ATCATGAAATGCGA*CATTGACATCAGGAAG*GACC
UTR01_0051_D10.b : CCATG*AAACCACCTACAACAGC*ATCATGAAATGCGA*CATTGGACTCAGGAAG*GACC
UTR01_0060_D02.b : CCATG*AGACCACCTACAACAGCATCATGAAATGGCGA*CATTGACATCAGGAAG*GAAC
TCH01_0064_G06.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAANGGA*C
SPL01_0055_E07.b : CCATG*AGACCACCTACAACAGC*ATCTTGAAGTGCGA*CCTTGACCTCAGGAAG*GACC
CLNT1_0031_B11.b : CCTTG*AAACCACCTACAACAGC*ATCATGAAGTGCGA*CAATGACATCAGGAAA*GACC
OVRM1_0165_G03.b :
SPLT1_0059_A11.b : acctacaacacctcctgaatgcgacttgacttcggaaggccttttgctaacacttcctct
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b : agctttgaatggggacctggactccggaggactttttgctaaacgtcctctgggggccca
TCH01_0090_D09.b : gaacaccttatacagcctcgtgaagtgcgacattccttcgggaatgaactctatgcttat
BKFL1_0089_E09.b : aacgcctctgtaggggatttgattcgggaggcccttttttaaactcccttccggggcccc
SPL01_0055_A11.b : Catgaaaccccctacaacagcttcctgaagtgcgacttttacttcggaaaggacctccta
BKFL1_0020_G02.b : ctcttgaatggacttgactcaggggacctctgctacacgtctcctggggccccctgtccc
BKFL1_0048_C08.b : ctacacagctctgaantgcacatgactcnggaggactcttgctacacgtcctccggggga
MLTL1_0079_E05.b : ttacacgcctcctaagtgcgatttgactccggaagaccccttgctaccacgtccctctgg
BKFL1_0119_B11.b : ccctacacagcatcatgaatggcgattggattcaggaagaccttttgctacaacgtccct
BKFL1_0025_B05.b : cactacacagcatcatgaatgcgacttgacctcaggaggacctcttgctaacacgtcctt
UTR01_0058_G10.b : CCATG*AAACCCCCCTCAACACC*TTCTTGAATTGCGA*CATTGACATCcaggaaggaac
TCH01_0060_A07.b : CCATG*AGACCACCTTACACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAA**GGAC
BKFL1_0120_F08.b : Catgagacacctacacagcctcatgaaatgcgacttgacctcgggaggacttcttggcta
UTR01_0059_H06.b : CCATG*AGACCACCCTACACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GACC
ADR01_0076_E01.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCANGAAG*GACC
SPL01_0004_G11.b : CCATG*AACCCCCCTACACAGC**ATCATGAAATGCAA*CATTGACATCAGGAAaggacc
SPL01_0019_E09.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GACC
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b : ttctgcttggccaatccaattgaaaaaccacccttacaaaaggcttatctttgaaattgg
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b : atcccttgaaaaccacccttccaaagccttcttggaattgcgaacctttgaactcccgga
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b : tgaaaccccctacaaagcttcctggaatgcgacatggacttcaggaaggacccccttgct
UTR01_0032_B11.b :
BFLT1_0140_B02.b : agacccctacaacgcctcctgagtggaacttgactcgggaggaccttttgcaacaactcc
SPL01_0046_H02.b : cctgaaaccccctaaacagcatcatgaaatgccacattgacattcggaaggaccctcttt
SPL01_0101_G06.b : catgagaccacctacacagcttcatgaatgcgacattgacctcggaagggactctatgct
OVRT1_0122_G10.b : CCATG*AAACCCCCTACAACAcctccatgaatgcgaccttgacattcggaaggacctctt
SPL01_0053_F11.b : CCTTG*AAACCACCTACCACAGC*ATCATTGAGTGCGA*CATTGACATCcaggaaggacc
UTR01_0074_G07.b : CCTTG*AAACCACCTACAACAGTTATCCTGAAGTGCGA*CATTGACCTCAGGAAGGgact
UTR01_0092_D05.b : CCATG*AGACCACCTACCACAGC*ATCATGAAGTGCGA*CTTTGACATCAGGAAGGGAC*
ADR01_0047_F07.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATTCAGAAAGGAC*
SPL01_0003_G09.b : CCATG*AAACCACCTACAACAGC*ATCATGAAATGCGA*CATTGACATCAGGGAAGGACC
UTR01_0063_G08.b : CCCTTGAGACCACCTACAACAGC*ATCCTGAAGTGCGA*CATTGACATCAGGAAA*GACC
UTR01_0068_H08.b : CCATG*AGACCACCCTCAACAGCATCATTGAAGTGCGAACATTGACCTCAGGAAG*GACC
SPL01_0094_C01.b : CCATG*AGACCACCTACCACAGC*ATCATGAAGTGCGA*CTTTGACATCAAGAAG*GACC
OVR01_0089_A08.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CTTTGACATCAGGAAG*GACC
OVR01_0046_B03.b : CCATG*AGACCACCTACCACAGC*ATCATGAAATGCGA*CCTTGAACTCAGGAAAGGAC*
SPL01_0035_B03.b : CCATG*AAACCACCTACCACAGC*ATCATGAAATGCGA*CATTGACTTTCAGAAA*GACC
SPL01_0100_A03.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCCGGAAAGGAC*
TCH01_0024_B04.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAAGAAG*GACC
SPL01_0084_A02.b : cccttgaaaacaccttacacaacctttttgaaatgtcggatttttccttcggggagggaa
OVRM1_0095_E09.b :
OVRT1_0004_E08.b : CCATG*AGAC*ACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GACT
OVR01_0020_H08.b : CCATG*AGAACACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GACC
OVRT1_0087_A10.b : C*ATG*AAGACACCTACAACAGC*ATCATGAGGTGCGA*CATTGACATTCAGGAG*GAAC
SKNB1_0027_A08.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAA*GACC
SPL01_0065_G06.b : CCATG*AAACCACCTAACACAGC*TTCATGTAGTGCcaactttgaatcagggaaggacct
CLNT1_0097_G03.b : CCATG*AGAACACCTACAACAGC*ATCATGAGGTGCGA*CATTGACATCAGGAAG*GACC
PCT01_0013_D08.b : *CATG*AGACCACCTACNACAGC*ATCATGAAGTGCGA*CTTTGACCTCAGGAAG*GACC
OVRT1_0090_G01.b : CCATG*AGACCACTTACAACAGC*ATCATGAAGTGCAA*CATGGACATCAGGAAG*GACC
SKNB1_0027_G04.b : CCATG*AGACCACCTACNACAGC*ATCATGAAATGCGA*CATTGACATCAGGAAG*GACC
SKNB1_0092_E12.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGGCATCANGAAG**GAC
PCT01_0007_C06.b : CCATG*AGACCACCTACTACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GAAC
TES01_0054_E07.b : CCATG*AGACCACCTACCACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GACC
SKNB1_0015_D11.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCANGAAG*GACC
TES01_0003_A03.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GACC
PST01_0059_D10.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCANGAAG*GACC
PST01_0025_G09.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCANGAAG*GACC
SPL01_0101_H02.b : aacttacaaacctttcttaaatgggaacatttaaatcaggaagggactcctatcttgaaa
OVRM1_0213_C07.b :
OVR01_0045_G06.b : CCATG*AGACCACCTACCACAGC*ATCATGAAGTGCGA*CATTGACATCAAGAAG*GACC
PCT01_0014_C08.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAAGAAG*GACC
OVRM1_0055_B06.b :
SPL01_0035_A09.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GACC
OVR01_0072_E07.b : CCATG*AGACCACCTACCACAGC*ATCATGAAGTGCGA*CATTGACATCCAGGAA*GACC
SPL01_0072_F11.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GACC
UTR01_0020_H08.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GACC
SPL01_0103_F06.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GACC
UTR01_0044_G05.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GACC
UTR01_0107_A10.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GACC
SPL01_0019_C02.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GACC
SPL01_0073_A03.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GACC
SPLT1_0096_D06.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GACC
SPL01_0037_H09.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GACC
SPL01_0034_G04.b : CCATG*AGACCACCTACAACAGC*ATCATGAAGTGCGA*CATTGACATCAGGAAG*GACC
SKNB1_0049_B05.b : nnttttnnnnnnnccaacgttggctatggagAGTGCGA*CATTGACATCAGGAAG*GACC
SKNB1_0066_A12.b : nnaaacnnnnnnnaggata
ILNT1_0023_A11.b :
20110601C-001404 : TCTATGCTAACAACGTC*CTCTCT*GGGGGCACCACCATGTACCCCGGCATTGCCGACCG
---------+---------+---------+---------+---------+---------+ 1057
SPL01_0090_D03.b : tgctaccacgtcctcttggggggacaacatgtaccccgcatggcaacccatgcaaaagg
OVRM1_0121_E05.b :
SPL01_0061_F12.b : aacttttgacccttccagggaaaggggaccttccttttgccttaaaaaaagcgttccctt
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b : gtcaaaaaattaacccctgcccccccctgaaataatatttgtccccagaccaaaaccccg
SMG01_0045_G12.b : taaaaagtccctcctgggggcccacctgttcccccggtttgccaaccctggcaaaaagaa
SMG01_0031_H06.b : ccccccctgtacccggatttcaacccatgcaaaagaaatcacccctggcccccccccgaa
SPLT1_0020_F08.b : acacctccttcttggggccccccctgttacccggctttgccgacccaggcaaaggaatta
TCH01_0096_B07.b : TCTATGCTAACAACGTC*CTCTCT*GGGGGCACaacatgtacccggcattgccgacgcat
UTR01_0099_A07.b : TCTATGCTAACAACGTC*CTCTCT*GGGGGCACCCACATGTACCCCGGCATTGCCGACCG
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b : ccctcttgggggcaccacctgttccccggctttcccaacccttcaaaaggattccacccc
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b : gaagggaacccttttgtgttaaaaacgttcctctttgtggggggcccccccccttgttac
OVR01_0066_F05.b : aaaaagcccttccggggggccccccctggtccccccgccttttctaacccctggcaaaag
UTR01_0028_D07.b :
OVRT1_0141_G05.b : cctttccccggtttccaccctcaaaagaatcacccctgccccccccgaaataaattttcc
OVRT1_0131_A11.b : ccttcctttctggggccccacccttttaccccggcttgcccaacccctggaaaaagaaat
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b : ttttggttacaacgttccccttttggggggcaccacctggtacccccgggatttcccaac
UTR01_0086_G07.b : aacaacgtccttcctgggggaaccccctgtaaccccgcctttgcccacacccatgcgaaa
OVR01_0028_E11.b : attctaaccacctccctctcctgggggcaccaccccttgaacccccggcatttcccaacc
SPL01_0079_F03.b : actcctctctggggcccccccatgttaccccggcattgccgaccgcttgcaaaaggagat
SPL01_0054_E02.b : gacttcattgcctaaaaacgttcctcttctggggggccccccccatggttaccccggcct
SPL01_0071_A08.b :
UTR01_0057_B10.b : ttattgctaataaaccttcctctctgggggggcaaccccctgtacccccggcttttgcca
OVR01_0055_B05.b : ctctatgtttataaaccgtccctctcttggggggcacccccaagttacccccggcttttt
OVR01_0086_B07.b : ggacctctttggctaaaaacggtcctttctgggggggtcccacttggtaaccccgggatt
UTR01_0035_H11.b :
CLNT1_0005_D05.b : taacaagtcctctctgggggcccaacctgtacccggctttgccaacccattcaaaaggaa
UTR01_0034_H04.b :
BFLT1_0111_D03.b : ctacaacgtcctcctgggggcaccacatggtcccccggcttcccaaacgctgcaaaagga
OVR01_0049_E08.b : tgcttacacgtcctttctgggggcaccacctgtaccccggcattgccgaacgcttgcaaa
UTR01_0034_D03.b :
UTR01_0102_D01.b : tgctaacaacgtcctctcggggggcaccccctggtaccccggctttgccaaccccttgca
SPL01_0056_B11.b : ccatgctaaaaaccgccctctcctggggggccccacctggtaccccgggcatttccgaac
SPL01_0095_E05.b : ccttgtctaacaaccttcttctctggggggccccccccctgtaaccccggcatttgccaa
SPL01_0087_E03.b : ctttgctaacacgtcctcctctgggggccccacctgttaccccggcattggcgacccctt
UTR01_0063_E03.b : tctttgctaaacaacgtcctctcccgggggggcccccccatggtacccccgggctttgcc
UTR01_0058_E03.b : ttgctaacaacctcctcctctggggggcccccccatgtacccccggctttgccccaccgc
UTR01_0049_B05.b : tcctattgctacaaccgtccttcttctgggggcccccccccttggtacccccccggcatt
TCH01_0050_B07.b : tttgctacaacgtcctctctgggggacccccatgttccccgggattgccgaacgcctgcc
OVR01_0062_C08.b : tatgcttacacgtcctctctggggcaaccacctgtaccccggctttgcccacgcctgcca
SPLT1_0009_A05.b : TCTTTGCTAcacctccttctgggggcaccacatgtacccggccttgcgaaccccatccaa
SPL01_0004_C05.b : ttctatgctaacaaccgtcctctctggggggcacccaccatgtacccccgggcatttgcc
SPL01_0066_C01.b : tatgctacaacgtcctctctgggggcacaccttgtaccccgcatttgccaccgc
SPL01_0068_H12.b : TCTATGCctact
UTR01_0086_E03.b : TCTATGCTAACAACttctctttgggggcaccacatgtaccccggcatgcccacgcctgca
UTR01_0088_F05.b : TCTTTGCTAACCACGTC*Cctctctgggggcaccccatgtaccccggcattgccaaccgc
SPL01_0094_H02.b : TCTATGCTAACAACGTT*CTCTCTGGGGGgcaccacatgtt
SPL01_0009_C07.b : TCTATGCTAACCACGTC*CTCTCTGGGGGgcacacccttgtaccccggcatttgccaacc
UTR01_0043_B08.b : TCTATGCTAACAACGTC*CTCTCTGGGGGCACCcaccttgtacccccggcattgcccgac
OVRT1_0048_H02.b : TCTATGCCAACAACGTC*TTCTCTGGGGGGCACACCATGTTCCCCcggatttgccgaccg
OVR01_0011_A12.b : TCTATGCTAAacaccgtcctctctggggggcaccaccatgtacccccgggcatggccgac
LNG01_0041_A11.b : TCTATGCTAACAACGTC*TTCTCT*GGGGGgccccaccatggtacccccggcctttgcca
UTR01_0050_H11.b : TTTATGCaacaacgttcctctcggggggccccaccttgtaccccgggcatgcccaacccc
SPL01_0076_H12.b : TCTAGTGCCACAACGTT*CTCTCT*GGGGGCACCACCATGTACCCg
OVRT1_0020_H01.b : TCTATGCTAACAACGTC*CTCTCT*GGGGGCACCCACATGTACCCCGGCATTGCCaaccc
SPL01_0035_C11.b : TCTATTCTAACAACGTC*CTCTCT*TGGGGCCCCACCATGTACCCCcggcatttgccaac
UTR01_0051_D10.b : TCTATGCTAACAACGTC*CTCTCC*GGGGGGACCACCCTGTACCCCccgcctttcccaac
UTR01_0060_D02.b : TCTATGCTAACAACTTC*CTTCTCTGGGGGCACCACCATGTACCCCGGgcatttgctaaa
TCH01_0064_G06.b : TCTATGCTAAC*ACGTC*CTCTCTGGGGGCCAC*ACCATGTACCCCGGCTTTGCgacgca
SPL01_0055_E07.b : TCTATGCTACCACCTCCTCTCT***GGGGGGACCCCCATGTACCCCGGCATTTGCGACCG
CLNT1_0031_B11.b : TCTATGCTTACCACGTC*CTCTCTTGGGGGCACCACCTTGGACCCCGGCATTGCCCACCG
OVRM1_0165_G03.b :
SPLT1_0059_A11.b : tgggggcccacctgtaccccgcatgccaaccctgcaaaagaattcacccctgccccgccc
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b : cccgtccccggctttcaaccctggaaaagaaaccaccccggccccccccccggaaataaa
TCH01_0090_D09.b : aatgtccttcctgggggacccactttgtacccggaaattgccaacccaatgcgaaggaaa
BKFL1_0089_E09.b : cctttccccggctttccaccctttaaaggaattccccccggcccccccccgaaaaaattt
SPL01_0055_A11.b : tgcctacacgtcctcccctggggccaccaccctgttacccgggcttg
BKFL1_0020_G02.b : cgcttgccacctggcaaggatacgcctgcccacaccggaaataaatttgcccccgagcaa
BKFL1_0048_C08.b : ccactgtacccgctttcaacccagcaaagaatcaaccctgccccaacctaaaaaaaatat
MLTL1_0079_E05.b : ggggccccatgtacccggcattgccacccctgccaaagaatcaaacctgggcccccaccg
BKFL1_0119_B11.b : ttgggggcccacatgtacccggcatttccaccctggaaagggaatcaaccctggcccccc
BKFL1_0025_B05.b : ccgggggcccccctgtacccggcttgccaccctgcaaaagaatccaccctgccccaaccc
UTR01_0058_G10.b : ttctatgctaacaaacctccttctctggggggcccacccctgttacccccggcttttccc
TCH01_0060_A07.b : TCTATGCTA*CAACGTC*CTCTCTGGGGGCACCACatgtaccccggcatgcccaccgctg
BKFL1_0120_F08.b : cacgtccttctggggccccacatgtaccccgcattgccaccctgtgcaaaggaatccccc
UTR01_0059_H06.b : TCTATGCTAACAACGTC*CTCTCT*GGGGGCACCACCCTGTACCCCcggctttgcccaac
ADR01_0076_E01.b : TCTATGCNNTACACGTC*CTCTCT*GGGGGCACCACCATGTACCCCNGCATTTGCCGACG
SPL01_0004_G11.b : tctattgctaacaacgtccctctctggggn
SPL01_0019_E09.b : TCTATGCTAACAACGTC*CTCTCCTGGGGGCACCACCATGTACCCCccgcattgccgact
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b : gccaactttttaacttcccgggaaagggaacttctttttgtcctataaaaaaggtctctc
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b : agggaccctccttggctaaaaacctcccccccccgggggggccacaccccatgtttaccc
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b : aaaacgtcctctctggggcaccccatgtaccccgctttccaacccttgcaaaagaaatca
UTR01_0032_B11.b :
BFLT1_0140_B02.b : ttcgggggcccccatttccccggcttgcgacccctgagaagaaacccccccggcccccca
SPL01_0046_H02.b : gctaaaaactccctctttgggggcaccaccatgttccccggcattttccaaccgcttgtc
SPL01_0101_G06.b : accacgtcctctctgggggcaccacatgttaccccgcattccaacccctgcaaaggaaat
OVRT1_0122_G10.b : gcctaacacgttctctcgtggggcccaccttttcccggcattgccaactcttgcaaagaa
SPL01_0053_F11.b : tctatgcctaacacgtcttctccgggggccccaccagtgtaccccggcattgccaaaccc
UTR01_0074_G07.b : ccttgccaaacacctccctcctctgggggcccccccctttacccccgggctttgcccaac
UTR01_0092_D05.b : TCTATGCTAACAcctcttctctggggcaccaccatgtaccccggcatttccaaccgctgc
ADR01_0047_F07.b : TCTATGCTAAC*ACGTC*CTCTCTGGGGGCACCACatgtacccggcatttgcgacgcatg
SPL01_0003_G09.b : TCTATGCTAACAACGTtcttctcctgggggcaccaccatgtacccccggcattgcccaac
UTR01_0063_G08.b : TCTATTCTAAACACGTC*CTCTCTGGGGGgccccaccctgttcccccgggcttgcccaac
UTR01_0068_H08.b : TCCTTTCTAACCACCTC*CTCTCTGGGGGCACCACCctggtcccccggcatttccccaac
SPL01_0094_C01.b : TCTATGCTAACAACGTC*CTCTCT*GGGGGCACCACCATGTAacccgcgcattgcccaac
OVR01_0089_A08.b : TCTATGCTAACAACGCCTTTCTT***GGGGCACCCCCATGTACCCCGGgcatgcccaacg
OVR01_0046_B03.b : TCTTTTCTAACAACGTC*CTCTTCTGGGGGCACCACCATGTACCCCccgctttgccgaac
SPL01_0035_B03.b : TCTATTCCTACAACGTC*CTCTCT*GGGGGCACCACCATGTACCCCcggcatttccaacc
SPL01_0100_A03.b : TCTATGCTAACAACGTC*TTCTCT*GGGGGCACCACCAGTTACCCCGGCATTGCCcgacc
TCH01_0024_B04.b : TCTATGCCNTACACGTC*CTCTCTGGGGGGCAC*ACCCTGTACCCCGGCATTGCCGACCG
SPL01_0084_A02.b : cttttttgctaacaaagctccttttttggggggcaccccccgtttccccccgggtttttg
OVRM1_0095_E09.b :
OVRT1_0004_E08.b : TCTATGCTAACAACtcctctcggggggcaccccatgtacctcggcttgccnaacgcatgc
OVR01_0020_H08.b : TCTATGCTAACAACGTtcctctcctgggggcaccacccatgtacccccgggctttgcccg
OVRT1_0087_A10.b : TCTATGCTAAC*ACGTC*CTCTCTGGGGGCACC**ACATGTACCCCGGCATTGCCaaccc
SKNB1_0027_A08.b : TCTATGCTAACAACGTC*CTCTCT*GGGGGCACCCACATGTACCCCGGCATTGCCGACCG
SPL01_0065_G06.b : tattctaacaacttcctctcttggggcaccaccatgttaccccgcctttgcccaacccat
CLNT1_0097_G03.b : TCTATGCTAAC*ACGTC*CTCTCT*GGGGGCACCCACATGTACCCCGGCATTGCgaacgc
PCT01_0013_D08.b : TCTATGCTAAC*ACGTC*CTCTCTGGGGGgcacaccatgtacccggctttgccaacgctt
OVRT1_0090_G01.b : TCTATGCTAACAACGTC*CTCTCTGGGGGCCCCACCtgtaccccggcttgcccaacccct
SKNB1_0027_G04.b : TCTATGCTAACAACGTC*CTCTCT*GGGGGCACCACCATGTACCCCGGGCATTGCGACCG
SKNB1_0092_E12.b : TCTATGCTAAC*ACGTC*CTCTCTGGGGGCA**CACCATGTACCCCGGCA*TGCCGACCG
PCT01_0007_C06.b : TCTATGNCATACACGTC*CTCTCT*GGGGGCAACAACATGTACCCCGGCATTGCCAACCG
TES01_0054_E07.b : TCTATTGCTACAACGTC*CTCTCTGGGGGGCACCA*CATGTACCCCGGCA*TGCCGAACG
SKNB1_0015_D11.b : TCTATNGCTAACACGTC*CTCTCT*GGGGGCACCACCATGTACCCCGGCATTGCCGAC*G
TES01_0003_A03.b : TCTATGCTAACAACGTC*CTCTCTGGGGGCACCACCATGTACCCCCGGCTTTGCCGACCG
PST01_0059_D10.b : TCTATGCTAACAACGTC*CTCTCTGGGGGCA**CACCATGTACCCCGGCATTGCCGACgc
PST01_0025_G09.b : TCTANTGCTAC*ACGTC*CTCTCTGGGGGCACC**ACATGTACCCCGGCATTG*CGACCG
SPL01_0101_H02.b : acatccccctcggggggcccacccatgtgaacccggaaatgcccaactccttaaaaaaat
OVRM1_0213_C07.b :
OVR01_0045_G06.b : TCTATGCTAACAACGTCCCTCTCTGGGGGGAACCACATATACCCCCGGCATTGCCGACCG
PCT01_0014_C08.b : TCTATGCTAACAACGTC*CTCTCTGGGGGGCAC*ACCATGTACCCCGGCA*TGCCGACCG
OVRM1_0055_B06.b :
SPL01_0035_A09.b : TCTATGCTAACAACGTC*CTCTCT*GGGGGCACCACCATGTACCCCGGCATTGCCGACCG
OVR01_0072_E07.b : TCTATGCTAACAACGTC*CTCTCTGGGGGCACCCCC**TGTACCCCGGCATTGCCGACCC
SPL01_0072_F11.b : TCTATGCTAACAACGTC*CTCTCT*GGGGGCACCACCATGTACCCCGGCATTGCCGACCG
UTR01_0020_H08.b : TCTATGCTAACAACGTC*CTCTCT*GGGGGCACCACCATGTACCCCGGCATTGCCGACCG
SPL01_0103_F06.b : TCTATGCTAACAACGTC*CTCTCT*GGGGGCACCACCATGTACCCCGGCATTGCCGACCG
UTR01_0044_G05.b : TCTATGCTAACAACGTC*CTCTCT*GGGGGCACCACCATGTACCCCGGCATTGCCGACCG
UTR01_0107_A10.b : TCTATGCTAACAACGTC*CTCTCT*GGGGGCACCACCATGTACCCCGGCATTGCCGACCG
SPL01_0019_C02.b : TCTATGCTAACAACGTC*CTCTCT*GGGGGCACCACCATGTACCCCGGCATTGCCGACCG
SPL01_0073_A03.b : TCTATGCTAACAACGTC*CTCTCT*GGGGGCACCACCATGTACCCCGGCATTGCCGACCG
SPLT1_0096_D06.b : TCTATGCTAACAACGTC*CTCTCT*GGGGGCACCACCATGTACCCCGGCATTGCCGACCG
SPL01_0037_H09.b : TCTATGCTAACAACGTC*CTCTCT*GGGGGCACCACCATGTACCCCGGCATTGCCGACCG
SPL01_0034_G04.b : TCTATGCTAACAACGTC*CTCTCT*GGGGGCACCACCATGTACCCCGGCATTGCCGACCG
SKNB1_0049_B05.b : TCTATGCTAACAACGTC*CTCTCT*GGGGGCACCACCATGTACCCCGGCATTGCCGACCG
SKNB1_0066_A12.b : cgttgtgcaggCACGTC*CTCTCT*GGGGGCACCACCATGTACCCCGGCATTGCCGACCG
ILNT1_0023_A11.b :
20110601C-001404 : CATGCAGAAGGAGATCACAGCCCTGGCACCCAGCACCATGAAGATCAAGATCATTGCCCC
---------+---------+---------+---------+---------+---------+ 1117
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b : ccttccgggggggg
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b : ggatgtggccacgggccttttccctncnagttgttccaaaaggataaaaacgggcccttt
SMG01_0045_G12.b : ttacaccccgggcccccccccccgggaaaaaaaaaattgtgccccccgaagcaaaaaacc
SMG01_0031_H06.b : aataaaaatttgccccccgagcaaaccccgcggagttggggcccccggggccttggcccc
SPLT1_0020_F08.b : caccccgggaccccccccgggaatataaatttttccctcccaaagcaaaaacccgtcgaa
TCH01_0096_B07.b : gcaaaggaaatcacagcctgccaccaccccttgagatcagatcattgccctctgacgcaa
UTR01_0099_A07.b : CATGCAaaaagaaatcaaaccctggccccagccacatgaagataagatcattgcccctct
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b : ggcccccacccctgaaaataaatatttgcccccccgaggcaaaaaccccgcggaattggg
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b : tcccggccattttcccaacccccttttcaaaaagagaaaataaaagcccctgtgggcccc
OVR01_0066_F05.b : aaaatccaacctccggggccccgccccccgtaaaaataaaaatctttccccccccggaac
UTR01_0028_D07.b :
OVRT1_0141_G05.b : cccggggaaaaacccctggagtgggcccccggcctcttccctccnaagtgggttccaagg
OVRT1_0131_A11.b : cccgccctgcccccccccccagtaaaaaaaatatttgccccccagaagcaaaaacccccc
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b : ccctggcaaaaaggaaataccaacccttggcccccccgcccctgtaaaatctagaatctt
UTR01_0086_G07.b : ggaaaatcaagccctggcccccagcaccttgaaaaactagaatcttttccccccctaaac
OVR01_0028_E11.b : gcaatgcaaaaagggaaatcccaaccccttggcacccccaccacccattaaaaaattaaa
SPL01_0079_F03.b : taagcccttggccccggcccctgaaaattaaaattttgccccctccgaacccaaaaa
SPL01_0054_E02.b : tttgcccaaccgcctgtcaaaaagggaaatt
SPL01_0071_A08.b :
UTR01_0057_B10.b : aaccccatgtcacaaggaaaattttctgcctcttgggccccccgtccccgaaaaaaatca
OVR01_0055_B05.b : ctaaacccctttgccaaaagagaaataccaagccccctgcccc
OVR01_0086_B07.b : ggccaaccggttttctcaagggaattttcagcccctgtggccccccgccccctgtgaaga
UTR01_0035_H11.b :
CLNT1_0005_D05.b : atccaacccttggcccccgccccttgaaattaagattatggccctcctgacccgaatccc
UTR01_0034_H04.b :
BFLT1_0111_D03.b : aatcaacccctggcccccgcccctgaaaattaaatttttgcccccccggaccaaataccc
OVR01_0049_E08.b : aggaaataaagccttggcccccgcacctt
UTR01_0034_D03.b :
UTR01_0102_D01.b : aaaggaaattccagccctgaccccccgccccttgaaatcagaatcatgcccctcctgaag
SPL01_0056_B11.b : cgcctgc
SPL01_0095_E05.b : cccccatgtccaaagggaaattcccgccc
SPL01_0087_E03.b : ggaaaagaaattcaagcctgggaccccagcccctgaaaattcaaaatcttgcccctccct
UTR01_0063_E03.b : caacccccttggccaaaaggaaaatcccaaccccttggcacccccacccacccattaaaa
UTR01_0058_E03.b : atgcaaaaaaggaaattcccaacccctgggccccccacccccccagtaaaaattaaaaat
UTR01_0049_B05.b : gccccaacccccctttgcaaaaagggaaaatcaaccagccccctggccccccccaacccc
TCH01_0050_B07.b : aaaagagatccaacccctggccccccgccccatgagaatcagatcattgcccctcctgaa
OVR01_0062_C08.b : aaggaaatcaagccctggcccccagaccctgaaaattcaaatctttgcccctccggaaca
SPLT1_0009_A05.b : aggaaatcccccctggcccccgccacctgagaataaaattttgccctccggaacccataa
SPL01_0004_C05.b : caacccccatgccaaaaaaggaaatttcccaccccctgggcac
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b : aaagaaattaaaccccggccccagcaccctgaaatcagatcatggccctcctaacgcaaa
UTR01_0088_F05.b : ctgtcaaaaggaaattccagccctggcccccgcccctggaaaatcaagattattgcccct
SPL01_0094_H02.b :
SPL01_0009_C07.b : gcctgccaaaagaaaatacagccccttggcacccaacaccctttaaaaaataaaaatttt
UTR01_0043_B08.b : cgccatgcaaaaaggaaaatcacaggcccctggccaccccaccacccttgaaaaaattaa
OVRT1_0048_H02.b : catgcaaagggaaatccacgccctgggacccagcaccatgaaaatccagaatcttggccc
OVR01_0011_A12.b : cggctg
LNG01_0041_A11.b : accccatgcaaaaaggaaatcacccccccctggccccccaccacccattgaaaaaattaa
UTR01_0050_H11.b : atgcaaaaggaaattcacaccccttggcccccaccaccattaag
SPL01_0076_H12.b :
OVRT1_0020_H01.b : attgcaaaaggaaatccaacccctggcccccgccccttgaaaattaaaatcttgcccctc
SPL01_0035_C11.b : ccccatgcaaaaaggaaattcccagccccttgccaccccacccaccctttaaaaaattaa
UTR01_0051_D10.b : cccctgcaaaaggaaatcacagcccctggccccccacccccttgaaaaataaaaatcttt
UTR01_0060_D02.b : ccgcatggcaaaagggagattccaccccctgggaccccaaccacccattaaaaattaaaa
TCH01_0064_G06.b : tgcaaaagaaatcacgccctggcacccgcacctgaaaatcagatcatgccccttctggac
SPL01_0055_E07.b : Cttgcgaaagaaattccagccctgggccccagcccctgaagatcaagata
CLNT1_0031_B11.b : CATGCCAAAGGAAATCACAGCCCGGGAACCCGGCACCATGAAaaatcaaatctttggccc
OVRM1_0165_G03.b :
SPLT1_0059_A11.b : cctgaattaaaatatttccccccgagccaaaaccccccgggagggggcccaccgggctct
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b : atttcccccccgaagaaaaacccccggggggggggcccccgggccttgtgccctccccaa
TCH01_0090_D09.b : tcacagccctgtccccctgccccttgagaatcaaattttgccccctccgacccaaatcct
BKFL1_0089_E09.b : ttcccctgaaaaaaaaccccggggagggggctccgggcctctttccccccnaaggggtca
SPL01_0055_A11.b :
BKFL1_0020_G02.b : acccgcggatggggcccccggccccgcctccccaagggaaaaaaagaaaaaacggccctt
BKFL1_0048_C08.b : tccccctgagcaaaaccgcggatgggggcccccgccccctcccttcccaagggaaaaaag
MLTL1_0079_E05.b : aaaattaaaaattgccccctagggcaaaaaccccggaggggggcccccggcctcctcccc
BKFL1_0119_B11.b : cccggaaaaaaatttggccccccgaggaaaaacccctgggaggggggccacgggcccttg
BKFL1_0025_B05.b : tgaaataaaatatggcccccgacccaaacccccggggggggcctccggcccctgcccctc
UTR01_0058_G10.b : aaacccaatggcaaaagggaaattccaaccccctgggcccccccccccccatgaaaaatt
TCH01_0060_A07.b : ccaaaggaatcacagccctgccaccagcccatgaagatcagaatctttgccctcctggac
BKFL1_0120_F08.b : cggcccgcccctgaataaaaatttggcctcccgagcaaaacccgcggatggggcccccgg
UTR01_0059_H06.b : gcattgcaaaggaaaatcacagcccctgcccacccacccccattaaaaattaaaattatt
ADR01_0076_E01.b : CATGCAAAANGAGATCACAGCCCTGGCACCCAGCACatgaagaatcagatcattgcccct
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b : tcctcttggggggggaccacctcccatttgtttactcccctgtgcttttttttcctaaca
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b : cgcgcttttgcccaacccccctgtcccaaaagggagattcc
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b : acccttggcccccccctggaaatcaaatttttcccccccgacccaaaaacccccgggatg
UTR01_0032_B11.b :
BFLT1_0140_B02.b : ctgaaaataattttgcccccggaccaatacccgcggatggggcccaccggctcttgccct
SPL01_0046_H02.b : aaaggaaattaaacccctggcaccc
SPL01_0101_G06.b : tacgccctggcacccgccccttgaaatcagatcttgccccccgaacccaatccccctcgg
OVRT1_0122_G10.b : atcaccccttgccccaccccctgaataaaaaatattgccccccggaaccaaatctccccg
SPL01_0053_F11.b : ttgccaaaagggaaatccaacccttgccccc
UTR01_0074_G07.b : ccccttgccaaaaaggaaaataacagccccttggcccccccaccccccttaaaaaaataa
UTR01_0092_D05.b : caaaggaaatcacaccctggaacccgcaccctgaaaatcagatcttgtcccctccgagcc
ADR01_0047_F07.b : caaagagatcacgccctggccccaccccatgaaatcagatcattgccctctgacccaata
SPL01_0003_G09.b : cggcattgcaaaaggaaaa
UTR01_0063_G08.b : gccatgccaaaaggaaatccccacccctggccccccaccccccttgaaaaataaaaaatc
UTR01_0068_H08.b : cccattccaaaaggaaattcacgcccccgggcccccaccccccatgaaaaattaaaaa
SPL01_0094_C01.b : gcatgccaaaagaaatta
OVR01_0089_A08.b : cctgccaaaaggaaaatccagcccttggcacccaccaccctgaagaatcaggatttttgg
OVR01_0046_B03.b : gcatgcaaaaaggaaaatccaagccctggccccccacaacccataaaaataaaaattatt
SPL01_0035_B03.b : cgcatgccaaaaagaaacaccaccccttgccccccccccaacctttaaaaaataaaaatt
SPL01_0100_A03.b : cctgtcaaaaagaaatccaagcccctggcacccggccccctgaaaaattaaaatctttgc
TCH01_0024_B04.b : CATGCCAAAGGAGATCACAGCCCTGGCACCCAGCACCCTGAAGATCCAGATTATTGCCCC
SPL01_0084_A02.b : cccaaccccttgtaaaaaagaaatttataatctctggggaccccctccccatgtaaataa
OVRM1_0095_E09.b :
OVRT1_0004_E08.b : aaaggaaatccccccctggccccagcccctgaatacagaatctttgccctccgaaccaaa
OVR01_0020_H08.b : accgcatgccagaagggaaaatcccagcccctgggcccccaacaaccattgaaaaatcaa
OVRT1_0087_A10.b : atgcagaaggaaaatcaagccctgcccccacaccttgaaaatcaaatcattcccctccgg
SKNB1_0027_A08.b : CATGCAGAAGGAGATCACAGCCCTGGCACCCAGCACCATGAAGATCAAGATCCATGCCCC
SPL01_0065_G06.b : ggcaaagggaatccaagccctggcaact
CLNT1_0097_G03.b : tgcaaaagaaatccagccctggcaccaacaacctgaaaatcagatattgcccttccgacc
PCT01_0013_D08.b : gcaaaagaaatcaaaccctggcacccagcccatgaaaatcaaatcattgcccttcctaac
OVRT1_0090_G01.b : tgcnaaagaaataaacccttggcccccaccccagaagatcaaattcttcgcctcctgaag
SKNB1_0027_G04.b : CATGCAAAAGGAGATCACAGCCCTGGCACCCAGCACCATGAAagatcaggatacatgccc
SKNB1_0092_E12.b : CATGCAGAAAGAGATCACAccctgcacccagcaccatgagatcagatcttgcccctctga
PCT01_0007_C06.b : CATGCAAAAGAAAATCACAGCCCTGcacccagcacatgaagataagatcatgcccttctg
TES01_0054_E07.b : CATGCAAAAGGAGATCACAGCCTTGGCACCagcaccatgagatcagatcattgcccctct
SKNB1_0015_D11.b : CATGCAAAAAGAGATCACAGCCCTGGCACCCAccacatgaagatcaggatcattgcccc
TES01_0003_A03.b : CATGCAGAAGGAGATCACAGCCCTGGCCCCCCGCCACCTGGAGATCAAGATCATTGCCCt
PST01_0059_D10.b : atgcagaaggagtcacagccctggcaccagcacatgaagatcagatcattgccctctgaa
PST01_0025_G09.b : CATGCAGAAAGAGATCACAGCCCTGGCACCCAGCAC*ATGGAGATCAAGATCATTGCCCC
SPL01_0101_H02.b : gggttctaaacccttgcttcccgagacctggaaaataaagaatatattgccccatcttga
OVRM1_0213_C07.b :
OVR01_0045_G06.b : CATGCAAAAGGAAATCCCAGCCCTTGCACCCAGCAacctgaaaaatcaaaatctttgccc
PCT01_0014_C08.b : CATGCAAAAGGAAATCACAGCCtggcacccacaccatggaaaacaagatctttcccctct
OVRM1_0055_B06.b :
SPL01_0035_A09.b : CATGCAGAAGGAGATCACAGCCCTGGCACCCAGCACCATGAAGATCAAGATCATTGCCCC
OVR01_0072_E07.b : CCTGCCAAAAGAAATCCCAGCCCTGGCACCCAGCAACCTGAAGATCAAGATCctttgccc
SPL01_0072_F11.b : CATGCAGAAAGAGATCACAGCCCTGGCACCCAGCACCATGAAGATCAAGATCATTGCCCC
UTR01_0020_H08.b : CATGCAGAAGGAGATCACAGCCCTGGCACCCAGCACCATGAAGATCAAGATCATTGCCCC
SPL01_0103_F06.b : CATGCAGAAGGAGATCACAGCCCTGGCACCCAGCACCATGAAGATCAAGATCATTGCCCC
UTR01_0044_G05.b : CATGCAGAAGGAGATCACAGCCCTGGCACCCAGCACCATGAAGATCAAGATCATTGCCCC
UTR01_0107_A10.b : CATGCAGAAGGAGATCACAGCCCTGGCACCCAGCACCATGAAGATCAAGATCATTGCCCC
SPL01_0019_C02.b : CATGCAGAAGGAGATCACAGCCCTGGCACCCAGCACCATGAAGATCAAGATCATTGCCCC
SPL01_0073_A03.b : CATGCAGAAGGAGATCACAGCCCTGGCACCCAGCACCATGAAGATCAAGATCATTGCCCC
SPLT1_0096_D06.b : CATGCAGAAGGAGATCACAGCCCTGGCACCCAGCACCATGAAGATCAAGATCATTGCCCC
SPL01_0037_H09.b : CATGCAGAAGGAGATCACAGCCCTGGCACCCAGCACCATGAAGATCAAGATCATTGCCCC
SPL01_0034_G04.b : CATGCAGAAGGAGATCACAGCCCTGGCACCCAGCACCATGAAGATCAAGATCATTGCCCC
SKNB1_0049_B05.b : CATGCAGAAGGAGATCACAGCCCTGGCACCCAGCACCATGAAGATCAAGATCATTGCCCC
SKNB1_0066_A12.b : CATGCAGAAGGAGATCACAGCCCTGGCACCCAGCACCATGAAGATCAAGATCATTGCCCC
ILNT1_0023_A11.b :
20110601C-001404 : TCCTGAGCGCAAATACTCCGTCTGGATTGGTGGCTCCATCCTGGCCTCTCTGTCCACCTT
---------+---------+---------+---------+---------+---------+ 1177
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b : tccccaattttaaatatccctcggttttttcacccggagattttgggaaagcttattttt
SMG01_0045_G12.b : ccccgggggggggggcctcctggggcctctttcccccttttaaaaagggggtatccaaaa
SMG01_0031_H06.b : ttccnaaagggtttcaccaaggaataaaaaacgggcgcctttcccccaaagtttaaaaat
SPLT1_0020_F08.b : tggggcccccccggcctcttgccctttcccaattggtttacaaaaggattaaaaaccggc
TCH01_0096_B07.b : tactccgtctgattgggggctcatcgggcctcttgccccttccgcaaattggattncaaa
UTR01_0099_A07.b : gaacgcaaaaatccgcccggattggtgcctcct
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b : ggcccccggggcctttttccctttccgaaatggggttctccaaaggggtataaaaaccgg
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b : tcccccccctttgaaaaaccaaagatataattgtccccccctctggaggcccaaaatatc
OVR01_0066_F05.b : caaaaactccccccgggatgggggctccctccgggccctctgttcccctttccaccaaag
UTR01_0028_D07.b :
OVRT1_0141_G05.b : attaaaaacgggcttttccccaaagtaaaaaaaccccgctgtttcaccccggagttggag
OVRT1_0131_A11.b : ggggtgggggccccctcggccctttgtcccttttcgaaaggtgttacaaaaaaggataaa
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b : gtgcctccccggagcgccaaatcccccgctccggagtggggggctccccctcggcc
UTR01_0086_G07.b : ccaaaaacccccccctggatgtgggcccccttcctgggccccctgttccccctttccaca
OVR01_0028_E11.b : aaatctttttccccccttcccgaaaccgccaaaaattccccccccccttgggggaatttg
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b : agaatctattgccccactccttagaacgcaaaaccatcctcccccgtgggtattgggggg
OVR01_0055_B05.b :
OVR01_0086_B07.b : ttaagaatttttggcccccttcttaggcacaaaatcctcccttccgatttggggtgggcc
UTR01_0035_H11.b :
CLNT1_0005_D05.b : cgccgggatggtggctccttctggcctcttgtcccctttcaaaaatgtggttcccaaaag
UTR01_0034_H04.b :
BFLT1_0111_D03.b : cgcggggatgggggcgccaccgggcccttttgccccttccgcaatgtggtcccaaaagga
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b : ccaaaaccccccctggattggggctccatccgggcctcttt
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b : gagcgcaaaaacccggcctgaatgggggggtccattcggggccctcttgtccaccttccg
UTR01_0063_E03.b : aatcaaaaatctttttgcccccccccctgaaaccccaaaaaaacctccccctcccggaat
UTR01_0058_E03.b : tctttggccccccccctggaagccccaaaaaaccccccgttctggggattgtgggggggg
UTR01_0049_B05.b : ccc
TCH01_0050_B07.b : gcaaataccccgccggaatgggtggcccatccgggccccttgtcccccttcccaaaattg
OVR01_0062_C08.b : aatatctcgccggaattgggggtccccctggggcctctgttcccctttcaaaga
SPLT1_0009_A05.b : cccgccggaatgggggccctccgggcctctttcccttcccaaagttggttcccaaaagga
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b : aaccggtcggaatggggcccctccggcctctggtcccttcccccaaggggattcccacag
UTR01_0088_F05.b : tcgggacccaaaaccccccccggaattggggggccccccctggcccccttgccccctttc
SPL01_0094_H02.b :
SPL01_0009_C07.b : tgccccctcccgaaaccccaaaaaac
UTR01_0043_B08.b : aaaattcatttgccccccttccctgaagccccaaaaaataactccccgttttctggggaa
OVRT1_0048_H02.b : ctccggaacccaaaaacccccccgggaattgggggctccctccgggcccccttgccccct
OVR01_0011_A12.b :
LNG01_0041_A11.b : aaattattttgcccccccccctggaaccccccaaaaaacctcccccttcccggggaattt
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b : ctgaacccaaaaacccccccggaatgggggctcctccgggccctttggtccccttccaca
SPL01_0035_C11.b : aaaaatcatttgccccccttccctaaaccccccaaaaattccccccccttttggggaaat
UTR01_0051_D10.b : tcccccctcccgaaagcccaaaaaaccccccttctggggatttgttgggctcccctcccc
UTR01_0060_D02.b : atacattggccccctccctgaacgccaaaattcttcccgttctggggatttggtgggggc
TCH01_0064_G06.b : gcaatactccgcctggatggtgggtccatcctggctcccgtgccactttccacaaaggt
SPL01_0055_E07.b :
CLNT1_0031_B11.b : ctcctgagcgcaaaacccccgccgggaatgggggccccatccgggcccccctggccccct
OVRM1_0165_G03.b :
SPLT1_0059_A11.b : tgtccccttcccaagtggttccaaagggtttaaaaaccgggccctttttccccccaagtt
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b : ggggttcacaagaaataaacaaaccggg
TCH01_0090_D09.b : ccttttgaatggtggtccctccggccctttgacccattctgaaaatgggtttcctataag
BKFL1_0089_E09.b : aaaaaataaaaaaggggccttttcccaaaatttaaaatcctcggcttggttccccggggg
SPL01_0055_A11.b :
BKFL1_0020_G02.b : ccccatgtaaaaaccggcggtgttcccaggggttggaagctcttttcatcccaccctctt
BKFL1_0048_C08.b : gaaaaaaaggggccctccccaatgttaaaatccgcctggttcccccgggtttggagcccc
MLTL1_0079_E05.b : tcccccaagggcccaaagagtaaaaaagggccctttccccaagtttaaaataccgccggt
BKFL1_0119_B11.b : gccctctccaaggggtctcacagggttacaaacgggcccttttcccccaaagtttaaaaa
BKFL1_0025_B05.b : cccagggttaaaaaggaaaaaaacggccccttccccaaatttaacatccgccgggtccca
UTR01_0058_G10.b : aaaaaaattatttgcccccccccctagaacccccaaaaaaaccccccgctcctgggaatt
TCH01_0060_A07.b : gcaataacccgccgggatggggggctccatcgggctctctgtccacctcccgcaaagggg
BKFL1_0120_F08.b : ccttcgcccctctccaagggacacaaagaaaaaaaacgggccctttccccaaagttaaac
UTR01_0059_H06.b : tgccccctccctgaaccccaaaacctccccttctgggatttggtggggcccccccc
ADR01_0076_E01.b : cctgaccgcaaaactcccccctggattgtgggctcatcctgggccctctgtccccttccc
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b : c
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b : ggggtcccccgggccctctggtccctttcaaaaggggttccccaaagggtaaaaaaaccg
UTR01_0032_B11.b :
BFLT1_0140_B02.b : ttccaagtgggtcaaaggaataaaaaccggcctctgtccccaagtttaaaattccggcct
SPL01_0046_H02.b :
SPL01_0101_G06.b : atgggggcccatccggcccctttcccctccgcaaatggtatcccaagagaaacaaaaaac
OVRT1_0122_G10.b : ggatgggggccctccggccccttgtccccctccccaatgggatcccaaaggattacaaac
SPL01_0053_F11.b :
UTR01_0074_G07.b : aaaaatattttgccccccctcccgggaaccccaaaaatacccccccctctgggggatttg
UTR01_0092_D05.b : aaatactccgtcggaattggggctccatcctggcctttctgtcactttcagcaaatgtga
ADR01_0047_F07.b : ctcctcgggatggtggctcatctggctcttgttcacttccgcaatgggatcacaaacgga
SPL01_0003_G09.b :
UTR01_0063_G08.b : tttgccccctccctgaaaccccaaaaaaccccccttcgggggattgtgtggggccccccc
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b : cccttcttgagcccaaatactccctcctggaatggtgggtctcctcctggccctcttgtc
OVR01_0046_B03.b : tggcccctcccggaaccccaaattcccccccttttgggaatttgggggggcttccttccc
SPL01_0035_B03.b : catttgcccccctcccgaaaaccccaaaattaccccccctctttgaattttggtgtggtt
SPL01_0100_A03.b : ccc
TCH01_0024_B04.b : TCCTGAACGCAAAactccctctgggatgggggggtcctccggggcctctcgtgccacttt
SPL01_0084_A02.b : caaataactttgtccccccctctaaa
OVRM1_0095_E09.b :
OVRT1_0004_E08.b : tcccggctggaatgggccccatctggccctggtccccttcagaaagggttctccaaaggg
OVR01_0020_H08.b : aaaaatcatttgcccccctccctgaaagccccaaaattacttcccctctctggggaattt
OVRT1_0087_A10.b : acgcaaatatccgtcggatggggggtcctcctggcctttgtcccctttccaaatggtggt
SKNB1_0027_A08.b : TCCTGAACGCAAATACCCCGCCTGGAATGGgggctcttcccggcctcttgttccactttc
SPL01_0065_G06.b :
CLNT1_0097_G03.b : gcaaaacccgtcgggtggggggcccatccggcctctttcccccttccccaatgggtttnc
PCT01_0013_D08.b : caaaaaacccgccgaatgggggtccatccggcctccttgtccccttccgcaatgtgggtt
OVRT1_0090_G01.b : ccaaaccccgctcggattggggctcatctggccctctgtccccttccccaagtgggttgc
SKNB1_0027_G04.b : cctccgaccgcaatactccgtccgggaatggtggctcatcctggcctctcct
SKNB1_0092_E12.b : acgcaataccccttccggatgntggctcatcctgcccctctgtcccttccccaaatggga
PCT01_0007_C06.b : acgcaaaaactcgtctgattgggggtcatccggctcttgtccccttccccaattgggatt
TES01_0054_E07.b : gacgcaatactcgtctggatgntggctcctccggccttctgtcactttcancaatgtgat
SKNB1_0015_D11.b :
TES01_0003_A03.b : cctgaccgcaatactccgccgggattgtgggctcttctgggctctctgtccaccttcaac
PST01_0059_D10.b : cgaatactcgtctggatggtggctccatctgcctctcgtccacttcagcaatgtgttcac
PST01_0025_G09.b : TCCTGACCGCAAATACTCGGTCTGGATTGGGGGCTCAATCCTGCCCTCTCTGTCCACCTT
SPL01_0101_H02.b : acttaaaaaaccccaccttga
OVRM1_0213_C07.b :
OVR01_0045_G06.b : cttcccgaacgccaaatacccccttcgggaatgggtgggctccttcccgggccctctttt
PCT01_0014_C08.b : gaacccaaaactccgccgggatggtggtccatcctncctcttggtcacttccccaaatgt
OVRM1_0055_B06.b :
SPL01_0035_A09.b : TCCTGAGCGCAAATACTCCGTCTGGATTGGTGGCTCCATCCTGCCCTCTCTGTCCACCTT
OVR01_0072_E07.b : ccccgaaccgcaaatcccccgtcgggattggggggctccctcctggccctcccgtccccc
SPL01_0072_F11.b : TCCCGAGCGCAAATACTCCGTCTGGATTGGTGGCTCCCTTCTGGCCTCTCTGTCCACCTT
UTR01_0020_H08.b : TCCTGAGCGCAAATACTCCGTCTGGATTGGTGGCTCCATCCTGGCCTCTCTGTCCACCTT
SPL01_0103_F06.b : TCCTGAGCGCAAATACTCCGTCTGGATTGGTGGCTCCATCCTGGCCTCTCTGTCCACCTT
UTR01_0044_G05.b : TCCTGAGCGCAAATACTCCGTCTGGATTGGTGGCTCCATCCTGGCCTCTCTGTCCACCTT
UTR01_0107_A10.b : TCCTGAGCGCAAATACTCCGTCTGGATTGGTGGCTCCATCCTGGCCTCTCTGTCCACCTT
SPL01_0019_C02.b : TCCTGAGCGCAAATACTCCGTCTGGATTGGTGGCTCCATCCTGGCCTCTCTGTCCACCTT
SPL01_0073_A03.b : TCCTGAGCGCAAATACTCCGTCTGGATTGGTGGCTCCATCCTGGCCTCTCTGTCCACCTT
SPLT1_0096_D06.b : TCCTGAGCGCAAATACTCCGTCTGGATTGGTGGCTCCATCCTGGCCTCTCTGTCCACCTT
SPL01_0037_H09.b : TCCTGAGCGCAAATACTCCGTCTGGATTGGTGGCTCCATCCTGGCCTCTCTGTCCACCTT
SPL01_0034_G04.b : TCCTGAGCGCAAATACTCCGTCTGGATTGGTGGCTCCATCCTGGCCTCTCTGTCCACCTT
SKNB1_0049_B05.b : TCCTGAGCGCAAATACTCCGTCTGGATTGGTGGCTCCATCCTGGCCTCTCTGTCCACCTT
SKNB1_0066_A12.b : TCCTGAGCGCAAATACTCCGTCTGGATTGGTGGCTCCATCCTGGCCTCTCTGTCCACCTT
ILNT1_0023_A11.b :
20110601C-001404 : CCAGCAAATGTGGATCAGCAAACAGGAGTACGACGAAGCCGGGCCGTCCATTGTCCACCG
---------+---------+---------+---------+---------+---------+ 1237
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b : aaatttccaaacccggcttttttgtttttacccggtgtttaaaannaaaaaaaaaanana
SMG01_0045_G12.b : gggagaaaaaaaaaacggggcccctttttcccccaaagtttttaaaaaaataccggggcg
SMG01_0031_H06.b : tcctgctttgtgtttaacccgggggtttgtgaaagggtttttttaaaatttcaaaaaggg
SPLT1_0020_F08.b : ccttttttccccaaagtttaaaaaattcccggtttttttttttaacaaggggaatttggg
TCH01_0096_B07.b : aggatacacaaccgggcgtccttgtccccaaaatttttaaaacataaccggtcggttgtt
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b : ggctctctgttccccccaaattttaaaaaaatacccgggctggtgtgtttaaaacccgga
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b : tcttc
OVR01_0066_F05.b : ggggtccccaacacgaaatcc
UTR01_0028_D07.b :
OVRT1_0141_G05.b : accctttcattcccccccccctcttttttttttttttcttaaaaaaaggggggggcccaa
OVRT1_0131_A11.b : aaaaacggggccctttttccccccaaagttttaaaaaaatcccgggcgtgtgtgtttaaa
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b : caagtgggatttcaccaaag
OVR01_0028_E11.b : ggg
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b : ctctccacctctctcggctct
OVR01_0055_B05.b :
OVR01_0086_B07.b : tcccttggggttcttttgtgccacctcttctccaaagtgtgggtcttcataataaa
UTR01_0035_H11.b :
CLNT1_0005_D05.b : gaatccaaaaacccggcgcccttttcccccaaaggttttaaacctttcgcggtcgtgtgt
UTR01_0034_H04.b :
BFLT1_0111_D03.b : ttcaaaaacggggcttcttttcccccaaagttttaaaaaaataccggccgggtgttctac
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b : a
UTR01_0063_E03.b : ttggggggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0058_E03.b : ctccccccccccttgggcccccctcccttgttccccccccct
UTR01_0049_B05.b :
TCH01_0050_B07.b : gattcccaaaagggattaaaaaaaacgggcctccttgttcaccccaaaggctctaaaaaa
OVR01_0062_C08.b :
SPLT1_0009_A05.b : tttaaaaacccggcgtctttttccccccaaggtttaaaaaataccggcccgttgttttta
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b : gatca
UTR01_0088_F05.b : ccccaagtgggttccccaacgggattacaaaaaccggcccctcctttt
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b : tttggggtggggct
OVRT1_0048_H02.b : tcccaaaaagggggtttccccaaaggggattcacaaaaaccggggccctcttttcccccc
OVR01_0011_A12.b :
LNG01_0041_A11.b : gtggtgggggcccttccccctcc
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b : aattgggttccccaacagggttcaaaaaaccgggccctccttttcccccaaaggctttaa
SPL01_0035_C11.b : ttttgtggggggcttctccccttttcccctcggggcccctccttcctctttttttt
UTR01_0051_D10.b : tgggccccctttctttttcccccccccttttccccaca
UTR01_0060_D02.b : ccccctcccg
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b : tcccccaagtgggtattccccaacaggagtttcaacaaacccgggccgtccattgttccc
OVRM1_0165_G03.b :
SPLT1_0059_A11.b : taaaaaatacccgccggtgtttttaaacacggggaattggtgaaaaggctttttttttaa
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b : gaatcaaaaaaccgggcgctctttccacgccatattctaaaaattacccggcgcgtggtc
BKFL1_0089_E09.b : gtgaaaacccccctttcctccccccccccccccgtttttttttcgtccaaaaaaaaaagg
SPL01_0055_A11.b :
BKFL1_0020_G02.b : ttttattatttgaaaaaaaaagcccccctctgggcggggttnnnnnnnnncccnnnnntc
BKFL1_0048_C08.b : tttcatcccaccccccctttttattattctaaaaaaaaaaccccctcttcggnnnnnnnn
MLTL1_0079_E05.b : gtccccccggagggtgaaagcccttccctctccccccccccccttttattatttgaaaaa
BKFL1_0119_B11.b : tcccccggtggttcaccccccgggagtggggagagccttttttaattctgagacgaggcc
BKFL1_0025_B05.b : cccgagttggaggcccctttcctccccaccccccttgttttttattccgaaaaaaaagcc
UTR01_0058_G10.b : gggggggggcccccccctccccggggccccccctc
TCH01_0060_A07.b : atccccaaccgggattccaccaaccc
BKFL1_0120_F08.b : ttccggcggggtccaaccccggatttgggaagcctctttcactccccccccccccttgtt
UTR01_0059_H06.b :
ADR01_0076_E01.b : ncaaattgggtccccaacagggttaaaaaaaccgggcgttcctgtccacccaaagttttt
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b : ggctccttttccccccaaattttaaaaattacccggccgtttttttccaacaagggaatg
UTR01_0032_B11.b :
BFLT1_0140_B02.b : ttgttcacacgggtgttgggaaggctttttcaattcagaaccgccttctggtgttaacaa
SPL01_0046_H02.b :
SPL01_0101_G06.b : ggccccatttct
OVRT1_0122_G10.b : cgggccccttgtcccccaaatgttaaaaattcgtgcgggttgttctaacaaggaaagatt
SPL01_0053_F11.b :
UTR01_0074_G07.b : ggggggggccttcccctccccctggggccccctccctttgtggtcccccccccccttttt
UTR01_0092_D05.b : a
ADR01_0047_F07.b : atacaaaaaccgggcctctttgccccgcaaaactctaaaaattaccggtcggtgttgttt
SPL01_0003_G09.b :
UTR01_0063_G08.b : cccctggc
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b : cccc
OVR01_0046_B03.b : cgggccccctctcttttttcccccccccttttcccccccacaaaattgttggggaaattt
SPL01_0035_B03.b : ttcccttccccttgcccccccttttcttttcccccccccttcttccccccccaacaaaat
SPL01_0100_A03.b :
TCH01_0024_B04.b : ccgccaaagttgattaccaacag
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b : atcaaaaaccgggcctcttgtccccgcaaagtttaaaaattccgtgccgttttgtttaca
OVR01_0020_H08.b : gggggggggctttcccctttcccctggggcccccctcttcttctgttccccaccccccct
OVRT1_0087_A10.b : tcccaaaggattacaaaacccggccttcttgtgcccccaagggtttaaaatatcccgtcc
SKNB1_0027_A08.b : tagaa
SPL01_0065_G06.b :
CLNT1_0097_G03.b : caaaggattcaaaaaacgggcccttctttgtccccaaatgtttaaaaattaacgggtcgg
PCT01_0013_D08.b : cccaaaggaatccacaaaccgggccctcctttccccccaaaagtcttaaaaattcccgtc
OVRT1_0090_G01.b : aaaaggtttcaaaaaccgggcctttttttcccccaaagtctttaaaattaccggtctcgt
SKNB1_0027_G04.b :
SKNB1_0092_E12.b : tccccaacgggatacaccaaccgggcccccttgtccccccaaagctctaaaacctccc
PCT01_0007_C06.b : ccaacggattcaacaaaccggccgcttttcccccaaagttttaaaattaccggtggtttg
TES01_0054_E07.b : caccaacgggatacaaaaaccgggccgtcatgtccccccaagctttaaaacttacctgct
SKNB1_0015_D11.b :
TES01_0003_A03.b : aaagtggatcaccaacaggattacaacaaaccggccgctcattgtcacccaa
PST01_0059_D10.b : caaccggatacaaaaccggccgtcattgtcacgcaatgctttaaaacttaccgctcgtgt
PST01_0025_G09.b : CCAGCAAtgtggatcacccaaagggagtacgaccaaaccggcccgcccttgttcccgcca
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b : gtcccccccttcccacccaaatgggggaaatcaaccaaaacagggaagaaccaaaccaaa
PCT01_0014_C08.b : gatccccaacgggattcaacaaaccgggccgtctttgccccccaaagttttaaaacctta
OVRM1_0055_B06.b :
SPL01_0035_A09.b : CCACCAAATTTGGATCACCAAACAGGAttaccaaaaaacccgggccctccatttgtcccc
OVR01_0072_E07.b : ttcccgcaaaatggggatcccccaaccgggagtacaaacaaccccggcccccccattgtc
SPL01_0072_F11.b : CCAGCAAATGTGGATCAGCAAAACAGGATTACGACAAACCGGGCCGTCCATTGTTCCACC
UTR01_0020_H08.b : CCAGCAAATGTGGATCAGCAAACAGGAa
SPL01_0103_F06.b : *CAGCAAATGTGGATCAGCAAACAGGAGTACGACGAAGCCGGGCCCGTCATTGTCCACCG
UTR01_0044_G05.b : CCAGCAAATGTGGATCAGCAAACAGGAGTACGACGAAACCGGGCCGTCCATTGTCCACCG
UTR01_0107_A10.b : CCAGCAAATGTGGATCAGCAAACAGGAGTACGACGAAGCCGGGCCGTCCATTGTCCACCG
SPL01_0019_C02.b : CCAGCAAATGTGGATCAGCAAACAGGAGTACGACGAAGCCGGGCCGTCCATTGTCCACCG
SPL01_0073_A03.b : CCAGCAAATGTGGATCAGCAAACAGGAGTACGACGAAGCCGGGCCGTCCATTGTCCACCG
SPLT1_0096_D06.b : CCAGCAAATGTGGATCAGCAAACAGGAGTACGACGAAGCCGGGCCGTCCATTGTCCACCG
SPL01_0037_H09.b : CCAGCAAATGTGGATCAGCAAACAGGAGTACGACGAAGCCGGGCCGTCCATTGTCCACCG
SPL01_0034_G04.b : CCAGCAAATGTGGATCAGCAAACAGGAGTACGACGAAGCCGGGCCGCCCATTGTCCACCG
SKNB1_0049_B05.b : CCAGCAAATGTGGATCAGCAAACAGGAGTACGACCAAGCCGGGCCGTCCATTGGCCACCG
SKNB1_0066_A12.b : CCAGCAAATGTGGATCAGCAAACAGGAGTACGACGAAGCCGGGCCGTCCATTGTCCACCG
ILNT1_0023_A11.b : nnnttgcaggttagaggcantaxxxxxxxxxxxxxxxxxx
20110601C-001404 : CAAATGCTTCTAAAACACTTACCCTGCTCGCTGTCTGTCTCTAGCACACACTGTGAATGT
---------+---------+---------+---------+---------+---------+ 1297
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b : aannancccccccgccccctgggggttcccaaaaanatttgttccaccccgagaaacttt
SMG01_0045_G12.b : gggtgttttcaaaacaggggggagttttggaaagaggttttttttttttaaatctccaca
SMG01_0031_H06.b : ggtttttttttttaacaaagtcccgaaaaaaaaaacctgtggtgggggggcctataatca
SPLT1_0020_F08.b : gaaaagccttttttttaaatcttacaagctaaagttttttgtttttacacacaattttcg
TCH01_0096_B07.b : tctaacaacagggaagttttggaaaaagcttcaacttttccaa
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b : gagttttgggaaaaagggcttttttttttataattcaaaaaaccgcgcgtttttgtgttt
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b : accccaaattttgtnnnnntaatnnttnnnnnnnnnnnnnnnnnnnnnttcccggaccca
OVRT1_0131_A11.b : cacggagagtgttggagaaggccttttttttttattttcccacaagacgcccacttttgt
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b : tcctacaaccgggaagttttgggaaaaccctaatttttccaattcctcacaaggtgaccg
UTR01_0034_H04.b :
BFLT1_0111_D03.b : acaggggagatttgtgagaaagccttttttttcaattttcacaagcacagccccttgtgt
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b : ttaccggggtctgttggt
OVR01_0062_C08.b :
SPLT1_0009_A05.b : aacaagggaaatttttggaaaaggctttttttttcaaattttcaccaaagcgggcatttt
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b : ccaaaagctttaaaaaactttccccgtcgctggttttttccttaaaaacacgggaaaatg
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b : aaacttaccggcccgtgttggtctaacaaatggaaggttttggaaaaagccttatttttt
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b : accaaaaggtttttaaaaaccttcacggg
OVRM1_0165_G03.b :
SPLT1_0059_A11.b : atttcccaaaaccggccccccttgtttttttaaacaaatttgcccaaaaaaaaaaaaaaa
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b : ccaaacaaggaaaagttgtgaaattgcctttattttcaaattttcgcaaacttaacgggc
BKFL1_0089_E09.b : ccgccctctcttttgcg
SPL01_0055_A11.b :
BKFL1_0020_G02.b : tccctttcgccgttctaannnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0048_C08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0079_E05.b : aaaagcccccacccccgaggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0119_B11.b : tgtgtttatattattttaaaaaaa
BKFL1_0025_B05.b : cctatttccgcggannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b : ttaaaaataaaaaaaaaaaaacggccccattatttggcggaggtttttttttaaangnta
UTR01_0059_H06.b :
ADR01_0076_E01.b : aaaattacctgttcctgttgttctacacaccgcggatgtttggggaaaggcttatttttt
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b : tttggaaaaactcttttttttaaattttcaaaaaaggcggcctcctttttttttataaaa
UTR01_0032_B11.b :
BFLT1_0140_B02.b : atccgaaaaaaagggttcgggggcgccataaaacccccccaaagagggtttttgtggaga
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b : gggaaaagccttttctctaaattctcacaacctccctcctttgtttttcatcaaattccg
SPL01_0053_F11.b :
UTR01_0074_G07.b : cccccacccacaaaaatatgtgtgtggggagaaatttct
UTR01_0092_D05.b :
ADR01_0047_F07.b : taacacaggaaaagttgggaaaagcctattttttcaaattctaaccaacctgacttactt
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b : aaaaacaaaaaaaaaaaagaagaaaaaaaaat
SPL01_0035_B03.b : tttttgtgaaaattttatacccacaaaaaaaac
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b : acggtgaagttgggaaaaccttttttttaaattccaaaaaccgagcttcttggttttaaa
OVR01_0020_H08.b : ttttctcccccccccaaaaaaatatgtgtgg
OVRT1_0087_A10.b : tttttttctaaaacaaggggatttttgggaaaggcctattttttaaaaattccacaaagg
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b : tggtcttaacaaaggggaattttgggaaagctctatttttcaaatttcaaaaagccgaac
PCT01_0013_D08.b : cgtgtttgtcataaaaacggtaatgttgtggaaaaagacttattttttcaaaattcttcc
OVRT1_0090_G01.b : tttgtctaaaaaagtgtaaattttgggaaaagccttaattttccaaatttccagcaaaac
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b : ttttaaaacagggaagtttggaaaaagtttttttttcaaatctcacaaacgaagcctctt
TES01_0054_E07.b : ccgttgtcttacaacggggaagtttgggaaagccttaatttttcaaattcaacaaaccga
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b : tgtctaacccccggggagtttgggaatagcctaatttttcaaatttcaacaaactgaacg
PST01_0025_G09.b : aagcttctaaaaaattacactgttcggtgttgttccaaacaaccctggaatgtttgggga
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b : acccccgggccccgcccccctttttggccccccccccccccaaaatgttt
PCT01_0014_C08.b : ccggtcttttggtttaaaaccctgtaaagttgggaaaaagcttaatttttcaaattttcc
OVRM1_0055_B06.b :
SPL01_0035_A09.b : cccaaaatctttctaaaaaactttacccctccttcctttcttttttttttgcccacaccc
OVR01_0072_E07.b : caccgcccaaggctttctaaaacacctaccccgggctccgggcgggtccctaaacccaac
SPL01_0072_F11.b : GCAATGCCTCTAAAACACTTACCCTGCTCGCTGTCTGTCCCTAGt
UTR01_0020_H08.b :
SPL01_0103_F06.b : CAAATGCTTTCTAAACACTTACCCTGCTCGCTGTCTGTCTCTAGCACACACTGTGGATGT
UTR01_0044_G05.b : CAAATG
UTR01_0107_A10.b : CAAATGCTTCTAAAACACTTACCCTGCTCGCTGTCTGTCTCTAGCACACACTGTGAATGT
SPL01_0019_C02.b : CAAATGCTTCTAAAACACTTACCCTGCTCGCTGTCTGTCTCTAGCACACACTGTGAATGT
SPL01_0073_A03.b : CAAATGCTTCTAAAACACTTACCCTGCTCGCTGTCTGTCTCTAGCACACACTGTGAATGT
SPLT1_0096_D06.b : CAAATGCTTCTAAAACACTTACCCTGCTCGCTGTCTGTCTCTAGCACACACTGTGAATGT
SPL01_0037_H09.b : CAAATGCTTCTAAAACACTTACCCTGCTCGCTGTCTGTCTCTAGCACACACTGTGAATGT
SPL01_0034_G04.b : CAAATGCTTCTAAAACACTTACCCTGCTCGCTGTCTGTCTCTAGCACACACTGTGAATGT
SKNB1_0049_B05.b : CAAATGCTTCTAAAACACTTACCCTGGTCGCTGTCTGTCTCTAGCACACACTGGGAATGG
SKNB1_0066_A12.b : CAAATGCTTCTAAAACACTTACCCTGCTCGCTGTCTGTCTCTAGCACACACTGTGAATGT
ILNT1_0023_A11.b : xxxxxxxxxxxxxxxxxxxxACCCTGCTCGCTGTCTGTCTCTAGCACACACTGTGAATGT
20110601C-001404 : TTTGTGGAATAATGCCTTCAATTCTTTTCCAAATCATTCCTAGCCAAAGCTCTGACTCGT
---------+---------+---------+---------+---------+---------+ 1357
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b : tttgttggtttttttttacacaaaatacatatttttgtgggggggggttngttnngcgcc
SMG01_0045_G12.b : aancgagccatttttgtttttttaaaaa
SMG01_0031_H06.b : gggaa
SPLT1_0020_F08.b : gaaaaaaaaaaaaaaaaaaaaanacacaannnnccgcccccccccttcgtgtttctgtaa
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b : tttacaaaaaatcgccggaaaaaaaaaaaagttgtttctttggggggcccttat
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b : cctgcc
OVRT1_0131_A11.b : tttttaaaaaaatctcgcccaaaaaaaaaaaa
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b : cccttgttttttataacgcgaagttaaaaaaaaaaaagagctgttttctcgggggcgcat
UTR01_0034_H04.b :
BFLT1_0111_D03.b : ttttaaccaaggtaaaaaaaaaccgcgttcccgtggggcgccaatataaaaaaccccccc
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b : tttttttttaaaacacaaattccgaaaaaaaaaaaaa
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b : tttgggaaaaacgcc
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b : caaaattccaaaaaaactgggggtaaattgtgttttataaccgaaagtctcggaa
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b : aaaaaaaanaannnnnnnnnnnccccccccccccctctttgtgtttccccaaaatgtgga
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b : tatgttttttaaaacaa
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLTL1_0079_E05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0119_B11.b :
BKFL1_0025_B05.b : nnnnnnnnnnnn
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b : ggtaatagaaacacaaaaaaat
UTR01_0059_H06.b :
ADR01_0076_E01.b : caaattctcaccaagctgaccgttcttgtgttttttataacgaagtgtccgtaaaaaaaa
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b : aaaatttccgaaaaaaaaaagcgtgttgtgggggcgccctttaatcttgggccccacccc
UTR01_0032_B11.b :
BFLT1_0140_B02.b : aaaaaaanttattttnnagtagaaaaataatttggggagagaagagctcannnnnnnnnn
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b : caaaaaaaaaaacaaaaaaaaagactctttgcgggccgcgataattaaaccccctcccta
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b : tggttttttaacagaaatttcgcgaaaaaaaaaaaaaaaaaaccctgtttgctgggggcg
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b : caaaagtcccgaaaaaaaaggctgttttctgggggcccatataaaaccccccccccaaaa
OVR01_0020_H08.b :
OVRT1_0087_A10.b : ggggggtttttgggttttaaaacaaaatatccccaaaaaaaaaggccgtggcgctcgcgg
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b : cgccttttgttttaaaccaaaggccggaaaaaaaaaaaaaaaaaagccctttctcccgcg
PCT01_0013_D08.b : aaaagtctaagcttctttgtgtttttaaaaacaagatttccgggaaaaaaaaaaaaaaac
OVRT1_0090_G01.b : gagagctccctttgtttttaaaccgaatgttaaaaaaaaaaaggg
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b : tggtttttaaccaaaatttggaaaaaaaaaaagcctgttctgtgggggccgcaataaaaa
TES01_0054_E07.b : gctccctttgtttttaaaccaaaggtcccgaaaaaaaaaaagcttttctctgggcggcca
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b : ttcttgggtttaaaacgaaatgttcggaaaaaaaaaagcccgtgcccgtggccggcctaa
PST01_0025_G09.b : aaagcctttaatcttccccaaaattccaacaaacctggacgggtccctttggtttttata
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b : aacaaacttaaaccttacttaggttttttaaaccgaaatgtccttgaaaaaaaaaaaaaa
OVRM1_0055_B06.b :
SPL01_0035_A09.b : ttttaaaatgtttttttggaaaaaaatttcccctttcaaatttttttttttcaaaaattt
OVR01_0072_E07.b : ctgggaaaggttttggggggaaaagagcccttcaaatctctttccaaatcaatccctagc
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b : TTTTGGGAATAATGCCTTCCAATCTTTTTCAAATCATTCCTgcccaagcctctgaaccnt
UTR01_0044_G05.b :
UTR01_0107_A10.b : TTTGTGGAATAATGCCTTCAATTCTTTT*CCAATCATTCCTAGCCAAAGCTCTGACTCGT
SPL01_0019_C02.b : TTTGTGGAATAATGCCTTCAATTCTTTTCCAAATCATTCCTAGCCAAAGCTCTGACTCGT
SPL01_0073_A03.b : TTTGTGGAATAATGCCTTCAATTCTTTTCCAAATCATTCCTAGCCAAAGCTCTGACTCGT
SPLT1_0096_D06.b : TTTGTGGAATAATGCCTTCAATTCTTTTCCAAATCATTCCTAGCCAAAGCTCTGACTCGT
SPL01_0037_H09.b : TTTGTGGAATAATGCCTTCAATTCTTTTCCAAATCATTCCTAGCCAAAGCTCTGACTCGT
SPL01_0034_G04.b : TTTGTGGAATAATGCCTTCAATTCTTTTCCAAATCATTCCTAGCCAAAGCTCTGACTCGT
SKNB1_0049_B05.b : TTTGTGGAATAATGGCCTCCATTCCTTTCCCAATCATTCCTAGCCCAAGCTCTGACTCGT
SKNB1_0066_A12.b : TTTGTGGAATAATGCCTTCAATTCTTTTCCAAATCATTCCTAGCCAAAGCTCTGACTCGT
ILNT1_0023_A11.b : TTTGTGGAATAATGCCTTCAATTCTTTTCCAAATCATTCCTAGCCAAAGCTCTGACTCGT
20110601C-001404 : TACCTTATGTGTTTTTTAATAAATCTGAAATATGTTACCTGTAAA**************A
---------+---------+---------+---------+---------+---------+ 1403
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b : cgggagggtctggtccttctc
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b : aatagnagacagccgaaagcttgtttgtttttttttctcacacacaatatttggtggggg
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b : aaaaag
UTR01_0034_H04.b :
BFLT1_0111_D03.b : acaaaaaatattttttttttgtgatat
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b : gaacaa
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b : nnnnnn
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b : annnnnnnnnnnnannanaaaanaaggccgttgtggcccggtcctttct
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b : ctttttagaat
UTR01_0032_B11.b :
BFLT1_0140_B02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b : aattagttgttttn
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b : cttaatccagg
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b : aaaatgtggtttttttttataaaaaaaaaaaaatatttttgtggaaataggggcgaactc
OVR01_0020_H08.b :
OVRT1_0087_A10.b : ct
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b : ccccttt
PCT01_0013_D08.b : cctttttttctgggcgcccaaaatataaaaaaccccccccccacacaaaaaaaaggtttt
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b : accccccccccacaaaaaagtgttttttgttttgaaaaaaaaaaaatttatttgttattt
TES01_0054_E07.b : aaattaaaacccacccccccaaaaagaaggttttttgttagaaaaaacatcaaatctttg
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b : attaaaaaacccccccgacaaaaaaaaatgttttcttttttcttggtaaa
PST01_0025_G09.b : acccgaaaggtccgggtaaaaaaaaaaaaaggccttggtttactaggggggcgccaatat
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b : gccctgttctatgtaggcgccccttaaatttaaaaaactcccccccccaacaaaaaaaaa
OVRM1_0055_B06.b :
SPL01_0035_A09.b : ttttctcttaatccccaaaaaccctttttttaacctttccttttctctctcttttttttt
OVR01_0072_E07.b : caaaggcctgtaa
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b : accctaagtgttttttaaaaaatctgaataggttaccggttnnaaaaaaacatttaaccc
UTR01_0044_G05.b :
UTR01_0107_A10.b : TACCTTATGTNGTTTTTAATAAATCTGAAATATGTTACCctgtnnnnnnnnnnnnnnnnn
SPL01_0019_C02.b : TACCTTATGTGTTTTTTAATAAATCTGAAATATGTTACCTGTAAA**************A
SPL01_0073_A03.b : TACCTTATGTGttttttaaataatctgaaatatgttaaaaaaaaaaaaaaaaaxxxxxxx
SPLT1_0096_D06.b : TACCTTATGTGTTTTTTAATAAATCTGAAATATGTTACCTGTAAA**************A
SPL01_0037_H09.b : TACCTTACGTGTTTTTTAATAAATCTGAAATATGTTACCTGTAAA**************A
SPL01_0034_G04.b : TACCTTATGTGTTTTTTAATAAATCTGAAATATGTTACCTGTaaaanananannnnnnaa
SKNB1_0049_B05.b : TACCTTATGTGTTTTTTAATAAATCTGAAATATGTTACCTGTAAA**************A
SKNB1_0066_A12.b : TACCTTATGTGTTTTTTAATAAATCTGAAATATGTTaaaaaaaaa**************a
ILNT1_0023_A11.b : TACCTTATGTGTTTTTTAATAAATCTGAAATATGTTACCTGTAAA**************A
20110601C-001404 : AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA.........
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b : ggcccct
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b : tcc
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b : tttttttttcttaataaaaaaaacacattaaattttcttttt
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b : ggggnnnnnnnnttcccttcccctctnnnnnnnnnnnnngacaattataaccttttcccc
TES01_0054_E07.b : ttctattgccgactccccccccccat
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b : taaaaaaccccacccccgccccacaaaaaatatgttgttgtttcttttttt
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b : agagtgtgtgtttttttgcccttgggcaaaaaaccccctttcaaaattttccttttgtgt
OVRM1_0055_B06.b :
SPL01_0035_A09.b : ttttttttttttttttct
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b : ccctaaaacattnaaaaacttttaaaaggggcccttggctccaacctcgggttcggcccc
UTR01_0044_G05.b :
UTR01_0107_A10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0019_C02.b : AAAAAAAAAAAAAxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0073_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxnnnnn
SPLT1_0096_D06.b : AAAAAAA
SPL01_0037_H09.b : AAAAAAAAAAAAAxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0034_G04.b : aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaagxxxxxxxxxxxx
SKNB1_0049_B05.b : AAAAAAAAAAAAAaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0066_A12.b : aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaxxxxxxxxx
ILNT1_0023_A11.b : AAAAAA
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b : ccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b : gtaccaatatatggggcggcaagaatttcccccccggccgccc
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b : tttaaaatatcctcgagggcccaagtttacgctacccgttt
UTR01_0044_G05.b :
UTR01_0107_A10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0019_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0073_A03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPLT1_0096_D06.b :
SPL01_0037_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0034_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0049_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0066_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b : xxxxxxxxxxxxxxxnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0073_A03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPLT1_0096_D06.b :
SPL01_0037_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0034_G04.b : xxxxxxxnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0049_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0066_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0073_A03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPLT1_0096_D06.b :
SPL01_0037_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0034_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0049_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0066_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b : nn
SPL01_0073_A03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPLT1_0096_D06.b :
SPL01_0037_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0034_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0049_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0066_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b : nnnnnnnnnnnnnnnnnnnnnnnnnn
SPLT1_0096_D06.b :
SPL01_0037_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0034_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0049_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0066_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0034_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0049_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0066_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b : xxxxxxggtctttttcaggggcccttcagtcccccaccggtctggtttcatgaatcaata
SPL01_0034_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0049_B05.b : xxxxnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0066_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxn
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b : atccaccccattaccccaatttttgtaaaaagggttttttattttggttttttaaaaaaa
SPL01_0034_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0049_B05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0066_A12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b : accctccccccccaccccctcccccccccctggaaaaccttgaaaaaaaaaaatataaaa
SPL01_0034_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0049_B05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0066_A12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b : aaaagggaaaaaaggtgcaaaaaattttttggggtttggtgtttgttgt
SPL01_0034_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0049_B05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0066_A12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b : nnnnnnnnnn
SKNB1_0049_B05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0066_A12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :
SPL01_0035_A09.b :
OVR01_0072_E07.b :
SPL01_0072_F11.b :
UTR01_0020_H08.b :
SPL01_0103_F06.b :
UTR01_0044_G05.b :
UTR01_0107_A10.b :
SPL01_0019_C02.b :
SPL01_0073_A03.b :
SPLT1_0096_D06.b :
SPL01_0037_H09.b :
SPL01_0034_G04.b :
SKNB1_0049_B05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SKNB1_0066_A12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ILNT1_0023_A11.b :
20110601C-001404 : ............................................................
---------+---------+---------+---------+---------+---------+ 1454
SPL01_0090_D03.b :
OVRM1_0121_E05.b :
SPL01_0061_F12.b :
UTR01_0009_H05.b :
UTR01_0008_D02.b :
SPLT1_0098_C11.b :
SMG01_0045_G12.b :
SMG01_0031_H06.b :
SPLT1_0020_F08.b :
TCH01_0096_B07.b :
UTR01_0099_A07.b :
OVRM1_0044_H09.b :
OVRM1_0225_C04.b :
LVRM1_0022_D01.b :
OVRM1_0198_G10.b :
OVRM1_0054_C08.b :
SPL01_0022_H04.b :
SMG01_0053_G02.b :
SPL01_0016_D07.b :
SPL01_0011_F10.b :
OVR01_0060_D04.b :
OVR01_0066_F05.b :
UTR01_0028_D07.b :
OVRT1_0141_G05.b :
OVRT1_0131_A11.b :
UTR01_0010_D07.b :
UTR01_0045_E06.b :
UTR01_0045_C08.b :
UTR01_0042_H09.b :
OVR01_0077_C07.b :
UTR01_0086_G07.b :
OVR01_0028_E11.b :
SPL01_0079_F03.b :
SPL01_0054_E02.b :
SPL01_0071_A08.b :
UTR01_0057_B10.b :
OVR01_0055_B05.b :
OVR01_0086_B07.b :
UTR01_0035_H11.b :
CLNT1_0005_D05.b :
UTR01_0034_H04.b :
BFLT1_0111_D03.b :
OVR01_0049_E08.b :
UTR01_0034_D03.b :
UTR01_0102_D01.b :
SPL01_0056_B11.b :
SPL01_0095_E05.b :
SPL01_0087_E03.b :
UTR01_0063_E03.b :
UTR01_0058_E03.b :
UTR01_0049_B05.b :
TCH01_0050_B07.b :
OVR01_0062_C08.b :
SPLT1_0009_A05.b :
SPL01_0004_C05.b :
SPL01_0066_C01.b :
SPL01_0068_H12.b :
UTR01_0086_E03.b :
UTR01_0088_F05.b :
SPL01_0094_H02.b :
SPL01_0009_C07.b :
UTR01_0043_B08.b :
OVRT1_0048_H02.b :
OVR01_0011_A12.b :
LNG01_0041_A11.b :
UTR01_0050_H11.b :
SPL01_0076_H12.b :
OVRT1_0020_H01.b :
SPL01_0035_C11.b :
UTR01_0051_D10.b :
UTR01_0060_D02.b :
TCH01_0064_G06.b :
SPL01_0055_E07.b :
CLNT1_0031_B11.b :
OVRM1_0165_G03.b :
SPLT1_0059_A11.b :
SPL01_0011_F07.b :
UTR01_0044_H04.b :
BKFL1_0095_A12.b :
TCH01_0090_D09.b :
BKFL1_0089_E09.b :
SPL01_0055_A11.b :
BKFL1_0020_G02.b :
BKFL1_0048_C08.b :
MLTL1_0079_E05.b :
BKFL1_0119_B11.b :
BKFL1_0025_B05.b :
UTR01_0058_G10.b :
TCH01_0060_A07.b :
BKFL1_0120_F08.b :
UTR01_0059_H06.b :
ADR01_0076_E01.b :
SPL01_0004_G11.b :
SPL01_0019_E09.b :
OVRM1_0007_G08.b :
OVRM1_0073_D07.b :
OVRM1_0126_A07.b :
OVRM1_0003_E03.b :
OVRM1_0053_C07.b :
OVRM1_0025_F07.b :
SPL01_0024_A09.b :
SPL01_0061_C12.b :
SPL01_0026_F08.b :
SPL01_0028_C08.b :
SPL01_0055_D11.b :
UTR01_0023_D08.b :
UTR01_0023_C06.b :
SMG01_0015_H04.b :
UTR01_0032_B11.b :
BFLT1_0140_B02.b :
SPL01_0046_H02.b :
SPL01_0101_G06.b :
OVRT1_0122_G10.b :
SPL01_0053_F11.b :
UTR01_0074_G07.b :
UTR01_0092_D05.b :
ADR01_0047_F07.b :
SPL01_0003_G09.b :
UTR01_0063_G08.b :
UTR01_0068_H08.b :
SPL01_0094_C01.b :
OVR01_0089_A08.b :
OVR01_0046_B03.b :
SPL01_0035_B03.b :
SPL01_0100_A03.b :
TCH01_0024_B04.b :
SPL01_0084_A02.b :
OVRM1_0095_E09.b :
OVRT1_0004_E08.b :
OVR01_0020_H08.b :
OVRT1_0087_A10.b :
SKNB1_0027_A08.b :
SPL01_0065_G06.b :
CLNT1_0097_G03.b :
PCT01_0013_D08.b :
OVRT1_0090_G01.b :
SKNB1_0027_G04.b :
SKNB1_0092_E12.b :
PCT01_0007_C06.b :
TES01_0054_E07.b :
SKNB1_0015_D11.b :
TES01_0003_A03.b :
PST01_0059_D10.b :
PST01_0025_G09.b :
SPL01_0101_H02.b :
OVRM1_0213_C07.b :
OVR01_0045_G06.b :
PCT01_0014_C08.b :
OVRM1_0055_B06.b :