[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-001409

Length: 1,623

Sequence [FASTA format sequence]
AAAAAGAACT AGAGACTTCC TCAGTGCCGG AGCACAAAAC AGCATCCCCA CTCACACTTG
TGAAGAGAAA GCAGAACTCA GATCCTTCTC AGATCCAACC AACCAGGAGG AGGGCGCCCT
GGCAGAGGAC AGGCACCACA GCCACCTGGA GGTGGCTGAG CCCCTGTGTC CCAGCAGGCA
CCATGAAGTT AACCCTAGGA AGACAGAAGA AGCCAAGAGA TGAAGAAAAT CCCCATGGTT
CTGAGGACCT CCAGGCGGCC CTGCAGGAGC CCAGGCTGCG GCTCCTCCTG GCCGGGAGGA
CGGGGGCGGG GAAGAGCTCC ACGGGAAACA GCATCCTGGG CCGGAAGCAC TTTGACTCCA
GGCTCAGGGC CACGTCGGTG ACCCGAAGCT GTGCCGTGGC GAGCGGCAGG TGGGCGGAGT
GGGACGTGGA TGTCCTTGAC ACCCCGGACC TTTTCAGCTC CGAAGTCGCC CGGACAGACC
CCGACTGCAA GGAGAGAGGC CGCTGCTACC TGCTCGCAGC CCCCGGGCCC CACGCCCTGC
TCCTGGTGAC CCAGCTGGGC CGCTTCACGG CCCAGGACCA GCAGGCCTGG AGGGGGGTGA
AGGCGCTGTT CGGGGACGGG GTCTCGGCGC ACACGATCGT GGTCTTCACC CGCAAGGAGG
ACCTGGCGGA GGGCTCCCTG CAGGACTACG TGCGCGACAG CGAGAACCAG GCGCTCAGGC
AGCTGGTGGC CGAGTGCGGG GGCCGCGTCT GCGCCTTTAA CAACCGCGCC ACGGGTCCCG
AGCAGGAGGC GCAGGTGACG GAGCTGATGC GGCTGGTGGA GGATCTGGTG AGGGACCGCG
GCGGCGCCCC CTACACCAAC GACGTGTACC GCCTGGCGCA GGCCCTGGGC GGCGTGAGCC
CGGAGGAGAG GCTCCGCAAG GTGGCCGAGC GAGTGGCACA GAAGCAGCAG GGGTGCTGCC
TGCAGAGGTT CCTGTGTGAG AAGCCGAAGG CTCAAAGGAC CTGGTGGGCG CTGGCCCTGG
CTGTGCTGGC CATCGTGATC CTGATAGCCC TGTTCTTTTT CAAAGGTCCG TAGTCAGGGT
TCTCTTAAGT CTGGTCTAAA CACTAAACAC TACTCCCACC TGAAGCGGGA TTTCAAAAGC
ATCTGTTTTA AAGCTTCTCA TTCACTGTAG TGAACAGCGT TTCAAATAAT CGCATGGGGA
GTACCTGTTG TGGCTCTTCG AGTTAAGGAC CCCGCCAGTT GTCTTCTTGA GGATGGGTCT
TTGCTTCCTG GTCTCCTTCA TGGGGTCAGA AGAGGGCCTT GGCAGCAACG TGCAGGTGAA
CGTCTCAGAG GCGGCTCACA TCTGGTGTTG CCTATGGCTG TGGTGTTGGC CTTGGCTGCG
GTGTCGCTTC AACCCCTGGT CCGAGAACTT CCTATGCCAC ANGATGGCGG TAAAAGGAAA
GAAATANGAG TTTCTGTTGT GGCTCAGCAT AAAGGAATCT GACTAGCATT CATGGGACAC
ACAAGTTCCA GCCCTGGCCC CGCTCAGTGG GTGAAGGATC TGGCATTGCC ATGACCCGTG
CTGTGGGTCA CAGACCCTGC TCAGATCCCC CTTTGCTGTG GCTGCNGCAT ANGCTCCTTC
TGG


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGIMAP1GTPase IMAP family member 1 [Homo sapiens]. 2757e-74O
Contig/Assembly ProteinGIMAP2GTPase IMAP family member 2 [Homo sapiens]. 1864e-47O
Contig/Assembly ProteinGIMAP1-GIMAP5GIMAP1-GIMAP5 protein [Homo sapiens]. 1628e-40
Contig/Assembly ProteinGIMAP5GTPase IMAP family member 5 [Homo sapiens]. 1611e-39O
Contig/Assembly ProteinGIMAP6GTPase IMAP family member 6 [Homo sapiens]. 1582e-38O
Contig/Assembly ProteinGIMAP8GTPase IMAP family member 8 [Homo sapiens]. 1412e-33
Contig/Assembly ProteinGIMAP7GTPase IMAP family member 7 [Homo sapiens]. 1412e-33O
Contig/Assembly ProteinGIMAP4GTPase IMAP family member 4 [Homo sapiens]. 1372e-32O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGimap1GTPase IMAP family member 1 [Mus musculus]. 2587e-69O
Contig/Assembly ProteinGimap1GTPase IMAP family member 1 [Mus musculus]. 2587e-69O
Contig/Assembly ProteinGimap5GTPase IMAP family member 5 [Mus musculus]. 1766e-44O
Contig/Assembly ProteinGimap3GTPase IMAP family member 3 [Mus musculus]. 1766e-44O
Contig/Assembly ProteinGimap7GTPase, IMAP family member 7 [Mus musculus]. 1512e-36O
Contig/Assembly ProteinGimap6GTPase IMAP family member 6 [Mus musculus]. 1404e-33
Contig/Assembly ProteinGimap8GTPase IMAP family member 8 [Mus musculus]. 1304e-30
Contig/Assembly ProteinGimap8GTPase IMAP family member 8 [Mus musculus]. 1304e-30
Contig/Assembly ProteinGimap9GTPase, IMAP family member 9 [Mus musculus]. 1295e-30O
Contig/Assembly ProteinGimap4GTPase IMAP family member 4 isoform a [Mus musculus]. 1172e-26O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC482795PREDICTED: similar to GTPase, IMAP family member 1 [Canis familiaris]. 2451e-64O
Contig/Assembly ProteinLOC482797PREDICTED: similar to GTPase, IMAP family member 5 [Canis familiaris]. 1867e-47O
Contig/Assembly ProteinLOC610898PREDICTED: similar to GTPase, IMAP family member 7 [Canis familiaris]. 1558e-38O
Contig/Assembly ProteinLOC475533PREDICTED: similar to GTPase, IMAP family member 4 (Immunity-associated protein 4) (Immunity-associated nucleotide 1 protein) (hIAN1) [Canis familiaris]. 1367e-32O
Contig/Assembly ProteinLOC482798PREDICTED: similar to GTPase, IMAP family member 5 [Canis familiaris]. 1351e-31O
Contig/Assembly ProteinLOC482794PREDICTED: similar to GTPase, IMAP family member 8 [Canis familiaris]. 1321e-30
Contig/Assembly ProteinLOC482796PREDICTED: similar to GTPase, IMAP family member 6 isoform 1 [Canis familiaris]. 1221e-27


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGIMAP1PREDICTED: GTPase, IMAP family member 1-like isoform 2 [Bos taurus]. 3272e-89O
Contig/Assembly ProteinGIMAP1PREDICTED: GTPase, IMAP family member 1-like isoform 1 [Bos taurus]. 3272e-89O
Contig/Assembly ProteinGIMAP1PREDICTED: GTPase, IMAP family member 1-like isoform 2 [Bos taurus]. 3259e-89O
Contig/Assembly ProteinGIMAP1PREDICTED: GTPase, IMAP family member 1-like isoform 1 [Bos taurus]. 3259e-89O
Contig/Assembly ProteinGIMAP1GTPase, IMAP family member 1 [Bos taurus]. 3187e-87O
Contig/Assembly ProteinLOC530077PREDICTED: GTPase, IMAP family member 1-like isoform 2 [Bos taurus]. 1611e-39O
Contig/Assembly ProteinLOC530077PREDICTED: GTPase, IMAP family member 1-like isoform 1 [Bos taurus]. 1611e-39O
Contig/Assembly ProteinLOC530077PREDICTED: GTPase, IMAP family member 1-like isoform 2 [Bos taurus]. 1611e-39O
Contig/Assembly ProteinLOC530077PREDICTED: GTPase, IMAP family member 1-like [Bos taurus]. 1611e-39O
Contig/Assembly ProteinLOC511617GTPase, IMAP family member 5-like [Bos taurus]. 1504e-36O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100518703PREDICTED: GTPase IMAP family member 1-like [Sus scrofa]. 498e-141O
Contig/Assembly ProteinLOC100519177PREDICTED: GTPase IMAP family member 1-like isoform 2 [Sus scrofa]. 430e-120O
Contig/Assembly ProteinLOC100523477PREDICTED: GTPase IMAP family member 2-like [Sus scrofa]. 1888e-48O
Contig/Assembly ProteinLOC100627300PREDICTED: GTPase IMAP family member 6-like [Sus scrofa]. 1464e-35O
Contig/Assembly ProteinLOC100518347PREDICTED: LOW QUALITY PROTEIN: GTPase IMAP family member 4-like [Sus scrofa]. 1141e-25O
Contig/Assembly ProteinLOC100626896PREDICTED: nitric oxide synthase, endothelial-like [Sus scrofa]. 90.13e-18
Contig/Assembly ProteinLOC100518161PREDICTED: GTPase IMAP family member 7-like [Sus scrofa]. 90.13e-18O


Assembly Members: 451      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
BFLT10036D03BFLT1_0036_D03.bFS642932 
BFLT10048G10BFLT1_0048_G10.bFS643808 
CLNT10003C07CLNT1_0003_C07.bFS657265 
CLNT10008D10CLNT1_0008_D10.bFS657680 
CLNT10015D01CLNT1_0015_D01.bFS658251 
CLNT10018B12CLNT1_0018_B12.bFS658466 
CLNT10019B11CLNT1_0019_B11.bFS658538 
CLNT10019G06CLNT1_0019_G06.bFS658586 
CLNT10024C09CLNT1_0024_C09.bFS658932 
CLNT10025E10CLNT1_0025_E10.bFS659035 
CLNT10028H09CLNT1_0028_H09.bFS659289 
CLNT10032C10CLNT1_0032_C10.bFS659552 
CLNT10034D04CLNT1_0034_D04.bFS659711 
CLNT10035E07CLNT1_0035_E07.bFS659801 
CLNT10039H12CLNT1_0039_H12.bFS660154 
CLNT10049C02CLNT1_0049_C02.bFS660915 
CLNT10052G10CLNT1_0052_G10.bFS661205 
CLNT10056B09CLNT1_0056_B09.bFS661462 
CLNT10056H03CLNT1_0056_H03.bFS661515 
CLNT10065B12CLNT1_0065_B12.bFS662157 
CLNT10071H08CLNT1_0071_H08.bFS662714 
CLNT10074F05CLNT1_0074_F05.bFS662938 
CLNT10086F09CLNT1_0086_F09.bFS663272 
CLNT10087D11CLNT1_0087_D11.b  
CLNT10087G07CLNT1_0087_G07.bFS663356 
CLNT10098D12CLNT1_0098_D12.bFS664181 
CLNT10119A07CLNT1_0119_A07.bHX220587 
CLNT10122H07CLNT1_0122_H07.bHX220887 
CLNT10125D06CLNT1_0125_D06.bHX221073 
CLNT10129C10CLNT1_0129_C10.bHX221369 
CLNT10137A10CLNT1_0137_A10.bHX221967 
CLNT10140H03CLNT1_0140_H03.bHX222254 
CLNT10141G03CLNT1_0141_G03.bHX222329 
CLNT10142B05CLNT1_0142_B05.bHX222363 
CLNT10143F05CLNT1_0143_F05.bHX222474 
CLNT10147C02CLNT1_0147_C02.bHX222759 
CLNT10151A03CLNT1_0151_A03.bHX223053 
HTMT10041F08HTMT1_0041_F08.bFS667079 AK392002
ITT010005C12ITT01_0005_C12.bBW976436 
ITT010012F03ITT01_0012_F03.bBW977107 
ITT010014B05ITT01_0014_B05.bBW977239 
ITT010017H12ITT01_0017_H12.bBW977578 
ITT010022F05ITT01_0022_F05.bBW978004 
ITT010022F06ITT01_0022_F06.bBW978005 
ITT010033C02ITT01_0033_C02.bBW978952 
ITT010039D07ITT01_0039_D07.bBW979516 
ITT010041A05ITT01_0041_A05.bBW979654 
ITT010042A04ITT01_0042_A04.bBW979745 
ITT010044B02ITT01_0044_B02.bBW979935 
ITT010044H07ITT01_0044_H07.bBW980007 
ITT010051B12ITT01_0051_B12.bBW980497 
ITT010061E07ITT01_0061_E07.bBW981433 
ITT010073H08ITT01_0073_H08.bBW982543 
ITT010079D05ITT01_0079_D05.bBW983017 
ITT010082A11ITT01_0082_A11.bBW983259 
ITT010082C02ITT01_0082_C02.bBW983273 
ITT010082H03ITT01_0082_H03.bBW983329 
ITT010085F11ITT01_0085_F11.bBW983567 
ITT010093H01ITT01_0093_H01.bBW984296 
ITT010093H03ITT01_0093_H03.bBW984298 
ITT010094D06ITT01_0094_D06.bBW984347 
ITT010099C05ITT01_0099_C05.bBW984790 
KDN010008B05KDN01_0008_B05.bFS671769 
KDN010022A05KDN01_0022_A05.bFS672810 
KDN010047E02KDN01_0047_E02.b  
KDN010053H03KDN01_0053_H03.bFS674696 
KDN010066F11KDN01_0066_F11.bFS675721 
KDN010100A11KDN01_0100_A11.bFS678362 
LNG010004C06LNG01_0004_C06.bBP435362 
LNG010006E08LNG01_0006_E08.bBP437514 
LNG010011G03LNG01_0011_G03.bBP439127 
LNG010011G04LNG01_0011_G04.bBP439208 
LNG010013D05LNG01_0013_D05.bBP436287 
LNG010015H07LNG01_0015_H07.bBP440459 
LNG010016E12LNG01_0016_E12.bBP437875 
LNG010019C01LNG01_0019_C01.bBP434971 
LNG010021G02LNG01_0021_G02.bBP439052 
LNG010028D02LNG01_0028_D02.bBP436043 
LNG010029E11LNG01_0029_E11.bBP437797 
LNG010033D06LNG01_0033_D06.bBP436383 
LNG010034A12LNG01_0034_A12.bBP433923 
LNG010035G08LNG01_0035_G08.bBP439559 
LNG010036B04LNG01_0036_B04.bBP434245 
LNG010042C06LNG01_0042_C06.bBP435391 
LNG010042E06LNG01_0042_E06.bBP437375 
LNG010042H06LNG01_0042_H06.bBP440400 
LNG010068H09LNG01_0068_H09.bBP440656 
LNG010070C10LNG01_0070_C10.bBP435745 
LNG010073G07LNG01_0073_G07.bBP439498 
LNG010080E06LNG01_0080_E06.bBP437401 
LNG010089G02LNG01_0089_G02.bBP439100 
LNG010091E01LNG01_0091_E01.bBP436982 
LNG010096D02LNG01_0096_D02.bBP436091 
LNG010098G11LNG01_0098_G11.bBP439854 
LNG010102A04LNG01_0102_A04.bBP433321 
LNG010106C04LNG01_0106_C04.bBP435268 
LNG010108C07LNG01_0108_C07.bBP435524 
LNG010109F05LNG01_0109_F05.bBP438365 
LVR010008D02LVR01_0008_D02.bBP443759 
LVR010011D11LVR01_0011_D11.bBP444420 
LVR010012G10LVR01_0012_G10.bBP446985 
LVR010019B11LVR01_0019_B11.bBP442640 
LVR010022G09LVR01_0022_G09.bBP446918 
LVR010026C12LVR01_0026_C12.bBP443621 
LVR010048B11LVR01_0048_B11.bBP442664 
LVR010050H05LVR01_0050_H05.bBP447562 
LVR010053D03LVR01_0053_D03.bBP443870 
LVR010053H06LVR01_0053_H06.bBP447643 
LVR010059A12LVR01_0059_A12.bBP441833 
LVR010061C12LVR01_0061_C12.bBP443647 
LVR010063F04LVR01_0063_F04.bBP445702 
LVR010067A09LVR01_0067_A09.bBP441617 
LVR010071F10LVR01_0071_F10.bBP446140 
LVR010072F06LVR01_0072_F06.bBP445853 
LVR010076G10LVR01_0076_G10.bBP447038 
LVR010078B12LVR01_0078_B12.bBP442765 
LVR010083D11LVR01_0083_D11.bCJ000043 
LVR010085D07LVR01_0085_D07.bCJ000212 
LVR010089F08LVR01_0089_F08.bCJ000568 
LVR010090E09LVR01_0090_E09.bCJ000648 
LVR010100A05LVR01_0100_A05.bBP441323 
LVR010102B09LVR01_0102_B09.bBP442546 
LVR010106D08LVR01_0106_D08.bBP444259 
LVRM10023A06LVRM1_0023_A06.b  
LVRM10029E08LVRM1_0029_E08.bBP139634 
LVRM10030D02LVRM1_0030_D02.bBP138952 
LVRM10072C01LVRM1_0072_C01.bBP449726 
LVRM10095E01LVRM1_0095_E01.bCJ003615 
LVRM10109C07LVRM1_0109_C07.bBP450134 
LVRM10153C11LVRM1_0153_C11.bBP450464 
MLN010006D04MLN01_0006_D04.bCJ008146 
MLN010006D12MLN01_0006_D12.bCJ008152 
MLN010014A03MLN01_0014_A03.bCJ008763 
MLN010015D04MLN01_0015_D04.bBW963379 
MLN010032C05MLN01_0032_C05.bCJ010117 
MLN010033H12MLN01_0033_H12.bCJ010259 
MLN010034A01MLN01_0034_A01.bBW963503 
MLN010037A11MLN01_0037_A11.bCJ010507 
MLN010042A08MLN01_0042_A08.bCJ010927 
MLN010042D05MLN01_0042_D05.bCJ010951 
MLN010042F05MLN01_0042_F05.bCJ010969 
MLN010044F07MLN01_0044_F07.bCJ011137 
MLN010047F08MLN01_0047_F08.bBW963588 
MLN010048C02MLN01_0048_C02.bCJ011341 
MLN010048C10MLN01_0048_C10.bCJ011348 
MLN010051B01MLN01_0051_B01.bCJ011583 
MLN010051E05MLN01_0051_E05.bCJ011618 
MLN010059F02MLN01_0059_F02.bCJ012303 
MLN010059G09MLN01_0059_G09.bCJ012322 
MLN010061C02MLN01_0061_C02.bCJ012419 
MLN010064E01MLN01_0064_E01.bCJ012689 
MLN010071B09MLN01_0071_B09.bCJ013267 
MLN010072H03MLN01_0072_H03.bCJ013414 
MLN010074B01MLN01_0074_B01.bCJ013522 
MLN010074D12MLN01_0074_D12.bCJ013548 
MLN010077G02MLN01_0077_G02.bCJ013772 
MLN010080D04MLN01_0080_D04.bCJ014003 
MLN010082E03MLN01_0082_E03.bCJ014182 
MLN010082G10MLN01_0082_G10.bCJ014213 
MLN010083G08MLN01_0083_G08.bCJ014297 
MLN010084B01MLN01_0084_B01.bCJ014324 
MLN010084B12MLN01_0084_B12.bCJ014334 
MLN010085E03MLN01_0085_E03.bCJ014439 
MLN010088C03MLN01_0088_C03.bCJ014672 
MLN010089B01MLN01_0089_B01.bCJ014740 
MLN010092E04MLN01_0092_E04.bCJ015027 
MLN010100E08MLN01_0100_E08.bCJ015718 
MLN010101F02MLN01_0101_F02.bCJ015815 
OVR010028D06OVR01_0028_D06.bBP142794 
OVR010047C10OVR01_0047_C10.bBP142508 
OVR010063A04OVR01_0063_A04.bBW965191 
OVRM10018A05OVRM1_0018_A05.bBP454958 AK234802
OVRM10064B05OVRM1_0064_B05.bBP146589 
OVRT10004H12OVRT1_0004_H12.bFS686750 
OVRT10006D11OVRT1_0006_D11.bFS686873 
OVRT10017C06OVRT1_0017_C06.bFS687776 
OVRT10025F03OVRT1_0025_F03.bFS688466 
OVRT10040H12OVRT1_0040_H12.bFS689709 
OVRT10077H06OVRT1_0077_H06.bFS692719 
OVRT10093G03OVRT1_0093_G03.bFS694011 
OVRT10107A11OVRT1_0107_A11.bHX235327 
OVRT10113A07OVRT1_0113_A07.bHX235827 
OVRT10115E07OVRT1_0115_E07.bHX236036 
OVRT10140H12OVRT1_0140_H12.bHX238066 
PBL010005D01PBL01_0005_D01.bBW968743 
PBL010005E09PBL01_0005_E09.bBW968761 AK396002
PBL010006B10PBL01_0006_B10.bBW968806 
PBL010006D09PBL01_0006_D09.bBW968820 
PBL010008D07PBL01_0008_D07.bBW968959 
PBL010008H03PBL01_0008_H03.bBW968992 
PBL010011F10PBL01_0011_F10.bBW969226 
PBL010011H07PBL01_0011_H07.bBW969244 
PBL010012A06PBL01_0012_A06.bBW969252 
PBL010012E12PBL01_0012_E12.bBW969282 
PBL010019A07PBL01_0019_A07.bBW969629 
PBL010020B03PBL01_0020_B03.bBW969708 
PBL010021D01PBL01_0021_D01.bBP462398 
PBL010025A05PBL01_0025_A05.bBP155088 
PBL010025F12PBL01_0025_F12.bBP156173 
PBL010027D01PBL01_0027_D01.bBW969945 
PBL010027D07PBL01_0027_D07.bBW969951 
PBL010028G01PBL01_0028_G01.bBW970019 
PBL010028G03PBL01_0028_G03.bBP156252 
PBL010032D10PBL01_0032_D10.bBP155782 
PBL010032H10PBL01_0032_H10.bBP156620 
PBL010033B03PBL01_0033_B03.bBW970078 
PBL010033B04PBL01_0033_B04.bBW970079 
PBL010033F03PBL01_0033_F03.bBW970096 
PBL010034E05PBL01_0034_E05.bBW970130 
PBL010039D02PBL01_0039_D02.bBW970346 
PBL010041C08PBL01_0041_C08.bBW970480 
PBL010044C04PBL01_0044_C04.bBW970677 
PBL010044E04PBL01_0044_E04.bBW970700 
PBL010045B04PBL01_0045_B04.bBW970740 
PBL010045G07PBL01_0045_G07.bBW970784 
PBL010045G12PBL01_0045_G12.bBP156411 
PBL010046G07PBL01_0046_G07.bBW970835 
PBL010048B02PBL01_0048_B02.bBW970892 
PBL010048C10PBL01_0048_C10.bBW970905 
PBL010049B02PBL01_0049_B02.bBW970952 
PBL010049E01PBL01_0049_E01.bBW970982 
PBL010049F07PBL01_0049_F07.b  
PBL010049H05PBL01_0049_H05.bBW971013 
PBL010050B04PBL01_0050_B04.bBW971025 
PBL010050G10PBL01_0050_G10.bBW971078 
PBL010053B06PBL01_0053_B06.bBW971177 
PBL010053G02PBL01_0053_G02.bBW971229 
PBL010054F07PBL01_0054_F07.bBW971308 
PBL010055B11PBL01_0055_B11.bBW971348 
PBL010055C04PBL01_0055_C04.bBW971350 
PBL010059A08PBL01_0059_A08.bBW971539 
PBL010059B05PBL01_0059_B05.bBW971543 
PBL010060D10PBL01_0060_D10.bBW971608 
PBL010065A01PBL01_0065_A01.bBW971970 
PBL010065C05PBL01_0065_C05.bBW971995 
PBL010065G06PBL01_0065_G06.bBW972038 
PBL010066E01PBL01_0066_E01.bBW972096 
PBL010066E06PBL01_0066_E06.bBW972101 
PBL010067G04PBL01_0067_G04.bBW972202 
PBL010068C12PBL01_0068_C12.bBW972248 
PBL010070E05PBL01_0070_E05.bBW972412 
PBL010071F06PBL01_0071_F06.bBW972500 
PBL010072C10PBL01_0072_C10.bBW972556 
PBL010072H08PBL01_0072_H08.bBW972609 
PBL010073C10PBL01_0073_C10.bBW972642 
PBL010073D12PBL01_0073_D12.bBW972654 
PBL010073E05PBL01_0073_E05.bBW972659 
PBL010074F07PBL01_0074_F07.bBW972764 
PBL010074G01PBL01_0074_G01.bBW972770 
PBL010074H11PBL01_0074_H11.bBW972790 
PBL010075B03PBL01_0075_B03.bBW972805 
PBL010075D04PBL01_0075_D04.bBW972828 
PBL010078E04PBL01_0078_E04.bBW973100 
PBL010080A02PBL01_0080_A02.bBW973234 
PBL010082H04PBL01_0082_H04.bBW973498 
PBL010085A09PBL01_0085_A09.bBW973684 
PBL010085D11PBL01_0085_D11.bBW973722 
PBL010085F01PBL01_0085_F01.bBW973736 
PBL010086B03PBL01_0086_B03.bBW973782 
PBL010086E11PBL01_0086_E11.bBW973823 
PBL010087D03PBL01_0087_D03.bBW973896 
PBL010089B12PBL01_0089_B12.bBW974059 
PBL010090A08PBL01_0090_A08.bBW974135 
PBL010091B10PBL01_0091_B10.bBW974230 
PBL010097E03PBL01_0097_E03.bBW974699 
PBL010100D05PBL01_0100_D05.bBW974962 
PBL010101E10PBL01_0101_E10.bBW975064 
PBL010102A07PBL01_0102_A07.bBW975108 
PBL010105B07PBL01_0105_B07.bBW975397 
PBL010105G06PBL01_0105_G06.bBW975455 
PBL010106C01PBL01_0106_C01.bBW975497 
PCT010003D02PCT01_0003_D02.b  
PST010008C09PST01_0008_C09.bFS697613 
PST010009B02PST01_0009_B02.bFS697671 
PST010010G04PST01_0010_G04.bFS697805 
PST010014B02PST01_0014_B02.bFS698068 
PST010020B03PST01_0020_B03.bFS698527 
PST010022C09PST01_0022_C09.bFS698704 
PST010029C10PST01_0029_C10.bFS699244 
PST010030B04PST01_0030_B04.bFS699273 
PST010032C06PST01_0032_C06.bFS699362 
PST010033D11PST01_0033_D11.bFS699432 
PST010035B11PST01_0035_B11.bFS699564 
PST010038B10PST01_0038_B10.bHX239150 
PST010038C10PST01_0038_C10.bFS699796 
PST010039A01PST01_0039_A01.bHX239153 
PST010039F04PST01_0039_F04.bFS699904 
PST010042C11PST01_0042_C11.bFS700126 
PST010046E12PST01_0046_E12.bFS700464 
PST010048H08PST01_0048_H08.b  
PST010052H05PST01_0052_H05.bFS700979 
PST010061D01PST01_0061_D01.bFS701647 
PST010064D10PST01_0064_D10.bFS701898 
PST010067H01PST01_0067_H01.b  
PST010070D07PST01_0070_D07.bFS702356 
PST010085D07PST01_0085_D07.bFS703567 
PST010087D10PST01_0087_D10.bFS703732 
PST010098H03PST01_0098_H03.b  
PTG010034G11PTG01_0034_G11.bFS707433 
PTG010050G10PTG01_0050_G10.bFS708861 
PTG010051D03PTG01_0051_D03.bFS708910 
PTG010075G07PTG01_0075_G07.bFS710807 
SMG010015D04SMG01_0015_D04.bFS714555 
SMG010019G10SMG01_0019_G10.bFS714946 
SMG010032B04SMG01_0032_B04.bFS716059 
SMG010046D03SMG01_0046_D03.bFS717281 
SMG010059D05SMG01_0059_D05.bFS718363 
SPL010001E01SPL01_0001_E01.bBP158016 
SPL010001F02SPL01_0001_F02.bBP158392 
SPL010003F01SPL01_0003_F01.bBP158361 
SPL010005F02SPL01_0005_F02.bBP158396 
SPL010008A10SPL01_0008_A10.bBP156918 
SPL010010B06SPL01_0010_B06.bBP157137 
SPL010013G01SPL01_0013_G01.bBP158715 
SPL010017B11SPL01_0017_B11.bBP157275 
SPL010021A09SPL01_0021_A09.bBP156901 
SPL010021E09SPL01_0021_E09.bBP158261 
SPL010022C03SPL01_0022_C03.bBP157397 
SPL010023D02SPL01_0023_D02.bBP157713 
SPL010024A03SPL01_0024_A03.bBP156741 
SPL010024C12SPL01_0024_C12.bBP157650 
SPL010026G08SPL01_0026_G08.bBP158929 
SPL010028D12SPL01_0028_D12.bBP158009 
SPL010030E07SPL01_0030_E07.bCJ016346 
SPL010031B01SPL01_0031_B01.bCJ016397 
SPL010033B06SPL01_0033_B06.bCJ016579 
SPL010034B11SPL01_0034_B11.bCJ016678 
SPL010034E02SPL01_0034_E02.bCJ016704 
SPL010036H03SPL01_0036_H03.bBP159119 
SPL010037G04SPL01_0037_G04.bBP158817 
SPL010038B06SPL01_0038_B06.bBP157155 
SPL010039F11SPL01_0039_F11.bBP158676 
SPL010041A02SPL01_0041_A02.bBP156725 
SPL010041B11SPL01_0041_B11.bBP157291 
SPL010041D10SPL01_0041_D10.bBP157955 
SPL010041F12SPL01_0041_F12.bBP158704 
SPL010042F02SPL01_0042_F02.bCJ016808 
SPL010043H08SPL01_0043_H08.bCJ016930 
SPL010044A11SPL01_0044_A11.bCJ016942 
SPL010044C04SPL01_0044_C04.bCJ016957 
SPL010044G03SPL01_0044_G03.bCJ017004 
SPL010045E01SPL01_0045_E01.bCJ017072 
SPL010046C02SPL01_0046_C02.bCJ017144 
SPL010048A07SPL01_0048_A07.bCJ017305 
SPL010050G01SPL01_0050_G01.bCJ017539 
SPL010050G06SPL01_0050_G06.bCJ017544 
SPL010051B09SPL01_0051_B09.bCJ017582 
SPL010051C03SPL01_0051_C03.bCJ017588 
SPL010051C07SPL01_0051_C07.bCJ017592 
SPL010051E08SPL01_0051_E08.bCJ017616 
SPL010052D09SPL01_0052_D09.bCJ017698 
SPL010052F09SPL01_0052_F09.bCJ017721 
SPL010052G04SPL01_0052_G04.bCJ017728 
SPL010053A11SPL01_0053_A11.bCJ017759 
SPL010053G12SPL01_0053_G12.bCJ017828 
SPL010053H03SPL01_0053_H03.bCJ017830 
SPL010054H11SPL01_0054_H11.bCJ017922 
SPL010056C05SPL01_0056_C05.bCJ018041 
SPL010057H09SPL01_0057_H09.bCJ018190 
SPL010058C05SPL01_0058_C05.bCJ018221 
SPL010060A12SPL01_0060_A12.bCJ018384 
SPL010060G12SPL01_0060_G12.bCJ018447 
SPL010063B11SPL01_0063_B11.bCJ018668 
SPL010063C04SPL01_0063_C04.bCJ018673 
SPL010063H09SPL01_0063_H09.bCJ018736 
SPL010064B06SPL01_0064_B06.bCJ018757 
SPL010064H05SPL01_0064_H05.bCJ018827 
SPL010065F11SPL01_0065_F11.bCJ018896 
SPL010067B05SPL01_0067_B05.bCJ019017 
SPL010068D09SPL01_0068_D09.bCJ019136 
SPL010068E07SPL01_0068_E07.bCJ019145 
SPL010068H04SPL01_0068_H04.bCJ019176 
SPL010069F08SPL01_0069_F08.bCJ019248 
SPL010069H06SPL01_0069_H06.bCJ019269 
SPL010070G08SPL01_0070_G08.bCJ019347 
SPL010071A09SPL01_0071_A09.bCJ019371 
SPL010071D05SPL01_0071_D05.bCJ019402 
SPL010073A02SPL01_0073_A02.bCJ019545 
SPL010074F08SPL01_0074_F08.bCJ019699 
SPL010075G04SPL01_0075_G04.bCJ019795 
SPL010075H09SPL01_0075_H09.bCJ019812 
SPL010077E04SPL01_0077_E04.bCJ019960 
SPL010078A07SPL01_0078_A07.bCJ020008 
SPL010078B05SPL01_0078_B05.bCJ020017 
SPL010079A01SPL01_0079_A01.bCJ020092 
SPL010079F06SPL01_0079_F06.bCJ020149 
SPL010079H04SPL01_0079_H04.bCJ020171 
SPL010079H11SPL01_0079_H11.bCJ020178 
SPL010082H08SPL01_0082_H08.bCJ020451 
SPL010083B09SPL01_0083_B09.bCJ020475 
SPL010083D03SPL01_0083_D03.bCJ020492 
SPL010083G01SPL01_0083_G01.bCJ020525 
SPL010084B08SPL01_0084_B08.bCJ020567 
SPL010084C04SPL01_0084_C04.bCJ020575 
SPL010085H04SPL01_0085_H04.bCJ020711 
SPL010085H11SPL01_0085_H11.bCJ020718 
SPL010087B12SPL01_0087_B12.bCJ020835 
SPL010088E12SPL01_0088_E12.bCJ020958 
SPL010089D05SPL01_0089_D05.bCJ021030 
SPL010091F01SPL01_0091_F01.bCJ021225 
SPL010093F04SPL01_0093_F04.bCJ021403 
SPL010097C05SPL01_0097_C05.bCJ021736 
SPL010097D07SPL01_0097_D07.bCJ021750 
SPL010099H10SPL01_0099_H10.bCJ021972 AK350591
SPL010100G08SPL01_0100_G08.bCJ022039 
SPL010101C10SPL01_0101_C10.bCJ022085 
SPL010103C09SPL01_0103_C09.bCJ022251 
SPL010105D07SPL01_0105_D07.bCJ022438 
SPL010105E03SPL01_0105_E03.bCJ022446 
SPLT10061G05SPLT1_0061_G05.bHX243951 
SPLT10069C05SPLT1_0069_C05.bHX244550 
SPLT10087D08SPLT1_0087_D08.bHX245976 
TCH010019D08TCH01_0019_D08.bCJ023842 
TCH010026D07TCH01_0026_D07.bCJ024360 
TCH010032B06TCH01_0032_B06.bCJ024793 
TCH010052D03TCH01_0052_D03.bCJ026319 
TCH010080C12TCH01_0080_C12.bCJ028211 
TCH010081E08TCH01_0081_E08.bCJ028306 
TCH010096C06TCH01_0096_C06.bCJ029450 
TES010001F05TES01_0001_F05.bCJ030065 
TES010014D09TES01_0014_D09.bCJ030941 
TES010020D05TES01_0020_D05.bCJ031344 
TES010026A01TES01_0026_A01.b  
TES010037H07TES01_0037_H07.b  
TES010039A05TES01_0039_A05.b  
TES010042B08TES01_0042_B08.bCJ032701 
TES010083D06TES01_0083_D06.bCJ035353 
TES010084B01TES01_0084_B01.bCJ035405 
TES010096D02TES01_0096_D02.bCJ036255 
THY010001D02THY01_0001_D02.bBP163183 
THY010007B11THY01_0007_B11.bBP161629 
THY010034A12THY01_0034_A12.bBP160501 
THY010039B02THY01_0039_B02.bBP160708 
THY010041B06THY01_0041_B06.bBP161131 
THY010046C05THY01_0046_C05.bBP162286 
THY010046G05THY01_0046_G05.bBP167289 
THY010046H08THY01_0046_H08.bBP168885 
THY010069G07THY01_0069_G07.bBP167516 
THY010082D09THY01_0082_D09.bBP163961 AK239236
THY010090G07THY01_0090_G07.bBP167530 
THY010110B12THY01_0110_B12.bBP161811 
THY010110D01THY01_0110_D01.bBP163166 
THY010115G01THY01_0115_G01.bBP166916 
THY010202F03THY01_0202_F03.bBP165898 
UTR010020C07UTR01_0020_C07.bBP170708 
UTR010036A04UTR01_0036_A04.bBP169517 
UTR010066C09UTR01_0066_C09.bBP463454 
UTR010075B03UTR01_0075_B03.bBP463026 
UTR010082H12UTR01_0082_H12.bCJ037615 
UTR010095E06UTR01_0095_E06.bCJ038773 
UTR010101D10UTR01_0101_D10.bCJ039236 

  

SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
810A2200.176WSAGG/R
C10300.824CGG/R
863C9400.847WSGAC/D
T1700.153GAT/D
871A2000.215WNCAC/H
G7300.785CGC/R


Alignment:      TOP

20110601C-001409 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
SPL01_0099_H10.b : nnntttgcta
SPL01_0083_G01.b : nnnnggctaggactatgac
PBL01_0070_E05.b :
PBL01_0072_C10.b :
SPL01_0071_A09.b :
PBL01_0005_E09.b :
SPL01_0069_F08.b :
SPL01_0087_B12.b :
SPL01_0100_G08.b :
THY01_0046_G05.b :
PBL01_0049_F07.b :
MLN01_0042_D05.b :
ITT01_0033_C02.b :
SPL01_0060_G12.b :
MLN01_0006_D12.b :
PBL01_0032_D10.b :
SPLT1_0061_G05.b :
UTR01_0101_D10.b :
CLNT1_0140_H03.b :
ITT01_0014_B05.b :
SPLT1_0087_D08.b :
PBL01_0012_A06.b :
LNG01_0106_C04.b :
HTMT1_0041_F08.b :
MLN01_0072_H03.b :
PBL01_0066_E01.b :
SPL01_0088_E12.b :
LNG01_0109_F05.b :
CLNT1_0137_A10.b :
LNG01_0035_G08.b :
LNG01_0021_G02.b :
LNG01_0004_C06.b : g
PBL01_0050_G10.b :
LNG01_0070_C10.b :
CLNT1_0143_F05.b :
CLNT1_0028_H09.b :
SPL01_0063_C04.b :
BFLT1_0036_D03.b :
LNG01_0036_B04.b :
SPL01_0001_F02.b :
ITT01_0094_D06.b :
CLNT1_0024_C09.b :
TCH01_0026_D07.b :
MLN01_0032_C05.b :
PBL01_0090_A08.b :
LVRM1_0095_E01.b :
OVRM1_0018_A05.b :
OVR01_0063_A04.b :
SPL01_0052_F09.b :
LVR01_0061_C12.b :
SPL01_0097_C05.b :
LVRM1_0023_A06.b :
SPL01_0054_H11.b :
THY01_0001_D02.b : aaggtacccactanncatntcaaccttccaattcaattatcctg
SPL01_0060_A12.b :
PBL01_0006_B10.b :
THY01_0046_H08.b :
MLN01_0051_B01.b :
SMG01_0059_D05.b :
SPL01_0034_B11.b :
OVRT1_0140_H12.b :
LVRM1_0072_C01.b :
SPL01_0105_D07.b :
LVRM1_0109_C07.b :
LVRM1_0029_E08.b :
PBL01_0008_H03.b :
SPL01_0075_H09.b :
THY01_0007_B11.b :
LNG01_0091_E01.b :
LVRM1_0030_D02.b :
MLN01_0083_G08.b :
SPL01_0050_G06.b :
SPL01_0017_B11.b :
SPL01_0033_B06.b :
SPL01_0043_H08.b :
THY01_0041_B06.b :
SPL01_0021_A09.b :
MLN01_0048_C02.b :
THY01_0069_G07.b :
MLN01_0034_A01.b :
PBL01_0033_B04.b :
SPL01_0022_C03.b :
PTG01_0050_G10.b :
PBL01_0008_D07.b :
SPL01_0013_G01.b :
MLN01_0033_H12.b :
SPL01_0021_E09.b :
SPL01_0068_H04.b :
PTG01_0051_D03.b :
SPL01_0053_H03.b :
PBL01_0025_F12.b :
MLN01_0042_F05.b :
SPL01_0048_A07.b :
SPL01_0051_C03.b :
SPL01_0091_F01.b :
PBL01_0033_F03.b :
PBL01_0034_E05.b :
SPL01_0063_B11.b :
SPL01_0052_G04.b :
PBL01_0019_A07.b :
ITT01_0085_F11.b :
OVRT1_0017_C06.b :
PBL01_0025_A05.b :
PBL01_0065_C05.b :
PBL01_0050_B04.b :
SPL01_0057_H09.b :
PBL01_0039_D02.b :
SPL01_0084_C04.b :
SPL01_0078_B05.b :
PTG01_0075_G07.b :
LVR01_0026_C12.b :
PBL01_0049_E01.b :
PBL01_0049_H05.b :
LVR01_0090_E09.b :
SPL01_0101_C10.b :
PBL01_0045_G12.b :
SPL01_0070_G08.b :
MLN01_0006_D04.b :
UTR01_0082_H12.b :
PBL01_0020_B03.b :
CLNT1_0087_G07.b :
LVR01_0089_F08.b :
SMG01_0046_D03.b :
PBL01_0027_D01.b :
MLN01_0074_D12.b :
PBL01_0011_H07.b :
SPL01_0050_G01.b :
SPL01_0079_H04.b :
MLN01_0037_A11.b :
CLNT1_0142_B05.b :
PBL01_0073_E05.b :
MLN01_0044_F07.b :
OVRT1_0107_A11.b :
SPL01_0056_C05.b :
SPL01_0083_D03.b :
PBL01_0021_D01.b :
LVR01_0085_D07.b :
MLN01_0064_E01.b :
SMG01_0019_G10.b :
SPL01_0038_B06.b :
SPL01_0071_D05.b :
MLN01_0015_D04.b :
SPL01_0068_D09.b :
PBL01_0086_B03.b :
CLNT1_0074_F05.b :
SPL01_0064_H05.b :
MLN01_0014_A03.b :
PBL01_0012_E12.b :
PBL01_0048_B02.b :
SPL01_0069_H06.b :
PBL01_0006_D09.b :
SPL01_0044_A11.b :
MLN01_0047_F08.b :
CLNT1_0019_G06.b :
PBL01_0045_G07.b :
PBL01_0046_G07.b :
SPL01_0041_F12.b :
CLNT1_0056_H03.b :
LVR01_0102_B09.b :
OVRT1_0113_A07.b :
CLNT1_0065_B12.b :
MLN01_0042_A08.b :
OVR01_0028_D06.b :
CLNT1_0098_D12.b :
LNG01_0073_G07.b :
MLN01_0088_C03.b :
SPL01_0053_G12.b :
SPL01_0074_F08.b :
MLN01_0080_D04.b :
SPL01_0036_H03.b :
LVR01_0067_A09.b :
MLN01_0077_G02.b :
SPL01_0079_H11.b :
LVR01_0008_D02.b :
LVR01_0019_B11.b :
MLN01_0089_B01.b :
SPL01_0041_B11.b :
LVR01_0022_G09.b :
LVR01_0078_B12.b :
CLNT1_0071_H08.b :
SPL01_0067_B05.b :
CLNT1_0008_D10.b :
SPL01_0079_F06.b :
OVRT1_0040_H12.b :
LNG01_0013_D05.b :
SPL01_0084_B08.b :
LNG01_0068_H09.b :
CLNT1_0122_H07.b :
UTR01_0036_A04.b :
LNG01_0029_E11.b :
ITT01_0017_H12.b :
MLN01_0084_B12.b :
LVR01_0072_F06.b :
ITT01_0022_F05.b :
PBL01_0033_B03.b :
BFLT1_0048_G10.b :
THY01_0034_A12.b :
SPL01_0058_C05.b :
SPL01_0039_F11.b :
LNG01_0042_E06.b :
LVR01_0053_D03.b :
LVR01_0100_A05.b :
CLNT1_0086_F09.b :
CLNT1_0035_E07.b :
UTR01_0075_B03.b :
LNG01_0034_A12.b :
SPL01_0085_H11.b :
OVRT1_0077_H06.b :
SPL01_0003_F01.b :
LNG01_0033_D06.b :
CLNT1_0018_B12.b :
LNG01_0019_C01.b :
SPL01_0085_H04.b :
THY01_0082_D09.b :
OVR01_0047_C10.b :
LVR01_0083_D11.b :
LNG01_0089_G02.b :
SPL01_0005_F02.b :
PBL01_0059_A08.b :
UTR01_0066_C09.b :
LVR01_0106_D08.b :
LNG01_0042_C06.b :
LVR01_0012_G10.b :
LVR01_0011_D11.b :
LVR01_0050_H05.b :
SPL01_0037_G04.b :
SPL01_0078_A07.b :
MLN01_0085_E03.b :
CLNT1_0003_C07.b :
CLNT1_0039_H12.b :
LNG01_0011_G04.b :
PBL01_0028_G03.b :
PBL01_0086_E11.b :
PBL01_0011_F10.b :
LVR01_0048_B11.b :
CLNT1_0056_B09.b :
ITT01_0042_A04.b :
ITT01_0012_F03.b :
SPL01_0103_C09.b :
PBL01_0075_B03.b :
PBL01_0059_B05.b :
THY01_0090_G07.b :
SPL01_0079_A01.b :
LNG01_0006_E08.b :
MLN01_0082_G10.b :
CLNT1_0119_A07.b :
PBL01_0074_F07.b :
SPL01_0064_B06.b :
THY01_0202_F03.b :
LNG01_0042_H06.b :
OVRT1_0093_G03.b :
PBL01_0087_D03.b :
PBL01_0073_D12.b :
OVRT1_0006_D11.b :
PBL01_0065_G06.b :
PBL01_0071_F06.b :
PBL01_0080_A02.b :
PBL01_0091_B10.b :
ITT01_0039_D07.b :
ITT01_0041_A05.b :
PBL01_0105_B07.b :
MLN01_0074_B01.b :
LNG01_0108_C07.b :
CLNT1_0049_C02.b :
MLN01_0084_B01.b :
SPL01_0082_H08.b :
SPL01_0065_F11.b :
SPL01_0008_A10.b :
LVR01_0063_F04.b :
SPL01_0068_E07.b :
CLNT1_0015_D01.b :
CLNT1_0034_D04.b :
CLNT1_0032_C10.b :
PBL01_0075_D04.b :
ITT01_0044_B02.b :
MLN01_0101_F02.b :
ITT01_0061_E07.b :
ITT01_0073_H08.b :
ITT01_0079_D05.b :
MLN01_0092_E04.b :
OVRT1_0025_F03.b :
PBL01_0065_A01.b :
LNG01_0015_H07.b :
ITT01_0082_H03.b :
PBL01_0053_G02.b :
PBL01_0067_G04.b :
LNG01_0096_D02.b :
PTG01_0034_G11.b :
PBL01_0074_G01.b :
PBL01_0066_E06.b :
PBL01_0068_C12.b :
PBL01_0055_C04.b :
THY01_0039_B02.b :
PBL01_0073_C10.b :
ITT01_0044_H07.b :
UTR01_0095_E06.b :
ITT01_0093_H01.b :
PBL01_0101_E10.b :
ITT01_0082_C02.b :
PBL01_0085_A09.b :
PBL01_0085_F01.b :
MLN01_0100_E08.b :
PBL01_0074_H11.b :
PBL01_0105_G06.b :
TCH01_0032_B06.b :
PBL01_0102_A07.b :
PBL01_0078_E04.b :
PBL01_0100_D05.b :
ITT01_0051_B12.b :
PBL01_0055_B11.b :
ITT01_0082_A11.b :
CLNT1_0141_G03.b :
PBL01_0032_H10.b :
CLNT1_0151_A03.b :
CLNT1_0025_E10.b :
CLNT1_0125_D06.b : ttagctctctcctctttttcaccttccgctttttgattacgccttaccgccttcggcttt
PST01_0098_H03.b :
THY01_0110_B12.b :
TES01_0096_D02.b :
SPL01_0023_D02.b :
CLNT1_0087_D11.b :
UTR01_0020_C07.b :
TES01_0001_F05.b :
PST01_0039_F04.b :
PBL01_0060_D10.b :
PST01_0052_H05.b :
KDN01_0100_A11.b :
KDN01_0066_F11.b :
THY01_0115_G01.b :
CLNT1_0129_C10.b :
TES01_0039_A05.b :
KDN01_0047_E02.b :
CLNT1_0147_C02.b :
PST01_0010_G04.b :
PST01_0008_C09.b :
KDN01_0053_H03.b :
TES01_0083_D06.b :
PST01_0042_C11.b :
TES01_0014_D09.b :
PST01_0032_C06.b :
PST01_0014_B02.b :
PST01_0030_B04.b :
PST01_0009_B02.b :
PST01_0038_B10.b :
KDN01_0008_B05.b :
PST01_0070_D07.b :
PST01_0064_D10.b :
PST01_0087_D10.b :
PST01_0046_E12.b :
PST01_0038_C10.b :
PST01_0033_D11.b :
KDN01_0022_A05.b :
TES01_0037_H07.b :
TES01_0084_B01.b :
PST01_0061_D01.b :
PST01_0020_B03.b :
PST01_0029_C10.b :
PST01_0067_H01.b :
TES01_0020_D05.b :
PST01_0035_B11.b :
TES01_0042_B08.b :
PST01_0085_D07.b :
SPL01_0073_A02.b :
SPL01_0031_B01.b :
SPL01_0026_G08.b :
OVRT1_0115_E07.b :
PBL01_0044_E04.b :
SPL01_0051_C07.b :
MLN01_0059_G09.b :
LNG01_0080_E06.b :
LVR01_0059_A12.b :
MLN01_0059_F02.b :
SPL01_0041_A02.b :
SPL01_0052_D09.b :
LVR01_0053_H06.b :
MLN01_0082_E03.b :
PBL01_0049_B02.b :
ITT01_0093_H03.b :
PBL01_0054_F07.b :
MLN01_0071_B09.b :
PBL01_0089_B12.b :
SPL01_0044_C04.b :
ITT01_0022_F06.b :
TCH01_0081_E08.b :
OVRT1_0004_H12.b :
TES01_0026_A01.b :
SPLT1_0069_C05.b :
SPL01_0105_E03.b :
PST01_0022_C09.b :
PST01_0048_H08.b :
SPL01_0053_A11.b :
PBL01_0041_C08.b :
PBL01_0027_D07.b :
SPL01_0044_G03.b :
LVRM1_0153_C11.b :
SPL01_0046_C02.b :
PBL01_0044_C04.b :
LNG01_0011_G03.b :
MLN01_0048_C10.b :
PBL01_0028_G01.b :
LVR01_0071_F10.b :
PBL01_0097_E03.b :
SPL01_0024_C12.b :
SPL01_0024_A03.b :
SPL01_0001_E01.b :
LNG01_0102_A04.b :
OVRM1_0064_B05.b :
SPL01_0051_E08.b :
SPL01_0041_D10.b :
SMG01_0032_B04.b :
SPL01_0089_D05.b :
PBL01_0053_B06.b :
SPL01_0083_B09.b :
LNG01_0028_D02.b :
TCH01_0080_C12.b :
LNG01_0016_E12.b :
CLNT1_0052_G10.b :
SPL01_0077_E04.b :
PBL01_0082_H04.b :
PBL01_0072_H08.b :
PST01_0039_A01.b :
PBL01_0005_D01.b :
MLN01_0061_C02.b :
PBL01_0045_B04.b :
SPL01_0063_H09.b :
ITT01_0005_C12.b :
PCT01_0003_D02.b :
THY01_0110_D01.b :
TCH01_0052_D03.b :
SPL01_0010_B06.b :
MLN01_0051_E05.b :
SPL01_0028_D12.b :
SPL01_0045_E01.b :
SMG01_0015_D04.b :
SPL01_0093_F04.b :
TCH01_0096_C06.b :
SPL01_0034_E02.b :
SPL01_0051_B09.b :
PBL01_0106_C01.b :
TCH01_0019_D08.b :
ITT01_0099_C05.b :
CLNT1_0019_B11.b :
LVR01_0076_G10.b :
SPL01_0075_G04.b :
LNG01_0098_G11.b :
SPL01_0030_E07.b :
PBL01_0048_C10.b :
SPL01_0042_F02.b :
SPL01_0097_D07.b :
THY01_0046_C05.b :
PBL01_0085_D11.b :
20110601C-001409 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
SPL01_0099_H10.b : ggacttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0083_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0070_E05.b : nnnggtgaaagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0072_C10.b : nnnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0071_A09.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0005_E09.b : nggcttcannaaagataacagagcxxxxxxxxxx
SPL01_0069_F08.b : nnggctaggcacttaacxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0087_B12.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0100_G08.b : tttnnnggctaggactatgacagtttgtcxxxxxxxxxxx
THY01_0046_G05.b : ctttggggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0049_F07.b :
MLN01_0042_D05.b : nnnnnggttgtgacttgacxxxxxxxxxxxxxxxxxxxxxx
ITT01_0033_C02.b : nnnggatcaacaxxxxxx
SPL01_0060_G12.b : nttgagctaggacttanacxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0006_D12.b : nnttttggtggctatgacagtttgtacxxxxxxxxxxxxxxxx
PBL01_0032_D10.b : ngggtcaacaxxxxx
SPLT1_0061_G05.b : nnnccgcgataagaggccgta
UTR01_0101_D10.b : nnnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0140_H03.b : nnnccccgtcgcgnacgxxxxxxxxxxxxxxx
ITT01_0014_B05.b : nnggctacacaxxxx
SPLT1_0087_D08.b : nnnccgctggtacgaxxxxxxxxx
PBL01_0012_A06.b : nnnnnnnnnnnnnnnnnnnn
LNG01_0106_C04.b : nnnccttggacttanacxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0041_F08.b : tttaacgaggtacgxxxxxxxxx
MLN01_0072_H03.b : nnnggctaggactatgacagtttgtcxxxxxxxxxxxxxxxxxxxxxx
PBL01_0066_E01.b : nnnaaagagxxxxxxxxx
SPL01_0088_E12.b : ctggcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0109_F05.b : tttttngggcggccatgacxxxxxxxxxxxxxxxxxx
CLNT1_0137_A10.b : ttcagctgtcngxxxxxxxxxxxxxxxxx
LNG01_0035_G08.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0021_G02.b : ggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0004_C06.b : cattatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0050_G10.b : aaatgaagcx
LNG01_0070_C10.b : nggtttgctggacatgacagtttgtcxxxxxxxxxxxx
CLNT1_0143_F05.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0028_H09.b : cacttcagcgtcggagtgxxxxxxxxxxx
SPL01_0063_C04.b : nnnggcttggactatgacxxxxxxxxxxxxxxxxxxxx
BFLT1_0036_D03.b : ggaactcgtctgcgnacgxxxxxxxxxxxxxxx
LNG01_0036_B04.b : ggctcaagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0001_F02.b : ttttggagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0094_D06.b : nnggtgaaacxxx
CLNT1_0024_C09.b : ttccttcagctgtacgagtgxxxxxxxxxxxx
TCH01_0026_D07.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxx
MLN01_0032_C05.b : nnnccatcggcnnggctggacttgacagtttgtcxxxxxxx
PBL01_0090_A08.b : nnnaagagtaacaxxx
LVRM1_0095_E01.b : xxxxxxxx
OVRM1_0018_A05.b : nagttgtcxxxxxxxxxxxxx
OVR01_0063_A04.b : cttgtcctnnnactttttttnnggcatggtacttnacagtttgtacxxxxxxxxxxxx
SPL01_0052_F09.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_C12.b : cgttctggcttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0097_C05.b : nnntttgcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0023_A06.b : gagaggaggtaggtggcaagxxxxxxxxx
SPL01_0054_H11.b : nnnnnggattggactatgacxxxxxxxxxxxxxxxxxxxxxx
THY01_0001_D02.b : tcccccctcacatacttgccattaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0060_A12.b : ttgcgctagtgacttnacxxxxxxxxxxxxxxxxxxxxxx
PBL01_0006_B10.b : nagtgacagaxxxx
THY01_0046_H08.b : tggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0051_B01.b : nntttgctaggactaagacxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0059_D05.b : tttaaatggctaaagcagc
SPL01_0034_B11.b : nnnngggctgtgacttnacagtttgtacxxxxxxxxxxxx
OVRT1_0140_H12.b : nnaagcggggnnnnnnnnnnccgttcgcgtacgagtgxxxxxxxxxxx
LVRM1_0072_C01.b : tagttgtcxxxxxxxxxxxxx
SPL01_0105_D07.b : nttttttgttttnnnagcatggactatnacxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0109_C07.b : caatttgtcxxxxxxxxxxxxxx
LVRM1_0029_E08.b : agttgtcxxxxxxxxxxxxx
PBL01_0008_H03.b : nnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0075_H09.b : nttttggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxx
THY01_0007_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0091_E01.b : nnnntagctggacttgacagtttgtcxxxxxxxxxxxxx
LVRM1_0030_D02.b : cgttgtcxxxxxxxxxxxxx
MLN01_0083_G08.b : nggctaggactatnacxxxxxxxxxxxxxxxxxxxxxx
SPL01_0050_G06.b : nnnccgcgcgnnnnnggcatggcctatnacxxxxxxxxxxxxxxxxxxxxxx
SPL01_0017_B11.b : agttggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0033_B06.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxx
SPL01_0043_H08.b : nnggttgctaggactatnacxxxxxxxxxxxxxxxxxxxxxx
THY01_0041_B06.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0021_A09.b : ggggttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0048_C02.b : nnnnggctaggacttgacxxxxxxxxxxxxxxxxxxxxxx
THY01_0069_G07.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0034_A01.b : nnntttgctaggacttgacxxxxxxxxxxxxxxxxxxxxxx
PBL01_0033_B04.b : natcaacaxxxxx
SPL01_0022_C03.b : cattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0050_G10.b : nccgggannnattagataaagcagcxx
PBL01_0008_D07.b : ngggcgttttccngatagagcagc
SPL01_0013_G01.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0033_H12.b : nnttttgctaggacatgacxxxxxxxxxxxxxxxxxxxxxx
SPL01_0021_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0068_H04.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxx
PTG01_0051_D03.b : tcatnnggctaaagcagcg
SPL01_0053_H03.b : nnnnggcataggacttanacxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0025_F12.b : ttaagctgaacaxxx
MLN01_0042_F05.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0048_A07.b : nnnttggctaggactatnacagtttgtacxxxxxxxxxxxx
SPL01_0051_C03.b : ttttggctaggactatnacxxxxxxxxxxxxxxxxxxxxxx
SPL01_0091_F01.b : nntttgctaggacttanacxxxxxxxxxxxxxxxxxxxxxx
PBL01_0033_F03.b : caacaxxx
PBL01_0034_E05.b : nnggatgaac
SPL01_0063_B11.b : tttggctaggactatnacxxxxxxxxxxxxxxxxxxxxxx
SPL01_0052_G04.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxx
PBL01_0019_A07.b : nnnnggtgacagaxxxx
ITT01_0085_F11.b : nnnggatcaacaxxxx
OVRT1_0017_C06.b : nnccgttagcgncggxxxxxxxxxxxxxxx
PBL01_0025_A05.b : nnnggtgxxxxxxxx
PBL01_0065_C05.b : nnnggataaacaxxxx
PBL01_0050_B04.b : acaxxxx
SPL01_0057_H09.b : ntttggcttggactatnacxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0039_D02.b : ngatgaacaxxxx
SPL01_0084_C04.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxx
SPL01_0078_B05.b : nnnnggctaggacttagacxxxxxxxxxxxxxxxxxxxxxx
PTG01_0075_G07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
LVR01_0026_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0049_E01.b : naagtgaagcxxxxx
PBL01_0049_H05.b : nttgtgxxxxxxxxx
LVR01_0090_E09.b : cttttggggcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0101_C10.b : nnnttgctagtgacttgacxxxxxxxxxxxxxxxxxx
PBL01_0045_G12.b : tagatgaagcxxxx
SPL01_0070_G08.b : nngggctaggactatnacxxxxxxxxxxxxxxxxxxxxxx
MLN01_0006_D04.b : nnnnnggtaggacttgacagtttgtacxxxxxxxxxxxx
UTR01_0082_H12.b : ntttggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0020_B03.b : ngtgxxxxxxxx
CLNT1_0087_G07.b : nngggcttttnnnnnccccctcagcgnacgxxxxxxxxxxxxxxx
LVR01_0089_F08.b : ccattttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0046_D03.b : taccgnnaagctaaagcagc
PBL01_0027_D01.b : nnaagtgaaacaxxxx
MLN01_0074_D12.b : ctaggactatgacxxxxxxxxxxxxxxxxxxxxxx
PBL01_0011_H07.b : nntttgatxxxxxxxxx
SPL01_0050_G01.b : nnnnggctaggacttgacxxxxxxxxxxxxxxxxxxxxxx
SPL01_0079_H04.b : tttggcttgtgactttacxxxxxxxxxxxxxxxxxxxxxx
MLN01_0037_A11.b : ttttggctagtgacttgacagtttgtacxxxxxxxxxxxx
CLNT1_0142_B05.b : nnnnnccgtcagctgtcxxxxxxxxxxxxxxxxx
PBL01_0073_E05.b : ngtgacacaxxx
MLN01_0044_F07.b : nnnggctaggacttgacagtttgtcxxxxxxxxxxxxx
OVRT1_0107_A11.b : nnnnccgtctgctgtcgxxxxxxxxxxxxxxx
SPL01_0056_C05.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0083_D03.b : nnnnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxx
PBL01_0021_D01.b : nggataaacaxxxxx
LVR01_0085_D07.b : atttttcgtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0064_E01.b : nnngggttggcctatgacxxxxxxxxxxxxxxxxxxxxxx
SMG01_0019_G10.b : ngggtcctnnnnnagatacagcagc
SPL01_0038_B06.b : gggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0071_D05.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxx
MLN01_0015_D04.b : nntttaagctggacttgacagtttgtcxxxxxxxxxxxxx
SPL01_0068_D09.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxx
PBL01_0086_B03.b : nnnagatgaacaxxx
CLNT1_0074_F05.b : nnccggtccnnngggcnccgttagcgnacgxxxxxxxxxxxxxxx
SPL01_0064_H05.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxx
MLN01_0014_A03.b : nntttggctggacatgacagtttgtacxxxxxxxxxxxx
PBL01_0012_E12.b : aaggcgaaacaggxxx
PBL01_0048_B02.b : ggtxxxxxxxxxx
SPL01_0069_H06.b : nnnggcttggactatnacxxxxxxxxxxxxxxxxxxxxxx
PBL01_0006_D09.b : naaaaggtggagcaxxx
SPL01_0044_A11.b : ttttggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxx
MLN01_0047_F08.b : nnnggctaggactatgacagtttgtcxxxxxxxxxxxxx
CLNT1_0019_G06.b : aaacttctgctgtcngxxxxxxxxxxxxxxx
PBL01_0045_G07.b : nttatgxxxxxxxxx
PBL01_0046_G07.b : nggatxxxxxxxxxx
SPL01_0041_F12.b : cacgggactttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0056_H03.b : ngcgttttnggaacctacgttagcggacgxxxxxxxxxxxxxxx
LVR01_0102_B09.b : gattagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0113_A07.b : nnnnccgtctgcgtacgagtgxxxxxxxxxxx
CLNT1_0065_B12.b : nnccgtttnnggncttccgttagcggacgxxxxxxxxxxxxxx
MLN01_0042_A08.b : nnnnggctagtgacttgacagtttgtcxxxxxxxxxxxxx
OVR01_0028_D06.b : ggaacttattgggcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0098_D12.b : nnnggctttnngggactcccctcagcgnacgxxxxxxxxxxxxxxx
LNG01_0073_G07.b : nnnggcgcatggctaagacxxxxxxxxxxxxxxxxxxxxxx
MLN01_0088_C03.b : nnnngggctgtgacttgacagtttgtacxxxxxxxxxxxx
SPL01_0053_G12.b : nnttggctaggactaanacxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0074_F08.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxx
MLN01_0080_D04.b : nggctaggacttgacxxxxxxxxxxxxxxxxxxxxxx
SPL01_0036_H03.b : agggcctagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_A09.b : ggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0077_G02.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxx
SPL01_0079_H11.b : nnnnggctaggacttanacxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_D02.b : gggctaacgtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0019_B11.b : ctttatgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0089_B01.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxx
SPL01_0041_B11.b : ggggggctttaggtccnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0022_G09.b : ccttttatgtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_B12.b : ggggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0071_H08.b : nggattcgttcagcgtcggxxxxxxxxxxxxxxx
SPL01_0067_B05.b : nnnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0008_D10.b : ccggtttnngggactcgtcagcgnacgxxxxxxxxxxxxxxx
SPL01_0079_F06.b : nnnggctaggacttanacxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0040_H12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0013_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0084_B08.b : tttggctaggactatnacxxxxxxxxxxxxxxxxxxxxxx
LNG01_0068_H09.b : nnttagctggacttgacagtttgtcxxxxxxxxxxxxx
CLNT1_0122_H07.b : ncctctatagcgnacgxxxxxxxxxxxxxxx
UTR01_0036_A04.b : ttttggatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0029_E11.b : cccccctccccccccggcattggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0017_H12.b : naaagtgaaacaxxxx
MLN01_0084_B12.b : nnnttgctagtgacttnacxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_F06.b : ccttttgggttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0022_F05.b : nnnggagxxxxxxxx
PBL01_0033_B03.b : aacaxxx
BFLT1_0048_G10.b : ggacttcgttagcgnacgagtgxxxxxxxxxxx
THY01_0034_A12.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0058_C05.b : nnnaagctaggacttagacxxxxxxxxxxxxxxxxxxxxxx
SPL01_0039_F11.b : gaggactttacgtgcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0042_E06.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0053_D03.b : ggcatttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0100_A05.b : ggcatataggtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0086_F09.b : ngggccccgttagctgtcgxxxxxxxxxxxxxxx
CLNT1_0035_E07.b : nattcgttctgcgtcggxxxxxxxxxxxxxxx
UTR01_0075_B03.b : cttagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0034_A12.b : gggggactatgctgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0085_H11.b : nnttggctaggacttanacxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0077_H06.b : nnncctcgttctgctgcagxxxxxxxxxxxxxx
SPL01_0003_F01.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0033_D06.b : ccattgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0018_B12.b : cccttcagctgtcggxxxxxxxxxxxxxxx
LNG01_0019_C01.b : cctcctccccccccgcgacttggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0085_H04.b : ttttggctaggactatnacxxxxxxxxxxxxxxxxxxxxxx
THY01_0082_D09.b : gcctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0047_C10.b : gggcttaacgtgcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_D11.b : ggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0089_G02.b : nnnnnggctggctatgacagtttgtcxxxxxxxxxxxxx
SPL01_0005_F02.b : tgttccctcggcctcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0059_A08.b : nnnggatxxxxxxxxx
UTR01_0066_C09.b : ttttttaaagcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_D08.b : ctttttggttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0042_C06.b : cctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_G10.b : ggggtggggcataxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_D11.b : ggttgaagcattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_H05.b : gggggggttttttacgcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0037_G04.b : ggggattaggggccnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0078_A07.b : nnnggcttggacttagacxxxxxxxxxxxxxxxxxxxxxx
MLN01_0085_E03.b : nnnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0003_C07.b : nccttcagcgtcggxxxxxxxxxxxxxxx
CLNT1_0039_H12.b : ttattcgtctctgcgtcngxxxxxxxxxxxxxxx
LNG01_0011_G04.b : gcttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0028_G03.b : nnaagtgaaacaxxxx
PBL01_0086_E11.b : nnnggtgatacaxxxx
PBL01_0011_F10.b : nnnnggctaaacaxxxx
LVR01_0048_B11.b : gggttttttttttgggcatagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0056_B09.b : atcccttctagcgtcngxxxxxxxxxxxxxxxx
ITT01_0042_A04.b : nnnggatgaacxxxxx
ITT01_0012_F03.b : ngggatgaacaxxxx
SPL01_0103_C09.b : nnnttgctaggacttanacxxxxxxxxxxxxxxxxxxxxxx
PBL01_0075_B03.b : nnnggtgacagaxxx
PBL01_0059_B05.b : naatgacacaxxx
THY01_0090_G07.b : ccttttggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0079_A01.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxx
LNG01_0006_E08.b : ggggttttaggcatagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0082_G10.b : ngggctaggactatgacagtttgtacxxxxxxxxxxxx
CLNT1_0119_A07.b : nnnnnccgttagctgacgxxxxxxxxxxxxxxx
PBL01_0074_F07.b : nnnaagtgaaagaxxx
SPL01_0064_B06.b : nnggtgctaggacttagacxxxxxxxxxxxxxxxxxxxxxx
THY01_0202_F03.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0042_H06.b : ggggcctcccagcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0093_G03.b : nnntttcgttagcgtacgagtgxxxxxxxxxxx
PBL01_0087_D03.b : nnnggtgxxxxxxxx
PBL01_0073_D12.b : aaaagatgaacaxxxx
OVRT1_0006_D11.b : ntttccgtctcagcgtacgxxxxxxxxxxxxxxx
PBL01_0065_G06.b : nnnggtgaagcxxxx
PBL01_0071_F06.b : nnnggtgxxxxxxxx
PBL01_0080_A02.b : naaagagxxxxxxxx
PBL01_0091_B10.b : nnnnggatgaacaxxxx
ITT01_0039_D07.b : nnnaatgaagcxxxxx
ITT01_0041_A05.b : nnnggagxxxxxxxxx
PBL01_0105_B07.b : nnnnggctgaacaxxx
MLN01_0074_B01.b : nnnngggtaggacttgacagtttgtacxxxxxxxxxxxx
LNG01_0108_C07.b : tttaacatggacttgacxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0049_C02.b : nggccggttnnnnnnnnccgttcagcggacgxxxxxxxxxxxxxxx
MLN01_0084_B01.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxx
SPL01_0082_H08.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxx
SPL01_0065_F11.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxx
SPL01_0008_A10.b : ccttttggatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0063_F04.b : gggctcncgggcattxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0068_E07.b : nnnggctaggcacttgacxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0015_D01.b : nggcgttntnnngactccgtcgcgnacgxxxxxxxxxxxxxxx
CLNT1_0034_D04.b : ggggccgtttgcgtcggxxxxxxxxxxxxxxx
CLNT1_0032_C10.b : gattccgtctgcgnacgxxxxxxxxxxxxxxx
PBL01_0075_D04.b : nnnaatgxxxxxxxx
ITT01_0044_B02.b : nnnggtgaaacaxxx
MLN01_0101_F02.b : nngggccttggactatgacxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0061_E07.b : nnnnggctaaacaxxxx
ITT01_0073_H08.b : nnttgctaaacaxxxx
ITT01_0079_D05.b : nnnggatgaacaxxxx
MLN01_0092_E04.b : nnnngggctggacttgacxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0025_F03.b : nnntttctatagccgtcggxxxxxxxxxxxxxxx
PBL01_0065_A01.b : nntttaggatcxxxxxxxxx
LNG01_0015_H07.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0082_H03.b : nnnggatatacaxxxx
PBL01_0053_G02.b : nngggtgxxxxxxxx
PBL01_0067_G04.b : nnnggagxxxxxxxx
LNG01_0096_D02.b : nnnnnggctggacatgacagttgnacxxxxxxxxxxxxx
PTG01_0034_G11.b : nccgactnnnattgcgtaagcagcg
PBL01_0074_G01.b : nnaagtgatagaxxx
PBL01_0066_E06.b : aaaagggatxxxxxxxx
PBL01_0068_C12.b : naaagatgaaacxxxxx
PBL01_0055_C04.b : nnggtgxxxxxxxxx
THY01_0039_B02.b : ttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0073_C10.b : nnnnggatgaacaxxx
ITT01_0044_H07.b : nnnnggagcaacaxxxx
UTR01_0095_E06.b : nnnnggcttggacttanacxxxxxxxxxxxxxxxxxxxxxx
ITT01_0093_H01.b : nagatgaacaxxxx
PBL01_0101_E10.b : nnnaagctgaacaxxxx
ITT01_0082_C02.b : nnnggatgaacaxxx
PBL01_0085_A09.b : nnnggtgxxxxxxxx
PBL01_0085_F01.b : nnggttgaacaxxxx
MLN01_0100_E08.b : tcggggtaggacttgacxxxxxxxxxxxxxxxxxxxxxx
PBL01_0074_H11.b : nnnaagtgxxxxxxxx
PBL01_0105_G06.b : nnnnggataaacaxxx
TCH01_0032_B06.b : ncccgggctggactatnacxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0102_A07.b : nnnnggctaaacaxxxxx
PBL01_0078_E04.b : nnnagtgxxxxxxxx
PBL01_0100_D05.b : nnnggtgatacaxxx
ITT01_0051_B12.b : nnnggtgxxxxxxxxxx
PBL01_0055_B11.b : nnaagtgxxxxxxxxx
ITT01_0082_A11.b : nnnggatgaacaxxxx
CLNT1_0141_G03.b : nnnnnccgtcagcgnacgxxxxxxxxxxxxxxx
PBL01_0032_H10.b : agatgaacax
CLNT1_0151_A03.b : nnnnccgtcagctgtcgxxxxxxxxxxxxxxx
CLNT1_0025_E10.b : gttccgttagctgacgxxxxxxxxxxxx
CLNT1_0125_D06.b : cgctatcttcnnnnnnnnnnnnnggggtttnnggnnncccatcgcgtatgagxxxxxxxx
PST01_0098_H03.b :
THY01_0110_B12.b : gttgacaaag
TES01_0096_D02.b :
SPL01_0023_D02.b : attttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0087_D11.b : nnnaaggttttnnggggnccttcagcggacgxxxxxxxxxxxxxxxxxx
UTR01_0020_C07.b : gggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0001_F05.b :
PST01_0039_F04.b :
PBL01_0060_D10.b : nnnggatxxxxxx
PST01_0052_H05.b :
KDN01_0100_A11.b :
KDN01_0066_F11.b :
THY01_0115_G01.b : gtgtcaaag
CLNT1_0129_C10.b : ntccctatagctnacgxxxxxxxxxxxxxx
TES01_0039_A05.b :
KDN01_0047_E02.b :
CLNT1_0147_C02.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxx
PST01_0010_G04.b :
PST01_0008_C09.b :
KDN01_0053_H03.b :
TES01_0083_D06.b :
PST01_0042_C11.b :
TES01_0014_D09.b :
PST01_0032_C06.b :
PST01_0014_B02.b :
PST01_0030_B04.b :
PST01_0009_B02.b :
PST01_0038_B10.b :
KDN01_0008_B05.b :
PST01_0070_D07.b :
PST01_0064_D10.b :
PST01_0087_D10.b :
PST01_0046_E12.b :
PST01_0038_C10.b :
PST01_0033_D11.b :
KDN01_0022_A05.b :
TES01_0037_H07.b :
TES01_0084_B01.b :
PST01_0061_D01.b :
PST01_0020_B03.b :
PST01_0029_C10.b :
PST01_0067_H01.b :
TES01_0020_D05.b :
PST01_0035_B11.b :
TES01_0042_B08.b :
PST01_0085_D07.b :
SPL01_0073_A02.b : ttttggctagtgacttnacxxxxxxxxxxxxxxxxxx
SPL01_0031_B01.b : nntttgcatggactatnacagtttgtacxxxxxxxxx
SPL01_0026_G08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0115_E07.b : nnnnccgtcagcgnacgxxxxxxxxxxxx
PBL01_0044_E04.b : gtgaaaca
SPL01_0051_C07.b : tttttagctaggactatnacxxxxxxxxxxxxxxxxx
MLN01_0059_G09.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxx
LNG01_0080_E06.b : nnnnnggctggacttgacagtttgtcxxxxxxxxxx
LVR01_0059_A12.b : gttgttaaagctttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0059_F02.b : nnnngggtaggactatnacxxxxxxxxxxxxxxxxxx
SPL01_0041_A02.b : ggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0052_D09.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxx
LVR01_0053_H06.b : gcctttggaggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0082_E03.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxx
PBL01_0049_B02.b : nnnaatgxxxxx
ITT01_0093_H03.b : nnggtgataca
PBL01_0054_F07.b : nnnggataa
MLN01_0071_B09.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxx
PBL01_0089_B12.b : nnnaagctgaacax
SPL01_0044_C04.b : ttttagctagtgacttnacxxxxxxxxxxxxxxxxx
ITT01_0022_F06.b : nnnnggtgxxxxxxx
TCH01_0081_E08.b : nggcttggactatgacxxxxxxxxxxxxxxxx
OVRT1_0004_H12.b : tttttcctctagctgtacgagtgxxxxxxxx
TES01_0026_A01.b :
SPLT1_0069_C05.b : nnnaacgcgagtac
SPL01_0105_E03.b : nnnnnggctagtgacttnacxxxxxxxxxxxx
PST01_0022_C09.b :
PST01_0048_H08.b :
SPL01_0053_A11.b : nttgcttggcttnggcatggtacttnacxxxxxxxxx
PBL01_0041_C08.b : nna
PBL01_0027_D07.b :
SPL01_0044_G03.b : ttttcgct
LVRM1_0153_C11.b :
SPL01_0046_C02.b : nnnnnggct
PBL01_0044_C04.b :
LNG01_0011_G03.b : cattxxxxxxxxxx
MLN01_0048_C10.b : nntttg
PBL01_0028_G01.b :
LVR01_0071_F10.b : cgtgggggtntggagcctagtgx
PBL01_0097_E03.b :
SPL01_0024_C12.b : gctttaxxxx
SPL01_0024_A03.b : txxxxxxxxx
SPL01_0001_E01.b : cattttgg
LNG01_0102_A04.b : ttttt
OVRM1_0064_B05.b :
SPL01_0051_E08.b : nnnngg
SPL01_0041_D10.b : gggggcattattgt
SMG01_0032_B04.b :
SPL01_0089_D05.b : nnggcta
PBL01_0053_B06.b :
SPL01_0083_B09.b : ttttggcta
LNG01_0028_D02.b : gcattttgcgtgx
TCH01_0080_C12.b : tttgg
LNG01_0016_E12.b : cxxx
CLNT1_0052_G10.b : nngggggctnnnn
SPL01_0077_E04.b : nnnggc
PBL01_0082_H04.b :
PBL01_0072_H08.b :
PST01_0039_A01.b :
PBL01_0005_D01.b :
MLN01_0061_C02.b : nn
PBL01_0045_B04.b :
SPL01_0063_H09.b :
ITT01_0005_C12.b :
PCT01_0003_D02.b :
THY01_0110_D01.b :
TCH01_0052_D03.b :
SPL01_0010_B06.b :
MLN01_0051_E05.b :
SPL01_0028_D12.b :
SPL01_0045_E01.b :
SMG01_0015_D04.b :
SPL01_0093_F04.b :
TCH01_0096_C06.b :
SPL01_0034_E02.b :
SPL01_0051_B09.b :
PBL01_0106_C01.b :
TCH01_0019_D08.b :
ITT01_0099_C05.b :
CLNT1_0019_B11.b :
LVR01_0076_G10.b :
SPL01_0075_G04.b :
LNG01_0098_G11.b :
SPL01_0030_E07.b :
PBL01_0048_C10.b :
SPL01_0042_F02.b :
SPL01_0097_D07.b :
THY01_0046_C05.b :
PBL01_0085_D11.b :
20110601C-001409 : .........AAAAAGAACTAGAGACTTCCTCAGTGCCGGAGCACAAAACAGCATCCCCAC
---------+---------+---------+---------+---------+---------+ 51
SPL01_0099_H10.b : xxxxxxxxxAAAAAGAACTAGAGACTTCCTCAGTGCCCCAGCACAAAACAGCATCCCCAC
SPL01_0083_G01.b : xxxxxxxxxxxxxxGAACTAGAGACTTCCTCAGTGCCCCAGCACAAAACAGCATCCCCAC
PBL01_0070_E05.b : xxxxxxxxxxxxxxGAACTAGAGACTTCCTCAGTGCCCCAGCACAAAACAGCATCCCCAC
PBL01_0072_C10.b : xxxxxxxxxxxxxxGAACTAGAGACTTCCTCAGTGCCCCAGCACAAAACAGCATCCCCAC
SPL01_0071_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCTACTGGAGCACAAAACAGCATCCCCAC
PBL01_0005_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGCCCCAGCACAAAACAGCATCCCCAC
SPL01_0069_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggTGGAGCACAAAACAGCATCCCCAC
SPL01_0087_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGAGCACAAAACAGCATCCCCAC
SPL01_0100_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGAGCACAAAACAGCATCCCCAC
THY01_0046_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAGCACAAAACAGCATCCCCAC
PBL01_0049_F07.b : gGGAGCACAAAACAGCACCTCCAC
MLN01_0042_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcctgGGAGCACAAAACAGCATCCCCAC
ITT01_0033_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAGCACAAAACAGCATCTCCAC
SPL01_0060_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCACAAAACAGCATCCCCAC
MLN01_0006_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctGAGCACAAAACAGCATCCCCAC
PBL01_0032_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCACAAAACAGCATCCCCAC
SPLT1_0061_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCACAAAACAGCATCCCCAC
UTR01_0101_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCACAAAACAGCATCCCCAC
CLNT1_0140_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCACAAAACAGCATCCCCAC
ITT01_0014_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGAGCACAAAACAGCCTCTCCAC
SPLT1_0087_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCACAAAACAGCATCCCCAC
PBL01_0012_A06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnatGAGCACAAAACAGCATCCCCAC
LNG01_0106_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaGAGCACAAAACAGCATCCCCAC
HTMT1_0041_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCACAAAACAGCATCCCCAC
MLN01_0072_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtcgagtcGAGCACAAAACAGCATCCCCAC
PBL01_0066_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCACAAAACAGCATCCCCAC
SPL01_0088_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxtgttaatagtcctAGCACAAAACAGCATCCCCAC
LNG01_0109_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCACAAAACAGCATCCCCAC
CLNT1_0137_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttAGCACAAAACAGCATCCCCAC
LNG01_0035_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaAGCACAAAACAGCATCCCCAC
LNG01_0021_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaAGCACAAAACAGCATCCCCAC
LNG01_0004_C06.b : xxxxxxxxxxxxcgcatcgagtcggccttgttgacctagAGCACAAAACAGCATCCCCAC
PBL01_0050_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCACAAAACAGCATCCCCAC
LNG01_0070_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCACAAAACAGCATCCCCAC
CLNT1_0143_F05.b : xxxxxxxxxxxxxxxxxxxxggctttgttggcctactggAGCACAAAACAGCATCCCCAC
CLNT1_0028_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtAGCACAAAACAGCATCCCCAC
SPL01_0063_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCACAAAACAGCATCCCCAC
BFLT1_0036_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtAGCACAAAACAGCATCCCCAC
LNG01_0036_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCACAAAACAGCATCCCCAC
SPL01_0001_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCACAAAACAGCATCCCCAC
ITT01_0094_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCACAAAACAGCATCCCCAC
CLNT1_0024_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctttggtAGCACAAAACAGCATCCCCAC
TCH01_0026_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCACAAAACAGCATCCCCAC
MLN01_0032_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCACAAAACAGCATCCCCAC
PBL01_0090_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCACAAAACAGCATCCCCAC
LVRM1_0095_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
OVRM1_0018_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
OVR01_0063_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0052_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVR01_0061_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0097_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVRM1_0023_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCAGCCCCGC
SPL01_0054_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
THY01_0001_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0060_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0006_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
THY01_0046_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0051_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SMG01_0059_D05.b : ggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0034_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
OVRT1_0140_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVRM1_0072_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0105_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVRM1_0109_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVRM1_0029_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGCACAAAACAGCATCCCCAC
PBL01_0008_H03.b : nnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0075_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
THY01_0007_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LNG01_0091_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVRM1_0030_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0083_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0050_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0017_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0033_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0043_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
THY01_0041_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0021_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0048_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
THY01_0069_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0034_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0033_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0022_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PTG01_0050_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0008_D07.b : tggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0013_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0033_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0021_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0068_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PTG01_0051_D03.b : gtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0053_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0025_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0042_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0048_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0051_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0091_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0033_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0034_E05.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0063_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0052_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0019_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
ITT01_0085_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
OVRT1_0017_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0025_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0065_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAA*ACAGCATCCCCAC
PBL01_0050_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCTCCAC
SPL01_0057_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0039_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0084_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0078_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PTG01_0075_G07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxGCACAAAACAGCATCCCCAC
LVR01_0026_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0049_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0049_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVR01_0090_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0101_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0045_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0070_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0006_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
UTR01_0082_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0020_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
CLNT1_0087_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVR01_0089_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SMG01_0046_D03.b : ggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0027_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0074_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0011_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0050_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0079_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0037_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
CLNT1_0142_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0073_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCCTCCCCAC
MLN01_0044_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
OVRT1_0107_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0056_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0083_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0021_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVR01_0085_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0064_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SMG01_0019_G10.b : ggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0038_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0071_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0015_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0068_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0086_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
CLNT1_0074_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0064_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0014_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0012_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0048_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0069_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0006_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0044_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0047_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
CLNT1_0019_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0045_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0046_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0041_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
CLNT1_0056_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVR01_0102_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
OVRT1_0113_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
CLNT1_0065_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0042_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
OVR01_0028_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
CLNT1_0098_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LNG01_0073_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0088_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0053_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0074_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0080_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0036_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVR01_0067_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0077_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0079_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVR01_0008_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVR01_0019_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0089_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0041_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVR01_0022_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVR01_0078_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
CLNT1_0071_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0067_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
CLNT1_0008_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0079_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
OVRT1_0040_H12.b : nnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LNG01_0013_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0084_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LNG01_0068_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
CLNT1_0122_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcggtGCACAAAACAGCATCCCCAC
UTR01_0036_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LNG01_0029_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
ITT01_0017_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0084_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVR01_0072_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
ITT01_0022_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0033_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
BFLT1_0048_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
THY01_0034_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0058_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0039_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LNG01_0042_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVR01_0053_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVR01_0100_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
CLNT1_0086_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
CLNT1_0035_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
UTR01_0075_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LNG01_0034_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0085_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
OVRT1_0077_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0003_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LNG01_0033_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
CLNT1_0018_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LNG01_0019_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0085_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
THY01_0082_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
OVR01_0047_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVR01_0083_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LNG01_0089_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0005_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0059_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
UTR01_0066_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVR01_0106_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LNG01_0042_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVR01_0012_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVR01_0011_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVR01_0050_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0037_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0078_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0085_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
CLNT1_0003_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
CLNT1_0039_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LNG01_0011_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0028_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0086_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0011_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVR01_0048_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
CLNT1_0056_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
ITT01_0042_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
ITT01_0012_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0103_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0075_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0059_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCCTCCCCAC
THY01_0090_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0079_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LNG01_0006_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0082_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
CLNT1_0119_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0074_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0064_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAGAACAGCATCCCCAC
THY01_0202_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LNG01_0042_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
OVRT1_0093_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0087_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0073_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
OVRT1_0006_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0065_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0071_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0080_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0091_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
ITT01_0039_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
ITT01_0041_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0105_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0074_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LNG01_0108_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
CLNT1_0049_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0084_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0082_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0065_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0008_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LVR01_0063_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
SPL01_0068_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
CLNT1_0015_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
CLNT1_0034_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
CLNT1_0032_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0075_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
ITT01_0044_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0101_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
ITT01_0061_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
ITT01_0073_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
ITT01_0079_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0092_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
OVRT1_0025_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0065_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LNG01_0015_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
ITT01_0082_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0053_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0067_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
LNG01_0096_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PTG01_0034_G11.b : gtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0074_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0066_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0068_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0055_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
THY01_0039_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0073_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
ITT01_0044_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
UTR01_0095_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
ITT01_0093_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0101_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
ITT01_0082_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0085_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0085_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
MLN01_0100_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0074_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0105_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
TCH01_0032_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0102_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0078_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0100_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
ITT01_0051_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
PBL01_0055_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
ITT01_0082_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAAAACAGCATCCCCAC
CLNT1_0141_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCACAAAACAGCATCCC*AC
PBL01_0032_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaGCAAAAACAGCATCCCCAC
CLNT1_0151_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCACAAAACAGCATCCCCAC
CLNT1_0025_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACTTAACAGCATCCCCAC
CLNT1_0125_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtagACAAAACAGCATCCCCAC
PST01_0098_H03.b : tttactgctgtggctatggACAAAACAGCATCCCCCT
THY01_0110_B12.b : cggcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCACAAAAGCATCCCCAC
TES01_0096_D02.b : ttttttggctgtggctatggacACAAACAGCATCCCCAC
SPL01_0023_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCAAAACAGCATCCCCAC
CLNT1_0087_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcagcgCAAAACAGCGTCCCCAC
UTR01_0020_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgggAAAAACAGCATCCCCAC
TES01_0001_F05.b : ttttcctgctgttgctatggACAAAAAGCATCCCCAC
PST01_0039_F04.b : ngtggcgttggctctggagCAAAACAGCATCCCCAC
PBL01_0060_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCAAAACAGCATCCCCAC
PST01_0052_H05.b : ggggtagctgtggctctggacACAAACAGCATCCCCAC
KDN01_0100_A11.b : nnnnncctgctgtggctctggACAAAAAGCATCCCCAC
KDN01_0066_F11.b : ntttttgctgcgttggctatggaCCAAACAGCATCCCCAC
THY01_0115_G01.b : cggcggtacggtcggaatcctcgagcacgtggcctactggagcaAAAACAGCATCCCCAC
CLNT1_0129_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgtatcaAAAACAGCATCCCCAC
TES01_0039_A05.b : tgtggctctggagCAAACAGCATCCCC*C
KDN01_0047_E02.b : cgaacagttgccactggagCCAAAAGCATCCCCAC
CLNT1_0147_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcggatcaAAAACAGCATCCCCAC
PST01_0010_G04.b : tttttcctgcgttggctatggaCCAAAAGCATCCCCAC
PST01_0008_C09.b : nnccggatnnnnnnncctgcgttggctctggaCCAAAAGCATCCCCAC
KDN01_0053_H03.b : nttgcgtggctatggaCCAAAAGCATCCCC*C
TES01_0083_D06.b : tttttcctgcgtttgctatggaCCAAAAGCATCCCCAC
PST01_0042_C11.b : tttttcctgcagttggctatgggcCAAACAGCATCCCCCT
TES01_0014_D09.b : nnnaactgctgtggctctggaCCAAAAGCATCCCCAC
PST01_0032_C06.b : nttcgacgtggctatggaCCAAAAGCATCCCCAC
PST01_0014_B02.b : nccgtgtattnntgctgcgttggctctggaCCAAAAGCATCCCCAC
PST01_0030_B04.b : tttttactgcggtggctctggaCCAAAAGCATCCCCAC
PST01_0009_B02.b : taattccctgcgttggctatggacCAAACAGCATCCCCAC
PST01_0038_B10.b : ctagctgtggctctggaCCAAAAGCATCCCC*C
KDN01_0008_B05.b : nncccttnnnnnnncctgcgttggctctggaCCAAAAGCATCCCCCN
PST01_0070_D07.b : ttttncctgcgttggctctgggCCAAAAGCATCCCCAC
PST01_0064_D10.b : ncctgcggtggctctggaCCAAAAGCATCCCCAC
PST01_0087_D10.b : nnncctgcgtggctatggaCCAAAAGCATCCCC*C
PST01_0046_E12.b : ttttactgcggtggctctggaCCAAACGCATCCCCAC
PST01_0038_C10.b : tagctgtggctctggaCCAAAAGCATCCCCAC
PST01_0033_D11.b : nttactgctgtggctctggagcCAAACAGCATCCCCAC
KDN01_0022_A05.b : nnttttcctgcggtggcctcggagCCAAAAGCATCCCC*C
TES01_0037_H07.b : tgtggctctggagcacAAACAGCATCCCCAC
TES01_0084_B01.b : tttttactgcgttggctctggacaCAAAAGCATCCCCAC
PST01_0061_D01.b : tttctgcggtggctctggagaCAAAAGCATCCCCAC
PST01_0020_B03.b : nttcctcgcgttggcctcggaCAAACGCATCCCCAC
PST01_0029_C10.b : ttttcctgcggtggctctggaaCAAAAGCATCCCCAC
PST01_0067_H01.b : nttttcctgcgttggctctggacCAAACGCATCCCCAC
TES01_0020_D05.b : gctctggagccAACAGCATCCCCAC
PST01_0035_B11.b : tagcgttggctctggagacAACAGCATCCCCAC
TES01_0042_B08.b : aacgtggctatggacAAAGCATCCCCAC
PST01_0085_D07.b : ntttctgtggctatggacacAAAGCATCCCCCN
SPL01_0073_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
SPL01_0031_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
SPL01_0026_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
OVRT1_0115_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
PBL01_0044_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
SPL01_0051_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
MLN01_0059_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
LNG01_0080_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
LVR01_0059_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
MLN01_0059_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
SPL01_0041_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
SPL01_0052_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
LVR01_0053_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
MLN01_0082_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
PBL01_0049_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
ITT01_0093_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
PBL01_0054_F07.b : agaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
MLN01_0071_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
PBL01_0089_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
SPL01_0044_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
ITT01_0022_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
TCH01_0081_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
OVRT1_0004_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCATCCCCAC
TES01_0026_A01.b : gcgttggctatggacactacAGCATCCCC*C
SPLT1_0069_C05.b : gaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgAGCATCCCCAC
SPL01_0105_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATCCCCAC
PST01_0022_C09.b : natcgctgtggctctggacacacGCATCCCC*C
PST01_0048_H08.b : accagcggtcgcgaaggacccaaacaCATCCCCTC
SPL01_0053_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCCCCAC
PBL01_0041_C08.b : agtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCCCCAC
PBL01_0027_D07.b : nnnggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0044_G03.b : agtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0153_C11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0046_C02.b : agtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0044_C04.b : nggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxc
LNG01_0011_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0048_C10.b : ctagtcctatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0028_G01.b : nnaagagcgacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0097_E03.b : nnnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0024_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0024_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0001_E01.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0102_A04.b : ggatggctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0064_B05.b : naattgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0051_E08.b : ctaggacttanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0041_D10.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0032_B04.b : nnggggctttttnnnnnggtaaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0089_D05.b : ggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0053_B06.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0083_B09.b : ggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0028_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0080_C12.b : cttggactataacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0016_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0052_G10.b : gtatccgttcagcgnacggaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0077_E04.b : taggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0082_H04.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0072_H08.b : nnnggtgaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0039_A01.b : gcgttg
PBL01_0005_D01.b : aaaaaaaagatacagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0061_C02.b : nnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0045_B04.b : nngatcaagcxxxxxxxxxxxxxxxxxxxxx
SPL01_0063_H09.b : ngtttgcttggactatnacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0005_C12.b : naatgatgaacaxxxxxxxxxxx
PCT01_0003_D02.b : nnnnggggatttta
THY01_0110_D01.b : gttgtcaaacagcggtccggtcggatcctcgag
TCH01_0052_D03.b : nnnnggcttggacttagacagtttgtacxxxxxxxxxxxx
SPL01_0010_B06.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0051_E05.b : nnnnggctaggacttgacxxxxxxxxxxxxxxxxxx
SPL01_0028_D12.b :
SPL01_0045_E01.b :
SMG01_0015_D04.b :
SPL01_0093_F04.b :
TCH01_0096_C06.b :
SPL01_0034_E02.b :
SPL01_0051_B09.b :
PBL01_0106_C01.b :
TCH01_0019_D08.b :
ITT01_0099_C05.b :
CLNT1_0019_B11.b :
LVR01_0076_G10.b :
SPL01_0075_G04.b :
LNG01_0098_G11.b :
SPL01_0030_E07.b :
PBL01_0048_C10.b :
SPL01_0042_F02.b :
SPL01_0097_D07.b :
THY01_0046_C05.b :
PBL01_0085_D11.b :
20110601C-001409 : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
---------+---------+---------+---------+---------+---------+ 109
SPL01_0099_H10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0083_G01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0070_E05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0072_C10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0071_A09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0005_E09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0069_F08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0087_B12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0100_G08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
THY01_0046_G05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0049_F07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0042_D05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
ITT01_0033_C02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0060_G12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0006_D12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0032_D10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPLT1_0061_G05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
UTR01_0101_D10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0140_H03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
ITT01_0014_B05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPLT1_0087_D08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0012_A06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0106_C04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
HTMT1_0041_F08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0072_H03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0066_E01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0088_E12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0109_F05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0137_A10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0035_G08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0021_G02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0004_C06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0050_G10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0070_C10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0143_F05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0028_H09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0063_C04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
BFLT1_0036_D03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0036_B04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0001_F02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCTAACCAACCAGGAG
ITT01_0094_D06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0024_C09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
TCH01_0026_D07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0032_C05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0090_A08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVRM1_0095_E01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
OVRM1_0018_A05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
OVR01_0063_A04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0052_F09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0061_C12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0097_C05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVRM1_0023_A06.b : *TCGCGCT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0054_H11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
THY01_0001_D02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0060_A12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0006_B10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
THY01_0046_H08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0051_B01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGGG
SMG01_0059_D05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCCCAGATCCAACCAACCAGGAG
SPL01_0034_B11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
OVRT1_0140_H12.b : *TCACACT*TGTGAAGAGCATGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVRM1_0072_C01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0105_D07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVRM1_0109_C07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVRM1_0029_E08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0008_H03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0075_H09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
THY01_0007_B11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0091_E01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVRM1_0030_D02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0083_G08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0050_G06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0017_B11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0033_B06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0043_H08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
THY01_0041_B06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0021_A09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0048_C02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
THY01_0069_G07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0034_A01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCCCAGATCCTACCAACCAGGAG
PBL01_0033_B04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0022_C03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PTG01_0050_G10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0008_D07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0013_G01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0033_H12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0021_E09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0068_H04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PTG01_0051_D03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0053_H03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0025_F12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0042_F05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0048_A07.b : *TCACACTATGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0051_C03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0091_F01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0033_F03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0034_E05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0063_B11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0052_G04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0019_A07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
ITT01_0085_F11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
OVRT1_0017_C06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0025_A05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0065_C05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0050_B04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0057_H09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0039_D02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0084_C04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0078_B05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PTG01_0075_G07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0026_C12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0049_E01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0049_H05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0090_E09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0101_C10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAGCCAGGAG
PBL01_0045_G12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0070_G08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0006_D04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
UTR01_0082_H12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0020_B03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0087_G07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0089_F08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SMG01_0046_D03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0027_D01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0074_D12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0011_H07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0050_G01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0079_H04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0037_A11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0142_B05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0073_E05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0044_F07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
OVRT1_0107_A11.b : *TCACACT*TGTGAAGAGAAAGCAGAGCTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0056_C05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0083_D03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0021_D01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0085_D07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0064_E01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SMG01_0019_G10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0038_B06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0071_D05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0015_D04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0068_D09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0086_B03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0074_F05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0064_H05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0014_A03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0012_E12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0048_B02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0069_H06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0006_D09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0044_A11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0047_F08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0019_G06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0045_G07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0046_G07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0041_F12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0056_H03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0102_B09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
OVRT1_0113_A07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0065_B12.b : *TCACACT*TGTGGAGAGAAAGCAGAACTCAGATCCTTCTCATATCCAACCAACCAGGAG
MLN01_0042_A08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
OVR01_0028_D06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0098_D12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0073_G07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0088_C03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0053_G12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0074_F08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0080_D04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0036_H03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0067_A09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0077_G02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0079_H11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0008_D02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0019_B11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0089_B01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0041_B11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0022_G09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0078_B12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0071_H08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0067_B05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0008_D10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0079_F06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
OVRT1_0040_H12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0013_D05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0084_B08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0068_H09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0122_H07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
UTR01_0036_A04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0029_E11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
ITT01_0017_H12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0084_B12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0072_F06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
ITT01_0022_F05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0033_B03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
BFLT1_0048_G10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
THY01_0034_A12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0058_C05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0039_F11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0042_E06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0053_D03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0100_A05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0086_F09.b : *TCACACT*TGTGAAGAGAAAGCAGAATTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0035_E07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
UTR01_0075_B03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0034_A12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0085_H11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
OVRT1_0077_H06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0003_F01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0033_D06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0018_B12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0019_C01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0085_H04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
THY01_0082_D09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
OVR01_0047_C10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0083_D11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0089_G02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0005_F02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0059_A08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
UTR01_0066_C09.b : *TCACACT*TGTGAGGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0106_D08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0042_C06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0012_G10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0011_D11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0050_H05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0037_G04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0078_A07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0085_E03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0003_C07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0039_H12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0011_G04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0028_G03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0086_E11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0011_F10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0048_B11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0056_B09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
ITT01_0042_A04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
ITT01_0012_F03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0103_C09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0075_B03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0059_B05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
THY01_0090_G07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0079_A01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0006_E08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0082_G10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0119_A07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0074_F07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0064_B06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
THY01_0202_F03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0042_H06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
OVRT1_0093_G03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0087_D03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0073_D12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
OVRT1_0006_D11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0065_G06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0071_F06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0080_A02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0091_B10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
ITT01_0039_D07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
ITT01_0041_A05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0105_B07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0074_B01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0108_C07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0049_C02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0084_B01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0082_H08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0065_F11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0008_A10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0063_F04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTT*TCAGATCCAACCAACCAGGAG
SPL01_0068_E07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0015_D01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0034_D04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0032_C10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0075_D04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
ITT01_0044_B02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0101_F02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
ITT01_0061_E07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
ITT01_0073_H08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
ITT01_0079_D05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0092_E04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
OVRT1_0025_F03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0065_A01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0015_H07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
ITT01_0082_H03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0053_G02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0067_G04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0096_D02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PTG01_0034_G11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0074_G01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0066_E06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0068_C12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0055_C04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
THY01_0039_B02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0073_C10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
ITT01_0044_H07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
UTR01_0095_E06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
ITT01_0093_H01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0101_E10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
ITT01_0082_C02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0085_A09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0085_F01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0100_E08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0074_H11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0105_G06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
TCH01_0032_B06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0102_A07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0078_E04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0100_D05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
ITT01_0051_B12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0055_B11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
ITT01_0082_A11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0141_G03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0032_H10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0151_A03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0025_E10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0125_D06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PST01_0098_H03.b : ***ACACT*TGTGAAGAGAAAGCAGAACTCACATCCTTCTCAGATCCAACCAACCAGGAG
THY01_0110_B12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
TES01_0096_D02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0023_D02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0087_D11.b : ATCACACT*TGTGAAGAGAAAGCAGAACTCACATCCTTCTCAGATCCAAGCAACCAGGAG
UTR01_0020_C07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
TES01_0001_F05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PST01_0039_F04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCACATCCTTCTCAGATCCAACCAATCAGGAG
PBL01_0060_D10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PST01_0052_H05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAATCAGGAG
KDN01_0100_A11.b : *TC*CACT*TGTGAAGAGAAAGCAGAACTCACATCCTTCTCAGATCCAACCAATCAGGAG
KDN01_0066_F11.b : *TC*CACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
THY01_0115_G01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0129_C10.b : *TCACACT*TGTGAAGAGAACCCTTAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
TES01_0039_A05.b : *TCACACT*TGTGAAGAGA*AGCAGAACTCAGATCCTTCTCAGATCCCAAC*ACCAGGAG
KDN01_0047_E02.b : *TC*CACT*TGTGAAGAGAAAGCAGAACTCCCATTCTTCTCAGATCCAACCAATCAGGAG
CLNT1_0147_C02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PST01_0010_G04.b : *TC*CACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAATCAGGAG
PST01_0008_C09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAATCAGGAG
KDN01_0053_H03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
TES01_0083_D06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGACCCTTCTCAGATCCAACCAACCAGGAG
PST01_0042_C11.b : *CC**ACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
TES01_0014_D09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PST01_0032_C06.b : *TC*CACT*TGTGAAGAGAAAGCAGAACTCAGACCCTTCATAGATCCAACCAACCAGGAG
PST01_0014_B02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PST01_0030_B04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PST01_0009_B02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAATCAGGAG
PST01_0038_B10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCCCATCCTTCTCAGATCCAACCAATCAGGAG
KDN01_0008_B05.b : *TC*CACT*TGTGAAGAGAAAGCAGAACTCACATCCTTCTCAGATCCAACCAACCAGGAG
PST01_0070_D07.b : *TC*CACT*TGTGAAGAGAAAGCAGAACTCACATCCTTCTCAGATCCAACCAATCAGGAG
PST01_0064_D10.b : *TC*CACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAATCAGGAG
PST01_0087_D10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAATCAGGAG
PST01_0046_E12.b : *TC*CACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAATCAGGAG
PST01_0038_C10.b : *TC*CACT*TGTGAAGAGAAAGCAGAACTCCCATTCTTCTCAGATCCAACCAACCAGGAG
PST01_0033_D11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCACATCCTTCTCAGATCCAACCAATCAGGAG
KDN01_0022_A05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAATCAGGAG
TES01_0037_H07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCA*CCAACCAGGAG
TES01_0084_B01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PST01_0061_D01.b : *TC*CACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAATCAGGAG
PST01_0020_B03.b : *TC*CACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAATCAGGAG
PST01_0029_C10.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTTTCAGATCCAACCAACCAGGAG
PST01_0067_H01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCACATCCTTCTCAGATCCAACCAATCAGGAG
TES01_0020_D05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PST01_0035_B11.b : *TC*CACT*TGTGAAGAGAAAGCAGAACTCACATTCTTCTCAGATCCAACCAACCAGGAG
TES01_0042_B08.b : *TC*CGCT*TGTGAAGA*AAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PST01_0085_D07.b : *TC*CACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAATCAGGAG
SPL01_0073_A02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0031_B01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0026_G08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
OVRT1_0115_E07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0044_E04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCATATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0051_C07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0059_G09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0080_E06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0059_A12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0059_F02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0041_A02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATTCAACCAACCAGGAG
SPL01_0052_D09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0053_H06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0082_E03.b : *TCACACT*TGCGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0049_B02.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
ITT01_0093_H03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0054_F07.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0071_B09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0089_B12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCACAGATCCAACCAACCAGGAG
SPL01_0044_C04.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
ITT01_0022_F06.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
TCH01_0081_E08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
OVRT1_0004_H12.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
TES01_0026_A01.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCACATCCTTCTCAGATCCA*CCAAGCAGGAG
SPLT1_0069_C05.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0105_E03.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PST01_0022_C09.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PST01_0048_H08.b : *TC*CACT*TGTGAAGAGAAAGCAGAACTCCCTTTCTTCTCGCATCCTACCAGCCTTGAG
SPL01_0053_A11.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0041_C08.b : *TCACACT*TGTGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0027_D07.b : xxxxxxCT*TGTGAAGAGAAAGCAGAACTCAGATTCTTCTCAGATCCAACCAACCAGGAG
SPL01_0044_G03.b : xxxxxxxxxxxxGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVRM1_0153_C11.b : xxxxxxxxxxxxGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0046_C02.b : xxxxxxxxxxxxGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0044_C04.b : gagtcctactggGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0011_G03.b : xxxxxxxxxxxxGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0048_C10.b : xxxxxxxxxxxgGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0028_G01.b : xxxxxxxxxxxxGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LVR01_0071_F10.b : xxxxxxxxxxxxGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0097_E03.b : xxxxxxxxxxxxGAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0024_C12.b : xxxxxxxxxxxxxAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0024_A03.b : xxxxxxxxxxxxxAAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0001_E01.b : xxxxxxxxxxxxxxAGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0102_A04.b : xxxxxxxxxxxxxxxGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
OVRM1_0064_B05.b : xxxxxxxxxxxxxxxGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0051_E08.b : xxxxxxxxxxxxxxtGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0041_D10.b : xxxxxxxxxxxxxxxGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SMG01_0032_B04.b : xxxxxxxxxxxxxxxGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0089_D05.b : xxxxxxxxxxxxxxxGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0053_B06.b : xxxxxxxxxxxxxxxGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0083_B09.b : xxxxxxxxxxxxxxxGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0028_D02.b : xxxxxxxxxxxxxxxGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
TCH01_0080_C12.b : xxxxxxxxxxxxxxxGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
LNG01_0016_E12.b : xxxxxxxxxxxxxxxGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
CLNT1_0052_G10.b : xxxxxxxxxxxxxxxGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
SPL01_0077_E04.b : xxxxxxxxxxxxxxxGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0082_H04.b : xxxxxxxxxxxxxxxGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0072_H08.b : xxxxxxxxxxxxxxxGAGAAAGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PST01_0039_A01.b : gctctggaccttgtgagagAAGCAGAACTCAGATCCTTCTCAGATCCA*CCAACCAGGAG
PBL01_0005_D01.b : xxxxxxxxxxxxxxxxxxxxxGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
MLN01_0061_C02.b : xxxxxxxxxxxxxxxxxxxxxGCAGAACTCAGATCCTTCTCAGATCCAACCAACCAGGAG
PBL01_0045_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxGAACTCAGATCCTTCTCAGATCCA*CCAACCAGGAG
SPL01_0063_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGATCCTTCTCAGATCCAACCAACCAGGAG
ITT01_0005_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGATCCTTCTCAGATCCA*CCAACCAGGAG
PCT01_0003_D02.b : annncctgcgttggctctggggacaaaactcGATCCTTCTC*GATCCA*CCAACCAGGAG
THY01_0110_D01.b : cactgttggctatgggaagaaaagcaaactcaattCTTCTCAGATC*AACCAACCAGGAG
TCH01_0052_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggCTCAGATCCAACCAACCAGGAG
SPL01_0010_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaaATCCAACCAACCAGGAG
MLN01_0051_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggCCAACCAACCAGGAG
SPL01_0028_D12.b : cttttaggtggactactcagacxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0045_E01.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0015_D04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPL01_0093_F04.b : nnnnggcttggactatnacxxxxxxxxxxxxxxx
TCH01_0096_C06.b : ttttnggcttg
SPL01_0034_E02.b : ttttaagcatggtacttnacagtttgtacxxxxxxxxxxxxxxxxx
SPL01_0051_B09.b : nnnn
PBL01_0106_C01.b :
TCH01_0019_D08.b :
ITT01_0099_C05.b :
CLNT1_0019_B11.b :
LVR01_0076_G10.b :
SPL01_0075_G04.b :
LNG01_0098_G11.b :
SPL01_0030_E07.b :
PBL01_0048_C10.b :
SPL01_0042_F02.b :
SPL01_0097_D07.b :
THY01_0046_C05.b :
PBL01_0085_D11.b :
20110601C-001409 : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
---------+---------+---------+---------+---------+---------+ 169
SPL01_0099_H10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0083_G01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0070_E05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0072_C10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0071_A09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0005_E09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0069_F08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0087_B12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0100_G08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
THY01_0046_G05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0049_F07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0042_D05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0033_C02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0060_G12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0006_D12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0032_D10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPLT1_0061_G05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
UTR01_0101_D10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0140_H03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0014_B05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPLT1_0087_D08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0012_A06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0106_C04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
HTMT1_0041_F08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0072_H03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0066_E01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCCGGAGGTGGCTGAGCCCCTGTGT
SPL01_0088_E12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0109_F05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0137_A10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0035_G08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0021_G02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0004_C06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0050_G10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0070_C10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0143_F05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0028_H09.b : GAGGGCGCCCTGGCAGAGGACAGGCGCCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0063_C04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
BFLT1_0036_D03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0036_B04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0001_F02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0094_D06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCTCCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0024_C09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
TCH01_0026_D07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0032_C05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0090_A08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVRM1_0095_E01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
OVRM1_0018_A05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
OVR01_0063_A04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0052_F09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0061_C12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTAGCTGAGCCCCTGTGT
SPL01_0097_C05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVRM1_0023_A06.b : GAGGGCGCCCTGGCGGAGGACAGGCACCACAGCCGCCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0054_H11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
THY01_0001_D02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0060_A12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0006_B10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
THY01_0046_H08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0051_B01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SMG01_0059_D05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0034_B11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
OVRT1_0140_H12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVRM1_0072_C01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0105_D07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVRM1_0109_C07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVRM1_0029_E08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGC
PBL01_0008_H03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0075_H09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
THY01_0007_B11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0091_E01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVRM1_0030_D02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0083_G08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0050_G06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0017_B11.b : GAGGGCGCCCCGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0033_B06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0043_H08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
THY01_0041_B06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0021_A09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0048_C02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
THY01_0069_G07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0034_A01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0033_B04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0022_C03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTAT
PTG01_0050_G10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0008_D07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0013_G01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCCGGAGGTGGCTGAGCCCCTGTGT
MLN01_0033_H12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0021_E09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0068_H04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PTG01_0051_D03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0053_H03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0025_F12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0042_F05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0048_A07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0051_C03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0091_F01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0033_F03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0034_E05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0063_B11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0052_G04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0019_A07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0085_F11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
OVRT1_0017_C06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0025_A05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0065_C05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0050_B04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0057_H09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0039_D02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0084_C04.b : GAGGGTGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0078_B05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PTG01_0075_G07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0026_C12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0049_E01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0049_H05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0090_E09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0101_C10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0045_G12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0070_G08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0006_D04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
UTR01_0082_H12.b : GAGGGCGCCCTAGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0020_B03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0087_G07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTAT
LVR01_0089_F08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SMG01_0046_D03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0027_D01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0074_D12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0011_H07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0050_G01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0079_H04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0037_A11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0142_B05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0073_E05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0044_F07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
OVRT1_0107_A11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0056_C05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0083_D03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0021_D01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0085_D07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0064_E01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SMG01_0019_G10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0038_B06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0071_D05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0015_D04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0068_D09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0086_B03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0074_F05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0064_H05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0014_A03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0012_E12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0048_B02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0069_H06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0006_D09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0044_A11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0047_F08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0019_G06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0045_G07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0046_G07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0041_F12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0056_H03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0102_B09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
OVRT1_0113_A07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0065_B12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0042_A08.b : GAGGGCGCCCTGGCAGAGGACAGGCGCCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
OVR01_0028_D06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0098_D12.b : GAGGGCGCCCTGGCAGAGGACACGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0073_G07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0088_C03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0053_G12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0074_F08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0080_D04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0036_H03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0067_A09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0077_G02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0079_H11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0008_D02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0019_B11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0089_B01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0041_B11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0022_G09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0078_B12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0071_H08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0067_B05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0008_D10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0079_F06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
OVRT1_0040_H12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0013_D05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0084_B08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0068_H09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0122_H07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
UTR01_0036_A04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGC
LNG01_0029_E11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0017_H12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0084_B12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0072_F06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0022_F05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0033_B03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
BFLT1_0048_G10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
THY01_0034_A12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0058_C05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0039_F11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0042_E06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0053_D03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0100_A05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0086_F09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0035_E07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
UTR01_0075_B03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0034_A12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0085_H11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
OVRT1_0077_H06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0003_F01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0033_D06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0018_B12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0019_C01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0085_H04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGGGCCCCTGTGT
THY01_0082_D09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
OVR01_0047_C10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0083_D11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0089_G02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0005_F02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGTGGTGGCTGAGCCCCTGTGT
PBL01_0059_A08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
UTR01_0066_C09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0106_D08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0042_C06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0012_G10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0011_D11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0050_H05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0037_G04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0078_A07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0085_E03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0003_C07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0039_H12.b : GAGGGCGCCCTGGCAGAGGACAGGCGCCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0011_G04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0028_G03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0086_E11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0011_F10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0048_B11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0056_B09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0042_A04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0012_F03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0103_C09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0075_B03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0059_B05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
THY01_0090_G07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0079_A01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0006_E08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0082_G10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0119_A07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0074_F07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0064_B06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
THY01_0202_F03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0042_H06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
OVRT1_0093_G03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0087_D03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0073_D12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
OVRT1_0006_D11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0065_G06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0071_F06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0080_A02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0091_B10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0039_D07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0041_A05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0105_B07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0074_B01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0108_C07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0049_C02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0084_B01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0082_H08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0065_F11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0008_A10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0063_F04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0068_E07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0015_D01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0034_D04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0032_C10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0075_D04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0044_B02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0101_F02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0061_E07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0073_H08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0079_D05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0092_E04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
OVRT1_0025_F03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0065_A01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0015_H07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0082_H03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0053_G02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0067_G04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0096_D02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PTG01_0034_G11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0074_G01.b : GAGGGCGCCCTGGCAGAGGACGGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0066_E06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0068_C12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACTTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0055_C04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
THY01_0039_B02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0073_C10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0044_H07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
UTR01_0095_E06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0093_H01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0101_E10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0082_C02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0085_A09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0085_F01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0100_E08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0074_H11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0105_G06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGGGCCCCTGTGT
TCH01_0032_B06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0102_A07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0078_E04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0100_D05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0051_B12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0055_B11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0082_A11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0141_G03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0032_H10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0151_A03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0025_E10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0125_D06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0098_H03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
THY01_0110_B12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
TES01_0096_D02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0023_D02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0087_D11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
UTR01_0020_C07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
TES01_0001_F05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0039_F04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0060_D10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0052_H05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
KDN01_0100_A11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
KDN01_0066_F11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
THY01_0115_G01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCCGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0129_C10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
TES01_0039_A05.b : GAGGGCGCCCTGGCACATGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
KDN01_0047_E02.b : GAGGGCGCCCTGGCTTAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0147_C02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0010_G04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0008_C09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
KDN01_0053_H03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
TES01_0083_D06.b : GAGGGCGCCCTGGCCCTGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0042_C11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
TES01_0014_D09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0032_C06.b : GAGGGCGCCCTGGCACATGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0014_B02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0030_B04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0009_B02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0038_B10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
KDN01_0008_B05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0070_D07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0064_D10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0087_D10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0046_E12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0038_C10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0033_D11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
KDN01_0022_A05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
TES01_0037_H07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
TES01_0084_B01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0061_D01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0020_B03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0029_C10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0067_H01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
TES01_0020_D05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0035_B11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
TES01_0042_B08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0085_D07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0073_A02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0031_B01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0026_G08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
OVRT1_0115_E07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0044_E04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0051_C07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0059_G09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0080_E06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0059_A12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0059_F02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0041_A02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0052_D09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0053_H06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0082_E03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0049_B02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0093_H03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0054_F07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0071_B09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0089_B12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0044_C04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0022_F06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
TCH01_0081_E08.b : GAGGGCGCCCTGGCAGAGGACGGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
OVRT1_0004_H12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
TES01_0026_A01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPLT1_0069_C05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0105_E03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0022_C09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0048_H08.b : GAGGGCGCCCTGTTATATGACAGGCACCACAACCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0053_A11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0041_C08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0027_D07.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0044_G03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVRM1_0153_C11.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0046_C02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0044_C04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0011_G03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0048_C10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0028_G01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LVR01_0071_F10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0097_E03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0024_C12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0024_A03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0001_E01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0102_A04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
OVRM1_0064_B05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0051_E08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0041_D10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SMG01_0032_B04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0089_D05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0053_B06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0083_B09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0028_D02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
TCH01_0080_C12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
LNG01_0016_E12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
CLNT1_0052_G10.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0077_E04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0082_H04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0072_H08.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PST01_0039_A01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0005_D01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0061_C02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PBL01_0045_B04.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0063_H09.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
ITT01_0005_C12.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
PCT01_0003_D02.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
THY01_0110_D01.b : GAGGGCGCCCTGGCAGAGGACAGGCACCGCAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
TCH01_0052_D03.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0010_B06.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
MLN01_0051_E05.b : GAGGGCGCCCTGGCAGAGGACAGGCACCACAGCCACCTGGAGGTGGCTGAGCCCCTGTGT
SPL01_0028_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAGGTGGCTGAGCCCCTGTGT
SPL01_0045_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAGGTGGCTGAGCCCCTGTGT
SMG01_0015_D04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxGGAGGTGGCTGAGCCCCTGTGT
SPL01_0093_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGAGCCCCTGTGT
TCH01_0096_C06.b : gactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0034_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttgatgaacaagtgaatgaacaaatt
SPL01_0051_B09.b : ggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0106_C01.b : nttaatgaagcxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0019_D08.b : nnnntttgtggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0099_C05.b : gtgat
CLNT1_0019_B11.b : tctcagcgta
LVR01_0076_G10.b : ccttttggtggxxxxxxxxxxxxxxxxxxxx
SPL01_0075_G04.b : nnnggcttggactatnacxxxxxxxx
LNG01_0098_G11.b :
SPL01_0030_E07.b :
PBL01_0048_C10.b :
SPL01_0042_F02.b :
SPL01_0097_D07.b :
THY01_0046_C05.b :
PBL01_0085_D11.b :
20110601C-001409 : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
---------+---------+---------+---------+---------+---------+ 228
SPL01_0099_H10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0083_G01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0070_E05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0072_C10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0071_A09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0005_E09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0069_F08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0087_B12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0100_G08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
THY01_0046_G05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0049_F07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0042_D05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0033_C02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0060_G12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0006_D12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0032_D10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPLT1_0061_G05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
UTR01_0101_D10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0140_H03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0014_B05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPLT1_0087_D08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0012_A06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0106_C04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
HTMT1_0041_F08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0072_H03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0066_E01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0088_E12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0109_F05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0137_A10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0035_G08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0021_G02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0004_C06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0050_G10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0070_C10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0143_F05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0028_H09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0063_C04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
BFLT1_0036_D03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0036_B04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0001_F02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0094_D06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0024_C09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
TCH01_0026_D07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0032_C05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0090_A08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAAACAGAAGAAGCCAAGAGATGAA*GAAA
LVRM1_0095_E01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
OVRM1_0018_A05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
OVR01_0063_A04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0052_F09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0061_C12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0097_C05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVRM1_0023_A06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0054_H11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCGAGAGATGAA*GAAA
THY01_0001_D02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGGCAGAAGAAGCCAAGAGATGAA*GACA
SPL01_0060_A12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0006_B10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
THY01_0046_H08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GGAA
MLN01_0051_B01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SMG01_0059_D05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0034_B11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
OVRT1_0140_H12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGACGACAGAAGAAGCCAAGAGATGAA*GAAA
LVRM1_0072_C01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0105_D07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVRM1_0109_C07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVRM1_0029_E08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0008_H03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0075_H09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
THY01_0007_B11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0091_E01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVRM1_0030_D02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0083_G08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0050_G06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0017_B11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0033_B06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0043_H08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
THY01_0041_B06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0021_A09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0048_C02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
THY01_0069_G07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0034_A01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0033_B04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0022_C03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PTG01_0050_G10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0008_D07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0013_G01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0033_H12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0021_E09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0068_H04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PTG01_0051_D03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0053_H03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0025_F12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0042_F05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0048_A07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0051_C03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0091_F01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0033_F03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0034_E05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0063_B11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGGAGAAGCCAAGAGATGAA*GAAA
SPL01_0052_G04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0019_A07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0085_F11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
OVRT1_0017_C06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0025_A05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0065_C05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0050_B04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0057_H09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0039_D02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0084_C04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0078_B05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PTG01_0075_G07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0026_C12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0049_E01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0049_H05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0090_E09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0101_C10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0045_G12.b : CCCAGTAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0070_G08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0006_D04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
UTR01_0082_H12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0020_B03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAG*GAAA
CLNT1_0087_G07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0089_F08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SMG01_0046_D03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0027_D01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0074_D12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0011_H07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0050_G01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0079_H04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0037_A11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0142_B05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0073_E05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0044_F07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
OVRT1_0107_A11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0056_C05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0083_D03.b : CCCAGCAGGCACCATGAAGTTAACCCTGGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0021_D01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0085_D07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0064_E01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SMG01_0019_G10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0038_B06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0071_D05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0015_D04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0068_D09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0086_B03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0074_F05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0064_H05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0014_A03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0012_E12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0048_B02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0069_H06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0006_D09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0044_A11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0047_F08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0019_G06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0045_G07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0046_G07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0041_F12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0056_H03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0102_B09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
OVRT1_0113_A07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0065_B12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0042_A08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
OVR01_0028_D06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0098_D12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0073_G07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0088_C03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0053_G12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0074_F08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0080_D04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0036_H03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0067_A09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0077_G02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0079_H11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0008_D02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0019_B11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0089_B01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0041_B11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0022_G09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0078_B12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0071_H08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0067_B05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0008_D10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0079_F06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACGGAAGAAGCCAAGAGATGAA*GAAA
OVRT1_0040_H12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0013_D05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0084_B08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0068_H09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0122_H07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
UTR01_0036_A04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0029_E11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0017_H12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0084_B12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0072_F06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0022_F05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0033_B03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
BFLT1_0048_G10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
THY01_0034_A12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0058_C05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0039_F11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0042_E06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0053_D03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0100_A05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0086_F09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0035_E07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
UTR01_0075_B03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0034_A12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0085_H11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
OVRT1_0077_H06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0003_F01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0033_D06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0018_B12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0019_C01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0085_H04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
THY01_0082_D09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
OVR01_0047_C10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0083_D11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0089_G02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAC*GAAA
SPL01_0005_F02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0059_A08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
UTR01_0066_C09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0106_D08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0042_C06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0012_G10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0011_D11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0050_H05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0037_G04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0078_A07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0085_E03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0003_C07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0039_H12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0011_G04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0028_G03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0086_E11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0011_F10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0048_B11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0056_B09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0042_A04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAG*GAAA
ITT01_0012_F03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0103_C09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0075_B03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0059_B05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
THY01_0090_G07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0079_A01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0006_E08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0082_G10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0119_A07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0074_F07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0064_B06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
THY01_0202_F03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0042_H06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
OVRT1_0093_G03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0087_D03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0073_D12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
OVRT1_0006_D11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0065_G06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0071_F06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0080_A02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0091_B10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0039_D07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0041_A05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0105_B07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0074_B01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0108_C07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0049_C02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0084_B01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACA***GAAGCCAAGAGATGAA*GAAA
SPL01_0082_H08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0065_F11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0008_A10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0063_F04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0068_E07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0015_D01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0034_D04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0032_C10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0075_D04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0044_B02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0101_F02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0061_E07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0073_H08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0079_D05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0092_E04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
OVRT1_0025_F03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0065_A01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0015_H07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0082_H03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0053_G02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0067_G04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0096_D02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PTG01_0034_G11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0074_G01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0066_E06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0068_C12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0055_C04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
THY01_0039_B02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0073_C10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0044_H07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
UTR01_0095_E06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0093_H01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0101_E10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0082_C02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0085_A09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0085_F01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0100_E08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0074_H11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0105_G06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
TCH01_0032_B06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0102_A07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0078_E04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0100_D05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0051_B12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0055_B11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0082_A11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0141_G03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0032_H10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0151_A03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0025_E10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0125_D06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0098_H03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
THY01_0110_B12.b : TCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
TES01_0096_D02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0023_D02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0087_D11.b : CCCGGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCCAGAGATGAA*GAAA
UTR01_0020_C07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
TES01_0001_F05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0039_F04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0060_D10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0052_H05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
KDN01_0100_A11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
KDN01_0066_F11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
THY01_0115_G01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0129_C10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
TES01_0039_A05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGACGAAGCCATGAGATGAA*GAAA
KDN01_0047_E02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0147_C02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0010_G04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0008_C09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
KDN01_0053_H03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
TES01_0083_D06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0042_C11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
TES01_0014_D09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0032_C06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0014_B02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0030_B04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0009_B02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0038_B10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
KDN01_0008_B05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0070_D07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0064_D10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0087_D10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0046_E12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0038_C10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0033_D11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
KDN01_0022_A05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
TES01_0037_H07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
TES01_0084_B01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0061_D01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0020_B03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0029_C10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0067_H01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
TES01_0020_D05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGGCAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0035_B11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
TES01_0042_B08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0085_D07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0073_A02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0031_B01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0026_G08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
OVRT1_0115_E07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0044_E04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0051_C07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0059_G09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0080_E06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0059_A12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0059_F02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0041_A02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0052_D09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0053_H06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0082_E03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0049_B02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0093_H03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0054_F07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0071_B09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0089_B12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0044_C04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0022_F06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
TCH01_0081_E08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
OVRT1_0004_H12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
TES01_0026_A01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPLT1_0069_C05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0105_E03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0022_C09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0048_H08.b : CCCACCAGGCACCATGAACTTAACCCTAGGAAGACAGATGAAGCCTAGAGATGAATGAAA
SPL01_0053_A11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0041_C08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0027_D07.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0044_G03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVRM1_0153_C11.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0046_C02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0044_C04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0011_G03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0048_C10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0028_G01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LVR01_0071_F10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0097_E03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0024_C12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0024_A03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0001_E01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0102_A04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
OVRM1_0064_B05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0051_E08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0041_D10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SMG01_0032_B04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0089_D05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0053_B06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0083_B09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0028_D02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
TCH01_0080_C12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGGAGACAGAAGAAGCCAAGAGATGAA*GAAA
LNG01_0016_E12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
CLNT1_0052_G10.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0077_E04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0082_H04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0072_H08.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PST01_0039_A01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0005_D01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0061_C02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0045_B04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0063_H09.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0005_C12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PCT01_0003_D02.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
THY01_0110_D01.b : TCCAGCAGGCACCATGAAGTTAACCCTAGGAAGAAAGAAGAAGCCAAGAGATGAA*GAAA
TCH01_0052_D03.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0010_B06.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
MLN01_0051_E05.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0028_D12.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0045_E01.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SMG01_0015_D04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0093_F04.b : CCCAGCAGGCACCATGAAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
TCH01_0096_C06.b : xxxxxxxxxCACTGAGCAATTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0034_E02.b : gtgtttgggactctttcAGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
SPL01_0051_B09.b : xxxxxxxxxxxxxxxxggGTTAACCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
PBL01_0106_C01.b : xxxxxxxxxxxxxxxxxxxxxxxCCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
TCH01_0019_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxCCTAGGAAGACAGAAGAAGCCAAGAGATGAA*GAAA
ITT01_0099_C05.b : acaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGATGAA*GAAA
CLNT1_0019_B11.b : cgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctttggagAA
LVR01_0076_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0075_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0098_G11.b :
SPL01_0030_E07.b :
PBL01_0048_C10.b :
SPL01_0042_F02.b :
SPL01_0097_D07.b :
THY01_0046_C05.b :
PBL01_0085_D11.b :
20110601C-001409 : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
---------+---------+---------+---------+---------+---------+ 287
SPL01_0099_H10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0083_G01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0070_E05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0072_C10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0071_A09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0005_E09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0069_F08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0087_B12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0100_G08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
THY01_0046_G05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0049_F07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0042_D05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0033_C02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCGC
SPL01_0060_G12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0006_D12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0032_D10.b : ACCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPLT1_0061_G05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
UTR01_0101_D10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0140_H03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0014_B05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPLT1_0087_D08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0012_A06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0106_C04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
HTMT1_0041_F08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0072_H03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0066_E01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0088_E12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0109_F05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0137_A10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0035_G08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0021_G02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0004_C06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0050_G10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0070_C10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGTAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0143_F05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0028_H09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0063_C04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
BFLT1_0036_D03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0036_B04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0001_F02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0094_D06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0024_C09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
TCH01_0026_D07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0032_C05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0090_A08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVRM1_0095_E01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
OVRM1_0018_A05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
OVR01_0063_A04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0052_F09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0061_C12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0097_C05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVRM1_0023_A06.b : ACCCCCATGGT*TCTGAGGACCTCCGGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0054_H11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
THY01_0001_D02.b : ATCCCCATGGT*TCTGAGGACCTCCGGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0060_A12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0006_B10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
THY01_0046_H08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0051_B01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SMG01_0059_D05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0034_B11.b : ATCCCCATGGT*TCTGGGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
OVRT1_0140_H12.b : ATCCCCGTGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVRM1_0072_C01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0105_D07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVRM1_0109_C07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVRM1_0029_E08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0008_H03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0075_H09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
THY01_0007_B11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0091_E01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVRM1_0030_D02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0083_G08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0050_G06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0017_B11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0033_B06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0043_H08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
THY01_0041_B06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0021_A09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0048_C02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
THY01_0069_G07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0034_A01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0033_B04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0022_C03.b : ATCCCCATGGT*TCTGGGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PTG01_0050_G10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0008_D07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0013_G01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0033_H12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0021_E09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0068_H04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PTG01_0051_D03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0053_H03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0025_F12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0042_F05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGACTGCGGCTCCTC
SPL01_0048_A07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0051_C03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0091_F01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0033_F03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0034_E05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0063_B11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0052_G04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0019_A07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0085_F11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
OVRT1_0017_C06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0025_A05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0065_C05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0050_B04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0057_H09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0039_D02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0084_C04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0078_B05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PTG01_0075_G07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0026_C12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0049_E01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0049_H05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0090_E09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0101_C10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0045_G12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0070_G08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0006_D04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
UTR01_0082_H12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0020_B03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0087_G07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0089_F08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SMG01_0046_D03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0027_D01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0074_D12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0011_H07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0050_G01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0079_H04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0037_A11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0142_B05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0073_E05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0044_F07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
OVRT1_0107_A11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0056_C05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0083_D03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0021_D01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0085_D07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0064_E01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SMG01_0019_G10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0038_B06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0071_D05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0015_D04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0068_D09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0086_B03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0074_F05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0064_H05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0014_A03.b : ATCCCCATGGT*TCTGAGGACCTCTAGGCGGCGCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0012_E12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0048_B02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0069_H06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0006_D09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0044_A11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0047_F08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0019_G06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCAGCGGCTCCTC
PBL01_0045_G07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0046_G07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0041_F12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0056_H03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0102_B09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
OVRT1_0113_A07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0065_B12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0042_A08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
OVR01_0028_D06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0098_D12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0073_G07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0088_C03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0053_G12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0074_F08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0080_D04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0036_H03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0067_A09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0077_G02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0079_H11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0008_D02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0019_B11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0089_B01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0041_B11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0022_G09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0078_B12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0071_H08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0067_B05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0008_D10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0079_F06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
OVRT1_0040_H12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0013_D05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0084_B08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0068_H09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0122_H07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
UTR01_0036_A04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0029_E11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0017_H12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0084_B12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0072_F06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0022_F05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0033_B03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
BFLT1_0048_G10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
THY01_0034_A12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0058_C05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0039_F11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0042_E06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0053_D03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0100_A05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0086_F09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0035_E07.b : ATCCCCATGGT*TCTGAGGACCTCCGGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
UTR01_0075_B03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0034_A12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0085_H11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
OVRT1_0077_H06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0003_F01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0033_D06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0018_B12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0019_C01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0085_H04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
THY01_0082_D09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
OVR01_0047_C10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0083_D11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0089_G02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0005_F02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0059_A08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
UTR01_0066_C09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0106_D08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0042_C06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0012_G10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0011_D11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0050_H05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0037_G04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0078_A07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0085_E03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0003_C07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0039_H12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0011_G04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0028_G03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0086_E11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0011_F10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0048_B11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0056_B09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0042_A04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0012_F03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0103_C09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0075_B03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0059_B05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
THY01_0090_G07.b : ACCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0079_A01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0006_E08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0082_G10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0119_A07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0074_F07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0064_B06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGTGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
THY01_0202_F03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0042_H06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
OVRT1_0093_G03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0087_D03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0073_D12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
OVRT1_0006_D11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0065_G06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0071_F06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0080_A02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0091_B10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0039_D07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0041_A05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0105_B07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0074_B01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0108_C07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCGGGCTGCGGCTCCTC
CLNT1_0049_C02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0084_B01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0082_H08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0065_F11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0008_A10.b : ATCCCCATGGT*TCTGAGGACCTCCAGACGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0063_F04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0068_E07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0015_D01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0034_D04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0032_C10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0075_D04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0044_B02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0101_F02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0061_E07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0073_H08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0079_D05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0092_E04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCTCAGGCTGCGGCTCCTC
OVRT1_0025_F03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0065_A01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCACAGGCTGCGGCTCCTC
LNG01_0015_H07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0082_H03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0053_G02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0067_G04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0096_D02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PTG01_0034_G11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0074_G01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAACCCAGGCTGCGGCTCCTC
PBL01_0066_E06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0068_C12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0055_C04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
THY01_0039_B02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0073_C10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0044_H07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
UTR01_0095_E06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0093_H01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGTAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0101_E10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0082_C02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0085_A09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0085_F01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0100_E08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0074_H11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0105_G06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
TCH01_0032_B06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0102_A07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0078_E04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0100_D05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0051_B12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0055_B11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0082_A11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0141_G03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0032_H10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0151_A03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0025_E10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0125_D06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0098_H03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
THY01_0110_B12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
TES01_0096_D02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0023_D02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0087_D11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
UTR01_0020_C07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
TES01_0001_F05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0039_F04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0060_D10.b : ATCCCCATGGT*TCTGGGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0052_H05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
KDN01_0100_A11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
KDN01_0066_F11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
THY01_0115_G01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0129_C10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
TES01_0039_A05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAAGAGCCCAGGCTGCGGCTCCTC
KDN01_0047_E02.b : ATCCCCGTGGG*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0147_C02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0010_G04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0008_C09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
KDN01_0053_H03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
TES01_0083_D06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0042_C11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
TES01_0014_D09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0032_C06.b : ATCCCCATGGT*TGTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0014_B02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0030_B04.b : ATCCCCATGGTGTGGGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0009_B02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0038_B10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
KDN01_0008_B05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0070_D07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0064_D10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0087_D10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0046_E12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0038_C10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0033_D11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
KDN01_0022_A05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
TES01_0037_H07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
TES01_0084_B01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0061_D01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0020_B03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0029_C10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0067_H01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
TES01_0020_D05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0035_B11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
TES01_0042_B08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0085_D07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0073_A02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0031_B01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0026_G08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
OVRT1_0115_E07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0044_E04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0051_C07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0059_G09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0080_E06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0059_A12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0059_F02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0041_A02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0052_D09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0053_H06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0082_E03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0049_B02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0093_H03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0054_F07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0071_B09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0089_B12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0044_C04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0022_F06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
TCH01_0081_E08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
OVRT1_0004_H12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
TES01_0026_A01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPLT1_0069_C05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0105_E03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0022_C09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0048_H08.b : ATCCCCGTGGT*TCTGAGGACCTCCAGGGGGCCCTGCATGAACCCAGGCTGCGGCTCCTC
SPL01_0053_A11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0041_C08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0027_D07.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0044_G03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVRM1_0153_C11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0046_C02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0044_C04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0011_G03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0048_C10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0028_G01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0071_F10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0097_E03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0024_C12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0024_A03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0001_E01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0102_A04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
OVRM1_0064_B05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0051_E08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0041_D10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SMG01_0032_B04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0089_D05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0053_B06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0083_B09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0028_D02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
TCH01_0080_C12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0016_E12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0052_G10.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0077_E04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0082_H04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0072_H08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PST01_0039_A01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0005_D01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0061_C02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0045_B04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0063_H09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0005_C12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PCT01_0003_D02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
THY01_0110_D01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGGTCCTC
TCH01_0052_D03.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0010_B06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
MLN01_0051_E05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0028_D12.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0045_E01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SMG01_0015_D04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0093_F04.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
TCH01_0096_C06.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0034_E02.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0051_B09.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
PBL01_0106_C01.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
TCH01_0019_D08.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
ITT01_0099_C05.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
CLNT1_0019_B11.b : ATCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LVR01_0076_G10.b : xTCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
SPL01_0075_G04.b : xTCCCCATGGT*TCTGAGGACCTCCAGGCGGCCCTGCAGGAGCCCAGGCTGCGGCTCCTC
LNG01_0098_G11.b : ttttttcgctggact
SPL01_0030_E07.b : nnnnggcta
PBL01_0048_C10.b :
SPL01_0042_F02.b :
SPL01_0097_D07.b :
THY01_0046_C05.b :
PBL01_0085_D11.b :
20110601C-001409 : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
---------+---------+---------+---------+---------+---------+ 347
SPL01_0099_H10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0083_G01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0070_E05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAGACAGCATCCTGGGCCGGAAG
PBL01_0072_C10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAGACAGCATCCTGGGCCGGAAG
SPL01_0071_A09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0005_E09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0069_F08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0087_B12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0100_G08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
THY01_0046_G05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0049_F07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0042_D05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0033_C02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0060_G12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0006_D12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0032_D10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPLT1_0061_G05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
UTR01_0101_D10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0140_H03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0014_B05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPLT1_0087_D08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0012_A06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0106_C04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
HTMT1_0041_F08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0072_H03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0066_E01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0088_E12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0109_F05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0137_A10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0035_G08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0021_G02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0004_C06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0050_G10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0070_C10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0143_F05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0028_H09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0063_C04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
BFLT1_0036_D03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0036_B04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0001_F02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0094_D06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0024_C09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
TCH01_0026_D07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0032_C05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0090_A08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVRM1_0095_E01.b : CTGGCCGGGAGGACGGGGGCGGGCAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
OVRM1_0018_A05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
OVR01_0063_A04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0052_F09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0061_C12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0097_C05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVRM1_0023_A06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0054_H11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
THY01_0001_D02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGTCGGAAG
SPL01_0060_A12.b : CTGGTCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0006_B10.b : CTGGCCGGGGGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
THY01_0046_H08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0051_B01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SMG01_0059_D05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0034_B11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
OVRT1_0140_H12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVRM1_0072_C01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0105_D07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVRM1_0109_C07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVRM1_0029_E08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0008_H03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0075_H09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
THY01_0007_B11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0091_E01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVRM1_0030_D02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0083_G08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0050_G06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0017_B11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0033_B06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0043_H08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
THY01_0041_B06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0021_A09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0048_C02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
THY01_0069_G07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0034_A01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0033_B04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0022_C03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PTG01_0050_G10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0008_D07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0013_G01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0033_H12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0021_E09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0068_H04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PTG01_0051_D03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0053_H03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0025_F12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0042_F05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0048_A07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0051_C03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0091_F01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0033_F03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0034_E05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0063_B11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0052_G04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0019_A07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0085_F11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
OVRT1_0017_C06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0025_A05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0065_C05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0050_B04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0057_H09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0039_D02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0084_C04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0078_B05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PTG01_0075_G07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0026_C12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0049_E01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0049_H05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0090_E09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0101_C10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0045_G12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0070_G08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0006_D04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
UTR01_0082_H12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0020_B03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0087_G07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0089_F08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SMG01_0046_D03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0027_D01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0074_D12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0011_H07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0050_G01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0079_H04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0037_A11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0142_B05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0073_E05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0044_F07.b : CTGGTCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
OVRT1_0107_A11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0056_C05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0083_D03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0021_D01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0085_D07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0064_E01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SMG01_0019_G10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0038_B06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0071_D05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0015_D04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0068_D09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0086_B03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0074_F05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0064_H05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0014_A03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0012_E12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0048_B02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0069_H06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0006_D09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0044_A11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0047_F08.b : CTGGCCGGGAGGGCGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0019_G06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0045_G07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0046_G07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0041_F12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0056_H03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0102_B09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
OVRT1_0113_A07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0065_B12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0042_A08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
OVR01_0028_D06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0098_D12.b : CTGGCCGGGAGGACGGGGGCGGGGAAAAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0073_G07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0088_C03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0053_G12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0074_F08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0080_D04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0036_H03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0067_A09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0077_G02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0079_H11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0008_D02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0019_B11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0089_B01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0041_B11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0022_G09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0078_B12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0071_H08.b : CTGGCCGGGAGGACGGGGGCGGGGAGGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0067_B05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0008_D10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0079_F06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
OVRT1_0040_H12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0013_D05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0084_B08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0068_H09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0122_H07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
UTR01_0036_A04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0029_E11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0017_H12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0084_B12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0072_F06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0022_F05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0033_B03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
BFLT1_0048_G10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
THY01_0034_A12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0058_C05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0039_F11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0042_E06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0053_D03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0100_A05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0086_F09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0035_E07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
UTR01_0075_B03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0034_A12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0085_H11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
OVRT1_0077_H06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0003_F01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0033_D06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0018_B12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0019_C01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0085_H04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
THY01_0082_D09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
OVR01_0047_C10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0083_D11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0089_G02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0005_F02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0059_A08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
UTR01_0066_C09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0106_D08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0042_C06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0012_G10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0011_D11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0050_H05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0037_G04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0078_A07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0085_E03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0003_C07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0039_H12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0011_G04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0028_G03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0086_E11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0011_F10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0048_B11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0056_B09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0042_A04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0012_F03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0103_C09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0075_B03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0059_B05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
THY01_0090_G07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0079_A01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0006_E08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0082_G10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0119_A07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0074_F07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0064_B06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
THY01_0202_F03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0042_H06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
OVRT1_0093_G03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0087_D03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0073_D12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
OVRT1_0006_D11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0065_G06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0071_F06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0080_A02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0091_B10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0039_D07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0041_A05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0105_B07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0074_B01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0108_C07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0049_C02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0084_B01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0082_H08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0065_F11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0008_A10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0063_F04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0068_E07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0015_D01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0034_D04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0032_C10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0075_D04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0044_B02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0101_F02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0061_E07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0073_H08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0079_D05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0092_E04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
OVRT1_0025_F03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0065_A01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0015_H07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0082_H03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTAGGCCGGAAG
PBL01_0053_G02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0067_G04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0096_D02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PTG01_0034_G11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0074_G01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0066_E06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0068_C12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0055_C04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
THY01_0039_B02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0073_C10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0044_H07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCGCGGGAAACAGCATCCTGGGCCGGAAG
UTR01_0095_E06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0093_H01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0101_E10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0082_C02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0085_A09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0085_F01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0100_E08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0074_H11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0105_G06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
TCH01_0032_B06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0102_A07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0078_E04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0100_D05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0051_B12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0055_B11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0082_A11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0141_G03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAATAGCATCCTGGGCCGGAAG
PBL01_0032_H10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0151_A03.b : CTGGTCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0025_E10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0125_D06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0098_H03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
THY01_0110_B12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATTCTGGGCCGGAAG
TES01_0096_D02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0023_D02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0087_D11.b : CTGGGCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
UTR01_0020_C07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
TES01_0001_F05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0039_F04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0060_D10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0052_H05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
KDN01_0100_A11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
KDN01_0066_F11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
THY01_0115_G01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0129_C10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
TES01_0039_A05.b : CTGGCCGGGAGGACGGGGGCGGGGAACAGCTCCACGGGAAACAGCATCCTGGGCCAGAAG
KDN01_0047_E02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0147_C02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0010_G04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0008_C09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
KDN01_0053_H03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
TES01_0083_D06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0042_C11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
TES01_0014_D09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0032_C06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0014_B02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0030_B04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0009_B02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0038_B10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
KDN01_0008_B05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0070_D07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0064_D10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0087_D10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0046_E12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0038_C10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0033_D11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
KDN01_0022_A05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
TES01_0037_H07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
TES01_0084_B01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0061_D01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0020_B03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0029_C10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0067_H01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
TES01_0020_D05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0035_B11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
TES01_0042_B08.b : CTGGCCGGGAGGAC*GGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0085_D07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0073_A02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0031_B01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0026_G08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
OVRT1_0115_E07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0044_E04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0051_C07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0059_G09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0080_E06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0059_A12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0059_F02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0041_A02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0052_D09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0053_H06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0082_E03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0049_B02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0093_H03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0054_F07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0071_B09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0089_B12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0044_C04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0022_F06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
TCH01_0081_E08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
OVRT1_0004_H12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
TES01_0026_A01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPLT1_0069_C05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0105_E03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0022_C09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0048_H08.b : CTGGCCGGGAGGACAGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0053_A11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0041_C08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0027_D07.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0044_G03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVRM1_0153_C11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0046_C02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0044_C04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0011_G03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0048_C10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0028_G01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0071_F10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0097_E03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0024_C12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0024_A03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0001_E01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0102_A04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
OVRM1_0064_B05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0051_E08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0041_D10.b : CTGGCCGGGAGGACGGGG*CGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SMG01_0032_B04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0089_D05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0053_B06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0083_B09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0028_D02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
TCH01_0080_C12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0016_E12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0052_G10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0077_E04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0082_H04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0072_H08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PST01_0039_A01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0005_D01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0061_C02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGGAACAGCATCCTGGGCCGGAAG
PBL01_0045_B04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0063_H09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0005_C12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PCT01_0003_D02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
THY01_0110_D01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATTCTGGGCCGGAAG
TCH01_0052_D03.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0010_B06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
MLN01_0051_E05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0028_D12.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0045_E01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SMG01_0015_D04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0093_F04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
TCH01_0096_C06.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0034_E02.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0051_B09.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
PBL01_0106_C01.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
TCH01_0019_D08.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
ITT01_0099_C05.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
CLNT1_0019_B11.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LVR01_0076_G10.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
SPL01_0075_G04.b : CTGGCCGGGAGGACGGGGGCGGGGAAGAGCTCCACGGGAAACAGCATCCTGGGCCGGAAG
LNG01_0098_G11.b : atnacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0030_E07.b : ggactatnacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0048_C10.b : nggtgaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0042_F02.b : tttttggctggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0097_D07.b :
THY01_0046_C05.b :
PBL01_0085_D11.b :
20110601C-001409 : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
---------+---------+---------+---------+---------+---------+ 405
SPL01_0099_H10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0083_G01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0070_E05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0072_C10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0071_A09.b : T**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0005_E09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0069_F08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0087_B12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0100_G08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
THY01_0046_G05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0049_F07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0042_D05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0033_C02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0060_G12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0006_D12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0032_D10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPLT1_0061_G05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
UTR01_0101_D10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0140_H03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0014_B05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPLT1_0087_D08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0012_A06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0106_C04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
HTMT1_0041_F08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0072_H03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0066_E01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0088_E12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0109_F05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0137_A10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0035_G08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0021_G02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0004_C06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0050_G10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0070_C10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0143_F05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGGTGTGCCGTGGCGAGCG
CLNT1_0028_H09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0063_C04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
BFLT1_0036_D03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0036_B04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0001_F02.b : C**ACTTTGACTCCGGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0094_D06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0024_C09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
TCH01_0026_D07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0032_C05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0090_A08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVRM1_0095_E01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
OVRM1_0018_A05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
OVR01_0063_A04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCNGTGACCCGAAGCTGTGCCGTGGCNNAGC
SPL01_0052_F09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0061_C12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0097_C05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVRM1_0023_A06.b : C**ACTTTGACTCCGGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0054_H11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
THY01_0001_D02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGCGCCGCGGCGAGCG
SPL01_0060_A12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0006_B10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
THY01_0046_H08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0051_B01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SMG01_0059_D05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0034_B11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
OVRT1_0140_H12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVRM1_0072_C01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0105_D07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVRM1_0109_C07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVRM1_0029_E08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0008_H03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0075_H09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
THY01_0007_B11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0091_E01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVRM1_0030_D02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0083_G08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0050_G06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0017_B11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0033_B06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0043_H08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
THY01_0041_B06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0021_A09.b : CGGGTTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0048_C02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
THY01_0069_G07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0034_A01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0033_B04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0022_C03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PTG01_0050_G10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0008_D07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0013_G01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0033_H12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0021_E09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0068_H04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PTG01_0051_D03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0053_H03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0025_F12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0042_F05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0048_A07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0051_C03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0091_F01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGCGCCGTGGCGAGCG
PBL01_0033_F03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0034_E05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0063_B11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0052_G04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0019_A07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0085_F11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
OVRT1_0017_C06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0025_A05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0065_C05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0050_B04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0057_H09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0039_D02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0084_C04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0078_B05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PTG01_0075_G07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0026_C12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0049_E01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0049_H05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0090_E09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0101_C10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0045_G12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0070_G08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0006_D04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
UTR01_0082_H12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0020_B03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0087_G07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0089_F08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SMG01_0046_D03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0027_D01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0074_D12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0011_H07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0050_G01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0079_H04.b : C**ACTCTGACCCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0037_A11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0142_B05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0073_E05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0044_F07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
OVRT1_0107_A11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0056_C05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0083_D03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0021_D01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0085_D07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0064_E01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SMG01_0019_G10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0038_B06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0071_D05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0015_D04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0068_D09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0086_B03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0074_F05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0064_H05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0014_A03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0012_E12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0048_B02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0069_H06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0006_D09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0044_A11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0047_F08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0019_G06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0045_G07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0046_G07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0041_F12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0056_H03.b : C**ACTTAGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0102_B09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
OVRT1_0113_A07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0065_B12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0042_A08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
OVR01_0028_D06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0098_D12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0073_G07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0088_C03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0053_G12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0074_F08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0080_D04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0036_H03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0067_A09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0077_G02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0079_H11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0008_D02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0019_B11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0089_B01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0041_B11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0022_G09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0078_B12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0071_H08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0067_B05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0008_D10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0079_F06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
OVRT1_0040_H12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0013_D05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0084_B08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0068_H09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0122_H07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
UTR01_0036_A04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0029_E11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0017_H12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0084_B12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0072_F06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0022_F05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0033_B03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
BFLT1_0048_G10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
THY01_0034_A12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0058_C05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0039_F11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0042_E06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0053_D03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0100_A05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0086_F09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0035_E07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
UTR01_0075_B03.b : C**ACTTTGACTACAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0034_A12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0085_H11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
OVRT1_0077_H06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0003_F01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0033_D06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0018_B12.b : C**ACTCTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0019_C01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0085_H04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
THY01_0082_D09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
OVR01_0047_C10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0083_D11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0089_G02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0005_F02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0059_A08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
UTR01_0066_C09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0106_D08.b : C**GCTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0042_C06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0012_G10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0011_D11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0050_H05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0037_G04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0078_A07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0085_E03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0003_C07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0039_H12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0011_G04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0028_G03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0086_E11.b : C**ACTTTGACTCCAGGCTCAGGGCCGCGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0011_F10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0048_B11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0056_B09.b : C**ACTTTGACTTTAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0042_A04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0012_F03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0103_C09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0075_B03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0059_B05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
THY01_0090_G07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0079_A01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0006_E08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0082_G10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0119_A07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0074_F07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0064_B06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
THY01_0202_F03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0042_H06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
OVRT1_0093_G03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0087_D03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0073_D12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
OVRT1_0006_D11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0065_G06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0071_F06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0080_A02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0091_B10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0039_D07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0041_A05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0105_B07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0074_B01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0108_C07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0049_C02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0084_B01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCAAAGCTGTGCCGTGGCGAGCG
SPL01_0082_H08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0065_F11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0008_A10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0063_F04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0068_E07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0015_D01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0034_D04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0032_C10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0075_D04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0044_B02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0101_F02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0061_E07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0073_H08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0079_D05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0092_E04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
OVRT1_0025_F03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0065_A01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0015_H07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0082_H03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCGGAAGCTGTGCCGTGGCGAGCG
PBL01_0053_G02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0067_G04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0096_D02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PTG01_0034_G11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0074_G01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0066_E06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0068_C12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0055_C04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
THY01_0039_B02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0073_C10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0044_H07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
UTR01_0095_E06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0093_H01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0101_E10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0082_C02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0085_A09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0085_F01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0100_E08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0074_H11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0105_G06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
TCH01_0032_B06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0102_A07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0078_E04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0100_D05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0051_B12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0055_B11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0082_A11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0141_G03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0032_H10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0151_A03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0025_E10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0125_D06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0098_H03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
THY01_0110_B12.b : C**ACTTTGACTTCAGGCTCAGGGCCACGTTGGTGACCCGAAGCTGTGCCGTGGCGAGCG
TES01_0096_D02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0023_D02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0087_D11.b : C**ACTTTGACTCCAGGCTCGGGGCCACGTCGGTGACCCGAATCTGTGACGTGGCGAGCG
UTR01_0020_C07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
TES01_0001_F05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0039_F04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0060_D10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGTGCG
PST01_0052_H05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
KDN01_0100_A11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
KDN01_0066_F11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
THY01_0115_G01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0129_C10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
TES01_0039_A05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCAGTGACCCGAAGCTGTGCCGTGGCGAGCG
KDN01_0047_E02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0147_C02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0010_G04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0008_C09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
KDN01_0053_H03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
TES01_0083_D06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0042_C11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
TES01_0014_D09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0032_C06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0014_B02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0030_B04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0009_B02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0038_B10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
KDN01_0008_B05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0070_D07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACTCGAAGCTGTGCCGTGGCGAGCG
PST01_0064_D10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0087_D10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0046_E12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0038_C10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0033_D11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
KDN01_0022_A05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
TES01_0037_H07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
TES01_0084_B01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0061_D01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0020_B03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0029_C10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0067_H01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
TES01_0020_D05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0035_B11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
TES01_0042_B08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCAGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0085_D07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0073_A02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0031_B01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0026_G08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
OVRT1_0115_E07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0044_E04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0051_C07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0059_G09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0080_E06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0059_A12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0059_F02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0041_A02.b : C**ACTTTGACTCTAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0052_D09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0053_H06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0082_E03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0049_B02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0093_H03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0054_F07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0071_B09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0089_B12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0044_C04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0022_F06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
TCH01_0081_E08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
OVRT1_0004_H12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
TES01_0026_A01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPLT1_0069_C05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0105_E03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0022_C09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0048_H08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAACTGTGCCGTGGCGAGCG
SPL01_0053_A11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0041_C08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0027_D07.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0044_G03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVRM1_0153_C11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0046_C02.b : C**ACTTTGATTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0044_C04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0011_G03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0048_C10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0028_G01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0071_F10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0097_E03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0024_C12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0024_A03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0001_E01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0102_A04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
OVRM1_0064_B05.b : C**ACTTTGACTCCNGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0051_E08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCCGTGCCGTGGCGAGCG
SPL01_0041_D10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SMG01_0032_B04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0089_D05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0053_B06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0083_B09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0028_D02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
TCH01_0080_C12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0016_E12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0052_G10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0077_E04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0082_H04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0072_H08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PST01_0039_A01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0005_D01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0061_C02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0045_B04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0063_H09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0005_C12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PCT01_0003_D02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
THY01_0110_D01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
TCH01_0052_D03.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0010_B06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
MLN01_0051_E05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0028_D12.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0045_E01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SMG01_0015_D04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0093_F04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
TCH01_0096_C06.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0034_E02.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0051_B09.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0106_C01.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
TCH01_0019_D08.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
ITT01_0099_C05.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
CLNT1_0019_B11.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LVR01_0076_G10.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0075_G04.b : C**ACTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
LNG01_0098_G11.b : xxxxxTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0030_E07.b : xxxxxTTTGACTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
PBL01_0048_C10.b : xxxxxxxxxxCTCCAGGCTCAGGGCCACGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0042_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCGGTGACCCGAAGCTGTGCCGTGGCGAGCG
SPL01_0097_D07.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0046_C05.b : t
PBL01_0085_D11.b :
20110601C-001409 : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
---------+---------+---------+---------+---------+---------+ 465
SPL01_0099_H10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0083_G01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0070_E05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0072_C10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0071_A09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0005_E09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0069_F08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0087_B12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0100_G08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
THY01_0046_G05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0049_F07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0042_D05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0033_C02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0060_G12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0006_D12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0032_D10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPLT1_0061_G05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
UTR01_0101_D10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0140_H03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0014_B05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPLT1_0087_D08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0012_A06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0106_C04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
HTMT1_0041_F08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0072_H03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0066_E01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0088_E12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0109_F05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0137_A10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0035_G08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0021_G02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0004_C06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0050_G10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0070_C10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0143_F05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0028_H09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0063_C04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
BFLT1_0036_D03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0036_B04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0001_F02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0094_D06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0024_C09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
TCH01_0026_D07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0032_C05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0090_A08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVRM1_0095_E01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
OVRM1_0018_A05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
OVR01_0063_A04.b : GCANGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0052_F09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0061_C12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0097_C05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVRM1_0023_A06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0054_H11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
THY01_0001_D02.b : GCAGGTGGGTGGAGTGGCGAGCGGATGTCCTTGACACCTCGGACCTTTTCAGTTCCGAAG
SPL01_0060_A12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0006_B10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
THY01_0046_H08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0051_B01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SMG01_0059_D05.b : GCAGGTGGGCGGGGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0034_B11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
OVRT1_0140_H12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVRM1_0072_C01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0105_D07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVRM1_0109_C07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVRM1_0029_E08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0008_H03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0075_H09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
THY01_0007_B11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0091_E01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVRM1_0030_D02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0083_G08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0050_G06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0017_B11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0033_B06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0043_H08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
THY01_0041_B06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0021_A09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0048_C02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
THY01_0069_G07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0034_A01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0033_B04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0022_C03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PTG01_0050_G10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0008_D07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0013_G01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0033_H12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0021_E09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0068_H04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PTG01_0051_D03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0053_H03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0025_F12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0042_F05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0048_A07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0051_C03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0091_F01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0033_F03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0034_E05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0063_B11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0052_G04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0019_A07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0085_F11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
OVRT1_0017_C06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0025_A05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0065_C05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0050_B04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0057_H09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0039_D02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0084_C04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0078_B05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PTG01_0075_G07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0026_C12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0049_E01.b : GCAGGAGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0049_H05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0090_E09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0101_C10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0045_G12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0070_G08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0006_D04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
UTR01_0082_H12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0020_B03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0087_G07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0089_F08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SMG01_0046_D03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0027_D01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0074_D12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0011_H07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0050_G01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0079_H04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0037_A11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0142_B05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0073_E05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0044_F07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
OVRT1_0107_A11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0056_C05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0083_D03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0021_D01.b : GCAGGTGGGCGGAGTGGGACGAGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAGG
LVR01_0085_D07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0064_E01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SMG01_0019_G10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0038_B06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0071_D05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0015_D04.b : GCAAGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0068_D09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0086_B03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0074_F05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0064_H05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0014_A03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0012_E12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0048_B02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0069_H06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCT**TCAGCTCCGAAG
PBL01_0006_D09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0044_A11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0047_F08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0019_G06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0045_G07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0046_G07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0041_F12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0056_H03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0102_B09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
OVRT1_0113_A07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0065_B12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0042_A08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
OVR01_0028_D06.b : GCAGGTGGGCGGAGTGGGACGTGGGTGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0098_D12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0073_G07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0088_C03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0053_G12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0074_F08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0080_D04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0036_H03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0067_A09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0077_G02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0079_H11.b : GCAGGTGGGCGGAGTGGGACATGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0008_D02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0019_B11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0089_B01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0041_B11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0022_G09.b : GCAGGTGGGCGGAGTGGGACGTGGATGCCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0078_B12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0071_H08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0067_B05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0008_D10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0079_F06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
OVRT1_0040_H12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0013_D05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACGCCCCGGACCTTTTCAGCTCCGAAG
SPL01_0084_B08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0068_H09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0122_H07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
UTR01_0036_A04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0029_E11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0017_H12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0084_B12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0072_F06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0022_F05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0033_B03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
BFLT1_0048_G10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
THY01_0034_A12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0058_C05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0039_F11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0042_E06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0053_D03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0100_A05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0086_F09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0035_E07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
UTR01_0075_B03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0034_A12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0085_H11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
OVRT1_0077_H06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0003_F01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0033_D06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0018_B12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0019_C01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0085_H04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
THY01_0082_D09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
OVR01_0047_C10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0083_D11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0089_G02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0005_F02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCATCTCCGAAG
PBL01_0059_A08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
UTR01_0066_C09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0106_D08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0042_C06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0012_G10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0011_D11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0050_H05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0037_G04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0078_A07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0085_E03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0003_C07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0039_H12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0011_G04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0028_G03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0086_E11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0011_F10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0048_B11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0056_B09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0042_A04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0012_F03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0103_C09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0075_B03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0059_B05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
THY01_0090_G07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0079_A01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0006_E08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0082_G10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0119_A07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0074_F07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0064_B06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
THY01_0202_F03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0042_H06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
OVRT1_0093_G03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0087_D03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0073_D12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGGCACCCCGGACCTTTTCAGCTCCGAAG
OVRT1_0006_D11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0065_G06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0071_F06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0080_A02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0091_B10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0039_D07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0041_A05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0105_B07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0074_B01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0108_C07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0049_C02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0084_B01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0082_H08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0065_F11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0008_A10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0063_F04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0068_E07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0015_D01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0034_D04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0032_C10.b : GCAGGTGAGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0075_D04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0044_B02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0101_F02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0061_E07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0073_H08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0079_D05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0092_E04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
OVRT1_0025_F03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0065_A01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0015_H07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0082_H03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0053_G02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0067_G04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0096_D02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PTG01_0034_G11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0074_G01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0066_E06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0068_C12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0055_C04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
THY01_0039_B02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0073_C10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0044_H07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
UTR01_0095_E06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0093_H01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0101_E10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0082_C02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0085_A09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0085_F01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0100_E08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0074_H11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0105_G06.b : GCAGGTGGGCGGAGTGGGACGTGGACGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
TCH01_0032_B06.b : GCAGGTGGGCGGAGTGGGACGTGGATGCCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0102_A07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0078_E04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTCTTCAGCTCCGAAG
PBL01_0100_D05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0051_B12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0055_B11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0082_A11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0141_G03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0032_H10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0151_A03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0025_E10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0125_D06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0098_H03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
THY01_0110_B12.b : GGAGGTGGGCGGAGTGGGGAGTGGATGTTCTTGACACCCCGGACCTTTTCAGCTCCGAAG
TES01_0096_D02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0023_D02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0087_D11.b : GCATGAGGGCGGATTGGGACGTGAATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAGG
UTR01_0020_C07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
TES01_0001_F05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0039_F04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0060_D10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0052_H05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
KDN01_0100_A11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
KDN01_0066_F11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
THY01_0115_G01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTTCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0129_C10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
TES01_0039_A05.b : GCATGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
KDN01_0047_E02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0147_C02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0010_G04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0008_C09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
KDN01_0053_H03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
TES01_0083_D06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0042_C11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
TES01_0014_D09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0032_C06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0014_B02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0030_B04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0009_B02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0038_B10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
KDN01_0008_B05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0070_D07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0064_D10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0087_D10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0046_E12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAACTCCGAAG
PST01_0038_C10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0033_D11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
KDN01_0022_A05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
TES01_0037_H07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
TES01_0084_B01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0061_D01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0020_B03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0029_C10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0067_H01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
TES01_0020_D05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0035_B11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCCTGACACCCCGGACCTTTTCAGCTCCGAAG
TES01_0042_B08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0085_D07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0073_A02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0031_B01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0026_G08.b : GCGGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
OVRT1_0115_E07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0044_E04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0051_C07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0059_G09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0080_E06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0059_A12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0059_F02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0041_A02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0052_D09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0053_H06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0082_E03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0049_B02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0093_H03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0054_F07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0071_B09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0089_B12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0044_C04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCCCCGAAG
ITT01_0022_F06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
TCH01_0081_E08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
OVRT1_0004_H12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
TES01_0026_A01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPLT1_0069_C05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0105_E03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGTAG
PST01_0022_C09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0048_H08.b : GCATGTGGGCGGATTGAGACGTGGATGTCCTTGACACCCCGGACCTTTTCATCTCCGAAG
SPL01_0053_A11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0041_C08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0027_D07.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0044_G03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVRM1_0153_C11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0046_C02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0044_C04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACGCCCCGGACCTTTTCAGCTCCGAAG
LNG01_0011_G03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0048_C10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0028_G01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0071_F10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0097_E03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0024_C12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0024_A03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0001_E01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0102_A04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
OVRM1_0064_B05.b : GCGGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0051_E08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0041_D10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SMG01_0032_B04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0089_D05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0053_B06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0083_B09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0028_D02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
TCH01_0080_C12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0016_E12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0052_G10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0077_E04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0082_H04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0072_H08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PST01_0039_A01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0005_D01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0061_C02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0045_B04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0063_H09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0005_C12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PCT01_0003_D02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
THY01_0110_D01.b : GCAGGTGGGCGGAGTGGGGAGTGGATGTTCTTGACACCCCGGACCTTTTCAGCTCCGAAG
TCH01_0052_D03.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0010_B06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
MLN01_0051_E05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0028_D12.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0045_E01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SMG01_0015_D04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0093_F04.b : GCAGGTGGGCGGAGTGGGACGTGGACGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
TCH01_0096_C06.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0034_E02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0051_B09.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0106_C01.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
TCH01_0019_D08.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
ITT01_0099_C05.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
CLNT1_0019_B11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LVR01_0076_G10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0075_G04.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
LNG01_0098_G11.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0030_E07.b : GCAGGCGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
PBL01_0048_C10.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0042_F02.b : GCAGGTGGGCGGAGTGGGACGTGGATGTCCTTGACACCCCGGACCTTTTCAGCTCCGAAG
SPL01_0097_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGACACCCCGGACCTTTTCAGCTCCGAAG
THY01_0046_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0085_D11.b :
20110601C-001409 : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
---------+---------+---------+---------+---------+---------+ 525
SPL01_0099_H10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0083_G01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0070_E05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0072_C10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0071_A09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0005_E09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0069_F08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0087_B12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0100_G08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
THY01_0046_G05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0049_F07.b : TCGCCCGGACAGACCCCGACTGCATGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0042_D05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0033_C02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0060_G12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0006_D12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0032_D10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPLT1_0061_G05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
UTR01_0101_D10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0140_H03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0014_B05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPLT1_0087_D08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0012_A06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0106_C04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
HTMT1_0041_F08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0072_H03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0066_E01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0088_E12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0109_F05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0137_A10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0035_G08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0021_G02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0004_C06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0050_G10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0070_C10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0143_F05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0028_H09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0063_C04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
BFLT1_0036_D03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0036_B04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0001_F02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0094_D06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0024_C09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
TCH01_0026_D07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0032_C05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0090_A08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVRM1_0095_E01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
OVRM1_0018_A05.b : TCNCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCANCCCCCG
OVR01_0063_A04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAAGTCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0052_F09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0061_C12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0097_C05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVRM1_0023_A06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0054_H11.b : TCGCCCGGACAGACCCCGACTGCCAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
THY01_0001_D02.b : TCGCCCGGACAGATCCCGACTGTAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0060_A12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0006_B10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
THY01_0046_H08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0051_B01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SMG01_0059_D05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0034_B11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
OVRT1_0140_H12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVRM1_0072_C01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0105_D07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVRM1_0109_C07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVRM1_0029_E08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0008_H03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0075_H09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
THY01_0007_B11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0091_E01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVRM1_0030_D02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0083_G08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0050_G06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0017_B11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0033_B06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0043_H08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
THY01_0041_B06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0021_A09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0048_C02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
THY01_0069_G07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0034_A01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0033_B04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCACGCAGCCCCCG
SPL01_0022_C03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PTG01_0050_G10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0008_D07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0013_G01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0033_H12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0021_E09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0068_H04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PTG01_0051_D03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0053_H03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0025_F12.b : TCGCCTGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0042_F05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0048_A07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0051_C03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0091_F01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0033_F03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0034_E05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0063_B11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0052_G04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0019_A07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0085_F11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
OVRT1_0017_C06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAACCCCCG
PBL01_0025_A05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0065_C05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0050_B04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0057_H09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0039_D02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0084_C04.b : TCGCCCGGACAGACCCCGGCTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0078_B05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PTG01_0075_G07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0026_C12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0049_E01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0049_H05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0090_E09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0101_C10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0045_G12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0070_G08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0006_D04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
UTR01_0082_H12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0020_B03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCGGCCCCCG
CLNT1_0087_G07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0089_F08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SMG01_0046_D03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0027_D01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0074_D12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0011_H07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0050_G01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0079_H04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0037_A11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0142_B05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0073_E05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0044_F07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
OVRT1_0107_A11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0056_C05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0083_D03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0021_D01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0085_D07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0064_E01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SMG01_0019_G10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0038_B06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0071_D05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0015_D04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCGGCCCCCG
SPL01_0068_D09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAAGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0086_B03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0074_F05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0064_H05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0014_A03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0012_E12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0048_B02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0069_H06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0006_D09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0044_A11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0047_F08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0019_G06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0045_G07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0046_G07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0041_F12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0056_H03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0102_B09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
OVRT1_0113_A07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0065_B12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0042_A08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
OVR01_0028_D06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0098_D12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0073_G07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0088_C03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0053_G12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0074_F08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0080_D04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0036_H03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0067_A09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0077_G02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0079_H11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0008_D02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0019_B11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0089_B01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0041_B11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0022_G09.b : TCGCCCGGACAGGCCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0078_B12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0071_H08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0067_B05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0008_D10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0079_F06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCA
OVRT1_0040_H12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0013_D05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0084_B08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0068_H09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0122_H07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
UTR01_0036_A04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0029_E11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0017_H12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0084_B12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0072_F06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0022_F05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0033_B03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
BFLT1_0048_G10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
THY01_0034_A12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0058_C05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0039_F11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0042_E06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0053_D03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0100_A05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0086_F09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0035_E07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
UTR01_0075_B03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0034_A12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0085_H11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
OVRT1_0077_H06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0003_F01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0033_D06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0018_B12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0019_C01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0085_H04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
THY01_0082_D09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
OVR01_0047_C10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0083_D11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0089_G02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0005_F02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0059_A08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
UTR01_0066_C09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0106_D08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0042_C06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0012_G10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0011_D11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0050_H05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0037_G04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0078_A07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0085_E03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0003_C07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0039_H12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0011_G04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0028_G03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0086_E11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0011_F10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0048_B11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0056_B09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0042_A04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0012_F03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0103_C09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0075_B03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0059_B05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
THY01_0090_G07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0079_A01.b : TCGCCCGGACAGACCTCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0006_E08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0082_G10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0119_A07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0074_F07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0064_B06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
THY01_0202_F03.b : TCGCCCGGGCAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0042_H06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
OVRT1_0093_G03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0087_D03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0073_D12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
OVRT1_0006_D11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0065_G06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0071_F06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0080_A02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0091_B10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0039_D07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0041_A05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0105_B07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0074_B01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0108_C07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0049_C02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0084_B01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0082_H08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0065_F11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0008_A10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0063_F04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0068_E07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0015_D01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0034_D04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0032_C10.b : TCGCCCGGACAGTCCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0075_D04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0044_B02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0101_F02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0061_E07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0073_H08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0079_D05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0092_E04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
OVRT1_0025_F03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0065_A01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0015_H07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0082_H03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0053_G02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTG*TACCTGCTCGCAGCCCCCG
PBL01_0067_G04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0096_D02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PTG01_0034_G11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0074_G01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0066_E06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0068_C12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0055_C04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
THY01_0039_B02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0073_C10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0044_H07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
UTR01_0095_E06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0093_H01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0101_E10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0082_C02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0085_A09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0085_F01.b : TCGCCCGGGCAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0100_E08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0074_H11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0105_G06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
TCH01_0032_B06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0102_A07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0078_E04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0100_D05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0051_B12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0055_B11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0082_A11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0141_G03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0032_H10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0151_A03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0025_E10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0125_D06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0098_H03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
THY01_0110_B12.b : TCGCCCGGACAGACCCCGAATGCAAGGAGAGAGGGCGCTGCTACCTGCTCGCAGCCCCCG
TES01_0096_D02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0023_D02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0087_D11.b : TCGCCCGGACAGACCCCGACTGCTAGGAGAGAGGCCGCTGCTACCTGCTCGGAGCCGCCG
UTR01_0020_C07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
TES01_0001_F05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0039_F04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0060_D10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0052_H05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
KDN01_0100_A11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
KDN01_0066_F11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
THY01_0115_G01.b : TCGCCCGGAAAGAACCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0129_C10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
TES01_0039_A05.b : TCGCCCGGACAGACCCCGACTGCTAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
KDN01_0047_E02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0147_C02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0010_G04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0008_C09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
KDN01_0053_H03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTGCCTGCTCGCAGCCCCCG
TES01_0083_D06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0042_C11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
TES01_0014_D09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0032_C06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0014_B02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0030_B04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACTTGCTCGCAGCCCCCG
PST01_0009_B02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0038_B10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
KDN01_0008_B05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCTG
PST01_0070_D07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0064_D10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0087_D10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0046_E12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0038_C10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0033_D11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
KDN01_0022_A05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
TES01_0037_H07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
TES01_0084_B01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0061_D01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0020_B03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0029_C10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0067_H01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
TES01_0020_D05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0035_B11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
TES01_0042_B08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0085_D07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0073_A02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0031_B01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0026_G08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
OVRT1_0115_E07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0044_E04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0051_C07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0059_G09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0080_E06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0059_A12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0059_F02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0041_A02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0052_D09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0053_H06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0082_E03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0049_B02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0093_H03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGTCCCCG
PBL01_0054_F07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0071_B09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0089_B12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0044_C04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0022_F06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
TCH01_0081_E08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
OVRT1_0004_H12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
TES01_0026_A01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPLT1_0069_C05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0105_E03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0022_C09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0048_H08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGACCCCG
SPL01_0053_A11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0041_C08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0027_D07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0044_G03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVRM1_0153_C11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0046_C02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0044_C04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0011_G03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCC*
MLN01_0048_C10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0028_G01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0071_F10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0097_E03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0024_C12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0024_A03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0001_E01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0102_A04.b : TCGCCCGGACAGACCCCGACTGCAATGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCA
OVRM1_0064_B05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0051_E08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0041_D10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SMG01_0032_B04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0089_D05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0053_B06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0083_B09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0028_D02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
TCH01_0080_C12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0016_E12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0052_G10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0077_E04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0082_H04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0072_H08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PST01_0039_A01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0005_D01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0061_C02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0045_B04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0063_H09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0005_C12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PCT01_0003_D02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
THY01_0110_D01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
TCH01_0052_D03.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0010_B06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
MLN01_0051_E05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0028_D12.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0045_E01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SMG01_0015_D04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0093_F04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
TCH01_0096_C06.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0034_E02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0051_B09.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0106_C01.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
TCH01_0019_D08.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
ITT01_0099_C05.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
CLNT1_0019_B11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LVR01_0076_G10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0075_G04.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
LNG01_0098_G11.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0030_E07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0048_C10.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0042_F02.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
SPL01_0097_D07.b : TCGCCCGGACAGACCCCGACTGCAAGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
THY01_0046_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxGGAGAGAGGCCGCTGCTACCTGCTCGCAGCCCCCG
PBL01_0085_D11.b :
20110601C-001409 : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
---------+---------+---------+---------+---------+---------+ 584
SPL01_0099_H10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0083_G01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0070_E05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0072_C10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0071_A09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0005_E09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0069_F08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0087_B12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0100_G08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
THY01_0046_G05.b : GGCCCCACGCCCTGCTCCTGGTGACCCCAGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0049_F07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0042_D05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
ITT01_0033_C02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0060_G12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0006_D12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCANGACCAGCAG
PBL01_0032_D10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPLT1_0061_G05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
UTR01_0101_D10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0140_H03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
ITT01_0014_B05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPLT1_0087_D08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0012_A06.b : GGCCCCACGCCCTGCTCCTGGGAGCCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0106_C04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
HTMT1_0041_F08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0072_H03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0066_E01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0088_E12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0109_F05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0137_A10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0035_G08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0021_G02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0004_C06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0050_G10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAACAG
LNG01_0070_C10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0143_F05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0028_H09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0063_C04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
BFLT1_0036_D03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0036_B04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0001_F02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
ITT01_0094_D06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0024_C09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
TCH01_0026_D07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0032_C05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0090_A08.b : GGC*CCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCGG
LVRM1_0095_E01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGtcggttcaagggccaagagnagcac
OVRM1_0018_A05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGtncgcncccaggtccaanaacaacctg
OVR01_0063_A04.b : GGGCCCACGCCCTGgttctgggaaccagctgggccgctttccgggcccagaacaacaggc
SPL01_0052_F09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCNCNGCCCNNGACCANCAG
LVR01_0061_C12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAACACCAGCct
SPL01_0097_C05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCANGACCANCAG
LVRM1_0023_A06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGGCCAGGACCAGCAN
SPL01_0054_H11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCGCGGCCCAGGACCAGCAG
THY01_0001_D02.b : GGCCTCCACCCCCGCTCCTGGTGACCC*ACCTGGGCCGCTTCACGGCCaaggcaccgcaa
SPL01_0060_A12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAT
PBL01_0006_B10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*ATCTGGGCCGCTTCACGGCCCAGGACCAGCAG
THY01_0046_H08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0051_B01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SMG01_0059_D05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGGCCAGGACCAGCAG
SPL01_0034_B11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
OVRT1_0140_H12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVRM1_0072_C01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGGCCANGACCAGCAG
SPL01_0105_D07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVRM1_0109_C07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAAGACCAGCAA
LVRM1_0029_E08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0008_H03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0075_H09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCANGACCAGCAG
THY01_0007_B11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0091_E01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVRM1_0030_D02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0083_G08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0050_G06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCANGACCAGCAG
SPL01_0017_B11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0033_B06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCANGACCAGCAG
SPL01_0043_H08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCANGACCAGCAG
THY01_0041_B06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0021_A09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0048_C02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
THY01_0069_G07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0034_A01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGGCCAAGACCATCAC
PBL01_0033_B04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0022_C03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PTG01_0050_G10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0008_D07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0013_G01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0033_H12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0021_E09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0068_H04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PTG01_0051_D03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGTTTCACGGCCCAGGACCAGCAA
SPL01_0053_H03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCANGACCAGCAG
PBL01_0025_F12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0042_F05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0048_A07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0051_C03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0091_F01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0033_F03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0034_E05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCANGACCAGCAG
SPL01_0063_B11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0052_G04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0019_A07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
ITT01_0085_F11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAA
OVRT1_0017_C06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0025_A05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0065_C05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0050_B04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0057_H09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0039_D02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0084_C04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0078_B05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PTG01_0075_G07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0026_C12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0049_E01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0049_H05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0090_E09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0101_C10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0045_G12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0070_G08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0006_D04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
UTR01_0082_H12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0020_B03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0087_G07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0089_F08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SMG01_0046_D03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0027_D01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0074_D12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0011_H07.b : GGCCCCACGCCCTGCTCCTGTGAACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0050_G01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0079_H04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0037_A11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0142_B05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0073_E05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0044_F07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
OVRT1_0107_A11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0056_C05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0083_D03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0021_D01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0085_D07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0064_E01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SMG01_0019_G10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0038_B06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0071_D05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0015_D04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0068_D09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0086_B03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0074_F05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0064_H05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0014_A03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0012_E12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0048_B02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0069_H06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0006_D09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0044_A11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0047_F08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCATGACCAGCAG
CLNT1_0019_G06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0045_G07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0046_G07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0041_F12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0056_H03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0102_B09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
OVRT1_0113_A07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0065_B12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0042_A08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
OVR01_0028_D06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0098_D12.b : GGCCCCACGCCCTGCTCCTGGTGAACC*AACTGGGCCGCTTCACGGCCCAAGACCAACAC
LNG01_0073_G07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0088_C03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0053_G12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0074_F08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0080_D04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCCTCACGGCCCAGGACCAGCAG
SPL01_0036_H03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0067_A09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0077_G02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0079_H11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0008_D02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0019_B11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0089_B01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0041_B11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0022_G09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0078_B12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0071_H08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGTAG
SPL01_0067_B05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0008_D10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0079_F06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
OVRT1_0040_H12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0013_D05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0084_B08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0068_H09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0122_H07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
UTR01_0036_A04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0029_E11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
ITT01_0017_H12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0084_B12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0072_F06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCGG
ITT01_0022_F05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0033_B03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AACTGGGCCGCTTCACGGCCCAGGACCAGCAG
BFLT1_0048_G10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
THY01_0034_A12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0058_C05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0039_F11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0042_E06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0053_D03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0100_A05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0086_F09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0035_E07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
UTR01_0075_B03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0034_A12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0085_H11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
OVRT1_0077_H06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0003_F01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0033_D06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0018_B12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0019_C01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0085_H04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
THY01_0082_D09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
OVR01_0047_C10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0083_D11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0089_G02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0005_F02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0059_A08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
UTR01_0066_C09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0106_D08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0042_C06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0012_G10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0011_D11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0050_H05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0037_G04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0078_A07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0085_E03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0003_C07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0039_H12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0011_G04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0028_G03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0086_E11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0011_F10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0048_B11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0056_B09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
ITT01_0042_A04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
ITT01_0012_F03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0103_C09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0075_B03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0059_B05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
THY01_0090_G07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0079_A01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0006_E08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0082_G10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0119_A07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0074_F07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACAGCCCAGGACCAGCAG
SPL01_0064_B06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
THY01_0202_F03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0042_H06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
OVRT1_0093_G03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0087_D03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0073_D12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
OVRT1_0006_D11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0065_G06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0071_F06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0080_A02.b : GGCCCCACGTCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0091_B10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
ITT01_0039_D07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
ITT01_0041_A05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0105_B07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0074_B01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0108_C07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0049_C02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0084_B01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0082_H08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0065_F11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0008_A10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0063_F04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0068_E07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0015_D01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0034_D04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0032_C10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0075_D04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
ITT01_0044_B02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0101_F02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
ITT01_0061_E07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
ITT01_0073_H08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAT
ITT01_0079_D05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0092_E04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
OVRT1_0025_F03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0065_A01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0015_H07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
ITT01_0082_H03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0053_G02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0067_G04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0096_D02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PTG01_0034_G11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0074_G01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0066_E06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0068_C12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0055_C04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
THY01_0039_B02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0073_C10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
ITT01_0044_H07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
UTR01_0095_E06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
ITT01_0093_H01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0101_E10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
ITT01_0082_C02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0085_A09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0085_F01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0100_E08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0074_H11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0105_G06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
TCH01_0032_B06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0102_A07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0078_E04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0100_D05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
ITT01_0051_B12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0055_B11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
ITT01_0082_A11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0141_G03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0032_H10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0151_A03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0025_E10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0125_D06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0098_H03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
THY01_0110_B12.b : GGCCCCACGCCCTGCTCCTGGTGAACC*AGCTGGGCCGCTTTACGGCCCANGAACAGCAG
TES01_0096_D02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0023_D02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0087_D11.b : GGACCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCACGACCAGCGC
UTR01_0020_C07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
TES01_0001_F05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0039_F04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGGCCAGGACCAGCAA
PBL01_0060_D10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0052_H05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
KDN01_0100_A11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
KDN01_0066_F11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
THY01_0115_G01.b : GGCCCCACGCCCCGCTCCTGGTGACCC*AGCTGGGCCGCTTCACCGCCCAGGAACACAGG
CLNT1_0129_C10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
TES01_0039_A05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAAGACCAGCAG
KDN01_0047_E02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0147_C02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGTCCAGGACCAGCAG
PST01_0010_G04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0008_C09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
KDN01_0053_H03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
TES01_0083_D06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0042_C11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
TES01_0014_D09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0032_C06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0014_B02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0030_B04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0009_B02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0038_B10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
KDN01_0008_B05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0070_D07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0064_D10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0087_D10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0046_E12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0038_C10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0033_D11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
KDN01_0022_A05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCGGGACCAGCAG
TES01_0037_H07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCATGACCAGCAG
TES01_0084_B01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0061_D01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0020_B03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0029_C10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0067_H01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
TES01_0020_D05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCATGACCAGCAG
PST01_0035_B11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
TES01_0042_B08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0085_D07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0073_A02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0031_B01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0026_G08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
OVRT1_0115_E07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0044_E04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCATGACCAACAC
SPL01_0051_C07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0059_G09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0080_E06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0059_A12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0059_F02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0041_A02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0052_D09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0053_H06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0082_E03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0049_B02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
ITT01_0093_H03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0054_F07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0071_B09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0089_B12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0044_C04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
ITT01_0022_F06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
TCH01_0081_E08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
OVRT1_0004_H12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
TES01_0026_A01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCACGACCAACAC
SPLT1_0069_C05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0105_E03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0022_C09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0048_H08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAAGACCAGCAG
SPL01_0053_A11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0041_C08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0027_D07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0044_G03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCATGACCAGCAG
LVRM1_0153_C11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0046_C02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0044_C04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0011_G03.b : ***CCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0048_C10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0028_G01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0071_F10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0097_E03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0024_C12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0024_A03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0001_E01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0102_A04.b : GGCCCCAGGCCCTGCTCCTGGTGACCC*AGCTGcccctcttcattggcgaactgccacag
OVRM1_0064_B05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0051_E08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGC*CAGGACCAGCAG
SPL01_0041_D10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SMG01_0032_B04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0089_D05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0053_B06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0083_B09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0028_D02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
TCH01_0080_C12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0016_E12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0052_G10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0077_E04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0082_H04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0072_H08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PST01_0039_A01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0005_D01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0061_C02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0045_B04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0063_H09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
ITT01_0005_C12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PCT01_0003_D02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
THY01_0110_D01.b : GGCCCCACGCCCTGCTCCTGGTGAACC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
TCH01_0052_D03.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0010_B06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
MLN01_0051_E05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAAAACCANCAG
SPL01_0028_D12.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0045_E01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SMG01_0015_D04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0093_F04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
TCH01_0096_C06.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0034_E02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0051_B09.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0106_C01.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
TCH01_0019_D08.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
ITT01_0099_C05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
CLNT1_0019_B11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LVR01_0076_G10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0075_G04.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
LNG01_0098_G11.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0030_E07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0048_C10.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0042_F02.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
SPL01_0097_D07.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
THY01_0046_C05.b : GGCCCCACGCCCTGCTCCTGGTGACCC*AGCTGGGCCGCTTCACGGCCCAGGACCAGCAG
PBL01_0085_D11.b :
20110601C-001409 : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
---------+---------+---------+---------+---------+---------+ 640
SPL01_0099_H10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0083_G01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0070_E05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0072_C10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0071_A09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0005_E09.b : GCCT*GGAGGGNGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0069_F08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0087_B12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0100_G08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
THY01_0046_G05.b : GCCT*TGTAGGGGGGTGGAAGGCGCTGTT*CGGCGACGGGGTCTCGGCGCACCCGATCGC
PBL01_0049_F07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0042_D05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0033_C02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0060_G12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0006_D12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CNGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0032_D10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPLT1_0061_G05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
UTR01_0101_D10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0140_H03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0014_B05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPLT1_0087_D08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0012_A06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTTTCGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0106_C04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
HTMT1_0041_F08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0072_H03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0066_E01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0088_E12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0109_F05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0137_A10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0035_G08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0021_G02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0004_C06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0050_G10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0070_C10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0143_F05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0028_H09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0063_C04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
BFLT1_0036_D03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0036_B04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0001_F02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0094_D06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0024_C09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
TCH01_0026_D07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0032_C05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0090_A08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVRM1_0095_E01.b : gccgggagggcggtggatgcgctgaccagcggctgggatccggccacagaccctaagcgc
OVRM1_0018_A05.b : gcgcgaagcgggggaggacactcaccggccgcaccaccaccctcggggaggccttgggat
OVR01_0063_A04.b : ctggaaggggggaaagggccttttcggggaaggggttcgggcccacacaattggggtctt
SPL01_0052_F09.b : GCCTnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LVR01_0061_C12.b : gccctggaagggggtgaacgctctcgacgcgagatggggatccctgcacctaacaattgt
SPL01_0097_C05.b : GCCT*GGAGGGGGG**TGATGGCactgngcnnnnanngnncncnncncccaaaatcntgg
LVRM1_0023_A06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGGT*CAAGGACgaagtcgcggcgcacggnatcaa
SPL01_0054_H11.b : GCCT*GGAGGGGGG**TGAAAGATCTGTT*CGGCGACtgggacgccgttcataccatcgc
THY01_0001_D02.b : gtccgtaggggggcgatcgcgctgccccctgacggcgtccccgcgcacccacccctggcc
SPL01_0060_A12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGG*GAAGGGGTCTCGGCGCACACAATGGT
PBL01_0006_B10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCCCACACCATCGT
THY01_0046_H08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0051_B01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACCGGGTCTCCGCGCACACCATCGT
SMG01_0059_D05.b : GCCT*GGAGGGGGG**TGAAGGCGCCGTT*CGGGGACCGGGTCTCGGCGCACACGATCGT
SPL01_0034_B11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*TCGGGACGGGGTCTCGGCGCACACGATCGT
OVRT1_0140_H12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVRM1_0072_C01.b : GCCT*GTGAGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0105_D07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVRM1_0109_C07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CTGGGACAGGGTCTCGGCGCACACGATCGT
LVRM1_0029_E08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0008_H03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0075_H09.b : GCCT*GGAGGGGGG**TGAANGCNCTGTT*CNGGGACGGGGTCTCGGCGCACACGATCGT
THY01_0007_B11.b : GCCTCGGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0091_E01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCAAACTATCGT
LVRM1_0030_D02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0083_G08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0050_G06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0017_B11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0033_B06.b : GCCT*GGGAGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0043_H08.b : GCCT*GGAGGGGGG**TGAAAGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
THY01_0041_B06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0021_A09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0048_C02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACAATCGT
THY01_0069_G07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0034_A01.b : GCCT*GGAGGGGGG**TGAATGCTCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0033_B04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0022_C03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PTG01_0050_G10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0008_D07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0013_G01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0033_H12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0021_E09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0068_H04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PTG01_0051_D03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0053_H03.b : GCCT*GGAGGGGGG**TGAANGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0025_F12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0042_F05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0048_A07.b : GCCT*GGAGGGCGG**TGAAGGCGCTGTT*CGGGGACGGTGTCTCGGCGCACACGATCGT
SPL01_0051_C03.b : GCCT*GGAGGGNGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0091_F01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0033_F03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0034_E05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0063_B11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0052_G04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0019_A07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0085_F11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
OVRT1_0017_C06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0025_A05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0065_C05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0050_B04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0057_H09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0039_D02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0084_C04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0078_B05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PTG01_0075_G07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0026_C12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0049_E01.b : GCCC*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0049_H05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0090_E09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0101_C10.b : GCCT*GGAG*GGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0045_G12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0070_G08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0006_D04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
UTR01_0082_H12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0020_B03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0087_G07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0089_F08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SMG01_0046_D03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0027_D01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0074_D12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0011_H07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0050_G01.b : GCCT*GGAGGGGGG**TGATGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0079_H04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0037_A11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0142_B05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0073_E05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0044_F07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
OVRT1_0107_A11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0056_C05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0083_D03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0021_D01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0085_D07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0064_E01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SMG01_0019_G10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0038_B06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0071_D05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0015_D04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0068_D09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0086_B03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0074_F05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0064_H05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0014_A03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0012_E12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0048_B02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0069_H06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0006_D09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0044_A11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0047_F08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0019_G06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0045_G07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0046_G07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0041_F12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0056_H03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0102_B09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
OVRT1_0113_A07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0065_B12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0042_A08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
OVR01_0028_D06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0098_D12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CCGGGACAGGGTCTCGGCGCACACGATCGT
LNG01_0073_G07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0088_C03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACTGGGTCTCGGCGCACACGATCGT
SPL01_0053_G12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0074_F08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0080_D04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0036_H03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0067_A09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0077_G02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0079_H11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0008_D02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0019_B11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0089_B01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0041_B11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0022_G09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0078_B12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0071_H08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0067_B05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0008_D10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0079_F06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
OVRT1_0040_H12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0013_D05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0084_B08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0068_H09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0122_H07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
UTR01_0036_A04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0029_E11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0017_H12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0084_B12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0072_F06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0022_F05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0033_B03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
BFLT1_0048_G10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
THY01_0034_A12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0058_C05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0039_F11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0042_E06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0053_D03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0100_A05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0086_F09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0035_E07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
UTR01_0075_B03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0034_A12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0085_H11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
OVRT1_0077_H06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0003_F01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0033_D06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0018_B12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0019_C01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGCT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0085_H04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
THY01_0082_D09.b : GCCT*GGAGGGNGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
OVR01_0047_C10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0083_D11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0089_G02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0005_F02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0059_A08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
UTR01_0066_C09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0106_D08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0042_C06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0012_G10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0011_D11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0050_H05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0037_G04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0078_A07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0085_E03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGACGCACACGATCGT
CLNT1_0003_C07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0039_H12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0011_G04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0028_G03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0086_E11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0011_F10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0048_B11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0056_B09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0042_A04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0012_F03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0103_C09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0075_B03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0059_B05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
THY01_0090_G07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0079_A01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCGCACGATCGT
LNG01_0006_E08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0082_G10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0119_A07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0074_F07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0064_B06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGCCTCGGCGCACACGATCGT
THY01_0202_F03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0042_H06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
OVRT1_0093_G03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0087_D03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0073_D12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
OVRT1_0006_D11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGCACGGGGTCTCGGCGCACACGATCGT
PBL01_0065_G06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0071_F06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0080_A02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0091_B10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0039_D07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0041_A05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0105_B07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0074_B01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0108_C07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0049_C02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0084_B01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0082_H08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0065_F11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0008_A10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0063_F04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0068_E07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0015_D01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0034_D04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0032_C10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0075_D04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0044_B02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0101_F02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0061_E07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0073_H08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0079_D05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0092_E04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
OVRT1_0025_F03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0065_A01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0015_H07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0082_H03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0053_G02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0067_G04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0096_D02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PTG01_0034_G11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0074_G01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0066_E06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0068_C12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0055_C04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
THY01_0039_B02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0073_C10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0044_H07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
UTR01_0095_E06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0093_H01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0101_E10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0082_C02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0085_A09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0085_F01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0100_E08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0074_H11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0105_G06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
TCH01_0032_B06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0102_A07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0078_E04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0100_D05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0051_B12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0055_B11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0082_A11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCCCGGCGCACACGATCGT
CLNT1_0141_G03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0032_H10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0151_A03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0025_E10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0125_D06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0098_H03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
THY01_0110_B12.b : GGCC*TGaaagggggtaagggcctgttcggggacgggttttcgggcacacaatgtggttt
TES01_0096_D02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0023_D02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0087_D11.b : GCCT*GGAGGGGGG**AGAATGCGCTGAT*CGGGGACTGGGTCTCGGCGCACACGATCGT
UTR01_0020_C07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
TES01_0001_F05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0039_F04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0060_D10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0052_H05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
KDN01_0100_A11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
KDN01_0066_F11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGCGGTCTCGGCGCACACGATCGT
THY01_0115_G01.b : GCCT*GGAAGGGGG**Taagggcctgtccgggaaggggttcgggcccaaaatactggttt
CLNT1_0129_C10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
TES01_0039_A05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACAGGGTCTCGGCGCACACAATCGT
KDN01_0047_E02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CCGGGACTGGGTCTCGGCGCACACGATCGT
CLNT1_0147_C02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0010_G04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0008_C09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
KDN01_0053_H03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
TES01_0083_D06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0042_C11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
TES01_0014_D09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGATCTCGGCGCACACGATCGT
PST01_0032_C06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0014_B02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0030_B04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0009_B02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0038_B10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
KDN01_0008_B05.b : GCCT*GGAGGGGGG**TGAAGGTGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0070_D07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0064_D10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0087_D10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0046_E12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0038_C10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0033_D11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
KDN01_0022_A05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
TES01_0037_H07.b : GCCC*GGAAGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACCCGATCGT
TES01_0084_B01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0061_D01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0020_B03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0029_C10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0067_H01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
TES01_0020_D05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0035_B11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
TES01_0042_B08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0085_D07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0073_A02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0031_B01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0026_G08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
OVRT1_0115_E07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0044_E04.b : GCCT*GGAGGGGGG**TGAAAGCACTGTT*CTGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0051_C07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0059_G09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0080_E06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0059_A12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0059_F02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0041_A02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0052_D09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0053_H06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0082_E03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0049_B02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0093_H03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0054_F07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0071_B09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0089_B12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0044_C04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0022_F06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
TCH01_0081_E08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGAGACGGGGTCTCGGCGCACACGATCGT
OVRT1_0004_H12.b : GCCT*GGAGGGTGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
TES01_0026_A01.b : GCCT*GGACGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPLT1_0069_C05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0105_E03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0022_C09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0048_H08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CAGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0053_A11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0041_C08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0027_D07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0044_G03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACTATCGT
LVRM1_0153_C11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0046_C02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0044_C04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0011_G03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0048_C10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0028_G01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0071_F10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0097_E03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0024_C12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0024_A03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0001_E01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0102_A04.b : gatcgagagatggattactcgttctctattccatgcatgatggtggatggcccttcttac
OVRM1_0064_B05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0051_E08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0041_D10.b : GCCT*GGAGGGGGG**TGAGGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SMG01_0032_B04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0089_D05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0053_B06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0083_B09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0028_D02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
TCH01_0080_C12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0016_E12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0052_G10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0077_E04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0082_H04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0072_H08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PST01_0039_A01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0005_D01.b : GCCT*GGAGGGGGG**TGAAAGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0061_C02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0045_B04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0063_H09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0005_C12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PCT01_0003_D02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
THY01_0110_D01.b : GCCT*GGAGGGGGG**T**AAGGGCTGTT*CGGGGAGGGGGTCTCGGgccaagatggtgg
TCH01_0052_D03.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0010_B06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
MLN01_0051_E05.b : GCCT*GGAGGGGGG**TGAATGCNCTGTT*CTGGGACGGGGTatcagcccaacagatcat
SPL01_0028_D12.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0045_E01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SMG01_0015_D04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0093_F04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
TCH01_0096_C06.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0034_E02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0051_B09.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0106_C01.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
TCH01_0019_D08.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
ITT01_0099_C05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
CLNT1_0019_B11.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LVR01_0076_G10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0075_G04.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
LNG01_0098_G11.b : GCCT*GGAGGGGGG**NGAAGGCGCTGNN*CNGCGACCGGGGCTCGGCccaagaaacacc
SPL01_0030_E07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0048_C10.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0042_F02.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
SPL01_0097_D07.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
THY01_0046_C05.b : GCCT*GGAGGGGGG**TGAAGGCGCTGTT*CGGGGACGGGGTCTCGGCGCACACGATCGT
PBL01_0085_D11.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGT
20110601C-001409 : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
---------+---------+---------+---------+---------+---------+ 696
SPL01_0099_H10.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCANGACTACGT*GCGCG
SPL01_0083_G01.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0070_E05.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0072_C10.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0071_A09.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCANGACTACGT*GCGCG
PBL01_0005_E09.b : GGTCTTCACCC**GCAGGAGGACCTGGCG*GAAGGCTCCC*TGCANGACTACGT*GCGCG
SPL01_0069_F08.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0087_B12.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0100_G08.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
THY01_0046_G05.b : GGTCTTCCACC*GCAAGGGAGgaccttggcggacggccccccttgcacggacttacatgc
PBL01_0049_F07.b : GGTCTTCACCCCGCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCACGACTACGT*GCGCG
MLN01_0042_D05.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
ITT01_0033_C02.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0060_G12.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TTGCAGACTACTT*GCGCG
MLN01_0006_D12.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0032_D10.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPLT1_0061_G05.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
UTR01_0101_D10.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
CLNT1_0140_H03.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
ITT01_0014_B05.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPLT1_0087_D08.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0012_A06.b : GGTCTTTCACT*CGCAGGAGGACCTGGCG*GAAGGGCTCC*TGCANGACTACGT*GCGCG
LNG01_0106_C04.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
HTMT1_0041_F08.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
MLN01_0072_H03.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0066_E01.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0088_E12.b : GGTCTTTCCCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
LNG01_0109_F05.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAAGACTACGT*GCGCG
CLNT1_0137_A10.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
LNG01_0035_G08.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
LNG01_0021_G02.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
LNG01_0004_C06.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0050_G10.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
LNG01_0070_C10.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
CLNT1_0143_F05.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
CLNT1_0028_H09.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0063_C04.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
BFLT1_0036_D03.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
LNG01_0036_B04.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0001_F02.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
ITT01_0094_D06.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
CLNT1_0024_C09.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
TCH01_0026_D07.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
MLN01_0032_C05.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0090_A08.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
LVRM1_0095_E01.b : atatagccgaaagcggatatggggccgagtttgacgaatcggacggcggcccggggggcg
OVRM1_0018_A05.b : tcgtccgtcaaancgcaccccgcgcgggagtcggcgacgccttagcgnccccgtatcgcc
OVR01_0063_A04.b : taccccccaaggggaaccggggggaggggtccctggggggaattctgggcggaaaaccga
SPL01_0052_F09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LVR01_0061_C12.b : ggtcatccgcggccaaagaaacgggcccgacttcatcacgccacacaaaaccccggaaaa
SPL01_0097_C05.b : ncggcacacnaagggagggaccannggannaattcttgangggtaaaagntcnacagctt
LVRM1_0023_A06.b : gggcttcaccgcgaggaggacctggaggagggtcccggcagaactacatgcgcgacaggg
SPL01_0054_H11.b : ggtcctctaccacacgcagaccggtgctgatgtcgtctctcagactgacggcgccacttc
THY01_0001_D02.b : ttcccccccacggcggacccggcggcagcttccctgcccgaactagtgccctgacagcca
SPL01_0060_A12.b : GGTCTTCACCC*GCtaaggaggaacctgtgtgagggctccctgcaagactacgatgcgct
PBL01_0006_B10.b : GGTCTTCACCC*GCCAGGAGGACCTGGCC*GAGGGCTCCC*TGCTAGACTACCT*GCGCG
THY01_0046_H08.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACCT*GCGCG
MLN01_0051_B01.b : GGTCTTCACCC*GCAAGGGAGACCTGGCG*GAGGGCTCCC*TGACAGACTACCT*GCGCC
SMG01_0059_D05.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GGAGGCTCCC*TGCAGGACTACGT*GCGCC
SPL01_0034_B11.b : GGGCTTCACCC*CGCAGGAAGACCTGGCG*GATGGCTCCC*TGCAGGACTACGT*GCGCG
OVRT1_0140_H12.b : GGTCTTCACCCGCCAGGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
LVRM1_0072_C01.b : GGTCTTCACCC*GC*AGGAGGACCTGGCG*GAGGGCTCC**TGTCAGACTACTT*GCGCG
SPL01_0105_D07.b : GGTCTTCACCC*GCAAGGAGGAACTGGCGGGAGGGCTCCC*TGCAGGACTACGT*GCGCG
LVRM1_0109_C07.b : GGTCTTCACCC*G*AAGGAGGACCTGGCG*GAGAGGTCCC*TGCAGGAATACTT*GCGCG
LVRM1_0029_E08.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0008_H03.b : GGTCTTCACCC*CCAAGGAGGACCTGGCG*GAGGGCTCCC*GGCAGGACTCCTG*GCGCC
SPL01_0075_H09.b : GGTCTTTCCCC*GCAAGGAGGACCTGGCGGGNGGGCTCCC*TGCAGGAATACGTGGCCCT
THY01_0007_B11.b : GGTCTTTCCCC*GCAAGGAGGACCTGGCG*GAGGGTTCCC*TGCACGACTACGT*GCGCT
LNG01_0091_E01.b : GGTCTTCACCC*CCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACTT*GCGCC
LVRM1_0030_D02.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
MLN01_0083_G08.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCATGACTACGT*GCGCG
SPL01_0050_G06.b : GGTCTTTCACC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0017_B11.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0033_B06.b : GGTCTTCACCC*GCCAGGAGGACCTGGCG*GAGGGCTCCC*TGCAAGACTACGT*GCGCG
SPL01_0043_H08.b : GGTCTTCACCC*GCAGGGAG*ACCTGGCG*GAGGGCTCCC*TGCAAGACTACGT*GCGCG
THY01_0041_B06.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0021_A09.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
MLN01_0048_C02.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACCT*GCGCG
THY01_0069_G07.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
MLN01_0034_A01.b : GGTCTTCAGCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCATGACTACAT*GCGCG
PBL01_0033_B04.b : GGCCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0022_C03.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PTG01_0050_G10.b : GGTCTTCACCC*GNCAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0008_D07.b : GGTCTTCACCC*CCAAGGAGGACCTGGCG*GAGGGCTCCC*CTGCAGACTACGT*GCGCG
SPL01_0013_G01.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
MLN01_0033_H12.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCANGACTACGT*GCGCG
SPL01_0021_E09.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0068_H04.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCANGACTACGT*GCGCG
PTG01_0051_D03.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAAGGCTCCC*CGCAGGACTACGT*GCGCG
SPL01_0053_H03.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAAGACTACGT*GCGCG
PBL01_0025_F12.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAAGGCTCCC*TGCAGGACTACGT*GCGCG
MLN01_0042_F05.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0048_A07.b : GGGCTTCACCC*GCAAGGAGGACCTGACG*GAGGGCTCCC*TGCGAGACTACGG*GCGCG
SPL01_0051_C03.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0091_F01.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0033_F03.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCANGACTACGT*GCGCG
PBL01_0034_E05.b : GGTCTTCACCC*GCAAGGGAGACCTGGCG*GAAGGCTCCC*TGCANGACTACGT*GCGCG
SPL01_0063_B11.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0052_G04.b : GGTCTTCNCCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0019_A07.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
ITT01_0085_F11.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
OVRT1_0017_C06.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAAGACTACGT*GCGCG
PBL01_0025_A05.b : GGTCTTTCACC*CGCAGGAGGACCTGGNC*GAAGGCTCCC*TGCANGACTACGT*GCGCG
PBL01_0065_C05.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0050_B04.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0057_H09.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0039_D02.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAAGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0084_C04.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0078_B05.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PTG01_0075_G07.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCANGACTACGT*GCGCG
LVR01_0026_C12.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0049_E01.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0049_H05.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
LVR01_0090_E09.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0101_C10.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0045_G12.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAAGGCTCCC*TGCANGACTACGT*GCGCG
SPL01_0070_G08.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCATGACTACGT*GCGCG
MLN01_0006_D04.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
UTR01_0082_H12.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0020_B03.b : GGTCTTCACC**GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCANGACTACGT*GCGCG
CLNT1_0087_G07.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
LVR01_0089_F08.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACCACGT*GCGCG
SMG01_0046_D03.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0027_D01.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAAGGCTCCC*TGCANGACTACGT*GCGCG
MLN01_0074_D12.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0011_H07.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0050_G01.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0079_H04.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCANGACTACGT*GCGCG
MLN01_0037_A11.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
CLNT1_0142_B05.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCANGACTACGT*GCGCG
PBL01_0073_E05.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
MLN01_0044_F07.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
OVRT1_0107_A11.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0056_C05.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0083_D03.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0021_D01.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCANGACTACGT*GCGCG
LVR01_0085_D07.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
MLN01_0064_E01.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SMG01_0019_G10.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCANGACTACGT*GCGCG
SPL01_0038_B06.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0071_D05.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
MLN01_0015_D04.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCACGACTACGT*GCGCG
SPL01_0068_D09.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0086_B03.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
CLNT1_0074_F05.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0064_H05.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
MLN01_0014_A03.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0012_E12.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCANGACTACGT*GCGCG
PBL01_0048_B02.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCANGACTACGT*GCGCG
SPL01_0069_H06.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0006_D09.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0044_A11.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
MLN01_0047_F08.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
CLNT1_0019_G06.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0045_G07.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
PBL01_0046_G07.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
SPL01_0041_F12.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
CLNT1_0056_H03.b : GGTCTTCACCC*GCAAGGAGGATCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
LVR01_0102_B09.b : GGTCTTCACCC*GCAAGGGGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG
OVRT1_0113_A07.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCANGACTACGT*GCGCG
CLNT1_0065_B12.b : GGTCTTCACCC*GCAAGGAGGACCTGGCG*GAGGGCTCCC*TGCAGGACTACGT*GCGCG