[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-001518

Length: 1,453

Sequence [FASTA format sequence]
ACATAGGCCG TCTTCAGCCG CAGCATCGAG TCGGCCGTCT TCAGCCGCAG CATCGAGTCG
GCCGTCTTCA GCCGCAGCAT CGAGTCGGCT TTCTCAGCTC TTCCTCATCA TTGCTCTACA
ACTCCGAAGA GCAACAGCTG AGACCACCTT GAGAAGAGCA TGGTCCCAGG CCGAGTTCTG
ATGTGGGGGG CCCTCGCCCT GACCGCCGTG ATGAGCGCCT GTGGAGGTGA AGACATTGCG
GCCGACCATG TTGCCTCCTA TGGCTTAAAT GTCTACCAGT CTTACGGTCC CAGCGGCTAT
TATACCCATG AATTTGATGG CGACGAGGAA TTCTACGTGG ACCTGGGGAA GAAGGAGACT
GTCTGGCAGC TGCCTCTGTT TAGCAAATTT AGAAGTTTTG ACCCACAGGG TGCACTGAGG
AACATAGCTA CGGCAAAACA TAATTTGAAC ATCCTGATTA AACGTTCCAA CAACACCGCG
GCTGTCAATC AGGTTCCTGA GGTGACTGTG TTTCCCAAGT CTCCAGTGAT GCTGGGTCAG
CCCAACACCC TCATCTGTCA TGTGGACAAC ATCTTTCCTC CTGTGATCAA CATCACGTGG
TTGAAGAACG GGCACTCTGT CACAGAAGGT TTTTCTGAGA CCAGCTTCCT CTCCAAAAAT
GATCATTCCT TCCTCAAGAT CAGTTATCTC ACCTTCCTCC CTTCTGATGA TGATTTTTAT
GACTGCAAAG TGGAGCACTG GGGCCTGGAT AAGCCACTTC TGAAACACTG GGAACCTGAG
ATTCCAGCCC CCATGTCAGA GCTGACAGAG ACAGTGGTCT GCGCCCTGGG ATTGATCGTG
GGCCTTGTGG GCATCGTGGT GGGCACTGTC TTCATCATTC AAGGCCTACG CTCAGGTGGT
CCCTCTAGAC ACCAAGGGTC CTTGTGAGTC ACACTCCAGA AGGGAAGGTG CACTGCCCGC
CTACAAGAGC TGAAGAGTGG ATGTGCTCAA CGACCTAGAA CTATTTTCTG GCCAAATTCA
TCATATACCT TCTCTCTTCC TACATTCTTC TTCTCACCTC TTCTCTGGAA CTTAAGGTGC
TGTGTCATCT CAGAATTCAT ATGCCCTTGG AATCCTCTTC CTGACCTTCT AGGTTTTTTT
TCTTTTCTCA GTTGTTACCT GTTATGGGAT CTCTGAGATA TCCCACTCGG CTACCTGATC
CCTCAGTGAC CCTAAACTAA TATGTACATG GAAACAATAA ATCACTTCAT GAGGTTTTTG
TACTGAAAAA AAAAAAAACT TTCATCTCAA GGCTGACTAG GACCATGGTC TCTTGCACTT
CAGGCCCATT TAATCTCATT TCCCAGGTTA TGCTTCATGC CCAGTAACAC AGGAGAAGCA
TGTATAGACT GACAATAAAT ATTTTGCTGT CTTAAAAAAA AAAAAAAAAA AAAAAAAAAA
AAAAAAAAAA AAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100507718PREDICTED: HLA class II histocompatibility antigen, DQ alpha 1 chain-like isoform 2 [Homo sapiens]. 394e-109O
Contig/Assembly ProteinLOC100507718PREDICTED: HLA class II histocompatibility antigen, DQ alpha 1 chain-like isoform 1 [Homo sapiens]. 394e-109O
Contig/Assembly ProteinLOC100509457PREDICTED: HLA class II histocompatibility antigen, DQ alpha 1 chain-like isoform 1 [Homo sapiens]. 385e-107O
Contig/Assembly ProteinLOC100509457PREDICTED: HLA class II histocompatibility antigen, DQ alpha 1 chain-like isoform 3 [Homo sapiens]. 385e-107O
Contig/Assembly ProteinHLA-DQA2HLA class II histocompatibility antigen, DQ alpha 2 chain precursor [Homo sapiens]. 383e-106O
Contig/Assembly ProteinHLA-DQA1HLA class II histocompatibility antigen, DQ alpha 1 chain precursor [Homo sapiens]. 381e-106O
Contig/Assembly ProteinLOC100507718PREDICTED: HLA class II histocompatibility antigen, DQ alpha 1 chain-like isoform 3 [Homo sapiens]. 379e-105O
Contig/Assembly ProteinLOC100509457PREDICTED: HLA class II histocompatibility antigen, DQ alpha 1 chain-like isoform 2 [Homo sapiens]. 371e-102O
Contig/Assembly ProteinLOC100507718PREDICTED: HLA class II histocompatibility antigen, DQ alpha 1 chain-like isoform 4 [Homo sapiens]. 3555e-98O
Contig/Assembly ProteinLOC100509457PREDICTED: HLA class II histocompatibility antigen, DQ alpha 1 chain-like isoform 4 [Homo sapiens]. 3455e-95O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinH2-Aahistocompatibility 2, class II antigen A, alpha precursor [Mus musculus]. 3402e-93O
Contig/Assembly ProteinH2-Oahistocompatibility 2, O region alpha locus [Mus musculus]. 2325e-61O
Contig/Assembly ProteinH2-Ea-pshistocompatibility 2, class II antigen E alpha precursor [Mus musculus]. 2172e-56O
Contig/Assembly ProteinH2-DMaclass II histocompatibility antigen, M alpha chain precursor [Mus musculus]. 799e-15O
Contig/Assembly ProteinH2-Obhistocompatibility 2, O region beta locus [Mus musculus]. 70.92e-12O
Contig/Assembly ProteinB2mbeta-2-microglobulin precursor [Mus musculus]. 67.43e-11O
Contig/Assembly ProteinH2-Eb1H-2 class II histocompatibility antigen, I-E beta chain precursor [Mus musculus]. 63.93e-10O
Contig/Assembly ProteinH2-DMb2histocompatibility 2, class II, locus Mb2 [Mus musculus]. 63.54e-10O
Contig/Assembly ProteinH2-DMb1class II histocompatibility antigen, M beta 1 chain precursor [Mus musculus]. 63.54e-10O
Contig/Assembly ProteinH2-Eb2histocompatibility 2, class II antigen E beta2 [Mus musculus]. 63.54e-10O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHLA-DQA1major histocompatibility complex, class II, DQ alpha [Canis lupus familiaris]. 386e-107O
Contig/Assembly ProteinLOC474869PREDICTED: similar to HLA class II histocompatibility antigen, DO alpha chain precursor (MHC class II antigen DOA) (MHC DZ alpha) (MHC DN-alpha) isoform 11 [Canis familiaris]. 2333e-61O
Contig/Assembly ProteinDLA-DRAMHC class II DR alpha chain [Canis lupus familiaris]. 2272e-59O
Contig/Assembly ProteinLOC474869PREDICTED: similar to HLA class II histocompatibility antigen, DO alpha chain precursor (MHC class II antigen DOA) (MHC DZ alpha) (MHC DN-alpha) isoform 10 [Canis familiaris]. 99.86e-21O
Contig/Assembly ProteinHLA-DQB1major histocompatibility complex, class II, DQ beta 1 [Canis lupus familiaris]. 68.22e-11O
Contig/Assembly ProteinHLA-DMAmajor histocompatibility complex, class II, DM alpha [Canis lupus familiaris]. 67.83e-11O
Contig/Assembly ProteinHLA-DRB1DLA class II histocompatibility antigen, DR-1 beta chain precursor [Canis lupus familiaris]. 67.83e-11O
Contig/Assembly ProteinLOC478284PREDICTED: similar to beta-2-microglobulin precursor isoform 2 [Canis familiaris]. 65.51e-10O
Contig/Assembly ProteinLOC478284PREDICTED: similar to beta-2-microglobulin precursor isoform 3 [Canis familiaris]. 65.51e-10O
Contig/Assembly ProteinHLA-DOBmajor histocompatibility complex, class II, DO beta [Canis lupus familiaris]. 60.54e-09O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHLA-DQA1major histocompatibility complex, class II, DQ alpha 5 [Bos taurus]. 376e-104O
Contig/Assembly ProteinBOLA-DQA1major histocompatibility complex, class II, DQ alpha, type 1 [Bos taurus]. 371e-102O
Contig/Assembly ProteinLOC100336394PREDICTED: BOLA-DQA2 protein-like [Bos taurus]. 367e-101O
Contig/Assembly ProteinBOLA-DQA3major histocompatibility complex, class II, DQ alpha, type 3 [Bos taurus]. 3589e-99O
Contig/Assembly ProteinBOLA-DQA2major histocompatibility complex, class II, DQ alpha 2 [Bos taurus]. 3441e-94O
Contig/Assembly ProteinBOLA-DYAmajor histocompatibility complex, class II, DY alpha [Bos taurus]. 3125e-85O
Contig/Assembly ProteinHLA-DOAHLA class II histocompatibility antigen, DO alpha chain [Bos taurus]. 2425e-64O
Contig/Assembly ProteinLOC525727PREDICTED: MHC class II antigen-like [Bos taurus]. 2425e-64O
Contig/Assembly ProteinLOC525727PREDICTED: MHC class II antigen-like [Bos taurus]. 2294e-60O
Contig/Assembly ProteinBOLA-DRAmajor histocompatibility complex, class II, DR alpha [Bos taurus]. 2281e-59O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSLA-DQA1SLA class II histocompatibility antigen, DQ haplotype D alpha chain precursor [Sus scrofa]. 474e-134O
Contig/Assembly ProteinSLA-DQASLA class II histocompatibility antigen, DQ haplotype C alpha chain precursor [Sus scrofa]. 446e-125O
Contig/Assembly ProteinSLAsrc-like-adapter [Sus scrofa]. 2624e-70O
Contig/Assembly ProteinSLA-DRAMHC class II DR-alpha [Sus scrofa]. 2263e-59O
Contig/Assembly ProteinSLA-DMASLA-DM alpha chain [Sus scrofa]. 75.95e-14O
Contig/Assembly ProteinSLA-DOAmajor histocompatibility complex, class II, DO alpha [Sus scrofa]. 75.95e-14O
Contig/Assembly ProteinB2Mbeta-2-microglobulin precursor [Sus scrofa]. 71.21e-12O
Contig/Assembly ProteinSLA-DQB1SLA class II histocompatibility antigen, DQ haplotype C beta chain precursor [Sus scrofa]. 65.96e-11O
Contig/Assembly ProteinSLA-DOBMHC class II, DO beta [Sus scrofa]. 63.92e-10O
Contig/Assembly ProteinLOC100513292PREDICTED: DLA class II histocompatibility antigen, DR-1 beta chain-like [Sus scrofa]. 63.53e-10O


Assembly Members: 452      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
AMP010004F02AMP01_0004_F02.bBW955253 
AMP010076B10AMP01_0076_B10.bBW960454 
AMP010077E01AMP01_0077_E01.bBW960551 
AMP010087C04AMP01_0087_C04.bBW961337 
AMP010093E11AMP01_0093_E11.bBW961867 
AMP010102D12AMP01_0102_D12.bBW962658 
CLNT10019D08CLNT1_0019_D08.bFS658556 
CLNT10021B01CLNT1_0021_B01.bFS658683 
CLNT10025F11CLNT1_0025_F11.bFS659047 
CLNT10027B05CLNT1_0027_B05.bFS659154 
CLNT10029C10CLNT1_0029_C10.bFS659319 
CLNT10031C11CLNT1_0031_C11.bFS659476 
CLNT10032B06CLNT1_0032_B06.bFS659541 
CLNT10036E01CLNT1_0036_E01.bFS659871 
CLNT10042B09CLNT1_0042_B09.bFS660339 
CLNT10052C06CLNT1_0052_C06.bFS661159 
CLNT10054E08CLNT1_0054_E08.bFS661330 
CLNT10055F10CLNT1_0055_F10.bFS661423 
CLNT10059C09CLNT1_0059_C09.bFS661703 
CLNT10059D09CLNT1_0059_D09.bFS661711 
CLNT10063H06CLNT1_0063_H06.bFS662058 
CLNT10068H12CLNT1_0068_H12.bFS662469 
CLNT10071C11CLNT1_0071_C11.bFS662665 
CLNT10071D10CLNT1_0071_D10.bFS662673 
CLNT10075F11CLNT1_0075_F11.bFS663026 
CLNT10078D11CLNT1_0078_D11.b  
CLNT10080B12CLNT1_0080_B12.b  
CLNT10083B02CLNT1_0083_B02.b  
CLNT10083G11CLNT1_0083_G11.b  
CLNT10084C05CLNT1_0084_C05.b  
CLNT10085G11CLNT1_0085_G11.bFS663205 
CLNT10088D07CLNT1_0088_D07.bFS663404 
CLNT10088H05CLNT1_0088_H05.bFS663439 
CLNT10089F10CLNT1_0089_F10.bFS663500 
CLNT10090D02CLNT1_0090_D02.bFS663552 
CLNT10092F05CLNT1_0092_F05.bFS663727 
CLNT10093C01CLNT1_0093_C01.bFS663775 
CLNT10095C12CLNT1_0095_C12.bFS663940 
CLNT10095G05CLNT1_0095_G05.bFS663969 
CLNT10097A05CLNT1_0097_A05.bFS664069 
CLNT10112E08CLNT1_0112_E08.bHX220085 
CLNT10119D03CLNT1_0119_D03.bHX220616 
CLNT10119G01CLNT1_0119_G01.bHX220640 
CLNT10122H12CLNT1_0122_H12.bHX220892 
CLNT10127E08CLNT1_0127_E08.bHX221229 
CLNT10128D05CLNT1_0128_D05.bHX221296 
CLNT10128E04CLNT1_0128_E04.bHX221306 
CLNT10131A11CLNT1_0131_A11.bHX221501 
CLNT10131A12CLNT1_0131_A12.bHX221502 
CLNT10132H04CLNT1_0132_H04.bHX221640 
CLNT10133C05CLNT1_0133_C05.bHX221670 
CLNT10133D01CLNT1_0133_D01.bHX221678 
CLNT10134E01CLNT1_0134_E01.bHX221768 
CLNT10135C09CLNT1_0135_C09.bHX221837 
CLNT10141D09CLNT1_0141_D09.bHX222302 
CLNT10141F03CLNT1_0141_F03.bHX222318 
CLNT10142B11CLNT1_0142_B11.bHX222366 
CLNT10147B09CLNT1_0147_B09.bHX222756 
CLNT10148C05CLNT1_0148_C05.bHX222842 
CLNT10151D11CLNT1_0151_D11.bHX223090 
ILNT10009A10ILNT1_0009_A10.bHX227378 
ILNT10015D06ILNT1_0015_D06.bHX227869 
ILNT10019A08ILNT1_0019_A08.b  
ILNT10037G06ILNT1_0037_G06.bHX229656 
ILNT10042G12ILNT1_0042_G12.b  
ILNT10090A03ILNT1_0090_A03.bHX233914 
ITT010002D12ITT01_0002_D12.bBW976174 
ITT010002H09ITT01_0002_H09.bBW976216 
ITT010004H03ITT01_0004_H03.bBW976394 
ITT010014C07ITT01_0014_C07.bBW977252 
ITT010016A10ITT01_0016_A10.bBW977410 AK398827
ITT010021H03ITT01_0021_H03.bBW977932 
ITT010022A01ITT01_0022_A01.bBW977941 
ITT010025B12ITT01_0025_B12.bBW978239 
ITT010028B10ITT01_0028_B10.bBW978508 
ITT010028D03ITT01_0028_D03.bBW978524 
ITT010028H05ITT01_0028_H05.bBW978572 
ITT010037E01ITT01_0037_E01.bBW979339 
ITT010040B12ITT01_0040_B12.bBW979584 
ITT010041E11ITT01_0041_E11.bBW979707 
ITT010041F05ITT01_0041_F05.bBW979713 
ITT010044H10ITT01_0044_H10.bBW980010 
ITT010047D03ITT01_0047_D03.bBW980143 
ITT010047D06ITT01_0047_D06.bBW980146 
ITT010057F08ITT01_0057_F08.bBW981088 
ITT010060F03ITT01_0060_F03.bBW981354 
ITT010066D11ITT01_0066_D11.bBW981875 
ITT010066E12ITT01_0066_E12.bBW981888 
ITT010066F10ITT01_0066_F10.bBW981898 
ITT010067E11ITT01_0067_E11.bBW981977 
ITT010071B12ITT01_0071_B12.bBW982305 
ITT010072B10ITT01_0072_B10.bBW982392 
ITT010073A08ITT01_0073_A08.bBW982463 
ITT010073A11ITT01_0073_A11.bBW982466 
ITT010073C01ITT01_0073_C01.bBW982478 
ITT010077D08ITT01_0077_D08.bBW982847 
ITT010078C11ITT01_0078_C11.bBW982921 
ITT010080G07ITT01_0080_G07.bBW983140 
ITT010084G07ITT01_0084_G07.bBW983495 
ITT010084H02ITT01_0084_H02.bBW983500 
ITT010085D11ITT01_0085_D11.bBW983550 
ITT010086H05ITT01_0086_H05.bBW983670 AK345232
ITT010087B03ITT01_0087_B03.bBW983691 
ITT010087E05ITT01_0087_E05.bBW983729 
ITT010089F06ITT01_0089_F06.bBW983924 
ITT010091F07ITT01_0091_F07.bBW984104 
ITT010092B05ITT01_0092_B05.bBW984146 
ITT010096C07ITT01_0096_C07.bBW984519 
ITT010097C07ITT01_0097_C07.bBW984610 
ITT010100D10ITT01_0100_D10.bBW984901 
ITT010100G02ITT01_0100_G02.bBW984926 
KDN010013G12KDN01_0013_G12.bFS672207 
KDN010014G12KDN01_0014_G12.bFS672285 
KDN010062B05KDN01_0062_B05.bFS675349 
LNG010002D06LNG01_0002_D06.bBP436357 
LNG010009B05LNG01_0009_B05.bBP434309 
LNG010009F12LNG01_0009_F12.bBP438880 
LNG010016A11LNG01_0016_A11.bBP433836 
LNG010016D03LNG01_0016_D03.bBP436119 
LNG010017F07LNG01_0017_F07.bBP438467 
LNG010019D06LNG01_0019_D06.bBP436372 
LNG010020C07LNG01_0020_C07.bBP435459 
LNG010021A08LNG01_0021_A08.bBP433599 
LNG010023E12LNG01_0023_E12.bBP437882 
LNG010024B08LNG01_0024_B08.bBP434568 
LNG010024B12LNG01_0024_B12.bBP434897 
LNG010026G01LNG01_0026_G01.bBP438977 
LNG010026G07LNG01_0026_G07.bBP439471 
LNG010028G02LNG01_0028_G02.bBP439057 
LNG010035F11LNG01_0035_F11.bBP438820 
LNG010042B09LNG01_0042_B09.bBP434656 
LNG010057B01LNG01_0057_B01.bBP434014 
LNG010062C02LNG01_0062_C02.bBP435075 
LNG010062D12LNG01_0062_D12.bBP436877 
LNG010063B02LNG01_0063_B02.bBP434094 
LNG010063C07LNG01_0063_C07.bBP435486 
LNG010065C12LNG01_0065_C12.bBP435905 
LNG010067H12LNG01_0067_H12.bBP440903 
LNG010071C01LNG01_0071_C01.bBP435006 
LNG010073F10LNG01_0073_F10.bBP438757 AK232063
LNG010076E02LNG01_0076_E02.bBP437059 
LNG010078F11LNG01_0078_F11.bBP438846 
LNG010081E11LNG01_0081_E11.bBP437833 
LNG010084F12LNG01_0084_F12.bBP438930 
LNG010085D12LNG01_0085_D12.bBP436893 
LNG010085H10LNG01_0085_H10.bBP440749 
LNG010087C08LNG01_0087_C08.bBP435591 
LNG010089C01LNG01_0089_C01.bBP435019 
LNG010092C01LNG01_0092_C01.bBP435021 
LNG010094G01LNG01_0094_G01.bBP439025 
LNG010097G03LNG01_0097_G03.bBP439189 
LNG010100E01LNG01_0100_E01.bBP436991 
LNG010104C12LNG01_0104_C12.bBP435934 
LNG010109D02LNG01_0109_D02.bBP436102 
LNG010109E01LNG01_0109_E01.bBP436999 
LVRM10128A01LVRM1_0128_A01.bBP448175 
LVRM10149H04LVRM1_0149_H04.bBP454066 
MLN010007E12MLN01_0007_E12.bCJ008237 
MLN010009H02MLN01_0009_H02.bCJ008428 
MLN010011E07MLN01_0011_E07.bCJ008570 
MLN010019B10MLN01_0019_B10.bCJ009046 
MLN010019G06MLN01_0019_G06.bCJ009096 AK233762
MLN010022F02MLN01_0022_F02.bCJ009328 
MLN010027A09MLN01_0027_A09.bCJ009699 
MLN010032D06MLN01_0032_D06.bCJ010128 
MLN010034D02MLN01_0034_D02.bCJ010288 
MLN010034H02MLN01_0034_H02.b  
MLN010036G02MLN01_0036_G02.bBW963518 
MLN010042B10MLN01_0042_B10.b  
MLN010042F08MLN01_0042_F08.bCJ010972 
MLN010042H12MLN01_0042_H12.bCJ010995 
MLN010048F04MLN01_0048_F04.bCJ011377 
MLN010050G02MLN01_0050_G02.bCJ011552 
MLN010052H09MLN01_0052_H09.bCJ011748 
MLN010056A12MLN01_0056_A12.bCJ012016 
MLN010059A04MLN01_0059_A04.bCJ012247 
MLN010059B02MLN01_0059_B02.bCJ012257 
MLN010060D12MLN01_0060_D12.bBW963660 
MLN010061F07MLN01_0061_F07.bCJ012448 
MLN010062G05MLN01_0062_G05.bCJ012543 
MLN010063D04MLN01_0063_D04.bCJ012599 
MLN010075B05MLN01_0075_B05.bBW963751 
MLN010076A09MLN01_0076_A09.bCJ013641 
MLN010076B05MLN01_0076_B05.bCJ013649 
MLN010083D04MLN01_0083_D04.bCJ014262 
MLN010099D03MLN01_0099_D03.bCJ015614 
OVRM10206E09OVRM1_0206_E09.bBP459148 AK236590
OVRM10206H11OVRM1_0206_H11.bBP462204 
OVRT10016D02OVRT1_0016_D02.bFS687705 
OVRT10043D10OVRT1_0043_D10.bFS689912 
OVRT10045A10OVRT1_0045_A10.bFS690049 
OVRT10069C03OVRT1_0069_C03.bFS692040 
OVRT10103D12OVRT1_0103_D12.bHX235040 
OVRT10119A03OVRT1_0119_A03.bHX236329 
OVRT10145F04OVRT1_0145_F04.bHX238458 
PBL010003D06PBL01_0003_D06.b  
PBL010004F10PBL01_0004_F10.bBP156130 
PBL010005F08PBL01_0005_F08.bBW968771 
PBL010010G08PBL01_0010_G08.bBW969144 
PBL010013E05PBL01_0013_E05.b  
PBL010013H03PBL01_0013_H03.bBW969365 
PBL010017G09PBL01_0017_G09.bBW969541 
PBL010019F05PBL01_0019_F05.bBW969672 
PBL010021C04PBL01_0021_C04.bBW969771 
PBL010022G02PBL01_0022_G02.bBP462429 
PBL010023C05PBL01_0023_C05.bBP155540 
PBL010023E11PBL01_0023_E11.bBP155959 
PBL010024D02PBL01_0024_D02.bBP155683 
PBL010025D12PBL01_0025_D12.bBP155810 
PBL010026F01PBL01_0026_F01.bBP156011 
PBL010027A09PBL01_0027_A09.bBW969918 
PBL010029H09PBL01_0029_H09.bBP156594 
PBL010030D08PBL01_0030_D08.bBP155759 
PBL010040G09PBL01_0040_G09.bBW970456 
PBL010041B04PBL01_0041_B04.bBP155341 
PBL010042H08PBL01_0042_H08.bBW970575 
PBL010044C11PBL01_0044_C11.bBW970684 
PBL010046A12PBL01_0046_A12.bBP155256 
PBL010046D01PBL01_0046_D01.bBP155674 
PBL010046G05PBL01_0046_G05.bBP156284 
PBL010053B03PBL01_0053_B03.bBW971174 
PBL010059B12PBL01_0059_B12.bBP155475 
PBL010061D10PBL01_0061_D10.bBW971687 
PBL010061E09PBL01_0061_E09.bBW971697 
PBL010064D06PBL01_0064_D06.bBW971925 
PBL010069F09PBL01_0069_F09.bBW972355 AK396120
PBL010070A10PBL01_0070_A10.bBP462333 
PBL010073A02PBL01_0073_A02.bBW972614 
PBL010073D06PBL01_0073_D06.bBW972648 
PBL010075B12PBL01_0075_B12.bBW972813 
PBL010077E06PBL01_0077_E06.bBW973012 
PBL010077F02PBL01_0077_F02.bBW973020 
PBL010078D02PBL01_0078_D02.bBW973086 
PBL010081E11PBL01_0081_E11.bBW973380 
PBL010081H03PBL01_0081_H03.bBW973406 
PBL010082C05PBL01_0082_C05.bBW973442 
PBL010083F11PBL01_0083_F11.bBW973568 
PBL010085E01PBL01_0085_E01.bBW973724 
PBL010086G05PBL01_0086_G05.bBW973840 
PBL010086H06PBL01_0086_H06.bBW973853 
PBL010088B03PBL01_0088_B03.b  
PBL010088E01PBL01_0088_E01.bBW973991 
PBL010089F01PBL01_0089_F01.bBW974095 
PBL010091F03PBL01_0091_F03.bBW974271 
PBL010093C06PBL01_0093_C06.bBW974367 
PBL010094C08PBL01_0094_C08.bBW974436 
PBL010095E12PBL01_0095_E12.bBW974534 
PBL010098A03PBL01_0098_A03.bBW974746 AK396178
PBL010098A05PBL01_0098_A05.bBW974747 
PBL010099H01PBL01_0099_H01.bBW974913 
PBL010100A06PBL01_0100_A06.bBW974929 
PBL010103B04PBL01_0103_B04.bBW975208 
PBL010103D03PBL01_0103_D03.bBW975230 
PBL010106A10PBL01_0106_A10.bBW975482 
PBL010106F06PBL01_0106_F06.bBW975537 
PBL010106G10PBL01_0106_G10.bBW975552 
PBL010106G11PBL01_0106_G11.bBW975553 
PST010043H06PST01_0043_H06.bFS700254 
PST010074H02PST01_0074_H02.bFS702698 
PST010077E10PST01_0077_E10.bFS702926 
SMG010023B10SMG01_0023_B10.bFS715253 
SMG010032C06SMG01_0032_C06.bHX239250 
SMG010051F08SMG01_0051_F08.bFS717734 
SMG010099G07SMG01_0099_G07.bFS721814 
SMG010103B07SMG01_0103_B07.bFS722074 
SPL010003E05SPL01_0003_E05.bBP158139 
SPL010004F10SPL01_0004_F10.bBP158626 
SPL010006A12SPL01_0006_A12.bBP156970 
SPL010009H01SPL01_0009_H01.bBP159044 
SPL010010C07SPL01_0010_C07.bBP157506 
SPL010013B10SPL01_0013_B10.bBP157248 
SPL010014C05SPL01_0014_C05.bBP157449 
SPL010016F03SPL01_0016_F03.bBP158435 
SPL010016F06SPL01_0016_F06.bBP158524 
SPL010025H04SPL01_0025_H04.bBP159142 
SPL010026F02SPL01_0026_F02.bBP158414 
SPL010026H11SPL01_0026_H11.bBP159329 
SPL010027D11SPL01_0027_D11.bBP157978 
SPL010028D04SPL01_0028_D04.bBP157778 
SPL010030G05SPL01_0030_G05.bCJ016367 
SPL010032B02SPL01_0032_B02.bCJ016488 
SPL010032C01SPL01_0032_C01.bCJ016498 
SPL010048C07SPL01_0048_C07.bCJ017328 
SPL010048E05SPL01_0048_E05.bCJ017349 
SPL010049C02SPL01_0049_C02.bCJ017415 
SPL010049C09SPL01_0049_C09.bCJ017422 
SPL010052C05SPL01_0052_C05.bCJ017683 
SPL010052D07SPL01_0052_D07.bCJ017696 
SPL010052G05SPL01_0052_G05.bCJ017729 
SPL010054B05SPL01_0054_B05.bCJ017853 
SPL010054B10SPL01_0054_B10.bCJ017858 
SPL010058F07SPL01_0058_F07.bCJ018255 
SPL010060A03SPL01_0060_A03.bCJ018375 
SPL010061B07SPL01_0061_B07.bCJ018477 
SPL010062A11SPL01_0062_A11.bCJ018562 
SPL010062B09SPL01_0062_B09.bCJ018572 
SPL010063A02SPL01_0063_A02.bCJ018647 
SPL010063G11SPL01_0063_G11.bCJ018727 
SPL010070A02SPL01_0070_A02.bCJ019275 
SPL010072A12SPL01_0072_A12.bCJ019465 
SPL010076D10SPL01_0076_D10.bCJ019859 
SPL010082D02SPL01_0082_D02.bCJ020398 
SPL010082E02SPL01_0082_E02.bCJ020410 
SPL010083D07SPL01_0083_D07.bCJ020496 
SPL010090H11SPL01_0090_H11.bCJ021167 
SPL010091H05SPL01_0091_H05.bCJ021253 
SPL010092B03SPL01_0092_B03.bCJ021273 
SPL010092E10SPL01_0092_E10.bCJ021310 
SPL010092H11SPL01_0092_H11.bCJ021345 
SPL010096B06SPL01_0096_B06.bCJ021636 
SPL010097F03SPL01_0097_F03.bCJ021768 
SPL010098E04SPL01_0098_E04.bCJ021846 
SPL010100B02SPL01_0100_B02.bCJ021983 
SPL010100E12SPL01_0100_E12.bCJ022022 
SPL010100F01SPL01_0100_F01.bCJ022023 
SPL010101B04SPL01_0101_B04.bCJ022069 
SPL010103A06SPL01_0103_A06.bCJ022227 
SPL010104C06SPL01_0104_C06.bCJ022334 
SPLT10001C09SPLT1_0001_C09.bHX239298 
SPLT10002F08SPLT1_0002_F08.bHX239397 
SPLT10019A03SPLT1_0019_A03.bHX240633 
SPLT10020A04SPLT1_0020_A04.bHX240708 
SPLT10030B12SPLT1_0030_B12.bHX241499 
SPLT10039D12SPLT1_0039_D12.bHX242230 
SPLT10044D10SPLT1_0044_D10.bHX242625 
SPLT10047G09SPLT1_0047_G09.bHX242890 
SPLT10049D07SPLT1_0049_D07.b  
SPLT10054E10SPLT1_0054_E10.b  
SPLT10066C05SPLT1_0066_C05.b  
SPLT10084E07SPLT1_0084_E07.bHX245752 
SPLT10098F11SPLT1_0098_F11.bHX246864 
TCH010010G01TCH01_0010_G01.bCJ023210 AK397867
TCH010028B03TCH01_0028_B03.bCJ024492 
TCH010043C02TCH01_0043_C02.bCJ025645 
TCH010080G01TCH01_0080_G01.bCJ028239 
TCH010084C09TCH01_0084_C09.bCJ028525 
TCH010084F04TCH01_0084_F04.bCJ028545 
TCH010085H12TCH01_0085_H12.bCJ028657 
TCH010094H11TCH01_0094_H11.bCJ029341 
TCH010096G05TCH01_0096_G05.bCJ029483 
TCH010101A01TCH01_0101_A01.bCJ029792 
TES010003G02TES01_0003_G02.bCJ030203 
TES010006A04TES01_0006_A04.bCJ030366 AK398122
TES010007G08TES01_0007_G08.bCJ030485 
TES010009H12TES01_0009_H12.bCJ030636 
TES010011G06TES01_0011_G06.bCJ030760 
TES010017F12TES01_0017_F12.bCJ031160 
TES010019G02TES01_0019_G02.bCJ031301 
TES010021C02TES01_0021_C02.bCJ031394 
TES010022A12TES01_0022_A12.bCJ031448 
TES010024B08TES01_0024_B08.bFS722179 
TES010038C08TES01_0038_C08.bCJ032492 
TES010042B02TES01_0042_B02.bCJ032698 
TES010051E09TES01_0051_E09.bCJ033269 
TES010051F09TES01_0051_F09.b  
TES010051G08TES01_0051_G08.b  
TES010054A08TES01_0054_A08.b  
TES010056B02TES01_0056_B02.bCJ033541 
TES010056E03TES01_0056_E03.bCJ033571 
TES010057H10TES01_0057_H10.bCJ033673 
TES010059B11TES01_0059_B11.bCJ033759 
TES010074H09TES01_0074_H09.bCJ034786 
TES010076A11TES01_0076_A11.bCJ034871 
TES010076B10TES01_0076_B10.bCJ034879 
TES010084E06TES01_0084_E06.bCJ035435 
TES010087A03TES01_0087_A03.bCJ035601 
TES010088H03TES01_0088_H03.bCJ035724 
TES010093H02TES01_0093_H02.bCJ036066 
TES010101F10TES01_0101_F10.bCJ036647 
TES010109F08TES01_0109_F08.bCJ037217 
TES010110C05TES01_0110_C05.bCJ037257 
THY010001E11THY01_0001_E11.bBP165369 
THY010004D05THY01_0004_D05.bBP163496 
THY010005D05THY01_0005_D05.bBP163497 
THY010007E01THY01_0007_E01.bBP164329 
THY010010A03THY01_0010_A03.bBP159569 
THY010011H05THY01_0011_H05.bBP168531 
THY010015C08THY01_0015_C08.bBP162568 
THY010016C12THY01_0016_C12.bBP162989 
THY010016D12THY01_0016_D12.bBP164230 
THY010018E01THY01_0018_E01.bBP164339 
THY010019E05THY01_0019_E05.bBP164764 
THY010020B04THY01_0020_B04.bBP160904 
THY010020D05THY01_0020_D05.bBP163508 
THY010021A05THY01_0021_A05.bBP159790 
THY010021G02THY01_0021_G02.bBP166947 
THY010022B08THY01_0022_B08.bBP161323 
THY010026B12THY01_0026_B12.bBW976030 
THY010029B05THY01_0029_B05.bBP161013 
THY010029B09THY01_0029_B09.bBP161430 
THY010029C12THY01_0029_C12.bBP162996 
THY010029E02THY01_0029_E02.bBP164455 
THY010029F11THY01_0029_F11.bBP166633 
THY010030F12THY01_0030_F12.bBP166741 
THY010032A09THY01_0032_A09.bBP160196 
THY010036F03THY01_0036_F03.bBP165818 
THY010036G06THY01_0036_G06.bBP167382 
THY010038G12THY01_0038_G12.bBP168017 
THY010040E04THY01_0040_E04.bBP164679 
THY010043D12THY01_0043_D12.bBP164252 
THY010045G06THY01_0045_G06.bBP167388 
THY010045G12THY01_0045_G12.bBP168024 
THY010047B03THY01_0047_B03.bBP160822 
THY010048G01THY01_0048_G01.bBP166860 
THY010050E02THY01_0050_E02.bBP164476 
THY010051D07THY01_0051_D07.bBP163737 
THY010053D07THY01_0053_D07.bBP163739 
THY010054B10THY01_0054_B10.bBP161560 
THY010054G03THY01_0054_G03.bBP167077 
THY010054H04THY01_0054_H04.bBP168464 AK398404
THY010055A09THY01_0055_A09.bBP160216 
THY010057C04THY01_0057_C04.bBP162191 
THY010057F09THY01_0057_F09.bBP166458 
THY010059H12THY01_0059_H12.bBP169328 
THY010061D06THY01_0061_D06.bBP163645 
THY010064C05THY01_0064_C05.bBP162304 
THY010068B09THY01_0068_B09.bBP161466 
THY010068G05THY01_0068_G05.bBP167310 
THY010074E06THY01_0074_E06.bBP164915 
THY010074H07THY01_0074_H07.bBP168803 
THY010076F09THY01_0076_F09.b  
THY010079E01THY01_0079_E01.bBP164388 
THY010080E04THY01_0080_E04.bBP164712 
THY010080H06THY01_0080_H06.b  
THY010084B01THY01_0084_B01.bBP160640 
THY010085D06THY01_0085_D06.b  
THY010089A03THY01_0089_A03.bBP159630 
THY010091C01THY01_0091_C01.bBP161900 
THY010091C08THY01_0091_C08.bBP162624 
THY010092A05THY01_0092_A05.bBP159836 
THY010092D06THY01_0092_D06.bBP163666 
THY010093F07THY01_0093_F07.bBP166279 
THY010096A01THY01_0096_A01.bBP159433 
THY010097F05THY01_0097_F05.bBP166086 
THY010100C03THY01_0100_C03.bBP162119 
THY010103D04THY01_0103_D04.bBP163469 
THY010105E01THY01_0105_E01.bBP164412 
THY010107B08THY01_0107_B08.b  
THY010108F07THY01_0108_F07.b  
THY010111B07THY01_0111_B07.bBP161288 
THY010113C04THY01_0113_C04.bBP162231 
THY010113G10THY01_0113_G10.bBP167869 
THY010114E07THY01_0114_E07.bBP165046 
THY010120G12THY01_0120_G12.bBP168082 
THY010204F01THY01_0204_F01.bBP165677 
THY010204G07THY01_0204_G07.bBP167564 
THY010204H02THY01_0204_H02.bBP168308 
THY010205F01THY01_0205_F01.bBP165678 
THY010205G04THY01_0205_G04.bBP167250 
THY010205H09THY01_0205_H09.bBP169060 
THY010206H01THY01_0206_H01.bBP462636 
THY010207D12THY01_0207_D12.bBP462570 

  

SNPs: 5      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
208G29540.704WNGTG/V
T12600.296TTG/L
347A2320.059WNGAG/E
G40200.941GGG/G
392C3030.077WNACA/T
G39500.923AGA/R
405A39700.928WSCCA/P
G2830.072CCG/P
888A11800.593WSCTA/L
G8100.407CTG/L


Alignment:      TOP

20110601C-001518 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
TCH01_0010_G01.b : nnnttggtaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0039_D12.b :
TES01_0009_H12.b :
THY01_0079_E01.b :
PBL01_0069_F09.b :
PBL01_0098_A03.b :
ITT01_0078_C11.b :
OVRM1_0206_E09.b :
OVRM1_0206_H11.b :
LNG01_0073_F10.b :
THY01_0103_D04.b :
THY01_0029_F11.b :
TES01_0019_G02.b :
THY01_0093_F07.b :
LNG01_0094_G01.b :
TES01_0076_B10.b :
TES01_0021_C02.b :
TES01_0003_G02.b :
ITT01_0092_B05.b :
THY01_0204_F01.b :
LNG01_0089_C01.b :
TES01_0006_A04.b :
SMG01_0023_B10.b :
TES01_0022_A12.b :
THY01_0091_C08.b :
ILNT1_0019_A08.b :
TES01_0088_H03.b :
TES01_0017_F12.b :
THY01_0020_D05.b :
SPL01_0013_B10.b :
THY01_0036_F03.b :
SPL01_0028_D04.b :
PBL01_0040_G09.b :
TES01_0084_E06.b :
OVRT1_0145_F04.b :
SPL01_0062_B09.b :
OVRT1_0043_D10.b :
TES01_0087_A03.b :
LNG01_0024_B12.b :
SPL01_0090_H11.b :
PST01_0077_E10.b :
CLNT1_0083_B02.b :
LNG01_0020_C07.b :
MLN01_0099_D03.b :
PBL01_0098_A05.b :
PBL01_0106_G10.b :
PBL01_0106_F06.b :
CLNT1_0054_E08.b :
MLN01_0076_A09.b :
LNG01_0063_B02.b :
KDN01_0013_G12.b :
CLNT1_0141_D09.b :
SPLT1_0030_B12.b :
TES01_0051_G08.b :
TES01_0076_A11.b :
TES01_0057_H10.b :
CLNT1_0151_D11.b :
CLNT1_0133_C05.b :
PBL01_0017_G09.b :
SPL01_0054_B10.b :
THY01_0022_B08.b :
CLNT1_0119_G01.b :
PBL01_0082_C05.b :
TCH01_0084_C09.b :
ITT01_0014_C07.b :
ITT01_0028_H05.b :
LNG01_0081_E11.b :
LNG01_0085_D12.b :
CLNT1_0032_B06.b :
ILNT1_0090_A03.b :
CLNT1_0093_C01.b :
CLNT1_0027_B05.b :
TCH01_0096_G05.b :
ITT01_0089_F06.b :
PST01_0074_H02.b :
THY01_0105_E01.b :
SPL01_0100_F01.b :
TES01_0074_H09.b :
ITT01_0085_D11.b :
PBL01_0044_C11.b :
THY01_0068_G05.b :
SPLT1_0020_A04.b :
SPL01_0016_F06.b :
SPL01_0060_A03.b :
THY01_0021_A05.b :
SPL01_0014_C05.b :
THY01_0045_G06.b :
SPLT1_0019_A03.b :
AMP01_0102_D12.b : cgcgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0103_B07.b :
AMP01_0093_E11.b : gcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0009_B05.b :
THY01_0080_H06.b :
LNG01_0017_F07.b :
THY01_0091_C01.b :
LNG01_0021_A08.b :
ITT01_0004_H03.b :
CLNT1_0071_C11.b :
ITT01_0057_F08.b :
SPL01_0097_F03.b :
OVRT1_0103_D12.b :
THY01_0205_F01.b :
PBL01_0088_E01.b :
THY01_0029_B05.b :
PBL01_0042_H08.b :
LNG01_0109_E01.b :
LNG01_0016_A11.b :
SPL01_0103_A06.b :
LNG01_0084_F12.b :
PBL01_0073_A02.b :
PBL01_0083_F11.b :
THY01_0111_B07.b :
THY01_0076_F09.b :
THY01_0120_G12.b :
PBL01_0004_F10.b :
MLN01_0034_H02.b :
THY01_0059_H12.b :
LVRM1_0149_H04.b :
THY01_0051_D07.b :
THY01_0048_G01.b :
LVRM1_0128_A01.b :
THY01_0040_E04.b :
PBL01_0003_D06.b :
TES01_0101_F10.b :
THY01_0007_E01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
PBL01_0023_C05.b :
THY01_0043_D12.b :
MLN01_0075_B05.b :
TES01_0110_C05.b :
PBL01_0005_F08.b :
SPL01_0030_G05.b :
SPL01_0063_G11.b :
THY01_0019_E05.b :
SPL01_0026_H11.b :
THY01_0004_D05.b :
THY01_0018_E01.b :
THY01_0005_D05.b : ttccctnttttttttt
THY01_0020_B04.b :
SPL01_0026_F02.b :
SMG01_0099_G07.b :
SMG01_0032_C06.b :
SPL01_0016_F03.b :
THY01_0021_G02.b :
THY01_0001_E11.b :
THY01_0016_D12.b :
THY01_0045_G12.b :
THY01_0010_A03.b : ttttttttttntttttcttnt
THY01_0016_C12.b :
THY01_0011_H05.b :
SPL01_0010_C07.b :
LNG01_0035_F11.b :
MLN01_0034_D02.b :
SPL01_0048_E05.b :
CLNT1_0068_H12.b :
PBL01_0013_E05.b :
CLNT1_0127_E08.b :
PBL01_0019_F05.b :
PBL01_0023_E11.b :
PBL01_0025_D12.b :
LNG01_0024_B08.b :
SPL01_0062_A11.b :
CLNT1_0119_D03.b :
CLNT1_0131_A11.b :
PBL01_0022_G02.b :
CLNT1_0131_A12.b :
CLNT1_0148_C05.b :
ITT01_0091_F07.b :
CLNT1_0135_C09.b :
CLNT1_0141_F03.b :
SPL01_0049_C02.b :
CLNT1_0052_C06.b :
THY01_0047_B03.b :
CLNT1_0128_D05.b :
LNG01_0078_F11.b :
CLNT1_0147_B09.b :
LNG01_0087_C08.b :
PBL01_0024_D02.b :
THY01_0029_C12.b :
LNG01_0085_H10.b :
MLN01_0036_G02.b :
CLNT1_0122_H12.b :
ITT01_0041_E11.b :
PBL01_0026_F01.b :
LNG01_0062_C02.b :
CLNT1_0097_A05.b :
SPL01_0048_C07.b :
LNG01_0023_E12.b :
CLNT1_0142_B11.b :
THY01_0205_H09.b :
LNG01_0026_G01.b :
LNG01_0002_D06.b :
THY01_0038_G12.b :
ITT01_0066_E12.b :
SPL01_0082_D02.b :
SPL01_0082_E02.b :
SPL01_0076_D10.b :
LNG01_0042_B09.b :
THY01_0030_F12.b :
CLNT1_0025_F11.b :
MLN01_0007_E12.b :
CLNT1_0132_H04.b :
ITT01_0025_B12.b :
THY01_0032_A09.b :
SPL01_0100_E12.b :
LNG01_0026_G07.b :
SPL01_0101_B04.b :
THY01_0029_B09.b :
THY01_0089_A03.b :
THY01_0057_F09.b :
LNG01_0097_G03.b :
CLNT1_0088_H05.b :
PBL01_0064_D06.b :
THY01_0053_D07.b :
SPL01_0052_G05.b :
THY01_0092_D06.b :
CLNT1_0095_C12.b :
CLNT1_0095_G05.b :
MLN01_0061_F07.b :
SPL01_0092_E10.b :
THY01_0074_E06.b :
CLNT1_0133_D01.b :
THY01_0080_E04.b :
LNG01_0016_D03.b :
SPL01_0054_B05.b :
THY01_0061_D06.b :
THY01_0204_G07.b :
PBL01_0088_B03.b :
PBL01_0046_D01.b :
PBL01_0021_C04.b :
CLNT1_0092_F05.b :
THY01_0054_H04.b :
CLNT1_0075_F11.b :
SPL01_0003_E05.b :
LNG01_0067_H12.b :
SPL01_0083_D07.b :
SPL01_0092_H11.b :
PBL01_0081_H03.b :
SPL01_0100_B02.b :
THY01_0084_B01.b :
PBL01_0013_H03.b :
PBL01_0061_D10.b :
ITT01_0037_E01.b :
THY01_0205_G04.b :
ITT01_0060_F03.b :
CLNT1_0085_G11.b :
CLNT1_0021_B01.b :
PBL01_0053_B03.b :
THY01_0204_H02.b :
SPL01_0098_E04.b :
CLNT1_0071_D10.b :
SPL01_0070_A02.b :
SPL01_0009_H01.b :
MLN01_0083_D04.b :
PBL01_0059_B12.b :
SPL01_0004_F10.b :
MLN01_0011_E07.b :
PBL01_0041_B04.b :
ITT01_0073_A11.b :
PBL01_0089_F01.b :
SPL01_0032_C01.b :
OVRT1_0069_C03.b :
CLNT1_0089_F10.b :
CLNT1_0063_H06.b :
CLNT1_0019_D08.b :
LNG01_0057_B01.b :
THY01_0054_B10.b :
CLNT1_0055_F10.b :
PBL01_0061_E09.b :
PBL01_0046_G05.b :
MLN01_0076_B05.b :
LNG01_0076_E02.b :
ITT01_0097_C07.b :
PBL01_0027_A09.b :
LNG01_0100_E01.b :
ITT01_0073_A08.b :
LNG01_0104_C12.b :
ITT01_0066_D11.b :
ITT01_0071_B12.b :
ITT01_0084_H02.b :
PBL01_0077_E06.b :
ITT01_0044_H10.b :
ITT01_0100_D10.b :
ITT01_0073_C01.b :
ITT01_0047_D03.b :
ITT01_0072_B10.b :
SPL01_0052_D07.b :
ITT01_0067_E11.b :
PBL01_0095_E12.b :
THY01_0085_D06.b :
PBL01_0103_B04.b :
PBL01_0085_E01.b :
ITT01_0040_B12.b :
ITT01_0087_E05.b :
PBL01_0086_G05.b :
LNG01_0062_D12.b :
MLN01_0048_F04.b :
PBL01_0078_D02.b :
PBL01_0081_E11.b :
ITT01_0028_D03.b :
ITT01_0077_D08.b :
PBL01_0030_D08.b :
PBL01_0091_F03.b :
ITT01_0028_B10.b :
OVRT1_0045_A10.b :
PBL01_0093_C06.b :
CLNT1_0036_E01.b :
PBL01_0106_G11.b :
LNG01_0092_C01.b :
CLNT1_0042_B09.b :
LNG01_0065_C12.b :
TCH01_0084_F04.b :
THY01_0057_C04.b :
MLN01_0009_H02.b :
THY01_0097_F05.b :
LNG01_0109_D02.b :
TCH01_0080_G01.b :
PBL01_0086_H06.b :
LNG01_0071_C01.b :
MLN01_0050_G02.b :
MLN01_0042_F08.b :
MLN01_0042_H12.b :
MLN01_0062_G05.b :
CLNT1_0059_D09.b :
THY01_0096_A01.b :
MLN01_0019_B10.b :
MLN01_0059_A04.b :
TCH01_0028_B03.b :
CLNT1_0090_D02.b :
PBL01_0100_A06.b :
THY01_0064_C05.b :
THY01_0092_A05.b :
THY01_0206_H01.b :
SPL01_0096_B06.b :
PBL01_0094_C08.b :
ITT01_0021_H03.b :
MLN01_0027_A09.b :
THY01_0055_A09.b :
TCH01_0101_A01.b :
SPL01_0104_C06.b :
TCH01_0085_H12.b :
PBL01_0077_F02.b :
CLNT1_0029_C10.b :
ITT01_0087_B03.b :
PBL01_0106_A10.b :
PBL01_0103_D03.b :
ITT01_0047_D06.b :
ITT01_0084_G07.b :
ITT01_0080_G07.b :
ITT01_0002_D12.b :
ITT01_0022_A01.b :
MLN01_0056_A12.b :
ITT01_0066_F10.b :
TCH01_0043_C02.b :
ITT01_0016_A10.b :
THY01_0050_E02.b : catxxxxxx
THY01_0015_C08.b :
PBL01_0010_G08.b :
SPL01_0072_A12.b :
SPLT1_0044_D10.b :
TES01_0056_E03.b :
SPLT1_0084_E07.b :
SPL01_0006_A12.b :
TES01_0042_B02.b :
ILNT1_0037_G06.b :
PBL01_0099_H01.b :
LNG01_0009_F12.b :
SPL01_0032_B02.b :
CLNT1_0080_B12.b :
KDN01_0062_B05.b :
PST01_0043_H06.b :
SPLT1_0001_C09.b :
ITT01_0096_C07.b :
SPL01_0058_F07.b :
SPLT1_0002_F08.b :
CLNT1_0088_D07.b :
MLN01_0032_D06.b :
PBL01_0075_B12.b :
TES01_0051_E09.b :
LNG01_0019_D06.b :
CLNT1_0078_D11.b :
CLNT1_0083_G11.b :
THY01_0113_G10.b :
SMG01_0051_F08.b :
SPL01_0027_D11.b :
THY01_0036_G06.b :
OVRT1_0119_A03.b :
SPL01_0049_C09.b :
CLNT1_0134_E01.b :
THY01_0029_E02.b :
THY01_0054_G03.b :
THY01_0074_H07.b :
SPL01_0091_H05.b :
CLNT1_0084_C05.b :
TES01_0038_C08.b :
MLN01_0052_H09.b :
CLNT1_0059_C09.b :
TES01_0054_A08.b :
THY01_0100_C03.b :
PBL01_0029_H09.b :
CLNT1_0031_C11.b :
TCH01_0094_H11.b :
PBL01_0073_D06.b :
TES01_0011_G06.b :
PBL01_0046_A12.b :
ITT01_0002_H09.b :
PBL01_0070_A10.b :
KDN01_0014_G12.b :
THY01_0114_E07.b :
TES01_0109_F08.b :
CLNT1_0128_E04.b :
TES01_0024_B08.b :
TES01_0093_H02.b :
TES01_0056_B02.b :
TES01_0059_B11.b :
TES01_0007_G08.b :
THY01_0026_B12.b : gxxxxxxxxxxxxx
AMP01_0077_E01.b : aatataggggatacttxxxxxxxxxxxxxxxx
MLN01_0042_B10.b :
SPL01_0025_H04.b :
AMP01_0087_C04.b : ctatatatagggctxxxxxxxx
OVRT1_0016_D02.b :
AMP01_0004_F02.b : aataacgatactaaxxxxxxxxxx
LNG01_0028_G02.b :
THY01_0113_C04.b :
THY01_0068_B09.b :
MLN01_0060_D12.b :
SPL01_0061_B07.b :
SPL01_0063_A02.b :
ITT01_0041_F05.b :
CLNT1_0112_E08.b :
SPL01_0052_C05.b :
ITT01_0100_G02.b :
SPL01_0092_B03.b :
TES01_0051_F09.b :
MLN01_0059_B02.b :
SPLT1_0098_F11.b :
THY01_0207_D12.b :
THY01_0107_B08.b :
THY01_0108_F07.b :
MLN01_0019_G06.b :
ITT01_0086_H05.b :
MLN01_0063_D04.b :
MLN01_0022_F02.b :
LNG01_0063_C07.b :
AMP01_0076_B10.b :
ILNT1_0015_D06.b :
ILNT1_0009_A10.b :
ILNT1_0042_G12.b :
SPLT1_0047_G09.b :
SPLT1_0066_C05.b :
SPLT1_0054_E10.b :
SPLT1_0049_D07.b :
20110601C-001518 : ................ACATAGGCCGTCTTCAGCCGCAGCATCGAGTCGGCCGTCTTCAG
---------+---------+---------+---------+---------+---------+ 44
TCH01_0010_G01.b : xxxxxxxxxxxxxxxxACATAGGCCGTCTTCAGCCGCAGCATCGAGTCGGCCGTCTTCAG
SPLT1_0039_D12.b : nnnnccgcggttagacg
TES01_0009_H12.b :
THY01_0079_E01.b : cctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0069_F09.b : nnnggtgxxx
PBL01_0098_A03.b : nnnnggtgxxx
ITT01_0078_C11.b : nnnnggctaaacaxx
OVRM1_0206_E09.b : agttgtcxxxxxxxxxxxx
OVRM1_0206_H11.b : agttgtcxxxxxxxxxxxx
LNG01_0073_F10.b : agtttgggctggacttgacxxxxxxxxxxxxx
THY01_0103_D04.b :
THY01_0029_F11.b : tttttgttgxxxxxxxxxxxxxxxxxxxxx
TES01_0019_G02.b :
THY01_0093_F07.b : ggggtgcncgggcttaxxxxxxxxxxxxxxxxxx
LNG01_0094_G01.b : tggnttggacggacttgacxx
TES01_0076_B10.b :
TES01_0021_C02.b :
TES01_0003_G02.b :
ITT01_0092_B05.b :
THY01_0204_F01.b : ccttttcgtggactanntagacxxx
LNG01_0089_C01.b : tttttggctgtacttgac
TES01_0006_A04.b :
SMG01_0023_B10.b :
TES01_0022_A12.b :
THY01_0091_C08.b : attxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0019_A08.b :
TES01_0088_H03.b :
TES01_0017_F12.b :
THY01_0020_D05.b : xxxxxxxxxxxxxxx
SPL01_0013_B10.b : atttgggtggxxxxxxxxxxxxxx
THY01_0036_F03.b : xxxxxxxxxxxxxxxxxxx
SPL01_0028_D04.b : ctttttggctgcactactag
PBL01_0040_G09.b :
TES01_0084_E06.b :
OVRT1_0145_F04.b : nnnnccgttcag
SPL01_0062_B09.b : nnnggcttggactatnacx
OVRT1_0043_D10.b : naaatccgttagct
TES01_0087_A03.b :
LNG01_0024_B12.b : ccttttggagccntatanngacxx
SPL01_0090_H11.b : ntttggctagtgacttgacx
PST01_0077_E10.b :
CLNT1_0083_B02.b : nnnttttatcnnnnnnnccgt
LNG01_0020_C07.b : gcxxxxxxxxxxxxxxxxxxxxxx
MLN01_0099_D03.b : nnnnggctagtgacttnacx
PBL01_0098_A05.b :
PBL01_0106_G10.b :
PBL01_0106_F06.b :
CLNT1_0054_E08.b : aatcccgttcagcgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0076_A09.b : nnnaagttgtgac
LNG01_0063_B02.b : nnnggttgtttttgncgcttggact
KDN01_0013_G12.b :
CLNT1_0141_D09.b : nnncctt
SPLT1_0030_B12.b : nnnnnnnnn
TES01_0051_G08.b :
TES01_0076_A11.b :
TES01_0057_H10.b :
CLNT1_0151_D11.b : nnnnnnct
CLNT1_0133_C05.b : nnnnccgttt
PBL01_0017_G09.b :
SPL01_0054_B10.b : nnnnggctaggactt
THY01_0022_B08.b : ggggggxxxxxxxxxxxxxx
CLNT1_0119_G01.b : nntttccgtta
PBL01_0082_C05.b :
TCH01_0084_C09.b : ntttggctagtgac
ITT01_0014_C07.b :
ITT01_0028_H05.b :
LNG01_0081_E11.b : nnnnaagctggactt
LNG01_0085_D12.b : ntttttcgttg
CLNT1_0032_B06.b : gaanccgtctgc
ILNT1_0090_A03.b :
CLNT1_0093_C01.b : nnggcttttnnnngggnnccgt
CLNT1_0027_B05.b : nnccgttt
TCH01_0096_G05.b : nnnnggctaggacttanac
ITT01_0089_F06.b :
PST01_0074_H02.b :
THY01_0105_E01.b :
SPL01_0100_F01.b : nttgcgtttgtgcttaaactgtttttnnnnggccttccgntccgcatggtacttn
TES01_0074_H09.b :
ITT01_0085_D11.b :
PBL01_0044_C11.b :
THY01_0068_G05.b : ctxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0020_A04.b :
SPL01_0016_F06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0060_A03.b : tttgggctagtgactt
THY01_0021_A05.b : tttgcatttxxxxxxxxxxxxxxx
SPL01_0014_C05.b : ctttaxxxxxxxxxxxxxxxx
THY01_0045_G06.b : ttxxxxxxxxxxxxxxxxx
SPLT1_0019_A03.b :
AMP01_0102_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0103_B07.b : n
AMP01_0093_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0009_B05.b : ccatttggctgxxxxxxxxx
THY01_0080_H06.b : gctttatggtggcattctcgttacaggttctggaaca
LNG01_0017_F07.b : ctttttggtgcacxxxxx
THY01_0091_C01.b : gctttttcxxxxxxxxxxxxx
LNG01_0021_A08.b : ggcxxxxxxxxxxxxxxxxx
ITT01_0004_H03.b :
CLNT1_0071_C11.b : gtttccgtc
ITT01_0057_F08.b :
SPL01_0097_F03.b : nnnnggcttgtgactt
OVRT1_0103_D12.b : nnnnccgt
THY01_0205_F01.b : cattttggtggxxxxxxxxxxx
PBL01_0088_E01.b :
THY01_0029_B05.b : ggtgaacctatxxxxxxx
PBL01_0042_H08.b :
LNG01_0109_E01.b : nnnnnggctgga
LNG01_0016_A11.b : ggctttggngncnxxxxxxx
SPL01_0103_A06.b : nnntttgcttgtgacttg
LNG01_0084_F12.b : nnnaatgctg
PBL01_0073_A02.b :
PBL01_0083_F11.b :
THY01_0111_B07.b :
THY01_0076_F09.b : ttggggtgcctxxxxxxxxx
THY01_0120_G12.b :
PBL01_0004_F10.b :
MLN01_0034_H02.b : nnnnnnnnnnn
THY01_0059_H12.b : gctttttgggtgxxxxxxxxxxx
LVRM1_0149_H04.b :
THY01_0051_D07.b : xxxxxxxxxxxxxxxxxxx
THY01_0048_G01.b : tttttggtggcxxxxxxxxxx
LVRM1_0128_A01.b :
THY01_0040_E04.b : ttttttggtgactattataa
PBL01_0003_D06.b :
TES01_0101_F10.b :
THY01_0007_E01.b : nnnnnnnnnnnnnnnnnnnnnnncccctctctcctcttgcctattaxxxxxxxxxxxxxx
PBL01_0023_C05.b :
THY01_0043_D12.b : cttttgggttgacxxxxxxxxx
MLN01_0075_B05.b : agtgattata
TES01_0110_C05.b :
PBL01_0005_F08.b :
SPL01_0030_G05.b : nnnaagctagtgacttn
SPL01_0063_G11.b : nggggctaggacttan
THY01_0019_E05.b : ggcxxxxxxxxxxxxxxxxxx
SPL01_0026_H11.b : cttxxxxxxxxxxxxxxxxxxxx
THY01_0004_D05.b :
THY01_0018_E01.b : tagcatttxxxxxxxxxxxxx
THY01_0005_D05.b : ttttctccctcttnnccctctcccctcttttttctctagcctattaxxxxxxxxxxxxxx
THY01_0020_B04.b : xxxxxxxxxxxxx
SPL01_0026_F02.b : catttggctgxxxxxxxxxxxx
SMG01_0099_G07.b :
SMG01_0032_C06.b : nnnnnn
SPL01_0016_F03.b : ccxxxxxxxxxxxxxxxxxxxxx
THY01_0021_G02.b : gcaxxxxxxxxxxxxxxxxx
THY01_0001_E11.b : tgacxxxxxxx
THY01_0016_D12.b : xxxxxxxxxxxxx
THY01_0045_G12.b : tttttgggtgxxxxxxxxxxx
THY01_0010_A03.b : tccttctcttcttccctttccctccctcccctcctcctagcctattaxxxxxxxxxxxxx
THY01_0016_C12.b : ggcatttxxxxxxxxxxxxxxx
THY01_0011_H05.b : ggcxxxxxxxxxxxxxxxxxx
SPL01_0010_C07.b : tttatgxxxxxxxxxxxxxxxx
LNG01_0035_F11.b : cxxxxxxxxxxxxxxxxxxxx
MLN01_0034_D02.b : nnnnggcttggactatn
SPL01_0048_E05.b : nnnnggctagtgacttn
CLNT1_0068_H12.b : nnggtttttnnnnntccgt
PBL01_0013_E05.b :
CLNT1_0127_E08.b : nccctttnnnnnnnnccgt
PBL01_0019_F05.b :
PBL01_0023_E11.b :
PBL01_0025_D12.b :
LNG01_0024_B08.b : cattttgggtgxxxxxxxxxx
SPL01_0062_A11.b : nnnggcttgtgacttn
CLNT1_0119_D03.b : nnnccacgtt
CLNT1_0131_A11.b : nnnnccctct
PBL01_0022_G02.b :
CLNT1_0131_A12.b : nnnnnccgtt
CLNT1_0148_C05.b : nnnnccgt
ITT01_0091_F07.b :
CLNT1_0135_C09.b : nnnnnccgtt
CLNT1_0141_F03.b : nnnnccgtca
SPL01_0049_C02.b : nnnnnggctagtgacttn
CLNT1_0052_C06.b : nnggcattctnnnngnnccgt
THY01_0047_B03.b : ttxxxxxxxxxxxxxxxxxxx
CLNT1_0128_D05.b : ccctttnnnnnnnnctcgt
LNG01_0078_F11.b : tttttccatgtctatg
CLNT1_0147_B09.b : nnnnccgt
LNG01_0087_C08.b : ggtnggagttcgactt
PBL01_0024_D02.b :
THY01_0029_C12.b : txxxxxxxxxxxxxxxxxxxx
LNG01_0085_H10.b : nnnttgttgttggcctatn
MLN01_0036_G02.b : tttttggcttgtgactt
CLNT1_0122_H12.b : ttttttccgtt
ITT01_0041_E11.b :
PBL01_0026_F01.b :
LNG01_0062_C02.b : nttatnggcttgtactatg
CLNT1_0097_A05.b : nntttttttttnnnnncccc
SPL01_0048_C07.b : nnnnggcttggactatn
LNG01_0023_E12.b : gcttttggagccnxxxxxxxx
CLNT1_0142_B11.b : nnnnnccgt
THY01_0205_H09.b : gcxxxxxxxxxxxxxxxxxxxxx
LNG01_0026_G01.b : ttggggcattaxxxxxxxxxxxxx
LNG01_0002_D06.b : ccxxxxxxxxxxxxxxxxxxxxx
THY01_0038_G12.b : tgggtgxxxxxxxxxxxx
ITT01_0066_E12.b :
SPL01_0082_D02.b : nnnnggctagtgacttn
SPL01_0082_E02.b : nnnnggcttgtgacttn
SPL01_0076_D10.b : ntggctaggactatn
LNG01_0042_B09.b : tgccttccccctgcttagtgacntataga
THY01_0030_F12.b : ctttttggttgxxxxxxxxxxx
CLNT1_0025_F11.b : ntttccgt
MLN01_0007_E12.b : nnnnttcttggactt
CLNT1_0132_H04.b : nnnnccgtt
ITT01_0025_B12.b :
THY01_0032_A09.b : tgggggxxxxxxxxxxxx
SPL01_0100_E12.b : ntttgcttggactatn
LNG01_0026_G07.b : ccxxxxxxxxxxxxxxxxx
SPL01_0101_B04.b : nnnnnggcttgtgacttn
THY01_0029_B09.b : tggtggacxxxxxxxxxx
THY01_0089_A03.b : ggcttttaggtgcctatanngac
THY01_0057_F09.b : ggtxxxxxxxxxxxxxxx
LNG01_0097_G03.b : tttttttgttggactt
CLNT1_0088_H05.b : nngggtcttnnnnnnccccta
PBL01_0064_D06.b :
THY01_0053_D07.b : txxxxxxxxxxxxxxxxxxxx
SPL01_0052_G05.b : nnnccgctagtgacttn
THY01_0092_D06.b : gtgaggtcccnaagctttgtgxxxxxxxxxx
CLNT1_0095_C12.b : gttttccgt
CLNT1_0095_G05.b : nngcttttnnnngggactcgt
MLN01_0061_F07.b : tttggactatn
SPL01_0092_E10.b : nnnggcttgga
THY01_0074_E06.b : ctttttcgtgcacxxxxxxxxx
CLNT1_0133_D01.b : nnnnnccgtt
THY01_0080_E04.b : ccxxxxxxxxxxxxxxxxxxxx
LNG01_0016_D03.b : tttttggtgcacxxxxxxxx
SPL01_0054_B05.b : nnnnggctagtgacttn
THY01_0061_D06.b : gxxxxxxxxxxxxxxxxxx
THY01_0204_G07.b : ctttttggtgcacxxxxxxxxxx
PBL01_0088_B03.b :
PBL01_0046_D01.b :
PBL01_0021_C04.b :
CLNT1_0092_F05.b : nggccccgt
THY01_0054_H04.b : gctxxxxxxxxxxxxxxxxxxxx
CLNT1_0075_F11.b : ngtttccgt
SPL01_0003_E05.b : cttttgctgacxxxxxxxxxx
LNG01_0067_H12.b : ntttttgctgg
SPL01_0083_D07.b : nnggcttggacttan
SPL01_0092_H11.b : nnttggctagtgactt
PBL01_0081_H03.b :
SPL01_0100_B02.b : nncccttttnnnntgcttggtacttg
THY01_0084_B01.b : cxxxxxxxxxxxxxxxxxxxx
PBL01_0013_H03.b :
PBL01_0061_D10.b :
ITT01_0037_E01.b :
THY01_0205_G04.b : cxxxxxxxxxxxxxxxxxxx
ITT01_0060_F03.b :
CLNT1_0085_G11.b : ngggttttttnnnaactcctt
CLNT1_0021_B01.b : ngtctttnnnnnnnccgt
PBL01_0053_B03.b :
THY01_0204_H02.b : gctxxxxxxxxxxxxxxxxxxx
SPL01_0098_E04.b : nnnnggctagtgacttn
CLNT1_0071_D10.b : gaatccgt
SPL01_0070_A02.b : nnnnggctagtgacttn
SPL01_0009_H01.b : ctttatggtgxxxxxxxxxx
MLN01_0083_D04.b : nnnnggctaggactatn
PBL01_0059_B12.b :
SPL01_0004_F10.b : gcaactggtgxxxxxxxxxxxx
MLN01_0011_E07.b : nnnaactggactt
PBL01_0041_B04.b :
ITT01_0073_A11.b :
PBL01_0089_F01.b :
SPL01_0032_C01.b : nnnnaagctagtgacttn
OVRT1_0069_C03.b : nnnnnccga
CLNT1_0089_F10.b : ntttccgt
CLNT1_0063_H06.b : nntttcgtt
CLNT1_0019_D08.b : nnnccttc
LNG01_0057_B01.b : nccgctttnnttcggctggactt
THY01_0054_B10.b : cttttggtggxxxxxxxxxx
CLNT1_0055_F10.b : cttctttnnggnattccgt
PBL01_0061_E09.b :
PBL01_0046_G05.b :
MLN01_0076_B05.b : ttttgggttggacttg
LNG01_0076_E02.b : nnnnaagctg
ITT01_0097_C07.b :
PBL01_0027_A09.b :
LNG01_0100_E01.b : nnnnnnggctggactt
ITT01_0073_A08.b :
LNG01_0104_C12.b : nnnnaagctggtactt
ITT01_0066_D11.b :
ITT01_0071_B12.b :
ITT01_0084_H02.b :
PBL01_0077_E06.b :
ITT01_0044_H10.b :
ITT01_0100_D10.b :
ITT01_0073_C01.b :
ITT01_0047_D03.b :
ITT01_0072_B10.b :
SPL01_0052_D07.b : nnnnggcttgga
ITT01_0067_E11.b :
PBL01_0095_E12.b :
THY01_0085_D06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0103_B04.b :
PBL01_0085_E01.b :
ITT01_0040_B12.b :
ITT01_0087_E05.b :
PBL01_0086_G05.b :
LNG01_0062_D12.b : nnttggtttttcggcgcatggactt
MLN01_0048_F04.b : nnnnggcttgtgacttn
PBL01_0078_D02.b :
PBL01_0081_E11.b :
ITT01_0028_D03.b :
ITT01_0077_D08.b :
PBL01_0030_D08.b :
PBL01_0091_F03.b :
ITT01_0028_B10.b :
OVRT1_0045_A10.b : ggggccct
PBL01_0093_C06.b :
CLNT1_0036_E01.b : atttacgtt
PBL01_0106_G11.b :
LNG01_0092_C01.b : tttttggttggactt
CLNT1_0042_B09.b : aatccgttc
LNG01_0065_C12.b : nttcggcgctggacttg
TCH01_0084_F04.b : nnnnggctagtgactt
THY01_0057_C04.b : tggggtgcactattagxx
MLN01_0009_H02.b : nnnttttctggactt
THY01_0097_F05.b : ggctxxxxxxxxxxxxxxxxxx
LNG01_0109_D02.b : nnnnnccttggacttg
TCH01_0080_G01.b : nnnnggctagtgactt
PBL01_0086_H06.b :
LNG01_0071_C01.b : nncctctcttntnnanntttnnnnggatggactt
MLN01_0050_G02.b : nnnnggcttgtgacttn
MLN01_0042_F08.b : nnnnggctagtgacttn
MLN01_0042_H12.b : cttggctaggactatn
MLN01_0062_G05.b : nnnggctagtgacttn
CLNT1_0059_D09.b : nnnnccgt
THY01_0096_A01.b : ggtctxxxxxxxxxxxxxxxxxx
MLN01_0019_B10.b : ntagnnggcttgtgactt
MLN01_0059_A04.b : nnnnaagctagtgacttn
TCH01_0028_B03.b : ntttgggctgtgacttna
CLNT1_0090_D02.b : nggcgttttnnngacccgt
PBL01_0100_A06.b :
THY01_0064_C05.b : atggxxxxxxxxxxxxxxxxx
THY01_0092_A05.b : gtgtggttgtacagcttcgtgxxxxxxxxx
THY01_0206_H01.b : gcatxxxxxxxxxxxxxxxxxxx
SPL01_0096_B06.b : nnnaatgcttgtgacttnac
PBL01_0094_C08.b :
ITT01_0021_H03.b :
MLN01_0027_A09.b : nnnggctagtgacttn
THY01_0055_A09.b : gtggtxxxxxxxxxxxxxxx
TCH01_0101_A01.b : nnnnggctagtg
SPL01_0104_C06.b : nnnnnggcttggactat
TCH01_0085_H12.b : ntttagctagtgacttn
PBL01_0077_F02.b :
CLNT1_0029_C10.b : ntgttttnnnnnnntnagt
ITT01_0087_B03.b :
PBL01_0106_A10.b :
PBL01_0103_D03.b :
ITT01_0047_D06.b :
ITT01_0084_G07.b :
ITT01_0080_G07.b :
ITT01_0002_D12.b :
ITT01_0022_A01.b :
MLN01_0056_A12.b : nnngggtagtgacttg
ITT01_0066_F10.b :
TCH01_0043_C02.b : nnnnnccttgtgacttn
ITT01_0016_A10.b :
THY01_0050_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0015_C08.b : xxxxxxxxxxxx
PBL01_0010_G08.b : nccgtatannnggataaacagctggaxxxxxxxxxxxxxxxxxx
SPL01_0072_A12.b : nnnnggcttgtgacttnac
SPLT1_0044_D10.b :
TES01_0056_E03.b :
SPLT1_0084_E07.b :
SPL01_0006_A12.b : cctxxxxxxxxxxxxxxxxx
TES01_0042_B02.b :
ILNT1_0037_G06.b :
PBL01_0099_H01.b :
LNG01_0009_F12.b : cgccxxxxxxxxxxxxxxxxx
SPL01_0032_B02.b : ntttggcttgtgac
CLNT1_0080_B12.b : nnnnaaatattnnnngnnnccgt
KDN01_0062_B05.b :
PST01_0043_H06.b :
SPLT1_0001_C09.b :
ITT01_0096_C07.b :
SPL01_0058_F07.b : nnnnggctaggactt
SPLT1_0002_F08.b :
CLNT1_0088_D07.b : nnnaattcttnnnggnnn
MLN01_0032_D06.b : natagggnnggctgtgac
PBL01_0075_B12.b :
TES01_0051_E09.b :
LNG01_0019_D06.b : gctttatxxxxxxxxxx
CLNT1_0078_D11.b : nnnnttttttnnnggaaccg
CLNT1_0083_G11.b : nnnttttagtnnnnnnnncct
THY01_0113_G10.b :
SMG01_0051_F08.b :
SPL01_0027_D11.b : cxxxxxxxxxxxxxxxxxx
THY01_0036_G06.b : ggtggacctatxx
OVRT1_0119_A03.b : ncgt
SPL01_0049_C09.b : nnnnggctagtgactt
CLNT1_0134_E01.b : nttttcc
THY01_0029_E02.b : ttxxxxxxxxxxxxxxx
THY01_0054_G03.b : cxxxxxxxxxxxxxxxxx
THY01_0074_H07.b : ctxxxxxxxxxxxxxxxxx
SPL01_0091_H05.b : nnnttgctaggactatgacxxxxxxxxxxxxxxxxxxxxx
CLNT1_0084_C05.b : nntttcgtnnnnnnnccg
TES01_0038_C08.b :
MLN01_0052_H09.b : nnttagtgnnnggcttgtgacttnacxx
CLNT1_0059_C09.b : nntt
TES01_0054_A08.b :
THY01_0100_C03.b : gctttanggtgactanntag
PBL01_0029_H09.b :
CLNT1_0031_C11.b : nttcttttnnnnnnnnc
TCH01_0094_H11.b : nnnaagctagtgac
PBL01_0073_D06.b :
TES01_0011_G06.b :
PBL01_0046_A12.b :
ITT01_0002_H09.b :
PBL01_0070_A10.b :
KDN01_0014_G12.b :
THY01_0114_E07.b :
TES01_0109_F08.b :
CLNT1_0128_E04.b : nnccgcttnnnnnnnnnnc
TES01_0024_B08.b :
TES01_0093_H02.b :
TES01_0056_B02.b :
TES01_0059_B11.b :
TES01_0007_G08.b :
THY01_0026_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0077_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0042_B10.b : ct
SPL01_0025_H04.b : nnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0087_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0016_D02.b :
AMP01_0004_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0028_G02.b : cc
THY01_0113_C04.b :
THY01_0068_B09.b : ctxxxxxx
MLN01_0060_D12.b :
SPL01_0061_B07.b : nnnn
SPL01_0063_A02.b : tttt
ITT01_0041_F05.b :
CLNT1_0112_E08.b :
SPL01_0052_C05.b : nnn
ITT01_0100_G02.b :
SPL01_0092_B03.b : nnnn
TES01_0051_F09.b :
MLN01_0059_B02.b :
SPLT1_0098_F11.b :
THY01_0207_D12.b :
THY01_0107_B08.b :
THY01_0108_F07.b :
MLN01_0019_G06.b :
ITT01_0086_H05.b :
MLN01_0063_D04.b :
MLN01_0022_F02.b :
LNG01_0063_C07.b :
AMP01_0076_B10.b :
ILNT1_0015_D06.b :
ILNT1_0009_A10.b :
ILNT1_0042_G12.b :
SPLT1_0047_G09.b :
SPLT1_0066_C05.b :
SPLT1_0054_E10.b :
SPLT1_0049_D07.b :
20110601C-001518 : CCGCAGCATCGAGTCGGCCGTCTTCAGCCGCAGCATCGAGTCGGCTTTCTCAGCT*CTTC
---------+---------+---------+---------+---------+---------+ 103
TCH01_0010_G01.b : CCGCAGCATCGAGTCGGCCGTCTTCAGCCGCAGCATCGAGTCGGCCTTGTTGGC**C*TA
SPLT1_0039_D12.b : ccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCTTTCTCAGCTCCATC
TES01_0009_H12.b : attttgctgtggctctggtctggCTTTCTCAGCTCCATC
THY01_0079_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCTTTCTCAGCTCCATC
PBL01_0069_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCTCAGCTCCATC
PBL01_0098_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCCAGCTCCATC
ITT01_0078_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctttTTTCTCAGTTCCATC
OVRM1_0206_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgttgcctacTGGC**CTAC
OVRM1_0206_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgttgcctacTGGC**CTAC
LNG01_0073_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggactTGGC**CTAC
THY01_0103_D04.b : gttgtcaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCTAC
THY01_0029_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtttaCTGG
TES01_0019_G02.b : tggctcTGG
THY01_0093_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAC
LNG01_0094_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggTGG
TES01_0076_B10.b : tttctgctgtgG
TES01_0021_C02.b : nttttcgctgtggctC
TES01_0003_G02.b : tttctgctgtggctC
ITT01_0092_B05.b : nnnggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtG
THY01_0204_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
LNG01_0089_C01.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaG
TES01_0006_A04.b : ttttgtcgctgtggctC
SMG01_0023_B10.b : ggtttttannnnggctaaagcagcggtccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0022_A12.b : gcgttggct
THY01_0091_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0019_A08.b : ntttgaaggtagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxg
TES01_0088_H03.b : tttcctgctgtggctc
TES01_0017_F12.b : cgctgtggct
THY01_0020_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0013_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0036_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0028_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0040_G09.b : nggtgcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0084_E06.b : ttttcctgctgttgctctg
OVRT1_0145_F04.b : ctgtngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0062_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0043_D10.b : gtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0087_A03.b : nnnnaactgcggtggcta
LNG01_0024_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0090_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0077_E10.b : nncctgctgttgc
CLNT1_0083_B02.b : ttgcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccc
LNG01_0020_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0099_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0098_A05.b : nnnnggcgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0106_G10.b : nnaaagctgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0106_F06.b : nnaagctgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0054_E08.b : xxxxxxxxxxxxxxxxxxgctgggctttgggtgtctttagagttctttctcagctccatc
MLN01_0076_A09.b : ttnacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0063_B02.b : tgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0013_G12.b : nncattnnnnnnnncctgcgttggc
CLNT1_0141_D09.b : cagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0030_B12.b : nnnnnnccagagaagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0051_G08.b : cactgttgct
TES01_0076_A11.b : tttncctgcggtggct
TES01_0057_H10.b : nnttcgctgtggctctg
CLNT1_0151_D11.b : cagcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0133_C05.b : gctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0017_G09.b : nggatgaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0054_B10.b : anacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0022_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0119_G01.b : gctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0082_C05.b : aaaggcgcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0084_C09.b : ttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0014_C07.b : nnnggctgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0028_H05.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0081_E11.b : gacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0085_D12.b : gacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0032_B06.b : tgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0090_A03.b : nnnaagcaggtacacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0093_C01.b : ttgcgttacgaggttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0027_B05.b : gctgtacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0096_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0089_F06.b : nttatgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0074_H02.b : nnnactgacgtggct
THY01_0105_E01.b : gtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgctat
SPL01_0100_F01.b : acagntttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0074_H09.b : ttttcctgctgtgg
ITT01_0085_D11.b : nnnaatcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0044_C11.b : ngtgaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0068_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0020_A04.b : nnnttcgcggaacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0016_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggggtactg
SPL01_0060_A03.b : nacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0021_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0014_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0045_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0019_A03.b : nnnaacgcgggtacacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0102_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0103_B07.b : gccttttnnnnnggatatagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0009_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0080_H06.b : aaaaagagggctgggtaccggtccgaggatttccttcgagcacggttggcctaacttgga
LNG01_0017_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0091_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0021_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0004_H03.b : nnnggtgatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0071_C11.b : tgncgtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0057_F08.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0097_F03.b : nacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0103_D12.b : cagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0205_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0088_E01.b : nnttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0029_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0042_H08.b : nnngggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0109_E01.b : cttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0016_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0103_A06.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0084_F12.b : gtacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0073_A02.b : naaagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0083_F11.b : aaaagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0111_B07.b : ttgtcaaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0076_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0120_G12.b : gtgtacaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0004_F10.b : ggtaccnnnnagataaagcagctggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0034_H02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxx
THY01_0059_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_H04.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0051_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0048_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_A01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0040_E04.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0003_D06.b : ngggtacnnnaangataagcggctggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0101_F10.b : ttccgctgttg
THY01_0007_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0023_C05.b : nnggagaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0043_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0075_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0110_C05.b : ctgcgttggctctggtttctcgctcct
PBL01_0005_F08.b : gggtaannnnngggtatacagctggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0030_G05.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0063_G11.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0019_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0026_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0004_D05.b : gaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0018_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0005_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0020_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0026_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0099_G07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxx
SMG01_0032_C06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxx
SPL01_0016_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0021_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0001_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0016_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0045_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0010_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0016_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0011_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0010_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0035_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0034_D02.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0048_E05.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0068_H12.b : tcgcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0013_E05.b : gtgacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0127_E08.b : ttgcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0019_F05.b : agtgaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0023_E11.b : ngatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0025_D12.b : aatagctgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0024_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0062_A11.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0119_D03.b : tgctntacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0131_A11.b : agcgntcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0022_G02.b : nngatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0131_A12.b : aggcgtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0148_C05.b : ctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0091_F07.b : nnnaatgacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0135_C09.b : tgctgtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0141_F03.b : gctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0049_C02.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0052_C06.b : ttgcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0047_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0128_D05.b : tagcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0078_F11.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0147_B09.b : cagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0087_C08.b : gacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0024_D02.b : nggtgcaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0029_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0085_H10.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0036_G02.b : gacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0122_H12.b : agctgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0041_E11.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0026_F01.b : nggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0062_C02.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0097_A05.b : tctgcttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0048_C07.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0023_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0142_B11.b : cagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0205_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0026_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0002_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0038_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0066_E12.b : nnttgatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0082_D02.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0082_E02.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0076_D10.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0042_B09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0030_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0025_F11.b : acgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0007_E12.b : gacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0132_H04.b : cagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0025_B12.b : ntttgagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0032_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0100_E12.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0026_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0101_B04.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0029_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0089_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0057_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0097_G03.b : gacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0088_H05.b : cttgcttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0064_D06.b : gaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0053_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0052_G05.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0092_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0095_C12.b : ctgctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0095_G05.b : tcgcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0061_F07.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0092_E10.b : ctatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0074_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0133_D01.b : agctgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0080_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0016_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0054_B05.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0061_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0204_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0088_B03.b : nnnggagtaagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0046_D01.b : nggatgaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0021_C04.b : aaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0092_F05.b : ctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0054_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0075_F11.b : ttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0003_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0067_H12.b : tacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0083_D07.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0092_H11.b : nacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0081_H03.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0100_B02.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0084_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0013_H03.b : ntttatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0061_D10.b : nnnggatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0037_E01.b : nttgtgaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0205_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0060_F03.b : nngggttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0085_G11.b : ctgcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0021_B01.b : tcgcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0053_B03.b : nnnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0204_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0098_E04.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0071_D10.b : ctgcgncggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0070_A02.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0009_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0083_D04.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0059_B12.b : nnnnaatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0004_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0011_E07.b : gacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0041_B04.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0073_A11.b : nnnnggtgcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0089_F01.b : nnnnggtgcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0032_C01.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0069_C03.b : tagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0089_F10.b : ctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0063_H06.b : ctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0019_D08.b : tgcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0057_B01.b : gacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0054_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0055_F10.b : ttgcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0061_E09.b : nnnggatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0046_G05.b : nnggatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0076_B05.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0076_E02.b : gacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0097_C07.b : nnnggtgatacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0027_A09.b : nnnggtgcgacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0100_E01.b : gacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0073_A08.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0104_C12.b : gacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0066_D11.b : nnnnggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0071_B12.b : nnnggatcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0084_H02.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0077_E06.b : nnngggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0044_H10.b : nnaagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0100_D10.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0073_C01.b : ntttgatcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0047_D03.b : nnnggagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0072_B10.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0052_D07.b : cttanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0067_E11.b : nnnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0095_E12.b : nnnggagaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0085_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0103_B04.b : nnnnggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0085_E01.b : nnaagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0040_B12.b : nnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0087_E05.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0086_G05.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0062_D12.b : gacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0048_F04.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0078_D02.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0081_E11.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0028_D03.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0077_D08.b : nnnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0030_D08.b : nnnnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0091_F03.b : nnngggatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0028_B10.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0045_A10.b : tcgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0093_C06.b : aaaaggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0036_E01.b : tgctgtcngagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0106_G11.b : nnaagctaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0092_C01.b : gacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0042_B09.b : tgcgncggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0065_C12.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0084_F04.b : nacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0057_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0009_H02.b : gacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0097_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0109_D02.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0080_G01.b : nacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0086_H06.b : nnaagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0071_C01.b : gacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0050_G02.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0042_F08.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0042_H12.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0062_G05.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0059_D09.b : ctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0096_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0019_B10.b : gacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0059_A04.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0028_B03.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0090_D02.b : ctgcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0100_A06.b : nnnntgtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0064_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0092_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0206_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0096_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0094_C08.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0021_H03.b : nggggagtaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0027_A09.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0055_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0101_A01.b : acttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0104_C06.b : nacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0085_H12.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0077_F02.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0029_C10.b : tcgcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0087_B03.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0106_A10.b : nnnnggctaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0103_D03.b : nnnnggtgtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0047_D06.b : nnnggttaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0084_G07.b : nnnnggagtaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0080_G07.b : nnnttgtcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0002_D12.b : nnnaagtgcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0022_A01.b : ttaagtgaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0056_A12.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0066_F10.b : nnnnggcgtaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0043_C02.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0016_A10.b : nnnnggctaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0050_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0015_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0010_G08.b : xxxxxxxxxxxxxxxxxxgctgggctttgggtgtctttagagttctttctcagctccatc
SPL01_0072_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0044_D10.b : nnnncgcgagtagacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0056_E03.b : tttcctgcggtggctct
SPLT1_0084_E07.b : nnnccgcggtacgacgccgntxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0006_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0042_B02.b : gtggc
ILNT1_0037_G06.b : nnnnccgacgtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0099_H01.b : nttaagctaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0009_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0032_B02.b : ttnacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0080_B12.b : ctgcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccc
KDN01_0062_B05.b : nnnncctgcgttgg
PST01_0043_H06.b : nccccgctgtggct
SPLT1_0001_C09.b : nnnnggcaagtagacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0096_C07.b : nnnnaatgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0058_F07.b : anacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0002_F08.b : nnnaagcgagtagcggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0088_D07.b : ccgtctgcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0032_D06.b : ttnacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0075_B12.b : aaaggatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0051_E09.b : cagtggctc
LNG01_0019_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0078_D11.b : tctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxc
CLNT1_0083_G11.b : tcatgcggtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcc
THY01_0113_G10.b : cgtgtcaaagcggctggtccggtcggaatcctcgagcactgtggc
SMG01_0051_F08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxx
SPL01_0027_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0036_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0119_A03.b : cagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0049_C09.b : nacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0134_E01.b : gttcagcgtacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0029_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0054_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0074_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0091_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0084_C05.b : tttgcgntcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcc
TES01_0038_C08.b : nttttcctgctgtt
MLN01_0052_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0059_C09.b : tcgtctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0054_A08.b : nnactgctctggc
THY01_0100_C03.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0029_H09.b : naagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0031_C11.b : cgtctgcgntcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0094_H11.b : ttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0073_D06.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0011_G06.b : nttcgc
PBL01_0046_A12.b : nnnaatgaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0002_H09.b : nnngggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0070_A10.b : nnnaagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0014_G12.b : nccctttnnnnnnncctgcgttt
THY01_0114_E07.b : gttgcaaaaagcagcggccggtccggaatcctcagcactgtggcct
TES01_0109_F08.b : accgcg
CLNT1_0128_E04.b : ctatatgcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0024_B08.b : cgctg
TES01_0093_H02.b : ttttcctgct
TES01_0056_B02.b : nnnnncctgct
TES01_0059_B11.b : ntttcctgc
TES01_0007_G08.b : cgct
THY01_0026_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0077_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0042_B10.b : tgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxc
SPL01_0025_H04.b : nnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxt
AMP01_0087_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0016_D02.b : nnnnnccgtttgctgtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0004_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0028_G02.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0113_C04.b : gttgtcaaaxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0068_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0060_D12.b : nctagtgacttnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0061_B07.b : ggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0063_A02.b : ggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0041_F05.b : nnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0112_E08.b : nnnnnccgtcagcgtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0052_C05.b : nggcttggactatnacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0100_G02.b : nggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0092_B03.b : ggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0051_F09.b : aagctaaaatnnncccctcgttg
MLN01_0059_B02.b : nnnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0098_F11.b : nnnaaggcgagtagacgccnxxxxxxxx
THY01_0207_D12.b : catttatggtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0107_B08.b : agttgtaaaacaggggtacggtcggaattctgagcat
THY01_0108_F07.b : gttgcaaaagcagcgtacggtcggaa
MLN01_0019_G06.b :
ITT01_0086_H05.b :
MLN01_0063_D04.b :
MLN01_0022_F02.b :
LNG01_0063_C07.b :
AMP01_0076_B10.b :
ILNT1_0015_D06.b :
ILNT1_0009_A10.b :
ILNT1_0042_G12.b :
SPLT1_0047_G09.b :
SPLT1_0066_C05.b :
SPLT1_0054_E10.b :
SPLT1_0049_D07.b :
20110601C-001518 : CTCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
---------+---------+---------+---------+---------+---------+ 158
TCH01_0010_G01.b : CGGATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPLT1_0039_D12.b : CTCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0009_H12.b : CTCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0079_E01.b : CTCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0069_F09.b : CTCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0098_A03.b : CTCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0078_C11.b : CTCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
OVRM1_0206_E09.b : TGGATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
OVRM1_0206_H11.b : TGGATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0073_F10.b : TGGATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0103_D04.b : TGGATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0029_F11.b : ATCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0019_G02.b : ATCATCATT*GCTC*TACA*CTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0093_F07.b : TGGATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0094_G01.b : ATCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0076_B10.b : CTATGGATC*TTGC*TCTCACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0021_C02.b : TGGATCATT*GCTC*T*CAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0003_G02.b : TGGATCATT*GCTC*T*CAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0092_B05.b : ATCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0204_F01.b : TGGATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0089_C01.b : ATCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0006_A04.b : TGGATCATT*GCTC*T*CGACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SMG01_0023_B10.b : TGGATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0022_A12.b : CTGGATCTT*GCTC*T*CAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0091_C08.b : ATCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ILNT1_0019_A08.b : CTCATCATT*GCTCCTACTTCTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0088_H03.b : tGGATCATT*GCTC*TC**ACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0017_F12.b : aGGATCATT*GCTC*T*CAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0020_D05.b : xGGATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0013_B10.b : xTCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0036_F03.b : xTCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0028_D04.b : xGGATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0040_G09.b : xGGATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0084_E06.b : gGGATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
OVRT1_0145_F04.b : xTCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0062_B09.b : xTCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
OVRT1_0043_D10.b : xTCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0087_A03.b : tGGATCATT*GCTC*TC**ACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0024_B12.b : xTCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0090_H11.b : tTCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PST01_0077_E10.b : tCTGGATCTTGCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0083_B02.b : tTCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCTTCTTG*AGAAGAG
LNG01_0020_C07.b : xTCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0099_D03.b : xTCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0098_A05.b : xTCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0106_G10.b : xTCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0106_F06.b : xGGATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0054_E08.b : cTCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0076_A09.b : xGGATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0063_B02.b : xGGATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
KDN01_0013_G12.b : tCTGGATCTTGCTC*TACA*CTCCG*AAGAGCA*CAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0141_D09.b : xcGATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPLT1_0030_B12.b : xxGATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0051_G08.b : acGGATCTT*GCTC*T*CAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAGCAC
TES01_0076_A11.b : ctGGATATT*GCTC*TACA*CTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0057_H10.b : gaTATCATT*GCTC*TC**ACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0151_D11.b : xxCATCTTT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0133_C05.b : xtGATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0017_G09.b : xxCATCATT*GCTC*TACCACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0054_B10.b : xxGATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0022_B08.b : xxGATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0119_G01.b : xtTATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0082_C05.b : xxGATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TCH01_0084_C09.b : xxTATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0014_C07.b : xxGATCATT*GCTC*TCCATCTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0028_H05.b : xxTATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0081_E11.b : xxAATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0085_D12.b : xxCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0032_B06.b : gaCATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ILNT1_0090_A03.b : xxGATCATT*GCTC*TACATCTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0093_C01.b : xaGATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0027_B05.b : xtTATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TCH01_0096_G05.b : xxTATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0089_F06.b : xxCATCATT*GCCC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PST01_0074_H02.b : ctGATCATT*GCTC*TC**ACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0105_E01.b : ggaATCATTGGCTC*TACAACTCCG*AAAAGC*ACAGCT*GAAACCACCTTG*AAAAGAG
SPL01_0100_F01.b : xxxTTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0074_H09.b : ctaTGGATC*TTGC*TCTCACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0085_D11.b : xxxTTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0044_C11.b : xxxTTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0068_G05.b : xxxTTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPLT1_0020_A04.b : xxxATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0016_F06.b : gaaATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0060_A03.b : xxxTTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0021_A05.b : xxxTTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0014_C05.b : xxxATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0045_G06.b : xxxTTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPLT1_0019_A03.b : xxxATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
AMP01_0102_D12.b : xxxATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SMG01_0103_B07.b : xxxATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
AMP01_0093_E11.b : xxxATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0009_B05.b : xxxTTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0080_H06.b : ttcATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCTTGAGACCACCTTG*AGAAGAG
LNG01_0017_F07.b : xxxATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0091_C01.b : xxxATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0021_A08.b : xxxATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0004_H03.b : xxxATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0071_C11.b : xxxTTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0057_F08.b : xxxATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0097_F03.b : xxxATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
OVRT1_0103_D12.b : xxxTTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0205_F01.b : xxxTTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0088_E01.b : xxxTTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0029_B05.b : xxxTTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0042_H08.b : xxxTTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0109_E01.b : xxxTTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0016_A11.b : xxxATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0103_A06.b : xxxTTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0084_F12.b : xxxATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0073_A02.b : xxxTTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0083_F11.b : xxxATCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0111_B07.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0076_F09.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0120_G12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0004_F10.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0034_H02.b : xxxxTCATT*GCTC*TACACCTCCG*AAGAGCTACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0059_H12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LVRM1_0149_H04.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0051_D07.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0048_G01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACACCT*GAGACCACCTTG*AGAAGAG
LVRM1_0128_A01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0040_E04.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GATACCACCTTG*AGAAGAG
PBL01_0003_D06.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GATACCACCTTG*AGAATAG
TES01_0101_F10.b : ctctGGATC*TTGC*TCTCACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0007_E01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0023_C05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0043_D12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0075_B05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCACCAGCT*GAGACCACCTTG*AGAAGAG
TES01_0110_C05.b : cctcTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0005_F08.b : xxxxTCATT*GCTC*T*CAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0030_G05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0063_G11.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0019_E05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0026_H11.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0004_D05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0018_E01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0005_D05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0020_B04.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0026_F02.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAA
SMG01_0099_G07.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SMG01_0032_C06.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0016_F03.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0021_G02.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0001_E11.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0016_D12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0045_G12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0010_A03.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0016_C12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0011_H05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0010_C07.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0035_F11.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0034_D02.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0048_E05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0068_H12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0013_E05.b : xxxxTCATT*GCTC*TACTACTCCT*AATAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0127_E08.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0019_F05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0023_E11.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0025_D12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0024_B08.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0062_A11.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0119_D03.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0131_A11.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0022_G02.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0131_A12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0148_C05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0091_F07.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0135_C09.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGGCCACCTTG*AGAAGAG
CLNT1_0141_F03.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0049_C02.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0052_C06.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0047_B03.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0128_D05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0078_F11.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0147_B09.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0087_C08.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0024_D02.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0029_C12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0085_H10.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0036_G02.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0122_H12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0041_E11.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0026_F01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0062_C02.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0097_A05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0048_C07.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0023_E12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0142_B11.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0205_H09.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0026_G01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0002_D06.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0038_G12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0066_E12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0082_D02.b : xxxxTCATT*GCTC*TACAACTCCG*AGGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0082_E02.b : xxxxTCATT*GCTC*TACAACTCCG*AGGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0076_D10.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0042_B09.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0030_F12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0025_F11.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0007_E12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0132_H04.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0025_B12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0032_A09.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0100_E12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0026_G07.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0101_B04.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0029_B09.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0089_A03.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0057_F09.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0097_G03.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0088_H05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0064_D06.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0053_D07.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0052_G05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0092_D06.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0095_C12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0095_G05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0061_F07.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0092_E10.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0074_E06.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0133_D01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0080_E04.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0016_D03.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0054_B05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0061_D06.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0204_G07.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0088_B03.b : xxxxTCATT*GCTC*TACAACTCCGTAAGAGCAACAGCT*GATACCACCTTG*AGAAGAG
PBL01_0046_D01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0021_C04.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0092_F05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0054_H04.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0075_F11.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0003_E05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0067_H12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0083_D07.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0092_H11.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0081_H03.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0100_B02.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0084_B01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0013_H03.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0061_D10.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0037_E01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0205_G04.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0060_F03.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0085_G11.b : xxxgTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0021_B01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0053_B03.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0204_H02.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0098_E04.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0071_D10.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0070_A02.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0009_H01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0083_D04.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0059_B12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0004_F10.b : xxxxTCATT*GCTC*TACAACTCTG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0011_E07.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0041_B04.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0073_A11.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0089_F01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0032_C01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
OVRT1_0069_C03.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0089_F10.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0063_H06.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0019_D08.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0057_B01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0054_B10.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0055_F10.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0061_E09.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0046_G05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0076_B05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0076_E02.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0097_C07.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0027_A09.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0100_E01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0073_A08.b : xxxxTCATT*GCTC*TACCACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0104_C12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0066_D11.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0071_B12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0084_H02.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0077_E06.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0044_H10.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0100_D10.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0073_C01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0047_D03.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0072_B10.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0052_D07.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0067_E11.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0095_E12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0085_D06.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCC*GAGACCACCCTAGAGAAGAG
PBL01_0103_B04.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0085_E01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGGCCACCTTG*AGAAGAG
ITT01_0040_B12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0087_E05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0086_G05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0062_D12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0048_F04.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0078_D02.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0081_E11.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0028_D03.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0077_D08.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0030_D08.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0091_F03.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0028_B10.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
OVRT1_0045_A10.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0093_C06.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0036_E01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0106_G11.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0092_C01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0042_B09.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0065_C12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TCH01_0084_F04.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0057_C04.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0009_H02.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0097_F05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0109_D02.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TCH01_0080_G01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0086_H06.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0071_C01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0050_G02.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0042_F08.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0042_H12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0062_G05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0059_D09.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0096_A01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0019_B10.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0059_A04.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TCH01_0028_B03.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0090_D02.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0100_A06.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0064_C05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0092_A05.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0206_H01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0096_B06.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0094_C08.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0021_H03.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0027_A09.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0055_A09.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TCH01_0101_A01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0104_C06.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TCH01_0085_H12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0077_F02.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0029_C10.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0087_B03.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0106_A10.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0103_D03.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAGGAG
ITT01_0047_D06.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0084_G07.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0080_G07.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0002_D12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0022_A01.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0056_A12.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0066_F10.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TCH01_0043_C02.b : xxxxTCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0016_A10.b : xxxxTCATT*GCTC*TACC*TTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0050_E02.b : xxxtcATTG*GCTC*TACAACTCCG*AAAAGCAACAGCTGGAGACCACCTTGAAGAAGAG
THY01_0015_C08.b : xxxggCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0010_G08.b : ctcacCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0072_A12.b : xctggCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPLT1_0044_D10.b : xxxxxGATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0056_E03.b : ggatcTCTT*GCTC*T*CAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPLT1_0084_E07.b : xxttaGATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0006_A12.b : xxxxxCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0042_B02.b : tcggaTCTT*GCTC*TC**ACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ILNT1_0037_G06.b : xxxxxGATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0099_H01.b : xxxxxCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0009_F12.b : xxgggCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0032_B02.b : xxxxxCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0080_B12.b : cgacaCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCCTCTTG*AGAAGAG
KDN01_0062_B05.b : ctctgATCTTGCTC*TC**ACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PST01_0043_H06.b : ctggaATCTTGCTC*T*CAACTCCG*AAGAGC*ACAGCT*GAGACCACCTTG*ACAATAG
SPLT1_0001_C09.b : xxxxxGATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0096_C07.b : xxxxxCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0058_F07.b : xxxxxCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPLT1_0002_F08.b : xxxxxGATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0088_D07.b : xxxtgGATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0032_D06.b : xxxxxCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GGGACCACCTTG*AGAAGAG
PBL01_0075_B12.b : xxxxxCATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0051_E09.b : tggatcTCTTGCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0019_D06.b : xxxxxxATT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0078_D11.b : tctctaCATTGCTC*TACAANTCCG*AAGAGCAACAGCT*GAGACCCCTTTG*AGAGGAG
CLNT1_0083_G11.b : tcaacaCATTGCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCTTTTTG*AGAAGAG
THY01_0113_G10.b : tatggatATTGCTC*TACA*CTCCG*AAGAACAACAGCT*GAGACCACCTTG*AGAAGAG
SMG01_0051_F08.b : xxxxxxxTT*GCTC*TACA*CTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0027_D11.b : xxxxxxxTT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0036_G06.b : xxxxxxxTT*GCTC*TACAACTCCG*AAGAACAACAGCT*GAGACCACCTTG*AGAAGAG
OVRT1_0119_A03.b : xxxgctcTTTGCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0049_C09.b : xxxxtcgTT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0134_E01.b : xxxxxxxTT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0029_E02.b : xxxxxxxTT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0054_G03.b : xxxxxxxTT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0074_H07.b : xxxxxxxTT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0091_H05.b : xxxxxxxTT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0084_C05.b : atttcatTTTGCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCTTTTTG*AGAAGAG
TES01_0038_C08.b : gctatggAT*GCTC*TC**ACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0052_H09.b : xxxxxxxTT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0059_C09.b : xxxxxxxTT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0054_A08.b : tatggatATTGCTC*TACAACTCCA*AAGAGCA*CAGCT*GAGACCACCTTG*AGAAGAG
THY01_0100_C03.b : xxxxggaTTTGCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0029_H09.b : xxxxxxxTT*GCTC*TACA*CTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0031_C11.b : xxxxxxxTT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TCH01_0094_H11.b : xxxxxxxTTTGCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0073_D06.b : xxxxxxxTT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0011_G06.b : gtggctcTG*GATGCTCTCACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0046_A12.b : xxxxxxxTT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0002_H09.b : xxxxxxxTTTGCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
PBL01_0070_A10.b : xxxxxxxTT*GCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
KDN01_0014_G12.b : gctacggATCTTGC*TCTCACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0114_E07.b : actggatcTTGCTC*TACAACTCCG*AAGA*CAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0109_F08.b : ttggctacTCTTGC*TCTCACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0128_E04.b : xxxxxxxxTTGCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0024_B08.b : tggctctggCTTGC*TCTCACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0093_H02.b : gttgctctggATGC*TCTCACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0056_B02.b : gtggctatggATGC*TCTCACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0059_B11.b : gttgctctggATGC*TCTCACTCCG*AA*AGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0007_G08.b : gtggctatggATGC*TCTCACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0026_B12.b : xxxxtcattgcCTC*TACAACTCCG*AAAAGCAACAGCT*GAAACCACCTTG*AAAAAAG
AMP01_0077_E01.b : xxxxxxxxxxxCTC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0042_B10.b : ctttgggctctggC*TACAACTCCG*AAGAGCAACAGCT*GAGCCTTCCTTG*AGAAGAG
SPL01_0025_H04.b : gttggcctactggC*TACAACTCCG*AAGAGCAACAGCT*GAGACTACCTTG*AGAAGAG
AMP01_0087_C04.b : xxxxxxxxxxxxcC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
OVRT1_0016_D02.b : xxxxxxxxxxxxxC*TACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
AMP01_0004_F02.b : xxxxxxxxxxxxxxxxACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
LNG01_0028_G02.b : xxxxxxxxxxxxxxxxACAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0113_C04.b : xxxxxxxxxxxxxctggACACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
THY01_0068_B09.b : xxxxxxxxxxxxxxxxxCAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
MLN01_0060_D12.b : xxxxxxxxxxxxxxxxxCAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0061_B07.b : xxxxxxxxxxxxxxxxxCAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0063_A02.b : xxxxxxxxxxxxxxxxxCAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0041_F05.b : xxxxxxxxxxxxxxxxxCAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
CLNT1_0112_E08.b : xxxxxxxxxxxxxxxxxCAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0052_C05.b : xxxxxxxxxxxxxxxxxCAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
ITT01_0100_G02.b : xxxxxxxxxxxxxxxxxCAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
SPL01_0092_B03.b : xxxxxxxxxxxxxxxxxCAACTCCG*AAGAGCAACAGCT*GAGACCACCTTG*AGAAGAG
TES01_0051_F09.b : tgctcggatctttgcttaCACTCCC*AAGAGCA*CAGCT*GAGACCACCTTG*AGAACCC
MLN01_0059_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCT*GAGACCACCTTG*AGAAGAG
SPLT1_0098_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgACCTTG*AGAAGAG
THY01_0207_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTG*AGAAGAG
THY01_0107_B08.b : ggtgggctatggattttggttaaaactccaaaaagcacagtgaaaaccacctgaaaaaaa
THY01_0108_F07.b : ttctcagcatgtgggctgatatngtctanactccgaaagcaacagtgacaccactagata
MLN01_0019_G06.b :
ITT01_0086_H05.b :
MLN01_0063_D04.b :
MLN01_0022_F02.b :
LNG01_0063_C07.b :
AMP01_0076_B10.b :
ILNT1_0015_D06.b :
ILNT1_0009_A10.b :
ILNT1_0042_G12.b :
SPLT1_0047_G09.b :
SPLT1_0066_C05.b :
SPLT1_0054_E10.b :
SPLT1_0049_D07.b :
20110601C-001518 : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
---------+---------+---------+---------+---------+---------+ 215
TCH01_0010_G01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPLT1_0039_D12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
TES01_0009_H12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0079_E01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0069_F09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0098_A03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0078_C11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
OVRM1_0206_E09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
OVRM1_0206_H11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0073_F10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0103_D04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0029_F11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TES01_0019_G02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0093_F07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0094_G01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TES01_0076_B10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TES01_0021_C02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TES01_0003_G02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0092_B05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0204_F01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0089_C01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TES01_0006_A04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SMG01_0023_B10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TES01_0022_A12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0091_C08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ILNT1_0019_A08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
TES01_0088_H03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TES01_0017_F12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0020_D05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0013_B10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
THY01_0036_F03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0028_D04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
PBL01_0040_G09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TES01_0084_E06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCCCCCTGACCGCCGTGATGAG
OVRT1_0145_F04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
SPL01_0062_B09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
OVRT1_0043_D10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
TES01_0087_A03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0024_B12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0090_H11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
PST01_0077_E10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0083_B02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
LNG01_0020_C07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
MLN01_0099_D03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0098_A05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0106_G10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0106_F06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0054_E08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
MLN01_0076_A09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0063_B02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
KDN01_0013_G12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0141_D09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
SPLT1_0030_B12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
TES01_0051_G08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TES01_0076_A11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TES01_0057_H10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0151_D11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
CLNT1_0133_C05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
PBL01_0017_G09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0054_B10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
THY01_0022_B08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0119_G01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
PBL01_0082_C05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TCH01_0084_C09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0014_C07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0028_H05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0081_E11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0085_D12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0032_B06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
ILNT1_0090_A03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
CLNT1_0093_C01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
CLNT1_0027_B05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
TCH01_0096_G05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0089_F06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PST01_0074_H02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0105_E01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0100_F01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
TES01_0074_H09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0085_D11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0044_C11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0068_G05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPLT1_0020_A04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
SPL01_0016_F06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
SPL01_0060_A03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
THY01_0021_A05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0014_C05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
THY01_0045_G06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPLT1_0019_A03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
AMP01_0102_D12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTAATGAG
SMG01_0103_B07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
AMP01_0093_E11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTAATGAG
LNG01_0009_B05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0080_H06.b : CATCGGGTCCCAGGCCGAGTTCTGATAGTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0017_F07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0091_C01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0021_A08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0004_H03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0071_C11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
ITT01_0057_F08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0097_F03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
OVRT1_0103_D12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
THY01_0205_F01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0088_E01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0029_B05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0042_H08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0109_E01.b : CAT**GGTCCCGGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0016_A11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0103_A06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
LNG01_0084_F12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCCCGCCCTGACCGCCGTGATGAG
PBL01_0073_A02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0083_F11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0111_B07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0076_F09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0120_G12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0004_F10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
MLN01_0034_H02.b : CAT**GGTCCCAGGCCCAGTTCTGAT*GTGGGGGGCCCTCCCCCTGACCGCCGTGATGAG
THY01_0059_H12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LVRM1_0149_H04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0051_D07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0048_G01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LVRM1_0128_A01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCC*TCGCCCTGACCGCCGTGATGAG
THY01_0040_E04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAC
PBL01_0003_D06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TES01_0101_F10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0007_E01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0023_C05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0043_D12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
MLN01_0075_B05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TES01_0110_C05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0005_F08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0030_G05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
SPL01_0063_G11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
THY01_0019_E05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0026_H11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
THY01_0004_D05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0018_E01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0005_D05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0020_B04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0026_F02.b : CAT**GGTCCCAGGTCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
SMG01_0099_G07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SMG01_0032_C06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0016_F03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
THY01_0021_G02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0001_E11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0016_D12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0045_G12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0010_A03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0016_C12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0011_H05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0010_C07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
LNG01_0035_F11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
MLN01_0034_D02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0048_E05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
CLNT1_0068_H12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
PBL01_0013_E05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0127_E08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*ATGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
PBL01_0019_F05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0023_E11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0025_D12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0024_B08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0062_A11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
CLNT1_0119_D03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
CLNT1_0131_A11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
PBL01_0022_G02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0131_A12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
CLNT1_0148_C05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
ITT01_0091_F07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0135_C09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
CLNT1_0141_F03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
SPL01_0049_C02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
CLNT1_0052_C06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
THY01_0047_B03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0128_D05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
LNG01_0078_F11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0147_B09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
LNG01_0087_C08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCATCGCCCTGACCGCCGTGATGAG
PBL01_0024_D02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0029_C12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0085_H10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
MLN01_0036_G02.b : CAT**GGTCCCAGGCCGAGCTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0122_H12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
ITT01_0041_E11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGTCGTGATGAG
PBL01_0026_F01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0062_C02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0097_A05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
SPL01_0048_C07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
LNG01_0023_E12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0142_B11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
THY01_0205_H09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0026_G01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0002_D06.b : CAT**GGCCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0038_G12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0066_E12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0082_D02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGAGGGCCCTCGCCCTGACCGCCTTGATGAG
SPL01_0082_E02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGAGGGCCCTCGCCCTGACCGCCTTGATGAG
SPL01_0076_D10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
LNG01_0042_B09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0030_F12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0025_F11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
MLN01_0007_E12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0132_H04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
ITT01_0025_B12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0032_A09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0100_E12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
LNG01_0026_G07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0101_B04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
THY01_0029_B09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0089_A03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0057_F09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0097_G03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0088_H05.b : CAT**GGTCCCAGGCCGAGCTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
PBL01_0064_D06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0053_D07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0052_G05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
THY01_0092_D06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0095_C12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
CLNT1_0095_G05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
MLN01_0061_F07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0092_E10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
THY01_0074_E06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0133_D01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
THY01_0080_E04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0016_D03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0054_B05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
THY01_0061_D06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0204_G07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0088_B03.b : CAT**GGTCCCCCGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0046_D01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0021_C04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0092_F05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
THY01_0054_H04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GAGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0075_F11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
SPL01_0003_E05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
LNG01_0067_H12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0083_D07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
SPL01_0092_H11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
PBL01_0081_H03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0100_B02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
THY01_0084_B01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0013_H03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0061_D10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0037_E01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0205_G04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0060_F03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0085_G11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
CLNT1_0021_B01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
PBL01_0053_B03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0204_H02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0098_E04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
CLNT1_0071_D10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
SPL01_0070_A02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
SPL01_0009_H01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
MLN01_0083_D04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0059_B12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0004_F10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
MLN01_0011_E07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0041_B04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0073_A11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0089_F01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0032_C01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
OVRT1_0069_C03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
CLNT1_0089_F10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
CLNT1_0063_H06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
CLNT1_0019_D08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
LNG01_0057_B01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0054_B10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0055_F10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
PBL01_0061_E09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0046_G05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
MLN01_0076_B05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0076_E02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCGGACCGCCGTGATGAG
ITT01_0097_C07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0027_A09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0100_E01.b : CAT**GGTCCCAGGCCGAGTTCCGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0073_A08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0104_C12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0066_D11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0071_B12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0084_H02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0077_E06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0044_H10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0100_D10.b : CGT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0073_C01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0047_D03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0072_B10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0052_D07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
ITT01_0067_E11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0095_E12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0085_D06.b : CATA*GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0103_B04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0085_E01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0040_B12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0087_E05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0086_G05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0062_D12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
MLN01_0048_F04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0078_D02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0081_E11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0028_D03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0077_D08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0030_D08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0091_F03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0028_B10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
OVRT1_0045_A10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
PBL01_0093_C06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0036_E01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
PBL01_0106_G11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0092_C01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0042_B09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
LNG01_0065_C12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TCH01_0084_F04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0057_C04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
MLN01_0009_H02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0097_F05.b : CAT**GGTCCCAAGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0109_D02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TCH01_0080_G01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0086_H06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0071_C01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
MLN01_0050_G02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
MLN01_0042_F08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
MLN01_0042_H12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
MLN01_0062_G05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0059_D09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
THY01_0096_A01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
MLN01_0019_B10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
MLN01_0059_A04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TCH01_0028_B03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0090_D02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
PBL01_0100_A06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0064_C05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0092_A05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0206_H01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0096_B06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
PBL01_0094_C08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0021_H03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
MLN01_0027_A09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0055_A09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TCH01_0101_A01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0104_C06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
TCH01_0085_H12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0077_F02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0029_C10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
ITT01_0087_B03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0106_A10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0103_D03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0047_D06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0084_G07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0080_G07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0002_D12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0022_A01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
MLN01_0056_A12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0066_F10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TCH01_0043_C02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0016_A10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0050_E02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0015_C08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0010_G08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0072_A12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
SPLT1_0044_D10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
TES01_0056_E03.b : CAT**GGTCCCAGGCCGAGTCCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPLT1_0084_E07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
SPL01_0006_A12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
TES01_0042_B02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ILNT1_0037_G06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
PBL01_0099_H01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0009_F12.b : CAT**GGT*CCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0032_B02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
CLNT1_0080_B12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
KDN01_0062_B05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PST01_0043_H06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPLT1_0001_C09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
ITT01_0096_C07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0058_F07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
SPLT1_0002_F08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
CLNT1_0088_D07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
MLN01_0032_D06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0075_B12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TES01_0051_E09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0019_D06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0078_D11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
CLNT1_0083_G11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
THY01_0113_G10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SMG01_0051_F08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0027_D11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
THY01_0036_G06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
OVRT1_0119_A03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
SPL01_0049_C09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
CLNT1_0134_E01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
THY01_0029_E02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0054_G03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0074_H07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0091_H05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
CLNT1_0084_C05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
TES01_0038_C08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
MLN01_0052_H09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0059_C09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
TES01_0054_A08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGGCCGCCGTGATGAG
THY01_0100_C03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0029_H09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0031_C11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
TCH01_0094_H11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0073_D06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TES01_0011_G06.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0046_A12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
ITT01_0002_H09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
PBL01_0070_A10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
KDN01_0014_G12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0114_E07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TES01_0109_F08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GCGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0128_E04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
TES01_0024_B08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TES01_0093_H02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TES01_0056_B02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TES01_0059_B11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
TES01_0007_G08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0026_B12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
AMP01_0077_E01.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
MLN01_0042_B10.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0025_H04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
AMP01_0087_C04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
OVRT1_0016_D02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
AMP01_0004_F02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
LNG01_0028_G02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0113_C04.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0068_B09.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
MLN01_0060_D12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0061_B07.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
SPL01_0063_A02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
ITT01_0041_F05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
CLNT1_0112_E08.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
SPL01_0052_C05.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
ITT01_0100_G02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPL01_0092_B03.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
TES01_0051_F09.b : CAT**GGATCCCGGCCGAGTTCTGAT*GTGGGGGGCCCTCCCCCTGACCGCCGTGATGAG
MLN01_0059_B02.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
SPLT1_0098_F11.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCTTGATGAG
THY01_0207_D12.b : CAT**GGTCCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
THY01_0107_B08.b : CAT**GGTCCCAGGCCGA*TTCTGAT*GTGGGGGGCCCTCCCCCTGACCGCCGTGATAAG
THY01_0108_F07.b : aaacatggtCCAGGCCGAGTTCTGAT*GTGGGGGGCCCTCGCCCTGACCGCCGTGATGAG
MLN01_0019_G06.b : gcctttaggnggcttggcctataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0086_H05.b :
MLN01_0063_D04.b :
MLN01_0022_F02.b :
LNG01_0063_C07.b :
AMP01_0076_B10.b :
ILNT1_0015_D06.b :
ILNT1_0009_A10.b :
ILNT1_0042_G12.b :
SPLT1_0047_G09.b :
SPLT1_0066_C05.b :
SPLT1_0054_E10.b :
SPLT1_0049_D07.b :
20110601C-001518 : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
---------+---------+---------+---------+---------+---------+ 260
TCH01_0010_G01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPLT1_0039_D12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0009_H12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0079_E01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0069_F09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0098_A03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0078_C11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
OVRM1_0206_E09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
OVRM1_0206_H11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0073_F10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0103_D04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0029_F11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0019_G02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0093_F07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0094_G01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0076_B10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0021_C02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0003_G02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0092_B05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0204_F01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0089_C01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0006_A04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SMG01_0023_B10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0022_A12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0091_C08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ILNT1_0019_A08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0088_H03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0017_F12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0020_D05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0013_B10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0036_F03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0028_D04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0040_G09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0084_E06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
OVRT1_0145_F04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*TCATGTTGCCT*CCTA
SPL01_0062_B09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
OVRT1_0043_D10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0087_A03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0024_B12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0090_H11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PST01_0077_E10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0083_B02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0020_C07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0099_D03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0098_A05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0106_G10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0106_F06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0054_E08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0076_A09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0063_B02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
KDN01_0013_G12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0141_D09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPLT1_0030_B12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0051_G08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0076_A11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0057_H10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0151_D11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0133_C05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0017_G09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0054_B10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0022_B08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0119_G01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0082_C05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TCH01_0084_C09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0014_C07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0028_H05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0081_E11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0085_D12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0032_B06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ILNT1_0090_A03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0093_C01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0027_B05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TCH01_0096_G05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0089_F06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PST01_0074_H02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0105_E01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0100_F01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0074_H09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0085_D11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGATGCCT*CCTA
PBL01_0044_C11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0068_G05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPLT1_0020_A04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0016_F06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0060_A03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0021_A05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0014_C05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0045_G06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPLT1_0019_A03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
AMP01_0102_D12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SMG01_0103_B07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
AMP01_0093_E11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0009_B05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0080_H06.b : CGCCTGTGGAGGTGAAGAACATTGCGG************CCGAACCATGTTGCCT*CCTA
LNG01_0017_F07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0091_C01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0021_A08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0004_H03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0071_C11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0057_F08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0097_F03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
OVRT1_0103_D12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0205_F01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0088_E01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CTATGTTGCCT*CCTA
THY01_0029_B05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0042_H08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0109_E01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0016_A11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0103_A06.b : CGCCTGTGGAGGTGAAG*ACACTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0084_F12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0073_A02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0083_F11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0111_B07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0076_F09.b : CGCCTGTGGAGGTGAAGACATTTGCGG************CCGA*CCATGTTGCCTCCCTA
THY01_0120_G12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0004_F10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0034_H02.b : CGCCTGTGGAGGTGAAG*ACTTTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0059_H12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LVRM1_0149_H04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0051_D07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0048_G01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LVRM1_0128_A01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0040_E04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0003_D06.b : CGCCTGTGGAGGTGAAG*ACATTGCCG************CCGA*CCATGTTGCCT*CCTA
TES01_0101_F10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0007_E01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0023_C05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0043_D12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0075_B05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0110_C05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0005_F08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0030_G05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0063_G11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0019_E05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0026_H11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0004_D05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0018_E01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0005_D05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0020_B04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0026_F02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SMG01_0099_G07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SMG01_0032_C06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0016_F03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0021_G02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0001_E11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0016_D12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0045_G12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0010_A03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0016_C12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0011_H05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0010_C07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0035_F11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0034_D02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0048_E05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0068_H12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0013_E05.b : CGCCTGTGGAGGTGAGG*ACGTTGCGG************CCGA*CCGTGTTGCCT*CCTA
CLNT1_0127_E08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0019_F05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0023_E11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0025_D12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0024_B08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0062_A11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0119_D03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0131_A11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0022_G02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0131_A12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0148_C05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0091_F07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0135_C09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0141_F03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0049_C02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0052_C06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0047_B03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0128_D05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0078_F11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0147_B09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0087_C08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0024_D02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0029_C12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0085_H10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0036_G02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0122_H12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0041_E11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0026_F01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTG
LNG01_0062_C02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0097_A05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0048_C07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0023_E12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0142_B11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0205_H09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0026_G01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0002_D06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0038_G12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0066_E12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0082_D02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0082_E02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0076_D10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0042_B09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0030_F12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0025_F11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0007_E12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0132_H04.b : CGCCTGTGGAGGCGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0025_B12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0032_A09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0100_E12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0026_G07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0101_B04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0029_B09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0089_A03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0057_F09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CTGA*CCATGTTGCCT*CCTA
LNG01_0097_G03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0088_H05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0064_D06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0053_D07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0052_G05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0092_D06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0095_C12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0095_G05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0061_F07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0092_E10.b : CGCCTGTGGAGGTGAAG*ACA*TGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0074_E06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0133_D01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0080_E04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0016_D03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0054_B05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0061_D06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0204_G07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0088_B03.b : CGCCTGTGGAGGTGAAG*ACCTTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0046_D01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0021_C04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0092_F05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0054_H04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0075_F11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0003_E05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0067_H12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0083_D07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0092_H11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0081_H03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0100_B02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0084_B01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0013_H03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0061_D10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0037_E01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0205_G04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0060_F03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0085_G11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0021_B01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0053_B03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0204_H02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0098_E04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0071_D10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0070_A02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0009_H01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0083_D04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0059_B12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0004_F10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0011_E07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0041_B04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0073_A11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0089_F01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0032_C01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
OVRT1_0069_C03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0089_F10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0063_H06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0019_D08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0057_B01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0054_B10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0055_F10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0061_E09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0046_G05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0076_B05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0076_E02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0097_C07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0027_A09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0100_E01.b : CGCCTGTGGAGGTGAAG*ACGTTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0073_A08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0104_C12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0066_D11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0071_B12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0084_H02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0077_E06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0044_H10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0100_D10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0073_C01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0047_D03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0072_B10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0052_D07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0067_E11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0095_E12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0085_D06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0103_B04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0085_E01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0040_B12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0087_E05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0086_G05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0062_D12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0048_F04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0078_D02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0081_E11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0028_D03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0077_D08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0030_D08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0091_F03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0028_B10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
OVRT1_0045_A10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0093_C06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0036_E01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0106_G11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0092_C01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0042_B09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0065_C12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TCH01_0084_F04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0057_C04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0009_H02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0097_F05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0109_D02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TCH01_0080_G01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0086_H06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0071_C01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0050_G02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0042_F08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0042_H12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0062_G05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0059_D09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0096_A01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0019_B10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0059_A04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TCH01_0028_B03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0090_D02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0100_A06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0064_C05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0092_A05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0206_H01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0096_B06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0094_C08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0021_H03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0027_A09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0055_A09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TCH01_0101_A01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0104_C06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TCH01_0085_H12.b : CGCCTGTAGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0077_F02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0029_C10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0087_B03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0106_A10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0103_D03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0047_D06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0084_G07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0080_G07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0002_D12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0022_A01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0056_A12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0066_F10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TCH01_0043_C02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0016_A10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0050_E02.b : CGCCTGTGGAGGTGAAA*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0015_C08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0010_G08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0072_A12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPLT1_0044_D10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0056_E03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPLT1_0084_E07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0006_A12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0042_B02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ILNT1_0037_G06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0099_H01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0009_F12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0032_B02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0080_B12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
KDN01_0062_B05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PST01_0043_H06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPLT1_0001_C09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0096_C07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0058_F07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPLT1_0002_F08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0088_D07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0032_D06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0075_B12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0051_E09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0019_D06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0078_D11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0083_G11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0113_G10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SMG01_0051_F08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0027_D11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0036_G06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
OVRT1_0119_A03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0049_C09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0134_E01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0029_E02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0054_G03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0074_H07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0091_H05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0084_C05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0038_C08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0052_H09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0059_C09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0054_A08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0100_C03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0029_H09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0031_C11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TCH01_0094_H11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0073_D06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGG*CCATGTTGCCT*CCTA
TES01_0011_G06.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0046_A12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0002_H09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
PBL01_0070_A10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
KDN01_0014_G12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0114_E07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0109_F08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0128_E04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0024_B08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0093_H02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0056_B02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0059_B11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0007_G08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0026_B12.b : CGCCTGGGGAGGTGAAA*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
AMP01_0077_E01.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0042_B10.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0025_H04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
AMP01_0087_C04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
OVRT1_0016_D02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
AMP01_0004_F02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
LNG01_0028_G02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0113_C04.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0068_B09.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0060_D12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0061_B07.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0063_A02.b : CGCCTGTGGAGGTGAAG*ACATTGCGGACCCTGACCTAGCCGA*CCATGTTGCCT*CCTA
ITT01_0041_F05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
CLNT1_0112_E08.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0052_C05.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
ITT01_0100_G02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPL01_0092_B03.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
TES01_0051_F09.b : CGCCTGTGGAGGTGAATGACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0059_B02.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
SPLT1_0098_F11.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0207_D12.b : CGCCTGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0107_B08.b : CGCCTGTGGAGGTGAAAGACATTGCGG************CCGA*CCATGTTGCCT*CCTA
THY01_0108_F07.b : CGCCCGTGGAGGTGAAG*ACATTGCGG************CCGA*CCATGTTGCCT*CCTA
MLN01_0019_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtcattgctctacaactccgaagagcaaca
ITT01_0086_H05.b :
MLN01_0063_D04.b :
MLN01_0022_F02.b :
LNG01_0063_C07.b :
AMP01_0076_B10.b :
ILNT1_0015_D06.b :
ILNT1_0009_A10.b :
ILNT1_0042_G12.b :
SPLT1_0047_G09.b :
SPLT1_0066_C05.b :
SPLT1_0054_E10.b :
SPLT1_0049_D07.b :
20110601C-001518 : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
---------+---------+---------+---------+---------+---------+ 320
TCH01_0010_G01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPLT1_0039_D12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0009_H12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0079_E01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0069_F09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0098_A03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0078_C11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
OVRM1_0206_E09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
OVRM1_0206_H11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0073_F10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0103_D04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0029_F11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0019_G02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0093_F07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0094_G01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0076_B10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0021_C02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0003_G02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0092_B05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0204_F01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0089_C01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0006_A04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SMG01_0023_B10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0022_A12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0091_C08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ILNT1_0019_A08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0088_H03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0017_F12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0020_D05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0013_B10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0036_F03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0028_D04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0040_G09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0084_E06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
OVRT1_0145_F04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0062_B09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
OVRT1_0043_D10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0087_A03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0024_B12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0090_H11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PST01_0077_E10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0083_B02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0020_C07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0099_D03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0098_A05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0106_G10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0106_F06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0054_E08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0076_A09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0063_B02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
KDN01_0013_G12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0141_D09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPLT1_0030_B12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0051_G08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0076_A11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0057_H10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0151_D11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0133_C05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0017_G09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0054_B10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0022_B08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0119_G01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0082_C05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TCH01_0084_C09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0014_C07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0028_H05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0081_E11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0085_D12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0032_B06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ILNT1_0090_A03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0093_C01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0027_B05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TCH01_0096_G05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0089_F06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PST01_0074_H02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0105_E01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0100_F01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0074_H09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0085_D11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0044_C11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0068_G05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPLT1_0020_A04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0016_F06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0060_A03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0021_A05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0014_C05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0045_G06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGGTGG
SPLT1_0019_A03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
AMP01_0102_D12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SMG01_0103_B07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
AMP01_0093_E11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0009_B05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0080_H06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0017_F07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0091_C01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0021_A08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0004_H03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0071_C11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0057_F08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0097_F03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCC*AGCGGCTATTATACCCATGAATTTGATGG
OVRT1_0103_D12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0205_F01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0088_E01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0029_B05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0042_H08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0109_E01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0016_A11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0103_A06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0084_F12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0073_A02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0083_F11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0111_B07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0076_F09.b : TGGCTTAAATGTNCTACCAGTCTTACGTCCCCGCGGCTATTATACCCATGAATTTGATGG
THY01_0120_G12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0004_F10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0034_H02.b : TGGGTTAAATGTCTACCAGTCTTACGGTCCCCCCGGCTATTATACCCATGAATTTCATGG
THY01_0059_H12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LVRM1_0149_H04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0051_D07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0048_G01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LVRM1_0128_A01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0040_E04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0003_D06.b : TGGCTTAAATGTCTACCACTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0101_F10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0007_E01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0023_C05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0043_D12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0075_B05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0110_C05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGACGG
PBL01_0005_F08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0030_G05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0063_G11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0019_E05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0026_H11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0004_D05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0018_E01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0005_D05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0020_B04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0026_F02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SMG01_0099_G07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGACGG
SMG01_0032_C06.b : TGGCTTAAATGCCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0016_F03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0021_G02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0001_E11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0016_D12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0045_G12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0010_A03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0016_C12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0011_H05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0010_C07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0035_F11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0034_D02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0048_E05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0068_H12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0013_E05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCCGCGGCTATTATACCCGTGAATTTGATGG
CLNT1_0127_E08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0019_F05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0023_E11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0025_D12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0024_B08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0062_A11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0119_D03.b : TGGCTTAAATGTCTACCAGTCTTGCGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0131_A11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0022_G02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0131_A12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0148_C05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0091_F07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0135_C09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0141_F03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0049_C02.b : TGGCTTAAATGTCTACCAGCCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0052_C06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0047_B03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0128_D05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0078_F11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0147_B09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0087_C08.b : TGGCTTAGATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0024_D02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0029_C12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0085_H10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0036_G02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0122_H12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0041_E11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0026_F01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0062_C02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0097_A05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0048_C07.b : TGGCTTAAATGTCTACCAGTCTCACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0023_E12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0142_B11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0205_H09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGACGG
LNG01_0026_G01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0002_D06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0038_G12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0066_E12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0082_D02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0082_E02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0076_D10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0042_B09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0030_F12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0025_F11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0007_E12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0132_H04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0025_B12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0032_A09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0100_E12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0026_G07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0101_B04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0029_B09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0089_A03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0057_F09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0097_G03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0088_H05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0064_D06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0053_D07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0052_G05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0092_D06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0095_C12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0095_G05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0061_F07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0092_E10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0074_E06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0133_D01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0080_E04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0016_D03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0054_B05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0061_D06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0204_G07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTACACCCATGAATTTGATGG
PBL01_0088_B03.b : TGGCTTAAATGTCTACCAGTCTTACTGTCCCAGCGGCTATTATACCCGTGAATTTGATGG
PBL01_0046_D01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0021_C04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0092_F05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0054_H04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0075_F11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0003_E05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0067_H12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0083_D07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0092_H11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0081_H03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0100_B02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0084_B01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0013_H03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0061_D10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0037_E01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0205_G04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0060_F03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0085_G11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0021_B01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0053_B03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0204_H02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0098_E04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0071_D10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0070_A02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0009_H01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0083_D04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0059_B12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0004_F10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0011_E07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0041_B04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0073_A11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0089_F01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0032_C01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
OVRT1_0069_C03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0089_F10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0063_H06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0019_D08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0057_B01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0054_B10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0055_F10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0061_E09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0046_G05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0076_B05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0076_E02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0097_C07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0027_A09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0100_E01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0073_A08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0104_C12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0066_D11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0071_B12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0084_H02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0077_E06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0044_H10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0100_D10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0073_C01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0047_D03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0072_B10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0052_D07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0067_E11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0095_E12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0085_D06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0103_B04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0085_E01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0040_B12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0087_E05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0086_G05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0062_D12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0048_F04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0078_D02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0081_E11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0028_D03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0077_D08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0030_D08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0091_F03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0028_B10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
OVRT1_0045_A10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0093_C06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0036_E01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0106_G11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0092_C01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0042_B09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0065_C12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TCH01_0084_F04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0057_C04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0009_H02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0097_F05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0109_D02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TCH01_0080_G01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0086_H06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0071_C01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0050_G02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0042_F08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0042_H12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0062_G05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0059_D09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0096_A01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0019_B10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0059_A04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TCH01_0028_B03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0090_D02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0100_A06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0064_C05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0092_A05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0206_H01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0096_B06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0094_C08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0021_H03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0027_A09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0055_A09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TCH01_0101_A01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0104_C06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TCH01_0085_H12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0077_F02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0029_C10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0087_B03.b : TGGCTCAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0106_A10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0103_D03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0047_D06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0084_G07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0080_G07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0002_D12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0022_A01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0056_A12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0066_F10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TCH01_0043_C02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0016_A10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0050_E02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0015_C08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0010_G08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0072_A12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPLT1_0044_D10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0056_E03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPLT1_0084_E07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0006_A12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0042_B02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ILNT1_0037_G06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0099_H01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0009_F12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0032_B02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0080_B12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
KDN01_0062_B05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PST01_0043_H06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPLT1_0001_C09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0096_C07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0058_F07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPLT1_0002_F08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0088_D07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0032_D06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0075_B12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0051_E09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0019_D06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0078_D11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0083_G11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0113_G10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SMG01_0051_F08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0027_D11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTGTACCCATGAATTTGATGG
THY01_0036_G06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
OVRT1_0119_A03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0049_C09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0134_E01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0029_E02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0054_G03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0074_H07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0091_H05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0084_C05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0038_C08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0052_H09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0059_C09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0054_A08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0100_C03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0029_H09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0031_C11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TCH01_0094_H11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0073_D06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0011_G06.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0046_A12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0002_H09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
PBL01_0070_A10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
KDN01_0014_G12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0114_E07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0109_F08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0128_E04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0024_B08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0093_H02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0056_B02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0059_B11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0007_G08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0026_B12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
AMP01_0077_E01.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0042_B10.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0025_H04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
AMP01_0087_C04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
OVRT1_0016_D02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
AMP01_0004_F02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
LNG01_0028_G02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0113_C04.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0068_B09.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0060_D12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0061_B07.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0063_A02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0041_F05.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
CLNT1_0112_E08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0052_C05.b : TGGCTTAAATGTCTACCAGTCTTACTGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0100_G02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPL01_0092_B03.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
TES01_0051_F09.b : TGGCTTAGATGTCTACCAATCTTTCGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0059_B02.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
SPLT1_0098_F11.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0207_D12.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0107_B08.b : TGGCTTAAATGTCTACCAGTCTTACGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
THY01_0108_F07.b : TGGCTTNAATGTCTACCAGTCTTATGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
MLN01_0019_G06.b : gctgagaccaccttgagaagagcATGGTCCCAGCGGCTATTATACCCATGAATTTGATGG
ITT01_0086_H05.b : nnttgatgaacaxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0063_D04.b :
MLN01_0022_F02.b :
LNG01_0063_C07.b :
AMP01_0076_B10.b :
ILNT1_0015_D06.b :
ILNT1_0009_A10.b :
ILNT1_0042_G12.b :
SPLT1_0047_G09.b :
SPLT1_0066_C05.b :
SPLT1_0054_E10.b :
SPLT1_0049_D07.b :
20110601C-001518 : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
---------+---------+---------+---------+---------+---------+ 378
TCH01_0010_G01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPLT1_0039_D12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0009_H12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0079_E01.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0069_F09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0098_A03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0078_C11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
OVRM1_0206_E09.b : TGACGAGCAATTCTACGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
OVRM1_0206_H11.b : TGACGAGCAATTCTACGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0073_F10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0103_D04.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0029_F11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0019_G02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0093_F07.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0094_G01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0076_B10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0021_C02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0003_G02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0092_B05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0204_F01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0089_C01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0006_A04.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SMG01_0023_B10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0022_A12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0091_C08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ILNT1_0019_A08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0088_H03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0017_F12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0020_D05.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0013_B10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0036_F03.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0028_D04.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0040_G09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0084_E06.b : CGACGAGGAACTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
OVRT1_0145_F04.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0062_B09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
OVRT1_0043_D10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0087_A03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0024_B12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0090_H11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PST01_0077_E10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0083_B02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0020_C07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0099_D03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0098_A05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0106_G10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0106_F06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0054_E08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0076_A09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0063_B02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
KDN01_0013_G12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0141_D09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPLT1_0030_B12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0051_G08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0076_A11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0057_H10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0151_D11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0133_C05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0017_G09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0054_B10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0022_B08.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0119_G01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0082_C05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TCH01_0084_C09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0014_C07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0028_H05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0081_E11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0085_D12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0032_B06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ILNT1_0090_A03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0093_C01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0027_B05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TCH01_0096_G05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0089_F06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PST01_0074_H02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0105_E01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0100_F01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0074_H09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0085_D11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0044_C11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0068_G05.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPLT1_0020_A04.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0016_F06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0060_A03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0021_A05.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0014_C05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0045_G06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPLT1_0019_A03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
AMP01_0102_D12.b : TGACGAGCAATTCTACGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SMG01_0103_B07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
AMP01_0093_E11.b : TGACGAGCAATTCTACGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0009_B05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0080_H06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTGGTCTGGCAG*CTGCCTCTG
LNG01_0017_F07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0091_C01.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0021_A08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0004_H03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0071_C11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0057_F08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0097_F03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
OVRT1_0103_D12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0205_F01.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0088_E01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0029_B05.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0042_H08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0109_E01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0016_A11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0103_A06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0084_F12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0073_A02.b : CGACGAGGAATCCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0083_F11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0111_B07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0076_F09.b : GCACCAGGAATTCTATGTGGGACTGGAGAAGAAGGAGATTG*TCTGGGAG*TTGCCTCTG
THY01_0120_G12.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0004_F10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0034_H02.b : GGACGAGGACTTCCACTTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAGGCTGCCTCTG
THY01_0059_H12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LVRM1_0149_H04.b : TGACGAGCAATTCTACGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0051_D07.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0048_G01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCTTCTG
LVRM1_0128_A01.b : TGACGAGCAATTCTACGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0040_E04.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0003_D06.b : CGACCAGGAATTCTACGTGGACCTGGGGAAGATGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0101_F10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0007_E01.b : CGACGAGGAATTCTACCTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0023_C05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0043_D12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0075_B05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0110_C05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0005_F08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0030_G05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0063_G11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0019_E05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0026_H11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0004_D05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0018_E01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0005_D05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0020_B04.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0026_F02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SMG01_0099_G07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SMG01_0032_C06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0016_F03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0021_G02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0001_E11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0016_D12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0045_G12.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0010_A03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0016_C12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0011_H05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0010_C07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0035_F11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0034_D02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0048_E05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0068_H12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0013_E05.b : CCACGAGGAATTCTACGTGGACCTGGGGAAGAAGGACACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0127_E08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0019_F05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0023_E11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0025_D12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0024_B08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0062_A11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0119_D03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0131_A11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0022_G02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0131_A12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0148_C05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0091_F07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0135_C09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0141_F03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0049_C02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0052_C06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0047_B03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0128_D05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0078_F11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0147_B09.b : CGACGAGGAACTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0087_C08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0024_D02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0029_C12.b : CGGCGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0085_H10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0036_G02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0122_H12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0041_E11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0026_F01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0062_C02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0097_A05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0048_C07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0023_E12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0142_B11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0205_H09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0026_G01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0002_D06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0038_G12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0066_E12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0082_D02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0082_E02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0076_D10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0042_B09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0030_F12.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0025_F11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0007_E12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0132_H04.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0025_B12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0032_A09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0100_E12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0026_G07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0101_B04.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0029_B09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0089_A03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0057_F09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0097_G03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0088_H05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0064_D06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0053_D07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0052_G05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0092_D06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0095_C12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0095_G05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0061_F07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0092_E10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAGGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0074_E06.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0133_D01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0080_E04.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0016_D03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0054_B05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0061_D06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0204_G07.b : TGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0088_B03.b : CGACGAGGAATTCTACGTGGACCTGGGGAATAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0046_D01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0021_C04.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0092_F05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0054_H04.b : CGACGAGGAATTCTATGTGGACCCGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0075_F11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0003_E05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0067_H12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0083_D07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0092_H11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0081_H03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0100_B02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0084_B01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0013_H03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0061_D10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0037_E01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0205_G04.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0060_F03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0085_G11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0021_B01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0053_B03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0204_H02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0098_E04.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0071_D10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0070_A02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0009_H01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0083_D04.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0059_B12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0004_F10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0011_E07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0041_B04.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0073_A11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0089_F01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0032_C01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
OVRT1_0069_C03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0089_F10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0063_H06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CAGCCTCTG
CLNT1_0019_D08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0057_B01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0054_B10.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0055_F10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0061_E09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0046_G05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0076_B05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0076_E02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0097_C07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0027_A09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0100_E01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0073_A08.b : CGACGAGGAATTCTTCGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0104_C12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0066_D11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0071_B12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0084_H02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0077_E06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0044_H10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0100_D10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0073_C01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0047_D03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0072_B10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0052_D07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0067_E11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0095_E12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0085_D06.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0103_B04.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0085_E01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0040_B12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0087_E05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0086_G05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0062_D12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0048_F04.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0078_D02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0081_E11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0028_D03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0077_D08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0030_D08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0091_F03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0028_B10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
OVRT1_0045_A10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0093_C06.b : CGACGAGGAATTCCACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0036_E01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0106_G11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0092_C01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*C*GCCTCTG
CLNT1_0042_B09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0065_C12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TCH01_0084_F04.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0057_C04.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0009_H02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0097_F05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0109_D02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TCH01_0080_G01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0086_H06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0071_C01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0050_G02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0042_F08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0042_H12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0062_G05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0059_D09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0096_A01.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0019_B10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0059_A04.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TCH01_0028_B03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0090_D02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0100_A06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0064_C05.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0092_A05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0206_H01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0096_B06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0094_C08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0021_H03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0027_A09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0055_A09.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TCH01_0101_A01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0104_C06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TCH01_0085_H12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0077_F02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0029_C10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0087_B03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0106_A10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0103_D03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0047_D06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0084_G07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0080_G07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0002_D12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0022_A01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0056_A12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0066_F10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TCH01_0043_C02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0016_A10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0050_E02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0015_C08.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0010_G08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0072_A12.b : CGACGAGGAATTCTACGTGGACCTAGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPLT1_0044_D10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0056_E03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPLT1_0084_E07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0006_A12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0042_B02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAGGGAGACTG*TCTGGCAG*CTGCCTCTG
ILNT1_0037_G06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0099_H01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0009_F12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0032_B02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0080_B12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
KDN01_0062_B05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PST01_0043_H06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPLT1_0001_C09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0096_C07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0058_F07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPLT1_0002_F08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0088_D07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0032_D06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0075_B12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0051_E09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0019_D06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0078_D11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0083_G11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0113_G10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SMG01_0051_F08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0027_D11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0036_G06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
OVRT1_0119_A03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0049_C09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0134_E01.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0029_E02.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0054_G03.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0074_H07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0091_H05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0084_C05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0038_C08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0052_H09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0059_C09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0054_A08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0100_C03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0029_H09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0031_C11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TCH01_0094_H11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0073_D06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0011_G06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0046_A12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0002_H09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
PBL01_0070_A10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
KDN01_0014_G12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0114_E07.b : CGACGAGGAATTCTATGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0109_F08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0128_E04.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0024_B08.b : CGACGAGGAATTCTGCGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0093_H02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0056_B02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0059_B11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0007_G08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0026_B12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAAAAGGAAACTG*TCTGGCAG*CTGCCTCTG
AMP01_0077_E01.b : TGACGAGCAATTCTACGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0042_B10.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0025_H04.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
AMP01_0087_C04.b : TGACGAGCAATTCTACGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
OVRT1_0016_D02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
AMP01_0004_F02.b : TGACGAGCAATTCTACGTGGACCTGGAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
LNG01_0028_G02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0113_C04.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0068_B09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0060_D12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0061_B07.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0063_A02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0041_F05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
CLNT1_0112_E08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0052_C05.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0100_G02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPL01_0092_B03.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
TES01_0051_F09.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAACGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0059_B02.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
SPLT1_0098_F11.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0207_D12.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0107_B08.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
THY01_0108_F07.b : CGACGAGGAATTCTATGTGGACCTGTAGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
MLN01_0019_G06.b : CGACGAGGAATTCTACGTGGACCTGGGGAAGAAGGAGACTG*TCTGGCAG*CTGCCTCTG
ITT01_0086_H05.b : xxxxxxxxxxxxxxxxxxxxtcattgctctacaactccgaagagcaaCAG*CTGCCTCTG
MLN01_0063_D04.b : nnggctaggac
MLN01_0022_F02.b :
LNG01_0063_C07.b :
AMP01_0076_B10.b : aatcctttaagatat
ILNT1_0015_D06.b :
ILNT1_0009_A10.b :
ILNT1_0042_G12.b :
SPLT1_0047_G09.b :
SPLT1_0066_C05.b :
SPLT1_0054_E10.b :
SPLT1_0049_D07.b :
20110601C-001518 : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
---------+---------+---------+---------+---------+---------+ 438
TCH01_0010_G01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPLT1_0039_D12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0009_H12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0079_E01.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0069_F09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0098_A03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0078_C11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
OVRM1_0206_E09.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
OVRM1_0206_H11.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0073_F10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0103_D04.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGCGCACTGAGGAACATAGCTACGGCAAAA
THY01_0029_F11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0019_G02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0093_F07.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0094_G01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0076_B10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0021_C02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0003_G02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0092_B05.b : TTTAGCAAATTTAGAAGTTTTAACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0204_F01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0089_C01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0006_A04.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SMG01_0023_B10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0022_A12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0091_C08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ILNT1_0019_A08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0088_H03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0017_F12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0020_D05.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0013_B10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0036_F03.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0028_D04.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0040_G09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0084_E06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
OVRT1_0145_F04.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0062_B09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
OVRT1_0043_D10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0087_A03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0024_B12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0090_H11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PST01_0077_E10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0083_B02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0020_C07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0099_D03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0098_A05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0106_G10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0106_F06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0054_E08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0076_A09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0063_B02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGTAAAA
KDN01_0013_G12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0141_D09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPLT1_0030_B12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0051_G08.b : TTTAGCAAATTTACAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCTAAA
TES01_0076_A11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0057_H10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0151_D11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0133_C05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0017_G09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0054_B10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0022_B08.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0119_G01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0082_C05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TCH01_0084_C09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0014_C07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0028_H05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0081_E11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0085_D12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0032_B06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ILNT1_0090_A03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0093_C01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0027_B05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TCH01_0096_G05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0089_F06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PST01_0074_H02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0105_E01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0100_F01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0074_H09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0085_D11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0044_C11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0068_G05.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPLT1_0020_A04.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0016_F06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0060_A03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0021_A05.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0014_C05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0045_G06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPLT1_0019_A03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
AMP01_0102_D12.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SMG01_0103_B07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
AMP01_0093_E11.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0009_B05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0080_H06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0017_F07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0091_C01.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0021_A08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0004_H03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0071_C11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0057_F08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0097_F03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
OVRT1_0103_D12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0205_F01.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0088_E01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0029_B05.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0042_H08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0109_E01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0016_A11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0103_A06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0084_F12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0073_A02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0083_F11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0111_B07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0076_F09.b : TTTAG*AAATTTACCAGTTTTGACCCCCAGGGTGCACTGAGGAACATAGCTACCGGAAAA
THY01_0120_G12.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0004_F10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0034_H02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACCGCAAAA
THY01_0059_H12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LVRM1_0149_H04.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0051_D07.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0048_G01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LVRM1_0128_A01.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0040_E04.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0003_D06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACCGCAAAC
TES01_0101_F10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0007_E01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0023_C05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0043_D12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0075_B05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0110_C05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0005_F08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0030_G05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0063_G11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0019_E05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0026_H11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0004_D05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0018_E01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0005_D05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0020_B04.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0026_F02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SMG01_0099_G07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SMG01_0032_C06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0016_F03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0021_G02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0001_E11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0016_D12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0045_G12.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0010_A03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0016_C12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0011_H05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0010_C07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0035_F11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0034_D02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0048_E05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0068_H12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0013_E05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAAGATAGCTACTGCAAAA
CLNT1_0127_E08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0019_F05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0023_E11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0025_D12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0024_B08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0062_A11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0119_D03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0131_A11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0022_G02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0131_A12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0148_C05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0091_F07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0135_C09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0141_F03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0049_C02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0052_C06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0047_B03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0128_D05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0078_F11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0147_B09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0087_C08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0024_D02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0029_C12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0085_H10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0036_G02.b : TTTAGCGAATTTACAAGTTTTGACCCACGGGGTGCACTGAGGAACATATCTACGGCAAAA
CLNT1_0122_H12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0041_E11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0026_F01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0062_C02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0097_A05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0048_C07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0023_E12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0142_B11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0205_H09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0026_G01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0002_D06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0038_G12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0066_E12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0082_D02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0082_E02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0076_D10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0042_B09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0030_F12.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0025_F11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0007_E12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0132_H04.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0025_B12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0032_A09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0100_E12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0026_G07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0101_B04.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0029_B09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0089_A03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0057_F09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0097_G03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0088_H05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0064_D06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAGCATAGCTACGGCAAAA
THY01_0053_D07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0052_G05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0092_D06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0095_C12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0095_G05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCGCTGAGGAACATAGCTACGGCAAAA
MLN01_0061_F07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0092_E10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0074_E06.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0133_D01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0080_E04.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0016_D03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0054_B05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0061_D06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0204_G07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0088_B03.b : TTTAACACATTTAGAAGTTTTGACCCACAGGGTGCACTGACGAACATACCTACGGCAGAA
PBL01_0046_D01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0021_C04.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0092_F05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0054_H04.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0075_F11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0003_E05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0067_H12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0083_D07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0092_H11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0081_H03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0100_B02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0084_B01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0013_H03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0061_D10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0037_E01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0205_G04.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0060_F03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0085_G11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0021_B01.b : TTTAGCAAATTTAGAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0053_B03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0204_H02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0098_E04.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0071_D10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0070_A02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0009_H01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0083_D04.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0059_B12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0004_F10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0011_E07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0041_B04.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0073_A11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0089_F01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0032_C01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
OVRT1_0069_C03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0089_F10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0063_H06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0019_D08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0057_B01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACGGAGGAACATAGCTACGGCAAAA
THY01_0054_B10.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0055_F10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0061_E09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0046_G05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0076_B05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0076_E02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0097_C07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0027_A09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0100_E01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0073_A08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGGACATAGCTACGGCAAAA
LNG01_0104_C12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0066_D11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0071_B12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0084_H02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0077_E06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0044_H10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0100_D10.b : TTTAGCAAATTTAGAAGTTTTGGCCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0073_C01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0047_D03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0072_B10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0052_D07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0067_E11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0095_E12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0085_D06.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0103_B04.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0085_E01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0040_B12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0087_E05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0086_G05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0062_D12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0048_F04.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0078_D02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0081_E11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0028_D03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0077_D08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0030_D08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0091_F03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0028_B10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
OVRT1_0045_A10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0093_C06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0036_E01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0106_G11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0092_C01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0042_B09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0065_C12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TCH01_0084_F04.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0057_C04.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0009_H02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0097_F05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0109_D02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TCH01_0080_G01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0086_H06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0071_C01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0050_G02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0042_F08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0042_H12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0062_G05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0059_D09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0096_A01.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0019_B10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0059_A04.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TCH01_0028_B03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0090_D02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0100_A06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0064_C05.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0092_A05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0206_H01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0096_B06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0094_C08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0021_H03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0027_A09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0055_A09.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TCH01_0101_A01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0104_C06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TCH01_0085_H12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0077_F02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0029_C10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTGCGGCAAAA
ITT01_0087_B03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATGGCTACGGCAAAA
PBL01_0106_A10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0103_D03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0047_D06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0084_G07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0080_G07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0002_D12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0022_A01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0056_A12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0066_F10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TCH01_0043_C02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0016_A10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0050_E02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0015_C08.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0010_G08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0072_A12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPLT1_0044_D10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0056_E03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPLT1_0084_E07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0006_A12.b : TTTAGCAAATATAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0042_B02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ILNT1_0037_G06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0099_H01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0009_F12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0032_B02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0080_B12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
KDN01_0062_B05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PST01_0043_H06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPLT1_0001_C09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0096_C07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0058_F07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPLT1_0002_F08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0088_D07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0032_D06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0075_B12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0051_E09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0019_D06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0078_D11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0083_G11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0113_G10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SMG01_0051_F08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0027_D11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0036_G06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
OVRT1_0119_A03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0049_C09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0134_E01.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0029_E02.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0054_G03.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0074_H07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0091_H05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0084_C05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0038_C08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0052_H09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0059_C09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0054_A08.b : TTTAGCAAATTTAGAAGTTTTGACCCCCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0100_C03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCGAAA
PBL01_0029_H09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0031_C11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TCH01_0094_H11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0073_D06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0011_G06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0046_A12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0002_H09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
PBL01_0070_A10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
KDN01_0014_G12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0114_E07.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0109_F08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0128_E04.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0024_B08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0093_H02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0056_B02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0059_B11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0007_G08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0026_B12.b : TTTAGCAAATTTAAAAGTTTTGACCCACAGGGGGCACTGAGGAACATAGCTACGGCAAAA
AMP01_0077_E01.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0042_B10.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0025_H04.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
AMP01_0087_C04.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
OVRT1_0016_D02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
AMP01_0004_F02.b : TTTAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATAGCTACGGCAAAA
LNG01_0028_G02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0113_C04.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0068_B09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0060_D12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0061_B07.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0063_A02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0041_F05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
CLNT1_0112_E08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0052_C05.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0100_G02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPL01_0092_B03.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
TES01_0051_F09.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATACCTACGGTCAAA
MLN01_0059_B02.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
SPLT1_0098_F11.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0207_D12.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0107_B08.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
THY01_0108_F07.b : TATAGCAAATTTACAAGTTTTGACCCGCAGGGTGCACTGAGGAACATACCTACGGCAAAA
MLN01_0019_G06.b : TTTAGCAAATTTAGAAGTTTTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
ITT01_0086_H05.b : TTTAGCAAATTTAGAAGTTCTGACCCACAGGGTGCACTGAGGAACATAGCTACGGCAAAA
MLN01_0063_D04.b : tatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0022_F02.b : nnnnggtaggacatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0063_C07.b : nttttcgcggcttggactatgacxxxxx
AMP01_0076_B10.b : cttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0015_D06.b :
ILNT1_0009_A10.b :
ILNT1_0042_G12.b :
SPLT1_0047_G09.b :
SPLT1_0066_C05.b :
SPLT1_0054_E10.b :
SPLT1_0049_D07.b :
20110601C-001518 : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
---------+---------+---------+---------+---------+---------+ 496
TCH01_0010_G01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPLT1_0039_D12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0009_H12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0079_E01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0069_F09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0098_A03.b : CATAATTCGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0078_C11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
OVRM1_0206_E09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
OVRM1_0206_H11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0073_F10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0103_D04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0029_F11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0019_G02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0093_F07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0094_G01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0076_B10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0021_C02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0003_G02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0092_B05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0204_F01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0089_C01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0006_A04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SMG01_0023_B10.b : CATAACTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0022_A12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0091_C08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ILNT1_0019_A08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0088_H03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0017_F12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0020_D05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0013_B10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0036_F03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0028_D04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0040_G09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0084_E06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
OVRT1_0145_F04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0062_B09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
OVRT1_0043_D10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0087_A03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0024_B12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0090_H11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PST01_0077_E10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0083_B02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0020_C07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0099_D03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0098_A05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0106_G10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0106_F06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0054_E08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0076_A09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0063_B02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
KDN01_0013_G12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0141_D09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPLT1_0030_B12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0051_G08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAAGTT*C
TES01_0076_A11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0057_H10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0151_D11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0133_C05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0017_G09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0054_B10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0022_B08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0119_G01.b : CATAATTTGTACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0082_C05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TCH01_0084_C09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0014_C07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0028_H05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0081_E11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0085_D12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0032_B06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ILNT1_0090_A03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0093_C01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0027_B05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TCH01_0096_G05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0089_F06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PST01_0074_H02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0105_E01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0100_F01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0074_H09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGGTGTCAA*TCAGTTT*C
ITT01_0085_D11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0044_C11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0068_G05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPLT1_0020_A04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0016_F06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0060_A03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0021_A05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0014_C05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0045_G06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPLT1_0019_A03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
AMP01_0102_D12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SMG01_0103_B07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
AMP01_0093_E11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0009_B05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0080_H06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0017_F07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0091_C01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0021_A08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0004_H03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0071_C11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0057_F08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0097_F03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
OVRT1_0103_D12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0205_F01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0088_E01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0029_B05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0042_H08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0109_E01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0016_A11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0103_A06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0084_F12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0073_A02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0083_F11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0111_B07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0076_F09.b : CATAATTTGAACATCCTGATTAAACGTTCCCACCCCACCGCGGCTGTCAA*TCCGGTT*T
THY01_0120_G12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0004_F10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0034_H02.b : CCTAACTTGAACATCCTGATTAAACGTTCCAGCAACACCGCGGCTGTCAA*TCACGTT*C
THY01_0059_H12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LVRM1_0149_H04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAAGTT*C
THY01_0051_D07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0048_G01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LVRM1_0128_A01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0040_E04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0003_D06.b : CATAATTTGAACATCCTGATTAAGCGTTCCAACAGCACCGCGGCTGTCAA*TCAGGTT*C
TES01_0101_F10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0007_E01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0023_C05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTTCC
THY01_0043_D12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0075_B05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0110_C05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0005_F08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0030_G05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0063_G11.b : CATAATTTGAACATCCTGATTAGACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0019_E05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0026_H11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0004_D05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0018_E01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0005_D05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0020_B04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0026_F02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SMG01_0099_G07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SMG01_0032_C06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*CCAGGTT*C
SPL01_0016_F03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0021_G02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0001_E11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0016_D12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0045_G12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0010_A03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0016_C12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0011_H05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0010_C07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0035_F11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0034_D02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0048_E05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0068_H12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0013_E05.b : CATAATTTGAACATCCTGATTACACGTTCCAACAACACCGCGGCTGTCGA*TCATGTT*C
CLNT1_0127_E08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0019_F05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0023_E11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0025_D12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0024_B08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0062_A11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0119_D03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0131_A11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0022_G02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0131_A12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0148_C05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0091_F07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0135_C09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0141_F03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0049_C02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0052_C06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0047_B03.b : CATAATTTGAACACCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0128_D05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0078_F11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0147_B09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0087_C08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0024_D02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0029_C12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0085_H10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0036_G02.b : CATAATTTGAACATCCTGATTAAACGTTCCAGCAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0122_H12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0041_E11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0026_F01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0062_C02.b : CATAATTTGAACATCCTGATTAAGCGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0097_A05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0048_C07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0023_E12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0142_B11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0205_H09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0026_G01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0002_D06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0038_G12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0066_E12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0082_D02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0082_E02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0076_D10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0042_B09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0030_F12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0025_F11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0007_E12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0132_H04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0025_B12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0032_A09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0100_E12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0026_G07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0101_B04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0029_B09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0089_A03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0057_F09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0097_G03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0088_H05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0064_D06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0053_D07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0052_G05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0092_D06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0095_C12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0095_G05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0061_F07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0092_E10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0074_E06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0133_D01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0080_E04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0016_D03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0054_B05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0061_D06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0204_G07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0088_B03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0046_D01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0021_C04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0092_F05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0054_H04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0075_F11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0003_E05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0067_H12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0083_D07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0092_H11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0081_H03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0100_B02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0084_B01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0013_H03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0061_D10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0037_E01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0205_G04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCGGGTT*C
ITT01_0060_F03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0085_G11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0021_B01.b : CATAATTTGAACGTCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0053_B03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0204_H02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0098_E04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0071_D10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0070_A02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0009_H01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0083_D04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0059_B12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0004_F10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0011_E07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0041_B04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0073_A11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0089_F01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0032_C01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
OVRT1_0069_C03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0089_F10.b : CATAATTTGAACATCCTGATCAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0063_H06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0019_D08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0057_B01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0054_B10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0055_F10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0061_E09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0046_G05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0076_B05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0076_E02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0097_C07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0027_A09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0100_E01.b : CATGATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0073_A08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0104_C12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0066_D11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0071_B12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0084_H02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0077_E06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0044_H10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0100_D10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0073_C01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0047_D03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0072_B10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0052_D07.b : CATAATTTGAACATCCTGATTAAACGTTC*AACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0067_E11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0095_E12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACGACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0085_D06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0103_B04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0085_E01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0040_B12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0087_E05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0086_G05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0062_D12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0048_F04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0078_D02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0081_E11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0028_D03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0077_D08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0030_D08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0091_F03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0028_B10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
OVRT1_0045_A10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0093_C06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0036_E01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0106_G11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0092_C01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0042_B09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0065_C12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TCH01_0084_F04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0057_C04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0009_H02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0097_F05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0109_D02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TCH01_0080_G01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACTGCGGCTGTCAA*TCAGGTT*C
PBL01_0086_H06.b : CATAATTTGAACATCCTGGTTAAACGTTCCAACAACACCGCGGCTGTCAA*CCAGGTT*C
LNG01_0071_C01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0050_G02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0042_F08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0042_H12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0062_G05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0059_D09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0096_A01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0019_B10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0059_A04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TCH01_0028_B03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0090_D02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0100_A06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0064_C05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0092_A05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0206_H01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0096_B06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0094_C08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0021_H03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0027_A09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0055_A09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TCH01_0101_A01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0104_C06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TCH01_0085_H12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0077_F02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0029_C10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0087_B03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0106_A10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0103_D03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0047_D06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0084_G07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0080_G07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0002_D12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0022_A01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0056_A12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0066_F10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TCH01_0043_C02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0016_A10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0050_E02.b : CATAATTTGAACATCCTGATTAAACGTTTCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0015_C08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0010_G08.b : TATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0072_A12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPLT1_0044_D10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0056_E03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPLT1_0084_E07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0006_A12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0042_B02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ILNT1_0037_G06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0099_H01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0009_F12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0032_B02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0080_B12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
KDN01_0062_B05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PST01_0043_H06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPLT1_0001_C09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0096_C07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0058_F07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPLT1_0002_F08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0088_D07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0032_D06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0075_B12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0051_E09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0019_D06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0078_D11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0083_G11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0113_G10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAAATCAGGTT*C
SMG01_0051_F08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0027_D11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0036_G06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
OVRT1_0119_A03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0049_C09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0134_E01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0029_E02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0054_G03.b : CATAATTTGAACATCCTGATTAAACGTTCCGACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0074_H07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0091_H05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0084_C05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0038_C08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0052_H09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0059_C09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0054_A08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCCGTCAA*TCAGGTT*C
THY01_0100_C03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0029_H09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0031_C11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TCH01_0094_H11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0073_D06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0011_G06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0046_A12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0002_H09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
PBL01_0070_A10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
KDN01_0014_G12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0114_E07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0109_F08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0128_E04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0024_B08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0093_H02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0056_B02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0059_B11.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGCCAA*TCAGGTT*C
TES01_0007_G08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0026_B12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
AMP01_0077_E01.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0042_B10.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0025_H04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
AMP01_0087_C04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
OVRT1_0016_D02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
AMP01_0004_F02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0028_G02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0113_C04.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0068_B09.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0060_D12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0061_B07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0063_A02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0041_F05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
CLNT1_0112_E08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0052_C05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0100_G02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPL01_0092_B03.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
TES01_0051_F09.b : CATAATTTGAACATCCTGATTAAACGTTCCAGCAACACCGCGGCTGTCTA*TCATGTT*C
MLN01_0059_B02.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
SPLT1_0098_F11.b : CATAATTTGAACATCCTGATTAAACGTTCCANNCACACCGCGGCTGTNCA*TCAGGTT*C
THY01_0207_D12.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0107_B08.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
THY01_0108_F07.b : CATAATTTGAACATCCTGATTAAACGTTCCAACGACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0019_G06.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
ITT01_0086_H05.b : CATAATTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0063_D04.b : xxxxxxTTGAACATCCTGATTAAACGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
MLN01_0022_F02.b : xxxxxxxxxxxxxxxxxxxxxxggtGTTCCAACAACACCGCGGCTGTCAA*TCAGGTT*C
LNG01_0063_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAA*TCAGGTT*C
AMP01_0076_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0015_D06.b :
ILNT1_0009_A10.b :
ILNT1_0042_G12.b :
SPLT1_0047_G09.b :
SPLT1_0066_C05.b :
SPLT1_0054_E10.b :
SPLT1_0049_D07.b :
20110601C-001518 : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
---------+---------+---------+---------+---------+---------+ 554
TCH01_0010_G01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPLT1_0039_D12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0009_H12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0079_E01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0069_F09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0098_A03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0078_C11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
OVRM1_0206_E09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
OVRM1_0206_H11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0073_F10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0103_D04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0029_F11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0019_G02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0093_F07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0094_G01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0076_B10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0021_C02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0003_G02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0092_B05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0204_F01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0089_C01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0006_A04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SMG01_0023_B10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0022_A12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0091_C08.b : CTGAGGTGAC*TGTGCTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ILNT1_0019_A08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0088_H03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0017_F12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0020_D05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0013_B10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0036_F03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0028_D04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0040_G09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0084_E06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
OVRT1_0145_F04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0062_B09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
OVRT1_0043_D10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0087_A03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0024_B12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0090_H11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PST01_0077_E10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0083_B02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0020_C07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0099_D03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0098_A05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0106_G10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0106_F06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0054_E08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0076_A09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0063_B02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
KDN01_0013_G12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0141_D09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPLT1_0030_B12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0051_G08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0076_A11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0057_H10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0151_D11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0133_C05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0017_G09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0054_B10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0022_B08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0119_G01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0082_C05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TCH01_0084_C09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0014_C07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0028_H05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0081_E11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0085_D12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0032_B06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ILNT1_0090_A03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0093_C01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0027_B05.b : CTGAGGTGAC*TGTGGTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TCH01_0096_G05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0089_F06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PST01_0074_H02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0105_E01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0100_F01.b : CTGAGGTGAC*TGTGTTTNCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0074_H09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0085_D11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0044_C11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0068_G05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPLT1_0020_A04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0016_F06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0060_A03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0021_A05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0014_C05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0045_G06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPLT1_0019_A03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
AMP01_0102_D12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SMG01_0103_B07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
AMP01_0093_E11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0009_B05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0080_H06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0017_F07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0091_C01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0021_A08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0004_H03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0071_C11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0057_F08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0097_F03.b : CTGAGGTGAC*TGTGCTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
OVRT1_0103_D12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0205_F01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0088_E01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0029_B05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0042_H08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0109_E01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0016_A11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0103_A06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0084_F12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0073_A02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0083_F11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0111_B07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0076_F09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGGT*GGGTAAGCCCAACACCCTCAT
THY01_0120_G12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0004_F10.b : CTGAGGTGAC*TGTGTTTCCCCAGTCTCCCGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0034_H02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCGATGATGCT*GGGTCACCCCAACACCCTCAT
THY01_0059_H12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LVRM1_0149_H04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0051_D07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0048_G01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LVRM1_0128_A01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0040_E04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0003_D06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0101_F10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0007_E01.b : CTGAGGTGAC*TGCGTTTCCCAAGTCTCCAGTGATGCT*GGGCCAGCCCAACACCCTCAT
PBL01_0023_C05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0043_D12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0075_B05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCGGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0110_C05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0005_F08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0030_G05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0063_G11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0019_E05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0026_H11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0004_D05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0018_E01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0005_D05.b : CTGAGGCGAC*TGTGTTTCCCAAGTCTCCAGCGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0020_B04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0026_F02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SMG01_0099_G07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SMG01_0032_C06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0016_F03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0021_G02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0001_E11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0016_D12.b : CTGAGGTGACCTGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0045_G12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0010_A03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0016_C12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0011_H05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0010_C07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0035_F11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0034_D02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0048_E05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0068_H12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0013_E05.b : CTGACGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0127_E08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0019_F05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0023_E11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0025_D12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0024_B08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0062_A11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0119_D03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0131_A11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0022_G02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0131_A12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATTCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0148_C05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0091_F07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0135_C09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0141_F03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0049_C02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0052_C06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0047_B03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0128_D05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0078_F11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0147_B09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0087_C08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0024_D02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0029_C12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0085_H10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0036_G02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0122_H12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0041_E11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0026_F01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0062_C02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0097_A05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0048_C07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0023_E12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0142_B11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0205_H09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0026_G01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0002_D06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0038_G12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0066_E12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0082_D02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0082_E02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0076_D10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0042_B09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0030_F12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0025_F11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0007_E12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0132_H04.b : CTGAGGTGAC*TGTGTTTCCCAGGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0025_B12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0032_A09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0100_E12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0026_G07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0101_B04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0029_B09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0089_A03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0057_F09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0097_G03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0088_H05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0064_D06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0053_D07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0052_G05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0092_D06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0095_C12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0095_G05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0061_F07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0092_E10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0074_E06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0133_D01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0080_E04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0016_D03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0054_B05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0061_D06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0204_G07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0088_B03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCATCCCAACACCCTCAT
PBL01_0046_D01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0021_C04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0092_F05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0054_H04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0075_F11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0003_E05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0067_H12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCACAACACCCTCAT
SPL01_0083_D07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0092_H11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0081_H03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0100_B02.b : CTGAGATGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0084_B01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0013_H03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0061_D10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0037_E01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0205_G04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0060_F03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0085_G11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0021_B01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0053_B03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0204_H02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0098_E04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0071_D10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0070_A02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0009_H01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0083_D04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0059_B12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0004_F10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0011_E07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0041_B04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0073_A11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0089_F01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0032_C01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
OVRT1_0069_C03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0089_F10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0063_H06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0019_D08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0057_B01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0054_B10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0055_F10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0061_E09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0046_G05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0076_B05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0076_E02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0097_C07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0027_A09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0100_E01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0073_A08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0104_C12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0066_D11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0071_B12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0084_H02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0077_E06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0044_H10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0100_D10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0073_C01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0047_D03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0072_B10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0052_D07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0067_E11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0095_E12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0085_D06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0103_B04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0085_E01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0040_B12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0087_E05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0086_G05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0062_D12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0048_F04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0078_D02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0081_E11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0028_D03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0077_D08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0030_D08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0091_F03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0028_B10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
OVRT1_0045_A10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0093_C06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0036_E01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0106_G11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0092_C01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0042_B09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0065_C12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TCH01_0084_F04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0057_C04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0009_H02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0097_F05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0109_D02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TCH01_0080_G01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0086_H06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0071_C01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0050_G02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0042_F08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0042_H12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0062_G05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0059_D09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0096_A01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0019_B10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0059_A04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TCH01_0028_B03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0090_D02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0100_A06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0064_C05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0092_A05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0206_H01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0096_B06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0094_C08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0021_H03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0027_A09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0055_A09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TCH01_0101_A01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0104_C06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TCH01_0085_H12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0077_F02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0029_C10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0087_B03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0106_A10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0103_D03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0047_D06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0084_G07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0080_G07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0002_D12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0022_A01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0056_A12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0066_F10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TCH01_0043_C02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCGT
ITT01_0016_A10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0050_E02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0015_C08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0010_G08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0072_A12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPLT1_0044_D10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0056_E03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPLT1_0084_E07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0006_A12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0042_B02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ILNT1_0037_G06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0099_H01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCCCAC
LNG01_0009_F12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0032_B02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0080_B12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
KDN01_0062_B05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PST01_0043_H06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPLT1_0001_C09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0096_C07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0058_F07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPLT1_0002_F08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0088_D07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0032_D06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0075_B12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0051_E09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0019_D06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0078_D11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0083_G11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0113_G10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SMG01_0051_F08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GAGTCAGCCCAACACCCTCAT
SPL01_0027_D11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0036_G06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
OVRT1_0119_A03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0049_C09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0134_E01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0029_E02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0054_G03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0074_H07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0091_H05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0084_C05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0038_C08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0052_H09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0059_C09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0054_A08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0100_C03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0029_H09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0031_C11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TCH01_0094_H11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0073_D06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0011_G06.b : CTGAGGTGAC*TGTGTTTCCCAAGCCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0046_A12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0002_H09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
PBL01_0070_A10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
KDN01_0014_G12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0114_E07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0109_F08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0128_E04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0024_B08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0093_H02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0056_B02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0059_B11.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0007_G08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0026_B12.b : CTGAGGGGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
AMP01_0077_E01.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0042_B10.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0025_H04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
AMP01_0087_C04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
OVRT1_0016_D02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
AMP01_0004_F02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0028_G02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0113_C04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0068_B09.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0060_D12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0061_B07.b : CTGAGGTGAC*TGTGCTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0063_A02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0041_F05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
CLNT1_0112_E08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0052_C05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0100_G02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPL01_0092_B03.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
TES01_0051_F09.b : CTGAGGTGAC*TGAGTTTCCCAAGTCTCCATTGATGCTTGGGTCAGCCCAACACCCTCAT
MLN01_0059_B02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
SPLT1_0098_F11.b : CTGAGGTGAC*TGTNGTTTCCAAGTCTCCAGTGATGCT*GGGTCAGCCCCACACCCTCAT
THY01_0207_D12.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0107_B08.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
THY01_0108_F07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0019_G06.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ITT01_0086_H05.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0063_D04.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
MLN01_0022_F02.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
LNG01_0063_C07.b : CTGAGGTGAC*TGTGTTTCCCAAGTCTCCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
AMP01_0076_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGTGATGCT*GGGTCAGCCCAACACCCTCAT
ILNT1_0015_D06.b :
ILNT1_0009_A10.b :
ILNT1_0042_G12.b :
SPLT1_0047_G09.b :
SPLT1_0066_C05.b :
SPLT1_0054_E10.b :
SPLT1_0049_D07.b :
20110601C-001518 : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
---------+---------+---------+---------+---------+---------+ 613
TCH01_0010_G01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPLT1_0039_D12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
TES01_0009_H12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0079_E01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0069_F09.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0098_A03.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
ITT01_0078_C11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
OVRM1_0206_E09.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
OVRM1_0206_H11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0073_F10.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0103_D04.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0029_F11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
TES01_0019_G02.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0093_F07.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0094_G01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
TES01_0076_B10.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
TES01_0021_C02.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
TES01_0003_G02.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
ITT01_0092_B05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0204_F01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0089_C01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
TES01_0006_A04.b : CCGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SMG01_0023_B10.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
TES01_0022_A12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0091_C08.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
ILNT1_0019_A08.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
TES01_0088_H03.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
TES01_0017_F12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0020_D05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0013_B10.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0036_F03.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0028_D04.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0040_G09.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
TES01_0084_E06.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
OVRT1_0145_F04.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0062_B09.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
OVRT1_0043_D10.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
TES01_0087_A03.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0024_B12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0090_H11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PST01_0077_E10.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0083_B02.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0020_C07.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
MLN01_0099_D03.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGGAC*GGGC
PBL01_0098_A05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0106_G10.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0106_F06.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0054_E08.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
MLN01_0076_A09.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0063_B02.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
KDN01_0013_G12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0141_D09.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPLT1_0030_B12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
TES01_0051_G08.b : CTGTCATGTGGACAACATCTTTCCTCCTATGATCAACATCACGTGGTTGAAGAAC*GGGC
TES01_0076_A11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
TES01_0057_H10.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0151_D11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0133_C05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0017_G09.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0054_B10.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0022_B08.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0119_G01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0082_C05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
TCH01_0084_C09.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
ITT01_0014_C07.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
ITT01_0028_H05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0081_E11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0085_D12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0032_B06.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
ILNT1_0090_A03.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0093_C01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0027_B05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
TCH01_0096_G05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
ITT01_0089_F06.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PST01_0074_H02.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0105_E01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0100_F01.b : CTGTCATGTGGACAACATCTTTTCCTCTGTGATCAACATCACGTGGGTGAAGAAC*GGGC
TES01_0074_H09.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATNCACATCACGTGGTTGAAGAAC*GGGC
ITT01_0085_D11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0044_C11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0068_G05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPLT1_0020_A04.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0016_F06.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0060_A03.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0021_A05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0014_C05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0045_G06.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPLT1_0019_A03.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
AMP01_0102_D12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SMG01_0103_B07.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
AMP01_0093_E11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0009_B05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0080_H06.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0017_F07.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0091_C01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0021_A08.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
ITT01_0004_H03.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0071_C11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
ITT01_0057_F08.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0097_F03.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
OVRT1_0103_D12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0205_F01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0088_E01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0029_B05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0042_H08.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0109_E01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0016_A11.b : CTGTCATGTGGACAACACCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0103_A06.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCTCGTGGTTGAAGAAC*GGGC
LNG01_0084_F12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0073_A02.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0083_F11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0111_B07.b : CTGTCATGTGGGCAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0076_F09.b : CTGTCATGTGGACAACATCTTTTCTCCTGTGATCAAAATCCCGTGGGTGAAGAAC*GGGC
THY01_0120_G12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0004_F10.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
MLN01_0034_H02.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACCTCCCGTGGTTCAAGAACGGGGC
THY01_0059_H12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LVRM1_0149_H04.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0051_D07.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0048_G01.b : CTGTCATATGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LVRM1_0128_A01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGAC
THY01_0040_E04.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0003_D06.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAGC*GGGC
TES01_0101_F10.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0007_E01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0023_C05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0043_D12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
MLN01_0075_B05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
TES01_0110_C05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0005_F08.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0030_G05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0063_G11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0019_E05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0026_H11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0004_D05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0018_E01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0005_D05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGCTGAAGAAC*GGGC
THY01_0020_B04.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0026_F02.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SMG01_0099_G07.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SMG01_0032_C06.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGNATCACATCACGTGGTTGAAGAAC*GGGC
SPL01_0016_F03.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0021_G02.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0001_E11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0016_D12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0045_G12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0010_A03.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGCGGTTGAAGAAC*GGGC
THY01_0016_C12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0011_H05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0010_C07.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0035_F11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
MLN01_0034_D02.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0048_E05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0068_H12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0013_E05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0127_E08.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0019_F05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0023_E11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0025_D12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0024_B08.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0062_A11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0119_D03.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0131_A11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0022_G02.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0131_A12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0148_C05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
ITT01_0091_F07.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0135_C09.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0141_F03.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0049_C02.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0052_C06.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0047_B03.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0128_D05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0078_F11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0147_B09.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0087_C08.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0024_D02.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0029_C12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0085_H10.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
MLN01_0036_G02.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0122_H12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
ITT01_0041_E11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0026_F01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0062_C02.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0097_A05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0048_C07.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0023_E12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0142_B11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0205_H09.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0026_G01.b : CTGTCATGTGGACAACATCTTTCTTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0002_D06.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0038_G12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGCC
ITT01_0066_E12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0082_D02.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0082_E02.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0076_D10.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0042_B09.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0030_F12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0025_F11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
MLN01_0007_E12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0132_H04.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
ITT01_0025_B12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0032_A09.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0100_E12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0026_G07.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0101_B04.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0029_B09.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0089_A03.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0057_F09.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0097_G03.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0088_H05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0064_D06.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0053_D07.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0052_G05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0092_D06.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0095_C12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0095_G05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
MLN01_0061_F07.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0092_E10.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0074_E06.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0133_D01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0080_E04.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0016_D03.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0054_B05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0061_D06.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0204_G07.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0088_B03.b : CTGTCATGTGGACGACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0046_D01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0021_C04.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0092_F05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0054_H04.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0075_F11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0003_E05.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
LNG01_0067_H12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0083_D07.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0092_H11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0081_H03.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0100_B02.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0084_B01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0013_H03.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0061_D10.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
ITT01_0037_E01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0205_G04.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
ITT01_0060_F03.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0085_G11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0021_B01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0053_B03.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
THY01_0204_H02.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0098_E04.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
CLNT1_0071_D10.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0070_A02.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0009_H01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
MLN01_0083_D04.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0059_B12.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
SPL01_0004_F10.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
MLN01_0011_E07.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0041_B04.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
ITT01_0073_A11.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTGGTTGAAGAAC*GGGC
PBL01_0089_F01.b : CTGTCATGTGGACAACATCTTTCCTCCTGTGATCAACATCACGTG