[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-001625

Length: 1,258

Sequence [FASTA format sequence]
AGCATCTCCA GAGACGACTC CCAGAACACG GCCTATCTGC AAATGAACAG CCTGAGAACA
GAAGACACGG CCCGCTATTA TTGTGCAGGA GCGGCTGTAG CGATTACTAT ACCGGTTTCT
GCTTTATGCT ATGGATCTCT GGGGCCCAGG CGTTGAAGTC GTCGTGTCCT CAGTGTCTGA
AACCAGCCCC AAAATCTTCC CACTGACTCT GGGGAGCAGC GAGCCTGCCG GATATGTGGT
CATCGCCTGC CTGGTCCGGG ACTTCTTCCC GTCAGAGCCC CTGACAGTAA CCTGGAGCCC
TAGTCGCGAG GGCGTTATTG TCAGAAACTT CCCCCCTGCG CAGGCCGGGG GCCTGTACAC
CATGAGCAGC CAGCTGACCT TGCCAGTCGA GCAGTGCCCA GCCGATCAGA TCCTGAAGTG
CCAAGTGCAG CACCTCTCCA AATCCAGCCA GTCCGTGAAC GTGCCCTGCA AAGATCCATG
TCCCCAGTGC TGCAAGCCCA GCCTGTCCCT GCAGCCACCA GCCCTTGCAG ACCTGCTCCT
GGGCTCCAAT GCCAGCCTCA CGTGCACACT CAGTGGCCTG AAAAAATCCG AGGGTGTCAG
CTTCACCTGG CAGCCCTCAG GTGGGAAGGA TGCCGTCCAG GCGTCCCCCA CGCGTGATTC
CTGTGGCTGC TACAGCGTGT CCAGCATCCT GCCAGGCTGT GCTGATCCTT GGAACAAAGG
AGAGACATTC TCCTGCACCG CCGCCCACTC TGAGTTGAAG AGCGCGCTAA CCGCCACCAT
CACCAAACCC AAAGTGAACA CGTTCCGGCC CCAGGTCCAC CTGCTGCCGC CGCCGTCGGA
GGAGCTGGCC CTCAATGAGC TGGTGACACT GACATGCCTG GTGCGGGGCT TCAGCCCCAA
GGATGTGCTG GTGCGATGGC TGCAAGGGGG CCAGGAACTG CCCCGTGACA AGTACCTCGT
CTGGGAATCC CTGCCAGAGC CTGGCCAGGC CATCCCCACC TACGCCGTGA CCAGCGTGCT
GCGCGTGGAC GCCGAGGACT GGAAGCAGGG AGACACCTTC TCCTGCATGG TGGGCCACGA
GGCCCTGCCC CTGGCCTTCA CCCAGAAGAA CATCGACCGC CTGGCGGGTA AACCCCCCAC
GTCAACGTGT CCGTGGTCAT GGCGGAAGCA GAGGGCATCT GCTACTGGAG CGCCCCGCCC
ACTCGCCCCT CGAATAAACT CCGTGCTCGC TTGAAAAAAA AAAAAAAAAA AAAAAAAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinIGLL5immunoglobulin lambda-like polypeptide 5 [Homo sapiens]. 574e-08O
Contig/Assembly ProteinIGLL1immunoglobulin lambda-like polypeptide 1 isoform a precursor [Homo sapiens]. 53.15e-07O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinIgh-VJ558PREDICTED: hypothetical protein LOC16061 [Mus musculus]. 385e-108O
Contig/Assembly ProteinIgh-VJ558PREDICTED: ig alpha chain C region [Mus musculus]. 383e-108
Contig/Assembly ProteinIgh-VJ558PREDICTED: ig alpha chain C region isoform 1 [Mus musculus]. 383e-108O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC607364PREDICTED: similar to Ig lambda chain C regions isoform 19 [Canis familiaris]. 59.76e-09O
Contig/Assembly ProteinLOC607558PREDICTED: similar to Immunoglobulin lambda-like polypeptide 1 precursor (Immunoglobulin-related 14.1 protein) (Immunoglobulin omega polypeptide) (Lambda 5) (CD179b antigen) [Canis familiaris]. 59.38e-09O
Contig/Assembly ProteinLOC607551PREDICTED: similar to Immunoglobulin lambda-like polypeptide 1 precursor (Immunoglobulin-related 14.1 protein) (Immunoglobulin omega polypeptide) (Lambda 5) (CD179b antigen) [Canis familiaris]. 59.38e-09O
Contig/Assembly ProteinLOC486474PREDICTED: similar to Immunoglobulin lambda-like polypeptide 1 precursor (Immunoglobulin-related 14.1 protein) (Immunoglobulin omega polypeptide) (Lambda 5) (CD179b antigen) [Canis familiaris]. 59.38e-09O
Contig/Assembly ProteinLOC607582PREDICTED: similar to Immunoglobulin lambda-like polypeptide 1 precursor (Immunoglobulin-related 14.1 protein) (Immunoglobulin omega polypeptide) (Lambda 5) (CD179b antigen) [Canis familiaris]. 58.91e-08O
Contig/Assembly ProteinLOC486473PREDICTED: similar to Immunoglobulin lambda-like polypeptide 1 precursor (Immunoglobulin-related 14.1 protein) (Immunoglobulin omega polypeptide) (Lambda 5) (CD179b antigen) [Canis familiaris]. 58.91e-08O
Contig/Assembly ProteinLOC607541PREDICTED: similar to Ig lambda chain C regions [Canis familiaris]. 58.91e-08O
Contig/Assembly ProteinLOC607364PREDICTED: similar to Immunoglobulin lambda-like polypeptide 1 precursor (Immunoglobulin-related 14.1 protein) (Immunoglobulin omega polypeptide) (Lambda 5) (CD179b antigen) isoform 3 [Canis familiaris]. 58.91e-08O
Contig/Assembly ProteinLOC608248PREDICTED: similar to Immunoglobulin lambda-like polypeptide 1 precursor (Immunoglobulin-related 14.1 protein) (Immunoglobulin omega polypeptide) (Lambda 5) (CD179b antigen) [Canis familiaris]. 58.91e-08O
Contig/Assembly ProteinLOC608238PREDICTED: similar to Immunoglobulin lambda-like polypeptide 1 precursor (Immunoglobulin-related 14.1 protein) (Immunoglobulin omega polypeptide) (Lambda 5) (CD179b antigen) [Canis familiaris]. 58.91e-08O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC524810hypothetical protein LOC524810 [Bos taurus]. 485e-144
Contig/Assembly ProteinIGLL1immunoglobulin lambda-like polypeptide 1 [Bos taurus]. 58.22e-08O
Contig/Assembly ProteinLOC616727PREDICTED: immunoglobulin lambda-like polypeptide 1-like [Bos taurus]. 58.22e-08O
Contig/Assembly ProteinLOC100336952PREDICTED: IGL@ protein-like [Bos taurus]. 56.26e-08O
Contig/Assembly ProteinLOC100141470PREDICTED: IGK protein-like [Bos taurus]. 53.54e-07O
Contig/Assembly ProteinLOC100141470PREDICTED: IGK protein-like [Bos taurus]. 53.54e-07O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC396781IgG heavy chain [Sus scrofa]. 1668e-52
Contig/Assembly ProteinLOC100152327immunoglobulin lambda-like polypeptide 5 [Sus scrofa]. 63.23e-10O
Contig/Assembly ProteinLOC100621525PREDICTED: immunoglobulin lambda-like polypeptide 5-like [Sus scrofa]. 62.84e-10O
Contig/Assembly ProteinLOC100523213PREDICTED: immunoglobulin lambda-like polypeptide 5-like [Sus scrofa]. 58.57e-09O


Assembly Members: 43      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ITT010033F08ITT01_0033_F08.bBW978991 
ITT010069H09ITT01_0069_H09.bBW982192 
ITT010081H09ITT01_0081_H09.bBW983245 
ITT010082E04ITT01_0082_E04.bBW983297 
ITT010084B03ITT01_0084_B03.bBW983441 
LNG010005B01LNG01_0005_B01.bBP433981 
MLN010075D01MLN01_0075_D01.bBW963753 
PBL010102C02PBL01_0102_C02.bBW975125 
SMG010095B02SMG01_0095_B02.bFS721437 
TCH010001H06TCH01_0001_H06.bCJ022552 
TCH010002A01TCH01_0002_A01.bCJ022556 
TCH010003F04TCH01_0003_F04.bCJ022680 
TCH010006D03TCH01_0006_D03.bCJ022882 
TCH010014D06TCH01_0014_D06.bCJ023469 
TCH010015D02TCH01_0015_D02.bCJ023539 
TCH010017F06TCH01_0017_F06.bCJ023706 
TCH010026C12TCH01_0026_C12.bCJ024355 
TCH010027E11TCH01_0027_E11.bCJ024452 
TCH010029A09TCH01_0029_A09.bCJ024556 
TCH010029H02TCH01_0029_H02.bCJ024622 
TCH010030D11TCH01_0030_D11.bCJ024663 
TCH010032B07TCH01_0032_B07.bCJ024794 
TCH010038F11TCH01_0038_F11.bCJ025287 
TCH010047H12TCH01_0047_H12.bCJ025984 
TCH010048D03TCH01_0048_D03.bCJ026017 
TCH010059A02TCH01_0059_A02.bCJ026606 
TCH010060G05TCH01_0060_G05.bCJ026727 
TCH010066D09TCH01_0066_D09.bCJ027168 
TCH010067F02TCH01_0067_F02.bCJ027257 
TCH010069A04TCH01_0069_A04.bCJ027344 
TCH010072C03TCH01_0072_C03.bCJ027595 AK350994
TCH010072H02TCH01_0072_H02.bCJ027646 
TCH010075H02TCH01_0075_H02.bCJ027870 
TCH010076B10TCH01_0076_B10.bCJ027894 
TCH010076G12TCH01_0076_G12.bCJ027947 
TCH010079G07TCH01_0079_G07.bCJ028170 
TCH010080E07TCH01_0080_E07.bCJ028225 
TCH010080F10TCH01_0080_F10.bCJ028236 
TCH010092D05TCH01_0092_D05.bCJ029144 
TCH010093B04TCH01_0093_B04.bCJ029200 
TCH010098D08TCH01_0098_D08.bCJ029605 
TCH010103B05TCH01_0103_B05.bCJ029961 
TCH010103D10TCH01_0103_D10.bCJ029986 AK351128

  

SNPs: 2      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
162C200.080WNGCC/A
T2300.920GTC/V
169C2700.931WSTCC/S
T200.069TCT/S


Alignment:      TOP

20110601C-001625 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
TCH01_0103_D10.b : nnnnggcatgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0075_H02.b :
TCH01_0048_D03.b :
TCH01_0017_F06.b :
TCH01_0032_B07.b :
TCH01_0015_D02.b :
TCH01_0093_B04.b :
TCH01_0002_A01.b :
TCH01_0059_A02.b :
TCH01_0103_B05.b : nnnggcttg
TCH01_0030_D11.b : nnnggtagtgacttaacxxxxxxxxxxxx
TCH01_0076_G12.b :
TCH01_0098_D08.b :
ITT01_0033_F08.b :
TCH01_0003_F04.b :
TCH01_0027_E11.b :
TCH01_0092_D05.b :
TCH01_0047_H12.b :
TCH01_0080_F10.b :
TCH01_0026_C12.b :
TCH01_0076_B10.b :
TCH01_0079_G07.b :
SMG01_0095_B02.b :
TCH01_0029_H02.b :
TCH01_0067_F02.b :
TCH01_0060_G05.b :
TCH01_0006_D03.b :
TCH01_0038_F11.b :
TCH01_0014_D06.b :
TCH01_0072_C03.b :
ITT01_0082_E04.b :
ITT01_0081_H09.b :
LNG01_0005_B01.b :
PBL01_0102_C02.b :
ITT01_0069_H09.b :
MLN01_0075_D01.b :
TCH01_0001_H06.b :
TCH01_0080_E07.b :
TCH01_0066_D09.b :
TCH01_0072_H02.b :
ITT01_0084_B03.b :
TCH01_0029_A09.b :
TCH01_0069_A04.b :
20110601C-001625 : ...................AGCATCTCCAGAGACGACTCCCAGAACACGGCCTATCTGCA
---------+---------+---------+---------+---------+---------+ 41
TCH01_0103_D10.b : xxxxxxxxxxxxxxxxxxxAGCATCTCCAGAGACGACTCCCAGAACACGGCCTATCTGCA
TCH01_0075_H02.b : nnnnggcattggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0048_D03.b : ttaggnnggcttgtgacttnacxxxxxxxxxxxxxxxxxxxxx
TCH01_0017_F06.b : nnnngggtaggacttgaca
TCH01_0032_B07.b : nngggtaggactat
TCH01_0015_D02.b : nnna
TCH01_0093_B04.b : ttttggc
TCH01_0002_A01.b : tttttggtagtactatnacxxxxxxxxxxxxxxxxxx
TCH01_0059_A02.b : nnnnnggataggaatatgacxxxxxxxxxxxx
TCH01_0103_B05.b : gacttaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0030_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgaagagaaccg
TCH01_0076_G12.b :
TCH01_0098_D08.b :
ITT01_0033_F08.b : nnnnaatgaacaxxxxxxxxxxxxxxxxxx
TCH01_0003_F04.b : nnggctaggacttgacxxxxxxxxxxxxxxxxxxx
TCH01_0027_E11.b : nnnnggc
TCH01_0092_D05.b : nnnggcttggactataacxxxxxxxxxxxxxxxxx
TCH01_0047_H12.b :
TCH01_0080_F10.b :
TCH01_0026_C12.b :
TCH01_0076_B10.b :
TCH01_0079_G07.b :
SMG01_0095_B02.b :
TCH01_0029_H02.b :
TCH01_0067_F02.b :
TCH01_0060_G05.b :
TCH01_0006_D03.b : nngggtaggact
TCH01_0038_F11.b : nnnng
TCH01_0014_D06.b : nnnnggctaggactatnacxxxxxxxxxxxxxxxxxxx
TCH01_0072_C03.b :
ITT01_0082_E04.b :
ITT01_0081_H09.b :
LNG01_0005_B01.b :
PBL01_0102_C02.b : nnnnggagtaaca
ITT01_0069_H09.b :
MLN01_0075_D01.b :
TCH01_0001_H06.b :
TCH01_0080_E07.b :
TCH01_0066_D09.b :
TCH01_0072_H02.b :
ITT01_0084_B03.b :
TCH01_0029_A09.b :
TCH01_0069_A04.b :
20110601C-001625 : AATGAACAGCCTGAGAACAGAAGACACGGCCCGCTATTATTGTGCAGGAGCGGCTGTAGC
---------+---------+---------+---------+---------+---------+ 101
TCH01_0103_D10.b : AATGAACAGCCTGAGAACAGAAGACACGGCCCGCTATTATTGTGCAGGAGGGGCTGTAGC
TCH01_0075_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxaGTGCAAGACACATTTGCTATACCGATGCCACT
TCH01_0048_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGTGCAGGATCGACTATAGC
TCH01_0017_F06.b : gtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxg
TCH01_0032_B07.b : aacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0015_D02.b : agctaggaatatnacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0093_B04.b : atggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0002_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxacggcccgctattactgtg
TCH01_0059_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxatgtgcaaaaggagag
TCH01_0103_B05.b : xxxxxxatgaccgaagatacggcccgctattactgtgcaacaggcactacggtatttatg
TCH01_0030_D11.b : aagacacggcacgctattactgtgcaagaaacttaggggcgacgatagcggttgctacag
TCH01_0076_G12.b : nnnnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0098_D08.b : nnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0033_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxaagacacggcccgctattactgtgcgagggaatact
TCH01_0003_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgatacggcccgctatt
TCH01_0027_E11.b : taggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0092_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgacacggcccggtatt
TCH01_0047_H12.b : nnnnaagcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0080_F10.b : nnnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0026_C12.b : nnngggctgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0076_B10.b : nnnnggctaggaatatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0079_G07.b : nnnnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0095_B02.b : nnggccttttnnnnngggtaaagcagcggntc
TCH01_0029_H02.b : nnngggtaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0067_F02.b : nnnnccgcatggactatgacagtttgtacxxxxxxxxxxxxxxx
TCH01_0060_G05.b : nnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0006_D03.b : tgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0038_F11.b : gctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0014_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxagaagacacggcccgctat
TCH01_0072_C03.b : ttttgggcttggacttnacxxxxxxxxxxxxxxxxxxx
ITT01_0082_E04.b : nnn
ITT01_0081_H09.b :
LNG01_0005_B01.b : ttccggtctttttttgattcgtgxxxxxxx
PBL01_0102_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgatgggctggggtcag
ITT01_0069_H09.b :
MLN01_0075_D01.b :
TCH01_0001_H06.b :
TCH01_0080_E07.b :
TCH01_0066_D09.b :
TCH01_0072_H02.b :
ITT01_0084_B03.b :
TCH01_0029_A09.b :
TCH01_0069_A04.b :
20110601C-001625 : GATTACTATACCGGTTTCTG*CTT**TATGCTA***TGGATCTC*TGGGGCCCAGGCGTT
---------+---------+---------+---------+---------+---------+ 154
TCH01_0103_D10.b : GATTACTACACCGATTTCGG***C**TATG********GATCTC*TGGGGCCCAGGCGTT
TCH01_0075_H02.b : AATTGCTATTCGTCCTTCGG***G**TATGTTA***TGGATCTC*ACGGGCCCAGGCGTT
TCH01_0048_D03.b : GGTTGCTATACCGGTTTCGG***G**TATGA*******GA*CTC*TGGGGCCCAGGCGTT
TCH01_0017_F06.b : gactatggTACTAGTTGCTGTCTT**TATG********GATCTC*TGGGGCCCAGGCGTT
TCH01_0032_B07.b : xxxxxtaaTACTAGTTCCTGTCTT**TATG********GATCTC*TGGGGCCCAGGCGTT
TCH01_0015_D02.b : xxxxxxxxxxxxxxxtccTGAATTACTATGCTA***TGGATCTT*TGGGGCCCAGGCGTT
TCH01_0093_B04.b : xxxxxxxxxxxxxxtgattatCTT**TACGGTA***TGCATGTC*TGGGGGCCAGGCGTT
TCH01_0002_A01.b : caacgttcggcagcaaaacaaTTTATTTTGCGA***TGGATCTC*TGGGGCCCAGGCGTT
TCH01_0059_A02.b : tgggagctgacgcgagtgggccTG**GACGTTA***TGGATCTC*TGGGGCCCAGGCGTT
TCH01_0103_B05.b : gtgcgaattggtcccagggggaGA**TATGCTA***TGGATCTC*TGGGGCCCAGGCGTT
TCH01_0030_D11.b : cggtgacggagcctgtctgcccGTATTATGCTA***TGCATCTC*TGGGGCCCAGGCGTT
TCH01_0076_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxTATGGTACTGTGAATCTC*TGGGGCCCAGGCGTT
TCH01_0098_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxGTTGGTA***TGGATCTC*TGGGGCCCAGGCGTT
ITT01_0033_F08.b : atacgtatggtgcaggttgggtaggggATAGAA***TGGATCTC*TGGGGCCCAGGCGTT
TCH01_0003_F04.b : actgtacaagacgaggggtacatctcgATTCTA***TATATCTC*TGGGGCCCAGGCGTT
TCH01_0027_E11.b : xxxxxxxxxxxxxxxcttgctccgccacTTATA***CGGATCTC*TGGGGCCCAGGCGTT
TCH01_0092_D05.b : actgtgtcctggggttttttgcggtaggTCCCA***CGGATCTC*TGGGGCCCAGGCGTT
TCH01_0047_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxcAATA****TGATCTCGTGGGGCCCAGGCGTT
TCH01_0080_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTA***TGCATTTA*TGGGGCCCAGGCGTT
TCH01_0026_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGGA***TAAATCTC*TGGGGCCCAGGCGTT
TCH01_0076_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTA***TGGATCTC*TGGGGCCCAGGCGTT
TCH01_0079_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtatCACTATTCTC*TGGGGCCCAGGCGTT
SMG01_0095_B02.b : ggntccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAGATCTC*CGGGGCCCAGGCGCT
TCH01_0029_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxatcatatcACGATCTC*TGGGGCCCAGGCGTC
TCH01_0067_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGATGTC*TGGGGCCCAGGCGTT
TCH01_0060_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcaccaatTTCCCTC*TGGGGCCCAGGCGTT
TCH01_0006_D03.b : atttttgtgcaagagaatcccggggacgatctcttattAATC*CATGGGGCCCAGGCGTT
TCH01_0038_F11.b : xxxxxxxxxxxxxxxttagtgtttgctatagcggttactGCCAC*TGGGGCCCAGGCGTT
TCH01_0014_D06.b : tactgtgtaggagctctaagtatggcgctagttgcagaaaTACCCTGGGGCCCAGGCGTT
TCH01_0072_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTC*TGGGGCCCAGGCGTT
ITT01_0082_E04.b : nggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCGTT
ITT01_0081_H09.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0005_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0102_C02.b : aggcctgagggatctgctcggccaggttgctggaggcacagggctgggcaggggctgagg
ITT01_0069_H09.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0075_D01.b : tttggtaggactatgacxxxxxxxxxxxxxxxxxxxxxx
TCH01_0001_H06.b : nngggttggactataacagtttgtacx
TCH01_0080_E07.b : nggcttggact
TCH01_0066_D09.b : nnnnggctag
TCH01_0072_H02.b :
ITT01_0084_B03.b :
TCH01_0029_A09.b :
TCH01_0069_A04.b :
20110601C-001625 : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
---------+---------+---------+---------+---------+---------+ 214
TCH01_0103_D10.b : GAGGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0075_H02.b : GAACTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0048_D03.b : GAAGTCGTCGTGTCTTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0017_F06.b : GAAGTCGTGGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0032_B07.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0015_D02.b : GAAGTCGTCGTGTCTTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0093_B04.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0002_A01.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGTCTCTGGGG
TCH01_0059_A02.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0103_B05.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0030_D11.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0076_G12.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0098_D08.b : GAAGTCGCCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
ITT01_0033_F08.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0003_F04.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0027_E11.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0092_D05.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0047_H12.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0080_F10.b : GAGGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0026_C12.b : GAAGTCGCCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0076_B10.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0079_G07.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
SMG01_0095_B02.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0029_H02.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0067_F02.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0060_G05.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0006_D03.b : GAAGTCGTCGTGTCCTCGGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0038_F11.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0014_D06.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
TCH01_0072_C03.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
ITT01_0082_E04.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
ITT01_0081_H09.b : GAAGTCGTCGTGTCCTCGGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
LNG01_0005_B01.b : GAAGTCGTCGTGTCCTCAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
PBL01_0102_C02.b : acgaggccaggatggACAGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
ITT01_0069_H09.b : xxxxxxxxxxxxxxxxxxGTGTCTGAAACCAGCCCCAAAATCTTCCCACTGACTCTGGGG
MLN01_0075_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTTCCCACTGACTCTGGGG
TCH01_0001_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctaTCTGGGG
TCH01_0080_E07.b : atgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0066_D09.b : gacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0072_H02.b : nnnnngctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0084_B03.b : nnnggat
TCH01_0029_A09.b : ntttggttggactataa
TCH01_0069_A04.b :
20110601C-001625 : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
---------+---------+---------+---------+---------+---------+ 274
TCH01_0103_D10.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0075_H02.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0048_D03.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0017_F06.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0032_B07.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0015_D02.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0093_B04.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0002_A01.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0059_A02.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0103_B05.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0030_D11.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0076_G12.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0098_D08.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
ITT01_0033_F08.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0003_F04.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0027_E11.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0092_D05.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0047_H12.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0080_F10.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0026_C12.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0076_B10.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0079_G07.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACCTCTTCCCGTCA
SMG01_0095_B02.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0029_H02.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0067_F02.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0060_G05.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0006_D03.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0038_F11.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0014_D06.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0072_C03.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
ITT01_0082_E04.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
ITT01_0081_H09.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
LNG01_0005_B01.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
PBL01_0102_C02.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
ITT01_0069_H09.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
MLN01_0075_D01.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0001_H06.b : AGCAGCGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0080_E07.b : xxxxxxGAGCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0066_D09.b : xxxxxxxxxCCTGCCGGATATGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
TCH01_0072_H02.b : xxxxxxxxxxxxxxxxxxagTGTGGTCATCGCCTGCCTGGTCCGGGACTTCTTCCCGTCA
ITT01_0084_B03.b : gaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCTTCCCGTCA
TCH01_0029_A09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCA
TCH01_0069_A04.b : nnnaagctaggaataagacxxxxxxxxxxx
20110601C-001625 : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
---------+---------+---------+---------+---------+---------+ 334
TCH01_0103_D10.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0075_H02.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0048_D03.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0017_F06.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0032_B07.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0015_D02.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0093_B04.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0002_A01.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0059_A02.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0103_B05.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0030_D11.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0076_G12.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0098_D08.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
ITT01_0033_F08.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0003_F04.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0027_E11.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0092_D05.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0047_H12.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0080_F10.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0026_C12.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0076_B10.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0079_G07.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
SMG01_0095_B02.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0029_H02.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0067_F02.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0060_G05.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0006_D03.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0038_F11.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0014_D06.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0072_C03.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
ITT01_0082_E04.b : GAGCCCCTGACAGTAACTTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
ITT01_0081_H09.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
LNG01_0005_B01.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
PBL01_0102_C02.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
ITT01_0069_H09.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
MLN01_0075_D01.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0001_H06.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0080_E07.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0066_D09.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0072_H02.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
ITT01_0084_B03.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0029_A09.b : GAGCCCCTGACAGTAACCTGGAGCCCTAGTCGCGAGGGCGTTATTGTCAGAAACTTCCCC
TCH01_0069_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtcgagTTCCCC
20110601C-001625 : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
---------+---------+---------+---------+---------+---------+ 394
TCH01_0103_D10.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0075_H02.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0048_D03.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0017_F06.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0032_B07.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0015_D02.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0093_B04.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0002_A01.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0059_A02.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGGGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0103_B05.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0030_D11.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0076_G12.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0098_D08.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
ITT01_0033_F08.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0003_F04.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0027_E11.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0092_D05.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0047_H12.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0080_F10.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0026_C12.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0076_B10.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0079_G07.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
SMG01_0095_B02.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0029_H02.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0067_F02.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0060_G05.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0006_D03.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0038_F11.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0014_D06.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0072_C03.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
ITT01_0082_E04.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
ITT01_0081_H09.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
LNG01_0005_B01.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
PBL01_0102_C02.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
ITT01_0069_H09.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
MLN01_0075_D01.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0001_H06.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0080_E07.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0066_D09.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0072_H02.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
ITT01_0084_B03.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0029_A09.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
TCH01_0069_A04.b : CCTGCGCAGGCCGGGGGCCTGTACACCATGAGCAGCCAGCTGACCTTGCCAGTCGAGCAG
20110601C-001625 : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
---------+---------+---------+---------+---------+---------+ 454
TCH01_0103_D10.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0075_H02.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0048_D03.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0017_F06.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0032_B07.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0015_D02.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0093_B04.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0002_A01.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0059_A02.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0103_B05.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0030_D11.b : TGCCCAGCCGATCGGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0076_G12.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0098_D08.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
ITT01_0033_F08.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0003_F04.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0027_E11.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0092_D05.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0047_H12.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0080_F10.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0026_C12.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0076_B10.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0079_G07.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
SMG01_0095_B02.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0029_H02.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0067_F02.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0060_G05.b : TGCCCAGCCGATCAGATCCTGAGGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0006_D03.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0038_F11.b : TACCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0014_D06.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0072_C03.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
ITT01_0082_E04.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
ITT01_0081_H09.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
LNG01_0005_B01.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
PBL01_0102_C02.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCT
ITT01_0069_H09.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
MLN01_0075_D01.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAGGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0001_H06.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0080_E07.b : TGCCCAGCCGACCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0066_D09.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0072_H02.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
ITT01_0084_B03.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0029_A09.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
TCH01_0069_A04.b : TGCCCAGCCGATCAGATCCTGAAGTGCCAAGTGCAGCACCTCTCCAAATCCAGCCAGTCC
20110601C-001625 : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
---------+---------+---------+---------+---------+---------+ 514
TCH01_0103_D10.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0075_H02.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0048_D03.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0017_F06.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0032_B07.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCGG
TCH01_0015_D02.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0093_B04.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0002_A01.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0059_A02.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0103_B05.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0030_D11.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0076_G12.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0098_D08.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
ITT01_0033_F08.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0003_F04.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0027_E11.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0092_D05.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0047_H12.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0080_F10.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0026_C12.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0076_B10.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0079_G07.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
SMG01_0095_B02.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0029_H02.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0067_F02.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0060_G05.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0006_D03.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0038_F11.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0014_D06.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0072_C03.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
ITT01_0082_E04.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
ITT01_0081_H09.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
LNG01_0005_B01.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTACAG
PBL01_0102_C02.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
ITT01_0069_H09.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
MLN01_0075_D01.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0001_H06.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0080_E07.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0066_D09.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0072_H02.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
ITT01_0084_B03.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0029_A09.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
TCH01_0069_A04.b : GTGAACGTGCCCTGCAAAGATCCATGTCCCCAGTGCTGCAAGCCCAGCCTGTCCCTGCAG
20110601C-001625 : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
---------+---------+---------+---------+---------+---------+ 574
TCH01_0103_D10.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0075_H02.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0048_D03.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0017_F06.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0032_B07.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0015_D02.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0093_B04.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0002_A01.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0059_A02.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0103_B05.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0030_D11.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0076_G12.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0098_D08.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
ITT01_0033_F08.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0003_F04.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0027_E11.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0092_D05.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0047_H12.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0080_F10.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0026_C12.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0076_B10.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0079_G07.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
SMG01_0095_B02.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0029_H02.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0067_F02.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0060_G05.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0006_D03.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0038_F11.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0014_D06.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0072_C03.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
ITT01_0082_E04.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
ITT01_0081_H09.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
LNG01_0005_B01.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
PBL01_0102_C02.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
ITT01_0069_H09.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
MLN01_0075_D01.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0001_H06.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0080_E07.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0066_D09.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0072_H02.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCGCGTGCACACTCAGT
ITT01_0084_B03.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0029_A09.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
TCH01_0069_A04.b : CCACCAGCCCTTGCAGACCTGCTCCTGGGCTCCAATGCCAGCCTCACGTGCACACTCAGT
20110601C-001625 : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
---------+---------+---------+---------+---------+---------+ 633
TCH01_0103_D10.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0075_H02.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0048_D03.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0017_F06.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0032_B07.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0015_D02.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0093_B04.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0002_A01.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0059_A02.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0103_B05.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0030_D11.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0076_G12.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0098_D08.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
ITT01_0033_F08.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0003_F04.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0027_E11.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0092_D05.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0047_H12.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0080_F10.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0026_C12.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0076_B10.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0079_G07.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
SMG01_0095_B02.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0029_H02.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0067_F02.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0060_G05.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0006_D03.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0038_F11.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0014_D06.b : GGCCTGAAAAAAATCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0072_C03.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
ITT01_0082_E04.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
ITT01_0081_H09.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
LNG01_0005_B01.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
PBL01_0102_C02.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
ITT01_0069_H09.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
MLN01_0075_D01.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0001_H06.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0080_E07.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0066_D09.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0072_H02.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
ITT01_0084_B03.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0029_A09.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
TCH01_0069_A04.b : GGCCTGAAAAAA*TCCGAGGGTGTCAGCTTCACCTGGCAGCCCTCAGGTGGGAAGGATGC
20110601C-001625 : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
---------+---------+---------+---------+---------+---------+ 693
TCH01_0103_D10.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0075_H02.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0048_D03.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0017_F06.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0032_B07.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0015_D02.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0093_B04.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0002_A01.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0059_A02.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0103_B05.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0030_D11.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0076_G12.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0098_D08.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
ITT01_0033_F08.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0003_F04.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0027_E11.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0092_D05.b : CGTCCAGGCGTCCCCCACGCGTGGTTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0047_H12.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0080_F10.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0026_C12.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0076_B10.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0079_G07.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
SMG01_0095_B02.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0029_H02.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0067_F02.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0060_G05.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0006_D03.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0038_F11.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0014_D06.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0072_C03.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
ITT01_0082_E04.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
ITT01_0081_H09.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
LNG01_0005_B01.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
PBL01_0102_C02.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
ITT01_0069_H09.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
MLN01_0075_D01.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0001_H06.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0080_E07.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0066_D09.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0072_H02.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
ITT01_0084_B03.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0029_A09.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
TCH01_0069_A04.b : CGTCCAGGCGTCCCCCACGCGTGATTCCTGTGGCTGCTACAGCGTGTCCAGCATCCTGCC
20110601C-001625 : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
---------+---------+---------+---------+---------+---------+ 753
TCH01_0103_D10.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0075_H02.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0048_D03.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0017_F06.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0032_B07.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0015_D02.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0093_B04.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0002_A01.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0059_A02.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0103_B05.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0030_D11.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0076_G12.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0098_D08.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCATCGCCGCCCACTCTGA
ITT01_0033_F08.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0003_F04.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0027_E11.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0092_D05.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0047_H12.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0080_F10.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0026_C12.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0076_B10.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0079_G07.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
SMG01_0095_B02.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0029_H02.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0067_F02.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0060_G05.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0006_D03.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0038_F11.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0014_D06.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0072_C03.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
ITT01_0082_E04.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
ITT01_0081_H09.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
LNG01_0005_B01.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
PBL01_0102_C02.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
ITT01_0069_H09.b : AGGCTGCGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
MLN01_0075_D01.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0001_H06.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0080_E07.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0066_D09.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0072_H02.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
ITT01_0084_B03.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0029_A09.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
TCH01_0069_A04.b : AGGCTGTGCTGATCCTTGGAACAAAGGAGAGACATTCTCCTGCACCGCCGCCCACTCTGA
20110601C-001625 : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
---------+---------+---------+---------+---------+---------+ 813
TCH01_0103_D10.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0075_H02.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0048_D03.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0017_F06.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0032_B07.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0015_D02.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0093_B04.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0002_A01.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0059_A02.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0103_B05.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0030_D11.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0076_G12.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0098_D08.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
ITT01_0033_F08.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0003_F04.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0027_E11.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0092_D05.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0047_H12.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0080_F10.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0026_C12.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0076_B10.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0079_G07.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
SMG01_0095_B02.b : GTTGAAGAGCGCGCNTACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCCGGCCCA
TCH01_0029_H02.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0067_F02.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0060_G05.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0006_D03.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0038_F11.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGCTCCGGCCCCA
TCH01_0014_D06.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0072_C03.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
ITT01_0082_E04.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
ITT01_0081_H09.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
LNG01_0005_B01.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
PBL01_0102_C02.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
ITT01_0069_H09.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
MLN01_0075_D01.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0001_H06.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0080_E07.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0066_D09.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0072_H02.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
ITT01_0084_B03.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0029_A09.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
TCH01_0069_A04.b : GTTGAAGAGCGCGCTAACCGCCACCATCACCAAACCCAAAGTGAACACGTTCCGGCCCCA
20110601C-001625 : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
---------+---------+---------+---------+---------+---------+ 873
TCH01_0103_D10.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCCTCATGAGCTGGTGACACTGAC
TCH01_0075_H02.b : GGTCCACCTGCTGCCGCCGCCCTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0048_D03.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0017_F06.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0032_B07.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCATTGAGCTGGTGACACTGAC
TCH01_0015_D02.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTNCATGAGCTGGTGACACTGAC
TCH01_0093_B04.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0002_A01.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0059_A02.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0103_B05.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0030_D11.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0076_G12.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0098_D08.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
ITT01_0033_F08.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0003_F04.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0027_E11.b : GGTCCACCTGCTGCCGCCGCCGTCGAAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0092_D05.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0047_H12.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0080_F10.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0026_C12.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0076_B10.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0079_G07.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
SMG01_0095_B02.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCCTCATGAGCTGGTGACACAGAC
TCH01_0029_H02.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0067_F02.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0060_G05.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0006_D03.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0038_F11.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0014_D06.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0072_C03.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
ITT01_0082_E04.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
ITT01_0081_H09.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
LNG01_0005_B01.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
PBL01_0102_C02.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTNCATGAGCTGGTGACACTGAC
ITT01_0069_H09.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
MLN01_0075_D01.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0001_H06.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0080_E07.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0066_D09.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0072_H02.b : GGTCCACCTGCTGCCGCCACCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
ITT01_0084_B03.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0029_A09.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
TCH01_0069_A04.b : GGTCCACCTGCTGCCGCCGCCGTCGGAGGAGCTGGCCCTCAATGAGCTGGTGACACTGAC
20110601C-001625 : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
---------+---------+---------+---------+---------+---------+ 931
TCH01_0103_D10.b : ATGNCCTGGTGCGGGGCTTCAGCCCCCANGATGTGCTGGTGCGATG*GCTGCAAGGGGGG
TCH01_0075_H02.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAAGATGTGCTGGTGCGATG*GCTGCCAGGGGGG
TCH01_0048_D03.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
TCH01_0017_F06.b : ATG*CCTGGTGCGGGGCTTCAGCCCCCAGGATGTGCTGGTGCGATGGGCTGCAGGGGGNC
TCH01_0032_B07.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
TCH01_0015_D02.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
TCH01_0093_B04.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAAGATGTGCTGGTGCGATG*GCTGCNAGGGGGC
TCH01_0002_A01.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGNCAGGGGGC
TCH01_0059_A02.b : ATGCCCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
TCH01_0103_B05.b : ATG*CCTGGGGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCNAGGGGGG
TCH01_0030_D11.b : ATG*CCTGGTGCGGGGCTTCAGCCCCA*GGATGTGCTGGTGCGATG*GCTGCCAAGGGGC
TCH01_0076_G12.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
TCH01_0098_D08.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAAGATGTGCTGGTGCGATG*GCTGCCAGGGGGC
ITT01_0033_F08.b : ATG*CCTGGTGCGGGGCTTCAGCCCCA*GGATGAGCTGGTGCGATG*GCTGCAAGGGGGC
TCH01_0003_F04.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAGGGGGGC
TCH01_0027_E11.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAAGGGGC
TCH01_0092_D05.b : ATG*CCTGGTGCGGGGCTTCAGCCCCCAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
TCH01_0047_H12.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
TCH01_0080_F10.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGTGGC
TCH01_0026_C12.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
TCH01_0076_B10.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
TCH01_0079_G07.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
SMG01_0095_B02.b : ATGCCTGGNTGCGGGGCTTCAGCCCCCAAGATGTGCTGTTGCGATG*GCTGCAAGGGGGG
TCH01_0029_H02.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAGGGGGGC
TCH01_0067_F02.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
TCH01_0060_G05.b : ATGCCTGGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATT*GCTGCAAGGGGGC
TCH01_0006_D03.b : ATG*CCTGGTGCGGGGGCTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
TCH01_0038_F11.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
TCH01_0014_D06.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
TCH01_0072_C03.b : ATG*CCTGGTGCGGGGCTTCACCCCCAAGGATGTGCTGGTGCGATGGCTGGCAAGGGGCC
ITT01_0082_E04.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGTGGC
ITT01_0081_H09.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
LNG01_0005_B01.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGAGGC
PBL01_0102_C02.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGNC
ITT01_0069_H09.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
MLN01_0075_D01.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGTGGC
TCH01_0001_H06.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
TCH01_0080_E07.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
TCH01_0066_D09.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
TCH01_0072_H02.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
ITT01_0084_B03.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
TCH01_0029_A09.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
TCH01_0069_A04.b : ATG*CCTGGTGCGGGGCTTCAGCCCCAAGGATGTGCTGGTGCGATG*GCTGCAAGGGGGC
20110601C-001625 : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCTGCCAGAGCCTGGCCA*G
---------+---------+---------+---------+---------+---------+ 988
TCH01_0103_D10.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCtgccagagctggccgggca
TCH01_0075_H02.b : CCCAGAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCTGCCAAAGCTGGC*CC*A
TCH01_0048_D03.b : CAG*GAACTG*CCCCGTGACCAGTACCTCGTCTGGGGATCCCTGCCAGAGCCTGG*CA*G
TCH01_0017_F06.b : CA**GAACTG*CCCCGTGGACAGTACCTCGTCTGGGAAATCCTGCagagcctgggcaggc
TCH01_0032_B07.b : CAG*GAACTA*CCCCGTGACAAGTACCTCGTCTGGG*ATCCCTGCCAGAGCCTGG*NC*A
TCH01_0015_D02.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGGATCCCTGCCAGAGCCTGGCCA*G
TCH01_0093_B04.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCTGCCCGAGCCTGGCCA*G
TCH01_0002_A01.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCTGCCAGAGCCTGGCCA*G
TCH01_0059_A02.b : CAG*GAACTG*CCCCGTGANCAGTACCTCGTCTGGGAATCCCTGCCAGAAGCTGGGCA*G
TCH01_0103_B05.b : CCA*GAACTG*CCCCGTGAACAGTACCTCGTCTGGGAATCCCTGGCAGAGCCTGGCCA*G
TCH01_0030_D11.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCGTGCAGAGNCTGGCCA*G
TCH01_0076_G12.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCTTGCAGAGCCTGGCCA*G
TCH01_0098_D08.b : CAG*GGACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCTGCCAGAGCCTGGCCA*G
ITT01_0033_F08.b : CAG*GAACTG*CCCCCGTGACAGTACCTCGTCTGGGAAATCCCTGCAGAGCCTGGGCA*G
TCH01_0003_F04.b : CAG**AACTG*CCCCGTTGACAGTACCTCGTCTGGGAATCC*TGCCAGAAGCTGGCCA*G
TCH01_0027_E11.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCTG*CAAAGCCTGGCCA*G
TCH01_0092_D05.b : CAG*GAACTG*CCCCGTGTACAGTACCTCGTCTGGGAAATCCTGGCAGAAGCTGGNCA*G
TCH01_0047_H12.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAAATCCTGNCAGAGNNCTGGCA*G
TCH01_0080_F10.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCTAGCAGAGCCTGGCCA*G
TCH01_0026_C12.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCTGCCAGAGCCTGGCCA*G
TCH01_0076_B10.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCTGCCAGAGCCTGGCCA*G
TCH01_0079_G07.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCTNGCAGAGCCTGGGCA*G
SMG01_0095_B02.b : CAG*NAACTG*CCCCGTGAACAGTACCTCGTCTGGGAATCCCTNGCCGAGCCTGGGCA*A
TCH01_0029_H02.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAAATCCTGCCAGAGCCTGGCCA*G
TCH01_0067_F02.b : CAG*GAACTG*CCCCGTGANCAGTACCTCGTCTGGGAAATCCCTGCAGAGCCTGNNGC*A
TCH01_0060_G05.b : CAA*GACCTGCCCCCGTGACAAGTACCCCGTCTGGGAATCCCTGGCCAAACCTGTCCAGG
TCH01_0006_D03.b : CAG*GAACTG*CCCCCGTGACAGTACCTCGTCTGGGAATCCCTGCCAGAGCCTGGCCA*G
TCH01_0038_F11.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCCTGCAGAGCCTGGCCA*G
TCH01_0014_D06.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAAATCCTGNCAGAGCCTGGGCA*G
TCH01_0072_C03.b : CA**GAACTG*CCCCCTTGACAGTACCTCGTCTGGGAATCCCTTGCAaaacctgccaggc
ITT01_0082_E04.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCTGCCAGAGCCTG*CCA*G
ITT01_0081_H09.b : CAG*GAACTG*CCCCGTNGACAGTACCTCGTCTGGGAATCCCTGCCAGAGCCTGGGCA*G
LNG01_0005_B01.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCTGCCAGAGCCTGGCCA*G
PBL01_0102_C02.b : CAG*GAACTG*CCCCCGTGACAGTACCTCGTCTGGGAATCCCTNGCAGAGCCTGGCCA*G
ITT01_0069_H09.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCTGCCAGAGCCTGGCCA*G
MLN01_0075_D01.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCTGCCAGAGCCTGGCCA*G
TCH01_0001_H06.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCTGCCAGAGCCTGGCCA*G
TCH01_0080_E07.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCTGCCAGAGCCTGGCCA*G
TCH01_0066_D09.b : CAG*GAACTG*CCCCGTGGACAGTACCTCGTCTGGGAATCCCTGCCAGAGCCTGGCCA*G
TCH01_0072_H02.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCTGCCAGAGCCTGGCCA*G
ITT01_0084_B03.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCTGCCAGAGCCTGGCCA*G
TCH01_0029_A09.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCTGCCAGAGCCTGGCCA*G
TCH01_0069_A04.b : CAG*GAACTG*CCCCGTGACAAGTACCTCGTCTGGGAATCCCTGCCAGAGCCTGGCCA*G
20110601C-001625 : GCCATCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACGCCGAGGACTGGAAGCAG
---------+---------+---------+---------+---------+---------+ 1048
TCH01_0103_D10.b : tcccccactaccccttgacaacgtgctgcgcttggacccaaagactggagcagggaaaca
TCH01_0075_H02.b : GCCATTCCCCACTACGCCGTGACCAGCGTGCTGCGCGTGAACCCCAAGGACTGGAAcagg
TCH01_0048_D03.b : GCCAT*CCCCACTACGCCGTGACCAcgtgctgcgcgtgaaaccccaggatggaaacaggg
TCH01_0017_F06.b : atccccactacgcgtgacagcgtgctgcgcgtggacgcgaagactgaagcaggagacacc
TCH01_0032_B07.b : GGCCATCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACCCCGAGGACTGGAAcagg
TCH01_0015_D02.b : GCCATCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACGCCGAGGACTGGAAGCAG
TCH01_0093_B04.b : GCCCTCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACcccaagactgaaaccagg
TCH01_0002_A01.b : GCCATCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACGCCGAGGACTGGAAGCAG
TCH01_0059_A02.b : GCCATCCCCCACTACGCCGTGACCAGCGTGCTGCGCGTGGACGCCCAGACCTGGAAcagg
TCH01_0103_B05.b : GCCATCCCCACCTACCCCGTGACagcgtgcttcccgtggacgcccaagactggagccggg
TCH01_0030_D11.b : GCCATCCCCACCTACCCCGTGACCAGCGTGCTGCCCGTGGACCCCAAGGACTtgaaacca
TCH01_0076_G12.b : GCCATCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACGCCAAGGACTGGAAGCAA
TCH01_0098_D08.b : GCCATCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACGCCGAGGACTGGAAACAG
ITT01_0033_F08.b : GCCATCCCCCACTACGCCGTGACCAGCGTGCTGCGCGTGGACGCCGAGactggaagcaag
TCH01_0003_F04.b : GCCAT*CCCACCTACGCCCTTGACAGCGTGCTGCCCGTGGACGCCAAGGACTGGAAGCAG
TCH01_0027_E11.b : GGCATCCCCACCTACGCCGTGAACCACGTGCTGCCCGTGGAACCCCAAGACTGGAAACA*
TCH01_0092_D05.b : NCCATCCCCA*CTACGCCGTGAACAGCGTGCTGCGCGTGGACCCCAAGGACTGGAAACAA
TCH01_0047_H12.b : NNCATCCCCA*CTACGCCGTGACCAGCGTGCTGCGCGTGGACGCCGAAGACTGGAAGCAG
TCH01_0080_F10.b : GCCATCCCCACCTAGCGCGTGACCAGCGTGCTGCGCGTGGACGCCGAGGACTGGAAGCtg
TCH01_0026_C12.b : GCCATCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGAACGCCGAGGACTGGAANNCA
TCH01_0076_B10.b : GCCATCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACGCCGAGGACTGGAAGCAG
TCH01_0079_G07.b : GCCATCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACGCCGAAGACTGGAAGCAG
SMG01_0095_B02.b : GGCATCCCCACCTACCCCGTGACCAcgtgctgcgcttgaaccccaagactggaaacagga
TCH01_0029_H02.b : GCCATCCCCA*CTACGCCGTGAACCACGTGCTGCGCGTGGACGCCGAGGAatgaagcagg
TCH01_0067_F02.b : GGCATCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACGCCGAGGACTGGAAGCAG
TCH01_0060_G05.b : GCCATCCCCACCTACNCCGTGACCAGCGTGgctgccccggggacccccaaggactggaaa
TCH01_0006_D03.b : GCCATCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACCCGAAGGACTGGAAACAG
TCH01_0038_F11.b : GCCATCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACGCCGAAGACTGGAAGCAG
TCH01_0014_D06.b : GNCATCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACGCCGAAGACTGGAAGCAG
TCH01_0072_C03.b : catcccacctaccccttgacacatgctcccgttgaaccccaagactgaaacaggaaaacc
ITT01_0082_E04.b : GCCATCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACGCTTAAGACTGGAAGCAG
ITT01_0081_H09.b : GCCATCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACGCCGAAGGACTGGAGCAG
LNG01_0005_B01.b : GCCATCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACGCCGAGGACTGGAAACAG
PBL01_0102_C02.b : GCCATCCCCA*CTACGCCGTGACCAGCGTGCTGCGCGTGGACGCgaagactggnagcngn
ITT01_0069_H09.b : GCCATCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACGCCGAGGACTGGAAACAG
MLN01_0075_D01.b : GCCATTCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACCCCGAGGACTGGAACCAG
TCH01_0001_H06.b : GCCATCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACGCCGAGGACTGGAAGCAG
TCH01_0080_E07.b : GCCATCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACGCCGAGGACTGGAAGCAG
TCH01_0066_D09.b : GCCATCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACGCCGAGGACTGGAAGCAG
TCH01_0072_H02.b : GCCATCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACGCCGAGGACTGGAAGCAG
ITT01_0084_B03.b : GCCATCCCCACCTGCGCCGTGACCAGCGTGCTGCGCGTGGACGCCGAGGACTGGAAGCAG
TCH01_0029_A09.b : GCCATCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACGCCGAGGACTGGAAGCAG
TCH01_0069_A04.b : GCCATCCCCACCTACGCCGTGACCAGCGTGCTGCGCGTGGACGCCGAGGACTGGAAGCAG
20110601C-001625 : GGAGACACCTTCTCCTGCATGGTGGGCCACGAGGCCCTGCCCCTGGCCTT*CACCCAGAA
---------+---------+---------+---------+---------+---------+ 1107
TCH01_0103_D10.b : ctccccctgcatgttggccacaaggcctgccctggcctccccaaaaaccttaacgcctgg
TCH01_0075_H02.b : aaacacctttcctgcagggggggcacaaagcctgccccggccttccccgaaaaactccaa
TCH01_0048_D03.b : agaaacttcccctgcttggtgggccagaagccttggccctgcccttccccaaaaaacaat
TCH01_0017_F06.b : tctcctgcatggtggggcacgagccttgccctgccttcaccaaagaacatcgacgctggc
TCH01_0032_B07.b : gagacccctctcctgcatggtgggccacgaggcctgcccctggctttcaccaaagaacat
TCH01_0015_D02.b : GGAGACAC*TTCCCCTGCATGGTGGGCCACGAGGCCCGGCCCCTGGgctcacccaaagac
TCH01_0093_B04.b : gagacacctctcctggatggtgggcacgaggcctgcccctggcttaccaaaaaacaccaa
TCH01_0002_A01.b : GGAGACACCTCTCCCTGCATGTTGGGCCACGAAGCCCTTGCCCTGGGCTT*TACCCAGAA
TCH01_0059_A02.b : gagacactctcccggcatgtgggccacaaggcctgcccctggcttcacccaaagacatcg
TCH01_0103_B05.b : aaacacctcccccgcatgtggggcacgaagccctggcccgggccttccccaaaagaacat
TCH01_0030_D11.b : ggaaacacttctcctgctggttggccacaaggcctggccctgggctccacccgaagacat
TCH01_0076_G12.b : GGAGACAC*CTctcctgcatggtgggcacgaggcctgccctggncttcaccgaagacatc
TCH01_0098_D08.b : GGAGACACCTTCCCCTGCTGGGTGGGCCACGAGGCCCTGCCCCTGGCCTT*CACCCAAAA
ITT01_0033_F08.b : gagacactttctctgcatggtgggcacgaggccctgccctggctttcgccaaagaacatc
TCH01_0003_F04.b : GGAaacccctctcctgcaggggggccacnaagcctgccccgggcttcacccaaaaacatc
TCH01_0027_E11.b : GGAGACCCCTTCTCCTGCCTGGTGGGCCACAAGGCCCctgccctgggcctttccccaaaa
TCH01_0092_D05.b : GGAGACAC*TTCTCCTGCATGGTGGGCCACGAGccttgcccctggctttcaccagaagac
TCH01_0047_H12.b : GNAGACACCTTCTCCTGCATGGTGGGNNCACGAGCCCTGCCCCTGGGCTT*CACCagaga
TCH01_0080_F10.b : tagacacttcccctgcatggtggggcacgggccctgcccttggctttccccaaagacctc
TCH01_0026_C12.b : GGAGAC*CCTTCTCCTGCATGGTGGGCCAGAAGGCCCTGCCCtggccttacccagaaaac
TCH01_0076_B10.b : GGAGACACTTCTCCTGGCATGGTGGGCCACGAGGCCCTGCCCCTGGCCTcacccaaagac
TCH01_0079_G07.b : GNAGACACCTTCTCCTGCATGGTGGGGNCACGAGNCCTGCCCCTGGNCTT*CACCAAANA
SMG01_0095_B02.b : aacccttctccgctgggggggcaagaggcccgccctggcttcaccaaaaaaccttcacgc
TCH01_0029_H02.b : gagacacttctcctgcagggggggcaagaggcctgcccctgcctttcaccaaagacatcg
TCH01_0067_F02.b : GGAGACACCTTCTCCTGCATGGTGGGCCcacgagccnntgccctggctttcaccagaaga
TCH01_0060_G05.b : acagggaaaaaactttcccctgcatggggggggccaagaaggccctggcccctgtggctt
TCH01_0006_D03.b : GNAGACCCCTcctctgcttggtgggcacgaagcccttgcccctggcttcacccaaaaaca
TCH01_0038_F11.b : GNAGACACTTCTCCCTGCATGGTGGGGCACGAGGGCCTGCCCCTGGCCTT*CACCCAGAA
TCH01_0014_D06.b : GGAGAacttctccntgcatggtgggnncacgagccctgcccctgcccntcaccaaaagac
TCH01_0072_C03.b : cttttcctgcatggtgggcaaaaaactttgcctctcgttactcaaaaaacaccacttcct
ITT01_0082_E04.b : GGAGACACCTTCTCCTGCATGGTGGGACACGAGGCCCTGCCCCTGGCCTTTCACC*AAAA
ITT01_0081_H09.b : GGAGACACCTTCTCCTGCATGGTGGGCCcacgagcccctgccctggncttcaccagaaga
LNG01_0005_B01.b : GGAAACACTTTCTCCTGCATGGTtgggccacgaagcccctgcccctggcctttccccaaa
PBL01_0102_C02.b : agacacttctcctgcatggtgggccacgagccntgccctggnctcancagaagacatcga
ITT01_0069_H09.b : GGAGACACTTTCTCCTGCATGGTGGGGCACGAGGCCCTGCCCCTGGCCTT**CACCCAAA
MLN01_0075_D01.b : GGAGACACCTTCTCCTGCTGGGGGGGCCAGAAGGCCCTGCCCCTtggccttcacccaaat
TCH01_0001_H06.b : GGAGACACCTTCTCCTGCATGGTGGGCCACGAGGCCCTGCCCCTGGCCTT**CACCCAAA
TCH01_0080_E07.b : GGAGACACCTTCTCCTGCATGGTGGGCCACGAGGCCCTGCCCCTGGTCTTTCACCCAGAA
TCH01_0066_D09.b : GGAGACACCTTCTCCTGCATGGTGGGGCACGAGGCCCTGCCCCTGGCCTT**CACCCAGA
TCH01_0072_H02.b : GGAGACACCTTCTCTTGCATGGTGGGCCACGAGGCCCTGCCCCTGGCCTT*CCCCAGAA*
ITT01_0084_B03.b : GGAGACACCTTCTCCTGCATGGTGGGCCACGAGGCCCTGCCCCTGGCCTT**CACCCAGA
TCH01_0029_A09.b : GGAGACACCTTCTCCTGCATGGTGGGCCACGAGGCCCTGCCCCTGGCCTT*CACCCAGAA
TCH01_0069_A04.b : GGAGACACCTTCTCTGGCATGGTGGGCCACGAGGCCCTGCCCCTGGCCTT*CACCCAGAA
20110601C-001625 : GAACATCGACCGCCTGGCGGGTAAACCCCCCA*CGTCAACGTGTCCGTGGTCATGGCGGA
---------+---------+---------+---------+---------+---------+ 1166
TCH01_0103_D10.b : ggtaaaccccccctcaatttcccttgttgggggaggcaaggtttgctttgacccccccca
TCH01_0075_H02.b : ggcccggcgggaaacccacccactcacctggccctggtatggcgaagcaaaaggattctc
TCH01_0048_D03.b : caacgcctggcgggtaaccccccacgttcacgttcctgggtccgggggaggccaaggcat
TCH01_0017_F06.b : ggtaaacaccccntcacttgtcttgtcttggggagggaaagtactcctatgacccccccc
TCH01_0032_B07.b : cgaccgcctgccgggaaaccccccactcaacgtttcctggtctggcggaggaaaagggat
TCH01_0015_D02.b : atcgaccgcctgcgggttaaccacccattcacgtgtcgtggtcatggcggagccaaggca
TCH01_0093_B04.b : cgcctgggggtaaaccacccactcaaatgtccgtggtcaggcgaagcaaaggctttgcta
TCH01_0002_A01.b : *AACATCAACCGCCTggcggtaaacccacccccgtcaactgtccctggtcatggcgaagc
TCH01_0059_A02.b : accgccgggggtaaaccccccactcaactgtccctggtcagggggagcaaagggatttgt
TCH01_0103_B05.b : cgaccgcctggcgggtaacccaccccgtcactggtcctggccttggcgaaggaaagcctt
TCH01_0030_D11.b : caacgccctgcgggaaaaccacccattcaactgttccgggtctggcgaaggcaaaggcat
TCH01_0076_G12.b : gacgccgggcgggtaaccacccagtcaactgttcctgttatggcgaaggcaaggcattcg
TCH01_0098_D08.b : GAACCTCCACCGCCTGGCGGGTAAACCCCCCC*CCTCAACGTGTCCGggttctggcggaa
ITT01_0033_F08.b : gaacgctggcgggtaaaccaacccgtcacgtgtcgttgtcatggcgaagcaaaaggcact
TCH01_0003_F04.b : cacggctggcgggaaaccacccagtcaacttgtctggcatgcggaggcaaggatcttcta
TCH01_0027_E11.b : aacctcacccgccctggcggggtaaacccccccacttaaacgttcccttgttattgggga
TCH01_0092_D05.b : atcgaccgcctggcgataacccacccagtcacgtgtccctgtcttgcggaagcagaggca
TCH01_0047_H12.b : ccatcgaccgctggcgggtaacccaccacgtcaacgtgtccttggtcatggcggagcaaa
TCH01_0080_F10.b : aaccgcctgtcgggaaaacccaccccggcacttgtccttggccatggggaagaagaagca
TCH01_0026_C12.b : atcgaccgcctggcgggtaacccaccccgtcaagttgtcctggtcatggggaaagcaaag
TCH01_0076_B10.b : atcgnacgcctggcgggtaacccacccagtcacctgtccttttcatgcgggaggaaaggg
TCH01_0079_G07.b : *AACATCGACgcctggcggtaaacccacccacgtcacttgtccgtggtcatggccgaagc
SMG01_0095_B02.b : tggggggaaaccacccactcaactgcccgggtctgcggaacaaagggattttcttggacc
TCH01_0029_H02.b : acgcctggcgggtaacccccccacgtcacctgtccgtggtcatggcggaagcaaaggcat
TCH01_0067_F02.b : catcgaccgcctggncggtaaccaccacgtcacgtgtccntgtcatggcgaagcaaaggc
TCH01_0060_G05.b : tcccccaaaaaaaccatccgaccgcccgtggggggggtaaacccccccccactctaaact
TCH01_0006_D03.b : ttcgacgctggcggggaaaccccccacttcaagtgtccttggtcttggcgaggaaagggt
TCH01_0038_F11.b : *GACATCGACCGCCTGGCGGGTAAACCCACCA*CGTCAACGTGTTCGTGGTCATGGCCGA
TCH01_0014_D06.b : atcgaccgcctgggcgggtaacccaccacgtcaaggtgtcttggtcatggcggagccaaa
TCH01_0072_C03.b : gtgcgtataaaacaaccacacaatccactatacttancaataaanaatactttccnctta
ITT01_0082_E04.b : NAACATCGACCTGCTGGCGGGTAAACCCACCCACGTCAACGTGTCCGTGGTCATGCCGGA
ITT01_0081_H09.b : acatcgnaccgctggcgggtaacccaccacgtcacgtgtccgtgtcatgccgaagcagag
LNG01_0005_B01.b : aaaaccatcgacccgctgggcgggtaaaccccccccccttcaaacgtgttccgtgggtca
PBL01_0102_C02.b : ccgctggcggtaanccaccacgtcacgtgtcgtggtcatggcgagcaaagccattgctat
ITT01_0069_H09.b : GACCATCGACCGCCTGGCGGGTAAACCCACCC*CGTTCACTTGTCCGTGGTCATGGCGGA
MLN01_0075_D01.b : aacactgacgccctgggggttcccggggaccctttccctggctggggtggaacttgctcg
TCH01_0001_H06.b : AGACATCGACCGCCTGGCGGGTAAACCAACCC*ACGTCActtgtccgtggccattggcga
TCH01_0080_E07.b : GACCATCGACCGCCTGGCGGGTAAACCCACCA*CGTTCACCTGTCCGTGGTCATGcggaa
TCH01_0066_D09.b : GAACATCGACCGCCTGGCCGGTAAACCCACCA*CGTCCACGTGTCCGTGGTCATGGCGGA
TCH01_0072_H02.b : *GACATCGACCGCCTGGCGGGTAAACCCccccgttcacgtgtccttggtaatggcgaagc
ITT01_0084_B03.b : AACCATCGACCGCCTGGCGGGTAAACCACCCA*CGTCAACGTGTCCGTGGTCATGGCGGA
TCH01_0029_A09.b : GACCATCGACCGCCTGGCGGGTAAACCACCCA*CGTCCACGTGTCCCTGGTCATGGCGGA
TCH01_0069_A04.b : GACCATCGACCGCCTGGCGGGTAAACCCCCCA*CGTCAACGTGTCCGTGGTCATGGGCGA
20110601C-001625 : AGCAGAGGGCATCTGCTACTGGAGCGCCCCGCCCACTCGCCCCTCGAATAAACTCCGTGC
---------+---------+---------+---------+---------+---------+ 1226
TCH01_0103_D10.b : cccccccaaaaatccggcctttaaaaaaaaaaaaggccatttccacccgcccc
TCH01_0075_H02.b : tattgaacccccccccaactcccctcaaaaaaaccgggt
TCH01_0048_D03.b : tggttatgtaaaaccccccaaaccccccaaaaaactccgggctcctgagaacccctaaaa
TCH01_0017_F06.b : cactccccccaaaaaaccggcccctgaaaaaaaaaaaaagccatggccaattcagtccgg
TCH01_0032_B07.b : ctgctattaccccccgcccatcgccctcgataatcccggcccccttgnnnnnnnnnnnnn
TCH01_0015_D02.b : ttgcttatgaccgcccgcccatcgccctaaaataatcctgctcccttggacaaaaaaaaa
TCH01_0093_B04.b : tggacccccccccactccccccaaaaaactcggggcctttgacgcaaaaaaaaaaaaaaa
TCH01_0002_A01.b : aaaaggattcggtattgaacccccccccaactccccctgaaaaaatcgggccccttaaaa
TCH01_0059_A02.b : tttgaaccccccccccccccccccaataaaatcgggtcccttaaaccaaaaaaaaaaaaa
TCH01_0103_B05.b : tgttaataaccccccccccctccccccgaataactccggctcctgtgaaaaaaaaaaaaa
TCH01_0030_D11.b : ttcctatgagcccccccc
TCH01_0076_G12.b : ttatgaacgcccgccaatgccctcgaaaaactccggctccctggaacaaaaaaaaaaaa
TCH01_0098_D08.b : gcaaagggatctgcttatgaccccccgtcaccccgcccccgaaaaatcctgggctccttg
ITT01_0033_F08.b : gctatgagccgccgcccatccccctcgaaaaatcggggtccctgaacccgcaaaaaaaaa
TCH01_0003_F04.b : tgaacccccgccctccccctcaataactcggtctgcttgaaaaaaaaaaagcacatggcc
TCH01_0027_E11.b : agaaaaaggcttctgtttttgaacccccccccccctctccct
TCH01_0092_D05.b : ttgcaattgaccccccgccaatccccttgaaaaaccccggctccctggaaaaaaaaaaaa
TCH01_0047_H12.b : aggcatctgctaatgagccgcccgcccactcgcccctcgaataacctcgtgccccttgaa
TCH01_0080_F10.b : tctggtaaccagccgcccgccattcgcccctgaataactcggggtccttgaacaacctaa
TCH01_0026_C12.b : ggcttttcctctaaaccgt
TCH01_0076_B10.b : atctgtatgaccgcccgccactccccctcgataactcgtggtcctttgaacaaaaaaaaa
TCH01_0079_G07.b : aaaggcatctgctactganccgccccgccaatcgcccctcgataaactccgtgctccttg
SMG01_0095_B02.b : ccccccccccccccctgaaaaacccgggcccttaaaccccaaaaaaaaaaaaaaaaaaaa
TCH01_0029_H02.b : cgctagtgaccgcccgcccattgcccctaaaaacttcggggtcctaaaaaanannnnnan
TCH01_0067_F02.b : tctgctatgancgcccgccactcgccctcgataaactcgtgctccctgaagcaaaaaaaa
TCH01_0060_G05.b : ggtcccgggggtcatgggggggaaggccaaaagggcattctttctatggaagccgcgccc
TCH01_0006_D03.b : tttgtatgaaccccccgcccatccccctcaaaaaactcgggcccttggacgcaaaaaaaa
TCH01_0038_F11.b : AGCAaaggccattgctaatgancggcccggccaattgccctgaattaactccgggtcgct
TCH01_0014_D06.b : ggcatctgcaatgagcggcccggccattcccccctcaaaaattccgtgctccttaaggaa
TCH01_0072_C03.b : tcttaaacacccctacaatatatacttaacttctttccttacacgatacacanaaatnna
ITT01_0082_E04.b : GGCAAAGGGatctgntantgagncgacccgccaatcggccctccaataactccgtgctcc
ITT01_0081_H09.b : gcatctgctatgaccgcccgccactcgccctcgaataactcgtgctcgctgaggcnnnnn
LNG01_0005_B01.b : tgggcgaaaggcaaaaagggcatcctgcctacttaaacccccccccccccccctctcccc
PBL01_0102_C02.b : gaccgcccccccatcgccctgaaaactcgtgtccctggaaaaannnnnnnnnnnannnnn
ITT01_0069_H09.b : ggcgaaggctctgcttatgagccgcccgcccactcgccctcaaataactcgggcccccct
MLN01_0075_D01.b : ggaagggcccgaagaaataaacctggaaggctaactttggcccacaccattacgctgtct
TCH01_0001_H06.b : gacagagggcatctgctaatgaaccgcccggccattgccccctgaataaactccttgctc
TCH01_0080_E07.b : gccaagggcatctgctatggaaccgccccgcccattcgcccctcaaataatccgtggtcg
TCH01_0066_D09.b : AGCAAAGGGCATCTGCTANTGAGGCGCCCCGNCCAATTGCCCCTtggattaacctccgtg
TCH01_0072_H02.b : aaaggcattcgctattaacccgcccgcccatcgcccctgaataaatccgtgctcgctgga
ITT01_0084_B03.b : GGCAGAAGGCATCTGCTNACTGAGCGCCCCCGCCACTCGCCCCTCGAATAA*CTCCGTGC
TCH01_0029_A09.b : AGCAGAGGGCATCTGCTAATGGAGCGCCCCGCCCACTCGCCCCTTGAATAAACTCCGTGC
TCH01_0069_A04.b : AGCAGAGGGCATCTGCTACTGAGCCGCCCCGCCCACTCGCCCCTCGAAATAACTCCGTGC
20110601C-001625 : TCGCTTGAAAAAAAAAAAAAAAAAAAAAAAAA............................
---------+---------+---------+---------+---------+---------+ 1258
TCH01_0103_D10.b :
TCH01_0075_H02.b :
TCH01_0048_D03.b : aaaaaaaaaaaattttaaaaaaaaaggggcctggtcccacacggggccgcccc
TCH01_0017_F06.b : ccttaaaatcccggggccactacaaccctttttaaaggcccaagagggataacagaaggc
TCH01_0032_B07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TCH01_0015_D02.b : aaaaaaaaaaaaggcccatttgcccaactcaggccggcccctttaaaatcctt
TCH01_0093_B04.b : gggccttgtcctcacgagggccgcccctaaaaatcccggggcaattttcgacccattttt
TCH01_0002_A01.b : aaaaaaaaaaaaaaaaaaaa
TCH01_0059_A02.b : aaa
TCH01_0103_B05.b : aaaagccatgtgccaactcaggccggcccctaatatctctcggggcacatttcct
TCH01_0030_D11.b :
TCH01_0076_G12.b :
TCH01_0098_D08.b : aaaaccccccccttcctccaaaanaaattnatagatataaaactgttaaattatttatat
ITT01_0033_F08.b : aaaaaaaaaagcccatgggctcactgcagtccggccctcttaaatccctgggggcaaaat
TCH01_0003_F04.b : cactgaggtcggccgctaaatatctcgggggcaatttagataccttttt
TCH01_0027_E11.b :
TCH01_0092_D05.b : aaaaaaaaaagccaatggcccaatttaggtcgggcccttaaattcctcgggagccaatta
TCH01_0047_H12.b : aaaaaaaaaaaaaaaggcccatgtgctcaactgcagtccggccgtcctaatt
TCH01_0080_F10.b : ataaactttggtaaggcaaaaatagggccatggcccaattggggcccggcccctaaaatc
TCH01_0026_C12.b :
TCH01_0076_B10.b : aaaaaaaaaaggccatggtcaactcaggtcggccttctaat
TCH01_0079_G07.b : gaacaaaaaaaaaaaaaaaaaaaaaaaaggcccatggtccaacctcagtccggcctcttt
SMG01_0095_B02.b : aaaaggcattgttccaattgggcggccccctaaatcctcgggggccccttcaccaccctt
TCH01_0029_H02.b : nnnnnnnnnnaaggcccttgtcctaactaggtccgcc
TCH01_0067_F02.b : aaaaaaaggccctgtgctccactcagtcgcgcccttcaa
TCH01_0060_G05.b : cccccaatatggccccctgaagaaaaaatcccggggccccgcctgtaaaaaaaaaaaaac
TCH01_0006_D03.b : aaaaaaaggccattgcccagctcaggccggccctcttaatccccagggcccaattaggta
TCH01_0038_F11.b : tgaaccccaaaaaaaaaaaaaagccaatgggctcaacggaggtccggc
TCH01_0014_D06.b : aaaaaaaaaaaaaaaaaggcccagtgctccactgaaggcgggccgcttaaaataccccag
TCH01_0072_C03.b : atancatactcaagcactctaacacaaaatacancacttattnacactcacttaaaaata
ITT01_0082_E04.b : ctgaaaaaaaaaaaaaagggccctgtgccaacctggagtccgggccctctaatattcttc
ITT01_0081_H09.b : nnnnnnnnnnnnaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnggcccatgtgt
LNG01_0005_B01.b : cccctcaaaataaaatcccccggggccttgccctttgaaaaaaaaaaaaaaaaaaaaaaa
PBL01_0102_C02.b : nnnnaaaaaagcccctggcaactcaggcggccctcaaattcccaggccacttccacccct
ITT01_0069_H09.b : tgaagcgcaaaaaaaaaaaaaaaaaaaaaaaggcccatgtgtccaatgcaggtccgcccc
MLN01_0075_D01.b : acctctttcgtgtaacccttttcttagcaccctttgaaatgtaaatatctggggcccact
TCH01_0001_H06.b : cctggaaaaaaaaaaaaaaaaaaaaggcccattttgctcaaacttgcagttccggcccct
TCH01_0080_E07.b : ctttgaaccccaaaaaaataaatattatttattaataattanatatttattttcattact
TCH01_0066_D09.b : ctcgccttgaaccgcnannnaaaaaaaaaannnnnnannnnnnnnaaaaaaaaaaaaaaa
TCH01_0072_H02.b : ccaaaaaaaaaaaaaaaaaaaaaaaggcccagtgtcccactcaggtccgggcgcctaaat
ITT01_0084_B03.b : TCGCTTGAAAAAAAAAAAAAAAAggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0029_A09.b : TCCCTTGnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TCH01_0069_A04.b : TCGCTTGGAAGCACaaaaaaaaaaaaaaaaaaaaaggnnnnnnnnnnnnnnnnnnnnnnn
20110601C-001625 : ............................................................
---------+---------+---------+---------+---------+---------+ 1258
TCH01_0103_D10.b :
TCH01_0075_H02.b :
TCH01_0048_D03.b :
TCH01_0017_F06.b : cttttaccctcgggaaacacgggttttaaacatcttggggtgtggaacccaatacccgaa
TCH01_0032_B07.b : nnnnnnn
TCH01_0015_D02.b :
TCH01_0093_B04.b : taaaaggccccaagggcgttataacggcgggcctttttacccgcgggaaactctgttttt
TCH01_0002_A01.b :
TCH01_0059_A02.b :
TCH01_0103_B05.b :
TCH01_0030_D11.b :
TCH01_0076_G12.b :
TCH01_0098_D08.b : aataaaagggcgccttgtctcaattggggccgccgcctcaaattctccgagggccagatt
ITT01_0033_F08.b : taagtaccactttttgaaaagggcccaagagggcataaaacagaacggccctttaaaccc
TCH01_0003_F04.b :
TCH01_0027_E11.b :
TCH01_0092_D05.b : cggtaccccttttgagagaggcccatagggcattttacaggccgggcccttt
TCH01_0047_H12.b :
TCH01_0080_F10.b : cctgggggccaccttacgttgcccttttttaaag
TCH01_0026_C12.b :
TCH01_0076_B10.b :
TCH01_0079_G07.b : aaaatccttgggggcaagttaacgtcccactttttttatat
SMG01_0095_B02.b : ttggaaagggccccaaggcttaaaaacggcgggcgcttttaaccccggggaaaatctttt
TCH01_0029_H02.b :
TCH01_0067_F02.b :
TCH01_0060_G05.b : caattttatantaaaaaaagggccccatggtgttttcacaccttcg
TCH01_0006_D03.b : c
TCH01_0038_F11.b :
TCH01_0014_D06.b : ggg
TCH01_0072_C03.b : aaannattctaaaaatcaanatgaatcacactcatatnanctccatcaatactactctaa
ITT01_0082_E04.b : aggggccacttaccgtccagcttttggaaaagggtcctaaggagccgatttagctgcccg
ITT01_0081_H09.b : cgactgaggccggcccttaaatcctcgggggccattacctccactttttgaaagggccca
LNG01_0005_B01.b : aaa
PBL01_0102_C02.b : ttttaaagggccaagggctataaacagccggccctttaccctcggaaatctttggtttaa
ITT01_0069_H09.b : cctaaataccctcaggggcccagcttaccataccactttttgtaaagaggtccctaaggg
MLN01_0075_D01.b : taaaccaaaagggcccctattcggacggaccaccctgggaggaccttgagaggcttttga
TCH01_0001_H06.b : ttaaatttccccgagggggccaaagcttaccgtacccactttttttgtaaaaggggtccc
TCH01_0080_E07.b : agtcctttctaaattctttaaaaatatatataattaaaggcccttgttctaacttgggtg
TCH01_0066_D09.b : aaaaaaagggcccatgtgctcaaattgcgggcccgggccccttaaataatcctccannnn
TCH01_0072_H02.b : aacctcgagggcccaacttccgtaccgctttttgaaaaagggtccctaagtgactcatta
ITT01_0084_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0029_A09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TCH01_0069_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-001625 : ............................................................
---------+---------+---------+---------+---------+---------+ 1258
TCH01_0103_D10.b :
TCH01_0075_H02.b :
TCH01_0048_D03.b :
TCH01_0017_F06.b : aaattttgggaacccccgcgttctttttaaaaaacaaatgtttatcagctcccccggcaa
TCH01_0032_B07.b :
TCH01_0015_D02.b :
TCH01_0093_B04.b : aaaactcttggggtattt
TCH01_0002_A01.b :
TCH01_0059_A02.b :
TCH01_0103_B05.b :
TCH01_0030_D11.b :
TCH01_0076_G12.b :
TCH01_0098_D08.b : aagcgaccgattttgtaaagaggtccttatgggcgtataaagtgggccgcgcttttatac
ITT01_0033_F08.b : ggaggaaaactacttggatttta
TCH01_0003_F04.b :
TCH01_0027_E11.b :
TCH01_0092_D05.b :
TCH01_0047_H12.b :
TCH01_0080_F10.b :
TCH01_0026_C12.b :
TCH01_0076_B10.b :
TCH01_0079_G07.b :
SMG01_0095_B02.b : ttttttaaaacctcttgggggatttgaccccccaaatccccgaaaaatattttttggtgc
TCH01_0029_H02.b :
TCH01_0067_F02.b :
TCH01_0060_G05.b :
TCH01_0006_D03.b :
TCH01_0038_F11.b :
TCH01_0014_D06.b :
TCH01_0072_C03.b : cactaacactaaacttnatttt
ITT01_0082_E04.b : gccgcctttaaccccgacggaaaacgcactggattttgtagaactcttctggggaaattt
ITT01_0081_H09.b : agggctataaacgggcggggttttaaaccttgggaaactactggatttagaaccctttgg
LNG01_0005_B01.b :
PBL01_0102_C02.b : aaccttttgggttggaaccccaataccggaaaattttttgttccccccggggttcttata
ITT01_0069_H09.b : agctatttaacagggcggggcgtttttacacccggcgggaaaaggcactgggattttaaa
MLN01_0075_D01.b : acctcccataactaaattgtgcctgtttaaaaacgaacctaatttggttttctcgtgtgc
TCH01_0001_H06.b : tatgggggccgttttaagcctaggccttggcctccttta
TCH01_0080_E07.b : gggcctttatattctccgggggccaaatttacgtacccctttgttaaaagggccccaagg
TCH01_0066_D09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TCH01_0072_H02.b : acctagccgggccttttttaaacccgtgatgaaaaccctattgggtctttgaagactttt
ITT01_0084_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxacgtcctgatggaaaacgctacctggaatctt
TCH01_0029_A09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TCH01_0069_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-001625 : ............................................................
---------+---------+---------+---------+---------+---------+ 1258
TCH01_0103_D10.b :
TCH01_0075_H02.b :
TCH01_0048_D03.b :
TCH01_0017_F06.b : cctttt
TCH01_0032_B07.b :
TCH01_0015_D02.b :
TCH01_0093_B04.b :
TCH01_0002_A01.b :
TCH01_0059_A02.b :
TCH01_0103_B05.b :
TCH01_0030_D11.b :
TCH01_0076_G12.b :
TCH01_0098_D08.b : ctcggagagaatctacg
ITT01_0033_F08.b :
TCH01_0003_F04.b :
TCH01_0027_E11.b :
TCH01_0092_D05.b :
TCH01_0047_H12.b :
TCH01_0080_F10.b :
TCH01_0026_C12.b :
TCH01_0076_B10.b :
TCH01_0079_G07.b :
SMG01_0095_B02.b : cccccccccggggttcccaaataaaaaaaagaattttttttttataagcgcgcccccccc
TCH01_0029_H02.b :
TCH01_0067_F02.b :
TCH01_0060_G05.b :
TCH01_0006_D03.b :
TCH01_0038_F11.b :
TCH01_0014_D06.b :
TCH01_0072_C03.b :
ITT01_0082_E04.b : ggaaccccgaattaccccgggaaaatttttggaggttaaacccccccgccggaattcccg
ITT01_0081_H09.b : gtgcattgaaaccccatttacccggaaaatt
LNG01_0005_B01.b :
PBL01_0102_C02.b : aaaaaacggttttttaaccccccccccccccacctatccccc
ITT01_0069_H09.b : aacactaccctgggggatatgtgaaaccccccaaaatatacctgggaaaaaattttgggt
MLN01_0075_D01.b : taatgtctccctaaaattataaaaacataaagagtcctgtgtc
TCH01_0001_H06.b :
TCH01_0080_E07.b : ggcctttataaagagcggggcgcttttaaccgg
TCH01_0066_D09.b :
TCH01_0072_H02.b :
ITT01_0084_B03.b : ggaagaaccttactcgggtgggacaattgacaaccccttcgaattaagcccaggaaaaaa
TCH01_0029_A09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TCH01_0069_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-001625 : ............................................................
---------+---------+---------+---------+---------+---------+ 1258
TCH01_0103_D10.b :
TCH01_0075_H02.b :
TCH01_0048_D03.b :
TCH01_0017_F06.b :
TCH01_0032_B07.b :
TCH01_0015_D02.b :
TCH01_0093_B04.b :
TCH01_0002_A01.b :
TCH01_0059_A02.b :
TCH01_0103_B05.b :
TCH01_0030_D11.b :
TCH01_0076_G12.b :
TCH01_0098_D08.b :
ITT01_0033_F08.b :
TCH01_0003_F04.b :
TCH01_0027_E11.b :
TCH01_0092_D05.b :
TCH01_0047_H12.b :
TCH01_0080_F10.b :
TCH01_0026_C12.b :
TCH01_0076_B10.b :
TCH01_0079_G07.b :
SMG01_0095_B02.b : tttaaacctttttttcccccaaattgtt
TCH01_0029_H02.b :
TCH01_0067_F02.b :
TCH01_0060_G05.b :
TCH01_0006_D03.b :
TCH01_0038_F11.b :
TCH01_0014_D06.b :
TCH01_0072_C03.b :
ITT01_0082_E04.b : gaaattaaataacagacgttctttgttttcccccccttgccctcc
ITT01_0081_H09.b :
LNG01_0005_B01.b :
PBL01_0102_C02.b :
ITT01_0069_H09.b : agggggaaccccctgcctggcg
MLN01_0075_D01.b :
TCH01_0001_H06.b :
TCH01_0080_E07.b :
TCH01_0066_D09.b :
TCH01_0072_H02.b :
ITT01_0084_B03.b : aattttagggaaagggtaacacacccaagctgcgctgaaattgcctagggttatttgaaa
TCH01_0029_A09.b :
TCH01_0069_A04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-001625 : ............................................................
---------+---------+---------+---------+---------+---------+ 1258
TCH01_0103_D10.b :
TCH01_0075_H02.b :
TCH01_0048_D03.b :
TCH01_0017_F06.b :
TCH01_0032_B07.b :
TCH01_0015_D02.b :
TCH01_0093_B04.b :
TCH01_0002_A01.b :
TCH01_0059_A02.b :
TCH01_0103_B05.b :
TCH01_0030_D11.b :
TCH01_0076_G12.b :
TCH01_0098_D08.b :
ITT01_0033_F08.b :
TCH01_0003_F04.b :
TCH01_0027_E11.b :
TCH01_0092_D05.b :
TCH01_0047_H12.b :
TCH01_0080_F10.b :
TCH01_0026_C12.b :
TCH01_0076_B10.b :
TCH01_0079_G07.b :
SMG01_0095_B02.b :
TCH01_0029_H02.b :
TCH01_0067_F02.b :
TCH01_0060_G05.b :
TCH01_0006_D03.b :
TCH01_0038_F11.b :
TCH01_0014_D06.b :
TCH01_0072_C03.b :
ITT01_0082_E04.b :
ITT01_0081_H09.b :
LNG01_0005_B01.b :
PBL01_0102_C02.b :
ITT01_0069_H09.b :
MLN01_0075_D01.b :
TCH01_0001_H06.b :
TCH01_0080_E07.b :
TCH01_0066_D09.b :
TCH01_0072_H02.b :
ITT01_0084_B03.b : ttaaccgggcgggtttttttggggttaaatcatccaggatttgccccccccacgttggta
TCH01_0029_A09.b :
TCH01_0069_A04.b :
20110601C-001625 : ............................................................
---------+---------+---------+---------+---------+---------+ 1258
TCH01_0103_D10.b :
TCH01_0075_H02.b :
TCH01_0048_D03.b :
TCH01_0017_F06.b :
TCH01_0032_B07.b :
TCH01_0015_D02.b :
TCH01_0093_B04.b :
TCH01_0002_A01.b :
TCH01_0059_A02.b :
TCH01_0103_B05.b :
TCH01_0030_D11.b :
TCH01_0076_G12.b :
TCH01_0098_D08.b :
ITT01_0033_F08.b :
TCH01_0003_F04.b :
TCH01_0027_E11.b :
TCH01_0092_D05.b :
TCH01_0047_H12.b :
TCH01_0080_F10.b :
TCH01_0026_C12.b :
TCH01_0076_B10.b :
TCH01_0079_G07.b :
SMG01_0095_B02.b :
TCH01_0029_H02.b :
TCH01_0067_F02.b :
TCH01_0060_G05.b :
TCH01_0006_D03.b :
TCH01_0038_F11.b :
TCH01_0014_D06.b :
TCH01_0072_C03.b :
ITT01_0082_E04.b :
ITT01_0081_H09.b :
LNG01_0005_B01.b :
PBL01_0102_C02.b :
ITT01_0069_H09.b :
MLN01_0075_D01.b :
TCH01_0001_H06.b :
TCH01_0080_E07.b :
TCH01_0066_D09.b :
TCH01_0072_H02.b :
ITT01_0084_B03.b : atacccccttggagtttgttaaacccccccccaaaaaaa
TCH01_0029_A09.b :
TCH01_0069_A04.b :