
[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-001761

Length: 1,163

Sequence [FASTA format sequence]

SNP mapping information
SNP IDRel.Chr.Location (cM)

Assembly Overview:      TOP
Change score limit to  

BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinUBCpolyubiquitin-C [Homo sapiens]. 6630.0
Contig/Assembly ProteinUBBpolyubiquitin-B precursor [Homo sapiens]. 444e-125O
Contig/Assembly ProteinRPS27Aubiquitin-40S ribosomal protein S27a precursor [Homo sapiens]. 1511e-36O
Contig/Assembly ProteinUBA52ubiquitin-60S ribosomal protein L40 precursor [Homo sapiens]. 1511e-36O
Contig/Assembly ProteinUBA52ubiquitin-60S ribosomal protein L40 precursor [Homo sapiens]. 1511e-36O
Contig/Assembly ProteinRPS27Aubiquitin-40S ribosomal protein S27a precursor [Homo sapiens]. 1511e-36O
Contig/Assembly ProteinRPS27Aubiquitin-40S ribosomal protein S27a precursor [Homo sapiens]. 1511e-36O
Contig/Assembly ProteinNEDD8NEDD8 precursor [Homo sapiens]. 97.13e-20O
Contig/Assembly ProteinUBDubiquitin D [Homo sapiens]. 84.32e-16O
Contig/Assembly ProteinISG15ubiquitin-like protein ISG15 precursor [Homo sapiens]. 773e-14O

BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinUbcpolyubiquitin-C [Mus musculus]. 6630.0O
Contig/Assembly ProteinUbbpolyubiquitin-B [Mus musculus]. 588e-168O
Contig/Assembly ProteinRps27aubiquitin-40S ribosomal protein S27a precursor [Mus musculus]. 1511e-36O
Contig/Assembly ProteinUba52ubiquitin-60S ribosomal protein L40 [Mus musculus]. 1518e-37O
Contig/Assembly ProteinRps27aubiquitin-40S ribosomal protein S27a precursor [Mus musculus]. 1511e-36O
Contig/Assembly ProteinGm7866PREDICTED: ubiquitin-like protein ISG15-like [Mus musculus]. 1501e-36O
Contig/Assembly ProteinGm7866PREDICTED: ubiquitin-like protein ISG15-like [Mus musculus]. 1501e-36O
Contig/Assembly ProteinGm8430PREDICTED: hypothetical protein LOC667035 [Mus musculus]. 1494e-36O
Contig/Assembly ProteinGm8430PREDICTED: hypothetical protein LOC667035 [Mus musculus]. 1487e-36O
Contig/Assembly ProteinGm4802PREDICTED: hypothetical protein LOC216818 [Mus musculus]. 1081e-23O

BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC610457PREDICTED: similar to CG11624-PA, isoform A [Canis familiaris]. 6630.0O
Contig/Assembly ProteinLOC479513PREDICTED: similar to ubiquitin B precursor isoform 1 [Canis familiaris]. 442e-124O
Contig/Assembly ProteinLOC479513PREDICTED: similar to ubiquitin B precursor isoform 3 [Canis familiaris]. 2989e-81O
Contig/Assembly ProteinLOC479513PREDICTED: similar to ubiquitin B precursor isoform 2 [Canis familiaris]. 2801e-75O
Contig/Assembly ProteinLOC608887PREDICTED: similar to polyubiquitin [Canis familiaris]. 1642e-40O
Contig/Assembly ProteinUBA52ubiquitin-60S ribosomal protein L40 precursor [Canis lupus familiaris]. 1511e-36O
Contig/Assembly ProteinLOC474599PREDICTED: similar to ubiquitin and ribosomal protein S27a precursor [Canis familiaris]. 1511e-36O
Contig/Assembly ProteinUB-RPL40hypothetical protein LOC612529 [Canis lupus familiaris]. 1511e-36O
Contig/Assembly ProteinLOC610074PREDICTED: similar to ubiquitin B precursor [Canis familiaris]. 1472e-35O
Contig/Assembly ProteinLOC481020PREDICTED: similar to ubiquitin and ribosomal protein S27a precursor [Canis familiaris]. 1433e-34O

BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinUBCpolyubiquitin-C [Bos taurus]. 6660.0O
Contig/Assembly ProteinLOC281370polyubiquitin-B [Bos taurus]. 586e-167O
Contig/Assembly ProteinLOC100335189PREDICTED: Os05g0242100-like [Bos taurus]. 3454e-95O
Contig/Assembly ProteinLOC100138493PREDICTED: Os05g0242100-like [Bos taurus]. 3041e-82O
Contig/Assembly ProteinLOC100296593PREDICTED: Os05g0242100-like [Bos taurus]. 2325e-61O
Contig/Assembly ProteinLOC100296593PREDICTED: Os05g0242100-like [Bos taurus]. 2325e-61O
Contig/Assembly ProteinUBA52ubiquitin-60S ribosomal protein L40 [Bos taurus]. 1519e-37O
Contig/Assembly ProteinRPS27Aubiquitin-40S ribosomal protein S27a [Bos taurus]. 1511e-36O
Contig/Assembly ProteinLOC783718PREDICTED: ubiquitin B-like, partial [Bos taurus]. 1502e-36O
Contig/Assembly ProteinLOC783718PREDICTED: ubiquitin B-like [Bos taurus]. 1496e-36O

BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100521156PREDICTED: polyubiquitin-B-like isoform 5 [Sus scrofa]. 592e-169O
Contig/Assembly ProteinLOC100521156PREDICTED: polyubiquitin-B-like isoform 2 [Sus scrofa]. 592e-169O
Contig/Assembly ProteinLOC100521156PREDICTED: polyubiquitin-B-like isoform 4 [Sus scrofa]. 592e-169O
Contig/Assembly ProteinLOC100521156PREDICTED: polyubiquitin-B-like isoform 1 [Sus scrofa]. 592e-169O
Contig/Assembly ProteinLOC100521156PREDICTED: polyubiquitin-B-like isoform 3 [Sus scrofa]. 592e-169O
Contig/Assembly ProteinUBBubiquitin [Sus scrofa]. 444e-125O
Contig/Assembly ProteinLOC100627098PREDICTED: hypothetical protein LOC100627098 [Sus scrofa]. 1686e-42O
Contig/Assembly ProteinLOC100514637PREDICTED: ubiquitin-40S ribosomal protein S27a-like [Sus scrofa]. 1518e-37O
Contig/Assembly ProteinUBA52ubiquitin-60S ribosomal protein L40 [Sus scrofa]. 1516e-37O
Contig/Assembly ProteinLOC100514637PREDICTED: ubiquitin-40S ribosomal protein S27a-like [Sus scrofa]. 1518e-37O

Assembly Members: 497      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.


SNPs: 5      TOP
Loc.AlleleIndividualsFreq.TypeAA Change

Alignment:      TOP

20110601C-001761 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
THY01_0115_C10.b :
THY01_0118_F10.b :
LVRM1_0144_B11.b :
OVR01_0018_H07.b :
LVRM1_0169_C01.b :
OVRM1_0096_A07.b :
OVR01_0027_E05.b :
THY01_0103_F06.b :
THY01_0105_C01.b :
LVRM1_0028_H03.b :
OVRM1_0071_H01.b :
LVRM1_0001_C11.b :
LVR01_0005_C07.b :
LNG01_0013_D04.b :
PST01_0089_H08.b :
PST01_0075_G09.b :
SKNB1_0078_G12.b :
LVRM1_0081_C01.b :
OVRM1_0147_E07.b :
LVRM1_0107_D02.b :
LVR01_0036_A03.b :
OVR01_0042_B06.b :
OVRM1_0005_E05.b :
TES01_0022_D07.b :
SKNB1_0009_C02.b :
PST01_0018_C05.b :
TES01_0029_F05.b :
PST01_0062_E07.b :
SKNB1_0095_G05.b :
KDN01_0052_B02.b :
KDN01_0032_D01.b :
KDN01_0057_A08.b :
PST01_0066_D01.b :
PST01_0019_F12.b :
PST01_0076_A09.b :
TES01_0046_E03.b :
KDN01_0072_E03.b :
KDN01_0059_A06.b :
KDN01_0086_E05.b :
PST01_0072_G06.b :
PST01_0028_H02.b :
KDN01_0043_D07.b :
PST01_0012_B09.b :
KDN01_0069_B03.b :
KDN01_0007_G03.b :
KDN01_0063_E08.b :
PST01_0089_C07.b :
TES01_0021_A08.b :
SKNB1_0074_B10.b :
PST01_0035_D09.b :
KDN01_0061_C02.b :
PST01_0087_H06.b :
PST01_0014_F06.b :
PST01_0014_A01.b :
TES01_0066_H01.b :
PST01_0080_A09.b :
KDN01_0026_C06.b :
KDN01_0052_D12.b :
KDN01_0080_F03.b :
PST01_0096_G02.b :
PST01_0063_G08.b :
TCH01_0080_D07.b :
KDN01_0078_E01.b :
PST01_0084_D08.b :
KDN01_0064_D03.b :
PST01_0071_B03.b :
KDN01_0062_E03.b :
PST01_0098_E01.b :
PST01_0057_A10.b :
PST01_0056_D06.b :
KDN01_0042_G11.b :
KDN01_0060_H02.b :
KDN01_0095_A03.b :
PST01_0007_C01.b :
KDN01_0054_B12.b :
PST01_0046_C06.b :
KDN01_0077_D04.b :
PST01_0085_B09.b :
KDN01_0066_B03.b :
KDN01_0049_C11.b :
KDN01_0058_H01.b :
BFLT1_0145_G02.b :
OVRM1_0151_D08.b :
OVRM1_0152_E09.b :
SKNB1_0002_G08.b :
OVRM1_0075_C07.b :
LVRM1_0105_D08.b :
OVRM1_0132_H06.b :
SKNB1_0003_A12.b :
OVRM1_0095_A12.b :
KDN01_0020_E03.b :
CBLT1_0067_A01.b :
BMWN1_0093_F01.b :
SKNB1_0022_C01.b :
HTMT1_0119_C05.b :
ILNT1_0078_B02.b :
BMWN1_0057_E12.b :
BMWN1_0019_F11.b :
PST01_0006_G11.b :
HTMT1_0027_D02.b :
ITT01_0080_G04.b :
HTMT1_0141_F09.b :
CLNT1_0032_D02.b :
OVRT1_0128_D09.b :
LNG01_0002_H11.b :
CBLT1_0028_D04.b :
ILNT1_0007_D09.b :
SKNB1_0085_E12.b :
OVR01_0045_B12.b :
HTMT1_0076_D12.b :
CBLT1_0006_G02.b :
SKNB1_0086_H04.b :
KDN01_0041_A06.b :
ILNT1_0054_E06.b :
PST01_0014_C07.b :
SKNB1_0058_E10.b :
PST01_0013_A03.b :
OVRT1_0037_D10.b :
KDN01_0036_G12.b :
CBLT1_0060_E09.b :
CBLT1_0063_A05.b :
KDN01_0065_A06.b :
ITT01_0069_F08.b :
OVRM1_0175_H02.b :
OVR01_0086_D02.b :
AMP01_0006_D03.b : ttttcgtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0012_F04.b : nnaatacttatcttxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0043_D06.b :
ADR01_0015_D01.b :
AMP01_0093_A02.b : tgcgcatatttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0009_D04.b :
OVRM1_0188_B09.b :
DCI01_0057_B12.b : natgatcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0089_D07.b :
DCI01_0031_A05.b : nnncctatcttxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0060_D09.b : gaaacccnnttaggtattttaxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0059_D10.b :
OVRM1_0018_B05.b :
OVRM1_0098_H12.b :
OVRM1_0002_B05.b :
DCI01_0035_F11.b : nnggtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_C12.b :
AMP01_0097_C02.b : gggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0028_E12.b :
AMP01_0065_A08.b : atatagctaatcttxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0037_F10.b : nnnaaagtatcttxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0035_E08.b : nnnggtaccatxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0030_F05.b :
DCI01_0044_H01.b : tattatcttxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_G07.b : aatctctagcgatacttaxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0044_C06.b :
LNG01_0094_B11.b :
AMP01_0016_F04.b : nntttactgaatcttxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0060_B08.b : acccccttaggatacttxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0074_A08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxx
AMP01_0088_G09.b : natacgtatcttxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0032_H01.b :
AMP01_0055_H06.b : nnggataaannttaagtgatatcttxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0096_B09.b : ggcgtatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0103_H09.b :
AMP01_0027_G05.b : nnnattatactcaaggaattttttcggaaaccataxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxx
AMP01_0023_D03.b : ttttagcgaatcttxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_D11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxx
DCI01_0011_H03.b : nntttctatcttxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0026_E03.b :
OVRT1_0007_E07.b :
AMP01_0017_H12.b : nttaatggtatcttxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0052_H06.b : nnnnggagataaannttagagaatcattxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0037_D08.b : nngggatatatatagggatacttaxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_D04.b : nnnnccgatatanttttggatatcttgggctgctcgcccaccgxxxxxx
AMP01_0077_D02.b : nggtaatctatttgggatacttxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0007_E04.b : ttttagctatcttxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0015_H08.b : nnnnttactctcttxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0056_A10.b : nnnggcaataaantaagccgacacattxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0080_E01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxx
OVRT1_0122_H09.b :
AMP01_0084_A02.b : aaaaccgtatcttxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0041_G10.b : nnaatgtatctaaxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0050_G06.b : nnngggttatttatagggatacttxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0054_B12.b : nnnggagtaaannnttagggacatcttxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0113_E01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxx
OVR01_0004_B09.b :
OVRT1_0007_A09.b :
LNG01_0085_F11.b :
LVRM1_0026_C10.b :
LVRM1_0131_E06.b :
OVRM1_0166_A06.b :
OVRM1_0173_C01.b :
SMG01_0041_F07.b :
SMG01_0066_C09.b :
OVRM1_0076_C10.b :
OVRM1_0120_D05.b :
PTG01_0052_A12.b :
LVRM1_0072_A03.b :
OVRM1_0102_E04.b :
LVRM1_0058_D02.b :
LVRM1_0109_F09.b :
OVRM1_0068_F09.b :
OVRM1_0159_D04.b :
OVRM1_0102_G06.b :
LVRM1_0163_C05.b :
OVRM1_0115_D04.b :
SMG01_0096_G06.b :
OVRM1_0026_E11.b :
LVRM1_0150_G04.b :
LVRM1_0042_A04.b :
OVRM1_0129_G05.b :
OVRM1_0176_F09.b :
OVRM1_0121_G09.b :
OVRM1_0066_G09.b :
OVRM1_0068_C06.b :
SMG01_0057_B11.b :
LVRM1_0174_E02.b :
OVRM1_0130_D04.b :
OVR01_0104_B05.b :
OVRM1_0149_C06.b :
OVRM1_0152_H02.b :
OVRM1_0049_C09.b : nnn
OVRM1_0207_G03.b :
OVRM1_0066_C12.b : t
OVR01_0083_D08.b :
OVRT1_0036_H12.b :
OVRM1_0110_A09.b :
OVR01_0073_A09.b :
LVRM1_0083_A04.b :
OVRM1_0195_C04.b :
OVRM1_0061_H06.b :
LVRM1_0039_C03.b :
OVRM1_0164_F10.b :
LVRM1_0005_A06.b :
OVR01_0075_B05.b :
OVR01_0081_G11.b :
OVRM1_0134_G10.b :
OVRM1_0081_G05.b :
OVRM1_0147_E06.b :
LVRM1_0040_D04.b :
OVRM1_0046_A02.b :
LVRM1_0179_D05.b :
OVRT1_0029_B08.b :
LVRM1_0145_C05.b :
LVRM1_0172_G08.b :
LVRM1_0165_D03.b :
LVRM1_0095_D01.b :
OVRM1_0218_G06.b :
LVRM1_0040_E07.b :
LVRM1_0130_D05.b :
LVRM1_0170_B09.b :
OVRM1_0089_H03.b :
LVRM1_0095_A05.b :
LVRM1_0106_E10.b :
OVR01_0081_H04.b :
OVR01_0061_H01.b :
LVRM1_0033_A07.b :
LVRM1_0092_F10.b :
OVRM1_0191_A03.b :
LNG01_0046_G10.b :
LVRM1_0151_F08.b :
OVRM1_0044_F08.b :
OVRM1_0133_H08.b :
LVRM1_0047_C08.b :
LVRM1_0082_D09.b :
LVRM1_0201_B12.b :
OVRM1_0130_G11.b :
OVRM1_0093_A01.b :
OVRM1_0020_F02.b :
LVRM1_0030_F01.b :
OVRM1_0128_B08.b :
LVRM1_0088_H09.b :
OVRM1_0004_B05.b :
LVRM1_0021_A03.b :
LVRM1_0099_D10.b :
OVRM1_0131_E10.b :
LVRM1_0153_C01.b :
OVRM1_0207_B08.b :
LNG01_0036_E09.b :
LVRM1_0148_D08.b :
LVRM1_0117_C12.b :
LVR01_0089_B12.b :
OVRM1_0152_H11.b :
OVRM1_0205_F05.b :
OVRM1_0043_B01.b :
OVRM1_0062_H07.b :
OVRM1_0127_B02.b :
OVRM1_0038_C06.b :
OVRM1_0005_B02.b :
OVRM1_0202_F06.b :
LVRM1_0144_E01.b :
OVRM1_0223_F09.b :
LVRM1_0140_B03.b :
OVRM1_0039_F01.b :
OVRM1_0224_G06.b :
OVRM1_0096_C10.b :
OVRM1_0113_E06.b :
OVRM1_0077_G03.b :
LVRM1_0139_H05.b :
LVR01_0088_G07.b :
OVRM1_0025_G12.b :
OVRM1_0107_G12.b :
OVRM1_0113_H07.b :
LVRM1_0150_H09.b :
OVRM1_0079_C07.b :
SMG01_0013_H05.b :
OVRM1_0114_B07.b :
OVRM1_0091_G06.b :
OVRM1_0105_A12.b :
OVRM1_0083_H11.b :
UTR01_0012_A11.b :
OVRT1_0129_G02.b :
LNG01_0107_G02.b :
LNG01_0073_C08.b :
PBL01_0026_D02.b :
OVR01_0068_F11.b :
SMG01_0067_G01.b :
SMG01_0087_F03.b :
OVRT1_0089_B05.b :
OVRT1_0017_E10.b :
THY01_0068_F05.b :
PTG01_0019_D06.b :
SPL01_0043_F10.b :
UTR01_0059_F09.b :
SMG01_0077_H11.b :
OVR01_0048_B07.b :
OVR01_0050_G03.b :
LNG01_0091_H09.b :
OVRT1_0149_A11.b :
THY01_0048_B03.b :
LNG01_0110_G10.b :
LVR01_0086_H11.b :
UTR01_0045_B03.b :
OVR01_0056_C10.b :
SMG01_0037_G10.b :
OVRT1_0150_B03.b :
UTR01_0015_E11.b :
OVRT1_0103_A04.b :
UTR01_0019_H08.b :
OVR01_0049_F08.b :
OVR01_0070_B05.b :
UTR01_0020_A02.b :
ITT01_0085_D08.b :
OVRT1_0139_F08.b :
UTR01_0039_C03.b :
SMG01_0053_F07.b :
LNG01_0032_E03.b :
THY01_0045_A08.b :
OVRT1_0148_D06.b :
OVRT1_0105_F01.b :
LVR01_0051_G10.b :
LVR01_0020_G10.b :
OVRT1_0113_G01.b :
SMG01_0069_F01.b :
UTR01_0004_C03.b :
LVR01_0082_H11.b :
LNG01_0021_E09.b :
OVRT1_0039_G12.b :
OVRT1_0057_A10.b :
OVR01_0078_B10.b :
OVR01_0014_A06.b :
LVR01_0084_E04.b :
LNG01_0019_G12.b :
UTR01_0033_G06.b :
OVR01_0028_H09.b :
LVR01_0074_H11.b :
OVR01_0056_B06.b :
LVR01_0059_B02.b :
OVRT1_0133_B11.b :
OVRT1_0125_H10.b :
ITT01_0095_B09.b :
PTG01_0082_F03.b :
LVR01_0078_G01.b :
ADR01_0030_E09.b :
SMG01_0076_C03.b :
OVRT1_0037_D06.b :
PBL01_0058_H06.b :
SPL01_0058_C11.b :
KDN01_0024_E03.b :
OVRT1_0005_A07.b :
OVRT1_0027_E02.b :
OVRT1_0002_F10.b :
SMG01_0067_G07.b :
CLNT1_0009_A08.b :
OVRT1_0031_A12.b :
BFLT1_0068_G01.b :
TCH01_0009_E04.b :
OVRT1_0025_D02.b :
OVRT1_0060_D06.b :
OVRT1_0056_F08.b :
ITT01_0012_E01.b :
ITT01_0051_B11.b :
LVR01_0081_B11.b :
OVRT1_0021_A08.b :
OVRT1_0019_F08.b :
OVRT1_0037_F12.b :
SPL01_0030_B01.b :
OVRT1_0031_D04.b :
TCH01_0009_A08.b :
UTR01_0050_A06.b :
LNG01_0020_H01.b :
MLN01_0026_A05.b :
OVRT1_0037_C04.b :
OVR01_0040_C09.b :
THY01_0035_A10.b :
ITT01_0026_E11.b :
LVR01_0011_G05.b :
BFLT1_0086_A09.b :
TCH01_0034_B01.b :
UTR01_0050_B06.b :
UTR01_0103_G08.b :
LNG01_0034_G08.b :
LNG01_0035_F10.b :
TCH01_0077_A07.b :
OVRT1_0057_B01.b :
LVR01_0096_C03.b :
LVR01_0099_E07.b :
OVR01_0091_F06.b :
LVR01_0059_H04.b :
SPL01_0090_G01.b :
UTR01_0083_F08.b :
TCH01_0028_F09.b :
LNG01_0074_E01.b :
CLNT1_0031_G07.b :
UTR01_0058_E02.b :
ITT01_0052_D05.b :
MLN01_0093_H01.b :
TCH01_0023_C06.b :
LVR01_0084_F02.b :
OVR01_0072_A08.b :
OVRT1_0071_C03.b :
OVR01_0093_G08.b :
OVRT1_0016_D06.b :
UTR01_0054_A12.b :
UTR01_0061_C05.b :
ITT01_0081_A04.b :
OVR01_0039_A05.b :
OVRT1_0036_H10.b :
PBL01_0088_E04.b :
UTR01_0081_B07.b :
OVRT1_0043_F07.b :
ITT01_0083_A03.b :
ITT01_0054_E01.b :
THY01_0125_G10.b :
OVRM1_0133_C05.b :
OVR01_0086_C02.b :
OVRM1_0160_B01.b :
OVRM1_0137_D11.b :
LVRM1_0092_H02.b :
OVRM1_0225_D02.b :
OVRT1_0104_C02.b :
OVR01_0017_D06.b :
LVRM1_0131_G08.b :
OVRM1_0048_A10.b :
OVRM1_0117_F07.b :
OVRM1_0108_B09.b :
OVRM1_0197_B03.b :
LVRM1_0036_F09.b :
OVRM1_0204_F05.b :
OVRM1_0004_C09.b :
SPL01_0011_H01.b :
LVRM1_0036_G11.b :
PST01_0052_F10.b :
SPL01_0029_C04.b :
LVRM1_0161_F02.b :
TES01_0081_A11.b :
SMG01_0097_E11.b :
ADR01_0047_H12.b :
BFLT1_0126_E08.b :
ITT01_0095_G04.b :
HTMT1_0081_D04.b :
TCH01_0037_E07.b :
PTG01_0055_B01.b :
KDN01_0046_C01.b :
KDN01_0058_C11.b :
KDN01_0041_D09.b :
PST01_0073_D07.b :
PST01_0015_F06.b :
KDN01_0059_H03.b :
SMG01_0040_B06.b :
OVRM1_0198_F02.b :
BKFL1_0032_F11.b : nnnaaatatatttatatccgaaccnattxxxxxx
UTR01_0046_F12.b :
PTG01_0103_G08.b :
SMG01_0045_E03.b :
KDN01_0046_F11.b :
KDN01_0052_H12.b :
OVRM1_0017_C02.b :
PCT01_0004_G02.b :
BKFL1_0079_H02.b :
MLTL1_0075_G06.b :
AMP01_0011_C10.b : nnaaacgtatcttxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0034_F02.b :
PTG01_0097_D04.b :
ADR01_0014_C10.b :
OVRM1_0066_A11.b :
OVRM1_0030_A02.b :
PTG01_0042_D03.b :
BKFL1_0009_E12.b :
PTG01_0032_C04.b :
20110601C-001761 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
THY01_0115_C10.b :
THY01_0118_F10.b :
LVRM1_0144_B11.b : nagttgtcxx
OVR01_0018_H07.b : gggggtgaacctattagxxxxxxxxxxxxxxxxx
LVRM1_0169_C01.b :
OVRM1_0096_A07.b :
OVR01_0027_E05.b : gggaatttatgggxxxxxxxxxxxxxxxxxx
THY01_0103_F06.b :
THY01_0105_C01.b :
LVRM1_0028_H03.b :
OVRM1_0071_H01.b : a
LVRM1_0001_C11.b : cxxxxx
LVR01_0005_C07.b : ggcaxxxxxxxxxxxxxxxxxxxxx
LNG01_0013_D04.b : txxxxxxxxxxxxxxxxxxxx
PST01_0089_H08.b :
PST01_0075_G09.b :
SKNB1_0078_G12.b :
LVRM1_0081_C01.b :
OVRM1_0147_E07.b :
LVRM1_0107_D02.b : n
LVR01_0036_A03.b : tttggggtgxxxxxxxxxxxxxxx
OVR01_0042_B06.b : ctcctcccccccccccacccccataggxxxxxxxxxx
OVRM1_0005_E05.b :
TES01_0022_D07.b :
SKNB1_0009_C02.b :
PST01_0018_C05.b :
TES01_0029_F05.b :
PST01_0062_E07.b :
SKNB1_0095_G05.b :
KDN01_0052_B02.b :
KDN01_0032_D01.b :
KDN01_0057_A08.b :
PST01_0066_D01.b :
PST01_0019_F12.b :
PST01_0076_A09.b :
TES01_0046_E03.b :
KDN01_0072_E03.b :
KDN01_0059_A06.b :
KDN01_0086_E05.b :
PST01_0072_G06.b :
PST01_0028_H02.b :
KDN01_0043_D07.b :
PST01_0012_B09.b :
KDN01_0069_B03.b :
KDN01_0007_G03.b :
KDN01_0063_E08.b :
PST01_0089_C07.b :
TES01_0021_A08.b :
SKNB1_0074_B10.b :
PST01_0035_D09.b :
KDN01_0061_C02.b :
PST01_0087_H06.b :
PST01_0014_F06.b :
PST01_0014_A01.b :
TES01_0066_H01.b :
PST01_0080_A09.b :
KDN01_0026_C06.b :
KDN01_0052_D12.b :
KDN01_0080_F03.b :
PST01_0096_G02.b :
PST01_0063_G08.b :
TCH01_0080_D07.b : nnttggctaggactatn
KDN01_0078_E01.b :
PST01_0084_D08.b :
KDN01_0064_D03.b :
PST01_0071_B03.b :
KDN01_0062_E03.b :
PST01_0098_E01.b :
PST01_0057_A10.b :
PST01_0056_D06.b :
KDN01_0042_G11.b :
KDN01_0060_H02.b :
KDN01_0095_A03.b :
PST01_0007_C01.b :
KDN01_0054_B12.b :
PST01_0046_C06.b :
KDN01_0077_D04.b :
PST01_0085_B09.b :
KDN01_0066_B03.b :
KDN01_0049_C11.b :
KDN01_0058_H01.b :
BFLT1_0145_G02.b : ntttcgttt
OVRM1_0151_D08.b :
OVRM1_0152_E09.b :
SKNB1_0002_G08.b :
OVRM1_0075_C07.b :
LVRM1_0105_D08.b :
OVRM1_0132_H06.b : na
SKNB1_0003_A12.b :
OVRM1_0095_A12.b :
KDN01_0020_E03.b :
CBLT1_0067_A01.b :
BMWN1_0093_F01.b :
SKNB1_0022_C01.b :
HTMT1_0119_C05.b :
ILNT1_0078_B02.b : n
BMWN1_0057_E12.b : nnnnncgagagt
BMWN1_0019_F11.b :
PST01_0006_G11.b :
HTMT1_0027_D02.b :
ITT01_0080_G04.b :
HTMT1_0141_F09.b : tttt
CLNT1_0032_D02.b : gggtccgtc
OVRT1_0128_D09.b : nnnncctata
LNG01_0002_H11.b : ggggcttttggtgccxxxxxxxxxxxx
CBLT1_0028_D04.b : t
ILNT1_0007_D09.b :
SKNB1_0085_E12.b :
OVR01_0045_B12.b : taaagcxxxxxxxxxxxxxxxxxxxx
HTMT1_0076_D12.b : tt
CBLT1_0006_G02.b : ttt
SKNB1_0086_H04.b :
KDN01_0041_A06.b :
ILNT1_0054_E06.b :
PST01_0014_C07.b :
SKNB1_0058_E10.b :
PST01_0013_A03.b :
OVRT1_0037_D10.b : nncctcctttag
KDN01_0036_G12.b :
CBLT1_0060_E09.b : t
CBLT1_0063_A05.b :
KDN01_0065_A06.b :
ITT01_0069_F08.b :
OVRM1_0175_H02.b :
OVR01_0086_D02.b : tttgcattggactaagac
AMP01_0006_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0012_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0043_D06.b :
ADR01_0015_D01.b :
AMP01_0093_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0009_D04.b :
OVRM1_0188_B09.b :
DCI01_0057_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0089_D07.b :
DCI01_0031_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0060_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0059_D10.b :
OVRM1_0018_B05.b :
OVRM1_0098_H12.b :
OVRM1_0002_B05.b :
DCI01_0035_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_C12.b :
AMP01_0097_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0028_E12.b : ttttgggtggxxxxxxxxxxxx
AMP01_0065_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0037_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0035_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0030_F05.b : nnnngggctggxxxxxxxxxxxxxx
DCI01_0044_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0044_C06.b : xxxxxxxxxxxxxxxxx
LNG01_0094_B11.b : ttttnaagttggcct
AMP01_0016_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0060_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0074_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0088_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0032_H01.b : aagagctttcgtgxxxxxxxxxxxx
AMP01_0055_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0096_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0103_H09.b : ntttgcttggacta
AMP01_0027_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0023_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0011_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0026_E03.b : n
OVRT1_0007_E07.b : nnnncctctctg
AMP01_0017_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0052_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0037_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0077_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0007_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0015_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0056_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0080_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0122_H09.b : nnnaaacgtta
AMP01_0084_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0041_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0050_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0054_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0113_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0004_B09.b : aaaatatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0007_A09.b : nnnnncctcta
LNG01_0085_F11.b : nnntttagctggacttgac
LVRM1_0026_C10.b :
LVRM1_0131_E06.b :
OVRM1_0166_A06.b :
OVRM1_0173_C01.b :
SMG01_0041_F07.b : nttaaca
SMG01_0066_C09.b : nnnnnnnnnnnnnn
OVRM1_0076_C10.b : cxx
OVRM1_0120_D05.b :
PTG01_0052_A12.b : nggactaag
LVRM1_0072_A03.b :
OVRM1_0102_E04.b :
LVRM1_0058_D02.b :
LVRM1_0109_F09.b :
OVRM1_0068_F09.b :
OVRM1_0159_D04.b : t
OVRM1_0102_G06.b :
LVRM1_0163_C05.b :
OVRM1_0115_D04.b : t
SMG01_0096_G06.b : nnnnnnnn
OVRM1_0026_E11.b :
LVRM1_0150_G04.b :
LVRM1_0042_A04.b :
OVRM1_0129_G05.b :
OVRM1_0176_F09.b :
OVRM1_0121_G09.b :
OVRM1_0066_G09.b :
OVRM1_0068_C06.b :
SMG01_0057_B11.b : gcct
LVRM1_0174_E02.b :
OVRM1_0130_D04.b :
OVR01_0104_B05.b : tttgcttgtactatgac
OVRM1_0149_C06.b :
OVRM1_0152_H02.b : t
OVRM1_0049_C09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0207_G03.b :
OVRM1_0066_C12.b : taatcttttntctnttatatctttccctcctattcattcccttccccttactttttttga
OVR01_0083_D08.b : nnnggctaggactatacac
OVRT1_0036_H12.b : nntttccttgcggcagggaagttttttnnnnnaagttttnnnnnnccc
OVRM1_0110_A09.b :
OVR01_0073_A09.b : ctagcatttagtgxxxxxxxxxxx
LVRM1_0083_A04.b :
OVRM1_0195_C04.b :
OVRM1_0061_H06.b :
LVRM1_0039_C03.b :
OVRM1_0164_F10.b :
LVRM1_0005_A06.b : cxx
OVR01_0075_B05.b : tagcxxxxxxxxxxxxxxxxxxx
OVR01_0081_G11.b : agcatttxxxxxxxxxxxxxxxx
OVRM1_0134_G10.b :
OVRM1_0081_G05.b :
OVRM1_0147_E06.b :
LVRM1_0040_D04.b :
OVRM1_0046_A02.b : atx
LVRM1_0179_D05.b :
OVRT1_0029_B08.b : ncccccttc
LVRM1_0145_C05.b :
LVRM1_0172_G08.b :
LVRM1_0165_D03.b :
LVRM1_0095_D01.b :
OVRM1_0218_G06.b :
LVRM1_0040_E07.b :
LVRM1_0130_D05.b : tx
LVRM1_0170_B09.b :
OVRM1_0089_H03.b :
LVRM1_0095_A05.b :
LVRM1_0106_E10.b :
OVR01_0081_H04.b : gcaxxxxxxxxxxxxxxxxxx
OVR01_0061_H01.b : nccttgcttgtactaanac
LVRM1_0033_A07.b :
LVRM1_0092_F10.b :
OVRM1_0191_A03.b :
LNG01_0046_G10.b : tctttttgttacggcatagtgxxxxxxxxxxx
LVRM1_0151_F08.b :
OVRM1_0044_F08.b :
OVRM1_0133_H08.b :
LVRM1_0047_C08.b :
LVRM1_0082_D09.b :
LVRM1_0201_B12.b :
OVRM1_0130_G11.b :
OVRM1_0093_A01.b :
OVRM1_0020_F02.b : xxx
LVRM1_0030_F01.b :
OVRM1_0128_B08.b :
LVRM1_0088_H09.b :
OVRM1_0004_B05.b :
LVRM1_0021_A03.b :
LVRM1_0099_D10.b :
OVRM1_0131_E10.b :
LVRM1_0153_C01.b :
OVRM1_0207_B08.b :
LNG01_0036_E09.b : atttagggtaxxxxxxxxx
LVRM1_0148_D08.b :
LVRM1_0117_C12.b :
LVR01_0089_B12.b : gacxxxxxxxxxxxxxxxxxxxx
OVRM1_0152_H11.b :
OVRM1_0205_F05.b :
OVRM1_0043_B01.b :
OVRM1_0062_H07.b :
OVRM1_0127_B02.b :
OVRM1_0038_C06.b :
OVRM1_0005_B02.b :
OVRM1_0202_F06.b :
LVRM1_0144_E01.b :
OVRM1_0223_F09.b :
LVRM1_0140_B03.b :
OVRM1_0039_F01.b :
OVRM1_0224_G06.b :
OVRM1_0096_C10.b : c
OVRM1_0113_E06.b :
OVRM1_0077_G03.b :
LVRM1_0139_H05.b :
LVR01_0088_G07.b : txxxxxxxxxxxxxxxxxxxxxx
OVRM1_0025_G12.b : c
OVRM1_0107_G12.b :
OVRM1_0113_H07.b :
LVRM1_0150_H09.b :
OVRM1_0079_C07.b :
SMG01_0013_H05.b : nncca
OVRM1_0114_B07.b :
OVRM1_0091_G06.b :
OVRM1_0105_A12.b :
OVRM1_0083_H11.b :
UTR01_0012_A11.b : tgggggggaacctataxxxxxxxxx
OVRT1_0129_G02.b : nnggcatatnnnnnnnnccgtta
LNG01_0107_G02.b : tagggggctgtgctaaac
LNG01_0073_C08.b : nnnnggctggacttgac
PBL01_0026_D02.b :
OVR01_0068_F11.b : nggcttggactatnacxx
SMG01_0067_G01.b :
SMG01_0087_F03.b : ngcca
OVRT1_0089_B05.b : ncctctt
OVRT1_0017_E10.b : nnnccttc
THY01_0068_F05.b : ctttttagtggxxxxxxxxxxxxx
PTG01_0019_D06.b : nnn
SPL01_0043_F10.b : nttttgctaggacttanac
UTR01_0059_F09.b : cxxxxxxxxxxxxxxxxxxxxx
SMG01_0077_H11.b :
OVR01_0048_B07.b : aagatxxxxxxxxxxxxxxxxxxxx
OVR01_0050_G03.b : nnnttgctagtgacttnac
LNG01_0091_H09.b : nnggtttgctggac
OVRT1_0149_A11.b : nnnnccgttcag
THY01_0048_B03.b : txxxxxxxxxxxxxxxxxxxx
LNG01_0110_G10.b : nttcttgtaaaaaagttttaaaaannnggggccatggacaagac
LVR01_0086_H11.b : gggcxxxxxxxxxxxxxxxxxxxx
UTR01_0045_B03.b : gggttaacxxxxxxxxxxxx
OVR01_0056_C10.b : ntttgctaggactatnacx
SMG01_0037_G10.b : nccgct
OVRT1_0150_B03.b : nctttcttcctcnnaannnnccgttttg
UTR01_0015_E11.b : gggggaacxxxxxxxxxxxx
OVRT1_0103_A04.b : ttccnccgtt
UTR01_0019_H08.b : ggttgcactaatagxxxxx
OVR01_0049_F08.b : nntttgctaggacttanac
OVR01_0070_B05.b : nnnnggctagtgacttgacxx
UTR01_0020_A02.b : txxxxxxxxxxxxxxxxxxxxxx
ITT01_0085_D08.b :
OVRT1_0139_F08.b : nnnccctaatnnnnnnnnccccttt
UTR01_0039_C03.b : tttttgagccctattagxxxxx
SMG01_0053_F07.b : ga
LNG01_0032_E03.b : ttttttttttttggcattggacntatagacx
THY01_0045_A08.b : gggxxxxxxxxxxxxxxxxx
OVRT1_0148_D06.b : nnnnnccgtta
OVRT1_0105_F01.b : nnnccgtca
LVR01_0051_G10.b : tggggggtttttnctcgctagtgxxxxxxxxxxxx
LVR01_0020_G10.b : cttatggtgxxxxxxxxxxxxx
OVRT1_0113_G01.b : nnttcccgtc
SMG01_0069_F01.b : ncgc
UTR01_0004_C03.b : ggggtgccxxxxxxxxxxx
LVR01_0082_H11.b : ggcatttagggtgxxxxxxxxxxxx
LNG01_0021_E09.b : ccxxxxxxxxxxxxxxxxxxxxx
OVRT1_0039_G12.b : nnnncccctttnnnnnnnnccgtta
OVRT1_0057_A10.b : nccgtttnnnnncctcctata
OVR01_0078_B10.b : nnnaagataggacttanac
OVR01_0014_A06.b : gggatxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_E04.b : ggcxxxxxxxxxxxxxxxxxxxx
LNG01_0019_G12.b : actggctttggtgxxxxxxxxxxxxx
UTR01_0033_G06.b : ctttatxxxxxxxxxxxxxxxxx
OVR01_0028_H09.b : ggggcxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_H11.b : ggcttttgtxxxxxxxxxxxxxxxx
OVR01_0056_B06.b : nnttggctaggactatnac
LVR01_0059_B02.b : tttataagcattggtgxxxxxxxxxxx
OVRT1_0133_B11.b : nncccatttnnnnnnnncccgtta
OVRT1_0125_H10.b : nnccgttc
ITT01_0095_B09.b :
PTG01_0082_F03.b :
LVR01_0078_G01.b : ttcttttttagcttggtgxxxxxxxxxxxx
ADR01_0030_E09.b :
SMG01_0076_C03.b :
OVRT1_0037_D06.b : nnnnnccgtca
PBL01_0058_H06.b :
SPL01_0058_C11.b : nnnggcttggactataacxx
KDN01_0024_E03.b :
OVRT1_0005_A07.b : nnntttcgttag
OVRT1_0027_E02.b : nnnnncctata
OVRT1_0002_F10.b : naacccctctca
SMG01_0067_G07.b : nccc
CLNT1_0009_A08.b : aaatggttc
OVRT1_0031_A12.b : ggttccgtc
BFLT1_0068_G01.b : nggcttttnnggactccgtt
TCH01_0009_E04.b : nnnngggctgtactaanacx
OVRT1_0025_D02.b : nnnnncctata
OVRT1_0060_D06.b : ncgtttttnnnggggaccctata
OVRT1_0056_F08.b : nccctttnnnnnnnccccgtta
ITT01_0012_E01.b :
ITT01_0051_B11.b :
LVR01_0081_B11.b : ggcxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0021_A08.b : ncccccttnnngggaccccgtta
OVRT1_0019_F08.b : nnncctcgttcn
OVRT1_0037_F12.b : ncccctnnnnngggggccgtta
SPL01_0030_B01.b : nnntttgcttggtacttnac
OVRT1_0031_D04.b : nnccccctta
TCH01_0009_A08.b : nnnngggtagtactaanac
UTR01_0050_A06.b : cttxxxxxxxxxxxxxxxxxxxxxx
LNG01_0020_H01.b : tttccagcattagtgxxxxxx
MLN01_0026_A05.b : nnngctaggacttgacx
OVRT1_0037_C04.b : nnnnccgtc
OVR01_0040_C09.b : gggcxxxxxxxxxxxxxxxxxxxxx
THY01_0035_A10.b : gggxxxxxxxxxxxxxxx
ITT01_0026_E11.b :
LVR01_0011_G05.b : gggggaggcattagtgxxxxxxxxxxxx
BFLT1_0086_A09.b : ggatccctcta
TCH01_0034_B01.b : nggggggttgtgacttaac
UTR01_0050_B06.b : cxxxxxxxxxxxxxxxxxxxxxx
UTR01_0103_G08.b : nggcttggactataacx
LNG01_0034_G08.b : ggaantctntaagcattggxxxxxxxxxxxx
LNG01_0035_F10.b : gctxxxxxxxxxxxxxxxxxxxx
TCH01_0077_A07.b : nttggggtagtactat
OVRT1_0057_B01.b : nnttccgtta
LVR01_0096_C03.b : gtgttttttctagcatagtgxxxxxxxxxxxx
LVR01_0099_E07.b : aagacttagtgxxxxxxxxxxxxx
OVR01_0091_F06.b : nnnnggctaggactatnac
LVR01_0059_H04.b : tgactttgcattggtgxxxxxxxxxxxx
SPL01_0090_G01.b : nntttgctagtgacttnacx
UTR01_0083_F08.b : nnnggcttggactatnac
TCH01_0028_F09.b : nttccgctaggactatgac
LNG01_0074_E01.b : nnnngggatgtacttga
CLNT1_0031_G07.b : nnnnccgtc
UTR01_0058_E02.b : cgcattatgxxxxxxxxxxxxxxxxx
ITT01_0052_D05.b :
MLN01_0093_H01.b : nnnnggctagtactaagac
TCH01_0023_C06.b : nnnggctaggac
LVR01_0084_F02.b : gggcaxxxxxxxxxxxxxxxxxxx
OVR01_0072_A08.b : nnnccgctagtgacttnac
OVRT1_0071_C03.b : nnnccccgttt
OVR01_0093_G08.b : nnnnagctaggacttagac
OVRT1_0016_D06.b : nncccccgttc
UTR01_0054_A12.b : ttttaggcaxxxxxxxxxxxxxxxxxx
UTR01_0061_C05.b : gcxxxxxxxxxxxxxxxxxxxxxx
ITT01_0081_A04.b :
OVR01_0039_A05.b : taggacxxxxxxxxxxxxxxxxxxxx
OVRT1_0036_H10.b : nnnccgtttnnnnggnnnccctca
PBL01_0088_E04.b :
UTR01_0081_B07.b : nnnnggctagtgacttnacxx
OVRT1_0043_F07.b : nnccttcgtta
ITT01_0083_A03.b :
ITT01_0054_E01.b :
THY01_0125_G10.b :
OVRM1_0133_C05.b :
OVR01_0086_C02.b : nggcttgtgacttgac
OVRM1_0160_B01.b :
OVRM1_0137_D11.b :
LVRM1_0092_H02.b :
OVRM1_0225_D02.b :
OVRT1_0104_C02.b : tttttnccgtcag
OVR01_0017_D06.b : gggggggaactattagxx
LVRM1_0131_G08.b :
OVRM1_0048_A10.b :
OVRM1_0117_F07.b :
OVRM1_0108_B09.b :
OVRM1_0197_B03.b :
LVRM1_0036_F09.b :
OVRM1_0204_F05.b :
OVRM1_0004_C09.b :
SPL01_0011_H01.b : ctxxxxxxxxxxxxxxxxxx
LVRM1_0036_G11.b :
PST01_0052_F10.b :
SPL01_0029_C04.b : nggggccatggac
LVRM1_0161_F02.b :
TES01_0081_A11.b :
SMG01_0097_E11.b : nnnn
ADR01_0047_H12.b :
BFLT1_0126_E08.b : ncccttca
ITT01_0095_G04.b :
HTMT1_0081_D04.b :
TCH01_0037_E07.b : nnnnnggctagg
PTG01_0055_B01.b : nnnnnnnn
KDN01_0046_C01.b :
KDN01_0058_C11.b :
KDN01_0041_D09.b :
PST01_0073_D07.b :
PST01_0015_F06.b :
KDN01_0059_H03.b :
SMG01_0040_B06.b : ntttaataaaatnttnnnncgct
OVRM1_0198_F02.b :
BKFL1_0032_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0046_F12.b : tgg
PTG01_0103_G08.b : nnnnnnnnnnnnnn
SMG01_0045_E03.b :
KDN01_0046_F11.b :
KDN01_0052_H12.b :
OVRM1_0017_C02.b :
PCT01_0004_G02.b :
BKFL1_0079_H02.b :
MLTL1_0075_G06.b : nnnccctaaatc
AMP01_0011_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0034_F02.b :
PTG01_0097_D04.b :
ADR01_0014_C10.b :
OVRM1_0066_A11.b :
OVRM1_0030_A02.b :
PTG01_0042_D03.b :
BKFL1_0009_E12.b :
PTG01_0032_C04.b :
---------+---------+---------+---------+---------+---------+ 41
LVRM1_0144_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCCTACTG
OVR01_0018_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtTGGCCTACTG
LVRM1_0169_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTG
OVRM1_0096_A07.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTG
OVR01_0027_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTG
THY01_0103_F06.b : gttgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTG
THY01_0105_C01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTG
LVRM1_0028_H03.b : acgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTG
OVRM1_0071_H01.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTG
LVRM1_0001_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTG
LVR01_0005_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTG
LNG01_0013_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTG
PST01_0089_H08.b : nnnttactgcgttggcaTG
PST01_0075_G09.b : nnnnncctgctgtggctaTG
SKNB1_0078_G12.b : ntttttctcgctgtggctaTG
LVRM1_0081_C01.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
OVRM1_0147_E07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
LVRM1_0107_D02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
LVR01_0036_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctcgttctactG
OVR01_0042_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
OVRM1_0005_E05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
TES01_0022_D07.b : ttttcgcggtggctcT
SKNB1_0009_C02.b : nnncccctgactgtggccT
PST01_0018_C05.b : T
TES01_0029_F05.b : ntcgcgttggctcT
PST01_0062_E07.b : tcgcgttggctcT
SKNB1_0095_G05.b : ncccctacagttgcctcT
KDN01_0052_B02.b : ctaT
KDN01_0032_D01.b : tttttttccctgctgtggctaT
KDN01_0057_A08.b : ttttcctggcgtggctaT
PST01_0066_D01.b : naatcgcggtggctcT
PST01_0019_F12.b : aaaaattnnactgcgttggctcT
PST01_0076_A09.b : nnnnnggctgcggttgctcT
TES01_0046_E03.b : ncttgcgttggctcT
KDN01_0072_E03.b : nnnncctgcggtggctcT
KDN01_0059_A06.b : nnnnncctgcggtggctaT
KDN01_0086_E05.b : nnnnnggctgctgttgctcT
PST01_0072_G06.b : nnnnnggctacggtggctaT
PST01_0028_H02.b : tatnntacctgcgttggctcT
KDN01_0043_D07.b : ttttccctgcgttggctaT
PST01_0012_B09.b : atttantnnactgcggtggctcT
KDN01_0069_B03.b : nttctgctgtggctcT
KDN01_0007_G03.b : nnccctttnnnnnnnactgcgttgtgctcG
KDN01_0063_E08.b : nnnnncctgcggtggctcT
PST01_0089_C07.b : nnnnncctgcggtggctaT
TES01_0021_A08.b : nnncctgctgtggctcT
SKNB1_0074_B10.b : nnnccttagctgtggctaT
PST01_0035_D09.b : nctggcggtggctcT
KDN01_0061_C02.b : ttgcgttggctcT
PST01_0087_H06.b : nnnnncctgacgtggctaT
PST01_0014_F06.b : catattannnncctgcgttggctcT
PST01_0014_A01.b : atanntttactgctgtggctcT
TES01_0066_H01.b : atttcctgaggtggctaT
PST01_0080_A09.b : nnncctgctgttgctcT
KDN01_0026_C06.b : nttggctgtggctcT
KDN01_0052_D12.b : tagctgtggctaT
KDN01_0080_F03.b : nnnncctgaggtggctcT
PST01_0096_G02.b : nnnnncctgctgtggctaT
PST01_0063_G08.b : nncctgcggtggctcT
TCH01_0080_D07.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcT
KDN01_0078_E01.b : ttttacttgcggtggctcT
PST01_0084_D08.b : nnncctgctgtggctcT
KDN01_0064_D03.b : nnnnncctgctgtggctcT
PST01_0071_B03.b : nnnncctgcggtggctaT
KDN01_0062_E03.b : nnnncctgctgtggctaT
PST01_0098_E01.b : ttttactgcggtggctcT
PST01_0057_A10.b : ttttttgctgcgttggctcT
PST01_0056_D06.b : nnctggctgtggctaT
KDN01_0042_G11.b : ntttttttcctgcgttggctaT
KDN01_0060_H02.b : nnnnaactgctgtggctaT
KDN01_0095_A03.b : nnnnggctgctgtggctaT
PST01_0007_C01.b : nnnggctaannnnnnnncctacgttggctaT
KDN01_0054_B12.b : tcgcgttggctcT
PST01_0046_C06.b : nnnncctcgcgttggcacT
KDN01_0077_D04.b : nnnggttgcggtggctcT
PST01_0085_B09.b : nnnncctgcgttggctcT
KDN01_0066_B03.b : nnnnncctgcgttggctaT
KDN01_0049_C11.b : tggctaT
KDN01_0058_H01.b : nttttcctgcgttggctaT
BFLT1_0145_G02.b : gcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcttt
OVRM1_0151_D08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0152_E09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0002_G08.b : ttttggccacagtggccac
OVRM1_0075_C07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0105_D08.b : cattgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxt
OVRM1_0132_H06.b : gtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxc
SKNB1_0003_A12.b : nnnncccacagtggctac
OVRM1_0095_A12.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0020_E03.b : acgttggctctg
CBLT1_0067_A01.b : tttttacgacagtagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0093_F01.b : tttttagcacggagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0022_C01.b : nggcgannnnnnnccctgcgtttgctac
HTMT1_0119_C05.b : nnnnggatggtacgcggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0078_B02.b : nnccgacgttacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0057_E12.b : agacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0019_F11.b : tttggcaggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0006_G11.b : nnccctttttnnnnnncctgcgttgtgctc
HTMT1_0027_D02.b : ttttccgacgtaacacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0080_G04.b : nnnngatcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxg
HTMT1_0141_F09.b : tacgacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0032_D02.b : tgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcg
OVRT1_0128_D09.b : gctgtcgnatgttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcg
LNG01_0002_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxa
CBLT1_0028_D04.b : ttttccaggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0007_D09.b : nnnnnggcaggtagaggccgtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0085_E12.b : ntttccggctgtggcta
OVR01_0045_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0076_D12.b : ttttggacggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0006_G02.b : tnggcaggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0086_H04.b : nncccgaannnnnttcctgcgttggctac
KDN01_0041_A06.b : cccaannnnnnnncctgcgttgtgctc
ILNT1_0054_E06.b : nnccgacggtacacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0014_C07.b : catttannnnnactgcgttggctac
SKNB1_0058_E10.b : nnnaacattnnnntnncctgcgctggctn
PST01_0013_A03.b : tttgttnnncctgctgtggcta
OVRT1_0037_D10.b : cgcacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0036_G12.b : nnnttgggcctgcgttggctct
CBLT1_0060_E09.b : ttttggcaagtagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0063_A05.b : nattcccgcaggtagacgccgtagtatttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0065_A06.b : nttttggctgaggtggctc
ITT01_0069_F08.b : nnnaatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxt
OVRM1_0175_H02.b : nagttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0086_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0006_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0012_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0043_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0015_D01.b : aatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0009_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0188_B09.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0057_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0089_D07.b : ccttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0060_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0059_D10.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0018_B05.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0098_H12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0002_B05.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0035_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_C12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0097_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0028_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0065_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0037_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0035_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0030_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgg
DCI01_0044_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0044_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0094_B11.b : tgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0016_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0060_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0074_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0088_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0032_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0055_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0096_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0103_H09.b : tgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0027_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0023_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0011_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0026_E03.b : nnggcaagtagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgagg
OVRT1_0007_E07.b : cgtangxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0017_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0052_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0037_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0077_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0007_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0015_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0056_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0080_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0122_H09.b : gctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0084_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0041_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0050_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0054_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0113_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0004_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0007_A09.b : gctgacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0085_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0026_C10.b : acgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0131_E06.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0166_A06.b : taattgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0173_C01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0041_F07.b : aagtgttanggactaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0066_C09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxx
OVRM1_0076_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0120_D05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0052_A12.b : cagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_A03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0102_E04.b : gagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0058_D02.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0109_F09.b : caattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0068_F09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0159_D04.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0102_G06.b : tagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0163_C05.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0115_D04.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0096_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxx
OVRM1_0026_E11.b : tttgacaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0150_G04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0042_A04.b : tttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0129_G05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0176_F09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0121_G09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0066_G09.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0068_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0057_B11.b : attaaaatggactaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0174_E02.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0130_D04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0104_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0149_C06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0152_H02.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0049_C09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
OVRM1_0207_G03.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0066_C12.b : acgatttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0083_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0036_H12.b : ttcgcgnacgnangtacttcgctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0110_A09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0073_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0083_A04.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0195_C04.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0061_H06.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_C03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0164_F10.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0005_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0075_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0081_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0134_G10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0081_G05.b : cgctgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0147_E06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_D04.b : tcgttgtcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0046_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0179_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0029_B08.b : tgcgtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_C05.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0172_G08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0165_D03.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0095_D01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0218_G06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_E07.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0130_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0170_B09.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0089_H03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0095_A05.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_E10.b : tcctgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0081_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0061_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_A07.b : gcgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0092_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0191_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0046_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0151_F08.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0044_F08.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0133_H08.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_C08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0082_D09.b : aattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0201_B12.b : gggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0130_G11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0093_A01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0020_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0030_F01.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0128_B08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0088_H09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0004_B05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_A03.b : cgtttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0099_D10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0131_E10.b : ncagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0153_C01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0207_B08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0036_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0148_D08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0117_C12.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0152_H11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0205_F05.b : gcagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0043_B01.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0062_H07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0127_B02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0038_C06.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0005_B02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0202_F06.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_E01.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0223_F09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0140_B03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0039_F01.b : ttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0224_G06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0096_C10.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0113_E06.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0077_G03.b : ccgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0139_H05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0025_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0107_G12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0113_H07.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0150_H09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0079_C07.b : cgttgacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0013_H05.b : ttatnnnnntgagtaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0114_B07.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0091_G06.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0105_A12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0083_H11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0012_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0129_G02.b : gcgttacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0107_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0073_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0026_D02.b : ngatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0068_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0067_G01.b : tttttttgactaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0087_F03.b : atttnnnnggataaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0089_B05.b : gctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0017_E10.b : agctgtacgatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0068_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0019_D06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxx
SPL01_0043_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0059_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0077_H11.b : tttttaagactaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0048_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0050_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0091_H09.b : ttgacagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0149_A11.b : ctgtangagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0048_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0110_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0045_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0056_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0037_G10.b : aaaannnnngggtcaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0150_B03.b : cgnaggagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0015_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0103_A04.b : agctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0019_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0049_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0070_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0020_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0085_D08.b : nnnngatcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0139_F08.b : gcgttcgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0039_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0053_F07.b : cctattnnnnggactaagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0032_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0045_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0148_D06.b : gcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0105_F01.b : gcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0020_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0113_G01.b : agcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0069_F01.b : actttattttgatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0004_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0021_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0039_G12.b : gcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0057_A10.b : gcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0078_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0014_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0019_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0033_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0028_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0056_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0059_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0133_B11.b : gcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0125_H10.b : gcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0095_B09.b : nnnaatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0082_F03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxx
LVR01_0078_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0030_E09.b : nnnaattgatgacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0076_C03.b : ttatttggactaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0037_D06.b : gcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0058_H06.b : ttagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0058_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0024_E03.b : cttttnnnnnncccgcgttggctcggg
OVRT1_0005_A07.b : ctgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0027_E02.b : gctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0002_F10.b : gcgtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0067_G07.b : ataatannnggactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0009_A08.b : agcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0031_A12.b : agcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0068_G01.b : cagcgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0009_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0025_D02.b : gctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0060_D06.b : gcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0056_F08.b : gcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0012_E01.b : ntttgagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0051_B11.b : nnnggtgcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0021_A08.b : gcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0019_F08.b : gcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0037_F12.b : gcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0030_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0031_D04.b : gctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0009_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0050_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0020_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0026_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0037_C04.b : agcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0040_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0035_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0026_E11.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0086_A09.b : gcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0034_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0050_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0103_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0034_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0035_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0077_A07.b : nacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0057_B01.b : gctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0091_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0059_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0090_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0083_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0028_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0074_E01.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0031_G07.b : tgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0058_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0052_D05.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0093_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0023_C06.b : ttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0072_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0071_C03.b : agcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0093_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0016_D06.b : agcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0054_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0061_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0081_A04.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0039_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0036_H10.b : gcgttacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0088_E04.b : nnggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0081_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0043_F07.b : gcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0083_A03.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0054_E01.b : nttgatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0125_G10.b : gttgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0133_C05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0086_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0160_B01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0137_D11.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0092_H02.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0225_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0104_C02.b : ctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0017_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0131_G08.b : tcgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0048_A10.b : nagctgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0117_F07.b : gcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0108_B09.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0197_B03.b : gagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0036_F09.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0204_F05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0004_C09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0011_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0036_G11.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0052_F10.b : acgcgttggctat
SPL01_0029_C04.b : ttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0161_F02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0081_A11.b : ncctgcggtggctct
SMG01_0097_E11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ADR01_0047_H12.b : ntttttagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0126_E08.b : gctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcc
ITT01_0095_G04.b : nnggtgatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0081_D04.b : naaaggacgagtagaggccgtagtatttatxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0037_E07.b : acttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0055_B01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
KDN01_0046_C01.b : atcgcagacgattgcct
KDN01_0058_C11.b : ttncctgcggtggct
KDN01_0041_D09.b : ngcaaggtannnnncctgcggtggc
PST01_0073_D07.b : nnncctgcgttggct
PST01_0015_F06.b : tgtttttnnncctgcgttggct
KDN01_0059_H03.b : ttttactgcggt
SMG01_0040_B06.b : atcattttggactaagcagcggnaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0198_F02.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0032_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0046_F12.b : ggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0103_G08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0045_E03.b : tatttattnagctaaagcagcggtaxxxxxxxx
KDN01_0046_F11.b :
KDN01_0052_H12.b :
OVRM1_0017_C02.b :
PCT01_0004_G02.b :
BKFL1_0079_H02.b : nnncccgaatcaaattncgatacataxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0075_G06.b : aagggnnannnnncccacctcaaaannacgaaaccataxxxxxxxxxxxxxxxxxxxxxx
AMP01_0011_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0034_F02.b :
PTG01_0097_D04.b :
ADR01_0014_C10.b :
OVRM1_0066_A11.b :
OVRM1_0030_A02.b :
PTG01_0042_D03.b :
BKFL1_0009_E12.b :
PTG01_0032_C04.b :
---------+---------+---------+---------+---------+---------+ 96
UTR01_0046_F12.b : xxxxxxxxxxxxxxxxxxxxxGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SMG01_0045_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0046_F11.b : G*CTGCCA
KDN01_0052_H12.b : cccTGTCA
OVRM1_0017_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0004_G02.b :
BKFL1_0079_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0075_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0011_C10.b : xxxxagtttcctgtatgcccggcgtgtgcccgcctgccgtccctgacccctgttgcaact
UTR01_0034_F02.b :
PTG01_0097_D04.b :
ADR01_0014_C10.b :
OVRM1_0066_A11.b :
OVRM1_0030_A02.b :
PTG01_0042_D03.b :
BKFL1_0009_E12.b : nnnnnnnnnnnnn
PTG01_0032_C04.b :
---------+---------+---------+---------+---------+---------+ 155
PCT01_0004_G02.b : nnnaaggacgtcaanannacctgcgttgtgctcggnnaACCATCACCCTG*G
BKFL1_0079_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0075_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0011_C10.b : ggcgactgacaaggcgcatctttgcatggaccttcgactggccatagcttctccctcgga
UTR01_0034_F02.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0097_D04.b : nnnnnnnnnnnnnnnnnn
ADR01_0014_C10.b :
OVRM1_0066_A11.b :
OVRM1_0030_A02.b : nggggnnnttttnttttnnnnnnttnnntttc
PTG01_0042_D03.b :
BKFL1_0009_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0032_C04.b :
---------+---------+---------+---------+---------+---------+ 214
UTR01_0034_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PTG01_0097_D04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxGAGGGC
ADR01_0014_C10.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0066_A11.b : ncagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0030_A02.b : cnnccntccccccncccctacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0042_D03.b : cctctattannnggctxxxxxxxxxxxxxxxxxxxxx
BKFL1_0009_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0032_C04.b :
---------+---------+---------+---------+---------+---------+ 273
LVRM1_0131_G08.b : gtctccccggacatgcacaggctgtattttgtcctgaaaacaactggaagatggcgtttt
OVRM1_0030_A02.b : xxxxxxxxxxxxxxxxxxxxxxxctggCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PTG01_0042_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
BKFL1_0009_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCTGGAAGATGGGCGCAC
PTG01_0032_C04.b : ntttgatcaaacaxxxxxxxxxxxxxxxxxxxxxxxxxx
---------+---------+---------+---------+---------+---------+ 332
LVRM1_0131_G08.b : cccgcctgaccctatatacgtataaggctccncttagccggtggaataggtgcacactga
---------+---------+---------+---------+---------+---------+ 389
LVRM1_0026_C10.b : GTGGGATGCAGAATCTTCGTGAAG*ACCcttgactgggtaatgaccatcaccctgggaat
LVRM1_0131_G08.b : catcccgttgataacccatgaaatatgccgacgcccactctacccctatcataatccctt
---------+---------+---------+---------+---------+---------+ 445
OVRM1_0175_H02.b : agcccatcgacaaccatctagaacgccagggcgaaaatccaagactaggaaggcatcccc
OVR01_0086_D02.b : AGCCCcagcgacccctctaagaacgttctatgctaaaattctcgaccaagaatgctttct
LVRM1_0026_C10.b : tgtgagcccagcgacaccttccagaacgtcggggcggaagatccaggacccggaaaggct
LVRM1_0131_E06.b : aatttaccttacccctctcagaatgtgcaggcgaaaatccattgactagtgcggcatcac
LVRM1_0131_G08.b : tatcctatacacccgtgaccgattgcactaaaaaccacatattttcaaaccacctttata
SMG01_0040_B06.b : AGCCCAACGACACCCctcgagaacgttaggcgaaaatcccggaaaaagaagggttccccc
---------+---------+---------+---------+---------+---------+ 502
OVRM1_0175_H02.b : cccaatacaccataaggccgatctttgcccggaatacactggaagaacgggcgctacctg
OVR01_0086_D02.b : ccctccaccatcctacgctgattttttccctggaaccatctggaaaaatgggctccctct
AMP01_0006_D03.b : CCCCaaaacaacctaaggctattctttcccggtaaccacttggaaattggctccactctg
LVRM1_0026_C10.b : tccccccccaaccatcagtaggatgatactttccctggaagcaaattgaaatataggggc
LVRM1_0131_E06.b : ctatatacatcacaggctgttcattgatcgctattctaacgcgtacacggtttgtttttt
OVRM1_0166_A06.b : CCCCCCCAaaccagcagaagctgatcttttgccgggaaagcaactggaaaaatggggccc