[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-001761

Length: 1,163

Sequence [FASTA format sequence]
CAGCTGGTAC GGTCCGGAAT CCTCAGCACT GTGGCCTACT GGAGTTTCGT GGAGGCCGGG
AGTTTGCCTG CGTTTCTTCT GTGACCGCTG TTGCCACTGC CACCTGACAA TGCAGATCTT
TGTAAAGACC TTGACTGGTA AGACCATCAC CCTGGAAGTG GAGCCCAGTG ACACCATTGA
GAATGTCAAG GGGAAGATTC AAGAAAAAGA GGGCATCCCC CCAGACCAGC AGAGGCTGAT
CTTTGCCGGG AAGCAGCTGG AAGATGGGCG CACCCTGTCT GACTACAACA TCCAGAAGGA
GTCCACCCTG CACCTGGTCC TCCGCCTCAG AGGTGGGATG CAGATCTTCG TGAAGACCTT
GACTGGTAAG ACCATCACCC TGGAAGTGGA GCCCAGCGAC ACCATCGAGA ACGTCAAGGC
GAAGATCCAG GACAAGGAAG GCATCCCCCC AGACCAGCAG AGGCTGATCT TTGCCGGGAA
GCAGCTGGAA GATGGGCGCA CCCTGTCTGA CTACAACATC CAGAAGGAGT CCACCCTGCA
CCTGGTCCTC CGCCTCAGAG GTGGGATGCA GATCTTCGTG AAGACCTTGA CTGGTAAGAC
CATCACCCTG GAAGTGGAGC CCAGCGACAC CATCGAGAAC GTCAAGGCGA AGATCCAGGA
CAAGGAAGGC ATCCCCCCAG ACCAGCAGAG GCTGATCTTT GCCGGGAAGC AGCTGGAAGA
TGGGCGCACC CTGTCTGACT ACAACATCCA GAAGGAGTCC ACCCTGCACC TGGTCCTCCG
CCTCAGAGGT GGGATGCAGA TCTTCGTGAA GACCTTGACT GGTAAGACCA TCACCCTGGA
AGTGGAGCCC AGCGACACCA TCGAGAACGT CAAGGCGAAG ATCCAGGACA AGGAAGGCAT
CCCCCCAGAC CAGCAGAGGC TGATCTTTGC CGGGAAGCAG CTGGAAGATG GGCGCACCCT
GTCTGACTAC AACATCCAGA AGGAGTCCAC CCTGCACCTG GTCCTCCGCC TCAGAGGTGG
GATGCAGATC TTCGTGAAGA CCTTGACTGG TAAGACCATC ACCCTGGAAG TGGAGCCCAG
CGACACCATC GAGAACGTCA AGGCGAAAAT CCAGGACAAG GAAGGCTTCC CCCCGACCAC
ACAAAGGTGA TCTTTGCCGG GAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinUBCpolyubiquitin-C [Homo sapiens]. 6630.0
Contig/Assembly ProteinUBBpolyubiquitin-B precursor [Homo sapiens]. 444e-125O
Contig/Assembly ProteinRPS27Aubiquitin-40S ribosomal protein S27a precursor [Homo sapiens]. 1511e-36O
Contig/Assembly ProteinUBA52ubiquitin-60S ribosomal protein L40 precursor [Homo sapiens]. 1511e-36O
Contig/Assembly ProteinUBA52ubiquitin-60S ribosomal protein L40 precursor [Homo sapiens]. 1511e-36O
Contig/Assembly ProteinRPS27Aubiquitin-40S ribosomal protein S27a precursor [Homo sapiens]. 1511e-36O
Contig/Assembly ProteinRPS27Aubiquitin-40S ribosomal protein S27a precursor [Homo sapiens]. 1511e-36O
Contig/Assembly ProteinNEDD8NEDD8 precursor [Homo sapiens]. 97.13e-20O
Contig/Assembly ProteinUBDubiquitin D [Homo sapiens]. 84.32e-16O
Contig/Assembly ProteinISG15ubiquitin-like protein ISG15 precursor [Homo sapiens]. 773e-14O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinUbcpolyubiquitin-C [Mus musculus]. 6630.0O
Contig/Assembly ProteinUbbpolyubiquitin-B [Mus musculus]. 588e-168O
Contig/Assembly ProteinRps27aubiquitin-40S ribosomal protein S27a precursor [Mus musculus]. 1511e-36O
Contig/Assembly ProteinUba52ubiquitin-60S ribosomal protein L40 [Mus musculus]. 1518e-37O
Contig/Assembly ProteinRps27aubiquitin-40S ribosomal protein S27a precursor [Mus musculus]. 1511e-36O
Contig/Assembly ProteinGm7866PREDICTED: ubiquitin-like protein ISG15-like [Mus musculus]. 1501e-36O
Contig/Assembly ProteinGm7866PREDICTED: ubiquitin-like protein ISG15-like [Mus musculus]. 1501e-36O
Contig/Assembly ProteinGm8430PREDICTED: hypothetical protein LOC667035 [Mus musculus]. 1494e-36O
Contig/Assembly ProteinGm8430PREDICTED: hypothetical protein LOC667035 [Mus musculus]. 1487e-36O
Contig/Assembly ProteinGm4802PREDICTED: hypothetical protein LOC216818 [Mus musculus]. 1081e-23O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC610457PREDICTED: similar to CG11624-PA, isoform A [Canis familiaris]. 6630.0O
Contig/Assembly ProteinLOC479513PREDICTED: similar to ubiquitin B precursor isoform 1 [Canis familiaris]. 442e-124O
Contig/Assembly ProteinLOC479513PREDICTED: similar to ubiquitin B precursor isoform 3 [Canis familiaris]. 2989e-81O
Contig/Assembly ProteinLOC479513PREDICTED: similar to ubiquitin B precursor isoform 2 [Canis familiaris]. 2801e-75O
Contig/Assembly ProteinLOC608887PREDICTED: similar to polyubiquitin [Canis familiaris]. 1642e-40O
Contig/Assembly ProteinUBA52ubiquitin-60S ribosomal protein L40 precursor [Canis lupus familiaris]. 1511e-36O
Contig/Assembly ProteinLOC474599PREDICTED: similar to ubiquitin and ribosomal protein S27a precursor [Canis familiaris]. 1511e-36O
Contig/Assembly ProteinUB-RPL40hypothetical protein LOC612529 [Canis lupus familiaris]. 1511e-36O
Contig/Assembly ProteinLOC610074PREDICTED: similar to ubiquitin B precursor [Canis familiaris]. 1472e-35O
Contig/Assembly ProteinLOC481020PREDICTED: similar to ubiquitin and ribosomal protein S27a precursor [Canis familiaris]. 1433e-34O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinUBCpolyubiquitin-C [Bos taurus]. 6660.0O
Contig/Assembly ProteinLOC281370polyubiquitin-B [Bos taurus]. 586e-167O
Contig/Assembly ProteinLOC100335189PREDICTED: Os05g0242100-like [Bos taurus]. 3454e-95O
Contig/Assembly ProteinLOC100138493PREDICTED: Os05g0242100-like [Bos taurus]. 3041e-82O
Contig/Assembly ProteinLOC100296593PREDICTED: Os05g0242100-like [Bos taurus]. 2325e-61O
Contig/Assembly ProteinLOC100296593PREDICTED: Os05g0242100-like [Bos taurus]. 2325e-61O
Contig/Assembly ProteinUBA52ubiquitin-60S ribosomal protein L40 [Bos taurus]. 1519e-37O
Contig/Assembly ProteinRPS27Aubiquitin-40S ribosomal protein S27a [Bos taurus]. 1511e-36O
Contig/Assembly ProteinLOC783718PREDICTED: ubiquitin B-like, partial [Bos taurus]. 1502e-36O
Contig/Assembly ProteinLOC783718PREDICTED: ubiquitin B-like [Bos taurus]. 1496e-36O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100521156PREDICTED: polyubiquitin-B-like isoform 5 [Sus scrofa]. 592e-169O
Contig/Assembly ProteinLOC100521156PREDICTED: polyubiquitin-B-like isoform 2 [Sus scrofa]. 592e-169O
Contig/Assembly ProteinLOC100521156PREDICTED: polyubiquitin-B-like isoform 4 [Sus scrofa]. 592e-169O
Contig/Assembly ProteinLOC100521156PREDICTED: polyubiquitin-B-like isoform 1 [Sus scrofa]. 592e-169O
Contig/Assembly ProteinLOC100521156PREDICTED: polyubiquitin-B-like isoform 3 [Sus scrofa]. 592e-169O
Contig/Assembly ProteinUBBubiquitin [Sus scrofa]. 444e-125O
Contig/Assembly ProteinLOC100627098PREDICTED: hypothetical protein LOC100627098 [Sus scrofa]. 1686e-42O
Contig/Assembly ProteinLOC100514637PREDICTED: ubiquitin-40S ribosomal protein S27a-like [Sus scrofa]. 1518e-37O
Contig/Assembly ProteinUBA52ubiquitin-60S ribosomal protein L40 [Sus scrofa]. 1516e-37O
Contig/Assembly ProteinLOC100514637PREDICTED: ubiquitin-40S ribosomal protein S27a-like [Sus scrofa]. 1518e-37O


Assembly Members: 497      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010014C10ADR01_0014_C10.bDB782761 
ADR010015D01ADR01_0015_D01.bDB782849 
ADR010030E09ADR01_0030_E09.bDB784155 
ADR010047H12ADR01_0047_H12.bDB785725 
AMP010006D03AMP01_0006_D03.bBW955392 
AMP010011C10AMP01_0011_C10.b  
AMP010012F04AMP01_0012_F04.bBW955884 
AMP010015H08AMP01_0015_H08.bBW956130 
AMP010016F04AMP01_0016_F04.bBW956185 
AMP010017H12AMP01_0017_H12.bBW956294 
AMP010023D03AMP01_0023_D03.bBW956718 
AMP010027G05AMP01_0027_G05.bBW957057 
AMP010034D04AMP01_0034_D04.bBW957439 
AMP010037D08AMP01_0037_D08.bBW957679 
AMP010050G06AMP01_0050_G06.bBW958568 
AMP010052H06AMP01_0052_H06.bBW958730 
AMP010054B12AMP01_0054_B12.bBW958839 
AMP010055H06AMP01_0055_H06.bBW958969 
AMP010056A10AMP01_0056_A10.bBW958983 
AMP010060B08AMP01_0060_B08.bBW959325 
AMP010060D09AMP01_0060_D09.bBW959349 
AMP010065A08AMP01_0065_A08.bBW959687 
AMP010068D11AMP01_0068_D11.bBW959929 
AMP010068E02AMP01_0068_E02.bBW959931 
AMP010069G07AMP01_0069_G07.bBW960042 
AMP010074A08AMP01_0074_A08.bBW960288 
AMP010077D02AMP01_0077_D02.bBW960541 
AMP010080E01AMP01_0080_E01.bBW960773 
AMP010084A02AMP01_0084_A02.bBW961050 
AMP010088G09AMP01_0088_G09.bBW961466 
AMP010093A02AMP01_0093_A02.bBW961819 
AMP010096B09AMP01_0096_B09.bBW962101 
AMP010097C02AMP01_0097_C02.bBW962196 
BFLT10068G01BFLT1_0068_G01.bFS645441 
BFLT10086A09BFLT1_0086_A09.bFS646780 
BFLT10126E08BFLT1_0126_E08.bHX203891 
BFLT10145G02BFLT1_0145_G02.bHX205188 
BKFL10009E12BKFL1_0009_E12.bFS648509 
BKFL10032F11BKFL1_0032_F11.bFS650118 
BKFL10079H02BKFL1_0079_H02.bFS653434 
BMWN10019F11BMWN1_0019_F11.bHX206731 
BMWN10057E12BMWN1_0057_E12.bHX209036 
BMWN10093F01BMWN1_0093_F01.bHX211315 
CBLT10006G02CBLT1_0006_G02.bHX212212 
CBLT10026E03CBLT1_0026_E03.bHX213680 
CBLT10028D04CBLT1_0028_D04.bHX213805 
CBLT10060E09CBLT1_0060_E09.bHX215919 
CBLT10063A05CBLT1_0063_A05.bHX216109 
CBLT10067A01CBLT1_0067_A01.bHX216435 
CLNT10009A08CLNT1_0009_A08.bFS657731 
CLNT10031G07CLNT1_0031_G07.bFS659516 
CLNT10032D02CLNT1_0032_D02.bFS659556 
DCI010007E04DCI01_0007_E04.bDB791007 
DCI010011H03DCI01_0011_H03.bDB791324 
DCI010031A05DCI01_0031_A05.bDB793011 
DCI010035E08DCI01_0035_E08.bDB793428 
DCI010035F11DCI01_0035_F11.bDB793442 
DCI010037F10DCI01_0037_F10.bDB793619 
DCI010041G10DCI01_0041_G10.bDB793875 
DCI010044H01DCI01_0044_H01.bDB794151 
DCI010057B12DCI01_0057_B12.bDB794616 
DCI010113E01DCI01_0113_E01.bDB799582 
HTMT10027D02HTMT1_0027_D02.bFS666196 
HTMT10076D12HTMT1_0076_D12.bFS669625 
HTMT10081D04HTMT1_0081_D04.bFS669922 
HTMT10119C05HTMT1_0119_C05.bHX224490 
HTMT10141F09HTMT1_0141_F09.bHX225940 
ILNT10007D09ILNT1_0007_D09.bHX227263 
ILNT10054E06ILNT1_0054_E06.bHX231011 
ILNT10078B02ILNT1_0078_B02.bHX232951 
ITT010012E01ITT01_0012_E01.bBW977094 
ITT010026E11ITT01_0026_E11.bBW978366 
ITT010051B11ITT01_0051_B11.bBW980496 
ITT010052D05ITT01_0052_D05.bBW980605 
ITT010054E01ITT01_0054_E01.bBW980798 
ITT010069F08ITT01_0069_F08.bBW982168 
ITT010080G04ITT01_0080_G04.bBW983137 
ITT010081A04ITT01_0081_A04.bBW983159 
ITT010083A03ITT01_0083_A03.bBW983341 
ITT010085D08ITT01_0085_D08.bBW983547 
ITT010095B09ITT01_0095_B09.bBW984419 
ITT010095G04ITT01_0095_G04.bBW984471 
KDN010007G03KDN01_0007_G03.bFS671740 
KDN010020E03KDN01_0020_E03.bHX234752 
KDN010024E03KDN01_0024_E03.bFS673014 
KDN010026C06KDN01_0026_C06.bFS673151 
KDN010032D01KDN01_0032_D01.bFS673634 
KDN010036G12KDN01_0036_G12.bFS673985 
KDN010041A06KDN01_0041_A06.bFS674027 
KDN010041D09KDN01_0041_D09.b  
KDN010042G11KDN01_0042_G11.bHX234774 
KDN010043D07KDN01_0043_D07.bFS674196 
KDN010046C01KDN01_0046_C01.b  
KDN010046F11KDN01_0046_F11.bFS674381 
KDN010049C11KDN01_0049_C11.bHX234780 
KDN010052B02KDN01_0052_B02.bFS674582 
KDN010052D12KDN01_0052_D12.bFS674598 
KDN010052H12KDN01_0052_H12.bFS674622 
KDN010054B12KDN01_0054_B12.bFS674725 
KDN010057A08KDN01_0057_A08.bFS674941 
KDN010058C11KDN01_0058_C11.bFS675038 
KDN010058H01KDN01_0058_H01.bFS675082 
KDN010059A06KDN01_0059_A06.bFS675096 
KDN010059H03KDN01_0059_H03.bFS675162 
KDN010060H02KDN01_0060_H02.bFS675241 
KDN010061C02KDN01_0061_C02.bFS675269 
KDN010062E03KDN01_0062_E03.bFS675380 
KDN010063E08KDN01_0063_E08.bFS675464 
KDN010064D03KDN01_0064_D03.bFS675535 
KDN010065A06KDN01_0065_A06.bFS675588 
KDN010066B03KDN01_0066_B03.bFS675673 
KDN010069B03KDN01_0069_B03.bFS675901 
KDN010072E03KDN01_0072_E03.bFS676172 
KDN010077D04KDN01_0077_D04.bFS676568 
KDN010078E01KDN01_0078_E01.bFS676648 
KDN010080F03KDN01_0080_F03.bFS676813 
KDN010086E05KDN01_0086_E05.bFS677268 
KDN010095A03KDN01_0095_A03.bFS677965 
LNG010002H11LNG01_0002_H11.bBP440775 
LNG010013D04LNG01_0013_D04.bBP436203 
LNG010019G12LNG01_0019_G12.bBP439886 
LNG010020H01LNG01_0020_H01.bBP439969 
LNG010021E09LNG01_0021_E09.bBP437613 
LNG010032E03LNG01_0032_E03.bBP437117 
LNG010034G08LNG01_0034_G08.bBP439558 
LNG010035F10LNG01_0035_F10.bBP438735 
LNG010036E09LNG01_0036_E09.bBP437625 
LNG010046G10LNG01_0046_G10.bBP439721 
LNG010073C08LNG01_0073_C08.bBP435579 
LNG010074E01LNG01_0074_E01.bBP436967 
LNG010085F11LNG01_0085_F11.bBP438853 
LNG010091H09LNG01_0091_H09.bBP440672 
LNG010094B11LNG01_0094_B11.bBP434864 
LNG010107G02LNG01_0107_G02.bBP439115 
LNG010110G10LNG01_0110_G10.b  
LVR010005C07LVR01_0005_C07.bBP443239 
LVR010011G05LVR01_0011_G05.bBP446623 
LVR010020G10LVR01_0020_G10.bBP446993 
LVR010036A03LVR01_0036_A03.b  
LVR010051G10LVR01_0051_G10.bBP447018 
LVR010059B02LVR01_0059_B02.bBP441983 
LVR010059H04LVR01_0059_H04.bBP447494 
LVR010074H11LVR01_0074_H11.bBP448048 
LVR010078G01LVR01_0078_G01.bBP446369 
LVR010081B11LVR01_0081_B11.bBP442692 
LVR010082H11LVR01_0082_H11.bBP448053 
LVR010084E04LVR01_0084_E04.bCJ000138 
LVR010084F02LVR01_0084_F02.bBW962715 
LVR010086H11LVR01_0086_H11.bBW962730 
LVR010088G07LVR01_0088_G07.bBW962739 
LVR010089B12LVR01_0089_B12.bCJ000529 
LVR010096C03LVR01_0096_C03.bBP443001 
LVR010099E07LVR01_0099_E07.bBP445051 
LVRM10001C11LVRM1_0001_C11.bBP138817 
LVRM10005A06LVRM1_0005_A06.bBP137674 
LVRM10009D04LVRM1_0009_D04.bBP139022 
LVRM10021A03LVRM1_0021_A03.bBP137567 
LVRM10026C10LVRM1_0026_C10.bBP138787 
LVRM10028H03LVRM1_0028_H03.bBP140840 
LVRM10030F01LVRM1_0030_F01.bBP139823 
LVRM10031C12LVRM1_0031_C12.bBP138876 
LVRM10033A07LVRM1_0033_A07.bCJ001211 
LVRM10036F09LVRM1_0036_F09.bBW962832 
LVRM10036G11LVRM1_0036_G11.bBW962834 
LVRM10039C03LVRM1_0039_C03.bBW962847 
LVRM10040D04LVRM1_0040_D04.bBW962855 
LVRM10040E07LVRM1_0040_E07.bCJ001840 
LVRM10042A04LVRM1_0042_A04.bBW962868 
LVRM10047C08LVRM1_0047_C08.bCJ002290 
LVRM10058D02LVRM1_0058_D02.bBP138960 
LVRM10072A03LVRM1_0072_A03.bBP448268 
LVRM10081C01LVRM1_0081_C01.bBW962936 
LVRM10082D09LVRM1_0082_D09.bCJ002543 
LVRM10083A04LVRM1_0083_A04.bBW962946 
LVRM10088H09LVRM1_0088_H09.bCJ003092 
LVRM10089D07LVRM1_0089_D07.bCJ003131 
LVRM10092F10LVRM1_0092_F10.bCJ003402 
LVRM10092H02LVRM1_0092_H02.bBW962996 
LVRM10095A05LVRM1_0095_A05.bBW963031 
LVRM10095D01LVRM1_0095_D01.bBW963035 
LVRM10099D10LVRM1_0099_D10.bCJ003931 
LVRM10105D08LVRM1_0105_D08.bBP451055 
LVRM10106E10LVRM1_0106_E10.bBP451995 
LVRM10107D02LVRM1_0107_D02.bBP450630 
LVRM10109F09LVRM1_0109_F09.bBP452731 
LVRM10117C12LVRM1_0117_C12.bBP450502 
LVRM10130D05LVRM1_0130_D05.bBP450861 
LVRM10131E06LVRM1_0131_E06.bBP451756 
LVRM10131G08LVRM1_0131_G08.bBP453497 
LVRM10139H05LVRM1_0139_H05.bBP454124 
LVRM10140B03LVRM1_0140_B03.bBP449106 
LVRM10144B11LVRM1_0144_B11.bBP449650 
LVRM10144E01LVRM1_0144_E01.bBP451437 
LVRM10145C05LVRM1_0145_C05.bBP450029 
LVRM10148D08LVRM1_0148_D08.bBP451095 
LVRM10150G04LVRM1_0150_G04.bBP453232 
LVRM10150H09LVRM1_0150_H09.bBP454424 
LVRM10151F08LVRM1_0151_F08.bBP452700 
LVRM10153C01LVRM1_0153_C01.bBP449769 
LVRM10161F02LVRM1_0161_F02.bBP452307 
LVRM10163C05LVRM1_0163_C05.bBW963087 
LVRM10165D03LVRM1_0165_D03.bCJ004258 
LVRM10169C01LVRM1_0169_C01.bCJ004554 
LVRM10170B09LVRM1_0170_B09.bCJ004634 
LVRM10172G08LVRM1_0172_G08.bBW963148 
LVRM10174E02LVRM1_0174_E02.bBW963158 
LVRM10179D05LVRM1_0179_D05.bCJ005358 
LVRM10201B12LVRM1_0201_B12.bCJ007076 
MLN010026A05MLN01_0026_A05.bCJ009612 
MLN010093H01MLN01_0093_H01.bCJ015148 
MLTL10075G06MLTL1_0075_G06.bFS684137 
OVR010004B09OVR01_0004_B09.bBP141982 
OVR010014A06OVR01_0014_A06.bBP141446 
OVR010017D06OVR01_0017_D06.bBP142787 
OVR010018H07OVR01_0018_H07.bBP144629 
OVR010027E05OVR01_0027_E05.bBP143204 
OVR010028H09OVR01_0028_H09.bBP144714 
OVR010032H01OVR01_0032_H01.bBP144417 
OVR010039A05OVR01_0039_A05.bBP141428 
OVR010040C09OVR01_0040_C09.bBP142465 
OVR010042B06OVR01_0042_B06.bBP141897 
OVR010045B12OVR01_0045_B12.bBP142116 
OVR010048B07OVR01_0048_B07.bBP141939 
OVR010049F08OVR01_0049_F08.bBW963996 
OVR010050G03OVR01_0050_G03.bBW964092 
OVR010056B06OVR01_0056_B06.bBW964582 
OVR010056C10OVR01_0056_C10.bBW964596 
OVR010061H01OVR01_0061_H01.bBW965095 
OVR010068F11OVR01_0068_F11.bBW965701 
OVR010070B05OVR01_0070_B05.bBW965826 
OVR010072A08OVR01_0072_A08.bBW966002 
OVR010073A09OVR01_0073_A09.bBW966094 
OVR010075B05OVR01_0075_B05.bBW966268 
OVR010078B10OVR01_0078_B10.bBW966521 
OVR010081G11OVR01_0081_G11.bBW966777 
OVR010081H04OVR01_0081_H04.bBW966782 
OVR010083D08OVR01_0083_D08.b  
OVR010086C02OVR01_0086_C02.bBW967067 
OVR010086D02OVR01_0086_D02.bBW967078 
OVR010091F06OVR01_0091_F06.bBW967475 
OVR010093G08OVR01_0093_G08.bBW967640 
OVR010104B05OVR01_0104_B05.bBW968468 
OVRM10002B05OVRM1_0002_B05.bBP455877 
OVRM10004B05OVRM1_0004_B05.bBP455878 
OVRM10004C09OVRM1_0004_C09.bBP457167 
OVRM10005B02OVRM1_0005_B02.bBP455633 
OVRM10005E05OVRM1_0005_E05.bBP458778 
OVRM10017C02OVRM1_0017_C02.bBP147503 
OVRM10018B05OVRM1_0018_B05.bBP455880 
OVRM10020F02OVRM1_0020_F02.bBP151247 
OVRM10025G12OVRM1_0025_G12.bBP153571 
OVRM10026E11OVRM1_0026_E11.bBP150939 
OVRM10030A02OVRM1_0030_A02.b  
OVRM10038C06OVRM1_0038_C06.bBP456932 
OVRM10039F01OVRM1_0039_F01.bBP459404 
OVRM10043B01OVRM1_0043_B01.bBP455560 
OVRM10043D06OVRM1_0043_D06.bBP457891 
OVRM10044F08OVRM1_0044_F08.bBP459990 
OVRM10046A02OVRM1_0046_A02.bBP144960 
OVRM10048A10OVRM1_0048_A10.bBP455337 
OVRM10049C09OVRM1_0049_C09.bBP148235 
OVRM10059D10OVRM1_0059_D10.bBP149631 
OVRM10061H06OVRM1_0061_H06.bBP154252 
OVRM10062H07OVRM1_0062_H07.bBP154368 
OVRM10066A11OVRM1_0066_A11.bBP145955 
OVRM10066C12OVRM1_0066_C12.bBP148587 
OVRM10066G09OVRM1_0066_G09.bBP153254 
OVRM10068C06OVRM1_0068_C06.bBP147939 
OVRM10068F09OVRM1_0068_F09.bBP152006 
OVRM10071H01OVRM1_0071_H01.bBP153715 
OVRM10075C07OVRM1_0075_C07.bBP148048 
OVRM10076C10OVRM1_0076_C10.bBP148370 
OVRM10077G03OVRM1_0077_G03.bBP152617 
OVRM10079C07OVRM1_0079_C07.bBP148052 
OVRM10081G05OVRM1_0081_G05.bBP152834 
OVRM10083H11OVRM1_0083_H11.bBP154830 
OVRM10089H03OVRM1_0089_H03.bBP153946 
OVRM10091G06OVRM1_0091_G06.bBP152950 
OVRM10093A01OVRM1_0093_A01.bBP144894 
OVRM10095A12OVRM1_0095_A12.bBP146095 
OVRM10096A07OVRM1_0096_A07.bBP145540 
OVRM10096C10OVRM1_0096_C10.bBP148388 
OVRM10098H12OVRM1_0098_H12.bBP154957 
OVRM10102E04OVRM1_0102_E04.bBP150280 
OVRM10102G06OVRM1_0102_G06.bBP152960 
OVRM10105A12OVRM1_0105_A12.bBP146104 
OVRM10107G12OVRM1_0107_G12.bBP153637 
OVRM10108B09OVRM1_0108_B09.bBP147052 
OVRM10110A09OVRM1_0110_A09.bBP145771 
OVRM10113E06OVRM1_0113_E06.bBP150486 
OVRM10113H07OVRM1_0113_H07.bBP154417 
OVRM10114B07OVRM1_0114_B07.bBP146844 
OVRM10115D04OVRM1_0115_D04.bBP149048 
OVRM10117F07OVRM1_0117_F07.b  
OVRM10120D05OVRM1_0120_D05.bBP149154 
OVRM10121G09OVRM1_0121_G09.bBP153307 
OVRM10127B02OVRM1_0127_B02.bBP146326 
OVRM10128B08OVRM1_0128_B08.bBP146963 
OVRM10129G05OVRM1_0129_G05.bBP152877 
OVRM10130D04OVRM1_0130_D04.bBP149061 
OVRM10130G11OVRM1_0130_G11.bBP153546 
OVRM10131E10OVRM1_0131_E10.bBP150915 
OVRM10132H06OVRM1_0132_H06.bBP154320 
OVRM10133C05OVRM1_0133_C05.bBP147890 
OVRM10133H08OVRM1_0133_H08.bBP154551 
OVRM10134G10OVRM1_0134_G10.bBP153433 
OVRM10137D11OVRM1_0137_D11.bBP149815 
OVRM10147E06OVRM1_0147_E06.bBP458865 
OVRM10147E07OVRM1_0147_E07.bBP458946 
OVRM10149C06OVRM1_0149_C06.bBP456942 
OVRM10151D08OVRM1_0151_D08.bBP458060 
OVRM10152E09OVRM1_0152_E09.bBP459115 
OVRM10152H02OVRM1_0152_H02.bBP461464 
OVRM10152H11OVRM1_0152_H11.bBP462158 
OVRM10159D04OVRM1_0159_D04.bBP457743 
OVRM10160B01OVRM1_0160_B01.bBP455575 
OVRM10164F10OVRM1_0164_F10.bBP460185 
OVRM10166A06OVRM1_0166_A06.bBP455064 
OVRM10173C01OVRM1_0173_C01.bBP456560 
OVRM10175H02OVRM1_0175_H02.bBP461482 
OVRM10176F09OVRM1_0176_F09.bBP460108 
OVRM10188B09OVRM1_0188_B09.bBP456258 
OVRM10191A03OVRM1_0191_A03.bBP454850 
OVRM10195C04OVRM1_0195_C04.bBP456815 
OVRM10197B03OVRM1_0197_B03.bBP455766 
OVRM10198F02OVRM1_0198_F02.b  
OVRM10202F06OVRM1_0202_F06.bBP459871 
OVRM10204F05OVRM1_0204_F05.bBP459798 
OVRM10205F05OVRM1_0205_F05.bBP459799 
OVRM10207B08OVRM1_0207_B08.bBP456198 
OVRM10207G03OVRM1_0207_G03.bBP460623 
OVRM10218G06OVRM1_0218_G06.bBP460888 
OVRM10223F09OVRM1_0223_F09.bBP460149 
OVRM10224G06OVRM1_0224_G06.bBP460892 
OVRM10225D02OVRM1_0225_D02.bBP457643 
OVRT10002F10OVRT1_0002_F10.bFS686559 
OVRT10005A07OVRT1_0005_A07.bFS686755 
OVRT10007A09OVRT1_0007_A09.bFS686927 
OVRT10007E07OVRT1_0007_E07.bFS686969 
OVRT10016D06OVRT1_0016_D06.bFS687708 
OVRT10017E10OVRT1_0017_E10.bFS687801 
OVRT10019F08OVRT1_0019_F08.bFS687973 
OVRT10021A08OVRT1_0021_A08.bFS688079 
OVRT10025D02OVRT1_0025_D02.bFS688442 
OVRT10027E02OVRT1_0027_E02.bFS688624 
OVRT10029B08OVRT1_0029_B08.bFS688739 
OVRT10031A12OVRT1_0031_A12.bFS688888 
OVRT10031D04OVRT1_0031_D04.bFS688911 
OVRT10036H10OVRT1_0036_H10.bFS689374 
OVRT10036H12OVRT1_0036_H12.bFS689376 
OVRT10037C04OVRT1_0037_C04.bFS689398 
OVRT10037D06OVRT1_0037_D06.bFS689410 
OVRT10037D10OVRT1_0037_D10.bFS689414 
OVRT10037F12OVRT1_0037_F12.bFS689438 
OVRT10039G12OVRT1_0039_G12.bFS689618 
OVRT10043F07OVRT1_0043_F07.bFS689931 
OVRT10056F08OVRT1_0056_F08.bFS690996 
OVRT10057A10OVRT1_0057_A10.bFS691027 
OVRT10057B01OVRT1_0057_B01.bFS691030 
OVRT10060D06OVRT1_0060_D06.bFS691303 
OVRT10071C03OVRT1_0071_C03.bFS692197 
OVRT10089B05OVRT1_0089_B05.bFS693633 
OVRT10103A04OVRT1_0103_A04.bHX234998 
OVRT10104C02OVRT1_0104_C02.b  
OVRT10105F01OVRT1_0105_F01.bHX235208 
OVRT10113G01OVRT1_0113_G01.bHX235882 
OVRT10122H09OVRT1_0122_H09.bHX236630 
OVRT10125H10OVRT1_0125_H10.bHX236860 
OVRT10128D09OVRT1_0128_D09.bHX237059 
OVRT10129G02OVRT1_0129_G02.bHX237169 
OVRT10133B11OVRT1_0133_B11.bHX237440 
OVRT10139F08OVRT1_0139_F08.bHX237963 
OVRT10148D06OVRT1_0148_D06.bHX238690 
OVRT10149A11OVRT1_0149_A11.bHX238745 
OVRT10150B03OVRT1_0150_B03.bHX238834 
PBL010026D02PBL01_0026_D02.bBW969908 
PBL010058H06PBL01_0058_H06.bBW971532 
PBL010088E04PBL01_0088_E04.bBW973994 
PCT010004G02PCT01_0004_G02.b  
PST010006G11PST01_0006_G11.bFS697493 
PST010007C01PST01_0007_C01.bFS697526 
PST010012B09PST01_0012_B09.bFS697921 
PST010013A03PST01_0013_A03.bFS697980 
PST010014A01PST01_0014_A01.bFS698055 
PST010014C07PST01_0014_C07.bFS698080 
PST010014F06PST01_0014_F06.bFS698110 
PST010015F06PST01_0015_F06.bFS698188 
PST010018C05PST01_0018_C05.bFS698380 
PST010019F12PST01_0019_F12.bFS698494 
PST010028H02PST01_0028_H02.bFS699225 
PST010035D09PST01_0035_D09.bFS699580 
PST010046C06PST01_0046_C06.bFS700438 
PST010052F10PST01_0052_F10.bFS700964 
PST010056D06PST01_0056_D06.bFS701261 
PST010057A10PST01_0057_A10.bFS701310 
PST010062E07PST01_0062_E07.bFS701746 
PST010063G08PST01_0063_G08.bFS701850 
PST010066D01PST01_0066_D01.bFS702045 
PST010071B03PST01_0071_B03.bFS702410 
PST010072G06PST01_0072_G06.bFS702533 
PST010073D07PST01_0073_D07.bFS702576 
PST010075G09PST01_0075_G09.bFS702781 
PST010076A09PST01_0076_A09.bFS702799 
PST010080A09PST01_0080_A09.bFS703131 
PST010084D08PST01_0084_D08.bFS703488 
PST010085B09PST01_0085_B09.bFS703549 
PST010087H06PST01_0087_H06.bFS703771 
PST010089C07PST01_0089_C07.bFS703877 
PST010089H08PST01_0089_H08.bFS703925 
PST010096G02PST01_0096_G02.b  
PST010098E01PST01_0098_E01.bFS704561 
PTG010019D06PTG01_0019_D06.bFS706084 
PTG010032C04PTG01_0032_C04.bFS707204 
PTG010042D03PTG01_0042_D03.bFS708109 
PTG010052A12PTG01_0052_A12.bFS708973 
PTG010055B01PTG01_0055_B01.bFS709220 
PTG010082F03PTG01_0082_F03.bFS711383 
PTG010097D04PTG01_0097_D04.bFS712301 
PTG010103G08PTG01_0103_G08.b  
SKNB10002G08SKNB1_0002_G08.bDB800192 
SKNB10003A12SKNB1_0003_A12.bDB800210 
SKNB10009C02SKNB1_0009_C02.b  
SKNB10022C01SKNB1_0022_C01.bFS713382 
SKNB10058E10SKNB1_0058_E10.bDB803483 
SKNB10074B10SKNB1_0074_B10.bDB804507 
SKNB10078G12SKNB1_0078_G12.bDB804773 
SKNB10085E12SKNB1_0085_E12.bDB805184 
SKNB10086H04SKNB1_0086_H04.bDB805292 
SKNB10095G05SKNB1_0095_G05.bDB805722 
SMG010013H05SMG01_0013_H05.bFS714418 
SMG010037G10SMG01_0037_G10.bFS716556 
SMG010040B06SMG01_0040_B06.b  
SMG010041F07SMG01_0041_F07.bFS716878 
SMG010045E03SMG01_0045_E03.bFS717201 
SMG010053F07SMG01_0053_F07.bFS717898 
SMG010057B11SMG01_0057_B11.bFS718178 
SMG010066C09SMG01_0066_C09.bFS718960 
SMG010067G01SMG01_0067_G01.bFS719087 
SMG010067G07SMG01_0067_G07.bFS719093 
SMG010069F01SMG01_0069_F01.bFS719243 
SMG010076C03SMG01_0076_C03.bFS719821 
SMG010077H11SMG01_0077_H11.bFS719967 
SMG010087F03SMG01_0087_F03.bFS720806 
SMG010096G06SMG01_0096_G06.bFS721574 
SMG010097E11SMG01_0097_E11.b  
SPL010011H01SPL01_0011_H01.bBP159046 
SPL010029C04SPL01_0029_C04.bCJ016226 
SPL010030B01SPL01_0030_B01.bCJ016304 
SPL010030F05SPL01_0030_F05.bCJ016355 
SPL010043F10SPL01_0043_F10.bCJ016909 
SPL010058C11SPL01_0058_C11.bCJ018227 
SPL010090G01SPL01_0090_G01.bCJ021146 
TCH010009A08TCH01_0009_A08.bCJ023089 
TCH010009E04TCH01_0009_E04.bBW975691 
TCH010023C06TCH01_0023_C06.bCJ024119 
TCH010028F09TCH01_0028_F09.bCJ024529 
TCH010034B01TCH01_0034_B01.bCJ024935 
TCH010037E07TCH01_0037_E07.bCJ025198 
TCH010077A07TCH01_0077_A07.bCJ027964 
TCH010080D07TCH01_0080_D07.bCJ028216 
TES010021A08TES01_0021_A08.bCJ031382 
TES010022D07TES01_0022_D07.bCJ031472 
TES010029F05TES01_0029_F05.bCJ031928 
TES010046E03TES01_0046_E03.bCJ032969 
TES010066H01TES01_0066_H01.bCJ034279 
TES010081A11TES01_0081_A11.bCJ035205 
THY010035A10THY01_0035_A10.bBP160297 
THY010045A08THY01_0045_A08.bBP160108 
THY010048B03THY01_0048_B03.bBP160823 
THY010068F05THY01_0068_F05.bBP166065 
THY010103F06THY01_0103_F06.bBP166193 
THY010105C01THY01_0105_C01.bBP161912 
THY010115C10THY01_0115_C10.bBP162854 
THY010118F10THY01_0118_F10.bBP166600 
THY010125G10THY01_0125_G10.bBP167878 
UTR010004C03UTR01_0004_C03.bBP170513 
UTR010012A11UTR01_0012_A11.bBP169809 
UTR010015E11UTR01_0015_E11.bBP171952 
UTR010019H08UTR01_0019_H08.bBP173423 
UTR010020A02UTR01_0020_A02.bBP169418 
UTR010028E12UTR01_0028_E12.bBP172005 
UTR010033G06UTR01_0033_G06.bBP172809 
UTR010034F02UTR01_0034_F02.bBP172099 
UTR010039C03UTR01_0039_C03.bBP170544 
UTR010044C06UTR01_0044_C06.bBP170685 
UTR010045B03UTR01_0045_B03.bBP170009 
UTR010046F12UTR01_0046_F12.bBP172552 
UTR010050A06UTR01_0050_A06.bBP462785 
UTR010050B06UTR01_0050_B06.bBP463081 
UTR010054A12UTR01_0054_A12.bBP462936 
UTR010058E02UTR01_0058_E02.bBP463859 
UTR010059F09UTR01_0059_F09.bBP464309 
UTR010061C05UTR01_0061_C05.bBP463355 
UTR010081B07UTR01_0081_B07.bCJ037452 
UTR010083F08UTR01_0083_F08.bCJ037681 
UTR010103G08UTR01_0103_G08.bCJ039450 
UTR010103H09UTR01_0103_H09.bCJ039463 

  

SNPs: 5      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
232A0680.151MSCAA/Q
G335480.849CAG/Q
283C340540.927MSGAC/D
T0310.073GAT/D
502C1881220.883WSACC/T
T4100.117ACT/T
640C102290.575WSAAC/N
T9700.425AAT/N
658A2200.092WSCAA/Q
G200170.908CAG/Q


Alignment:      TOP

20110601C-001761 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
THY01_0115_C10.b :
THY01_0118_F10.b :
LVRM1_0144_B11.b :
OVR01_0018_H07.b :
LVRM1_0169_C01.b :
OVRM1_0096_A07.b :
OVR01_0027_E05.b :
THY01_0103_F06.b :
THY01_0105_C01.b :
LVRM1_0028_H03.b :
OVRM1_0071_H01.b :
LVRM1_0001_C11.b :
LVR01_0005_C07.b :
LNG01_0013_D04.b :
PST01_0089_H08.b :
PST01_0075_G09.b :
SKNB1_0078_G12.b :
LVRM1_0081_C01.b :
OVRM1_0147_E07.b :
LVRM1_0107_D02.b :
LVR01_0036_A03.b :
OVR01_0042_B06.b :
OVRM1_0005_E05.b :
TES01_0022_D07.b :
SKNB1_0009_C02.b :
PST01_0018_C05.b :
TES01_0029_F05.b :
PST01_0062_E07.b :
SKNB1_0095_G05.b :
KDN01_0052_B02.b :
KDN01_0032_D01.b :
KDN01_0057_A08.b :
PST01_0066_D01.b :
PST01_0019_F12.b :
PST01_0076_A09.b :
TES01_0046_E03.b :
KDN01_0072_E03.b :
KDN01_0059_A06.b :
KDN01_0086_E05.b :
PST01_0072_G06.b :
PST01_0028_H02.b :
KDN01_0043_D07.b :
PST01_0012_B09.b :
KDN01_0069_B03.b :
KDN01_0007_G03.b :
KDN01_0063_E08.b :
PST01_0089_C07.b :
TES01_0021_A08.b :
SKNB1_0074_B10.b :
PST01_0035_D09.b :
KDN01_0061_C02.b :
PST01_0087_H06.b :
PST01_0014_F06.b :
PST01_0014_A01.b :
TES01_0066_H01.b :
PST01_0080_A09.b :
KDN01_0026_C06.b :
KDN01_0052_D12.b :
KDN01_0080_F03.b :
PST01_0096_G02.b :
PST01_0063_G08.b :
TCH01_0080_D07.b :
KDN01_0078_E01.b :
PST01_0084_D08.b :
KDN01_0064_D03.b :
PST01_0071_B03.b :
KDN01_0062_E03.b :
PST01_0098_E01.b :
PST01_0057_A10.b :
PST01_0056_D06.b :
KDN01_0042_G11.b :
KDN01_0060_H02.b :
KDN01_0095_A03.b :
PST01_0007_C01.b :
KDN01_0054_B12.b :
PST01_0046_C06.b :
KDN01_0077_D04.b :
PST01_0085_B09.b :
KDN01_0066_B03.b :
KDN01_0049_C11.b :
KDN01_0058_H01.b :
BFLT1_0145_G02.b :
OVRM1_0151_D08.b :
OVRM1_0152_E09.b :
SKNB1_0002_G08.b :
OVRM1_0075_C07.b :
LVRM1_0105_D08.b :
OVRM1_0132_H06.b :
SKNB1_0003_A12.b :
OVRM1_0095_A12.b :
KDN01_0020_E03.b :
CBLT1_0067_A01.b :
BMWN1_0093_F01.b :
SKNB1_0022_C01.b :
HTMT1_0119_C05.b :
ILNT1_0078_B02.b :
BMWN1_0057_E12.b :
BMWN1_0019_F11.b :
PST01_0006_G11.b :
HTMT1_0027_D02.b :
ITT01_0080_G04.b :
HTMT1_0141_F09.b :
CLNT1_0032_D02.b :
OVRT1_0128_D09.b :
LNG01_0002_H11.b :
CBLT1_0028_D04.b :
ILNT1_0007_D09.b :
SKNB1_0085_E12.b :
OVR01_0045_B12.b :
HTMT1_0076_D12.b :
CBLT1_0006_G02.b :
SKNB1_0086_H04.b :
KDN01_0041_A06.b :
ILNT1_0054_E06.b :
PST01_0014_C07.b :
SKNB1_0058_E10.b :
PST01_0013_A03.b :
OVRT1_0037_D10.b :
KDN01_0036_G12.b :
CBLT1_0060_E09.b :
CBLT1_0063_A05.b :
KDN01_0065_A06.b :
ITT01_0069_F08.b :
OVRM1_0175_H02.b :
OVR01_0086_D02.b :
AMP01_0006_D03.b : ttttcgtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0012_F04.b : nnaatacttatcttxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0043_D06.b :
ADR01_0015_D01.b :
AMP01_0093_A02.b : tgcgcatatttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0009_D04.b :
OVRM1_0188_B09.b :
DCI01_0057_B12.b : natgatcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0089_D07.b :
DCI01_0031_A05.b : nnncctatcttxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0060_D09.b : gaaacccnnttaggtattttaxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0059_D10.b :
OVRM1_0018_B05.b :
OVRM1_0098_H12.b :
OVRM1_0002_B05.b :
DCI01_0035_F11.b : nnggtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_C12.b :
AMP01_0097_C02.b : gggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0028_E12.b :
AMP01_0065_A08.b : atatagctaatcttxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0037_F10.b : nnnaaagtatcttxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0035_E08.b : nnnggtaccatxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0030_F05.b :
DCI01_0044_H01.b : tattatcttxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_G07.b : aatctctagcgatacttaxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0044_C06.b :
LNG01_0094_B11.b :
AMP01_0016_F04.b : nntttactgaatcttxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0060_B08.b : acccccttaggatacttxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0074_A08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxx
AMP01_0088_G09.b : natacgtatcttxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0032_H01.b :
AMP01_0055_H06.b : nnggataaannttaagtgatatcttxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0096_B09.b : ggcgtatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0103_H09.b :
AMP01_0027_G05.b : nnnattatactcaaggaattttttcggaaaccataxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxx
AMP01_0023_D03.b : ttttagcgaatcttxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_D11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxx
DCI01_0011_H03.b : nntttctatcttxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0026_E03.b :
OVRT1_0007_E07.b :
AMP01_0017_H12.b : nttaatggtatcttxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0052_H06.b : nnnnggagataaannttagagaatcattxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0037_D08.b : nngggatatatatagggatacttaxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_D04.b : nnnnccgatatanttttggatatcttgggctgctcgcccaccgxxxxxx
AMP01_0077_D02.b : nggtaatctatttgggatacttxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0007_E04.b : ttttagctatcttxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0015_H08.b : nnnnttactctcttxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0056_A10.b : nnnggcaataaantaagccgacacattxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0080_E01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxx
OVRT1_0122_H09.b :
AMP01_0084_A02.b : aaaaccgtatcttxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0041_G10.b : nnaatgtatctaaxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0050_G06.b : nnngggttatttatagggatacttxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0054_B12.b : nnnggagtaaannnttagggacatcttxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0113_E01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxx
OVR01_0004_B09.b :
OVRT1_0007_A09.b :
LNG01_0085_F11.b :
LVRM1_0026_C10.b :
LVRM1_0131_E06.b :
OVRM1_0166_A06.b :
OVRM1_0173_C01.b :
SMG01_0041_F07.b :
SMG01_0066_C09.b :
OVRM1_0076_C10.b :
OVRM1_0120_D05.b :
PTG01_0052_A12.b :
LVRM1_0072_A03.b :
OVRM1_0102_E04.b :
LVRM1_0058_D02.b :
LVRM1_0109_F09.b :
OVRM1_0068_F09.b :
OVRM1_0159_D04.b :
OVRM1_0102_G06.b :
LVRM1_0163_C05.b :
OVRM1_0115_D04.b :
SMG01_0096_G06.b :
OVRM1_0026_E11.b :
LVRM1_0150_G04.b :
LVRM1_0042_A04.b :
OVRM1_0129_G05.b :
OVRM1_0176_F09.b :
OVRM1_0121_G09.b :
OVRM1_0066_G09.b :
OVRM1_0068_C06.b :
SMG01_0057_B11.b :
LVRM1_0174_E02.b :
OVRM1_0130_D04.b :
OVR01_0104_B05.b :
OVRM1_0149_C06.b :
OVRM1_0152_H02.b :
OVRM1_0049_C09.b : nnn
OVRM1_0207_G03.b :
OVRM1_0066_C12.b : t
OVR01_0083_D08.b :
OVRT1_0036_H12.b :
OVRM1_0110_A09.b :
OVR01_0073_A09.b :
LVRM1_0083_A04.b :
OVRM1_0195_C04.b :
OVRM1_0061_H06.b :
LVRM1_0039_C03.b :
OVRM1_0164_F10.b :
LVRM1_0005_A06.b :
OVR01_0075_B05.b :
OVR01_0081_G11.b :
OVRM1_0134_G10.b :
OVRM1_0081_G05.b :
OVRM1_0147_E06.b :
LVRM1_0040_D04.b :
OVRM1_0046_A02.b :
LVRM1_0179_D05.b :
OVRT1_0029_B08.b :
LVRM1_0145_C05.b :
LVRM1_0172_G08.b :
LVRM1_0165_D03.b :
LVRM1_0095_D01.b :
OVRM1_0218_G06.b :
LVRM1_0040_E07.b :
LVRM1_0130_D05.b :
LVRM1_0170_B09.b :
OVRM1_0089_H03.b :
LVRM1_0095_A05.b :
LVRM1_0106_E10.b :
OVR01_0081_H04.b :
OVR01_0061_H01.b :
LVRM1_0033_A07.b :
LVRM1_0092_F10.b :
OVRM1_0191_A03.b :
LNG01_0046_G10.b :
LVRM1_0151_F08.b :
OVRM1_0044_F08.b :
OVRM1_0133_H08.b :
LVRM1_0047_C08.b :
LVRM1_0082_D09.b :
LVRM1_0201_B12.b :
OVRM1_0130_G11.b :
OVRM1_0093_A01.b :
OVRM1_0020_F02.b :
LVRM1_0030_F01.b :
OVRM1_0128_B08.b :
LVRM1_0088_H09.b :
OVRM1_0004_B05.b :
LVRM1_0021_A03.b :
LVRM1_0099_D10.b :
OVRM1_0131_E10.b :
LVRM1_0153_C01.b :
OVRM1_0207_B08.b :
LNG01_0036_E09.b :
LVRM1_0148_D08.b :
LVRM1_0117_C12.b :
LVR01_0089_B12.b :
OVRM1_0152_H11.b :
OVRM1_0205_F05.b :
OVRM1_0043_B01.b :
OVRM1_0062_H07.b :
OVRM1_0127_B02.b :
OVRM1_0038_C06.b :
OVRM1_0005_B02.b :
OVRM1_0202_F06.b :
LVRM1_0144_E01.b :
OVRM1_0223_F09.b :
LVRM1_0140_B03.b :
OVRM1_0039_F01.b :
OVRM1_0224_G06.b :
OVRM1_0096_C10.b :
OVRM1_0113_E06.b :
OVRM1_0077_G03.b :
LVRM1_0139_H05.b :
LVR01_0088_G07.b :
OVRM1_0025_G12.b :
OVRM1_0107_G12.b :
OVRM1_0113_H07.b :
LVRM1_0150_H09.b :
OVRM1_0079_C07.b :
SMG01_0013_H05.b :
OVRM1_0114_B07.b :
OVRM1_0091_G06.b :
OVRM1_0105_A12.b :
OVRM1_0083_H11.b :
UTR01_0012_A11.b :
OVRT1_0129_G02.b :
LNG01_0107_G02.b :
LNG01_0073_C08.b :
PBL01_0026_D02.b :
OVR01_0068_F11.b :
SMG01_0067_G01.b :
SMG01_0087_F03.b :
OVRT1_0089_B05.b :
OVRT1_0017_E10.b :
THY01_0068_F05.b :
PTG01_0019_D06.b :
SPL01_0043_F10.b :
UTR01_0059_F09.b :
SMG01_0077_H11.b :
OVR01_0048_B07.b :
OVR01_0050_G03.b :
LNG01_0091_H09.b :
OVRT1_0149_A11.b :
THY01_0048_B03.b :
LNG01_0110_G10.b :
LVR01_0086_H11.b :
UTR01_0045_B03.b :
OVR01_0056_C10.b :
SMG01_0037_G10.b :
OVRT1_0150_B03.b :
UTR01_0015_E11.b :
OVRT1_0103_A04.b :
UTR01_0019_H08.b :
OVR01_0049_F08.b :
OVR01_0070_B05.b :
UTR01_0020_A02.b :
ITT01_0085_D08.b :
OVRT1_0139_F08.b :
UTR01_0039_C03.b :
SMG01_0053_F07.b :
LNG01_0032_E03.b :
THY01_0045_A08.b :
OVRT1_0148_D06.b :
OVRT1_0105_F01.b :
LVR01_0051_G10.b :
LVR01_0020_G10.b :
OVRT1_0113_G01.b :
SMG01_0069_F01.b :
UTR01_0004_C03.b :
LVR01_0082_H11.b :
LNG01_0021_E09.b :
OVRT1_0039_G12.b :
OVRT1_0057_A10.b :
OVR01_0078_B10.b :
OVR01_0014_A06.b :
LVR01_0084_E04.b :
LNG01_0019_G12.b :
UTR01_0033_G06.b :
OVR01_0028_H09.b :
LVR01_0074_H11.b :
OVR01_0056_B06.b :
LVR01_0059_B02.b :
OVRT1_0133_B11.b :
OVRT1_0125_H10.b :
ITT01_0095_B09.b :
PTG01_0082_F03.b :
LVR01_0078_G01.b :
ADR01_0030_E09.b :
SMG01_0076_C03.b :
OVRT1_0037_D06.b :
PBL01_0058_H06.b :
SPL01_0058_C11.b :
KDN01_0024_E03.b :
OVRT1_0005_A07.b :
OVRT1_0027_E02.b :
OVRT1_0002_F10.b :
SMG01_0067_G07.b :
CLNT1_0009_A08.b :
OVRT1_0031_A12.b :
BFLT1_0068_G01.b :
TCH01_0009_E04.b :
OVRT1_0025_D02.b :
OVRT1_0060_D06.b :
OVRT1_0056_F08.b :
ITT01_0012_E01.b :
ITT01_0051_B11.b :
LVR01_0081_B11.b :
OVRT1_0021_A08.b :
OVRT1_0019_F08.b :
OVRT1_0037_F12.b :
SPL01_0030_B01.b :
OVRT1_0031_D04.b :
TCH01_0009_A08.b :
UTR01_0050_A06.b :
LNG01_0020_H01.b :
MLN01_0026_A05.b :
OVRT1_0037_C04.b :
OVR01_0040_C09.b :
THY01_0035_A10.b :
ITT01_0026_E11.b :
LVR01_0011_G05.b :
BFLT1_0086_A09.b :
TCH01_0034_B01.b :
UTR01_0050_B06.b :
UTR01_0103_G08.b :
LNG01_0034_G08.b :
LNG01_0035_F10.b :
TCH01_0077_A07.b :
OVRT1_0057_B01.b :
LVR01_0096_C03.b :
LVR01_0099_E07.b :
OVR01_0091_F06.b :
LVR01_0059_H04.b :
SPL01_0090_G01.b :
UTR01_0083_F08.b :
TCH01_0028_F09.b :
LNG01_0074_E01.b :
CLNT1_0031_G07.b :
UTR01_0058_E02.b :
ITT01_0052_D05.b :
MLN01_0093_H01.b :
TCH01_0023_C06.b :
LVR01_0084_F02.b :
OVR01_0072_A08.b :
OVRT1_0071_C03.b :
OVR01_0093_G08.b :
OVRT1_0016_D06.b :
UTR01_0054_A12.b :
UTR01_0061_C05.b :
ITT01_0081_A04.b :
OVR01_0039_A05.b :
OVRT1_0036_H10.b :
PBL01_0088_E04.b :
UTR01_0081_B07.b :
OVRT1_0043_F07.b :
ITT01_0083_A03.b :
ITT01_0054_E01.b :
THY01_0125_G10.b :
OVRM1_0133_C05.b :
OVR01_0086_C02.b :
OVRM1_0160_B01.b :
OVRM1_0137_D11.b :
LVRM1_0092_H02.b :
OVRM1_0225_D02.b :
OVRT1_0104_C02.b :
OVR01_0017_D06.b :
LVRM1_0131_G08.b :
OVRM1_0048_A10.b :
OVRM1_0117_F07.b :
OVRM1_0108_B09.b :
OVRM1_0197_B03.b :
LVRM1_0036_F09.b :
OVRM1_0204_F05.b :
OVRM1_0004_C09.b :
SPL01_0011_H01.b :
LVRM1_0036_G11.b :
PST01_0052_F10.b :
SPL01_0029_C04.b :
LVRM1_0161_F02.b :
TES01_0081_A11.b :
SMG01_0097_E11.b :
ADR01_0047_H12.b :
BFLT1_0126_E08.b :
ITT01_0095_G04.b :
HTMT1_0081_D04.b :
TCH01_0037_E07.b :
PTG01_0055_B01.b :
KDN01_0046_C01.b :
KDN01_0058_C11.b :
KDN01_0041_D09.b :
PST01_0073_D07.b :
PST01_0015_F06.b :
KDN01_0059_H03.b :
SMG01_0040_B06.b :
OVRM1_0198_F02.b :
BKFL1_0032_F11.b : nnnaaatatatttatatccgaaccnattxxxxxx
UTR01_0046_F12.b :
PTG01_0103_G08.b :
SMG01_0045_E03.b :
KDN01_0046_F11.b :
KDN01_0052_H12.b :
OVRM1_0017_C02.b :
PCT01_0004_G02.b :
BKFL1_0079_H02.b :
MLTL1_0075_G06.b :
AMP01_0011_C10.b : nnaaacgtatcttxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0034_F02.b :
PTG01_0097_D04.b :
ADR01_0014_C10.b :
OVRM1_0066_A11.b :
OVRM1_0030_A02.b :
PTG01_0042_D03.b :
BKFL1_0009_E12.b :
PTG01_0032_C04.b :
20110601C-001761 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
THY01_0115_C10.b :
THY01_0118_F10.b :
LVRM1_0144_B11.b : nagttgtcxx
OVR01_0018_H07.b : gggggtgaacctattagxxxxxxxxxxxxxxxxx
LVRM1_0169_C01.b :
OVRM1_0096_A07.b :
OVR01_0027_E05.b : gggaatttatgggxxxxxxxxxxxxxxxxxx
THY01_0103_F06.b :
THY01_0105_C01.b :
LVRM1_0028_H03.b :
OVRM1_0071_H01.b : a
LVRM1_0001_C11.b : cxxxxx
LVR01_0005_C07.b : ggcaxxxxxxxxxxxxxxxxxxxxx
LNG01_0013_D04.b : txxxxxxxxxxxxxxxxxxxx
PST01_0089_H08.b :
PST01_0075_G09.b :
SKNB1_0078_G12.b :
LVRM1_0081_C01.b :
OVRM1_0147_E07.b :
LVRM1_0107_D02.b : n
LVR01_0036_A03.b : tttggggtgxxxxxxxxxxxxxxx
OVR01_0042_B06.b : ctcctcccccccccccacccccataggxxxxxxxxxx
OVRM1_0005_E05.b :
TES01_0022_D07.b :
SKNB1_0009_C02.b :
PST01_0018_C05.b :
TES01_0029_F05.b :
PST01_0062_E07.b :
SKNB1_0095_G05.b :
KDN01_0052_B02.b :
KDN01_0032_D01.b :
KDN01_0057_A08.b :
PST01_0066_D01.b :
PST01_0019_F12.b :
PST01_0076_A09.b :
TES01_0046_E03.b :
KDN01_0072_E03.b :
KDN01_0059_A06.b :
KDN01_0086_E05.b :
PST01_0072_G06.b :
PST01_0028_H02.b :
KDN01_0043_D07.b :
PST01_0012_B09.b :
KDN01_0069_B03.b :
KDN01_0007_G03.b :
KDN01_0063_E08.b :
PST01_0089_C07.b :
TES01_0021_A08.b :
SKNB1_0074_B10.b :
PST01_0035_D09.b :
KDN01_0061_C02.b :
PST01_0087_H06.b :
PST01_0014_F06.b :
PST01_0014_A01.b :
TES01_0066_H01.b :
PST01_0080_A09.b :
KDN01_0026_C06.b :
KDN01_0052_D12.b :
KDN01_0080_F03.b :
PST01_0096_G02.b :
PST01_0063_G08.b :
TCH01_0080_D07.b : nnttggctaggactatn
KDN01_0078_E01.b :
PST01_0084_D08.b :
KDN01_0064_D03.b :
PST01_0071_B03.b :
KDN01_0062_E03.b :
PST01_0098_E01.b :
PST01_0057_A10.b :
PST01_0056_D06.b :
KDN01_0042_G11.b :
KDN01_0060_H02.b :
KDN01_0095_A03.b :
PST01_0007_C01.b :
KDN01_0054_B12.b :
PST01_0046_C06.b :
KDN01_0077_D04.b :
PST01_0085_B09.b :
KDN01_0066_B03.b :
KDN01_0049_C11.b :
KDN01_0058_H01.b :
BFLT1_0145_G02.b : ntttcgttt
OVRM1_0151_D08.b :
OVRM1_0152_E09.b :
SKNB1_0002_G08.b :
OVRM1_0075_C07.b :
LVRM1_0105_D08.b :
OVRM1_0132_H06.b : na
SKNB1_0003_A12.b :
OVRM1_0095_A12.b :
KDN01_0020_E03.b :
CBLT1_0067_A01.b :
BMWN1_0093_F01.b :
SKNB1_0022_C01.b :
HTMT1_0119_C05.b :
ILNT1_0078_B02.b : n
BMWN1_0057_E12.b : nnnnncgagagt
BMWN1_0019_F11.b :
PST01_0006_G11.b :
HTMT1_0027_D02.b :
ITT01_0080_G04.b :
HTMT1_0141_F09.b : tttt
CLNT1_0032_D02.b : gggtccgtc
OVRT1_0128_D09.b : nnnncctata
LNG01_0002_H11.b : ggggcttttggtgccxxxxxxxxxxxx
CBLT1_0028_D04.b : t
ILNT1_0007_D09.b :
SKNB1_0085_E12.b :
OVR01_0045_B12.b : taaagcxxxxxxxxxxxxxxxxxxxx
HTMT1_0076_D12.b : tt
CBLT1_0006_G02.b : ttt
SKNB1_0086_H04.b :
KDN01_0041_A06.b :
ILNT1_0054_E06.b :
PST01_0014_C07.b :
SKNB1_0058_E10.b :
PST01_0013_A03.b :
OVRT1_0037_D10.b : nncctcctttag
KDN01_0036_G12.b :
CBLT1_0060_E09.b : t
CBLT1_0063_A05.b :
KDN01_0065_A06.b :
ITT01_0069_F08.b :
OVRM1_0175_H02.b :
OVR01_0086_D02.b : tttgcattggactaagac
AMP01_0006_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0012_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0043_D06.b :
ADR01_0015_D01.b :
AMP01_0093_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0009_D04.b :
OVRM1_0188_B09.b :
DCI01_0057_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0089_D07.b :
DCI01_0031_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0060_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0059_D10.b :
OVRM1_0018_B05.b :
OVRM1_0098_H12.b :
OVRM1_0002_B05.b :
DCI01_0035_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_C12.b :
AMP01_0097_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0028_E12.b : ttttgggtggxxxxxxxxxxxx
AMP01_0065_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0037_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0035_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0030_F05.b : nnnngggctggxxxxxxxxxxxxxx
DCI01_0044_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0044_C06.b : xxxxxxxxxxxxxxxxx
LNG01_0094_B11.b : ttttnaagttggcct
AMP01_0016_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0060_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0074_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0088_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0032_H01.b : aagagctttcgtgxxxxxxxxxxxx
AMP01_0055_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0096_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0103_H09.b : ntttgcttggacta
AMP01_0027_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0023_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0011_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0026_E03.b : n
OVRT1_0007_E07.b : nnnncctctctg
AMP01_0017_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0052_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0037_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0077_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0007_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0015_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0056_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0080_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0122_H09.b : nnnaaacgtta
AMP01_0084_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0041_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0050_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0054_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0113_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0004_B09.b : aaaatatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0007_A09.b : nnnnncctcta
LNG01_0085_F11.b : nnntttagctggacttgac
LVRM1_0026_C10.b :
LVRM1_0131_E06.b :
OVRM1_0166_A06.b :
OVRM1_0173_C01.b :
SMG01_0041_F07.b : nttaaca
SMG01_0066_C09.b : nnnnnnnnnnnnnn
OVRM1_0076_C10.b : cxx
OVRM1_0120_D05.b :
PTG01_0052_A12.b : nggactaag
LVRM1_0072_A03.b :
OVRM1_0102_E04.b :
LVRM1_0058_D02.b :
LVRM1_0109_F09.b :
OVRM1_0068_F09.b :
OVRM1_0159_D04.b : t
OVRM1_0102_G06.b :
LVRM1_0163_C05.b :
OVRM1_0115_D04.b : t
SMG01_0096_G06.b : nnnnnnnn
OVRM1_0026_E11.b :
LVRM1_0150_G04.b :
LVRM1_0042_A04.b :
OVRM1_0129_G05.b :
OVRM1_0176_F09.b :
OVRM1_0121_G09.b :
OVRM1_0066_G09.b :
OVRM1_0068_C06.b :
SMG01_0057_B11.b : gcct
LVRM1_0174_E02.b :
OVRM1_0130_D04.b :
OVR01_0104_B05.b : tttgcttgtactatgac
OVRM1_0149_C06.b :
OVRM1_0152_H02.b : t
OVRM1_0049_C09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0207_G03.b :
OVRM1_0066_C12.b : taatcttttntctnttatatctttccctcctattcattcccttccccttactttttttga
OVR01_0083_D08.b : nnnggctaggactatacac
OVRT1_0036_H12.b : nntttccttgcggcagggaagttttttnnnnnaagttttnnnnnnccc
OVRM1_0110_A09.b :
OVR01_0073_A09.b : ctagcatttagtgxxxxxxxxxxx
LVRM1_0083_A04.b :
OVRM1_0195_C04.b :
OVRM1_0061_H06.b :
LVRM1_0039_C03.b :
OVRM1_0164_F10.b :
LVRM1_0005_A06.b : cxx
OVR01_0075_B05.b : tagcxxxxxxxxxxxxxxxxxxx
OVR01_0081_G11.b : agcatttxxxxxxxxxxxxxxxx
OVRM1_0134_G10.b :
OVRM1_0081_G05.b :
OVRM1_0147_E06.b :
LVRM1_0040_D04.b :
OVRM1_0046_A02.b : atx
LVRM1_0179_D05.b :
OVRT1_0029_B08.b : ncccccttc
LVRM1_0145_C05.b :
LVRM1_0172_G08.b :
LVRM1_0165_D03.b :
LVRM1_0095_D01.b :
OVRM1_0218_G06.b :
LVRM1_0040_E07.b :
LVRM1_0130_D05.b : tx
LVRM1_0170_B09.b :
OVRM1_0089_H03.b :
LVRM1_0095_A05.b :
LVRM1_0106_E10.b :
OVR01_0081_H04.b : gcaxxxxxxxxxxxxxxxxxx
OVR01_0061_H01.b : nccttgcttgtactaanac
LVRM1_0033_A07.b :
LVRM1_0092_F10.b :
OVRM1_0191_A03.b :
LNG01_0046_G10.b : tctttttgttacggcatagtgxxxxxxxxxxx
LVRM1_0151_F08.b :
OVRM1_0044_F08.b :
OVRM1_0133_H08.b :
LVRM1_0047_C08.b :
LVRM1_0082_D09.b :
LVRM1_0201_B12.b :
OVRM1_0130_G11.b :
OVRM1_0093_A01.b :
OVRM1_0020_F02.b : xxx
LVRM1_0030_F01.b :
OVRM1_0128_B08.b :
LVRM1_0088_H09.b :
OVRM1_0004_B05.b :
LVRM1_0021_A03.b :
LVRM1_0099_D10.b :
OVRM1_0131_E10.b :
LVRM1_0153_C01.b :
OVRM1_0207_B08.b :
LNG01_0036_E09.b : atttagggtaxxxxxxxxx
LVRM1_0148_D08.b :
LVRM1_0117_C12.b :
LVR01_0089_B12.b : gacxxxxxxxxxxxxxxxxxxxx
OVRM1_0152_H11.b :
OVRM1_0205_F05.b :
OVRM1_0043_B01.b :
OVRM1_0062_H07.b :
OVRM1_0127_B02.b :
OVRM1_0038_C06.b :
OVRM1_0005_B02.b :
OVRM1_0202_F06.b :
LVRM1_0144_E01.b :
OVRM1_0223_F09.b :
LVRM1_0140_B03.b :
OVRM1_0039_F01.b :
OVRM1_0224_G06.b :
OVRM1_0096_C10.b : c
OVRM1_0113_E06.b :
OVRM1_0077_G03.b :
LVRM1_0139_H05.b :
LVR01_0088_G07.b : txxxxxxxxxxxxxxxxxxxxxx
OVRM1_0025_G12.b : c
OVRM1_0107_G12.b :
OVRM1_0113_H07.b :
LVRM1_0150_H09.b :
OVRM1_0079_C07.b :
SMG01_0013_H05.b : nncca
OVRM1_0114_B07.b :
OVRM1_0091_G06.b :
OVRM1_0105_A12.b :
OVRM1_0083_H11.b :
UTR01_0012_A11.b : tgggggggaacctataxxxxxxxxx
OVRT1_0129_G02.b : nnggcatatnnnnnnnnccgtta
LNG01_0107_G02.b : tagggggctgtgctaaac
LNG01_0073_C08.b : nnnnggctggacttgac
PBL01_0026_D02.b :
OVR01_0068_F11.b : nggcttggactatnacxx
SMG01_0067_G01.b :
SMG01_0087_F03.b : ngcca
OVRT1_0089_B05.b : ncctctt
OVRT1_0017_E10.b : nnnccttc
THY01_0068_F05.b : ctttttagtggxxxxxxxxxxxxx
PTG01_0019_D06.b : nnn
SPL01_0043_F10.b : nttttgctaggacttanac
UTR01_0059_F09.b : cxxxxxxxxxxxxxxxxxxxxx
SMG01_0077_H11.b :
OVR01_0048_B07.b : aagatxxxxxxxxxxxxxxxxxxxx
OVR01_0050_G03.b : nnnttgctagtgacttnac
LNG01_0091_H09.b : nnggtttgctggac
OVRT1_0149_A11.b : nnnnccgttcag
THY01_0048_B03.b : txxxxxxxxxxxxxxxxxxxx
LNG01_0110_G10.b : nttcttgtaaaaaagttttaaaaannnggggccatggacaagac
LVR01_0086_H11.b : gggcxxxxxxxxxxxxxxxxxxxx
UTR01_0045_B03.b : gggttaacxxxxxxxxxxxx
OVR01_0056_C10.b : ntttgctaggactatnacx
SMG01_0037_G10.b : nccgct
OVRT1_0150_B03.b : nctttcttcctcnnaannnnccgttttg
UTR01_0015_E11.b : gggggaacxxxxxxxxxxxx
OVRT1_0103_A04.b : ttccnccgtt
UTR01_0019_H08.b : ggttgcactaatagxxxxx
OVR01_0049_F08.b : nntttgctaggacttanac
OVR01_0070_B05.b : nnnnggctagtgacttgacxx
UTR01_0020_A02.b : txxxxxxxxxxxxxxxxxxxxxx
ITT01_0085_D08.b :
OVRT1_0139_F08.b : nnnccctaatnnnnnnnnccccttt
UTR01_0039_C03.b : tttttgagccctattagxxxxx
SMG01_0053_F07.b : ga
LNG01_0032_E03.b : ttttttttttttggcattggacntatagacx
THY01_0045_A08.b : gggxxxxxxxxxxxxxxxxx
OVRT1_0148_D06.b : nnnnnccgtta
OVRT1_0105_F01.b : nnnccgtca
LVR01_0051_G10.b : tggggggtttttnctcgctagtgxxxxxxxxxxxx
LVR01_0020_G10.b : cttatggtgxxxxxxxxxxxxx
OVRT1_0113_G01.b : nnttcccgtc
SMG01_0069_F01.b : ncgc
UTR01_0004_C03.b : ggggtgccxxxxxxxxxxx
LVR01_0082_H11.b : ggcatttagggtgxxxxxxxxxxxx
LNG01_0021_E09.b : ccxxxxxxxxxxxxxxxxxxxxx
OVRT1_0039_G12.b : nnnncccctttnnnnnnnnccgtta
OVRT1_0057_A10.b : nccgtttnnnnncctcctata
OVR01_0078_B10.b : nnnaagataggacttanac
OVR01_0014_A06.b : gggatxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_E04.b : ggcxxxxxxxxxxxxxxxxxxxx
LNG01_0019_G12.b : actggctttggtgxxxxxxxxxxxxx
UTR01_0033_G06.b : ctttatxxxxxxxxxxxxxxxxx
OVR01_0028_H09.b : ggggcxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_H11.b : ggcttttgtxxxxxxxxxxxxxxxx
OVR01_0056_B06.b : nnttggctaggactatnac
LVR01_0059_B02.b : tttataagcattggtgxxxxxxxxxxx
OVRT1_0133_B11.b : nncccatttnnnnnnnncccgtta
OVRT1_0125_H10.b : nnccgttc
ITT01_0095_B09.b :
PTG01_0082_F03.b :
LVR01_0078_G01.b : ttcttttttagcttggtgxxxxxxxxxxxx
ADR01_0030_E09.b :
SMG01_0076_C03.b :
OVRT1_0037_D06.b : nnnnnccgtca
PBL01_0058_H06.b :
SPL01_0058_C11.b : nnnggcttggactataacxx
KDN01_0024_E03.b :
OVRT1_0005_A07.b : nnntttcgttag
OVRT1_0027_E02.b : nnnnncctata
OVRT1_0002_F10.b : naacccctctca
SMG01_0067_G07.b : nccc
CLNT1_0009_A08.b : aaatggttc
OVRT1_0031_A12.b : ggttccgtc
BFLT1_0068_G01.b : nggcttttnnggactccgtt
TCH01_0009_E04.b : nnnngggctgtactaanacx
OVRT1_0025_D02.b : nnnnncctata
OVRT1_0060_D06.b : ncgtttttnnnggggaccctata
OVRT1_0056_F08.b : nccctttnnnnnnnccccgtta
ITT01_0012_E01.b :
ITT01_0051_B11.b :
LVR01_0081_B11.b : ggcxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0021_A08.b : ncccccttnnngggaccccgtta
OVRT1_0019_F08.b : nnncctcgttcn
OVRT1_0037_F12.b : ncccctnnnnngggggccgtta
SPL01_0030_B01.b : nnntttgcttggtacttnac
OVRT1_0031_D04.b : nnccccctta
TCH01_0009_A08.b : nnnngggtagtactaanac
UTR01_0050_A06.b : cttxxxxxxxxxxxxxxxxxxxxxx
LNG01_0020_H01.b : tttccagcattagtgxxxxxx
MLN01_0026_A05.b : nnngctaggacttgacx
OVRT1_0037_C04.b : nnnnccgtc
OVR01_0040_C09.b : gggcxxxxxxxxxxxxxxxxxxxxx
THY01_0035_A10.b : gggxxxxxxxxxxxxxxx
ITT01_0026_E11.b :
LVR01_0011_G05.b : gggggaggcattagtgxxxxxxxxxxxx
BFLT1_0086_A09.b : ggatccctcta
TCH01_0034_B01.b : nggggggttgtgacttaac
UTR01_0050_B06.b : cxxxxxxxxxxxxxxxxxxxxxx
UTR01_0103_G08.b : nggcttggactataacx
LNG01_0034_G08.b : ggaantctntaagcattggxxxxxxxxxxxx
LNG01_0035_F10.b : gctxxxxxxxxxxxxxxxxxxxx
TCH01_0077_A07.b : nttggggtagtactat
OVRT1_0057_B01.b : nnttccgtta
LVR01_0096_C03.b : gtgttttttctagcatagtgxxxxxxxxxxxx
LVR01_0099_E07.b : aagacttagtgxxxxxxxxxxxxx
OVR01_0091_F06.b : nnnnggctaggactatnac
LVR01_0059_H04.b : tgactttgcattggtgxxxxxxxxxxxx
SPL01_0090_G01.b : nntttgctagtgacttnacx
UTR01_0083_F08.b : nnnggcttggactatnac
TCH01_0028_F09.b : nttccgctaggactatgac
LNG01_0074_E01.b : nnnngggatgtacttga
CLNT1_0031_G07.b : nnnnccgtc
UTR01_0058_E02.b : cgcattatgxxxxxxxxxxxxxxxxx
ITT01_0052_D05.b :
MLN01_0093_H01.b : nnnnggctagtactaagac
TCH01_0023_C06.b : nnnggctaggac
LVR01_0084_F02.b : gggcaxxxxxxxxxxxxxxxxxxx
OVR01_0072_A08.b : nnnccgctagtgacttnac
OVRT1_0071_C03.b : nnnccccgttt
OVR01_0093_G08.b : nnnnagctaggacttagac
OVRT1_0016_D06.b : nncccccgttc
UTR01_0054_A12.b : ttttaggcaxxxxxxxxxxxxxxxxxx
UTR01_0061_C05.b : gcxxxxxxxxxxxxxxxxxxxxxx
ITT01_0081_A04.b :
OVR01_0039_A05.b : taggacxxxxxxxxxxxxxxxxxxxx
OVRT1_0036_H10.b : nnnccgtttnnnnggnnnccctca
PBL01_0088_E04.b :
UTR01_0081_B07.b : nnnnggctagtgacttnacxx
OVRT1_0043_F07.b : nnccttcgtta
ITT01_0083_A03.b :
ITT01_0054_E01.b :
THY01_0125_G10.b :
OVRM1_0133_C05.b :
OVR01_0086_C02.b : nggcttgtgacttgac
OVRM1_0160_B01.b :
OVRM1_0137_D11.b :
LVRM1_0092_H02.b :
OVRM1_0225_D02.b :
OVRT1_0104_C02.b : tttttnccgtcag
OVR01_0017_D06.b : gggggggaactattagxx
LVRM1_0131_G08.b :
OVRM1_0048_A10.b :
OVRM1_0117_F07.b :
OVRM1_0108_B09.b :
OVRM1_0197_B03.b :
LVRM1_0036_F09.b :
OVRM1_0204_F05.b :
OVRM1_0004_C09.b :
SPL01_0011_H01.b : ctxxxxxxxxxxxxxxxxxx
LVRM1_0036_G11.b :
PST01_0052_F10.b :
SPL01_0029_C04.b : nggggccatggac
LVRM1_0161_F02.b :
TES01_0081_A11.b :
SMG01_0097_E11.b : nnnn
ADR01_0047_H12.b :
BFLT1_0126_E08.b : ncccttca
ITT01_0095_G04.b :
HTMT1_0081_D04.b :
TCH01_0037_E07.b : nnnnnggctagg
PTG01_0055_B01.b : nnnnnnnn
KDN01_0046_C01.b :
KDN01_0058_C11.b :
KDN01_0041_D09.b :
PST01_0073_D07.b :
PST01_0015_F06.b :
KDN01_0059_H03.b :
SMG01_0040_B06.b : ntttaataaaatnttnnnncgct
OVRM1_0198_F02.b :
BKFL1_0032_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0046_F12.b : tgg
PTG01_0103_G08.b : nnnnnnnnnnnnnn
SMG01_0045_E03.b :
KDN01_0046_F11.b :
KDN01_0052_H12.b :
OVRM1_0017_C02.b :
PCT01_0004_G02.b :
BKFL1_0079_H02.b :
MLTL1_0075_G06.b : nnnccctaaatc
AMP01_0011_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0034_F02.b :
PTG01_0097_D04.b :
ADR01_0014_C10.b :
OVRM1_0066_A11.b :
OVRM1_0030_A02.b :
PTG01_0042_D03.b :
BKFL1_0009_E12.b :
PTG01_0032_C04.b :
20110601C-001761 : ...................CAGCTGGTACGGTCCGGAATCCTCAGCACTGTGGCCTACTG
---------+---------+---------+---------+---------+---------+ 41
THY01_0115_C10.b : gttgtcaaaagCAGCTGGTACGGTCCGGAATCCTCAGCACGTTGGCCTA*TG
THY01_0118_F10.b : gttgcaaaaaCAGCTGGTACGGTCCGGAATCCTCAGCACTGTGGCCTACTG
LVRM1_0144_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCCTACTG
OVR01_0018_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtTGGCCTACTG
LVRM1_0169_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTG
OVRM1_0096_A07.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTG
OVR01_0027_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTG
THY01_0103_F06.b : gttgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTG
THY01_0105_C01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTG
LVRM1_0028_H03.b : acgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTG
OVRM1_0071_H01.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTG
LVRM1_0001_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTG
LVR01_0005_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTG
LNG01_0013_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTG
PST01_0089_H08.b : nnnttactgcgttggcaTG
PST01_0075_G09.b : nnnnncctgctgtggctaTG
SKNB1_0078_G12.b : ntttttctcgctgtggctaTG
LVRM1_0081_C01.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
OVRM1_0147_E07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
LVRM1_0107_D02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
LVR01_0036_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctcgttctactG
OVR01_0042_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
OVRM1_0005_E05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
TES01_0022_D07.b : ttttcgcggtggctcT
SKNB1_0009_C02.b : nnncccctgactgtggccT
PST01_0018_C05.b : T
TES01_0029_F05.b : ntcgcgttggctcT
PST01_0062_E07.b : tcgcgttggctcT
SKNB1_0095_G05.b : ncccctacagttgcctcT
KDN01_0052_B02.b : ctaT
KDN01_0032_D01.b : tttttttccctgctgtggctaT
KDN01_0057_A08.b : ttttcctggcgtggctaT
PST01_0066_D01.b : naatcgcggtggctcT
PST01_0019_F12.b : aaaaattnnactgcgttggctcT
PST01_0076_A09.b : nnnnnggctgcggttgctcT
TES01_0046_E03.b : ncttgcgttggctcT
KDN01_0072_E03.b : nnnncctgcggtggctcT
KDN01_0059_A06.b : nnnnncctgcggtggctaT
KDN01_0086_E05.b : nnnnnggctgctgttgctcT
PST01_0072_G06.b : nnnnnggctacggtggctaT
PST01_0028_H02.b : tatnntacctgcgttggctcT
KDN01_0043_D07.b : ttttccctgcgttggctaT
PST01_0012_B09.b : atttantnnactgcggtggctcT
KDN01_0069_B03.b : nttctgctgtggctcT
KDN01_0007_G03.b : nnccctttnnnnnnnactgcgttgtgctcG
KDN01_0063_E08.b : nnnnncctgcggtggctcT
PST01_0089_C07.b : nnnnncctgcggtggctaT
TES01_0021_A08.b : nnncctgctgtggctcT
SKNB1_0074_B10.b : nnnccttagctgtggctaT
PST01_0035_D09.b : nctggcggtggctcT
KDN01_0061_C02.b : ttgcgttggctcT
PST01_0087_H06.b : nnnnncctgacgtggctaT
PST01_0014_F06.b : catattannnncctgcgttggctcT
PST01_0014_A01.b : atanntttactgctgtggctcT
TES01_0066_H01.b : atttcctgaggtggctaT
PST01_0080_A09.b : nnncctgctgttgctcT
KDN01_0026_C06.b : nttggctgtggctcT
KDN01_0052_D12.b : tagctgtggctaT
KDN01_0080_F03.b : nnnncctgaggtggctcT
PST01_0096_G02.b : nnnnncctgctgtggctaT
PST01_0063_G08.b : nncctgcggtggctcT
TCH01_0080_D07.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcT
KDN01_0078_E01.b : ttttacttgcggtggctcT
PST01_0084_D08.b : nnncctgctgtggctcT
KDN01_0064_D03.b : nnnnncctgctgtggctcT
PST01_0071_B03.b : nnnncctgcggtggctaT
KDN01_0062_E03.b : nnnncctgctgtggctaT
PST01_0098_E01.b : ttttactgcggtggctcT
PST01_0057_A10.b : ttttttgctgcgttggctcT
PST01_0056_D06.b : nnctggctgtggctaT
KDN01_0042_G11.b : ntttttttcctgcgttggctaT
KDN01_0060_H02.b : nnnnaactgctgtggctaT
KDN01_0095_A03.b : nnnnggctgctgtggctaT
PST01_0007_C01.b : nnnggctaannnnnnnncctacgttggctaT
KDN01_0054_B12.b : tcgcgttggctcT
PST01_0046_C06.b : nnnncctcgcgttggcacT
KDN01_0077_D04.b : nnnggttgcggtggctcT
PST01_0085_B09.b : nnnncctgcgttggctcT
KDN01_0066_B03.b : nnnnncctgcgttggctaT
KDN01_0049_C11.b : tggctaT
KDN01_0058_H01.b : nttttcctgcgttggctaT
BFLT1_0145_G02.b : gcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcttt
OVRM1_0151_D08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0152_E09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0002_G08.b : ttttggccacagtggccac
OVRM1_0075_C07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0105_D08.b : cattgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxt
OVRM1_0132_H06.b : gtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxc
SKNB1_0003_A12.b : nnnncccacagtggctac
OVRM1_0095_A12.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0020_E03.b : acgttggctctg
CBLT1_0067_A01.b : tttttacgacagtagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0093_F01.b : tttttagcacggagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0022_C01.b : nggcgannnnnnnccctgcgtttgctac
HTMT1_0119_C05.b : nnnnggatggtacgcggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0078_B02.b : nnccgacgttacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0057_E12.b : agacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0019_F11.b : tttggcaggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0006_G11.b : nnccctttttnnnnnncctgcgttgtgctc
HTMT1_0027_D02.b : ttttccgacgtaacacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0080_G04.b : nnnngatcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxg
HTMT1_0141_F09.b : tacgacggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0032_D02.b : tgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcg
OVRT1_0128_D09.b : gctgtcgnatgttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcg
LNG01_0002_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxa
CBLT1_0028_D04.b : ttttccaggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0007_D09.b : nnnnnggcaggtagaggccgtagtattaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0085_E12.b : ntttccggctgtggcta
OVR01_0045_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0076_D12.b : ttttggacggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0006_G02.b : tnggcaggtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0086_H04.b : nncccgaannnnnttcctgcgttggctac
KDN01_0041_A06.b : cccaannnnnnnncctgcgttgtgctc
ILNT1_0054_E06.b : nnccgacggtacacgccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0014_C07.b : catttannnnnactgcgttggctac
SKNB1_0058_E10.b : nnnaacattnnnntnncctgcgctggctn
PST01_0013_A03.b : tttgttnnncctgctgtggcta
OVRT1_0037_D10.b : cgcacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0036_G12.b : nnnttgggcctgcgttggctct
CBLT1_0060_E09.b : ttttggcaagtagaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0063_A05.b : nattcccgcaggtagacgccgtagtatttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0065_A06.b : nttttggctgaggtggctc
ITT01_0069_F08.b : nnnaatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxt
OVRM1_0175_H02.b : nagttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0086_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0006_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0012_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0043_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0015_D01.b : aatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0093_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0009_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0188_B09.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0057_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0089_D07.b : ccttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0031_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0060_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0059_D10.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0018_B05.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0098_H12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0002_B05.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0035_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_C12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0097_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0028_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0065_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0037_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0035_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0030_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgg
DCI01_0044_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0044_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0094_B11.b : tgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0016_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0060_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0074_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0088_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0032_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0055_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0096_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0103_H09.b : tgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0027_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0023_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0068_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0011_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0026_E03.b : nnggcaagtagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgagg
OVRT1_0007_E07.b : cgtangxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0017_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0052_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0037_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0077_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0007_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0015_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0056_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0080_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0122_H09.b : gctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0084_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0041_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0050_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0054_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0113_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0004_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0007_A09.b : gctgacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0085_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0026_C10.b : acgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0131_E06.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0166_A06.b : taattgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0173_C01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0041_F07.b : aagtgttanggactaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0066_C09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxx
OVRM1_0076_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0120_D05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0052_A12.b : cagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_A03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0102_E04.b : gagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0058_D02.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0109_F09.b : caattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0068_F09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0159_D04.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0102_G06.b : tagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0163_C05.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0115_D04.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0096_G06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxx
OVRM1_0026_E11.b : tttgacaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0150_G04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0042_A04.b : tttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0129_G05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0176_F09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0121_G09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0066_G09.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0068_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0057_B11.b : attaaaatggactaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0174_E02.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0130_D04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0104_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0149_C06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0152_H02.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0049_C09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
OVRM1_0207_G03.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0066_C12.b : acgatttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0083_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0036_H12.b : ttcgcgnacgnangtacttcgctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0110_A09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0073_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0083_A04.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0195_C04.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0061_H06.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_C03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0164_F10.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0005_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0075_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0081_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0134_G10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0081_G05.b : cgctgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0147_E06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_D04.b : tcgttgtcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0046_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0179_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0029_B08.b : tgcgtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_C05.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0172_G08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0165_D03.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0095_D01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0218_G06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_E07.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0130_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0170_B09.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0089_H03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0095_A05.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_E10.b : tcctgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0081_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0061_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_A07.b : gcgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0092_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0191_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0046_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0151_F08.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0044_F08.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0133_H08.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_C08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0082_D09.b : aattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0201_B12.b : gggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0130_G11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0093_A01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0020_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0030_F01.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0128_B08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0088_H09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0004_B05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_A03.b : cgtttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0099_D10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0131_E10.b : ncagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0153_C01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0207_B08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0036_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0148_D08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0117_C12.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0152_H11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0205_F05.b : gcagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0043_B01.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0062_H07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0127_B02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0038_C06.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0005_B02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0202_F06.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_E01.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0223_F09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0140_B03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0039_F01.b : ttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0224_G06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0096_C10.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0113_E06.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0077_G03.b : ccgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0139_H05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0025_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0107_G12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0113_H07.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0150_H09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0079_C07.b : cgttgacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0013_H05.b : ttatnnnnntgagtaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0114_B07.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0091_G06.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0105_A12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0083_H11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0012_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0129_G02.b : gcgttacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0107_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0073_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0026_D02.b : ngatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0068_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0067_G01.b : tttttttgactaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0087_F03.b : atttnnnnggataaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0089_B05.b : gctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0017_E10.b : agctgtacgatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0068_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0019_D06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxx
SPL01_0043_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0059_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0077_H11.b : tttttaagactaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0048_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0050_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0091_H09.b : ttgacagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0149_A11.b : ctgtangagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0048_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0110_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0045_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0056_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0037_G10.b : aaaannnnngggtcaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0150_B03.b : cgnaggagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0015_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0103_A04.b : agctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0019_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0049_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0070_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0020_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0085_D08.b : nnnngatcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0139_F08.b : gcgttcgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0039_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0053_F07.b : cctattnnnnggactaagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0032_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0045_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0148_D06.b : gcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0105_F01.b : gcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0020_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0113_G01.b : agcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0069_F01.b : actttattttgatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0004_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0021_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0039_G12.b : gcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0057_A10.b : gcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0078_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0014_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0019_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0033_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0028_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0056_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0059_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0133_B11.b : gcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0125_H10.b : gcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0095_B09.b : nnnaatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0082_F03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxx
LVR01_0078_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0030_E09.b : nnnaattgatgacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0076_C03.b : ttatttggactaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0037_D06.b : gcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0058_H06.b : ttagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0058_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0024_E03.b : cttttnnnnnncccgcgttggctcggg
OVRT1_0005_A07.b : ctgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0027_E02.b : gctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0002_F10.b : gcgtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0067_G07.b : ataatannnggactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0009_A08.b : agcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0031_A12.b : agcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0068_G01.b : cagcgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0009_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0025_D02.b : gctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0060_D06.b : gcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0056_F08.b : gcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0012_E01.b : ntttgagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0051_B11.b : nnnggtgcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0021_A08.b : gcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0019_F08.b : gcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0037_F12.b : gcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0030_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0031_D04.b : gctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0009_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0050_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0020_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0026_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0037_C04.b : agcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0040_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0035_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0026_E11.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0086_A09.b : gcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0034_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0050_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0103_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0034_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0035_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0077_A07.b : nacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0057_B01.b : gctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0091_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0059_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0090_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0083_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0028_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0074_E01.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0031_G07.b : tgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0058_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0052_D05.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0093_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0023_C06.b : ttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0072_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0071_C03.b : agcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0093_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0016_D06.b : agcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0054_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0061_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0081_A04.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0039_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0036_H10.b : gcgttacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0088_E04.b : nnggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0081_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0043_F07.b : gcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0083_A03.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0054_E01.b : nttgatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0125_G10.b : gttgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0133_C05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0086_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0160_B01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0137_D11.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0092_H02.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0225_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0104_C02.b : ctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0017_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0131_G08.b : tcgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0048_A10.b : nagctgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0117_F07.b : gcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0108_B09.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0197_B03.b : gagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0036_F09.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0204_F05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0004_C09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0011_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0036_G11.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0052_F10.b : acgcgttggctat
SPL01_0029_C04.b : ttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0161_F02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0081_A11.b : ncctgcggtggctct
SMG01_0097_E11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ADR01_0047_H12.b : ntttttagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0126_E08.b : gctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcc
ITT01_0095_G04.b : nnggtgatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0081_D04.b : naaaggacgagtagaggccgtagtatttatxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0037_E07.b : acttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0055_B01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
KDN01_0046_C01.b : atcgcagacgattgcct
KDN01_0058_C11.b : ttncctgcggtggct
KDN01_0041_D09.b : ngcaaggtannnnncctgcggtggc
PST01_0073_D07.b : nnncctgcgttggct
PST01_0015_F06.b : tgtttttnnncctgcgttggct
KDN01_0059_H03.b : ttttactgcggt
SMG01_0040_B06.b : atcattttggactaagcagcggnaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0198_F02.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0032_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0046_F12.b : ggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0103_G08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0045_E03.b : tatttattnagctaaagcagcggtaxxxxxxxx
KDN01_0046_F11.b :
KDN01_0052_H12.b :
OVRM1_0017_C02.b :
PCT01_0004_G02.b :
BKFL1_0079_H02.b : nnncccgaatcaaattncgatacataxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0075_G06.b : aagggnnannnnncccacctcaaaannacgaaaccataxxxxxxxxxxxxxxxxxxxxxx
AMP01_0011_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0034_F02.b :
PTG01_0097_D04.b :
ADR01_0014_C10.b :
OVRM1_0066_A11.b :
OVRM1_0030_A02.b :
PTG01_0042_D03.b :
BKFL1_0009_E12.b :
PTG01_0032_C04.b :
20110601C-001761 : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
---------+---------+---------+---------+---------+---------+ 96
THY01_0115_C10.b : GAGTT*CGTGGAG*GCCGGGAGT*T*GCCTGCG*TT*CTTCTG*TGACCGCTG*TTGCCA
THY01_0118_F10.b : GAGTT*CGTGGAG*GCCGGGAGT*T*GCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0144_B11.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0018_H07.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0169_C01.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0096_A07.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0027_E05.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
THY01_0103_F06.b : GAGTT*CGTGGAG*GCCGGGAGT*T*GCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
THY01_0105_C01.b : GAGTT*CGTGGAG*GCCGGGAGT*T*GCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0028_H03.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0071_H01.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0001_C11.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVR01_0005_C07.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LNG01_0013_D04.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0089_H08.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0075_G09.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SKNB1_0078_G12.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0081_C01.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0147_E07.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0107_D02.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVR01_0036_A03.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0042_B06.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0005_E05.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
TES01_0022_D07.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SKNB1_0009_C02.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*CTGTCA
PST01_0018_C05.b : GGATTTCGTGGAG**CCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*CTGCCA
TES01_0029_F05.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0062_E07.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SKNB1_0095_G05.b : GGAGTTTGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0052_B02.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTC*TTTTCA
KDN01_0032_D01.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0057_A08.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0066_D01.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTC*TTGCCA
PST01_0019_F12.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0076_A09.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
TES01_0046_E03.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0072_E03.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0059_A06.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0086_E05.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0072_G06.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0028_H02.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0043_D07.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0012_B09.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0069_B03.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0007_G03.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0063_E08.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCT
PST01_0089_C07.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
TES01_0021_A08.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SKNB1_0074_B10.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0035_D09.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*CTGCCA
KDN01_0061_C02.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0087_H06.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0014_F06.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0014_A01.b : GGAGTTCGTGGAG*GCCGGGAGT*TCGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
TES01_0066_H01.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0080_A09.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0026_C06.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTGCTTGCCA
KDN01_0052_D12.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTC*TTTCCA
KDN01_0080_F03.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0096_G02.b : GGAGTTCGTGGAG*GCCGAGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGACC*ATCAAA
PST01_0063_G08.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
TCH01_0080_D07.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0078_E01.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0084_D08.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0064_D03.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0071_B03.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0062_E03.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0098_E01.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*CTGCCA
PST01_0057_A10.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0056_D06.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0042_G11.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0060_H02.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0095_A03.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0007_C01.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0054_B12.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0046_C06.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0077_D04.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0085_B09.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0066_B03.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0049_C11.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTGCCTGTCA
KDN01_0058_H01.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
BFLT1_0145_G02.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0151_D08.b : TAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0152_E09.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCACTG*TTGCCA
SKNB1_0002_G08.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCCG*TTGCCA
OVRM1_0075_C07.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0105_D08.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0132_H06.b : TAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SKNB1_0003_A12.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0095_A12.b : TAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0020_E03.b : GAGTTTCGTGGAG*GCCGGGTAG*TTGCCTGCG*TTTCTTCTG*TGACCCCTG*TTGCCA
CBLT1_0067_A01.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
BMWN1_0093_F01.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SKNB1_0022_C01.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*CTGTCA
HTMT1_0119_C05.b : GAGTTTCGCGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
ILNT1_0078_B02.b : GAGTTTCCTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
BMWN1_0057_E12.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
BMWN1_0019_F11.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0006_G11.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
HTMT1_0027_D02.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
ITT01_0080_G04.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
HTMT1_0141_F09.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
CLNT1_0032_D02.b : TAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0128_D09.b : TAGTTTCGTGGAG*GCCGGGAGT*CTGCCTGCG*TTTCTTCTGCTGACCGCTG*TTGCCA
LNG01_0002_H11.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
CBLT1_0028_D04.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
ILNT1_0007_D09.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SKNB1_0085_E12.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0045_B12.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
HTMT1_0076_D12.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
CBLT1_0006_G02.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SKNB1_0086_H04.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0041_A06.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
ILNT1_0054_E06.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0014_C07.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SKNB1_0058_E10.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0013_A03.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0037_D10.b : TAGTTTCGTGGAG*GCCGGGGGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0036_G12.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
CBLT1_0060_E09.b : GAGTTTCGTGGAC*GCTGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
CBLT1_0063_A05.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0065_A06.b : GGAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
ITT01_0069_F08.b : GAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0175_H02.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0086_D02.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0006_D03.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0012_F04.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0043_D06.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
ADR01_0015_D01.b : xAGTTTCGTGGAG*GCCCCGATT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0093_A02.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0009_D04.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0188_B09.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
DCI01_0057_B12.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0089_D07.b : xGTTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
DCI01_0031_A05.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0060_D09.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0059_D10.b : xAGTTTCCTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0018_B05.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0098_H12.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0002_B05.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
DCI01_0035_F11.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0031_C12.b : xGTTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0097_C02.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
UTR01_0028_E12.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0065_A08.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
DCI01_0037_F10.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
DCI01_0035_E08.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SPL01_0030_F05.b : cAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
DCI01_0044_H01.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0069_G07.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
UTR01_0044_C06.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LNG01_0094_B11.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0016_F04.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0060_B08.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0074_A08.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0088_G09.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0032_H01.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0055_H06.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0096_B09.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
UTR01_0103_H09.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0027_G05.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0068_E02.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0023_D03.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0068_D11.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
DCI01_0011_H03.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
CBLT1_0026_E03.b : cAGTTTCGTGGAGTGCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0007_E07.b : xGTTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0017_H12.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0052_H06.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0037_D08.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0034_D04.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0077_D02.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCCGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
DCI01_0007_E04.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0015_H08.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0056_A10.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0080_E01.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0122_H09.b : cAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0084_A02.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
DCI01_0041_G10.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0050_G06.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
AMP01_0054_B12.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
DCI01_0113_E01.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0004_B09.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0007_A09.b : xGTTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LNG01_0085_F11.b : xAGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0026_C10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0131_E06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0166_A06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0173_C01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SMG01_0041_F07.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SMG01_0066_C09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0076_C10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0120_D05.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PTG01_0052_A12.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0072_A03.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0102_E04.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0058_D02.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0109_F09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0068_F09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0159_D04.b : xxGTTTCGTGGAG*GCCGGGAGT*TTCCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0102_G06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0163_C05.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0115_D04.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SMG01_0096_G06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0026_E11.b : xxGTTTCGTGGAG*GCCGGGAGT**TGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0150_G04.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0042_A04.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0129_G05.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0176_F09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0121_G09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0066_G09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0068_C06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SMG01_0057_B11.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0174_E02.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0130_D04.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0104_B05.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0149_C06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0152_H02.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0049_C09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0207_G03.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0066_C12.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0083_D08.b : xxGTTTCCTGGAG*GCCGGGAGT*TTGCCTGCC*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0036_H12.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0110_A09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0073_A09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0083_A04.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TCGCCA
OVRM1_0195_C04.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0061_H06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0039_C03.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0164_F10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0005_A06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0075_B05.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0081_G11.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0134_G10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0081_G05.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0147_E06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0040_D04.b : ttGTTTCGTGGAG*GACGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0046_A02.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0179_D05.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0029_B08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0145_C05.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0172_G08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0165_D03.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0095_D01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0218_G06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0040_E07.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0130_D05.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0170_B09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0089_H03.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0095_A05.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0106_E10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0081_H04.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0061_H01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0033_A07.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0092_F10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0191_A03.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LNG01_0046_G10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0151_F08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0044_F08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0133_H08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0047_C08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0082_D09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0201_B12.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0130_G11.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0093_A01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0020_F02.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0030_F01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0128_B08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0088_H09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0004_B05.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0021_A03.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0099_D10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCCTCTG*TGACCGCTG*TTGCCA
OVRM1_0131_E10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0153_C01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0207_B08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LNG01_0036_E09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0148_D08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0117_C12.b : xxGTTTTGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVR01_0089_B12.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCG
OVRM1_0152_H11.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0205_F05.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0043_B01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0062_H07.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0127_B02.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0038_C06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0005_B02.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0202_F06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0144_E01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0223_F09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0140_B03.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0039_F01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0224_G06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0096_C10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*CGACCGCTG*TTGCCA
OVRM1_0113_E06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0077_G03.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0139_H05.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVR01_0088_G07.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*CCTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0025_G12.b : xxGTTTCGTGGAG*GCCGAGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0107_G12.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0113_H07.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0150_H09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0079_C07.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SMG01_0013_H05.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0114_B07.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0091_G06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0105_A12.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0083_H11.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
UTR01_0012_A11.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0129_G02.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LNG01_0107_G02.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LNG01_0073_C08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PBL01_0026_D02.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0068_F11.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SMG01_0067_G01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SMG01_0087_F03.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0089_B05.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0017_E10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
THY01_0068_F05.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*CGACCGCTG*TTGCCA
PTG01_0019_D06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SPL01_0043_F10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
UTR01_0059_F09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SMG01_0077_H11.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACTGCTG*TTGCCA
OVR01_0048_B07.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0050_G03.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LNG01_0091_H09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0149_A11.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
THY01_0048_B03.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LNG01_0110_G10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVR01_0086_H11.b : xxGTTTCGTGGAG*GCCGGGAGT*TTTCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
UTR01_0045_B03.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0056_C10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SMG01_0037_G10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0150_B03.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
UTR01_0015_E11.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0103_A04.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
UTR01_0019_H08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0049_F08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0070_B05.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
UTR01_0020_A02.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
ITT01_0085_D08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0139_F08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
UTR01_0039_C03.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SMG01_0053_F07.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LNG01_0032_E03.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
THY01_0045_A08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0148_D06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0105_F01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVR01_0051_G10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVR01_0020_G10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0113_G01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SMG01_0069_F01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
UTR01_0004_C03.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVR01_0082_H11.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LNG01_0021_E09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0039_G12.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTACCA
OVRT1_0057_A10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0078_B10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0014_A06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVR01_0084_E04.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LNG01_0019_G12.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
UTR01_0033_G06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0028_H09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVR01_0074_H11.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0056_B06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVR01_0059_B02.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0133_B11.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0125_H10.b : xxGTTTCGTGGAG*GCCGGGGGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
ITT01_0095_B09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PTG01_0082_F03.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVR01_0078_G01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
ADR01_0030_E09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SMG01_0076_C03.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0037_D06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PBL01_0058_H06.b : xxGTTTCGTGGAG*CCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SPL01_0058_C11.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0024_E03.b : gcAGTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0005_A07.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0027_E02.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0002_F10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SMG01_0067_G07.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
CLNT1_0009_A08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0031_A12.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TCGCCA
BFLT1_0068_G01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
TCH01_0009_E04.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0025_D02.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0060_D06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTTTG*TGACCGCTG*TTGCCA
OVRT1_0056_F08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
ITT01_0012_E01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGTTG*TTGCCA
ITT01_0051_B11.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVR01_0081_B11.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0021_A08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0019_F08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0037_F12.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SPL01_0030_B01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0031_D04.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
TCH01_0009_A08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
UTR01_0050_A06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LNG01_0020_H01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
MLN01_0026_A05.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0037_C04.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0040_C09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
THY01_0035_A10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
ITT01_0026_E11.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVR01_0011_G05.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
BFLT1_0086_A09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
TCH01_0034_B01.b : xxGTTTCGTGGAG*GCCGGGAGTTTTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
UTR01_0050_B06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
UTR01_0103_G08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LNG01_0034_G08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LNG01_0035_F10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
TCH01_0077_A07.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0057_B01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVR01_0096_C03.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVR01_0099_E07.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0091_F06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVR01_0059_H04.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SPL01_0090_G01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
UTR01_0083_F08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
TCH01_0028_F09.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LNG01_0074_E01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
CLNT1_0031_G07.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
UTR01_0058_E02.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
ITT01_0052_D05.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
MLN01_0093_H01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
TCH01_0023_C06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVR01_0084_F02.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0072_A08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0071_C03.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0093_G08.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0016_D06.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
UTR01_0054_A12.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
UTR01_0061_C05.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
ITT01_0081_A04.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0039_A05.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0036_H10.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PBL01_0088_E04.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
UTR01_0081_B07.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0043_F07.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
ITT01_0083_A03.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
ITT01_0054_E01.b : xxGTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
THY01_0125_G10.b : xxxGTTCGTGGAG*GCCGGGAGT*T*GCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0133_C05.b : xgcTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVR01_0086_C02.b : xaaTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0160_B01.b : xtcTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0137_D11.b : tacTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0092_H02.b : xxxTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0225_D02.b : xxxTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRT1_0104_C02.b : xxcTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCACTG*TTGCCA
OVR01_0017_D06.b : xxxTTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0131_G08.b : xxgcTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0048_A10.b : xxtcTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0117_F07.b : xxtcTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0108_B09.b : xxxxTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0197_B03.b : xxxxTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0036_F09.b : xtacTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0204_F05.b : xxtcTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0004_C09.b : xxxxTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SPL01_0011_H01.b : xxxxTTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0036_G11.b : xxgtcTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0052_F10.b : ggancTCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SPL01_0029_C04.b : xxxxxxCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
LVRM1_0161_F02.b : xxxxxxCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
TES01_0081_A11.b : gagtttCGTGGAG**CCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SMG01_0097_E11.b : nnnnnnCGTGGAGGCCCGGGANT*TTGCCTGCGNTTTCTTCTG*TGACCGCTG*TTGCCA
ADR01_0047_H12.b : xxxtggCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
BFLT1_0126_E08.b : ctttaaCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
ITT01_0095_G04.b : xxxxxxCGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
HTMT1_0081_D04.b : xxxxxxgGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
TCH01_0037_E07.b : xxxxxxxGTGGAG*GCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PTG01_0055_B01.b : nntttcgtggaAG*GCCGGGAGT*TTGCCTGCGNTTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0046_C01.b : atggagttcgtggaGCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTCCTTTTTA
KDN01_0058_C11.b : ctggagttcgtggaGCCGCGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0041_D09.b : acggagttcgtggaGCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTGCCTT**A
PST01_0073_D07.b : ctggagttcgtggaGCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PST01_0015_F06.b : acggagttcgtggaGCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0059_H03.b : ggctatggcgtggaGCCGGGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
SMG01_0040_B06.b : xxntttcntggaggcCTGGGAGT*TTGCCTGCGNTTTCTTCTG*TGACCGCTG*TTGCCA
OVRM1_0198_F02.b : xxttctcgtggaggccagaGAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
BKFL1_0032_F11.b : xxxxxxxxxxxxxxxxxxxxAGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
UTR01_0046_F12.b : xxxxxxxxxxxxxxxxxxxxxGT*TTGCCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
PTG01_0103_G08.b : nnnnncgctggaggccgggtacT*TTGCCTGCGTTTTCTTCTG*TGACCGCGGCTTGCCA
SMG01_0045_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGCG*TTTCTTCTG*TGACCGCTG*TTGCCA
KDN01_0046_F11.b : G*CTGCCA
KDN01_0052_H12.b : cccTGTCA
OVRM1_0017_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0004_G02.b :
BKFL1_0079_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0075_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0011_C10.b : xxxxagtttcctgtatgcccggcgtgtgcccgcctgccgtccctgacccctgttgcaact
UTR01_0034_F02.b :
PTG01_0097_D04.b :
ADR01_0014_C10.b :
OVRM1_0066_A11.b :
OVRM1_0030_A02.b :
PTG01_0042_D03.b :
BKFL1_0009_E12.b : nnnnnnnnnnnnn
PTG01_0032_C04.b :
20110601C-001761 : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
---------+---------+---------+---------+---------+---------+ 155
THY01_0115_C10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
THY01_0118_F10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0144_B11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0018_H07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0169_C01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0096_A07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0027_E05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
THY01_0103_F06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
THY01_0105_C01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0028_H03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0071_H01.b : CTGCCACCCGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0001_C11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVR01_0005_C07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LNG01_0013_D04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0089_H08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0075_G09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SKNB1_0078_G12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0081_C01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0147_E07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0107_D02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVR01_0036_A03.b : CTGCCACCTGACAATGCATATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTGAG
OVR01_0042_B06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0005_E05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
TES01_0022_D07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SKNB1_0009_C02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0018_C05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
TES01_0029_F05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0062_E07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SKNB1_0095_G05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0052_B02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0032_D01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0057_A08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCCTGACTGGTAAGACCATCACCCTG*G
PST01_0066_D01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0019_F12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0076_A09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
TES01_0046_E03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0072_E03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0059_A06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0086_E05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTGAGACCATCACCCTG*G
PST01_0072_G06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0028_H02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0043_D07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0012_B09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0069_B03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0007_G03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0063_E08.b : TTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0089_C07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
TES01_0021_A08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SKNB1_0074_B10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0035_D09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0061_C02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0087_H06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0014_F06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0014_A01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
TES01_0066_H01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0080_A09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0026_C06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0052_D12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0080_F03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0096_G02.b : GTGCCACCTGANAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0063_G08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
TCH01_0080_D07.b : CTGCCACCTGACAATGCAGATCTTTGTAAGGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0078_E01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0084_D08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0064_D03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0071_B03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0062_E03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0098_E01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTCGACTGGTAAGACCATCACCCTG*G
PST01_0057_A10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0056_D06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0042_G11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0060_H02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0095_A03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0007_C01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0054_B12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0046_C06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0077_D04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0085_B09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0066_B03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0049_C11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0058_H01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
BFLT1_0145_G02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0151_D08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0152_E09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SKNB1_0002_G08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0075_C07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0105_D08.b : CTGCCACCTGACAATGCAGACCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0132_H06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SKNB1_0003_A12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0095_A12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0020_E03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
CBLT1_0067_A01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
BMWN1_0093_F01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SKNB1_0022_C01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
HTMT1_0119_C05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
ILNT1_0078_B02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
BMWN1_0057_E12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
BMWN1_0019_F11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0006_G11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
HTMT1_0027_D02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
ITT01_0080_G04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
HTMT1_0141_F09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
CLNT1_0032_D02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0128_D09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LNG01_0002_H11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
CBLT1_0028_D04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
ILNT1_0007_D09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SKNB1_0085_E12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCACCACCCTG*G
OVR01_0045_B12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
HTMT1_0076_D12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
CBLT1_0006_G02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SKNB1_0086_H04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0041_A06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
ILNT1_0054_E06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0014_C07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SKNB1_0058_E10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0013_A03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0037_D10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0036_G12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
CBLT1_0060_E09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
CBLT1_0063_A05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0065_A06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
ITT01_0069_F08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0175_H02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0086_D02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0006_D03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0012_F04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0043_D06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
ADR01_0015_D01.b : CTGCCTCCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0093_A02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0009_D04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0188_B09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
DCI01_0057_B12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0089_D07.b : CTGCCACCTAACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
DCI01_0031_A05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0060_D09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0059_D10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0018_B05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0098_H12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCACCACCCTG*G
OVRM1_0002_B05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
DCI01_0035_F11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0031_C12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0097_C02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
UTR01_0028_E12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0065_A08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
DCI01_0037_F10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
DCI01_0035_E08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SPL01_0030_F05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
DCI01_0044_H01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0069_G07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
UTR01_0044_C06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LNG01_0094_B11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0016_F04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0060_B08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCACCACCCTG*G
AMP01_0074_A08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0088_G09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0032_H01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0055_H06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0096_B09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
UTR01_0103_H09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0027_G05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0068_E02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0023_D03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0068_D11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
DCI01_0011_H03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
CBLT1_0026_E03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0007_E07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0017_H12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0052_H06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0037_D08.b : CTGCCACCTGACAATGCATATCTTTGTAAAGACCTAGACTGGTAAGACCATCACCCTG*G
AMP01_0034_D04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0077_D02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
DCI01_0007_E04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0015_H08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0056_A10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0080_E01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0122_H09.b : CTGCCACCTGACAATGCAGATCTTTGCAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0084_A02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
DCI01_0041_G10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0050_G06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
AMP01_0054_B12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
DCI01_0113_E01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0004_B09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0007_A09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LNG01_0085_F11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0026_C10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0131_E06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0166_A06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0173_C01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SMG01_0041_F07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SMG01_0066_C09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGATCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0076_C10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0120_D05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PTG01_0052_A12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0072_A03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0102_E04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0058_D02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0109_F09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0068_F09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0159_D04.b : CTGCCACCTGACAATGCAGATCTTTGTAAACACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0102_G06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0163_C05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0115_D04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SMG01_0096_G06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0026_E11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0150_G04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0042_A04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0129_G05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0176_F09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0121_G09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0066_G09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0068_C06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SMG01_0057_B11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0174_E02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0130_D04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0104_B05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0149_C06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0152_H02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*A
OVRM1_0049_C09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTGGT
OVRM1_0207_G03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0066_C12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0083_D08.b : CTGCCACCTGACCATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCCCCCTG*G
OVRT1_0036_H12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0110_A09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0073_A09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0083_A04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0195_C04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0061_H06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0039_C03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0164_F10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0005_A06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0075_B05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0081_G11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0134_G10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0081_G05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0147_E06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0040_D04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0046_A02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0179_D05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0029_B08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0145_C05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0172_G08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0165_D03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0095_D01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0218_G06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0040_E07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0130_D05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0170_B09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0089_H03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0095_A05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0106_E10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0081_H04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0061_H01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0033_A07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0092_F10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0191_A03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LNG01_0046_G10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0151_F08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0044_F08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0133_H08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0047_C08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0082_D09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0201_B12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0130_G11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0093_A01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0020_F02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0030_F01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0128_B08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0088_H09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0004_B05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0021_A03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0099_D10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0131_E10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0153_C01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0207_B08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LNG01_0036_E09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0148_D08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0117_C12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVR01_0089_B12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0152_H11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0205_F05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0043_B01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0062_H07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0127_B02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0038_C06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0005_B02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0202_F06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0144_E01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0223_F09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0140_B03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0039_F01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0224_G06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0096_C10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0113_E06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0077_G03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0139_H05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVR01_0088_G07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0025_G12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0107_G12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0113_H07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0150_H09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0079_C07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SMG01_0013_H05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0114_B07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0091_G06.b : CTGCCACCTGACAATGCAGATCCTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0105_A12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0083_H11.b : CTGCCACCTGACAATGCGGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
UTR01_0012_A11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0129_G02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LNG01_0107_G02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LNG01_0073_C08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PBL01_0026_D02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAAACCATCACCCTG*G
OVR01_0068_F11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SMG01_0067_G01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SMG01_0087_F03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0089_B05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0017_E10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
THY01_0068_F05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PTG01_0019_D06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGGCCATCACCCTG*G
SPL01_0043_F10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
UTR01_0059_F09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCGCCCTG*G
SMG01_0077_H11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0048_B07.b : CTGCCACCTGACAGTGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0050_G03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LNG01_0091_H09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0149_A11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
THY01_0048_B03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LNG01_0110_G10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*A
LVR01_0086_H11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
UTR01_0045_B03.b : CTGCCACCTGACAATGCAGGTCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0056_C10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SMG01_0037_G10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0150_B03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
UTR01_0015_E11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0103_A04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
UTR01_0019_H08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0049_F08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0070_B05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
UTR01_0020_A02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
ITT01_0085_D08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0139_F08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
UTR01_0039_C03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SMG01_0053_F07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LNG01_0032_E03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
THY01_0045_A08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0148_D06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0105_F01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVR01_0051_G10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVR01_0020_G10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0113_G01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCGTCACCCTG*G
SMG01_0069_F01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
UTR01_0004_C03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVR01_0082_H11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LNG01_0021_E09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0039_G12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0057_A10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0078_B10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0014_A06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVR01_0084_E04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LNG01_0019_G12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
UTR01_0033_G06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0028_H09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVR01_0074_H11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0056_B06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVR01_0059_B02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0133_B11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0125_H10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
ITT01_0095_B09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PTG01_0082_F03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVR01_0078_G01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
ADR01_0030_E09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SMG01_0076_C03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0037_D06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PBL01_0058_H06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SPL01_0058_C11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0024_E03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0005_A07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0027_E02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0002_F10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SMG01_0067_G07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
CLNT1_0009_A08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0031_A12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
BFLT1_0068_G01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
TCH01_0009_E04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0025_D02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0060_D06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAGGACCATCACCCTG*G
OVRT1_0056_F08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
ITT01_0012_E01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
ITT01_0051_B11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVR01_0081_B11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0021_A08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0019_F08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0037_F12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SPL01_0030_B01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0031_D04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
TCH01_0009_A08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
UTR01_0050_A06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LNG01_0020_H01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
MLN01_0026_A05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0037_C04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0040_C09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
THY01_0035_A10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
ITT01_0026_E11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVR01_0011_G05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
BFLT1_0086_A09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
TCH01_0034_B01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
UTR01_0050_B06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
UTR01_0103_G08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LNG01_0034_G08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTAACTGGTAAGACCATCACCCTG*G
LNG01_0035_F10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
TCH01_0077_A07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0057_B01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVR01_0096_C03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVR01_0099_E07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0091_F06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVR01_0059_H04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SPL01_0090_G01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
UTR01_0083_F08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
TCH01_0028_F09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LNG01_0074_E01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
CLNT1_0031_G07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
UTR01_0058_E02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
ITT01_0052_D05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*A
MLN01_0093_H01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
TCH01_0023_C06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVR01_0084_F02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0072_A08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0071_C03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0093_G08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0016_D06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
UTR01_0054_A12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
UTR01_0061_C05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
ITT01_0081_A04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0039_A05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0036_H10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PBL01_0088_E04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
UTR01_0081_B07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0043_F07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
ITT01_0083_A03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
ITT01_0054_E01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
THY01_0125_G10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0133_C05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0086_C02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0160_B01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0137_D11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0092_H02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0225_D02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRT1_0104_C02.b : CTGCCACATGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVR01_0017_D06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0131_G08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0048_A10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0117_F07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0108_B09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCCG*G
OVRM1_0197_B03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0036_F09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0204_F05.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0004_C09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SPL01_0011_H01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0036_G11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0052_F10.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SPL01_0029_C04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
LVRM1_0161_F02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
TES01_0081_A11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SMG01_0097_E11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
ADR01_0047_H12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
BFLT1_0126_E08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
ITT01_0095_G04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
HTMT1_0081_D04.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
TCH01_0037_E07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PTG01_0055_B01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0046_C01.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGATTGGTAAGACCATCACCCTG*G
KDN01_0058_C11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0041_D09.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTCTTTGGTAAGACCATCACCCTG*G
PST01_0073_D07.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PST01_0015_F06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0059_H03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SMG01_0040_B06.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0198_F02.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
BKFL1_0032_F11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
UTR01_0046_F12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PTG01_0103_G08.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
SMG01_0045_E03.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
KDN01_0046_F11.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTCGACTGGTAAGACCATCACCCTG*G
KDN01_0052_H12.b : CTGCCACCTGACAATGCAGATCTTTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
OVRM1_0017_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxTGTAAAGACCTTGACTGGTAAGACCATCACCCTG*G
PCT01_0004_G02.b : nnnaaggacgtcaanannacctgcgttgtgctcggnnaACCATCACCCTG*G
BKFL1_0079_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0075_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0011_C10.b : ggcgactgacaaggcgcatctttgcatggaccttcgactggccatagcttctccctcgga
UTR01_0034_F02.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0097_D04.b : nnnnnnnnnnnnnnnnnn
ADR01_0014_C10.b :
OVRM1_0066_A11.b :
OVRM1_0030_A02.b : nggggnnnttttnttttnnnnnnttnnntttc
PTG01_0042_D03.b :
BKFL1_0009_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0032_C04.b :
20110601C-001761 : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
---------+---------+---------+---------+---------+---------+ 214
THY01_0115_C10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
THY01_0118_F10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGGAAAAGAGGGC
LVRM1_0144_B11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0018_H07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ACTCAAGAAAAAGAGGGC
LVRM1_0169_C01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0096_A07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0027_E05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
THY01_0103_F06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
THY01_0105_C01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0028_H03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0071_H01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0001_C11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVR01_0005_C07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LNG01_0013_D04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0089_H08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0075_G09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SKNB1_0078_G12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0081_C01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0147_E07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAGAAGAGGGC
LVRM1_0107_D02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVR01_0036_A03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAGGGGGAAC*ATTCAAGAAAAAGAGGGC
OVR01_0042_B06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAATTATTCAAGAAAAAGAGGGC
OVRM1_0005_E05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
TES01_0022_D07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SKNB1_0009_C02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0018_C05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
TES01_0029_F05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0062_E07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SKNB1_0095_G05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0052_B02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0032_D01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0057_A08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0066_D01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0019_F12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0076_A09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
TES01_0046_E03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0072_E03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0059_A06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0086_E05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0072_G06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0028_H02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0043_D07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0012_B09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0069_B03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0007_G03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0063_E08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCGAGAAAAAGAGGGC
PST01_0089_C07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
TES01_0021_A08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SKNB1_0074_B10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0035_D09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0061_C02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0087_H06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0014_F06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0014_A01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
TES01_0066_H01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0080_A09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0026_C06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0052_D12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0080_F03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0096_G02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0063_G08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
TCH01_0080_D07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0078_E01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0084_D08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0064_D03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0071_B03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0062_E03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0098_E01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0057_A10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0056_D06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0042_G11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0060_H02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0095_A03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0007_C01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0054_B12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0046_C06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0077_D04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0085_B09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0066_B03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0049_C11.b : AAGTAGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0058_H01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
BFLT1_0145_G02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0151_D08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0152_E09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SKNB1_0002_G08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0075_C07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0105_D08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0132_H06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SKNB1_0003_A12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0095_A12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0020_E03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
CBLT1_0067_A01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
BMWN1_0093_F01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SKNB1_0022_C01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
HTMT1_0119_C05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCNAGGGGAAG*ATTCAAGAAAAAGAGGGC
ILNT1_0078_B02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
BMWN1_0057_E12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
BMWN1_0019_F11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0006_G11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
HTMT1_0027_D02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
ITT01_0080_G04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
HTMT1_0141_F09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
CLNT1_0032_D02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0128_D09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LNG01_0002_H11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
CBLT1_0028_D04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
ILNT1_0007_D09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SKNB1_0085_E12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0045_B12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
HTMT1_0076_D12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
CBLT1_0006_G02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SKNB1_0086_H04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0041_A06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
ILNT1_0054_E06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0014_C07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SKNB1_0058_E10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0013_A03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0037_D10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0036_G12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
CBLT1_0060_E09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
CBLT1_0063_A05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0065_A06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
ITT01_0069_F08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0175_H02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0086_D02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAC*ATTCAAGAAAAATAGGGC
AMP01_0006_D03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0012_F04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0043_D06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
ADR01_0015_D01.b : AAGTGGAGCCCAGTGACTCCATCGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0093_A02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0009_D04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0188_B09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
DCI01_0057_B12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0089_D07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
DCI01_0031_A05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0060_D09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0059_D10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0018_B05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0098_H12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0002_B05.b : AAGTGTAGCCCAGTGACACCGTTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
DCI01_0035_F11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0031_C12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0097_C02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
UTR01_0028_E12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0065_A08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
DCI01_0037_F10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
DCI01_0035_E08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SPL01_0030_F05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
DCI01_0044_H01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0069_G07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
UTR01_0044_C06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAGGGGGAAG*ATTCAAGAAAAAGAGGGC
LNG01_0094_B11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0016_F04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0060_B08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0074_A08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0088_G09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0032_H01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0055_H06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0096_B09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
UTR01_0103_H09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0027_G05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0068_E02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0023_D03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0068_D11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
DCI01_0011_H03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
CBLT1_0026_E03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0007_E07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0017_H12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0052_H06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0037_D08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0034_D04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0077_D02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
DCI01_0007_E04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0015_H08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0056_A10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0080_E01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0122_H09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0084_A02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
DCI01_0041_G10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0050_G06.b : AAGTGGAGCCCAGTGGCACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
AMP01_0054_B12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
DCI01_0113_E01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0004_B09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0007_A09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LNG01_0085_F11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0026_C10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0131_E06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0166_A06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0173_C01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SMG01_0041_F07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SMG01_0066_C09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0076_C10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0120_D05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PTG01_0052_A12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0072_A03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0102_E04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0058_D02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0109_F09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0068_F09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0159_D04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0102_G06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0163_C05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0115_D04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SMG01_0096_G06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0026_E11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0150_G04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0042_A04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0129_G05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0176_F09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0121_G09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0066_G09.b : AAGTGGAGCCCAGTGACGCCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0068_C06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SMG01_0057_B11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0174_E02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0130_D04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0104_B05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0149_C06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0152_H02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0049_C09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0207_G03.b : AAGTGGAGCCCAGTGACACCGTTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0066_C12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAC*ATTCAAGAAAAAGAGGGC
OVR01_0083_D08.b : AAGTGGAGCCCAGTGACCCCCTTGAGAATGGCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0036_H12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0110_A09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0073_A09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0083_A04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0195_C04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0061_H06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0039_C03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0164_F10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0005_A06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0075_B05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0081_G11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0134_G10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0081_G05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0147_E06.b : AAGTGGAGCCCAGTGACACCATCGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0040_D04.b : AAGTGGAGCCCAGTGACGCCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0046_A02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0179_D05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0029_B08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0145_C05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0172_G08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0165_D03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0095_D01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0218_G06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0040_E07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0130_D05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0170_B09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0089_H03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0095_A05.b : AAGTGGAGCCCAGTGATACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0106_E10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0081_H04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0061_H01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0033_A07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0092_F10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0191_A03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LNG01_0046_G10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0151_F08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0044_F08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0133_H08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0047_C08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0082_D09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0201_B12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0130_G11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0093_A01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0020_F02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0030_F01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0128_B08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0088_H09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0004_B05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0021_A03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0099_D10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0131_E10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0153_C01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0207_B08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LNG01_0036_E09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0148_D08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0117_C12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVR01_0089_B12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0152_H11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0205_F05.b : AAGTGGAGCCCAGTGACACCATTGAGGATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0043_B01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0062_H07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0127_B02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0038_C06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0005_B02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0202_F06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0144_E01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0223_F09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0140_B03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0039_F01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0224_G06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0096_C10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0113_E06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0077_G03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0139_H05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVR01_0088_G07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0025_G12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0107_G12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0113_H07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0150_H09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0079_C07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SMG01_0013_H05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0114_B07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0091_G06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0105_A12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0083_H11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
UTR01_0012_A11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0129_G02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LNG01_0107_G02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LNG01_0073_C08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PBL01_0026_D02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0068_F11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SMG01_0067_G01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SMG01_0087_F03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0089_B05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0017_E10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
THY01_0068_F05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PTG01_0019_D06.b : AAGTGGAGCCCAGTGACACCATTGGGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SPL01_0043_F10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
UTR01_0059_F09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGAGAAG*ATTCAAGAAAAAGAGGGC
SMG01_0077_H11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0048_B07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0050_G03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LNG01_0091_H09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0149_A11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
THY01_0048_B03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LNG01_0110_G10.b : AAGTGGAGCCCAGTGACACCATTGACAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVR01_0086_H11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
UTR01_0045_B03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0056_C10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SMG01_0037_G10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0150_B03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
UTR01_0015_E11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0103_A04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
UTR01_0019_H08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0049_F08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0070_B05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
UTR01_0020_A02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
ITT01_0085_D08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0139_F08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
UTR01_0039_C03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SMG01_0053_F07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LNG01_0032_E03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
THY01_0045_A08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0148_D06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0105_F01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVR01_0051_G10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVR01_0020_G10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0113_G01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SMG01_0069_F01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
UTR01_0004_C03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVR01_0082_H11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LNG01_0021_E09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0039_G12.b : AAGTGGAGCCCAGTGACACCATTGAGAGTGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0057_A10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0078_B10.b : AAGTGGAGCCCAGTGACACCATTGAGAAGGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0014_A06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVR01_0084_E04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LNG01_0019_G12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
UTR01_0033_G06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0028_H09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVR01_0074_H11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0056_B06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVR01_0059_B02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0133_B11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0125_H10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
ITT01_0095_B09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PTG01_0082_F03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGAGC
LVR01_0078_G01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
ADR01_0030_E09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SMG01_0076_C03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0037_D06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PBL01_0058_H06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SPL01_0058_C11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0024_E03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAGAAGAGGGC
OVRT1_0005_A07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0027_E02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0002_F10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SMG01_0067_G07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
CLNT1_0009_A08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0031_A12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
BFLT1_0068_G01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
TCH01_0009_E04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0025_D02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTTAAGAAAAAGAGGGC
OVRT1_0060_D06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0056_F08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
ITT01_0012_E01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
ITT01_0051_B11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVR01_0081_B11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0021_A08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0019_F08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0037_F12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SPL01_0030_B01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0031_D04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
TCH01_0009_A08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
UTR01_0050_A06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LNG01_0020_H01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
MLN01_0026_A05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0037_C04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0040_C09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
THY01_0035_A10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
ITT01_0026_E11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVR01_0011_G05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
BFLT1_0086_A09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
TCH01_0034_B01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
UTR01_0050_B06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
UTR01_0103_G08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LNG01_0034_G08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LNG01_0035_F10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
TCH01_0077_A07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0057_B01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVR01_0096_C03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVR01_0099_E07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0091_F06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVR01_0059_H04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SPL01_0090_G01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
UTR01_0083_F08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
TCH01_0028_F09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LNG01_0074_E01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
CLNT1_0031_G07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
UTR01_0058_E02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
ITT01_0052_D05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
MLN01_0093_H01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
TCH01_0023_C06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVR01_0084_F02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0072_A08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0071_C03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0093_G08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0016_D06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
UTR01_0054_A12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
UTR01_0061_C05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
ITT01_0081_A04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0039_A05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0036_H10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PBL01_0088_E04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
UTR01_0081_B07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0043_F07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
ITT01_0083_A03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
ITT01_0054_E01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
THY01_0125_G10.b : AAGTGGAGCCCAGTGACACCATTG*GAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0133_C05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0086_C02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCTAGAAAAAGAGGGC
OVRM1_0160_B01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0137_D11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAGG*ATTCAAGAAAAAGAGGGC
LVRM1_0092_H02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0225_D02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRT1_0104_C02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVR01_0017_D06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0131_G08.b : AAGCGGAGCCCAGCGACACCTTTGAGAATGTCACGGGGAAG*ATTCtcgataatgagtgg
OVRM1_0048_A10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0117_F07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0108_B09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAAAAAAAGAGGGC
OVRM1_0197_B03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0036_F09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0204_F05.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0004_C09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SPL01_0011_H01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAGG*ATTCAAGAAAAAGAGGGC
LVRM1_0036_G11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0052_F10.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SPL01_0029_C04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
LVRM1_0161_F02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
TES01_0081_A11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SMG01_0097_E11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
ADR01_0047_H12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
BFLT1_0126_E08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
ITT01_0095_G04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
HTMT1_0081_D04.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
TCH01_0037_E07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PTG01_0055_B01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0046_C01.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0058_C11.b : AAGTGGAGCCCAGAGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0041_D09.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0073_D07.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PST01_0015_F06.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGT
KDN01_0059_H03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SMG01_0040_B06.b : AAGTGGAGCCCAGTGACACCATTGAGAAATGTCAGGGGAAG*AATTCAGAANAAGAGGGC
OVRM1_0198_F02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
BKFL1_0032_F11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
UTR01_0046_F12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PTG01_0103_G08.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
SMG01_0045_E03.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0046_F11.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
KDN01_0052_H12.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
OVRM1_0017_C02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PCT01_0004_G02.b : *AGTGGAGCCCAGCGACACCATCGAGAACGTCAAGGCGAAG*ATCCAAGACAAGGAAGGC
BKFL1_0079_H02.b : AAGTGGAGCCCAGTGACACCATTGAGAATGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
MLTL1_0075_G06.b : xxxxxxAGCCCAGCGACACCATCGAGAATGTCAAGGCGAAG*ATCCAGGACAAGGAAGGC
AMP01_0011_C10.b : gctgcaggccatGTGACGCCATTGACAATGTCAAGGGGAAG*ATTCCAGATGAAGAGGGC
UTR01_0034_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTGTCAAGGGGAAG*ATTCAAGAAAAAGAGGGC
PTG01_0097_D04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxGAGGGC
ADR01_0014_C10.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0066_A11.b : ncagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0030_A02.b : cnnccntccccccncccctacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0042_D03.b : cctctattannnggctxxxxxxxxxxxxxxxxxxxxx
BKFL1_0009_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0032_C04.b :
20110601C-001761 : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
---------+---------+---------+---------+---------+---------+ 273
THY01_0115_C10.b : AT*CCCCCCAGACTAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
THY01_0118_F10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0144_B11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0018_H07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0169_C01.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0096_A07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0027_E05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
THY01_0103_F06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
THY01_0105_C01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0028_H03.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0071_H01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0001_C11.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVR01_0005_C07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LNG01_0013_D04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0089_H08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0075_G09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SKNB1_0078_G12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0081_C01.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0147_E07.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0107_D02.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVR01_0036_A03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCACCTGGAATATGGGCGCAC
OVR01_0042_B06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0005_E05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
TES01_0022_D07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SKNB1_0009_C02.b : AT*CCCCC*AGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0018_C05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
TES01_0029_F05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0062_E07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SKNB1_0095_G05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGGCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0052_B02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGGCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0032_D01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0057_A08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0066_D01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0019_F12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0076_A09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
TES01_0046_E03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0072_E03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0059_A06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGTGCAC
KDN01_0086_E05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0072_G06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0028_H02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0043_D07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0012_B09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0069_B03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0007_G03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0063_E08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0089_C07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
TES01_0021_A08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SKNB1_0074_B10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0035_D09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0061_C02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0087_H06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGACGGGCGCAC
PST01_0014_F06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0014_A01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
TES01_0066_H01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0080_A09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0026_C06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0052_D12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0080_F03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0096_G02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0063_G08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
TCH01_0080_D07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0078_E01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0084_D08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0064_D03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0071_B03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0062_E03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0098_E01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0057_A10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0056_D06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0042_G11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0060_H02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0095_A03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0007_C01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0054_B12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0046_C06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0077_D04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0085_B09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0066_B03.b : AT*CCCCCCAGACCAGCGGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0049_C11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0058_H01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
BFLT1_0145_G02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0151_D08.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0152_E09.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SKNB1_0002_G08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0075_C07.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0105_D08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0132_H06.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SKNB1_0003_A12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0095_A12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0020_E03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
CBLT1_0067_A01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
BMWN1_0093_F01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SKNB1_0022_C01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
HTMT1_0119_C05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
ILNT1_0078_B02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
BMWN1_0057_E12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
BMWN1_0019_F11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0006_G11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
HTMT1_0027_D02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
ITT01_0080_G04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
HTMT1_0141_F09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
CLNT1_0032_D02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCTGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0128_D09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LNG01_0002_H11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
CBLT1_0028_D04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
ILNT1_0007_D09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SKNB1_0085_E12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0045_B12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
HTMT1_0076_D12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
CBLT1_0006_G02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SKNB1_0086_H04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0041_A06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
ILNT1_0054_E06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0014_C07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SKNB1_0058_E10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0013_A03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0037_D10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0036_G12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
CBLT1_0060_E09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
CBLT1_0063_A05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0065_A06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
ITT01_0069_F08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0175_H02.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0086_D02.b : AT*CCCCCCAGACCACCACAGGCTGATCTTTGCCGGGAAGCAGCTGGAACATGGGCGCAC
AMP01_0006_D03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0012_F04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0043_D06.b : GT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
ADR01_0015_D01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0093_A02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0009_D04.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0188_B09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
DCI01_0057_B12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0089_D07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
DCI01_0031_A05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0060_D09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0059_D10.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0018_B05.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0098_H12.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0002_B05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
DCI01_0035_F11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0031_C12.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0097_C02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
UTR01_0028_E12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0065_A08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
DCI01_0037_F10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
DCI01_0035_E08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SPL01_0030_F05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
DCI01_0044_H01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0069_G07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
UTR01_0044_C06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LNG01_0094_B11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0016_F04.b : AT*CCCCCCAGACCAGCAGAGGCTGGTCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0060_B08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0074_A08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0088_G09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0032_H01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0055_H06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0096_B09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
UTR01_0103_H09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0027_G05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0068_E02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0023_D03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0068_D11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
DCI01_0011_H03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
CBLT1_0026_E03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0007_E07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0017_H12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0052_H06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0037_D08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0034_D04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0077_D02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
DCI01_0007_E04.b : CT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0015_H08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0056_A10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0080_E01.b : CT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0122_H09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0084_A02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
DCI01_0041_G10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0050_G06.b : CT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0054_B12.b : ATCCCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
DCI01_0113_E01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0004_B09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0007_A09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LNG01_0085_F11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0026_C10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0131_E06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0166_A06.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0173_C01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SMG01_0041_F07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SMG01_0066_C09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0076_C10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0120_D05.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PTG01_0052_A12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0072_A03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0102_E04.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0058_D02.b : AT*CCCCCCAGACCAGCAAAGGCTGATCCTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0109_F09.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0068_F09.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0159_D04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0102_G06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0163_C05.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0115_D04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SMG01_0096_G06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0026_E11.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGATGGAAGATGGGCGCAC
LVRM1_0150_G04.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0042_A04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0129_G05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0176_F09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0121_G09.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0066_G09.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0068_C06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SMG01_0057_B11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0174_E02.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0130_D04.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0104_B05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0149_C06.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0152_H02.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0049_C09.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0207_G03.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0066_C12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0083_D08.b : AT*CCCCCCCGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0036_H12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0110_A09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0073_A09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0083_A04.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0195_C04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0061_H06.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0039_C03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0164_F10.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0005_A06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0075_B05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0081_G11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0134_G10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0081_G05.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCACCTGGAAGATGGGCGCAC
OVRM1_0147_E06.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0040_D04.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0046_A02.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0179_D05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0029_B08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0145_C05.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCGGCTGGAAGATGGGCGCAC
LVRM1_0172_G08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0165_D03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0095_D01.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0218_G06.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0040_E07.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0130_D05.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0170_B09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0089_H03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0095_A05.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0106_E10.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0081_H04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0061_H01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0033_A07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0092_F10.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0191_A03.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LNG01_0046_G10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0151_F08.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0044_F08.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0133_H08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0047_C08.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0082_D09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0201_B12.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0130_G11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0093_A01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0020_F02.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0030_F01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0128_B08.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0088_H09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0004_B05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0021_A03.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0099_D10.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0131_E10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0153_C01.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0207_B08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LNG01_0036_E09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0148_D08.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0117_C12.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVR01_0089_B12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0152_H11.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0205_F05.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0043_B01.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0062_H07.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0127_B02.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0038_C06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0005_B02.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0202_F06.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0144_E01.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0223_F09.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0140_B03.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0039_F01.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTCGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0224_G06.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0096_C10.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0113_E06.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0077_G03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0139_H05.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVR01_0088_G07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0025_G12.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0107_G12.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0113_H07.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0150_H09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0079_C07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SMG01_0013_H05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0114_B07.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0091_G06.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0105_A12.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0083_H11.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
UTR01_0012_A11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0129_G02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LNG01_0107_G02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LNG01_0073_C08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PBL01_0026_D02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0068_F11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SMG01_0067_G01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SMG01_0087_F03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0089_B05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0017_E10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
THY01_0068_F05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PTG01_0019_D06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SPL01_0043_F10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
UTR01_0059_F09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTCTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SMG01_0077_H11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0048_B07.b : AT*CCCCCCAGACCAGCACAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0050_G03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LNG01_0091_H09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0149_A11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
THY01_0048_B03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LNG01_0110_G10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVR01_0086_H11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
UTR01_0045_B03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0056_C10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SMG01_0037_G10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0150_B03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
UTR01_0015_E11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0103_A04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
UTR01_0019_H08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0049_F08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0070_B05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
UTR01_0020_A02.b : ATCCCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
ITT01_0085_D08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0139_F08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
UTR01_0039_C03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SMG01_0053_F07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LNG01_0032_E03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
THY01_0045_A08.b : AT*CCTCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0148_D06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0105_F01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVR01_0051_G10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVR01_0020_G10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0113_G01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SMG01_0069_F01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
UTR01_0004_C03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVR01_0082_H11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LNG01_0021_E09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0039_G12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0057_A10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0078_B10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0014_A06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVR01_0084_E04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LNG01_0019_G12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
UTR01_0033_G06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0028_H09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVR01_0074_H11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0056_B06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVR01_0059_B02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0133_B11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0125_H10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
ITT01_0095_B09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PTG01_0082_F03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVR01_0078_G01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
ADR01_0030_E09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SMG01_0076_C03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0037_D06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PBL01_0058_H06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SPL01_0058_C11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0024_E03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0005_A07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0027_E02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0002_F10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGGTGGGCGCAC
SMG01_0067_G07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
CLNT1_0009_A08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0031_A12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
BFLT1_0068_G01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
TCH01_0009_E04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0025_D02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0060_D06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0056_F08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAGGATGGGCGCAC
ITT01_0012_E01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
ITT01_0051_B11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVR01_0081_B11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0021_A08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0019_F08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0037_F12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SPL01_0030_B01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0031_D04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
TCH01_0009_A08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
UTR01_0050_A06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LNG01_0020_H01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
MLN01_0026_A05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0037_C04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0040_C09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
THY01_0035_A10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
ITT01_0026_E11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVR01_0011_G05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
BFLT1_0086_A09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
TCH01_0034_B01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
UTR01_0050_B06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
UTR01_0103_G08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LNG01_0034_G08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LNG01_0035_F10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
TCH01_0077_A07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0057_B01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVR01_0096_C03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVR01_0099_E07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0091_F06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVR01_0059_H04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SPL01_0090_G01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
UTR01_0083_F08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
TCH01_0028_F09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LNG01_0074_E01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
CLNT1_0031_G07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
UTR01_0058_E02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
ITT01_0052_D05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
MLN01_0093_H01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
TCH01_0023_C06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVR01_0084_F02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0072_A08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0071_C03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0093_G08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0016_D06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
UTR01_0054_A12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
UTR01_0061_C05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
ITT01_0081_A04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0039_A05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0036_H10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PBL01_0088_E04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
UTR01_0081_B07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0043_F07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
ITT01_0083_A03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
ITT01_0054_E01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
THY01_0125_G10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0133_C05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0086_C02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0160_B01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0137_D11.b : AT*CCCCCCAGACCAGCGAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0092_H02.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0225_D02.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRT1_0104_C02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVR01_0017_D06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0131_G08.b : gtctccccggacatgcacaggctgtattttgtcctgaaaacaactggaagatggcgtttt
OVRM1_0048_A10.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0117_F07.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0108_B09.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0197_B03.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0036_F09.b : A**CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0204_F05.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0004_C09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SPL01_0011_H01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0036_G11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0052_F10.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SPL01_0029_C04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
LVRM1_0161_F02.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
TES01_0081_A11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SMG01_0097_E11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
ADR01_0047_H12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
BFLT1_0126_E08.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCATCTGGAAGATGGGCGCAC
ITT01_0095_G04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
HTMT1_0081_D04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
TCH01_0037_E07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PTG01_0055_B01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0046_C01.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0058_C11.b : AT*CCCCCCAGACCAGCACATGCTGATCTTTGCCGGGAAGCACCTGGAAGATGGGCACAC
KDN01_0041_D09.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0073_D07.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PST01_0015_F06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0059_H03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SMG01_0040_B06.b : AT*CCCCCCAGACCAGCAGAAGCTGATCTTTGCCGGNAAGCANCTGGNAGAATGGCGCAC
OVRM1_0198_F02.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
BKFL1_0032_F11.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
UTR01_0046_F12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PTG01_0103_G08.b : AT*CCCCCCAGACCAGCAGAGGCCGATCCTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
SMG01_0045_E03.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0046_F11.b : AT*CCCCCCAGACCAGCAGGGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
KDN01_0052_H12.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0017_C02.b : AT*CCCCCCAGACCAGCAAAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PCT01_0004_G02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
BKFL1_0079_H02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
MLTL1_0075_G06.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
AMP01_0011_C10.b : AT*CCCCCCAGACCATCTTATGCTGATCTTTGCCGGGAAGCATCTGGAAGAGGGGCGCAC
UTR01_0034_F02.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PTG01_0097_D04.b : AT*CCCCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
ADR01_0014_C10.b : xxxxxxCCCAGACCAGCAGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0066_A11.b : xxxxxxxxxxxxxxxxxxGAGGCTGATCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
OVRM1_0030_A02.b : xxxxxxxxxxxxxxxxxxxxxxxctggCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
PTG01_0042_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTGCCGGGAAGCAGCTGGAAGATGGGCGCAC
BKFL1_0009_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCTGGAAGATGGGCGCAC
PTG01_0032_C04.b : ntttgatcaaacaxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-001761 : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
---------+---------+---------+---------+---------+---------+ 332
THY01_0115_C10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCTCCTGGTCCTCCGCCTCAGAG
THY01_0118_F10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0144_B11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0018_H07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0169_C01.b : CCTGTCTGATTACAACATCCTGAAAGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0096_A07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0027_E05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
THY01_0103_F06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
THY01_0105_C01.b : CCTGTTTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0028_H03.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAAAG
OVRM1_0071_H01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0001_C11.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAAAG
LVR01_0005_C07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LNG01_0013_D04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0089_H08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0075_G09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SKNB1_0078_G12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0081_C01.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0147_E07.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0107_D02.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVR01_0036_A03.b : CCTGTCTGACTACAACATCCAAAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0042_B06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0005_E05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
TES01_0022_D07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SKNB1_0009_C02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAA
PST01_0018_C05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
TES01_0029_F05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0062_E07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SKNB1_0095_G05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0052_B02.b : CCTGTCTGACTACAACATCCAGAAGGAGCCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0032_D01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0057_A08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0066_D01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0019_F12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0076_A09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
TES01_0046_E03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0072_E03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0059_A06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0086_E05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0072_G06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0028_H02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0043_D07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0012_B09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0069_B03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0007_G03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0063_E08.b : CCTGTCTGACTACAACATCCAGAAGGGGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0089_C07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
TES01_0021_A08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SKNB1_0074_B10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0035_D09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0061_C02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0087_H06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0014_F06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0014_A01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
TES01_0066_H01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0080_A09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0026_C06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0052_D12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0080_F03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0096_G02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0063_G08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
TCH01_0080_D07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0078_E01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0084_D08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCCCCGCCTCAGAG
KDN01_0064_D03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0071_B03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0062_E03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0098_E01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0057_A10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0056_D06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0042_G11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0060_H02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0095_A03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0007_C01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0054_B12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0046_C06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0077_D04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0085_B09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0066_B03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0049_C11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0058_H01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
BFLT1_0145_G02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0151_D08.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0152_E09.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SKNB1_0002_G08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0075_C07.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0105_D08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0132_H06.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SKNB1_0003_A12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0095_A12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0020_E03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
CBLT1_0067_A01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
BMWN1_0093_F01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SKNB1_0022_C01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
HTMT1_0119_C05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
ILNT1_0078_B02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
BMWN1_0057_E12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
BMWN1_0019_F11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0006_G11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
HTMT1_0027_D02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
ITT01_0080_G04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCACCGCCTCAGAG
HTMT1_0141_F09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
CLNT1_0032_D02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0128_D09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LNG01_0002_H11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
CBLT1_0028_D04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
ILNT1_0007_D09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SKNB1_0085_E12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0045_B12.b : CCTGTCTGACTACNACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
HTMT1_0076_D12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
CBLT1_0006_G02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SKNB1_0086_H04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0041_A06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
ILNT1_0054_E06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0014_C07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SKNB1_0058_E10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0013_A03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0037_D10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0036_G12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
CBLT1_0060_E09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
CBLT1_0063_A05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0065_A06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
ITT01_0069_F08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0175_H02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0086_D02.b : CCTGTCTGACTACAACATCCATAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCATAA
AMP01_0006_D03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0012_F04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0043_D06.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
ADR01_0015_D01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0093_A02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0009_D04.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0188_B09.b : CCTGTCTGACTACAACATCCAGAAAGAGTCCA*CCCTGGACCTGGTCCTCCGCCTCAAAA
DCI01_0057_B12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0089_D07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
DCI01_0031_A05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0060_D09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0059_D10.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0018_B05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0098_H12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0002_B05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
DCI01_0035_F11.b : CCTGTCTGACTACAGCATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0031_C12.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0097_C02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCGCCTGGTCCTCCGCCTCAGAG
UTR01_0028_E12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0065_A08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
DCI01_0037_F10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
DCI01_0035_E08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SPL01_0030_F05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
DCI01_0044_H01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0069_G07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
UTR01_0044_C06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LNG01_0094_B11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0016_F04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0060_B08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0074_A08.b : CCTGTCTGACTACCACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0088_G09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0032_H01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0055_H06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0096_B09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
UTR01_0103_H09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0027_G05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0068_E02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0023_D03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0068_D11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
DCI01_0011_H03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
CBLT1_0026_E03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0007_E07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0017_H12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0052_H06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0037_D08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0034_D04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0077_D02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
DCI01_0007_E04.b : CCTGTCTGACTACAACATCCAGAGGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0015_H08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCTGCCTCAGAG
AMP01_0056_A10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0080_E01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0122_H09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0084_A02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
DCI01_0041_G10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0050_G06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0054_B12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
DCI01_0113_E01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0004_B09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0007_A09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LNG01_0085_F11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0026_C10.b : CCTGTCTGACTACGACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0131_E06.b : CCTGTCTGACTACAACATCTAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAAAC
OVRM1_0166_A06.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAA
OVRM1_0173_C01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SMG01_0041_F07.b : CCTGTCTGACTACAACATCCAGAAAGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAA
SMG01_0066_C09.b : CCTGTCTGACTACAGCATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0076_C10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0120_D05.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PTG01_0052_A12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0072_A03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0102_E04.b : CCTGTCTGATTACAACATCCAGAATGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCACAG
LVRM1_0058_D02.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0109_F09.b : CCTGTCTGATTACAACATCCCGAAGGAGACCA*CCCTGCACCTGGTCCTCCGCCTCAAAA
OVRM1_0068_F09.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0159_D04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACAGGGTCCTCCGCCTCAAAG
OVRM1_0102_G06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0163_C05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAAAG
OVRM1_0115_D04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SMG01_0096_G06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0026_E11.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0150_G04.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0042_A04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0129_G05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0176_F09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0121_G09.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0066_G09.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0068_C06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SMG01_0057_B11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0174_E02.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0130_D04.b : CCTGTCTGATTACCACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0104_B05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0149_C06.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAA
OVRM1_0152_H02.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0049_C09.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCACAG
OVRM1_0207_G03.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0066_C12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCACAG
OVR01_0083_D08.b : CCTGTCTGACTACAACATCCAGAAGGAGTTCA*CCCTGCACCTGGTCCTTCGCCTCAGAG
OVRT1_0036_H12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0110_A09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCACAG
OVR01_0073_A09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0083_A04.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0195_C04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0061_H06.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAAAG
LVRM1_0039_C03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0164_F10.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0005_A06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0075_B05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0081_G11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0134_G10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0081_G05.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0147_E06.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0040_D04.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0046_A02.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0179_D05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0029_B08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0145_C05.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0172_G08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0165_D03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0095_D01.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0218_G06.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0040_E07.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0130_D05.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0170_B09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0089_H03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0095_A05.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0106_E10.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0081_H04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0061_H01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0033_A07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0092_F10.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0191_A03.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LNG01_0046_G10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0151_F08.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0044_F08.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0133_H08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0047_C08.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0082_D09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0201_B12.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0130_G11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0093_A01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0020_F02.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0030_F01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0128_B08.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0088_H09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0004_B05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0021_A03.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0099_D10.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0131_E10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0153_C01.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0207_B08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LNG01_0036_E09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0148_D08.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0117_C12.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVR01_0089_B12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0152_H11.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0205_F05.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0043_B01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0062_H07.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAAAG
OVRM1_0127_B02.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0038_C06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0005_B02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0202_F06.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0144_E01.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0223_F09.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0140_B03.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0039_F01.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0224_G06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0096_C10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0113_E06.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0077_G03.b : CCTGTCTGACTACNACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAAAG
LVRM1_0139_H05.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVR01_0088_G07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0025_G12.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0107_G12.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0113_H07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0150_H09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0079_C07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SMG01_0013_H05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0114_B07.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0091_G06.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0105_A12.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0083_H11.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
UTR01_0012_A11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0129_G02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LNG01_0107_G02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LNG01_0073_C08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PBL01_0026_D02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0068_F11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SMG01_0067_G01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SMG01_0087_F03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0089_B05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0017_E10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
THY01_0068_F05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PTG01_0019_D06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SPL01_0043_F10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
UTR01_0059_F09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SMG01_0077_H11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAAAG
OVR01_0048_B07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCATAG
OVR01_0050_G03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LNG01_0091_H09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CC*TGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0149_A11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
THY01_0048_B03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LNG01_0110_G10.b : CCTGTCCGACTACAACATCCAGAATGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCATAG
LVR01_0086_H11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
UTR01_0045_B03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0056_C10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SMG01_0037_G10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0150_B03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
UTR01_0015_E11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0103_A04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
UTR01_0019_H08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0049_F08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0070_B05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
UTR01_0020_A02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
ITT01_0085_D08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0139_F08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
UTR01_0039_C03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SMG01_0053_F07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LNG01_0032_E03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
THY01_0045_A08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0148_D06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0105_F01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVR01_0051_G10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVR01_0020_G10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0113_G01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SMG01_0069_F01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
UTR01_0004_C03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVR01_0082_H11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LNG01_0021_E09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0039_G12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0057_A10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0078_B10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCACCGCCTCAGAG
OVR01_0014_A06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVR01_0084_E04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LNG01_0019_G12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
UTR01_0033_G06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0028_H09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVR01_0074_H11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0056_B06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVR01_0059_B02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0133_B11.b : CCTGTCTGACTACAGCATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0125_H10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
ITT01_0095_B09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PTG01_0082_F03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVR01_0078_G01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
ADR01_0030_E09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SMG01_0076_C03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0037_D06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PBL01_0058_H06.b : CCTGTCTGACTACAACATCCAGAGGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SPL01_0058_C11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0024_E03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0005_A07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0027_E02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0002_F10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SMG01_0067_G07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
CLNT1_0009_A08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0031_A12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
BFLT1_0068_G01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
TCH01_0009_E04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0025_D02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0060_D06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0056_F08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
ITT01_0012_E01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
ITT01_0051_B11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVR01_0081_B11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0021_A08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0019_F08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0037_F12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SPL01_0030_B01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0031_D04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
TCH01_0009_A08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
UTR01_0050_A06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LNG01_0020_H01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
MLN01_0026_A05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0037_C04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0040_C09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
THY01_0035_A10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
ITT01_0026_E11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVR01_0011_G05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
BFLT1_0086_A09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
TCH01_0034_B01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
UTR01_0050_B06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
UTR01_0103_G08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LNG01_0034_G08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LNG01_0035_F10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
TCH01_0077_A07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0057_B01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVR01_0096_C03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVR01_0099_E07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0091_F06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVR01_0059_H04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SPL01_0090_G01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
UTR01_0083_F08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
TCH01_0028_F09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LNG01_0074_E01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
CLNT1_0031_G07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
UTR01_0058_E02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
ITT01_0052_D05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
MLN01_0093_H01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
TCH01_0023_C06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVR01_0084_F02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0072_A08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0071_C03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0093_G08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0016_D06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
UTR01_0054_A12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
UTR01_0061_C05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
ITT01_0081_A04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0039_A05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0036_H10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PBL01_0088_E04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
UTR01_0081_B07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0043_F07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
ITT01_0083_A03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
ITT01_0054_E01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
THY01_0125_G10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0133_C05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0086_C02.b : CCTGTCTGAATACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0160_B01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0137_D11.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0092_H02.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0225_D02.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRT1_0104_C02.b : CCTGTCTGACTACGACATCCAGAAGGACTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVR01_0017_D06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0131_G08.b : cccgcctgaccctatatacgtataaggctccncttagccggtggaataggtgcacactga
OVRM1_0048_A10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0117_F07.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0108_B09.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCACAG
OVRM1_0197_B03.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0036_F09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0204_F05.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0004_C09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SPL01_0011_H01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0036_G11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0052_F10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SPL01_0029_C04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
LVRM1_0161_F02.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
TES01_0081_A11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SMG01_0097_E11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCCCAGAG
ADR01_0047_H12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
BFLT1_0126_E08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
ITT01_0095_G04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
HTMT1_0081_D04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
TCH01_0037_E07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PTG01_0055_B01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0046_C01.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0058_C11.b : CCTGTCTGACTACGACATCCATAAGGAGTCCA*CCCTGCACCTGTGCCTCCGCCTCACAG
KDN01_0041_D09.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0073_D07.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PST01_0015_F06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0059_H03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SMG01_0040_B06.b : CCTGTCTGACTANCACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAAAA
OVRM1_0198_F02.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
BKFL1_0032_F11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
UTR01_0046_F12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PTG01_0103_G08.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
SMG01_0045_E03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0046_F11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
KDN01_0052_H12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0017_C02.b : CCTGTCTGATTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PCT01_0004_G02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
BKFL1_0079_H02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
MLTL1_0075_G06.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
AMP01_0011_C10.b : CCTGTCTGACTACCACATCCAGAAGGAGTCCAGCCCTGCACCTGGTCCTCCGCCTCAGAG
UTR01_0034_F02.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PTG01_0097_D04.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
ADR01_0014_C10.b : CCTGTCTGACTACAACATCCAGAAGGAGTCTA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0066_A11.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
OVRM1_0030_A02.b : CCTGTCTGACTACAACATCCACAAGGAGTTCA*CCCTGCACCTGGTCCTCCGCCTCAAAG
PTG01_0042_D03.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
BKFL1_0009_E12.b : CCTGTCTGACTACAACATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
PTG01_0032_C04.b : xxxxxxxxxxxxxxxxATCCAGAAGGAGTCCA*CCCTGCACCTGGTCCTCCGCCTCAGAG
20110601C-001761 : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
---------+---------+---------+---------+---------+---------+ 389
THY01_0115_C10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
THY01_0118_F10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0144_B11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0018_H07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0169_C01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0096_A07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0027_E05.b : GTGGGATGCAG*ATCTTCGTGAGG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
THY01_0103_F06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
THY01_0105_C01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0028_H03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0071_H01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0001_C11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVR01_0005_C07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LNG01_0013_D04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0089_H08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACTATCACCCTG*GAAGTGG
PST01_0075_G09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SKNB1_0078_G12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0081_C01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0147_E07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0107_D02.b : GTGGGATGCAG*ATCTTCCTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVR01_0036_A03.b : GTGGGATGCAT*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0042_B06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0005_E05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
TES01_0022_D07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SKNB1_0009_C02.b : GTGGGATGCAG*ATCTTCCTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0018_C05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
TES01_0029_F05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0062_E07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SKNB1_0095_G05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0052_B02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0032_D01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0057_A08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0066_D01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0019_F12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0076_A09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
TES01_0046_E03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTGAGACCATCACCCTG*GAAGTGG
KDN01_0072_E03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0059_A06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0086_E05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0072_G06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0028_H02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0043_D07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0012_B09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0069_B03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0007_G03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0063_E08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0089_C07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
TES01_0021_A08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SKNB1_0074_B10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0035_D09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0061_C02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0087_H06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0014_F06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0014_A01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
TES01_0066_H01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0080_A09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0026_C06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0052_D12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0080_F03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0096_G02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0063_G08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
TCH01_0080_D07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0078_E01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0084_D08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0064_D03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0071_B03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0062_E03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0098_E01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0057_A10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0056_D06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0042_G11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0060_H02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0095_A03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0007_C01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0054_B12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0046_C06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0077_D04.b : GTGGGGTGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0085_B09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0066_B03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0049_C11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0058_H01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
BFLT1_0145_G02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0151_D08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0152_E09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SKNB1_0002_G08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0075_C07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0105_D08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0132_H06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SKNB1_0003_A12.b : GTGGGACGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0095_A12.b : GTGGGATGCAG*ACCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0020_E03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
CBLT1_0067_A01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
BMWN1_0093_F01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SKNB1_0022_C01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
HTMT1_0119_C05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
ILNT1_0078_B02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
BMWN1_0057_E12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
BMWN1_0019_F11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0006_G11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
HTMT1_0027_D02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
ITT01_0080_G04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
HTMT1_0141_F09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
CLNT1_0032_D02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0128_D09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LNG01_0002_H11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
CBLT1_0028_D04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
ILNT1_0007_D09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SKNB1_0085_E12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0045_B12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
HTMT1_0076_D12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
CBLT1_0006_G02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SKNB1_0086_H04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0041_A06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
ILNT1_0054_E06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0014_C07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SKNB1_0058_E10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0013_A03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0037_D10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0036_G12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
CBLT1_0060_E09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
CBLT1_0063_A05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0065_A06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
ITT01_0069_F08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0175_H02.b : GTGGGATGCAA*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCctggagtggg
OVR01_0086_D02.b : GTGGGATGCCA*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0006_D03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0012_F04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0043_D06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
ADR01_0015_D01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0093_A02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0009_D04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0188_B09.b : GTGGGATGCAG*ATCTTCCTGAAG*ACCTTGACTGGTAAGACCATCACCCTGGGAAGTGG
DCI01_0057_B12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0089_D07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
DCI01_0031_A05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0060_D09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0059_D10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0018_B05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0098_H12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0002_B05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
DCI01_0035_F11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0031_C12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTA*GACCATCACCCTG*GAAGTGG
AMP01_0097_C02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
UTR01_0028_E12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0065_A08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
DCI01_0037_F10.b : GTGGGATGCAG*ATCTTCGTGTAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
DCI01_0035_E08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SPL01_0030_F05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
DCI01_0044_H01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0069_G07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
UTR01_0044_C06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LNG01_0094_B11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0016_F04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0060_B08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0074_A08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*AAAGTGG
AMP01_0088_G09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0032_H01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0055_H06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0096_B09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGGCCATCACCCTG*GAAGTGG
UTR01_0103_H09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0027_G05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0068_E02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGGCCATCACCCTG*GAAGTGG
AMP01_0023_D03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0068_D11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
DCI01_0011_H03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
CBLT1_0026_E03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0007_E07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0017_H12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0052_H06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0037_D08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0034_D04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0077_D02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
DCI01_0007_E04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0015_H08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0056_A10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0080_E01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0122_H09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0084_A02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
DCI01_0041_G10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0050_G06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0054_B12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
DCI01_0113_E01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0004_B09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0007_A09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LNG01_0085_F11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0026_C10.b : GTGGGATGCAGAATCTTCGTGAAG*ACCcttgactgggtaatgaccatcaccctgggaat
LVRM1_0131_E06.b : GTGGGATGCAA*ATCTTCGTGAAG*ACCTTGACCGGCAAGACCACCTCCCTG*GAtttgg
OVRM1_0166_A06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTGGTAAGTGG
OVRM1_0173_C01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SMG01_0041_F07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGNTAGACCATCACCCTG*GAAGTGG
SMG01_0066_C09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCCATCACCTG*NAAGTGG
OVRM1_0076_C10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0120_D05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCAACCTG*GAAGTGG
PTG01_0052_A12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0072_A03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0102_E04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0058_D02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0109_F09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGGAAGACCATCACCCTG*GAAGTGG
OVRM1_0068_F09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0159_D04.b : GTGGGATGCAG*ATCTTCGTGAAGTACCTTGACTGGTAAGACCATCACACTG*GAAGTGG
OVRM1_0102_G06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0163_C05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0115_D04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SMG01_0096_G06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0026_E11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0150_G04.b : GCGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAGGTGG
LVRM1_0042_A04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0129_G05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0176_F09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0121_G09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0066_G09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0068_C06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SMG01_0057_B11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0174_E02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0130_D04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0104_B05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0149_C06.b : GTGGGATGCAG*ATCTTCCTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0152_H02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0049_C09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0207_G03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0066_C12.b : GTGGGATGCAG*ATCTTCTTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0083_D08.b : GTGGGATGCAG*ATCTTCGTGAAG*ATCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0036_H12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0110_A09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0073_A09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0083_A04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0195_C04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0061_H06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0039_C03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0164_F10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0005_A06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0075_B05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0081_G11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0134_G10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0081_G05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*AAAGTGG
OVRM1_0147_E06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0040_D04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0046_A02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0179_D05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0029_B08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0145_C05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0172_G08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0165_D03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0095_D01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0218_G06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0040_E07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0130_D05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0170_B09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0089_H03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0095_A05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GGAGTGG
LVRM1_0106_E10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0081_H04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0061_H01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0033_A07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0092_F10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0191_A03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LNG01_0046_G10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0151_F08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0044_F08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0133_H08.b : GTGGGATGCAG*ATCTTCGTGAAG*GCCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0047_C08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0082_D09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0201_B12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0130_G11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0093_A01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATAACCCTG*GAAGTGG
OVRM1_0020_F02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0030_F01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0128_B08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0088_H09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0004_B05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0021_A03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0099_D10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0131_E10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0153_C01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0207_B08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LNG01_0036_E09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0148_D08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0117_C12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVR01_0089_B12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0152_H11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0205_F05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0043_B01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0062_H07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0127_B02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0038_C06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0005_B02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0202_F06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0144_E01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0223_F09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0140_B03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0039_F01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0224_G06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0096_C10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0113_E06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0077_G03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0139_H05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVR01_0088_G07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0025_G12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0107_G12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0113_H07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0150_H09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0079_C07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SMG01_0013_H05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0114_B07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0091_G06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0105_A12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0083_H11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
UTR01_0012_A11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0129_G02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LNG01_0107_G02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LNG01_0073_C08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PBL01_0026_D02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0068_F11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SMG01_0067_G01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SMG01_0087_F03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0089_B05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0017_E10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
THY01_0068_F05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PTG01_0019_D06.b : GTGGGATGCAG*GTCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SPL01_0043_F10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
UTR01_0059_F09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SMG01_0077_H11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0048_B07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0050_G03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LNG01_0091_H09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0149_A11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
THY01_0048_B03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LNG01_0110_G10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVR01_0086_H11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
UTR01_0045_B03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0056_C10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SMG01_0037_G10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0150_B03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
UTR01_0015_E11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*AAAGTGG
OVRT1_0103_A04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
UTR01_0019_H08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0049_F08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0070_B05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
UTR01_0020_A02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
ITT01_0085_D08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0139_F08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
UTR01_0039_C03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SMG01_0053_F07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LNG01_0032_E03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
THY01_0045_A08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0148_D06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0105_F01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVR01_0051_G10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVR01_0020_G10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0113_G01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SMG01_0069_F01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
UTR01_0004_C03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVR01_0082_H11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LNG01_0021_E09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0039_G12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0057_A10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0078_B10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0014_A06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVR01_0084_E04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LNG01_0019_G12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
UTR01_0033_G06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0028_H09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVR01_0074_H11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0056_B06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVR01_0059_B02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0133_B11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0125_H10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
ITT01_0095_B09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PTG01_0082_F03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVR01_0078_G01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
ADR01_0030_E09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SMG01_0076_C03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0037_D06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PBL01_0058_H06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SPL01_0058_C11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0024_E03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0005_A07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0027_E02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0002_F10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SMG01_0067_G07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
CLNT1_0009_A08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0031_A12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
BFLT1_0068_G01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
TCH01_0009_E04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0025_D02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0060_D06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0056_F08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
ITT01_0012_E01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
ITT01_0051_B11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVR01_0081_B11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0021_A08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0019_F08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0037_F12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SPL01_0030_B01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0031_D04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
TCH01_0009_A08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
UTR01_0050_A06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LNG01_0020_H01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
MLN01_0026_A05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0037_C04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0040_C09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
THY01_0035_A10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
ITT01_0026_E11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVR01_0011_G05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
BFLT1_0086_A09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
TCH01_0034_B01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
UTR01_0050_B06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
UTR01_0103_G08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LNG01_0034_G08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LNG01_0035_F10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
TCH01_0077_A07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0057_B01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVR01_0096_C03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVR01_0099_E07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0091_F06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVR01_0059_H04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SPL01_0090_G01.b : GTGGGATGCAA*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
UTR01_0083_F08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
TCH01_0028_F09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LNG01_0074_E01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
CLNT1_0031_G07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
UTR01_0058_E02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
ITT01_0052_D05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
MLN01_0093_H01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
TCH01_0023_C06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVR01_0084_F02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0072_A08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0071_C03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0093_G08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0016_D06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
UTR01_0054_A12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
UTR01_0061_C05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
ITT01_0081_A04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0039_A05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0036_H10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PBL01_0088_E04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
UTR01_0081_B07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0043_F07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
ITT01_0083_A03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
ITT01_0054_E01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
THY01_0125_G10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0133_C05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVR01_0086_C02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0160_B01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0137_D11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0092_H02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0225_D02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRT1_0104_C02.b : GTGGGATGCAG*ATCTTCCTGAAG*ACCTTGACTGGTAACACCATCACCCTG*GAAGTGG
OVR01_0017_D06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0131_G08.b : catcccgttgataacccatgaaatatgccgacgcccactctacccctatcataatccctt
OVRM1_0048_A10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0117_F07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0108_B09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0197_B03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0036_F09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0204_F05.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0004_C09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SPL01_0011_H01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0036_G11.b : GTGGGATGCAG*ATCATCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0052_F10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SPL01_0029_C04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
LVRM1_0161_F02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
TES01_0081_A11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SMG01_0097_E11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
ADR01_0047_H12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
BFLT1_0126_E08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
ITT01_0095_G04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
HTMT1_0081_D04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
TCH01_0037_E07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PTG01_0055_B01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0046_C01.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0058_C11.b : GTGGGATGCAG*ATCTTCGGGAAT*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0041_D09.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0073_D07.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PST01_0015_F06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0059_H03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SMG01_0040_B06.b : GTGGGATGCAG*ATCTTCTTGAAA*ACTTTGACTGGTNAGAACTTCCACCTG*TGAGTTG
OVRM1_0198_F02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
BKFL1_0032_F11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
UTR01_0046_F12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PTG01_0103_G08.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
SMG01_0045_E03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0046_F11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
KDN01_0052_H12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0017_C02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PCT01_0004_G02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
BKFL1_0079_H02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
MLTL1_0075_G06.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
AMP01_0011_C10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCGCCCTG*GAAATGG
UTR01_0034_F02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PTG01_0097_D04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
ADR01_0014_C10.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0066_A11.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
OVRM1_0030_A02.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PTG01_0042_D03.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
BKFL1_0009_E12.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
PTG01_0032_C04.b : GTGGGATGCAG*ATCTTCGTGAAG*ACCTTGACTGGTAAGACCATCACCCTG*GAAGTGG
20110601C-001761 : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
---------+---------+---------+---------+---------+---------+ 445
THY01_0115_C10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*T
THY01_0118_F10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0144_B11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0018_H07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0169_C01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0096_A07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0027_E05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
THY01_0103_F06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
THY01_0105_C01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0028_H03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0071_H01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0001_C11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVR01_0005_C07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LNG01_0013_D04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0089_H08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0075_G09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SKNB1_0078_G12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0081_C01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0147_E07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0107_D02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVR01_0036_A03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0042_B06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0005_E05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
TES01_0022_D07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SKNB1_0009_C02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATTCA*GGACAAGGAAGGGAT*C
PST01_0018_C05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
TES01_0029_F05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0062_E07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SKNB1_0095_G05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0052_B02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0032_D01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0057_A08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0066_D01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0019_F12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0076_A09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
TES01_0046_E03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0072_E03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0059_A06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0086_E05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0072_G06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0028_H02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0043_D07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0012_B09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0069_B03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0007_G03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0063_E08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0089_C07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
TES01_0021_A08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SKNB1_0074_B10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0035_D09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0061_C02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0087_H06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0014_F06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0014_A01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
TES01_0066_H01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0080_A09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0026_C06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0052_D12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0080_F03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0096_G02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0063_G08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
TCH01_0080_D07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0078_E01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0084_D08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0064_D03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0071_B03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0062_E03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0098_E01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0057_A10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0056_D06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0042_G11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0060_H02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0095_A03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0007_C01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0054_B12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0046_C06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0077_D04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0085_B09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0066_B03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0049_C11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0058_H01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
BFLT1_0145_G02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0151_D08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0152_E09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SKNB1_0002_G08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGTGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0075_C07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0105_D08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0132_H06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SKNB1_0003_A12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0095_A12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0020_E03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
CBLT1_0067_A01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
BMWN1_0093_F01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SKNB1_0022_C01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
HTMT1_0119_C05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
ILNT1_0078_B02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
BMWN1_0057_E12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
BMWN1_0019_F11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0006_G11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
HTMT1_0027_D02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
ITT01_0080_G04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
HTMT1_0141_F09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
CLNT1_0032_D02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0128_D09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LNG01_0002_H11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
CBLT1_0028_D04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
ILNT1_0007_D09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SKNB1_0085_E12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0045_B12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
HTMT1_0076_D12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
CBLT1_0006_G02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SKNB1_0086_H04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0041_A06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
ILNT1_0054_E06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0014_C07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SKNB1_0058_E10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0013_A03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0037_D10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0036_G12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAC*C
CBLT1_0060_E09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
CBLT1_0063_A05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0065_A06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
ITT01_0069_F08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0175_H02.b : agcccatcgacaaccatctagaacgccagggcgaaaatccaagactaggaaggcatcccc
OVR01_0086_D02.b : AGCCCcagcgacccctctaagaacgttctatgctaaaattctcgaccaagaatgctttct
AMP01_0006_D03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAACATCCA*GGACAAGGAAGGCAT*C
AMP01_0012_F04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*AGACAAGGAAGGCAT*C
OVRM1_0043_D06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAATATCCA*GGACAAGGAAGGCAT*C
ADR01_0015_D01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0093_A02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0009_D04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0188_B09.b : AGCCCAGCGACACC*CTCGAGAACGTCCAGGGCGAAGATCCA*AGACCAGGAAGGCATCC
DCI01_0057_B12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0089_D07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
DCI01_0031_A05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0060_D09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0059_D10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0018_B05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0098_H12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0002_B05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
DCI01_0035_F11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0031_C12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0097_C02.b : AGCCCAGCGACGCC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
UTR01_0028_E12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0065_A08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
DCI01_0037_F10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
DCI01_0035_E08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SPL01_0030_F05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
DCI01_0044_H01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0069_G07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
UTR01_0044_C06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LNG01_0094_B11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0016_F04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0060_B08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0074_A08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0088_G09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0032_H01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0055_H06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0096_B09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
UTR01_0103_H09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0027_G05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0068_E02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0023_D03.b : AGCCCAGCGACGCC*ATCGAGAACGTC*TAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0068_D11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
DCI01_0011_H03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
CBLT1_0026_E03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0007_E07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0017_H12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0052_H06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0037_D08.b : GGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0034_D04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0077_D02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
DCI01_0007_E04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0015_H08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0056_A10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0080_E01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0122_H09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0084_A02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
DCI01_0041_G10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0050_G06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0054_B12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
DCI01_0113_E01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0004_B09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0007_A09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LNG01_0085_F11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0026_C10.b : tgtgagcccagcgacaccttccagaacgtcggggcggaagatccaggacccggaaaggct
LVRM1_0131_E06.b : aatttaccttacccctctcagaatgtgcaggcgaaaatccattgactagtgcggcatcac
OVRM1_0166_A06.b : AGCCCAACGACACCCATCGAGAACGTC*TAGGCGAAGATCCAAGGACAAGGAAGGCAT*C
OVRM1_0173_C01.b : AGCCCAGCGACTACCATCGAGAACGTC*AAGGCCAAGATCCA*TGACAAGGAACGCAT*C
SMG01_0041_F07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCC*AGACAAG*AAGGCAT*C
SMG01_0066_C09.b : AGCCCAGCGACACT*ATCGAGAATGTC*AAGGCGAAGATCCA*NGACNAGGAAGGCAT*C
OVRM1_0076_C10.b : AGCCCAGCGACACC*ATCGAGAACGTT*AAGGCGAAGATCCA*GGACACGGAAGGCAT*C
OVRM1_0120_D05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PTG01_0052_A12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0072_A03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*TGACAAGGAAGGCAT*C
OVRM1_0102_E04.b : AGCCCAGCGACACC*ATCTAGAACGTC*AAGGTGAACATCCA*TGATAAGGAAGGTAT*C
LVRM1_0058_D02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0109_F09.b : AGCCCAGCGACACC*ATCCAGAAAGTC*CAGGCGAAAATCCC*GGACAAGGAAGGCAT*C
OVRM1_0068_F09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0159_D04.b : AGCCCAGCGACACC*ATCGAGAACATC*ACGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0102_G06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0163_C05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAATGCAT*C
OVRM1_0115_D04.b : AGCCCATCGACACC*ATCTAGAACGTC*AAGGCGAAGATCCA*TGACAAGGAAGGCAT*C
SMG01_0096_G06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0026_E11.b : AGCCCAGCGACACC*ATTGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*T
LVRM1_0150_G04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0042_A04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0129_G05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0176_F09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0121_G09.b : AGCCCAGCGACACC*ATCTAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0066_G09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0068_C06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*TGACAAGGAAGGCAT*C
SMG01_0057_B11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0174_E02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0130_D04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0104_B05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0149_C06.b : AGCCCAGCGACACC*ATCCAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0152_H02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0049_C09.b : AGCCCATAGACACC*ATCGAGAACGCTCAAGGTGAATATCCA*GGACAAGGAAGGCAT*C
OVRM1_0207_G03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACTAGGAAGGCAT*C
OVRM1_0066_C12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0083_D08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0036_H12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0110_A09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0073_A09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0083_A04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0195_C04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0061_H06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0039_C03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0164_F10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0005_A06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0075_B05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0081_G11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0134_G10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0081_G05.b : AGCCCAGCAACACC*ATCGAGAACGAC*AACGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0147_E06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0040_D04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0046_A02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0179_D05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0029_B08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0145_C05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0172_G08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0165_D03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0095_D01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0218_G06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0040_E07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0130_D05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0170_B09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0089_H03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0095_A05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0106_E10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0081_H04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0061_H01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0033_A07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0092_F10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0191_A03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LNG01_0046_G10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0151_F08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0044_F08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0133_H08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0047_C08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0082_D09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0201_B12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0130_G11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0093_A01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0020_F02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0030_F01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0128_B08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0088_H09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0004_B05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0021_A03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0099_D10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0131_E10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0153_C01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0207_B08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LNG01_0036_E09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0148_D08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0117_C12.b : AGCCCAGCGACATC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVR01_0089_B12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0152_H11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0205_F05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0043_B01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0062_H07.b : AGCCCAGCGACACC*NTCGAGAACGTC*NAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0127_B02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0038_C06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0005_B02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0202_F06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0144_E01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0223_F09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0140_B03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0039_F01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0224_G06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0096_C10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0113_E06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0077_G03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0139_H05.b : AGCCCAGCGACACC*CTCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCATCC
LVR01_0088_G07.b : ACCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAAGCAT*C
OVRM1_0025_G12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0107_G12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0113_H07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0150_H09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0079_C07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SMG01_0013_H05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0114_B07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0091_G06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0105_A12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0083_H11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
UTR01_0012_A11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0129_G02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LNG01_0107_G02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LNG01_0073_C08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PBL01_0026_D02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0068_F11.b : AGCCCAGCGACGCC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SMG01_0067_G01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SMG01_0087_F03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0089_B05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0017_E10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
THY01_0068_F05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PTG01_0019_D06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SPL01_0043_F10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
UTR01_0059_F09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SMG01_0077_H11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0048_B07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0050_G03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LNG01_0091_H09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0149_A11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
THY01_0048_B03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LNG01_0110_G10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVR01_0086_H11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
UTR01_0045_B03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0056_C10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SMG01_0037_G10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0150_B03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
UTR01_0015_E11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0103_A04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
UTR01_0019_H08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0049_F08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0070_B05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
UTR01_0020_A02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
ITT01_0085_D08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0139_F08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
UTR01_0039_C03.b : AGCCCATCGACACC*ATCGAAAACGTC*AAGGCGAAAATCCA*GGACAAGGAAGGCAT*C
SMG01_0053_F07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LNG01_0032_E03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
THY01_0045_A08.b : AGCCCAGCGACACC*ATCGAGAATGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0148_D06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0105_F01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVR01_0051_G10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVR01_0020_G10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0113_G01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SMG01_0069_F01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
UTR01_0004_C03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVR01_0082_H11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LNG01_0021_E09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0039_G12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0057_A10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0078_B10.b : AGCCCGGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0014_A06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVR01_0084_E04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LNG01_0019_G12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
UTR01_0033_G06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0028_H09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVR01_0074_H11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0056_B06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVR01_0059_B02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0133_B11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0125_H10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
ITT01_0095_B09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PTG01_0082_F03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVR01_0078_G01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
ADR01_0030_E09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SMG01_0076_C03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0037_D06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PBL01_0058_H06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SPL01_0058_C11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0024_E03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0005_A07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0027_E02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0002_F10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SMG01_0067_G07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
CLNT1_0009_A08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0031_A12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
BFLT1_0068_G01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
TCH01_0009_E04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCG*GGACAAGGAAGGCAT*C
OVRT1_0025_D02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0060_D06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0056_F08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
ITT01_0012_E01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAGGATCCA*GGACAAGGAAGGCAT*C
ITT01_0051_B11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVR01_0081_B11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACGAGGAAGGCAT*C
OVRT1_0021_A08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0019_F08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0037_F12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SPL01_0030_B01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0031_D04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
TCH01_0009_A08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
UTR01_0050_A06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LNG01_0020_H01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
MLN01_0026_A05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0037_C04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0040_C09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
THY01_0035_A10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
ITT01_0026_E11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVR01_0011_G05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
BFLT1_0086_A09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
TCH01_0034_B01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
UTR01_0050_B06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
UTR01_0103_G08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LNG01_0034_G08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LNG01_0035_F10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
TCH01_0077_A07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0057_B01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVR01_0096_C03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVR01_0099_E07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0091_F06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVR01_0059_H04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SPL01_0090_G01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
UTR01_0083_F08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
TCH01_0028_F09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCG*GGACAAGGAAGGCAT*C
LNG01_0074_E01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
CLNT1_0031_G07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
UTR01_0058_E02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
ITT01_0052_D05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
MLN01_0093_H01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
TCH01_0023_C06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVR01_0084_F02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0072_A08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0071_C03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0093_G08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0016_D06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
UTR01_0054_A12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
UTR01_0061_C05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
ITT01_0081_A04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVR01_0039_A05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0036_H10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PBL01_0088_E04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
UTR01_0081_B07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0043_F07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
ITT01_0083_A03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
ITT01_0054_E01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
THY01_0125_G10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0133_C05.b : AGTCCAGCGACACC*ATCGAGAACGTC*AAGGCGAATATCCA*GGACAAGGAAGGCAT*C
OVR01_0086_C02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAAATCCA*GGACAAGGAATGCAT*C
OVRM1_0160_B01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0137_D11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGTAGATCCC*GGACAAGGAAGGCAT*C
LVRM1_0092_H02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0225_D02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRT1_0104_C02.b : AGCCCAGCGACACC*ATCTAGAACGTC*AAGGCGAACATCCA*GGACAAGGAAGGCAT*C
OVR01_0017_D06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0131_G08.b : tatcctatacacccgtgaccgattgcactaaaaaccacatattttcaaaccacctttata
OVRM1_0048_A10.b : AGCCCAGCGACACC*ATCGAGCACGTC*AAGGCGAAGATCCC*GGACAAGGAAGGCAT*C
OVRM1_0117_F07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0108_B09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0197_B03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0036_F09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0204_F05.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0004_C09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SPL01_0011_H01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0036_G11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0052_F10.b : AGCCCAGCGACACC*ATCGAGAACGCC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SPL01_0029_C04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
LVRM1_0161_F02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
TES01_0081_A11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SMG01_0097_E11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
ADR01_0047_H12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
BFLT1_0126_E08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
ITT01_0095_G04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
HTMT1_0081_D04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
TCH01_0037_E07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PTG01_0055_B01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0046_C01.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0058_C11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*CGACAAGGAAGGCAT*C
KDN01_0041_D09.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0073_D07.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PST01_0015_F06.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0059_H03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
SMG01_0040_B06.b : AGCCCAACGACACCCctcgagaacgttaggcgaaaatcccggaaaaagaagggttccccc
OVRM1_0198_F02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
BKFL1_0032_F11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
UTR01_0046_F12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PTG01_0103_G08.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAATATCCA*GGACAAGGAAGGCAT*C
SMG01_0045_E03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0046_F11.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
KDN01_0052_H12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0017_C02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PCT01_0004_G02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
BKFL1_0079_H02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
MLTL1_0075_G06.b : AGCCCAGCGACACC*ATCGAGAAACGT*CAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
AMP01_0011_C10.b : AGCCCATCGACACC*ATCCAGAACGTC*AAGGCGAATATCCA*GGACAAGGAAGGCAT*C
UTR01_0034_F02.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PTG01_0097_D04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
ADR01_0014_C10.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*AGACAAGGAAGGCAT*C
OVRM1_0066_A11.b : AGCCCAGCGACACC*ATCGAGAACGTC*CAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
OVRM1_0030_A02.b : AGCCCAACGACACC*ATCGAGAACGCC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
PTG01_0042_D03.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGGAT*C
BKFL1_0009_E12.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*AGACAAGGAAGGCAT*C
PTG01_0032_C04.b : AGCCCAGCGACACC*ATCGAGAACGTC*AAGGCGAAGATCCA*GGACAAGGAAGGCAT*C
20110601C-001761 : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
---------+---------+---------+---------+---------+---------+ 502
THY01_0115_C10.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
THY01_0118_F10.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0144_B11.b : CCCCCACACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVR01_0018_H07.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
LVRM1_0169_C01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0096_A07.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVR01_0027_E05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
THY01_0103_F06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
THY01_0105_C01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
LVRM1_0028_H03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0071_H01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0001_C11.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVR01_0005_C07.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
LNG01_0013_D04.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
PST01_0089_H08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
PST01_0075_G09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
SKNB1_0078_G12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
LVRM1_0081_C01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0147_E07.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0107_D02.b : CCCCCACACCAGCACAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVR01_0036_A03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
OVR01_0042_B06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
OVRM1_0005_E05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
TES01_0022_D07.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
SKNB1_0009_C02.b : CCCCCAGAACAGCAGAAGCTGATCTT*TGCC*GGGAAGCAACTGGAAGATGGGCGCA*CT
PST01_0018_C05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
TES01_0029_F05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
PST01_0062_E07.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
SKNB1_0095_G05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
KDN01_0052_B02.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
KDN01_0032_D01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
KDN01_0057_A08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
PST01_0066_D01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
PST01_0019_F12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
PST01_0076_A09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
TES01_0046_E03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
KDN01_0072_E03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
KDN01_0059_A06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
KDN01_0086_E05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
PST01_0072_G06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
PST01_0028_H02.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
KDN01_0043_D07.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
PST01_0012_B09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
KDN01_0069_B03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
KDN01_0007_G03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
KDN01_0063_E08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
PST01_0089_C07.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
TES01_0021_A08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGACGGGCGCA*CT
SKNB1_0074_B10.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
PST01_0035_D09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
KDN01_0061_C02.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
PST01_0087_H06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
PST01_0014_F06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
PST01_0014_A01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
TES01_0066_H01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
PST01_0080_A09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
KDN01_0026_C06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
KDN01_0052_D12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
KDN01_0080_F03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
PST01_0096_G02.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
PST01_0063_G08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
TCH01_0080_D07.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
KDN01_0078_E01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
PST01_0084_D08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
KDN01_0064_D03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
PST01_0071_B03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
KDN01_0062_E03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
PST01_0098_E01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
PST01_0057_A10.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
PST01_0056_D06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
KDN01_0042_G11.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
KDN01_0060_H02.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
KDN01_0095_A03.b : CCCCCAGACCGGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
PST01_0007_C01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
KDN01_0054_B12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
PST01_0046_C06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
KDN01_0077_D04.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
PST01_0085_B09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
KDN01_0066_B03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
KDN01_0049_C11.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
KDN01_0058_H01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
BFLT1_0145_G02.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0151_D08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0152_E09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
SKNB1_0002_G08.b : CCCCCAGACCAGCAGAGGCTGATCTTCTGCCCCGGAAGCAGCTGGAAGATGGGCGCA*CT
OVRM1_0075_C07.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0105_D08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0132_H06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
SKNB1_0003_A12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
OVRM1_0095_A12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
KDN01_0020_E03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
CBLT1_0067_A01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
BMWN1_0093_F01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
SKNB1_0022_C01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
HTMT1_0119_C05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
ILNT1_0078_B02.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
BMWN1_0057_E12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
BMWN1_0019_F11.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
PST01_0006_G11.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
HTMT1_0027_D02.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
ITT01_0080_G04.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
HTMT1_0141_F09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
CLNT1_0032_D02.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRT1_0128_D09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LNG01_0002_H11.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
CBLT1_0028_D04.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
ILNT1_0007_D09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
SKNB1_0085_E12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
OVR01_0045_B12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
HTMT1_0076_D12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
CBLT1_0006_G02.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
SKNB1_0086_H04.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
KDN01_0041_A06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
ILNT1_0054_E06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
PST01_0014_C07.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
SKNB1_0058_E10.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
PST01_0013_A03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
OVRT1_0037_D10.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
KDN01_0036_G12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
CBLT1_0060_E09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
CBLT1_0063_A05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
KDN01_0065_A06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
ITT01_0069_F08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
OVRM1_0175_H02.b : cccaatacaccataaggccgatctttgcccggaatacactggaagaacgggcgctacctg
OVR01_0086_D02.b : ccctccaccatcctacgctgattttttccctggaaccatctggaaaaatgggctccctct
AMP01_0006_D03.b : CCCCaaaacaacctaaggctattctttcccggtaaccacttggaaattggctccactctg
AMP01_0012_F04.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0043_D06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
ADR01_0015_D01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
AMP01_0093_A02.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0009_D04.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCACA*CC
OVRM1_0188_B09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCCNGGGAAGCAGCTGGGAAAATGGCGCAACC
DCI01_0057_B12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0089_D07.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
DCI01_0031_A05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
AMP01_0060_D09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
OVRM1_0059_D10.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0018_B05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0098_H12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0002_B05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
DCI01_0035_F11.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0031_C12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
AMP01_0097_C02.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
UTR01_0028_E12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
AMP01_0065_A08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
DCI01_0037_F10.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
DCI01_0035_E08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAACTGGAAGATGGGCGCA*CT
SPL01_0030_F05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
DCI01_0044_H01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
AMP01_0069_G07.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
UTR01_0044_C06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
LNG01_0094_B11.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
AMP01_0016_F04.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
AMP01_0060_B08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
AMP01_0074_A08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCATCTGGAAGATGGGCGCA*CC
AMP01_0088_G09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAGGATGGGCGCA*CT
OVR01_0032_H01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
AMP01_0055_H06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
AMP01_0096_B09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
UTR01_0103_H09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
AMP01_0027_G05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
AMP01_0068_E02.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
AMP01_0023_D03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
AMP01_0068_D11.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
DCI01_0011_H03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
CBLT1_0026_E03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRT1_0007_E07.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
AMP01_0017_H12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
AMP01_0052_H06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
AMP01_0037_D08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
AMP01_0034_D04.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
AMP01_0077_D02.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
DCI01_0007_E04.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
AMP01_0015_H08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
AMP01_0056_A10.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
AMP01_0080_E01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRT1_0122_H09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
AMP01_0084_A02.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
DCI01_0041_G10.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
AMP01_0050_G06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
AMP01_0054_B12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
DCI01_0113_E01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVR01_0004_B09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
OVRT1_0007_A09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LNG01_0085_F11.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0026_C10.b : tccccccccaaccatcagtaggatgatactttccctggaagcaaattgaaatataggggc
LVRM1_0131_E06.b : ctatatacatcacaggctgttcattgatcgctattctaacgcgtacacggtttgtttttt
OVRM1_0166_A06.b : CCCCCCCAaaccagcagaagctgatcttttgccgggaaagcaactggaaaaatggggccc
OVRM1_0173_C01.b : CCCTCATACCAGCAGAGGCTGATCTT*TGCC*GGGAAACAGCTGGAAGATGCGCGCA*CC
SMG01_0041_F07.b : CCCCAAAAC*AGCCGAGGCTGATCTT*TGCC*GGGAAGCANCTGGAAAATGGGCGCA*CC
SMG01_0066_C09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAACANCTGGGAAAATGGGCCC*AC
OVRM1_0076_C10.b : CCCCCATACCATCAGAGGCTGATCTT*TGAC*GGTAATCAGCTGGAATATGGGCACT*CC
OVRM1_0120_D05.b : CCCCCATACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGAAAGATGGGCGCC*AC
PTG01_0052_A12.b : CCCCCAGACCAGCAGAAGCTGATCTT*TGCCGGGGAAGCAACTGAAAGATGGGCGCA*CC
LVRM1_0072_A03.b : CCCCCAGACCAGCATAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0102_E04.b : TCCCCATACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCATCTGGAAGATGGGCGCA*CC
LVRM1_0058_D02.b : CCCCCAAACCAGCATAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0109_F09.b : CCCCCCCACCCGCACAAGCTGATCTT*TTCC*CGGAAGCACCTGGAAAATGGGCGCA*CC
OVRM1_0068_F09.b : CCCCCAGACCAGCATAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAACATGGACGCA*CC
OVRM1_0159_D04.b : CCCCCACACCACCATAGGCTGATCTT*TGCC*CGGAGACAGCTGGAAGATGGGCGCA*CC
OVRM1_0102_G06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0163_C05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAATATGGGCGCA*CC
OVRM1_0115_D04.b : CCCCCATACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
SMG01_0096_G06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GG*AAGCAGCTGGAAGATGGGCGCA*CT
OVRM1_0026_E11.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0150_G04.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0042_A04.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0129_G05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0176_F09.b : CCCCCAGACCACCAGAGGCTGATCTT*TGCC*GGGAAGCCACTGGAAGATGGGCGCA*CC
OVRM1_0121_G09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0066_G09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0068_C06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
SMG01_0057_B11.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
LVRM1_0174_E02.b : CCCCCAGACCAGCAAAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0130_D04.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVR01_0104_B05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAAATGGGCGCA*CT
OVRM1_0149_C06.b : CCCCCCGAACAACAGAAGCTGATCTT*TGCC*GGGAAGCAACTGGAAGATGGGCGCA*CC
OVRM1_0152_H02.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0049_C09.b : CCCCCACACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0207_G03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0066_C12.b : CCCCCAGACCAGCATAGGCTGATCTT*TGCC*GGGAAGTAGCTGGAAGATGGGTGCA*CC
OVR01_0083_D08.b : CCCCCCGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAAATGGGCGCA*CT
OVRT1_0036_H12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0110_A09.b : CCCCCACACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVR01_0073_A09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
LVRM1_0083_A04.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0195_C04.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGTC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0061_H06.b : CCCCCCCACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCANCTGGAAGATGGGCGCA*CC
LVRM1_0039_C03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0164_F10.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0005_A06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVR01_0075_B05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
OVR01_0081_G11.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
OVRM1_0134_G10.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0081_G05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGCAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0147_E06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0040_D04.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0046_A02.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0179_D05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRT1_0029_B08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0145_C05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0172_G08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0165_D03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0095_D01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0218_G06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0040_E07.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0130_D05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0170_B09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0089_H03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0095_A05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0106_E10.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVR01_0081_H04.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
OVR01_0061_H01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
LVRM1_0033_A07.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0092_F10.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0191_A03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LNG01_0046_G10.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
LVRM1_0151_F08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0044_F08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0133_H08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0047_C08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0082_D09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0201_B12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0130_G11.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0093_A01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0020_F02.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0030_F01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0128_B08.b : CCCCCCGACCAGCAGAAGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0088_H09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0004_B05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0021_A03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0099_D10.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0131_E10.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0153_C01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0207_B08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LNG01_0036_E09.b : CCCCCACACCATCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
LVRM1_0148_D08.b : CCCCCCGACCAGCAGAAGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0117_C12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVR01_0089_B12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0152_H11.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0205_F05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0043_B01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0062_H07.b : CCCCCAGACCAGCAAAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0127_B02.b : CCTCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0038_C06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0005_B02.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0202_F06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0144_E01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0223_F09.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0140_B03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGAAAGATGGGCGCA*CC
OVRM1_0039_F01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0224_G06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0096_C10.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0113_E06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0077_G03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0139_H05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVR01_0088_G07.b : CCCCCATACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
OVRM1_0025_G12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0107_G12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0113_H07.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LVRM1_0150_H09.b : CCCCCCGACCAGCAGAAGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0079_C07.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
SMG01_0013_H05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0114_B07.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0091_G06.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0105_A12.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRM1_0083_H11.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
UTR01_0012_A11.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
OVRT1_0129_G02.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LNG01_0107_G02.b : CCCCCAGACGAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
LNG01_0073_C08.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
PBL01_0026_D02.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVR01_0068_F11.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
SMG01_0067_G01.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CT
SMG01_0087_F03.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRT1_0089_B05.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
OVRT1_0017_E10.b : CCCCCAGACCAGCAGAGGCTGATCTT*TGCC*GGGAAGCAGCTGGAAGATGGGCGCA*CC
THY01_0068_F05.b : CCCCCAGACCAGCAGAGGCT