[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-001812

Length: 1,328

Sequence [FASTA format sequence]
TGATTCTCTG CTGTCAGGCA CGCGGTCGCT GGGCAACGGC TCTTCAGCGG ACAGCTCTCC
AAACCAACCC CAGCGCCCCT TCTCTACTTT CCCTTCAGCC CTAGAGCGGC ATCCTGGAGC
CAGGCCCTCA GCAGGTGGGG CCCGCGCCTT TGCACTCAGC CCGGAGGCTC GCGGCGAGAG
TGCTGCTAGT GGGCACCCAA CCCATTCTGC GTCGCATCGG CTGCCAGCAT TGCGCAGACC
TTCGGCCTCG CGTTTGGGAG AAACCAGACC CATCCGCTGT CCGTGCAGAG GCACCGCTGC
CCCGCTCCCG ACCATGTCGT CCAACATTCG CGTGGCGGTG GTGACCGGCG GCAACAAGGG
CATCGGCCTC GCCATCGTGC GTGATCTGTG CCAGCAGTTC TCGGGGGATG TGATGCTTAC
GGCGCGGGAC GTGGCGAGAG GCCAGGCGGC GGTGCAGCAG CTGCAGGCTG AGGGTCTGAG
CCCGCGCTTC CACCAGCTGG ATATCGACGA CCTTCGGAGC ATCCAGGCCC TGCGCGACTT
CCTGCTCAAG GAGTATGGGG GACTCAACGT GCTGGTCAAT AACGCGGGCA TCGCTTTCAA
AACTGTTGAT CCCACACCGT TTCATATTCA AGCAGAAGTA ACTATGAAAA CAAACTTCTT
GGGAACCCGA AATGTATGCA CAGAGCTCCT GCCTCTGATA AAACCCCAAG GCAGAGTGGT
GAATGTGTCT AGCACTGAGA GTGTCAGAGC TCTTAACAAC TGCAGTCCTG AACTGCAACA
GAAGTTCAAG AGTGAGACCA TCACAGAGGA AGAGCTGGTG GGGCTCATGA ACAAGTTTGT
GGAAGACACA AAGAACGGAG TCCATAAGAA GGAAGGCTGG CCAAGTACCG CGTACGGAGT
GACAAAAATC GGGGTCACTG TACTCTCCAG GATCTATGCC AGGAAACTGA GTGAGCAGAG
AGCAGGGGAC AAGATCCTCC TGAATGCCTG CTGCCCAGGG TGGGTGAGAA CTGACATGGC
TGGACCCAAA GCCCCCAAGA GCCCAGAGGA AGGAGCAGAG ACCCCCGTGT ACCTGGCCCT
TTTACCCTCA GATGCAGAGG GGCCTCACGG TCAGTTTGTT TCTGAAAAAA AAGTGTAAAA
TGGGGTGTTC CCCCTTAGAG CTACCCCTGG GTCAATGCAT AATTTGTGTC CTGATTTCCC
CAAAGGATAC TTACCCTATC AAAAATTTCC CTGTCAAAAA AAAAAAAAAA AAAAAAAAAA
TTTGCCCCAA CTTCAGGTCC CGGCCCCCTA ACTAATCTAA AAAAAAACCC CCCCCACCCC
CCCCGAAC


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCBR1carbonyl reductase [NADPH] 1 [Homo sapiens]. 493e-139O
Contig/Assembly ProteinCBR3carbonyl reductase [NADPH] 3 [Homo sapiens]. 397e-110O
Contig/Assembly ProteinRDH14retinol dehydrogenase 14 [Homo sapiens]. 64.72e-10O
Contig/Assembly ProteinRDH11retinol dehydrogenase 11 [Homo sapiens]. 62.87e-10O
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 [Homo sapiens]. 62.49e-10O
Contig/Assembly ProteinRDH13retinol dehydrogenase 13 isoform 1 [Homo sapiens]. 61.22e-09O
Contig/Assembly ProteinDHRS13dehydrogenase/reductase SDR family member 13 precursor [Homo sapiens]. 59.76e-09O
Contig/Assembly ProteinHSD17B1417-beta-hydroxysteroid dehydrogenase 14 [Homo sapiens]. 54.32e-07O
Contig/Assembly ProteinPECRperoxisomal trans-2-enoyl-CoA reductase [Homo sapiens]. 521e-06O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCbr1carbonyl reductase [NADPH] 1 [Mus musculus]. 456e-128O
Contig/Assembly ProteinLOC386400PREDICTED: carbonyl reductase [NADPH] 1-like [Mus musculus]. 438e-123O
Contig/Assembly ProteinCbr3carbonyl reductase 3 [Mus musculus]. 407e-113O
Contig/Assembly ProteinLOC100505223PREDICTED: carbonyl reductase [NADPH] 1-like, partial [Mus musculus]. 3524e-97O
Contig/Assembly ProteinLOC100503768PREDICTED: carbonyl reductase [NADPH] 1-like [Mus musculus]. 1411e-33O
Contig/Assembly ProteinRdh14retinol dehydrogenase 14 [Mus musculus]. 70.53e-12O
Contig/Assembly ProteinRdh13retinol dehydrogenase 13 [Mus musculus]. 69.36e-12O
Contig/Assembly ProteinRdh11retinol dehydrogenase 11 [Mus musculus]. 66.64e-11O
Contig/Assembly ProteinRdh12retinol dehydrogenase 12 [Mus musculus]. 65.59e-11O
Contig/Assembly ProteinDhrsxdehydrogenase/reductase SDR family member on chromosome X homolog precursor [Mus musculus]. 63.93e-10O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC610164PREDICTED: similar to Carbonyl reductase [NADPH] 1 (NADPH-dependent carbonyl reductase 1) (Prostaglandin-E(2) 9-reductase) (Prostaglandin 9-ketoreductase) (15-hydroxyprostaglandin dehydrogenase [NADP+]) [Canis familiaris]. 474e-133O
Contig/Assembly ProteinLOC480785PREDICTED: similar to Carbonyl reductase [NADPH] 1 (NADPH-dependent carbonyl reductase 1) (Prostaglandin-E(2) 9-reductase) (Prostaglandin 9-ketoreductase) (15-hydroxyprostaglandin dehydrogenase [NADP+]) [Canis familiaris]. 431e-121O
Contig/Assembly ProteinLOC478411PREDICTED: similar to Carbonyl reductase [NADPH] 1 (NADPH-dependent carbonyl reductase 1) (Prostaglandin-E(2) 9-reductase) (Prostaglandin 9-ketoreductase) (15-hydroxyprostaglandin dehydrogenase [NADP+]) [Canis familiaris]. 426e-119O
Contig/Assembly ProteinLOC487748PREDICTED: similar to carbonyl reductase 3 [Canis familiaris]. 426e-119
Contig/Assembly ProteinLOC475790PREDICTED: similar to Retinol dehydrogenase 12 [Canis familiaris]. 69.38e-12
Contig/Assembly ProteinLOC482983PREDICTED: similar to retinol dehydrogenase 14 (all-trans and 9-cis) isoform 1 [Canis familiaris]. 65.11e-10O
Contig/Assembly ProteinLOC480366PREDICTED: similar to Retinol dehydrogenase 11 (Retinal reductase 1) (RalR1) (Prostate short-chain dehydrogenase/reductase 1) (Androgen-regulated short-chain dehydrogenase/reductase 1) (HCV core-binding protein HCBP12) [Canis familiaris]. 64.72e-10O
Contig/Assembly ProteinLOC491173PREDICTED: similar to retinol dehydrogenase 11 (predicted) [Canis familiaris]. 63.93e-10O
Contig/Assembly ProteinLOC490744PREDICTED: similar to retinol dehydrogenase 12 (all-trans and 9-cis) [Canis familiaris]. 63.54e-10O
Contig/Assembly ProteinLOC611373PREDICTED: similar to Retinol dehydrogenase 13 [Canis familiaris]. 63.26e-10O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCBR1PREDICTED: carbonyl reductase-like [Bos taurus]. 474e-134O
Contig/Assembly ProteinCBR1carbonyl reductase [NADPH] 1 [Bos taurus]. 471e-133O
Contig/Assembly ProteinLOC100335345PREDICTED: carbonyl reductase-like [Bos taurus]. 455e-128O
Contig/Assembly ProteinLOC781294PREDICTED: 20-beta-hydroxysteroid dehydrogenase-like [Bos taurus]. 436e-122O
Contig/Assembly ProteinMGC12713320-beta-hydroxysteroid dehydrogenase-like [Bos taurus]. 436e-122O
Contig/Assembly ProteinCBR3carbonyl reductase [NADPH] 3 [Bos taurus]. 421e-118O
Contig/Assembly ProteinLOC100337384PREDICTED: 20-beta-hydroxysteroid dehydrogenase-like [Bos taurus]. 2211e-57O
Contig/Assembly ProteinDHRS12dehydrogenase/reductase SDR family member 12 [Bos taurus]. 68.22e-11O
Contig/Assembly ProteinRDH13retinol dehydrogenase 13 [Bos taurus]. 68.22e-11O
Contig/Assembly ProteinDHRS13dehydrogenase/reductase SDR family member 13 precursor [Bos taurus]. 674e-11O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100622246PREDICTED: carbonyl reductase [NADPH] 1-like [Sus scrofa]. 544e-155O
Contig/Assembly ProteinCBR1carbonyl reductase [NADPH] 1 [Sus scrofa]. 483e-137O
Contig/Assembly ProteinLOC100512990PREDICTED: carbonyl reductase [NADPH] 3-like [Sus scrofa]. 407e-114O
Contig/Assembly ProteinLOC100626165PREDICTED: carbonyl reductase [NADPH] 1-like, partial [Sus scrofa]. 2992e-81O
Contig/Assembly ProteinLOC100516970PREDICTED: retinol dehydrogenase 14-like [Sus scrofa]. 65.95e-11O
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 [Sus scrofa]. 63.52e-10O
Contig/Assembly ProteinLOC100513982PREDICTED: retinol dehydrogenase 12-like [Sus scrofa]. 62.84e-10O
Contig/Assembly ProteinLOC100154684PREDICTED: retinol dehydrogenase 11 [Sus scrofa]. 61.69e-10O
Contig/Assembly ProteinLOC100517586PREDICTED: 11-cis retinol dehydrogenase-like [Sus scrofa]. 50.42e-06O


Assembly Members: 210      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010022C09ADR01_0022_C09.bDB783416 
ADR010101H11ADR01_0101_H11.bDB790521 
CBLT10100B01CBLT1_0100_B01.bHX219110 
CLNT10031E05CLNT1_0031_E05.bFS659491 
ITT010010D12ITT01_0010_D12.bBW976906 
ITT010032G06ITT01_0032_G06.bBW978911 
ITT010049A02ITT01_0049_A02.bBW980293 
ITT010066F05ITT01_0066_F05.bBW981893 
ITT010101B05ITT01_0101_B05.bBW984962 
KDN010033A09KDN01_0033_A09.bFS673684 
KDN010033C01KDN01_0033_C01.bFS673698 
KDN010058E02KDN01_0058_E02.bFS675051 
KDN010065E01KDN01_0065_E01.bFS675622 
KDN010071A11KDN01_0071_A11.bFS676057 
LNG010085B08LNG01_0085_B08.bBP434608 
LNG010091C01LNG01_0091_C01.bBP435020 
LVR010044H06LVR01_0044_H06.bBP447634 
LVR010052B04LVR01_0052_B04.bBP442133 
LVR010058C02LVR01_0058_C02.bBP442906 
LVR010074A02LVR01_0074_A02.bBP441076 
LVRM10022H05LVRM1_0022_H05.bBP140915 
LVRM10033F06LVRM1_0033_F06.bCJ001266 
LVRM10099C05LVRM1_0099_C05.bBW963070 
LVRM10140G12LVRM1_0140_G12.bBP453792 
LVRM10157B07LVRM1_0157_B07.bBP449385 
MLN010041A05MLN01_0041_A05.bCJ010837 
MLN010084F02MLN01_0084_F02.bCJ014369 
MLN010100F10MLN01_0100_F10.bCJ015731 
OVR010005A01OVR01_0005_A01.bBP141242 
OVR010005B10OVR01_0005_B10.bBP142017 
OVR010020B10OVR01_0020_B10.bBP142028 
OVR010025A11OVR01_0025_A11.bBP141636 
OVR010030D09OVR01_0030_D09.bBP142905 
OVR010034G04OVR01_0034_G04.bBP144082 
OVR010036E07OVR01_0036_E07.bBP143287 AK394847
OVR010041A02OVR01_0041_A02.bBP141308 
OVR010048F06OVR01_0048_F06.bBP143708 
OVR010048G07OVR01_0048_G07.bBP144203 
OVR010052C08OVR01_0052_C08.bBW964237 
OVR010058D12OVR01_0058_D12.bBW964790 
OVR010059A05OVR01_0059_A05.bBW964838 
OVR010063E06OVR01_0063_E06.bBW965237 
OVR010070A07OVR01_0070_A07.bBW965818 
OVR010085C11OVR01_0085_C11.bBW966993 
OVR010085D03OVR01_0085_D03.bBW966997 
OVR010096C02OVR01_0096_C02.bBW967820 
OVR010098B04OVR01_0098_B04.bBW967962 
OVR010101H08OVR01_0101_H08.bBW968267 
OVR010102E07OVR01_0102_E07.bBW968320 
OVRM10020H04OVRM1_0020_H04.bBP154007 
OVRM10114D01OVRM1_0114_D01.bBP148728 
OVRM10116E11OVRM1_0116_E11.bBP151016 
OVRM10182A05OVRM1_0182_A05.bBP454993 
OVRM10182B09OVRM1_0182_B09.bBP456254 
OVRM10196G11OVRM1_0196_G11.bBP461258 
OVRT10112C08OVRT1_0112_C08.bHX235767 
PST010021B11PST01_0021_B11.bHX239123 
PST010028G03PST01_0028_G03.bFS699218 
PST010037B08PST01_0037_B08.b  
PST010037G06PST01_0037_G06.bFS699758 
PST010039B10PST01_0039_B10.bFS699869 
PST010041E05PST01_0041_E05.bFS700054 
PST010049B09PST01_0049_B09.bFS700675 
PST010054E09PST01_0054_E09.bFS701117 
PST010057B10PST01_0057_B10.bFS701318 
PST010059D12PST01_0059_D12.bFS701504 
PST010060E11PST01_0060_E11.bFS701592 
PST010077D12PST01_0077_D12.bFS702917 
PST010077F09PST01_0077_F09.bFS702937 
PST010086B08PST01_0086_B08.bFS703628 
PST010087G02PST01_0087_G02.bFS703755 
PST010095A08PST01_0095_A08.b  
PST010095E07PST01_0095_E07.bFS704355 
PST010097G12PST01_0097_G12.bFS704516 
PTG010087C04PTG01_0087_C04.bFS711770 
PTG010101A06PTG01_0101_A06.b  AK397139
SKNB10064E09SKNB1_0064_E09.bDB803894 
SKNB10065H11SKNB1_0065_H11.bDB803981 
SMG010022H05SMG01_0022_H05.bFS715225 
SMG010035B11SMG01_0035_B11.bFS716327 
SMG010042C06SMG01_0042_C06.bFS716923 
SMG010048C10SMG01_0048_C10.bFS717451 
SMG010072G10SMG01_0072_G10.bFS719522 
SMG010091B04SMG01_0091_B04.bFS721107 
SMG010100F02SMG01_0100_F02.bFS721866 
SPL010001H02SPL01_0001_H02.bBP159068 
SPL010043D12SPL01_0043_D12.bCJ016887 
SPL010044D11SPL01_0044_D11.bCJ016976 
SPL010075D05SPL01_0075_D05.bCJ019765 
SPL010098H05SPL01_0098_H05.bCJ021880 
SPL010104E06SPL01_0104_E06.bCJ022355 
TCH010017D05TCH01_0017_D05.bCJ023687 
TCH010023E11TCH01_0023_E11.bCJ024142 
TCH010059F07TCH01_0059_F07.bCJ026653 
TCH010076C06TCH01_0076_C06.bCJ027901 
TCH010076C09TCH01_0076_C09.bCJ027903 
TCH010092E03TCH01_0092_E03.bCJ029151 
TES010002B06TES01_0002_B06.bFS722152 
TES010003C11TES01_0003_C11.bCJ030183 
TES010003G08TES01_0003_G08.b  
TES010005B09TES01_0005_B09.bCJ030305 
TES010005G08TES01_0005_G08.b  
TES010006F12TES01_0006_F12.bCJ030416 
TES010006H02TES01_0006_H02.bFS722156 
TES010007E09TES01_0007_E09.bCJ030471 
TES010008A03TES01_0008_A03.bCJ030497 
TES010009D01TES01_0009_D01.bCJ030593 
TES010010B12TES01_0010_B12.bCJ030655 
TES010011A11TES01_0011_A11.bCJ030713 
TES010011H10TES01_0011_H10.bCJ030772 
TES010014D01TES01_0014_D01.bCJ030935 
TES010014F06TES01_0014_F06.bCJ030955 
TES010014G11TES01_0014_G11.bCJ030967 
TES010016B02TES01_0016_B02.bCJ031057 
TES010016F05TES01_0016_F05.bCJ031090 
TES010016G11TES01_0016_G11.bCJ031104 
TES010018A09TES01_0018_A09.bCJ031188 
TES010018B10TES01_0018_B10.bCJ031197 
TES010018F11TES01_0018_F11.bCJ031233 
TES010020D09TES01_0020_D09.b  AK398160
TES010022E12TES01_0022_E12.bCJ031485 
TES010024B03TES01_0024_B03.bCJ031595 
TES010024D10TES01_0024_D10.bCJ031616 
TES010024F06TES01_0024_F06.bCJ031629 
TES010025E04TES01_0025_E04.bCJ031681 
TES010026H09TES01_0026_H09.b  
TES010027B02TES01_0027_B02.bCJ031773 
TES010029F01TES01_0029_F01.bCJ031924 
TES010029H05TES01_0029_H05.bCJ031945 
TES010030A09TES01_0030_A09.bCJ031959 
TES010030B11TES01_0030_B11.bCJ031968 
TES010031F08TES01_0031_F08.bCJ032066 
TES010033E11TES01_0033_E11.bCJ032184 
TES010036A07TES01_0036_A07.bCJ032352 
TES010036G05TES01_0036_G05.bCJ032400 
TES010036H09TES01_0036_H09.bCJ032412 
TES010038D11TES01_0038_D11.bCJ032506 AK398199
TES010038G06TES01_0038_G06.bCJ032526 
TES010039D03TES01_0039_D03.bCJ032553 
TES010039F08TES01_0039_F08.b  
TES010042B10TES01_0042_B10.b  
TES010043A01TES01_0043_A01.bCJ032756 
TES010045A10TES01_0045_A10.bCJ032879 
TES010045C04TES01_0045_C04.bCJ032892 
TES010045D09TES01_0045_D09.bCJ032903 
TES010046G10TES01_0046_G10.bFS722217 
TES010049D02TES01_0049_D02.bCJ033119 
TES010049D11TES01_0049_D11.bCJ033127 
TES010051G05TES01_0051_G05.b  
TES010054C03TES01_0054_C03.bCJ033429 
TES010055E01TES01_0055_E01.bCJ033494 
TES010058C01TES01_0058_C01.bCJ033696 
TES010059D08TES01_0059_D08.bCJ033777 
TES010059G09TES01_0059_G09.bCJ033806 
TES010060A10TES01_0060_A10.bCJ033829 
TES010061D07TES01_0061_D07.bCJ033908 
TES010061E09TES01_0061_E09.bCJ033918 
TES010063A09TES01_0063_A09.bCJ034028 
TES010066E10TES01_0066_E10.bCJ034261 
TES010067A03TES01_0067_A03.bCJ034287 
TES010069D07TES01_0069_D07.bCJ034456 
TES010069F05TES01_0069_F05.b  
TES010069H01TES01_0069_H01.bCJ034481 
TES010070C11TES01_0070_C11.bCJ034514 
TES010071F04TES01_0071_F04.bCJ034598 
TES010072B04TES01_0072_B04.bCJ034631 
TES010072B11TES01_0072_B11.bCJ034637 
TES010072C03TES01_0072_C03.bCJ034638 
TES010072D11TES01_0072_D11.bCJ034651 
TES010073E06TES01_0073_E06.bCJ034716 
TES010074G04TES01_0074_G04.b  
TES010076A03TES01_0076_A03.bCJ034865 
TES010076F02TES01_0076_F02.bCJ034910 
TES010078C06TES01_0078_C06.bCJ035005 
TES010078F12TES01_0078_F12.bCJ035034 
TES010080E03TES01_0080_E03.bCJ035161 
TES010083C04TES01_0083_C04.bCJ035343 
TES010086E08TES01_0086_E08.bCJ035568 
TES010088E12TES01_0088_E12.bCJ035703 
TES010090E10TES01_0090_E10.bCJ035838 
TES010091D09TES01_0091_D09.bCJ035892 AK398280
TES010091F12TES01_0091_F12.bCJ035911 
TES010093H08TES01_0093_H08.bCJ036070 
TES010094B03TES01_0094_B03.bCJ036085 
TES010094B09TES01_0094_B09.b  
TES010095D02TES01_0095_D02.bCJ036180 
TES010096F05TES01_0096_F05.bCJ036278 
TES010097F08TES01_0097_F08.bCJ036355 
TES010097H04TES01_0097_H04.bCJ036369 
TES010098C06TES01_0098_C06.bCJ036398 
TES010098E01TES01_0098_E01.bCJ036411 
TES010100F11TES01_0100_F11.bCJ036580 
TES010100H01TES01_0100_H01.b  
TES010104H07TES01_0104_H07.bCJ036889 
TES010105B06TES01_0105_B06.bCJ036907 
TES010105G12TES01_0105_G12.bCJ036956 
TES010106F04TES01_0106_F04.bCJ037016 
TES010107G12TES01_0107_G12.bCJ037092 
TES010109A11TES01_0109_A11.bCJ037174 
TES010109E02TES01_0109_E02.bCJ037203 
TES010109G01TES01_0109_G01.bCJ037221 
TES010109H01TES01_0109_H01.bCJ037228 
TES010110C07TES01_0110_C07.b  AK351374
THY010016B07THY01_0016_B07.bBP161213 
THY010051C04THY01_0051_C04.bBP162185 
THY010059F04THY01_0059_F04.bBP165954 
THY010118B07THY01_0118_B07.bBP161295 
UTR010011C01UTR01_0011_C01.bBP170428 
UTR010013A04UTR01_0013_A04.bBP169496 
UTR010102D12UTR01_0102_D12.bCJ039327 

  

SNPs: 5      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
137A200.053W-
G3510.947
256A040.020M-
G19150.980
303C19840.981MNCCG/P
G040.019CGG/R
515C19550.976MNCGG/R
G050.024GGG/G
525A19350.980MNCAG/Q
G040.020CGG/R


Alignment:      TOP

20110601C-001812 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRM1_0182_B09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0005_B10.b : taggggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0009_D01.b :
TES01_0018_B10.b :
TES01_0042_B10.b :
TES01_0030_A09.b :
TES01_0038_G06.b :
TES01_0106_F04.b :
TES01_0045_A10.b :
OVR01_0020_B10.b : gg
SPL01_0043_D12.b :
OVR01_0025_A11.b : attagagctttggtgcx
TES01_0073_E06.b :
TES01_0104_H07.b :
OVR01_0052_C08.b :
LVR01_0058_C02.b : g
TES01_0076_A03.b :
TES01_0069_H01.b :
TES01_0043_A01.b :
OVR01_0048_G07.b : a
TES01_0109_A11.b :
TES01_0024_B03.b :
TES01_0110_C07.b :
TES01_0036_H09.b :
TES01_0061_D07.b :
TES01_0055_E01.b :
CBLT1_0100_B01.b :
TES01_0069_F05.b :
TES01_0020_D09.b :
TES01_0003_G08.b :
SMG01_0072_G10.b :
OVR01_0048_F06.b :
PST01_0028_G03.b :
TES01_0036_G05.b :
TES01_0060_A10.b :
TES01_0088_E12.b :
TES01_0109_H01.b :
TES01_0006_H02.b :
TES01_0094_B03.b :
TES01_0091_D09.b :
TES01_0002_B06.b :
TES01_0080_E03.b :
TES01_0098_E01.b :
TES01_0030_B11.b :
TES01_0071_F04.b :
TES01_0100_F11.b :
TES01_0100_H01.b :
TES01_0097_H04.b :
TES01_0014_F06.b :
TES01_0024_D10.b :
TES01_0105_B06.b :
TES01_0008_A03.b :
TES01_0051_G05.b :
TES01_0058_C01.b :
TES01_0026_H09.b :
TES01_0063_A09.b :
PTG01_0101_A06.b :
ITT01_0032_G06.b :
OVR01_0058_D12.b :
TES01_0039_F08.b :
ADR01_0101_H11.b :
TES01_0072_D11.b :
TES01_0078_C06.b :
TES01_0072_C03.b :
TES01_0090_E10.b :
TES01_0098_C06.b :
TES01_0059_D08.b :
TES01_0039_D03.b :
TES01_0091_F12.b :
TES01_0086_E08.b :
TES01_0016_B02.b :
TES01_0011_A11.b :
TES01_0049_D11.b :
KDN01_0065_E01.b :
TES01_0033_E11.b :
TES01_0025_E04.b :
TES01_0007_E09.b :
TES01_0070_C11.b :
TES01_0059_G09.b :
TES01_0018_F11.b :
TES01_0083_C04.b :
TES01_0069_D07.b :
TES01_0006_F12.b :
TES01_0072_B04.b :
TES01_0076_F02.b :
TCH01_0023_E11.b :
TES01_0061_E09.b :
TES01_0046_G10.b :
TES01_0096_F05.b :
TES01_0054_C03.b :
TES01_0094_B09.b :
TES01_0003_C11.b :
TES01_0005_B09.b :
PST01_0077_D12.b :
PST01_0095_E07.b :
KDN01_0071_A11.b :
TES01_0078_F12.b :
TES01_0066_E10.b :
THY01_0016_B07.b :
TES01_0014_G11.b :
UTR01_0102_D12.b :
LNG01_0085_B08.b :
ITT01_0049_A02.b :
THY01_0118_B07.b :
TES01_0097_F08.b :
SPL01_0104_E06.b :
TES01_0016_G11.b :
TES01_0107_G12.b :
TES01_0022_E12.b :
TES01_0093_H08.b :
SPL01_0001_H02.b :
OVR01_0085_C11.b : nnnnggcttggactatnac
OVR01_0034_G04.b :
LVRM1_0099_C05.b :
OVRM1_0020_H04.b :
OVRM1_0114_D01.b :
SMG01_0048_C10.b :
OVRM1_0116_E11.b :
UTR01_0013_A04.b :
OVR01_0098_B04.b :
THY01_0051_C04.b :
SPL01_0044_D11.b :
OVR01_0059_A05.b :
ADR01_0022_C09.b :
OVR01_0101_H08.b :
OVR01_0063_E06.b :
THY01_0059_F04.b :
SMG01_0035_B11.b :
MLN01_0041_A05.b :
TCH01_0076_C06.b :
OVR01_0036_E07.b :
MLN01_0084_F02.b :
TCH01_0076_C09.b :
SPL01_0075_D05.b :
ITT01_0010_D12.b :
CLNT1_0031_E05.b :
OVRM1_0196_G11.b :
TES01_0027_B02.b :
TES01_0029_H05.b :
SMG01_0091_B04.b :
OVR01_0030_D09.b :
TES01_0005_G08.b :
TCH01_0059_F07.b :
TES01_0109_E02.b :
PST01_0095_A08.b :
LNG01_0091_C01.b :
TES01_0072_B11.b :
TES01_0049_D02.b :
TES01_0016_F05.b :
TES01_0036_A07.b :
PST01_0037_B08.b :
TES01_0067_A03.b :
TES01_0024_F06.b :
TES01_0045_C04.b :
TES01_0038_D11.b :
PTG01_0087_C04.b :
OVR01_0041_A02.b :
OVR01_0005_A01.b :
TES01_0031_F08.b :
TES01_0018_A09.b :
TES01_0095_D02.b :
PST01_0060_E11.b :
MLN01_0100_F10.b :
TES01_0029_F01.b :
TES01_0109_G01.b :
TES01_0105_G12.b :
SMG01_0022_H05.b :
TES01_0045_D09.b :
PST01_0037_G06.b :
TES01_0011_H10.b :
OVR01_0070_A07.b :
SKNB1_0064_E09.b :
TES01_0014_D01.b :
PST01_0087_G02.b :
SMG01_0042_C06.b :
TES01_0074_G04.b :
PST01_0097_G12.b :
SMG01_0100_F02.b :
LVRM1_0033_F06.b :
OVRM1_0182_A05.b :
LVRM1_0140_G12.b :
UTR01_0011_C01.b :
OVR01_0102_E07.b :
OVR01_0096_C02.b :
LVR01_0044_H06.b :
SPL01_0098_H05.b :
LVR01_0052_B04.b :
ITT01_0101_B05.b :
TCH01_0017_D05.b :
OVR01_0085_D03.b :
PST01_0049_B09.b :
PST01_0021_B11.b :
PST01_0057_B10.b :
PST01_0041_E05.b :
KDN01_0058_E02.b :
TES01_0010_B12.b :
SKNB1_0065_H11.b :
TCH01_0092_E03.b :
PST01_0059_D12.b :
PST01_0039_B10.b :
PST01_0077_F09.b :
LVRM1_0022_H05.b :
OVRT1_0112_C08.b :
ITT01_0066_F05.b :
LVR01_0074_A02.b :
PST01_0054_E09.b :
KDN01_0033_C01.b :
KDN01_0033_A09.b :
LVRM1_0157_B07.b :
PST01_0086_B08.b :
20110601C-001812 : TGATTCTCTGCTGTCAGGCACGCGGTCGCTGGGCAACGGCTCTTCAGCGGACAGCTCTCC
---------+---------+---------+---------+---------+---------+ 60
OVRM1_0182_B09.b : TGATTCTCTGCTGTCAGGCACGCGGTCGCTGGGCAACGGCTCTTCAGCGGACAGCTCTCC
OVR01_0005_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0009_D01.b : ntttttcgcgttggctc
TES01_0018_B10.b : ctgtggctctggctgt
TES01_0042_B10.b : ttttcctgctgtggctctggcttgt
TES01_0030_A09.b : ntcgcgttg
TES01_0038_G06.b : tttttcctgctgtg
TES01_0106_F04.b : ttttcct
TES01_0045_A10.b :
OVR01_0020_B10.b : ggggggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0043_D12.b : nnttttgcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0025_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0073_E06.b :
TES01_0104_H07.b :
OVR01_0052_C08.b : nnnnggatgggacttanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_C02.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0076_A03.b :
TES01_0069_H01.b :
TES01_0043_A01.b :
OVR01_0048_G07.b : aggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0109_A11.b :
TES01_0024_B03.b :
TES01_0110_C07.b : ttctgta
TES01_0036_H09.b :
TES01_0061_D07.b :
TES01_0055_E01.b :
CBLT1_0100_B01.b : nttggacgtgagaggccgtaxx
TES01_0069_F05.b :
TES01_0020_D09.b :
TES01_0003_G08.b :
SMG01_0072_G10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVR01_0048_F06.b : agagctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0028_G03.b :
TES01_0036_G05.b :
TES01_0060_A10.b :
TES01_0088_E12.b :
TES01_0109_H01.b :
TES01_0006_H02.b :
TES01_0094_B03.b :
TES01_0091_D09.b :
TES01_0002_B06.b :
TES01_0080_E03.b :
TES01_0098_E01.b :
TES01_0030_B11.b :
TES01_0071_F04.b :
TES01_0100_F11.b :
TES01_0100_H01.b :
TES01_0097_H04.b :
TES01_0014_F06.b :
TES01_0024_D10.b :
TES01_0105_B06.b :
TES01_0008_A03.b :
TES01_0051_G05.b :
TES01_0058_C01.b :
TES01_0026_H09.b :
TES01_0063_A09.b :
PTG01_0101_A06.b : n
ITT01_0032_G06.b :
OVR01_0058_D12.b : nnttttgcttggac
TES01_0039_F08.b :
ADR01_0101_H11.b :
TES01_0072_D11.b :
TES01_0078_C06.b :
TES01_0072_C03.b :
TES01_0090_E10.b :
TES01_0098_C06.b :
TES01_0059_D08.b :
TES01_0039_D03.b :
TES01_0091_F12.b :
TES01_0086_E08.b :
TES01_0016_B02.b :
TES01_0011_A11.b :
TES01_0049_D11.b :
KDN01_0065_E01.b :
TES01_0033_E11.b :
TES01_0025_E04.b :
TES01_0007_E09.b :
TES01_0070_C11.b :
TES01_0059_G09.b :
TES01_0018_F11.b :
TES01_0083_C04.b :
TES01_0069_D07.b :
TES01_0006_F12.b :
TES01_0072_B04.b :
TES01_0076_F02.b :
TCH01_0023_E11.b : n
TES01_0061_E09.b :
TES01_0046_G10.b :
TES01_0096_F05.b :
TES01_0054_C03.b :
TES01_0094_B09.b :
TES01_0003_C11.b :
TES01_0005_B09.b :
PST01_0077_D12.b :
PST01_0095_E07.b :
KDN01_0071_A11.b :
TES01_0078_F12.b :
TES01_0066_E10.b :
THY01_0016_B07.b :
TES01_0014_G11.b :
UTR01_0102_D12.b :
LNG01_0085_B08.b :
ITT01_0049_A02.b :
THY01_0118_B07.b :
TES01_0097_F08.b :
SPL01_0104_E06.b :
TES01_0016_G11.b :
TES01_0107_G12.b :
TES01_0022_E12.b :
TES01_0093_H08.b :
SPL01_0001_H02.b :
OVR01_0085_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0034_G04.b :
LVRM1_0099_C05.b :
OVRM1_0020_H04.b :
OVRM1_0114_D01.b :
SMG01_0048_C10.b :
OVRM1_0116_E11.b :
UTR01_0013_A04.b :
OVR01_0098_B04.b :
THY01_0051_C04.b :
SPL01_0044_D11.b :
OVR01_0059_A05.b :
ADR01_0022_C09.b :
OVR01_0101_H08.b :
OVR01_0063_E06.b :
THY01_0059_F04.b :
SMG01_0035_B11.b :
MLN01_0041_A05.b :
TCH01_0076_C06.b :
OVR01_0036_E07.b :
MLN01_0084_F02.b :
TCH01_0076_C09.b :
SPL01_0075_D05.b :
ITT01_0010_D12.b :
CLNT1_0031_E05.b :
OVRM1_0196_G11.b :
TES01_0027_B02.b :
TES01_0029_H05.b :
SMG01_0091_B04.b :
OVR01_0030_D09.b :
TES01_0005_G08.b :
TCH01_0059_F07.b :
TES01_0109_E02.b :
PST01_0095_A08.b :
LNG01_0091_C01.b :
TES01_0072_B11.b :
TES01_0049_D02.b :
TES01_0016_F05.b :
TES01_0036_A07.b :
PST01_0037_B08.b :
TES01_0067_A03.b :
TES01_0024_F06.b :
TES01_0045_C04.b :
TES01_0038_D11.b :
PTG01_0087_C04.b :
OVR01_0041_A02.b :
OVR01_0005_A01.b :
TES01_0031_F08.b :
TES01_0018_A09.b :
TES01_0095_D02.b :
PST01_0060_E11.b :
MLN01_0100_F10.b :
TES01_0029_F01.b :
TES01_0109_G01.b :
TES01_0105_G12.b :
SMG01_0022_H05.b :
TES01_0045_D09.b :
PST01_0037_G06.b :
TES01_0011_H10.b :
OVR01_0070_A07.b :
SKNB1_0064_E09.b :
TES01_0014_D01.b :
PST01_0087_G02.b :
SMG01_0042_C06.b :
TES01_0074_G04.b :
PST01_0097_G12.b :
SMG01_0100_F02.b :
LVRM1_0033_F06.b :
OVRM1_0182_A05.b :
LVRM1_0140_G12.b :
UTR01_0011_C01.b :
OVR01_0102_E07.b :
OVR01_0096_C02.b :
LVR01_0044_H06.b :
SPL01_0098_H05.b :
LVR01_0052_B04.b :
ITT01_0101_B05.b :
TCH01_0017_D05.b :
OVR01_0085_D03.b :
PST01_0049_B09.b :
PST01_0021_B11.b :
PST01_0057_B10.b :
PST01_0041_E05.b :
KDN01_0058_E02.b :
TES01_0010_B12.b :
SKNB1_0065_H11.b :
TCH01_0092_E03.b :
PST01_0059_D12.b :
PST01_0039_B10.b :
PST01_0077_F09.b :
LVRM1_0022_H05.b :
OVRT1_0112_C08.b :
ITT01_0066_F05.b :
LVR01_0074_A02.b :
PST01_0054_E09.b :
KDN01_0033_C01.b :
KDN01_0033_A09.b :
LVRM1_0157_B07.b :
PST01_0086_B08.b :
20110601C-001812 : AAACCAACCCCAGCGCCCCTTCTCTACTTTCCCTTCAGCCCTAGAGCGGCATCCTGGAGC
---------+---------+---------+---------+---------+---------+ 120
OVRM1_0182_B09.b : AAACCAACCCCAGCGCCCCTTCTCTACTTTCCCTTCAGCCCTAGAGCGGCATCCTGGAGC
OVR01_0005_B10.b : xxxccaACCCCAGCGCCCCTTCTCTACTTTCCCTTCAGCCCTAGAGCGGCATCCTGGAGC
TES01_0009_D01.b : tggaaccaCCCCGCGCCCCTTCTCTACTTTCCCTTCAGCCCTAGAGCGGCATCCTGGAGC
TES01_0018_B10.b : tggcctactggAGCGCCCCTTCTCTACTTTCCCTTCAGCCCTAGAGCGGCATCCTGGAGC
TES01_0042_B10.b : tggcctactggAGCGCCCCTTCTCTACTTTCCCTTCAGCCCTAGAGCGGCATCCTGGAGC
TES01_0030_A09.b : gctatggtacccGCGCCCCTTCTCTACTTTCCCTTCAGCCCTAGAGCGGCATCCTGGAGC
TES01_0038_G06.b : gctatggtacccGCGCCCCTTCTCTACTTTCCCTTCAGCCCTAGAGCGGCATCCTGGAGC
TES01_0106_F04.b : gctgtggctctggacgCCCTTCTCTACTTTCCCTTC*GCCCTAGAGCGGCATCCTGGAGC
TES01_0045_A10.b : cgttggctctaggaTTCTCTACTTTCCCTTC*GCCCTAGAGCGGCATCCTGGAGC
OVR01_0020_B10.b : xxxxxxxxxxxxxxxxxxxxxCTCTACTTTCCCTTCAGCCCTAGAGCGGCATCCTGGAGC
SPL01_0043_D12.b : xxxxxxxxxxxxxxxxxxxxxxaCTACTTTCCCTTCAGCCCTAGAGCGGCATCCTGGAGC
OVR01_0025_A11.b : xxxxxxxxxxxxgttggcctactggACTTTCCCTTCAGCCCTAGAGCGGCATCCTGGAGC
TES01_0073_E06.b : nnccggcgtggctctggttcctCTTTCCTTC**GCCCTAGAGCGGCATCCTGGAGC
TES01_0104_H07.b : ntttnttcgcgtggctatggatctCTTTCCCTTC*GCCCTAGAGCGGCATCCTGGAGC
OVR01_0052_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCCTTCAGCCCTAGAGCGGCATCCTGGAGC
LVR01_0058_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTTTCCCTTCAGCCCTAGAGCGGCATCCTGGAGC
TES01_0076_A03.b : tttctcgctgtggctctggacaCTTTCCTTC*GCCCTAGAGCGGCATCCTGGAGC
TES01_0069_H01.b : ttttatgcggtggctctggacaCTTTCCTTC*GCCCTAGAGCGGCATCCTGGAGC
TES01_0043_A01.b : ttcctgcgttggctctggttccaCTTTCCTTC*GCCCTAGAGCGGCATCCTGGAGC
OVR01_0048_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCCCTTCAGCCCTAGAGCGGCATCCTGGAGC
TES01_0109_A11.b : ttcctgcagtggctatggcttccacTTTCCTTCAGCCCTAGAGCGGCATCCTGGAGC
TES01_0024_B03.b : ntcgcgtggctctggaTTTCCTTC*GCCCTAGAGCGGCATCCTGGAGC
TES01_0110_C07.b : actaatattgagcgactgtggccactggaTTCCCTTCGCCCATGAGCGGCATCCTGGAGC
TES01_0036_H09.b : tttttcctgcggtggctatggatttCCTTCAGCCCTAGAGCGGCATCCTGGAGC
TES01_0061_D07.b : gtggctctggatttcCCTTCGCCCTAGAGCGGCATCCTGGAGC
TES01_0055_E01.b : nttttcctgcgttggctatggtgtggccaCTGGAGCCCTAGAGCGGCATCCTGGAGC
CBLT1_0100_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCCCTAGAGCGGCATCCTGGAGC
TES01_0069_F05.b : tcgcgttggctctggtgttggctctggAGCCCTAGAGCGGCATCCTGGAGC
TES01_0020_D09.b : ggctctggtgtaggactactggAGCCCTATAGCGGCGTCCTGGAGC
TES01_0003_G08.b : ctgtggctctggAGCCCTAGAGCGGCATCCTGGAGC
SMG01_0072_G10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxGCCCTAGAGCGGCATCCTGGAGC
OVR01_0048_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCCTAGAGCGGCATCCTGGAGC
PST01_0028_G03.b : tttactgctgtggctctggatttccttCGCCCTGAGCGGCATCCTGGAGC
TES01_0036_G05.b : cactttggctcggcttcGCCCTGAGCGGCATCCTGGAGC
TES01_0060_A10.b : nncctgctgtggctctggaGCCCTGAGCGGCATCCTGGAGC
TES01_0088_E12.b : ttttactgcggtggctatgcttcaCCCTGAGCGGCATCCTGGAGC
TES01_0109_H01.b : ttttactcgctgtggctatggaCCCTGAGCGGCATCCTGGAGC
TES01_0006_H02.b : nncctgctgtggctctgggaCCTAGAGCGGCATCCTGGAGC
TES01_0094_B03.b : tttttcctcgcgtggctatggagCCTGAGCGGCATCCTGGAGC
TES01_0091_D09.b : ttttncctgcgttggctctggaCGGCATCCTGGAGC
TES01_0002_B06.b : ttttcgctgtggctctggATCCTGGAGC
TES01_0080_E03.b : nnncctgcgtggctctggacctagacggcTCCTGGAGC
TES01_0098_E01.b : nttttactgcgtggctctggatCTGGAGC
TES01_0030_B11.b : ccgctgtggctctggGGGGAC
TES01_0071_F04.b : nnncccgctgtggctctgGGAGC
TES01_0100_F11.b : tttttgctgcgtggctctgGGAGC
TES01_0100_H01.b : ntttactgctgtggctctgGGAGC
TES01_0097_H04.b : nnccgctgtggctctgGGAGC
TES01_0014_F06.b : nttnncctgctgtggctctggatgGGGAG
TES01_0024_D10.b : gcgttggctctacctGGAG
TES01_0105_B06.b : nttttaccgcgtggctctggacctGGAG
TES01_0008_A03.b : tttcccgcggtggctctggGGAG
TES01_0051_G05.b : ncttcgctgtggctctgggtac
TES01_0058_C01.b : nnncctgcgttggctcgag
TES01_0026_H09.b : tttttcccgctgtggctctggag
TES01_0063_A09.b : ttactgcgtggctc
PTG01_0101_A06.b : nccgcgttannnnnggcgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0032_G06.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0058_D12.b : tatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0039_F08.b : gcgttggctctggatgggga
ADR01_0101_H11.b : ttaaaaagctgaacggctgnaxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0072_D11.b : ttttcc
TES01_0078_C06.b : ntttccac
TES01_0072_C03.b : tttct
TES01_0090_E10.b : nnnccctgct
TES01_0098_C06.b : ntttc
TES01_0059_D08.b : ccccncctgc
TES01_0039_D03.b : tttttcct
TES01_0091_F12.b : nntttcccgcgttggc
TES01_0086_E08.b : ntttactgc
TES01_0016_B02.b : ntttcg
TES01_0011_A11.b : nntctg
TES01_0049_D11.b : ttttggtgctgt
KDN01_0065_E01.b : nnnaactgc
TES01_0033_E11.b :
TES01_0025_E04.b : t
TES01_0007_E09.b :
TES01_0070_C11.b : tttcct
TES01_0059_G09.b : nntttcctg
TES01_0018_F11.b :
TES01_0083_C04.b : ttttttcctg
TES01_0069_D07.b : cc
TES01_0006_F12.b : gg
TES01_0072_B04.b : tttcctg
TES01_0076_F02.b : tttttc
TCH01_0023_E11.b : ggcttgtgacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0061_E09.b :
TES01_0046_G10.b :
TES01_0096_F05.b :
TES01_0054_C03.b :
TES01_0094_B09.b :
TES01_0003_C11.b :
TES01_0005_B09.b :
PST01_0077_D12.b :
PST01_0095_E07.b :
KDN01_0071_A11.b :
TES01_0078_F12.b :
TES01_0066_E10.b :
THY01_0016_B07.b : gccxxxxxxxxxxxxxx
TES01_0014_G11.b :
UTR01_0102_D12.b : ntttggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0085_B08.b : tttttttagacggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0049_A02.b : nnttagtgaaacaxxxxxxxxxxxxxxx
THY01_0118_B07.b : agttgtcaaagcggcgtxxxxxxxx
TES01_0097_F08.b : nnccc
SPL01_0104_E06.b : nnnnggcttggactatnacagtttgtacxxxxxxxxxxxxxxxxx
TES01_0016_G11.b :
TES01_0107_G12.b :
TES01_0022_E12.b :
TES01_0093_H08.b :
SPL01_0001_H02.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0085_C11.b : xxxxxxxxxxxxxxxctttgtaaaagaatccaaatctctctctattaagtcgccactggg
OVR01_0034_G04.b : gaagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0099_C05.b : ncgttgtcxxxxxxxxxxxxxxxxxxx
OVRM1_0020_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0114_D01.b : cagttgtcxxxxxxxxxxxxxxxxxxx
SMG01_0048_C10.b : nggctttatnnntggctaaagcagcxxxxxxx
OVRM1_0116_E11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxx
UTR01_0013_A04.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0098_B04.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0051_C04.b : ttttggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0044_D11.b : ttttggcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0059_A05.b : ntttgcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0022_C09.b : ttaacaxxxxxxxxxx
OVR01_0101_H08.b : tttgcttgtgacttaacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0063_E06.b : nnnggcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0059_F04.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0035_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0041_A05.b : ttttnagttggactatgacagtttgtacxxxxxxxxxxxxxxxxxx
TCH01_0076_C06.b : nnnttagtnnnnnggctgtgacttgacagtttgtcxxxxxxxxxxxxxxxxxxx
OVR01_0036_E07.b : agggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0084_F02.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0076_C09.b : nnnnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0075_D05.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0010_D12.b : aaaagtgaagcxxxxxxxxxxx
CLNT1_0031_E05.b : nnnnnccgtctgctgtcggaggttxxxxxxxxxxxxxx
OVRM1_0196_G11.b : nagttgtcatxxxxxxxxxxxxxxx
TES01_0027_B02.b :
TES01_0029_H05.b :
SMG01_0091_B04.b : ctcattnggataaacaxxxx
OVR01_0030_D09.b : gggggcctttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0005_G08.b :
TCH01_0059_F07.b : nngggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0109_E02.b :
PST01_0095_A08.b :
LNG01_0091_C01.b : tttttagttggacttgacxxxxxxxxxxxxxxxxxxxxxx
TES01_0072_B11.b :
TES01_0049_D02.b :
TES01_0016_F05.b :
TES01_0036_A07.b :
PST01_0037_B08.b :
TES01_0067_A03.b :
TES01_0024_F06.b :
TES01_0045_C04.b :
TES01_0038_D11.b :
PTG01_0087_C04.b : nnncc
OVR01_0041_A02.b : ggggxxxxxxxxxxxxxxxxxxx
OVR01_0005_A01.b : gtggaccatctagxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0031_F08.b :
TES01_0018_A09.b :
TES01_0095_D02.b :
PST01_0060_E11.b :
MLN01_0100_F10.b : nggttggac
TES01_0029_F01.b :
TES01_0109_G01.b :
TES01_0105_G12.b :
SMG01_0022_H05.b :
TES01_0045_D09.b :
PST01_0037_G06.b :
TES01_0011_H10.b :
OVR01_0070_A07.b :
SKNB1_0064_E09.b :
TES01_0014_D01.b :
PST01_0087_G02.b :
SMG01_0042_C06.b :
TES01_0074_G04.b :
PST01_0097_G12.b :
SMG01_0100_F02.b :
LVRM1_0033_F06.b :
OVRM1_0182_A05.b :
LVRM1_0140_G12.b :
UTR01_0011_C01.b :
OVR01_0102_E07.b :
OVR01_0096_C02.b :
LVR01_0044_H06.b : cc
SPL01_0098_H05.b :
LVR01_0052_B04.b : gtgtgggggtttt
ITT01_0101_B05.b :
TCH01_0017_D05.b :
OVR01_0085_D03.b :
PST01_0049_B09.b :
PST01_0021_B11.b :
PST01_0057_B10.b :
PST01_0041_E05.b :
KDN01_0058_E02.b :
TES01_0010_B12.b :
SKNB1_0065_H11.b :
TCH01_0092_E03.b :
PST01_0059_D12.b :
PST01_0039_B10.b :
PST01_0077_F09.b :
LVRM1_0022_H05.b :
OVRT1_0112_C08.b :
ITT01_0066_F05.b :
LVR01_0074_A02.b :
PST01_0054_E09.b :
KDN01_0033_C01.b :
KDN01_0033_A09.b :
LVRM1_0157_B07.b :
PST01_0086_B08.b :
20110601C-001812 : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
---------+---------+---------+---------+---------+---------+ 180
OVRM1_0182_B09.b : CAGGCCCTGAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
OVR01_0005_B10.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0009_D01.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0018_B10.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0042_B10.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0030_A09.b : CAGGCCCTCAGCAGGTAGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0038_G06.b : CAGGCCCTCAGCAGGTAGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0106_F04.b : CCGGTTCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0045_A10.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
OVR01_0020_B10.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
SPL01_0043_D12.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
OVR01_0025_A11.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0073_E06.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0104_H07.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
OVR01_0052_C08.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
LVR01_0058_C02.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0076_A03.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0069_H01.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0043_A01.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
OVR01_0048_G07.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0109_A11.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0024_B03.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0110_C07.b : CAGGCCCTCTGCACGCGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0036_H09.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0061_D07.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0055_E01.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
CBLT1_0100_B01.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0069_F05.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0020_D09.b : CAGGCCCTCTGCAAGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0003_G08.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
SMG01_0072_G10.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
OVR01_0048_F06.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
PST01_0028_G03.b : CAGGCCCTCAGCAGGCGGTGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0036_G05.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0060_A10.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0088_E12.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0109_H01.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0006_H02.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTTAGCCCGGAGGCTCGCGGCGAGAG
TES01_0094_B03.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0091_D09.b : C*GGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0002_B06.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0080_E03.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0098_E01.b : CAGGCCCTCAGCAGGTGGGGCCCGTGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0030_B11.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0071_F04.b : CAGGCCCTC*GCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGGG
TES01_0100_F11.b : CAGGCCCTC*GCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0100_H01.b : CAGGCCCTC*GCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0097_H04.b : CAGGCCCTC*GCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0014_F06.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0024_D10.b : CCGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0105_B06.b : CAGGCCCTCAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0008_A03.b : CCGGCCCTC*GCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0051_G05.b : cAGGCCCTC*GCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0058_C01.b : ccGGCCCTC*GCAGGTGGGGCCCGCGCCTTTGC*CTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0026_H09.b : ccGGCCCTC*GCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0063_A09.b : tggaGCCCTCGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
PTG01_0101_A06.b : xxxxxxxggAGCAGGCGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
ITT01_0032_G06.b : xxxxactggAGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
OVR01_0058_D12.b : xxxxxxxxxxGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0039_F08.b : gcaggccctcGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
ADR01_0101_H11.b : xxxxxxxxxxGCAGGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0072_D11.b : tgcgtggctctgcAGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0078_C06.b : gttggctctgagcAGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0072_C03.b : gctgtggctctggAGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0090_E10.b : gtggctctggagcAGTGGGGCCCGCGCCTTTGC*CTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0098_C06.b : cactttggctcacAGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0059_D08.b : gctggctctggacAGTGGGGCCCGCGCCTTTGC*CTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0039_D03.b : gcgatgctctgacAGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0091_F12.b : tctggtctggagcAGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0086_E08.b : gctggctctggacAGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0016_B02.b : cgttggctctggcAGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0011_A11.b : cgtggctctggacAGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0049_D11.b : ggctctggggagcAGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
KDN01_0065_E01.b : tgtggctatggacAGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0033_E11.b : gttggctctggaGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0025_E04.b : gtggctctggagctGTGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAC
TES01_0007_E09.b : ggagcAGTGGGGCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0070_C11.b : gcgtggctctggacAGTGGGGCCGCGCCTTTGC*CTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0059_G09.b : ctgttgctctggacAGTGGGGCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0018_F11.b : tctggctctggacaGTGGGGC*CGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0083_C04.b : cgttggctctggacAGTGGGGCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0069_D07.b : tgtggctctggagcgGTGGGGCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0006_F12.b : cgttggctatgagcgGTGGGGCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0072_B04.b : cgtggctctggagcgGTGGGGCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0076_F02.b : gctgtggctctggaggGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TCH01_0023_E11.b : xxxxxxxxxxxxxxxgGGGGCCCGCGCCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0061_E09.b : ttGGCTATGGACTC*GCCCGGAGGCTCGCGGCGAGAG
TES01_0046_G10.b : gttGGCTCTGGACTC*GCCCGGAGGCTCGCGGCGAGAG
TES01_0096_F05.b : tcctcacgttGGCTCTGGACTC*GCCCGGAGGCTCGCGGCGAGAG
TES01_0054_C03.b : ncctacgctGGCTCTGGACTC*GCCCGGAGGCTCGCGGCGAGAG
TES01_0094_B09.b : ttttcctcgctgtGGCTCTGGAC*CAGCCCGGAGGCTCGCGGCGAGAG
TES01_0003_C11.b : tcgcgttGGCTCTGGACTC*GCCCGGAGGCTCGCGGCGAGAG
TES01_0005_B09.b : nctcgcgttGGCTCTGGACTC*GCCCGGAGGCTCGCGGCGAGAG
PST01_0077_D12.b : nnncctgcgttGGCTCTGGACTC*GCCCGGAGGCTCGCGGCGAGAG
PST01_0095_E07.b : nnnngctgcggtGGCTATGGACTC*GCCCGGAGGCTCGCGGCGAGAG
KDN01_0071_A11.b : ttttactgcgttGGCTCTGGACTC*GCCCGGAGGCTCGCGGCGAGAG
TES01_0078_F12.b : nttttgctgcggttGCTATGGACTC*GCCCGGAGGCTCGCGGCGAGAG
TES01_0066_E10.b : tttttcctgcgtttGCTCTGGACTC*GCCCGGAGGCTCGCGGCGAGAG
THY01_0016_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxagTTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0014_G11.b : acacgttggctctggTTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
UTR01_0102_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
LNG01_0085_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxcTTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
ITT01_0049_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTGCACTCAGCCCGGAGGCTCGCGGCGAGAG
THY01_0118_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxtggtaCTGGACTC*GCCCGGAGGCTCGCGGCGAGAG
TES01_0097_F08.b : ggtttnnnnnttcctgcgttggcntcggagCTGGACTCGCCCGGAGGCTCGCGGCGAGAG
SPL01_0104_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0016_G11.b : ncccgacgttggctctggcTTGCCNCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0107_G12.b : tttttactgctgttgctaTGGACTCGCCCGGAGGCTCGCGGCGAGAG
TES01_0022_E12.b : cgcgttggctctggGCACTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0093_H08.b : tttttcctcgcgtttgctacGGACTCGCCCGGAGGCTCGCGGCGAGAG
SPL01_0001_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctgACTCAGCCCGGAGGCTCGCGGCGAGAG
OVR01_0085_C11.b : agacggctgctcattctgtgaaggcttttgtgaACTCAGCCCGGAGGCTCGCGGCGAGAG
OVR01_0034_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCCCGGAGGCTCGCGGCGAGAG
LVRM1_0099_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCCCGGAGGCTCGCGGCGAGAG
OVRM1_0020_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCCCGGAGGCTCGCGGCGAGAG
OVRM1_0114_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCCCGGAGGCTCGCGGCGAGAG
SMG01_0048_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCCCGGAGGCTCGCGGCGAGAG
OVRM1_0116_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCCCGGAGGCTCGCGGCGAGAG
UTR01_0013_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCCCGGAGGCTCGCGGCGAGAG
OVR01_0098_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCCCGGAGGCTCGCGGCGAGAG
THY01_0051_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCCCGGAGGCTCGCGGCGAGAG
SPL01_0044_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCCCGGAGGCTCGCGGCGAGAG
OVR01_0059_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCCCGGAGGCTCGCGGCGAGAG
ADR01_0022_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCCCGGGGGCTCGCGGCGAGAG
OVR01_0101_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCCCGGAGGCTCGCGGCGAGAG
OVR01_0063_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCCCGGAGGCTCGCGGCGAGAG
THY01_0059_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCCCGGAGGCTCGCGGCGAGAG
SMG01_0035_B11.b : nnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxCTCAGCCCGGAGGCTCGCGGCGAGAG
MLN01_0041_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCCCGGAGGCTCGCGGCGAGAG
TCH01_0076_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGTCCGGAGGCTCGCGGCGAGAG
OVR01_0036_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCCCGGAGGCTCGCGGCGAGAG
MLN01_0084_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCCCGGAGGCTCGCGGCGAGAG
TCH01_0076_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGTCCGGAGGCTCGCGGCGAGAG
SPL01_0075_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCCCGGAGGCTCGCGGCGAGAG
ITT01_0010_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCCCGGAGGCTCGCGGCGAGAG
CLNT1_0031_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCAGCCCGGAGGCTCGCGGCGAGAG
OVRM1_0196_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0027_B02.b : tcgcgttggctctggggTCAGCCCGGAG*CTCGCGGCGAGAG
TES01_0029_H05.b : ccgcgttggctctggaTCGCCCGGAGGCTCGCGGCGAGAG
SMG01_0091_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCCCGGAGGCTCGCGGCGAGAG
OVR01_0030_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGCCCGGAGGCTCGCGGCGAGAG
TES01_0005_G08.b : tcgcgttggctctggAGCCCGGAG*CTCGCGGCGAGAG
TCH01_0059_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtAGCCCGGAGGCTCGCGGCGAGAG
TES01_0109_E02.b : ttttttcgcgttggctctggaGCCCGGAG*CTCGCGGCGAGAG
PST01_0095_A08.b : nnnnccggctgtggctctggaGCCCGGAG*CTCGCGGCGAGAG
LNG01_0091_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCGGAGGCTCGCGGCGAGAG
TES01_0072_B11.b : ttccgctgtggctctggctcaCCCGGAGCTCGCGGCGAGAG
TES01_0049_D02.b : tttttcctgctgtgctatggggCCGGAGGCTCGCGGCGAGAG
TES01_0016_F05.b : nnnnncctgctgtggctatgagCCGGAGGCTCGCGGCGAGAG
TES01_0036_A07.b : nnncctgcgttgctctggagCCGGAG*CTCGCGGCGAGA*
PST01_0037_B08.b : ggctatggagCCGGAGGTCGCGGCGAGAG
TES01_0067_A03.b : ttttcctgctgttgctctgccgtGAGCTCGCGGCGAGAG
TES01_0024_F06.b : tgttggctctggagccggagcCGCGGCGAGAG
TES01_0045_C04.b : GAG
TES01_0038_D11.b : ttttcctgctgtggctacgga
PTG01_0087_C04.b : cgtttnnnnnnnnggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0041_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgtttaa
OVR01_0005_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0031_F08.b : tcacgtttggctat
TES01_0018_A09.b : cgttggc
TES01_0095_D02.b : tttttcctgctgtgg
PST01_0060_E11.b : nnnnggctactgtggctatgg
MLN01_0100_F10.b : ttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0029_F01.b : tcac
TES01_0109_G01.b : tttcctact
TES01_0105_G12.b : ntagctgca
SMG01_0022_H05.b : nnnggcttaaannnnggctaaagcagcggtaxxxxxxxxxxxxxxxxxxxxxx
TES01_0045_D09.b :
PST01_0037_G06.b :
TES01_0011_H10.b : ctgctg
OVR01_0070_A07.b : nnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0064_E09.b :
TES01_0014_D01.b :
PST01_0087_G02.b : nnnn
SMG01_0042_C06.b : nncccgttatnnnnnggataaagcagcxxxxxxxxxxxxxxxxxx
TES01_0074_G04.b :
PST01_0097_G12.b :
SMG01_0100_F02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LVRM1_0033_F06.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0182_A05.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0140_G12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0011_C01.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0102_E07.b : nnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0096_C02.b : nnnggctaggactatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_H06.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0098_H05.b : nnnttgctaggacttanacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0052_B04.b : ccagccacggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0101_B05.b : nnnnggtgaaacaxxxxxxxxxxxxxxxxxxxxx
TCH01_0017_D05.b : nnnnggctggacttgacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0085_D03.b : nnnnagcttggactatnacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0049_B09.b :
PST01_0021_B11.b :
PST01_0057_B10.b :
PST01_0041_E05.b :
KDN01_0058_E02.b :
TES01_0010_B12.b :
SKNB1_0065_H11.b :
TCH01_0092_E03.b : nnnnagcttggacttaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0059_D12.b :
PST01_0039_B10.b :
PST01_0077_F09.b :
LVRM1_0022_H05.b : agttgacxxxxxxx
OVRT1_0112_C08.b : nnnnccgtcagcgnaggxxxxxxxxx
ITT01_0066_F05.b : nnnggatga
LVR01_0074_A02.b : ttttttttttttttcgcttggtgxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0054_E09.b :
KDN01_0033_C01.b :
KDN01_0033_A09.b :
LVRM1_0157_B07.b :
PST01_0086_B08.b :
20110601C-001812 : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
---------+---------+---------+---------+---------+---------+ 240
OVRM1_0182_B09.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVR01_0005_B10.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0009_D01.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0018_B10.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0042_B10.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0030_A09.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0038_G06.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0106_F04.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0045_A10.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVR01_0020_B10.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
SPL01_0043_D12.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVR01_0025_A11.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0073_E06.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0104_H07.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVR01_0052_C08.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
LVR01_0058_C02.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0076_A03.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0069_H01.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0043_A01.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVR01_0048_G07.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0109_A11.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0024_B03.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0110_C07.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0036_H09.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0061_D07.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0055_E01.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
CBLT1_0100_B01.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0069_F05.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGGCC
TES01_0020_D09.b : TGCTGCTAGTGGGCACCCAACCGATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0003_G08.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
SMG01_0072_G10.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVR01_0048_F06.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
PST01_0028_G03.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0036_G05.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0060_A10.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0088_E12.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0109_H01.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0006_H02.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0094_B03.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0091_D09.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0002_B06.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0080_E03.b : TGCCGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0098_E01.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0030_B11.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0071_F04.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0100_F11.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0100_H01.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0097_H04.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0014_F06.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0024_D10.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0105_B06.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0008_A03.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0051_G05.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0058_C01.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0026_H09.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0063_A09.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
PTG01_0101_A06.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
ITT01_0032_G06.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVR01_0058_D12.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0039_F08.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
ADR01_0101_H11.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0072_D11.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0078_C06.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0072_C03.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0090_E10.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0098_C06.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0059_D08.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0039_D03.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0091_F12.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0086_E08.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0016_B02.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0011_A11.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0049_D11.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
KDN01_0065_E01.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0033_E11.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0025_E04.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0007_E09.b : CGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0070_C11.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0059_G09.b : TGCTGCTAGTGGGCACTCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0018_F11.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCATACC
TES01_0083_C04.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0069_D07.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0006_F12.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0072_B04.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0076_F02.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TCH01_0023_E11.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0061_E09.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0046_G10.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0096_F05.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0054_C03.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0094_B09.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0003_C11.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0005_B09.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
PST01_0077_D12.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
PST01_0095_E07.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
KDN01_0071_A11.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0078_F12.b : TGCTGCCAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0066_E10.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
THY01_0016_B07.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0014_G11.b : TGTTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
UTR01_0102_D12.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
LNG01_0085_B08.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGTTGCCAGCATTGCGCAGACC
ITT01_0049_A02.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
THY01_0118_B07.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0097_F08.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
SPL01_0104_E06.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0016_G11.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0107_G12.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0022_E12.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0093_H08.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
SPL01_0001_H02.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVR01_0085_C11.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVR01_0034_G04.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
LVRM1_0099_C05.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVRM1_0020_H04.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVRM1_0114_D01.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
SMG01_0048_C10.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVRM1_0116_E11.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
UTR01_0013_A04.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVR01_0098_B04.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
THY01_0051_C04.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
SPL01_0044_D11.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVR01_0059_A05.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
ADR01_0022_C09.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVR01_0101_H08.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVR01_0063_E06.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
THY01_0059_F04.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
SMG01_0035_B11.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
MLN01_0041_A05.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TCH01_0076_C06.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVR01_0036_E07.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
MLN01_0084_F02.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TCH01_0076_C09.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
SPL01_0075_D05.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGGCC
ITT01_0010_D12.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
CLNT1_0031_E05.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVRM1_0196_G11.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0027_B02.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0029_H05.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
SMG01_0091_B04.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVR01_0030_D09.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0005_G08.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TCH01_0059_F07.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0109_E02.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
PST01_0095_A08.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
LNG01_0091_C01.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0072_B11.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0049_D02.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0016_F05.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0036_A07.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
PST01_0037_B08.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0067_A03.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0024_F06.b : TGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0045_C04.b : TGCTGCTAGTGGGCAC*CAACCCATTCTGCGTCGCATCGGCTGCCAGCCTTGCGCAGACC
TES01_0038_D11.b : nGCTGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
PTG01_0087_C04.b : xxxxGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVR01_0041_A02.b : ctggGCTAGTGGGCACCCAACCCATTCTGCGTCGCCTTGGCTGCCAGCATTGCGCAGACC
OVR01_0005_A01.b : xxxxGCTAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0031_F08.b : gggctgcAGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0018_A09.b : tctgggctGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0095_D02.b : ctctggctGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
PST01_0060_E11.b : aggctgctGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
MLN01_0100_F10.b : xxxxxxxxGTGGGCACCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0029_F01.b : tgttgctgctgtGGGCACCACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0109_G01.b : gttgctatggagggGCACCACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0105_G12.b : gtggctctggagggGCACCACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCACACT
SMG01_0022_H05.b : xxxxxxxxxxxxxxxCCCAACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0045_D09.b : ctggtatgggcACCACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCACACC
PST01_0037_G06.b : ctgtggctctggACCACCCATTCTGCGTC*CATCGGCTGCCAGCATTGCGCAGACC
TES01_0011_H10.b : tggctctggatgggcacCCACCCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVR01_0070_A07.b : xxxxxxxxxxxxxxxxxxxxxGGATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
SKNB1_0064_E09.b : tggggcctgactgtggctatGGATTCTGCGTC*CATCGGCTGCC*GCATTGCGCAGACC
TES01_0014_D01.b : nncctgctgtggctctGGATTCTGCGTC*CATCGGCTGCCAGCATTGCGCAGACC
PST01_0087_G02.b : ncctgacgtggctatggaccaCCATTCTGCGTCGCATCGGCTGC*AGCATTGCGCAGACC
SMG01_0042_C06.b : xxxxxxxxxxxxxxxxxxxxxxCATTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0074_G04.b : tggctctggATTCTGCGTC*CATCGGCTGCCAGCATTGCGCAGACC
PST01_0097_G12.b : nnnncctgacgtggctatggATTCTGCGTC*CATCGGCTGCCAGCATTGCGCAGACC
SMG01_0100_F02.b : nnnnnnnnnnnnnnnxxxxxxxxxTTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
LVRM1_0033_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxTTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVRM1_0182_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxTTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
LVRM1_0140_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxTTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
UTR01_0011_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxTTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVR01_0102_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxTTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVR01_0096_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxTTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
LVR01_0044_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxTTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
SPL01_0098_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxTTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
LVR01_0052_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxTTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
ITT01_0101_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxTTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TCH01_0017_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxTTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
OVR01_0085_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxTTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
PST01_0049_B09.b : ttacgttggctatggaTCTGCGTC*CATCGGCTGCCAGCATTGCGCAGACC
PST01_0021_B11.b : gttggctctggaTCTGCGTCGCATCGGCTGCC*GCATTGCGCAGACC
PST01_0057_B10.b : ttttttcctgcgttggcctggaTCTGCGTC*CATCGGCTGCCAGCATTGCGCAGACC
PST01_0041_E05.b : nnncctgactgtggctatggaTCTGCGTC*CATCGGCTGCCAGCATTGCGCAGACC
KDN01_0058_E02.b : ttttcctgcggtggctctggaTCTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
TES01_0010_B12.b : ntcggcgttggctatggaTCTGCGTC*CATCGGCTGCCAGCATTGCGCAGACC
SKNB1_0065_H11.b : nnnnggtcgctgtggctatggattTGCGTC*CATCGGCTGCCAGCATTGCGCAGACC
TCH01_0092_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxTGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
PST01_0059_D12.b : nttttgactgcgttggctatggattcGCGTC*CATCGGCTGCC*GCATTGCGCAGACC
PST01_0039_B10.b : tcgcgttggctatgattcGCGTCGCATCGGCTGCCAGCATTGCGCAGACC
PST01_0077_F09.b : nnncctgcggttgctatggattcGCGTC*CATCGGCTGCCAGCATTGCGCAGACC
LVRM1_0022_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGCGCAGACC
OVRT1_0112_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGCGCAGACC
ITT01_0066_F05.b : acaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATTGCGCAGACC
LVR01_0074_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGCGCAGACC
PST01_0054_E09.b : ttcctcgctgtggctatggaTGCGCAGACC
KDN01_0033_C01.b : ttttgctgcgttggctatggatgcgcGACC
KDN01_0033_A09.b : tttttacggctgtggctctggatgcgcGACC
LVRM1_0157_B07.b : nagttgtcxxxxx
PST01_0086_B08.b :
20110601C-001812 : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
---------+---------+---------+---------+---------+---------+ 299
OVRM1_0182_B09.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVR01_0005_B10.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0009_D01.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0018_B10.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0042_B10.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0030_A09.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0038_G06.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0106_F04.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0045_A10.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVR01_0020_B10.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
SPL01_0043_D12.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVR01_0025_A11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0073_E06.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0104_H07.b : TTCGACCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVR01_0052_C08.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
LVR01_0058_C02.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0076_A03.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0069_H01.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0043_A01.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVR01_0048_G07.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0109_A11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0024_B03.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0110_C07.b : TTCGGCCTCGCTTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0036_H09.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0061_D07.b : TTCGACCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0055_E01.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
CBLT1_0100_B01.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0069_F05.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0020_D09.b : TTCGGCCTCGCGTTCG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0003_G08.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
SMG01_0072_G10.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVR01_0048_F06.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
PST01_0028_G03.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0036_G05.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0060_A10.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0088_E12.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0109_H01.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0006_H02.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0094_B03.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0091_D09.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0002_B06.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0080_E03.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0098_E01.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0030_B11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0071_F04.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0100_F11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0100_H01.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0097_H04.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0014_F06.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0024_D10.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0105_B06.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0008_A03.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0051_G05.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0058_C01.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0026_H09.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0063_A09.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
PTG01_0101_A06.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
ITT01_0032_G06.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVR01_0058_D12.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACACATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0039_F08.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
ADR01_0101_H11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0072_D11.b : TTCGGCCTCGCGTTTG*GGAGAGACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0078_C06.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0072_C03.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0090_E10.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0098_C06.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0059_D08.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0039_D03.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0091_F12.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0086_E08.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0016_B02.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0011_A11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0049_D11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
KDN01_0065_E01.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0033_E11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0025_E04.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0007_E09.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0070_C11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0059_G09.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0018_F11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0083_C04.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0069_D07.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0006_F12.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0072_B04.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0076_F02.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TCH01_0023_E11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0061_E09.b : TTCGGCCTCGCGTTTG*GGAGAAACCTGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0046_G10.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0096_F05.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0054_C03.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0094_B09.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0003_C11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAAACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0005_B09.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
PST01_0077_D12.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
PST01_0095_E07.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
KDN01_0071_A11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGTAGAGGCACCGCTG
TES01_0078_F12.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0066_E10.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
THY01_0016_B07.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0014_G11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
UTR01_0102_D12.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
LNG01_0085_B08.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
ITT01_0049_A02.b : TTCGGCCTCGCGTTTG*GGAGGAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
THY01_0118_B07.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0097_F08.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
SPL01_0104_E06.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0016_G11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0107_G12.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0022_E12.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0093_H08.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
SPL01_0001_H02.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVR01_0085_C11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVR01_0034_G04.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
LVRM1_0099_C05.b : TTCGGCCTCGCGTTTA*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVRM1_0020_H04.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVRM1_0114_D01.b : TTCGGCCTCGCGTTTA*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
SMG01_0048_C10.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVRM1_0116_E11.b : TTCGGCCTCGCGTTTA*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
UTR01_0013_A04.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVR01_0098_B04.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
THY01_0051_C04.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
SPL01_0044_D11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVR01_0059_A05.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
ADR01_0022_C09.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVR01_0101_H08.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVR01_0063_E06.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
THY01_0059_F04.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
SMG01_0035_B11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
MLN01_0041_A05.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TCH01_0076_C06.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVR01_0036_E07.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
MLN01_0084_F02.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAAGCACCGCTG
TCH01_0076_C09.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
SPL01_0075_D05.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
ITT01_0010_D12.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
CLNT1_0031_E05.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVRM1_0196_G11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0027_B02.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0029_H05.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
SMG01_0091_B04.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVR01_0030_D09.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0005_G08.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TCH01_0059_F07.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0109_E02.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
PST01_0095_A08.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
LNG01_0091_C01.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0072_B11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0049_D02.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0016_F05.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0036_A07.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
PST01_0037_B08.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0067_A03.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0024_F06.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0045_C04.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0038_D11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
PTG01_0087_C04.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVR01_0041_A02.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVR01_0005_A01.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0031_F08.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0018_A09.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0095_D02.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
PST01_0060_E11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
MLN01_0100_F10.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0029_F01.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0109_G01.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0105_G12.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
SMG01_0022_H05.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0045_D09.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
PST01_0037_G06.b : TTCCGTCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0011_H10.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVR01_0070_A07.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
SKNB1_0064_E09.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0014_D01.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
PST01_0087_G02.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
SMG01_0042_C06.b : TTCGGCCTCGCGTTTG*GGGGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0074_G04.b : TTCGGCCTCGCGCTTGTGGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
PST01_0097_G12.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
SMG01_0100_F02.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
LVRM1_0033_F06.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVRM1_0182_A05.b : TTCGGCCTCGCGTTTA*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
LVRM1_0140_G12.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
UTR01_0011_C01.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVR01_0102_E07.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVR01_0096_C02.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
LVR01_0044_H06.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
SPL01_0098_H05.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
LVR01_0052_B04.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
ITT01_0101_B05.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TCH01_0017_D05.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVR01_0085_D03.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
PST01_0049_B09.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
PST01_0021_B11.b : TTCGGCCTCGCGTTTG*GGAGAAACTAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
PST01_0057_B10.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
PST01_0041_E05.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
KDN01_0058_E02.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TES01_0010_B12.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
SKNB1_0065_H11.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
TCH01_0092_E03.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
PST01_0059_D12.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
PST01_0039_B10.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
PST01_0077_F09.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
LVRM1_0022_H05.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
OVRT1_0112_C08.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
ITT01_0066_F05.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
LVR01_0074_A02.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
PST01_0054_E09.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGTCCGTGCAGAGGCACCGCTG
KDN01_0033_C01.b : TTCGGCCTCGCGTTTG*GGAGAAAC*AGACCCATCCGCTGCCCGTGCAGAGGCACCGCTG
KDN01_0033_A09.b : TTCGGCCTCGCGTTTG*GGAGAAACCAGACCCATCCGCTGCCCTTGCAGAGGCACCGCTG
LVRM1_0157_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGCACCGCTG
PST01_0086_B08.b : nncctgcgttgctctggaagcacgct
20110601C-001812 : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
---------+---------+---------+---------+---------+---------+ 359
OVRM1_0182_B09.b : CCCGGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVR01_0005_B10.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0009_D01.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0018_B10.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0042_B10.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0030_A09.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0038_G06.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0106_F04.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0045_A10.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVR01_0020_B10.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
SPL01_0043_D12.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVR01_0025_A11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0073_E06.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0104_H07.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVR01_0052_C08.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
LVR01_0058_C02.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0076_A03.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0069_H01.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0043_A01.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVR01_0048_G07.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0109_A11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0024_B03.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0110_C07.b : CCCCGCTCCCGACCATGTCGTCCAACTTTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0036_H09.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0061_D07.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0055_E01.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
CBLT1_0100_B01.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0069_F05.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0020_D09.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0003_G08.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
SMG01_0072_G10.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAAG
OVR01_0048_F06.b : CCCCGCTCCCGACCTTGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
PST01_0028_G03.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0036_G05.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0060_A10.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0088_E12.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0109_H01.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0006_H02.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0094_B03.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0091_D09.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0002_B06.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0080_E03.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0098_E01.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0030_B11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0071_F04.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0100_F11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0100_H01.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0097_H04.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0014_F06.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0024_D10.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0105_B06.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0008_A03.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0051_G05.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0058_C01.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0026_H09.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0063_A09.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
PTG01_0101_A06.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
ITT01_0032_G06.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVR01_0058_D12.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0039_F08.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
ADR01_0101_H11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0072_D11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0078_C06.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0072_C03.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0090_E10.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0098_C06.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0059_D08.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0039_D03.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGGCCGGCGGCAACAAGG
TES01_0091_F12.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0086_E08.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0016_B02.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0011_A11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0049_D11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
KDN01_0065_E01.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0033_E11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0025_E04.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0007_E09.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0070_C11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0059_G09.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0018_F11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0083_C04.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0069_D07.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0006_F12.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0072_B04.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGCGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0076_F02.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TCH01_0023_E11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0061_E09.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0046_G10.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0096_F05.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0054_C03.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0094_B09.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0003_C11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0005_B09.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
PST01_0077_D12.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
PST01_0095_E07.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
KDN01_0071_A11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0078_F12.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0066_E10.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
THY01_0016_B07.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0014_G11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
UTR01_0102_D12.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
LNG01_0085_B08.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
ITT01_0049_A02.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
THY01_0118_B07.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0097_F08.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
SPL01_0104_E06.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0016_G11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0107_G12.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0022_E12.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0093_H08.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
SPL01_0001_H02.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVR01_0085_C11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVR01_0034_G04.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
LVRM1_0099_C05.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVRM1_0020_H04.b : CCCGGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVRM1_0114_D01.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
SMG01_0048_C10.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVRM1_0116_E11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
UTR01_0013_A04.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVR01_0098_B04.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
THY01_0051_C04.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
SPL01_0044_D11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVR01_0059_A05.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
ADR01_0022_C09.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVR01_0101_H08.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAGGG
OVR01_0063_E06.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
THY01_0059_F04.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
SMG01_0035_B11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
MLN01_0041_A05.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TCH01_0076_C06.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCATCAAGG
OVR01_0036_E07.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
MLN01_0084_F02.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TCH01_0076_C09.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCATCAAGG
SPL01_0075_D05.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
ITT01_0010_D12.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
CLNT1_0031_E05.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVRM1_0196_G11.b : CCCGGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0027_B02.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0029_H05.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
SMG01_0091_B04.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVR01_0030_D09.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0005_G08.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TCH01_0059_F07.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0109_E02.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
PST01_0095_A08.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
LNG01_0091_C01.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0072_B11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0049_D02.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0016_F05.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0036_A07.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
PST01_0037_B08.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0067_A03.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0024_F06.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0045_C04.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0038_D11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
PTG01_0087_C04.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVR01_0041_A02.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVR01_0005_A01.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0031_F08.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0018_A09.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0095_D02.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
PST01_0060_E11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
MLN01_0100_F10.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0029_F01.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0109_G01.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0105_G12.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
SMG01_0022_H05.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0045_D09.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
PST01_0037_G06.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0011_H10.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVR01_0070_A07.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
SKNB1_0064_E09.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0014_D01.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
PST01_0087_G02.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
SMG01_0042_C06.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0074_G04.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
PST01_0097_G12.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
SMG01_0100_F02.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
LVRM1_0033_F06.b : CCCGGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVRM1_0182_A05.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
LVRM1_0140_G12.b : CCCGGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGCGGTGACCGGCGGCAACAAGG
UTR01_0011_C01.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVR01_0102_E07.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVR01_0096_C02.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
LVR01_0044_H06.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
SPL01_0098_H05.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
LVR01_0052_B04.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
ITT01_0101_B05.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TCH01_0017_D05.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVR01_0085_D03.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
PST01_0049_B09.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
PST01_0021_B11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
PST01_0057_B10.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
PST01_0041_E05.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
KDN01_0058_E02.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TES01_0010_B12.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
SKNB1_0065_H11.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
TCH01_0092_E03.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
PST01_0059_D12.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
PST01_0039_B10.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
PST01_0077_F09.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
LVRM1_0022_H05.b : CCCGGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
OVRT1_0112_C08.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
ITT01_0066_F05.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
LVR01_0074_A02.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
PST01_0054_E09.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
KDN01_0033_C01.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
KDN01_0033_A09.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
LVRM1_0157_B07.b : CCCCGCTCCCGACCATGTCGTCCAACATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
PST01_0086_B08.b : gCCCGCTCCCGACC*TGTCGTCCA*CATTCGCGTGGCGGTGGTGACCGGCGGCAACAAGG
20110601C-001812 : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
---------+---------+---------+---------+---------+---------+ 419
OVRM1_0182_B09.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVR01_0005_B10.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0009_D01.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0018_B10.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0042_B10.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0030_A09.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0038_G06.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0106_F04.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0045_A10.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVR01_0020_B10.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
SPL01_0043_D12.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVR01_0025_A11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0073_E06.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0104_H07.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVR01_0052_C08.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
LVR01_0058_C02.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0076_A03.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0069_H01.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0043_A01.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVR01_0048_G07.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0109_A11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0024_B03.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0110_C07.b : GCATCGGCCTCGCCATCTTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0036_H09.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0061_D07.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0055_E01.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
CBLT1_0100_B01.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0069_F05.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0020_D09.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0003_G08.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
SMG01_0072_G10.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCATTTCTCGGGGGATGTGATGCTTA
OVR01_0048_F06.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
PST01_0028_G03.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0036_G05.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0060_A10.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0088_E12.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0109_H01.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGACGCTTA
TES01_0006_H02.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGACGTGATGCTTA
TES01_0094_B03.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0091_D09.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTCA
TES01_0002_B06.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0080_E03.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0098_E01.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0030_B11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0071_F04.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0100_F11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0100_H01.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0097_H04.b : GCATCGGTCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0014_F06.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0024_D10.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0105_B06.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0008_A03.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0051_G05.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0058_C01.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0026_H09.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0063_A09.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
PTG01_0101_A06.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGACGCTTA
ITT01_0032_G06.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVR01_0058_D12.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0039_F08.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
ADR01_0101_H11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0072_D11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0078_C06.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0072_C03.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0090_E10.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0098_C06.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0059_D08.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0039_D03.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0091_F12.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0086_E08.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0016_B02.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0011_A11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0049_D11.b : GCATCAGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
KDN01_0065_E01.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0033_E11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0025_E04.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0007_E09.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0070_C11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0059_G09.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0018_F11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0083_C04.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0069_D07.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0006_F12.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0072_B04.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0076_F02.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TCH01_0023_E11.b : GCATCGGCCTCGCCATCGTGCGTGACCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0061_E09.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0046_G10.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0096_F05.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0054_C03.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0094_B09.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0003_C11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0005_B09.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
PST01_0077_D12.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
PST01_0095_E07.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
KDN01_0071_A11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0078_F12.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0066_E10.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
THY01_0016_B07.b : GCATCGGCCTCGCCATCCTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0014_G11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
UTR01_0102_D12.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
LNG01_0085_B08.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
ITT01_0049_A02.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
THY01_0118_B07.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0097_F08.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCGCGGGGGATGTGATGCTTA
SPL01_0104_E06.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0016_G11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0107_G12.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0022_E12.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0093_H08.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
SPL01_0001_H02.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVR01_0085_C11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVR01_0034_G04.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
LVRM1_0099_C05.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVRM1_0020_H04.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVRM1_0114_D01.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
SMG01_0048_C10.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVRM1_0116_E11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
UTR01_0013_A04.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVR01_0098_B04.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
THY01_0051_C04.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
SPL01_0044_D11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVR01_0059_A05.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
ADR01_0022_C09.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVR01_0101_H08.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVR01_0063_E06.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
THY01_0059_F04.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
SMG01_0035_B11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
MLN01_0041_A05.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TCH01_0076_C06.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVR01_0036_E07.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
MLN01_0084_F02.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TCH01_0076_C09.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
SPL01_0075_D05.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
ITT01_0010_D12.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
CLNT1_0031_E05.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVRM1_0196_G11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0027_B02.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0029_H05.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
SMG01_0091_B04.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVR01_0030_D09.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0005_G08.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TCH01_0059_F07.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0109_E02.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
PST01_0095_A08.b : GCATCGGCCTCGCCATCGTGCCTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
LNG01_0091_C01.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0072_B11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0049_D02.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0016_F05.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0036_A07.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
PST01_0037_B08.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0067_A03.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0024_F06.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0045_C04.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0038_D11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
PTG01_0087_C04.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVR01_0041_A02.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVR01_0005_A01.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0031_F08.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0018_A09.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0095_D02.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
PST01_0060_E11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
MLN01_0100_F10.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0029_F01.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0109_G01.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0105_G12.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
SMG01_0022_H05.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0045_D09.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
PST01_0037_G06.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0011_H10.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVR01_0070_A07.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
SKNB1_0064_E09.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0014_D01.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
PST01_0087_G02.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
SMG01_0042_C06.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0074_G04.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
PST01_0097_G12.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
SMG01_0100_F02.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
LVRM1_0033_F06.b : GCATCGGCCTCGCCATCGTGCGTGATCTGCGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVRM1_0182_A05.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
LVRM1_0140_G12.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
UTR01_0011_C01.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVR01_0102_E07.b : GCATCGGCCTCGCCATCGTGCGAGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVR01_0096_C02.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGTGGGATGTGATGCTTA
LVR01_0044_H06.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
SPL01_0098_H05.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
LVR01_0052_B04.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
ITT01_0101_B05.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TCH01_0017_D05.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVR01_0085_D03.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
PST01_0049_B09.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
PST01_0021_B11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
PST01_0057_B10.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
PST01_0041_E05.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
KDN01_0058_E02.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TES01_0010_B12.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
SKNB1_0065_H11.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
TCH01_0092_E03.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
PST01_0059_D12.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
PST01_0039_B10.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
PST01_0077_F09.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
LVRM1_0022_H05.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
OVRT1_0112_C08.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
ITT01_0066_F05.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
LVR01_0074_A02.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
PST01_0054_E09.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
KDN01_0033_C01.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
KDN01_0033_A09.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
LVRM1_0157_B07.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
PST01_0086_B08.b : GCATCGGCCTCGCCATCGTGCGTGATCTGTGCCAGCAGTTCTCGGGGGATGTGATGCTTA
20110601C-001812 : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
---------+---------+---------+---------+---------+---------+ 479
OVRM1_0182_B09.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVR01_0005_B10.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0009_D01.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0018_B10.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0042_B10.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0030_A09.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0038_G06.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0106_F04.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0045_A10.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVR01_0020_B10.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
SPL01_0043_D12.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVR01_0025_A11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0073_E06.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0104_H07.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVR01_0052_C08.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
LVR01_0058_C02.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0076_A03.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0069_H01.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0043_A01.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVR01_0048_G07.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0109_A11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0024_B03.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0110_C07.b : CGGCGCGGGACGTGGCGAGAGGCCATGCTGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0036_H09.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0061_D07.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0055_E01.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
CBLT1_0100_B01.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0069_F05.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0020_D09.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0003_G08.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
SMG01_0072_G10.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVR01_0048_F06.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
PST01_0028_G03.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0036_G05.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0060_A10.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0088_E12.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0109_H01.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0006_H02.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0094_B03.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0091_D09.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0002_B06.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0080_E03.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0098_E01.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0030_B11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0071_F04.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0100_F11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0100_H01.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0097_H04.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0014_F06.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0024_D10.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0105_B06.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0008_A03.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0051_G05.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0058_C01.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0026_H09.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0063_A09.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
PTG01_0101_A06.b : CGGCGCGGGACGTGGCGAGAGGCCANGNNCGCGTGCANCAGCTGCAGGCTGAGGGTCTGA
ITT01_0032_G06.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVR01_0058_D12.b : CTGCGCGTGACATGGCGAGAGGCCAAGCGGCGGTGCATCATCTGCAGGCTGAGGGTCTGA
TES01_0039_F08.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
ADR01_0101_H11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0072_D11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0078_C06.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0072_C03.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0090_E10.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0098_C06.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0059_D08.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0039_D03.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0091_F12.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0086_E08.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0016_B02.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0011_A11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0049_D11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
KDN01_0065_E01.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0033_E11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0025_E04.b : CGGCGCGGGACGTGGCGAGAGGCCATGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0007_E09.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0070_C11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0059_G09.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0018_F11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0083_C04.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0069_D07.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0006_F12.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0072_B04.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0076_F02.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TCH01_0023_E11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0061_E09.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0046_G10.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0096_F05.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0054_C03.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0094_B09.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCGGGCTGAGGGTCTGA
TES01_0003_C11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0005_B09.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
PST01_0077_D12.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
PST01_0095_E07.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
KDN01_0071_A11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0078_F12.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0066_E10.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
THY01_0016_B07.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0014_G11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
UTR01_0102_D12.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
LNG01_0085_B08.b : CGGCGCGGGGCGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
ITT01_0049_A02.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
THY01_0118_B07.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0097_F08.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
SPL01_0104_E06.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0016_G11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0107_G12.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0022_E12.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0093_H08.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
SPL01_0001_H02.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVR01_0085_C11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVR01_0034_G04.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
LVRM1_0099_C05.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVRM1_0020_H04.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVRM1_0114_D01.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
SMG01_0048_C10.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVRM1_0116_E11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
UTR01_0013_A04.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVR01_0098_B04.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
THY01_0051_C04.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
SPL01_0044_D11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVR01_0059_A05.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
ADR01_0022_C09.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVR01_0101_H08.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVR01_0063_E06.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
THY01_0059_F04.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
SMG01_0035_B11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
MLN01_0041_A05.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TCH01_0076_C06.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVR01_0036_E07.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
MLN01_0084_F02.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TCH01_0076_C09.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
SPL01_0075_D05.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
ITT01_0010_D12.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
CLNT1_0031_E05.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVRM1_0196_G11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0027_B02.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0029_H05.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
SMG01_0091_B04.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVR01_0030_D09.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0005_G08.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TCH01_0059_F07.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0109_E02.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
PST01_0095_A08.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCCGA
LNG01_0091_C01.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0072_B11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0049_D02.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0016_F05.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0036_A07.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
PST01_0037_B08.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0067_A03.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0024_F06.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0045_C04.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0038_D11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
PTG01_0087_C04.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVR01_0041_A02.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGTAGCTGCAGGCTGAGGGTCTGA
OVR01_0005_A01.b : CGGCGCGGGACGTGGCGAAAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0031_F08.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0018_A09.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0095_D02.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
PST01_0060_E11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
MLN01_0100_F10.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0029_F01.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0109_G01.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0105_G12.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
SMG01_0022_H05.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0045_D09.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
PST01_0037_G06.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0011_H10.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVR01_0070_A07.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
SKNB1_0064_E09.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0014_D01.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
PST01_0087_G02.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
SMG01_0042_C06.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0074_G04.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
PST01_0097_G12.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
SMG01_0100_F02.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
LVRM1_0033_F06.b : CGGCGCGGGGCGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVRM1_0182_A05.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
LVRM1_0140_G12.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
UTR01_0011_C01.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVR01_0102_E07.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVR01_0096_C02.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
LVR01_0044_H06.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
SPL01_0098_H05.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
LVR01_0052_B04.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
ITT01_0101_B05.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TCH01_0017_D05.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVR01_0085_D03.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
PST01_0049_B09.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
PST01_0021_B11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
PST01_0057_B10.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
PST01_0041_E05.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
KDN01_0058_E02.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TES01_0010_B12.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
SKNB1_0065_H11.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
TCH01_0092_E03.b : CGGCGCGGGACGTGGCGAGAGACCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
PST01_0059_D12.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
PST01_0039_B10.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
PST01_0077_F09.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
LVRM1_0022_H05.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
OVRT1_0112_C08.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
ITT01_0066_F05.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
LVR01_0074_A02.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
PST01_0054_E09.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
KDN01_0033_C01.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
KDN01_0033_A09.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
LVRM1_0157_B07.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
PST01_0086_B08.b : CGGCGCGGGACGTGGCGAGAGGCCAGGCGGCGGTGCAGCAGCTGCAGGCTGAGGGTCTGA
20110601C-001812 : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
---------+---------+---------+---------+---------+---------+ 538
OVRM1_0182_B09.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTGGGAGCATCCGGGCCCT*GCGCGAC
OVR01_0005_B10.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0009_D01.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0018_B10.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0042_B10.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0030_A09.b : GCCCGCGCTTCCACCAGCCGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0038_G06.b : GCCCGCGCTTCCACCAGCCGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0106_F04.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0045_A10.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
OVR01_0020_B10.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
SPL01_0043_D12.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
OVR01_0025_A11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0073_E06.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGGC
TES01_0104_H07.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTTGGAGCATCCAGGCCCT*GCGCGAC
OVR01_0052_C08.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
LVR01_0058_C02.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0076_A03.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0069_H01.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0043_A01.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
OVR01_0048_G07.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0109_A11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0024_B03.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0110_C07.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCTGGCCCTTGCGCGAC
TES01_0036_H09.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0061_D07.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0055_E01.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
CBLT1_0100_B01.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0069_F05.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0020_D09.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0003_G08.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
SMG01_0072_G10.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
OVR01_0048_F06.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
PST01_0028_G03.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0036_G05.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0060_A10.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0088_E12.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0109_H01.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0006_H02.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0094_B03.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0091_D09.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0002_B06.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0080_E03.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0098_E01.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0030_B11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0071_F04.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0100_F11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0100_H01.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0097_H04.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGTCCT*GCGCGAC
TES01_0014_F06.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0024_D10.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0105_B06.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0008_A03.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0051_G05.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0058_C01.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0026_H09.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0063_A09.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
PTG01_0101_A06.b : GCCCNGCGCTCCCACAGCTGGATATCGcgacnttcggagcatccaggcctgcgcgacttc
ITT01_0032_G06.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
OVR01_0058_D12.b : GCCCGCGCTTCCACCACCTGGATATCGACTACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0039_F08.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
ADR01_0101_H11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0072_D11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0078_C06.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0072_C03.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0090_E10.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0098_C06.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAACATCCAGGCCCT*GCGCGAC
TES01_0059_D08.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0039_D03.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0091_F12.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0086_E08.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0016_B02.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0011_A11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0049_D11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
KDN01_0065_E01.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0033_E11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0025_E04.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0007_E09.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0070_C11.b : GCCCGCGCTTCCACCAGCCGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0059_G09.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0018_F11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0083_C04.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0069_D07.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0006_F12.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0072_B04.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0076_F02.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TCH01_0023_E11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0061_E09.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0046_G10.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0096_F05.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0054_C03.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0094_B09.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0003_C11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0005_B09.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
PST01_0077_D12.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
PST01_0095_E07.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
KDN01_0071_A11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0078_F12.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0066_E10.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
THY01_0016_B07.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0014_G11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
UTR01_0102_D12.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCC*GCGCGAC
LNG01_0085_B08.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
ITT01_0049_A02.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
THY01_0118_B07.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0097_F08.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
SPL01_0104_E06.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0016_G11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0107_G12.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0022_E12.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0093_H08.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
SPL01_0001_H02.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
OVR01_0085_C11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
OVR01_0034_G04.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
LVRM1_0099_C05.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
OVRM1_0020_H04.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTGGGAGCATCCGGGCCCT*GCGCGAC
OVRM1_0114_D01.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
SMG01_0048_C10.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
OVRM1_0116_E11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
UTR01_0013_A04.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
OVR01_0098_B04.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
THY01_0051_C04.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
SPL01_0044_D11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
OVR01_0059_A05.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
ADR01_0022_C09.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
OVR01_0101_H08.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
OVR01_0063_E06.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
THY01_0059_F04.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
SMG01_0035_B11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
MLN01_0041_A05.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TCH01_0076_C06.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
OVR01_0036_E07.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
MLN01_0084_F02.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TCH01_0076_C09.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
SPL01_0075_D05.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
ITT01_0010_D12.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
CLNT1_0031_E05.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
OVRM1_0196_G11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTGGGAGCATCCGGGCCCT*GCGCGAC
TES01_0027_B02.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0029_H05.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
SMG01_0091_B04.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
OVR01_0030_D09.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0005_G08.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TCH01_0059_F07.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0109_E02.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
PST01_0095_A08.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
LNG01_0091_C01.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0072_B11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0049_D02.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0016_F05.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0036_A07.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
PST01_0037_B08.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0067_A03.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0024_F06.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0045_C04.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0038_D11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
PTG01_0087_C04.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
OVR01_0041_A02.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
OVR01_0005_A01.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0031_F08.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0018_A09.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0095_D02.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
PST01_0060_E11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
MLN01_0100_F10.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0029_F01.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0109_G01.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0105_G12.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
SMG01_0022_H05.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0045_D09.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
PST01_0037_G06.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0011_H10.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
OVR01_0070_A07.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
SKNB1_0064_E09.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTACGGAGCATCCAGGCCCT*GCGCGAC
TES01_0014_D01.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
PST01_0087_G02.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
SMG01_0042_C06.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0074_G04.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
PST01_0097_G12.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
SMG01_0100_F02.b : GCCCGCGCTTCCCACAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
LVRM1_0033_F06.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTGGGAGCATCCGGGCCCT*GCGCGAC
OVRM1_0182_A05.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
LVRM1_0140_G12.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTGGGAGCATCCGGGCCCT*GCGCGAC
UTR01_0011_C01.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
OVR01_0102_E07.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
OVR01_0096_C02.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
LVR01_0044_H06.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
SPL01_0098_H05.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
LVR01_0052_B04.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
ITT01_0101_B05.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TCH01_0017_D05.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
OVR01_0085_D03.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
PST01_0049_B09.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
PST01_0021_B11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
PST01_0057_B10.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
PST01_0041_E05.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
KDN01_0058_E02.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TES01_0010_B12.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
SKNB1_0065_H11.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
TCH01_0092_E03.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
PST01_0059_D12.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
PST01_0039_B10.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
PST01_0077_F09.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
LVRM1_0022_H05.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTGGGAGCATCCGGGCCCT*GCGCGAC
OVRT1_0112_C08.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
ITT01_0066_F05.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
LVR01_0074_A02.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
PST01_0054_E09.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
KDN01_0033_C01.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
KDN01_0033_A09.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
LVRM1_0157_B07.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
PST01_0086_B08.b : GCCCGCGCTTCCACCAGCTGGATATCGACGACCTTCGGAGCATCCAGGCCCT*GCGCGAC
20110601C-001812 : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
---------+---------+---------+---------+---------+---------+ 597
OVRM1_0182_B09.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVR01_0005_B10.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0009_D01.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0018_B10.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0042_B10.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0030_A09.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0038_G06.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0106_F04.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0045_A10.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVR01_0020_B10.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
SPL01_0043_D12.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVR01_0025_A11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0073_E06.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0104_H07.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVR01_0052_C08.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
LVR01_0058_C02.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0076_A03.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0069_H01.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0043_A01.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVR01_0048_G07.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0109_A11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0024_B03.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0110_C07.b : TTCCTGCTCAAAGAGTATGGGGGACTCAACTTGCCGGTCAATAACGCGGGCATCGC*TTT
TES01_0036_H09.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0061_D07.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0055_E01.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
CBLT1_0100_B01.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0069_F05.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0020_D09.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0003_G08.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
SMG01_0072_G10.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVR01_0048_F06.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
PST01_0028_G03.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0036_G05.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0060_A10.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0088_E12.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0109_H01.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0006_H02.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0094_B03.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0091_D09.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0002_B06.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0080_E03.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0098_E01.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0030_B11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0071_F04.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGCGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0100_F11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0100_H01.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0097_H04.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0014_F06.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0024_D10.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0105_B06.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0008_A03.b : TTCCTGCTCGAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0051_G05.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0058_C01.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0026_H09.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0063_A09.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
PTG01_0101_A06.b : ctgctcaagagtagggggactccacgtgctggtcataagccgggctccttttcaaaaggt
ITT01_0032_G06.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVR01_0058_D12.b : TTCCTGCTCAAGGAGTATGGGGGACTCACCGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0039_F08.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
ADR01_0101_H11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0072_D11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0078_C06.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0072_C03.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0090_E10.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0098_C06.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0059_D08.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0039_D03.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0091_F12.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0086_E08.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0016_B02.b : TTCCTGCT*AAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0011_A11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0049_D11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
KDN01_0065_E01.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0033_E11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGCTTTT
TES01_0025_E04.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCTATAACGCGGGCATCGC*TTT
TES01_0007_E09.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0070_C11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0059_G09.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0018_F11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0083_C04.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0069_D07.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0006_F12.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0072_B04.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0076_F02.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TCH01_0023_E11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0061_E09.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0046_G10.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0096_F05.b : TTCCTGCTCAAGGAGTAAGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0054_C03.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0094_B09.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0003_C11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0005_B09.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
PST01_0077_D12.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
PST01_0095_E07.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
KDN01_0071_A11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0078_F12.b : TTCCTGCTCAAGGAGTATGGGGGA*TCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0066_E10.b : TTCCTGCTCAAGGAGTAAGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
THY01_0016_B07.b : TTCCTGCTCAAGGAGTATGGGGGACTCACCGTGCTGGTCAATAACGCGCGCATCGC*TTT
TES01_0014_G11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
UTR01_0102_D12.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
LNG01_0085_B08.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
ITT01_0049_A02.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
THY01_0118_B07.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0097_F08.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
SPL01_0104_E06.b : TTCCTGCTCAAGGAGTATGGGGAACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0016_G11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0107_G12.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0022_E12.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0093_H08.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
SPL01_0001_H02.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVR01_0085_C11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVR01_0034_G04.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
LVRM1_0099_C05.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVRM1_0020_H04.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVRM1_0114_D01.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
SMG01_0048_C10.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCGATAACGCGGGCATCGC*TTT
OVRM1_0116_E11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
UTR01_0013_A04.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVR01_0098_B04.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
THY01_0051_C04.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
SPL01_0044_D11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVR01_0059_A05.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
ADR01_0022_C09.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVR01_0101_H08.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVR01_0063_E06.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
THY01_0059_F04.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
SMG01_0035_B11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
MLN01_0041_A05.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TCH01_0076_C06.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVR01_0036_E07.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
MLN01_0084_F02.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TCH01_0076_C09.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
SPL01_0075_D05.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
ITT01_0010_D12.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
CLNT1_0031_E05.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVRM1_0196_G11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0027_B02.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0029_H05.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
SMG01_0091_B04.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVR01_0030_D09.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0005_G08.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TCH01_0059_F07.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0109_E02.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
PST01_0095_A08.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
LNG01_0091_C01.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0072_B11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0049_D02.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0016_F05.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0036_A07.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
PST01_0037_B08.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0067_A03.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0024_F06.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0045_C04.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0038_D11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
PTG01_0087_C04.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVR01_0041_A02.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVR01_0005_A01.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0031_F08.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0018_A09.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0095_D02.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
PST01_0060_E11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
MLN01_0100_F10.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0029_F01.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0109_G01.b : TTCCTGCTCAAGGAGTATGAGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0105_G12.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
SMG01_0022_H05.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0045_D09.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
PST01_0037_G06.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0011_H10.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVR01_0070_A07.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
SKNB1_0064_E09.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAGCGCGGGCATCGC*TTT
TES01_0014_D01.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
PST01_0087_G02.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
SMG01_0042_C06.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0074_G04.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
PST01_0097_G12.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
SMG01_0100_F02.b : TTCCTGCTCANGGAGTATGGGGGACTCAACGTGCTGGTCCATAACGCGGGCATCGC*TTT
LVRM1_0033_F06.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVRM1_0182_A05.b : CTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
LVRM1_0140_G12.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
UTR01_0011_C01.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVR01_0102_E07.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVR01_0096_C02.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
LVR01_0044_H06.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
SPL01_0098_H05.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
LVR01_0052_B04.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
ITT01_0101_B05.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TCH01_0017_D05.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
OVR01_0085_D03.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
PST01_0049_B09.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
PST01_0021_B11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
PST01_0057_B10.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
PST01_0041_E05.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
KDN01_0058_E02.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TES01_0010_B12.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
SKNB1_0065_H11.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
TCH01_0092_E03.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
PST01_0059_D12.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
PST01_0039_B10.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
PST01_0077_F09.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
LVRM1_0022_H05.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTC
OVRT1_0112_C08.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
ITT01_0066_F05.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
LVR01_0074_A02.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
PST01_0054_E09.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
KDN01_0033_C01.b : TCCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
KDN01_0033_A09.b : TCCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
LVRM1_0157_B07.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
PST01_0086_B08.b : TTCCTGCTCAAGGAGTATGGGGGACTCAACGTGCTGGTCAATAACGCGGGCATCGC*TTT
20110601C-001812 : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
---------+---------+---------+---------+---------+---------+ 655
OVRM1_0182_B09.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVR01_0005_B10.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0009_D01.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0018_B10.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0042_B10.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0030_A09.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0038_G06.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0106_F04.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0045_A10.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVR01_0020_B10.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
SPL01_0043_D12.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVR01_0025_A11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0073_E06.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCCAGCAGAGGTAACTATG*AAAACAAAT
TES01_0104_H07.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVR01_0052_C08.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
LVR01_0058_C02.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0076_A03.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0069_H01.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0043_A01.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVR01_0048_G07.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAGAC
TES01_0109_A11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0024_B03.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0110_C07.b : tcaaaacctgttgattccccacaccgttttcatattcaagccgatataactatgaaaact
TES01_0036_H09.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0061_D07.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0055_E01.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
CBLT1_0100_B01.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0069_F05.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAATAACTATG*AAAACAACC
TES01_0020_D09.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACGAAC
TES01_0003_G08.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
SMG01_0072_G10.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVR01_0048_F06.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
PST01_0028_G03.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0036_G05.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0060_A10.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0088_E12.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0109_H01.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0006_H02.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0094_B03.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0091_D09.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0002_B06.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0080_E03.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATN*GAAACAAAC
TES01_0098_E01.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0030_B11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0071_F04.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0100_F11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0100_H01.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0097_H04.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0014_F06.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0024_D10.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0105_B06.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0008_A03.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0051_G05.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0058_C01.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0026_H09.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0063_A09.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
PTG01_0101_A06.b : gatcccaacctgtcccattccggcgaaagccctttgaaaaccaattcttgggaaccccaa
ITT01_0032_G06.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVR01_0058_D12.b : CGAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0039_F08.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
ADR01_0101_H11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0072_D11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0078_C06.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0072_C03.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0090_E10.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0098_C06.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0059_D08.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0039_D03.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0091_F12.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0086_E08.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0016_B02.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0011_A11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0049_D11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
KDN01_0065_E01.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0033_E11.b : CAAAACTGTTGATCCC*CACCCGTTTCATATTTCAGCAGAAGTTACTATG*AAAACAAAC
TES01_0025_E04.b : CAAAACTGTTGATCCC*ACACCGTTTCTTATTCATGCTTAATTAACTTTG*AAAACAAAC
TES01_0007_E09.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0070_C11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0059_G09.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0018_F11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0083_C04.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0069_D07.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0006_F12.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0072_B04.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0076_F02.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TCH01_0023_E11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0061_E09.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0046_G10.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0096_F05.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0054_C03.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0094_B09.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0003_C11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0005_B09.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
PST01_0077_D12.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
PST01_0095_E07.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
KDN01_0071_A11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0078_F12.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0066_E10.b : CAAAACTGTTGATCCC*ACACCGTTCCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
THY01_0016_B07.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCCAGCAGAAGTAACTATG*AAAACCACT
TES01_0014_G11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAAAAGTAACTATG*AAAACAAAC
UTR01_0102_D12.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
LNG01_0085_B08.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
ITT01_0049_A02.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
THY01_0118_B07.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0097_F08.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
SPL01_0104_E06.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0016_G11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0107_G12.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0022_E12.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0093_H08.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
SPL01_0001_H02.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVR01_0085_C11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVR01_0034_G04.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
LVRM1_0099_C05.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVRM1_0020_H04.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVRM1_0114_D01.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
SMG01_0048_C10.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVRM1_0116_E11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
UTR01_0013_A04.b : CAAAACTGTTGATTCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVR01_0098_B04.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
THY01_0051_C04.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
SPL01_0044_D11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVR01_0059_A05.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
ADR01_0022_C09.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVR01_0101_H08.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVR01_0063_E06.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
THY01_0059_F04.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
SMG01_0035_B11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
MLN01_0041_A05.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TCH01_0076_C06.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVR01_0036_E07.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
MLN01_0084_F02.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TCH01_0076_C09.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
SPL01_0075_D05.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
ITT01_0010_D12.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
CLNT1_0031_E05.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVRM1_0196_G11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0027_B02.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0029_H05.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
SMG01_0091_B04.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVR01_0030_D09.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0005_G08.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TCH01_0059_F07.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0109_E02.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
PST01_0095_A08.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
LNG01_0091_C01.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0072_B11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0049_D02.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0016_F05.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0036_A07.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
PST01_0037_B08.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0067_A03.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0024_F06.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCCAGCAGAAGTAACTATG*AAAACAAAC
TES01_0045_C04.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0038_D11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
PTG01_0087_C04.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVR01_0041_A02.b : CAAAACTGTTGATCCC*ACACCGTTTCATCTTCAAGCAGAAGTAACTATG*AAAACAAAC
OVR01_0005_A01.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0031_F08.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATGAAAAACAAAC
TES01_0018_A09.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0095_D02.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
PST01_0060_E11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
MLN01_0100_F10.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0029_F01.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0109_G01.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0105_G12.b : CAAAACTGTTGATCCC*ACACCGTTTCACATTCAAGCAGAAGTAACTATG*AAAACAAAC
SMG01_0022_H05.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0045_D09.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
PST01_0037_G06.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0011_H10.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTAAG*AAAACAAAC
OVR01_0070_A07.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
SKNB1_0064_E09.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0014_D01.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
PST01_0087_G02.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
SMG01_0042_C06.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0074_G04.b : CAAAACTGTTGATCCCCACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
PST01_0097_G12.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
SMG01_0100_F02.b : CAAAACTGTTGATCCC*ACAC*GTTTCATAATCAAGCCGAGGTAACTATG*AAAACAAAC
LVRM1_0033_F06.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVRM1_0182_A05.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
LVRM1_0140_G12.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
UTR01_0011_C01.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVR01_0102_E07.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVR01_0096_C02.b : CAAAACCGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
LVR01_0044_H06.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
SPL01_0098_H05.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
LVR01_0052_B04.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
ITT01_0101_B05.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TCH01_0017_D05.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVR01_0085_D03.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
PST01_0049_B09.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
PST01_0021_B11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
PST01_0057_B10.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
PST01_0041_E05.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
KDN01_0058_E02.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TES01_0010_B12.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTACCTATG*AAAACAAAC
SKNB1_0065_H11.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
TCH01_0092_E03.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
PST01_0059_D12.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
PST01_0039_B10.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
PST01_0077_F09.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
LVRM1_0022_H05.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
OVRT1_0112_C08.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
ITT01_0066_F05.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
LVR01_0074_A02.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
PST01_0054_E09.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
KDN01_0033_C01.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
KDN01_0033_A09.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
LVRM1_0157_B07.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
PST01_0086_B08.b : CAAAACTGTTGATCCC*ACACCGTTTCATATTCAAGCAGAAGTAACTATG*AAAACAAAC
20110601C-001812 : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
---------+---------+---------+---------+---------+---------+ 712
OVRM1_0182_B09.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVR01_0005_B10.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0009_D01.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0018_B10.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0042_B10.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0030_A09.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0038_G06.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0106_F04.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0045_A10.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVR01_0020_B10.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
SPL01_0043_D12.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVR01_0025_A11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0073_E06.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTT*CTGCCTCTGATTAAACCCC*CATGC
TES01_0104_H07.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVR01_0052_C08.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
LVR01_0058_C02.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0076_A03.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATNNAAACCC*CAGGC
TES01_0069_H01.b : TT*CTTTGGGACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0043_A01.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVR01_0048_G07.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0109_A11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0024_B03.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0110_C07.b : aactttcttgggaacccctaaatgttattgccatttaactccctggctcttgatataacc
TES01_0036_H09.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCCCTGATAAAACCCC*AAGGC
TES01_0061_D07.b : TT*CTTGGAAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0055_E01.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
CBLT1_0100_B01.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0069_F05.b : TT*CTTGGAAACCCGAAAGGTATGCACAGAGCTC*CTGCCTCCTATAAACCCCC*AGGCA
TES01_0020_D09.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*TAGGC
TES01_0003_G08.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
SMG01_0072_G10.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATA*AACCCC*AAAGC
OVR01_0048_F06.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
PST01_0028_G03.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0036_G05.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0060_A10.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0088_E12.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAACCCCC*AAG*C
TES01_0109_H01.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0006_H02.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0094_B03.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0091_D09.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0002_B06.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0080_E03.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0098_E01.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0030_B11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0071_F04.b : TT*CTTGGGAACCCCGAATGTATGCACAGAGCTT*CTGCCTCTGATAAAACCCC*A*GGC
TES01_0100_F11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*A*GGC
TES01_0100_H01.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0097_H04.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0014_F06.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0024_D10.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0105_B06.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0008_A03.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0051_G05.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0058_C01.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0026_H09.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0063_A09.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
PTG01_0101_A06.b : ttggtgccccaaaccccggcccttgaaaaaccccaggggaaaagggaaaagggtccaacc
ITT01_0032_G06.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVR01_0058_D12.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0039_F08.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
ADR01_0101_H11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0072_D11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0078_C06.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAA*CCCC*AAGGC
TES01_0072_C03.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0090_E10.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAA*CCCC*AAGGC
TES01_0098_C06.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0059_D08.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0039_D03.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0091_F12.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0086_E08.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0016_B02.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0011_A11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0049_D11.b : TT*CTTGGGAGCCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
KDN01_0065_E01.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0033_E11.b : TT*CCTGGGAACCCGAAttgttttgcactgaactcctgccctctgataaaccccaatggt
TES01_0025_E04.b : TT*CTTGGGAATCCGAAATGTATGCCCAGAGCTC*CTGCCTCTGATAAAATCCC*AAGGT
TES01_0007_E09.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0070_C11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTNGATAAACCCC*AAGGC
TES01_0059_G09.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0018_F11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0083_C04.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0069_D07.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CCGCCTCTGATAAAACCCC*AAGGC
TES01_0006_F12.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0072_B04.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0076_F02.b : TTNCTTGGGACCCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*CAAGC
TCH01_0023_E11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0061_E09.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0046_G10.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0096_F05.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0054_C03.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0094_B09.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0003_C11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGTTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0005_B09.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
PST01_0077_D12.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
PST01_0095_E07.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
KDN01_0071_A11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0078_F12.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0066_E10.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
THY01_0016_B07.b : CT*CTTGGGAACCCGAAACGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*CAGGC
TES01_0014_G11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
UTR01_0102_D12.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
LNG01_0085_B08.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
ITT01_0049_A02.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
THY01_0118_B07.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0097_F08.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
SPL01_0104_E06.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0016_G11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAACTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0107_G12.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0022_E12.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0093_H08.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAAC*CC*AAGGG
SPL01_0001_H02.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVR01_0085_C11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVR01_0034_G04.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCCCAAGGC
LVRM1_0099_C05.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVRM1_0020_H04.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVRM1_0114_D01.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
SMG01_0048_C10.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVRM1_0116_E11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
UTR01_0013_A04.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVR01_0098_B04.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
THY01_0051_C04.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
SPL01_0044_D11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVR01_0059_A05.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
ADR01_0022_C09.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVR01_0101_H08.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVR01_0063_E06.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
THY01_0059_F04.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
SMG01_0035_B11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
MLN01_0041_A05.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TCH01_0076_C06.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVR01_0036_E07.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
MLN01_0084_F02.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TCH01_0076_C09.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
SPL01_0075_D05.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
ITT01_0010_D12.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
CLNT1_0031_E05.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVRM1_0196_G11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0027_B02.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0029_H05.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
SMG01_0091_B04.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVR01_0030_D09.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0005_G08.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TCH01_0059_F07.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0109_E02.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
PST01_0095_A08.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
LNG01_0091_C01.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0072_B11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0049_D02.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0016_F05.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0036_A07.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
PST01_0037_B08.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0067_A03.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0024_F06.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0045_C04.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0038_D11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
PTG01_0087_C04.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVR01_0041_A02.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVR01_0005_A01.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0031_F08.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGAAAAAACCCC*AAGGC
TES01_0018_A09.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0095_D02.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
PST01_0060_E11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
MLN01_0100_F10.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0029_F01.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0109_G01.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0105_G12.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
SMG01_0022_H05.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCC**AAGGC
TES01_0045_D09.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
PST01_0037_G06.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0011_H10.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVR01_0070_A07.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
SKNB1_0064_E09.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0014_D01.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGT
PST01_0087_G02.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
SMG01_0042_C06.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0074_G04.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTCCCTGCCTCTGATAAAACCT**AAAGC
PST01_0097_G12.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
SMG01_0100_F02.b : TT*CTTGGGAcccgaaatgtattgcccgagcttctgcctcttgataaaaccccaagccaa
LVRM1_0033_F06.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVRM1_0182_A05.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
LVRM1_0140_G12.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
UTR01_0011_C01.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVR01_0102_E07.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVR01_0096_C02.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
LVR01_0044_H06.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
SPL01_0098_H05.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
LVR01_0052_B04.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
ITT01_0101_B05.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TCH01_0017_D05.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVR01_0085_D03.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
PST01_0049_B09.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
PST01_0021_B11.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
PST01_0057_B10.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
PST01_0041_E05.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
KDN01_0058_E02.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TES01_0010_B12.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
SKNB1_0065_H11.b : TT*CATGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
TCH01_0092_E03.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
PST01_0059_D12.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
PST01_0039_B10.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
PST01_0077_F09.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
LVRM1_0022_H05.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
OVRT1_0112_C08.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
ITT01_0066_F05.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
LVR01_0074_A02.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
PST01_0054_E09.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
KDN01_0033_C01.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
KDN01_0033_A09.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
LVRM1_0157_B07.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
PST01_0086_B08.b : TT*CTTGGGAACCCGAAATGTATGCACAGAGCTC*CTGCCTCTGATAAAACCCC*AAGGC
20110601C-001812 : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
---------+---------+---------+---------+---------+---------+ 770
OVRM1_0182_B09.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAG
OVR01_0005_B10.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0009_D01.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0018_B10.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0042_B10.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0030_A09.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0038_G06.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0106_F04.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTA*CAACTGCAGTCCTG
TES01_0045_A10.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVR01_0020_B10.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
SPL01_0043_D12.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVR01_0025_A11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0073_E06.b : AGAATGGTGAATGTGTCTAGCA*CTGAAAGTGTCAGAGTT*CTTAACAACTGgcagtctg
TES01_0104_H07.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTNAACACTGCAGTCCTG
OVR01_0052_C08.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
LVR01_0058_C02.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0076_A03.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAAACACTGCAGTCCTG
TES01_0069_H01.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0043_A01.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVR01_0048_G07.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0109_A11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0024_B03.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0110_C07.b : ccccagggcttagtggtgaatgtgtctctacaactggagagtggtcatatctcttaacaa
TES01_0036_H09.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0061_D07.b : AAAATGGTGAATGTGTCTAGCA*CTGAGAGTGTCAAAGCT*CTTAACAACTGCCGTCCTG
TES01_0055_E01.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
CBLT1_0100_B01.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0069_F05.b : aaatgggtgatgtgtctagcccggaaagtgtcaaacctcttacaacggcgttcctgaact
TES01_0020_D09.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCTGAGCT*CTTAACAACTGCAGTCCTG
TES01_0003_G08.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
SMG01_0072_G10.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVR01_0048_F06.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
PST01_0028_G03.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0036_G05.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0060_A10.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0088_E12.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CNTTTACACTGCAGTCCTG
TES01_0109_H01.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0006_H02.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0094_B03.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0091_D09.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0002_B06.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0080_E03.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACA*CTGCAGTCCTG
TES01_0098_E01.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0030_B11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTACAGTCCTG
TES01_0071_F04.b : AGAATGGTGAATGTGCCTAGCC*CTGAGAGTGTCAAAGCT*CTTAACA*CTGCAGTCCTG
TES01_0100_F11.b : AGAGTGGTGGATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTTACA*CTGCAGTCCTG
TES01_0100_H01.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0097_H04.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0014_F06.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0024_D10.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0105_B06.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTTAACACTGCAGTCCTG
TES01_0008_A03.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0051_G05.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCTGAGCTCCTTAACCACTGCAGTCCTG
TES01_0058_C01.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0026_H09.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0063_A09.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
PTG01_0101_A06.b : tgaaaggtgaaaaactttaaaaatgggctccggaagtggaaaaatttcaaaggggacccc
ITT01_0032_G06.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVR01_0058_D12.b : AGAGTGATGAATGTGTCTAGCA*CTGATAGTGTCAGAGCT*CTTAGCAACTGCAGTCCTG
TES01_0039_F08.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
ADR01_0101_H11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0072_D11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTTAACACTGCGGTCCTG
TES01_0078_C06.b : AGAGTGGTGAATGTGTCTAACA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0072_C03.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0090_E10.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0098_C06.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0059_D08.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTTACAACTGCAGTCCTG
TES01_0039_D03.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0091_F12.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0086_E08.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0016_B02.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0011_A11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0049_D11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
KDN01_0065_E01.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0033_E11.b : gagtggtgaaagtggctagcccctgaaagtgtccagagctcttaacaacttgtagttctg
TES01_0025_E04.b : AGAGTGGTGAATGTGTtctagccctgacattgtcatagctccttacaatcgccgttccta
TES01_0007_E09.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0070_C11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0059_G09.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0018_F11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0083_C04.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0069_D07.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCCTTCTTG
TES01_0006_F12.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGTAGTCCTG
TES01_0072_B04.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0076_F02.b : AGAGTGGTGAATGTGTCTAGCA*CTGANAGTGTCAGAGCT*CTTAAC*ACTGCCGTCCTG
TCH01_0023_E11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCGGAGCT*CTTAACAACTGCAGTCCTG
TES01_0061_E09.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAATGTCAAAGCT*CTTAACAACTGCAGTCCTG
TES01_0046_G10.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CCTAACAACTGCAGTCCTG
TES01_0096_F05.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0054_C03.b : AGAGTGGTGAATGTGTCAAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0094_B09.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0003_C11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0005_B09.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
PST01_0077_D12.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
PST01_0095_E07.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
KDN01_0071_A11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0078_F12.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0066_E10.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
THY01_0016_B07.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTTACCACTGCAGTCCCG
TES01_0014_G11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
UTR01_0102_D12.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
LNG01_0085_B08.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
ITT01_0049_A02.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
THY01_0118_B07.b : ACAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTTCGAGCT*CTTAACAACTGGGGTCCTG
TES01_0097_F08.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
SPL01_0104_E06.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0016_G11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0107_G12.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0022_E12.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0093_H08.b : CGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCC*CTTAACAACTGCAGTCCTG
SPL01_0001_H02.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVR01_0085_C11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVR01_0034_G04.b : AGAGTGGTGAATGTGTCTAGCACCTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
LVRM1_0099_C05.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVRM1_0020_H04.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVRM1_0114_D01.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
SMG01_0048_C10.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVRM1_0116_E11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
UTR01_0013_A04.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVR01_0098_B04.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACCACTGCAGTCCTG
THY01_0051_C04.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
SPL01_0044_D11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVR01_0059_A05.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
ADR01_0022_C09.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVR01_0101_H08.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVR01_0063_E06.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
THY01_0059_F04.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
SMG01_0035_B11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
MLN01_0041_A05.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TCH01_0076_C06.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVR01_0036_E07.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
MLN01_0084_F02.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TCH01_0076_C09.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
SPL01_0075_D05.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
ITT01_0010_D12.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
CLNT1_0031_E05.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVRM1_0196_G11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0027_B02.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0029_H05.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
SMG01_0091_B04.b : AGAGTGGTGAATGTGCCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVR01_0030_D09.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0005_G08.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TCH01_0059_F07.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGGGCT*CTTAACAACTGCAGTCCTG
TES01_0109_E02.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
PST01_0095_A08.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
LNG01_0091_C01.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0072_B11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0049_D02.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0016_F05.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0036_A07.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
PST01_0037_B08.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0067_A03.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0024_F06.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0045_C04.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0038_D11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
PTG01_0087_C04.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTNAACACTGCAGTCCTG
OVR01_0041_A02.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVR01_0005_A01.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0031_F08.b : AGAATGGTGAATGTGTCTAGCA*CTGAAAGTGTCAGAGCT*CTTTAAAACTGCAGTCCCG
TES01_0018_A09.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0095_D02.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
PST01_0060_E11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
MLN01_0100_F10.b : AGAGTGGTGAAAGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0029_F01.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0109_G01.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0105_G12.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
SMG01_0022_H05.b : AGAGTGGTGAATGTGTCTAGCA*CTGANAGTGTCAGAGCT*CTTNAACACTGCAGTCCTG
TES01_0045_D09.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
PST01_0037_G06.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0011_H10.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVR01_0070_A07.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
SKNB1_0064_E09.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0014_D01.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
PST01_0087_G02.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
SMG01_0042_C06.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0074_G04.b : AAATTGGTGAATGTGTCTAGCA*CTGAGAGTGGCTTATCT*CTTAAAAACTtgcatcttg
PST01_0097_G12.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
SMG01_0100_F02.b : attggtgaattggtcctcccctgaaagttgcaaacctcttaaaaatgggttccctgaatt
LVRM1_0033_F06.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVRM1_0182_A05.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
LVRM1_0140_G12.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
UTR01_0011_C01.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVR01_0102_E07.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVR01_0096_C02.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
LVR01_0044_H06.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
SPL01_0098_H05.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
LVR01_0052_B04.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
ITT01_0101_B05.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TCH01_0017_D05.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVR01_0085_D03.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
PST01_0049_B09.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
PST01_0021_B11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
PST01_0057_B10.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
PST01_0041_E05.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
KDN01_0058_E02.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TES01_0010_B12.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
SKNB1_0065_H11.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
TCH01_0092_E03.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
PST01_0059_D12.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
PST01_0039_B10.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
PST01_0077_F09.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
LVRM1_0022_H05.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
OVRT1_0112_C08.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
ITT01_0066_F05.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
LVR01_0074_A02.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
PST01_0054_E09.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
KDN01_0033_C01.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
KDN01_0033_A09.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
LVRM1_0157_B07.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
PST01_0086_B08.b : AGAGTGGTGAATGTGTCTAGCA*CTGAGAGTGTCAGAGCT*CTTAACAACTGCAGTCCTG
20110601C-001812 : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
---------+---------+---------+---------+---------+---------+ 828
OVRM1_0182_B09.b :
OVR01_0005_B10.b : AACTGCAACAGAAGTTCAAGAGTGAAACCATCA*CAGAAGAA*GAGCTGGTGGGGCTCAT
TES01_0009_D01.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0018_B10.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0042_B10.b : AACTGCAACAGAAGTTCAAGAGCGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0030_A09.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0038_G06.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0106_F04.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0045_A10.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVR01_0020_B10.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
SPL01_0043_D12.b : AACTGCACCAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAACTGGTGGGGCTCAT
OVR01_0025_A11.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0073_E06.b : aacgggcacaaaattccagaagggaaacctccccaaaggaagaactggggggggcccgga
TES01_0104_H07.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVR01_0052_C08.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
LVR01_0058_C02.b : AACTGCAACAGAAGTTCAAGAGTGAGATCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0076_A03.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCAACAGAGGAA*AAGCTGGTGGGGCTCAT
TES01_0069_H01.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0043_A01.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVR01_0048_G07.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0109_A11.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0024_B03.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0110_C07.b : ttgcagtcctgaaatgctactgaaagtttctaaagtgagacctttctttttatgtaaaaa
TES01_0036_H09.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0061_D07.b : AACTGCAACAGAAGTTCCAGAGTGAGACCTTCT*CAAAGGAT*GACCTGGGGGGGCTCCT
TES01_0055_E01.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
CBLT1_0100_B01.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0069_F05.b : gcaacgaaatttcaaaatgggaacctcccacaagaaaaacctgggggggctcatgaaaaa
TES01_0020_D09.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CATAGGAA*GAGCTGGTGTGGCTCAT
TES01_0003_G08.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
SMG01_0072_G10.b : AACTGCAACAGAgtttcagagcgagacatccccgaggaagacctgggggggctcatgaac
OVR01_0048_F06.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
PST01_0028_G03.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0036_G05.b : AACTGCAACAGAAGTTCAAGAGTGAGACCCTCC*CAGAAGAA*GAGCTGGTGGGGCTCAT
TES01_0060_A10.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0088_E12.b : AACTGGCACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAAAGAGCTGGTGGGGCTCAT
TES01_0109_H01.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0006_H02.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0094_B03.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0091_D09.b : AACTGGCACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0002_B06.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0080_E03.b : AACTGCAACAGAAGTTCAGGAGTGAGACCATCC*CAGAGAAA*GACTTGGTGGGGCTCAT
TES01_0098_E01.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0030_B11.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0071_F04.b : AACTGGCACgaaagttcaggatggagacctccccgaaggaaaaccggggggggctcagga
TES01_0100_F11.b : AACTGCAACAGAAGGTTCAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0100_H01.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0097_H04.b : AACTGCAACAGAAGTTCCAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0014_F06.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0024_D10.b : AACTGCAACAGAAGTTCTAGAGTGAGACCATCA*CAGAAGAA*GAGCTGGTGGGGCTCAT
TES01_0105_B06.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCCGGTGGGGCTCAT
TES01_0008_A03.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0051_G05.b : AACTGCAACAGAAGTCCAAGAGTGAGACCTTCC*CAAAGGAA*TAGCTGGTGGGGCTCAT
TES01_0058_C01.b : AACTGCAACAGAAGTTCCAGAGTGAGACCATTA*CAGANGAA*GAGCTGGTGGGGCTCAT
TES01_0026_H09.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0063_A09.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCCT
PTG01_0101_A06.b : ccccaaagggaaaggggggggccctaaaaaaattttgggaaaacaaaaaaagggggcccc
ITT01_0032_G06.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVR01_0058_D12.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGATGAA*GAGCTGGTGGGGCTCAT
TES01_0039_F08.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
ADR01_0101_H11.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0072_D11.b : AACTGCCACAGAAGTTCAGGAGGGAGACCCTCC*Ccgaagaggagcctgggggggctcat
TES01_0078_C06.b : AACTGCAACAGAATTTCAAGAGTGAGACCATCC*CAAAGGAA*GAGCTGGTGGGGCTCCT
TES01_0072_C03.b : AACTGCAACAGAAGTCCA*GAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCCT
TES01_0090_E10.b : AACTGCAACAGAAGTTCAAGAGTGAGAACCTCA*CAGAGGAA*GAGCTGGTGGGGCTTCT
TES01_0098_C06.b : AGCTGNCACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0059_D08.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0039_D03.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0091_F12.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0086_E08.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0016_B02.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0011_A11.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0049_D11.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
KDN01_0065_E01.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0033_E11.b : aaactgctagagaaggttcataatggagaccctcctatatggaaaagctgttggggttca
TES01_0025_E04.b : actgcttcagaaagttctttatttagaccattcccgatggaacaactggtggggttcatg
TES01_0007_E09.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CATATGAA*GAGCTGGTGGGGCTCAT
TES01_0070_C11.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CCAGAGAA*GAGCTGTTGGGGCTCAT
TES01_0059_G09.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTAGTGGGGCTCAT
TES01_0018_F11.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0083_C04.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0069_D07.b : AACTGCCACAGAAGTTCAGGAGTGAGACCTTCCCCAAGGAAA*GACCTGGTGGGGCTCCT
TES01_0006_F12.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0072_B04.b : AACTGGCACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0076_F02.b : AACTtgcacagaagtccagaatgaaacttcccaaaggagaactggtgggggccaggaaca
TCH01_0023_E11.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0061_E09.b : AACTGCAACATAAGTTCAGGAGTGAAACCTTCC*CAAAGAAA*AAACTGGTGGGGCTCAT
TES01_0046_G10.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0096_F05.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0054_C03.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0094_B09.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0003_C11.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0005_B09.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
PST01_0077_D12.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
PST01_0095_E07.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
KDN01_0071_A11.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0078_F12.b : AACTGCAACAGAAGTTCAAGAGTGAGACCTTCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0066_E10.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
THY01_0016_B07.b : ACCTGCCACCGAAGCTCCAGAGCGAGACCCTCA*CTAACGAA*GAGCTGGTGGGGCTCAT
TES01_0014_G11.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
UTR01_0102_D12.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
LNG01_0085_B08.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
ITT01_0049_A02.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
THY01_0118_B07.b : AACTGTGAACGAAGTTCAGGAGTGAGACat
TES01_0097_F08.b : AACTGGCACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
SPL01_0104_E06.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0016_G11.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0107_G12.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAAGAA*GAGCTGGTGGGGCTCAT
TES01_0022_E12.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0093_H08.b : AACTGCAACAGAAGTTCCAGAGTGAAACCCTCT*CAAATGAA*AAGCTGGTGGGGCTCAT
SPL01_0001_H02.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVR01_0085_C11.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVR01_0034_G04.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*AAGCTGGGGGGGCTCTT
LVRM1_0099_C05.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGCGCTCAT
OVRM1_0020_H04.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVRM1_0114_D01.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
SMG01_0048_C10.b : ATCTGNCACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVRM1_0116_E11.b : AACTGGCACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
UTR01_0013_A04.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVR01_0098_B04.b : AACTGCAACAGAAGTTCAAGAGTGAGACCCTCA*CAGAAGGAAGAGCTGGTGGGGCTCAT
THY01_0051_C04.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
SPL01_0044_D11.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVR01_0059_A05.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
ADR01_0022_C09.b : AACTGCAACAGAAGTTTCAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVR01_0101_H08.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVR01_0063_E06.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
THY01_0059_F04.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
SMG01_0035_B11.b : AACTGGCACAGAAGTTCAAGAGTGAGACCATCA*CAGAAGAA*GAGCTGGTGGGGCTCAT
MLN01_0041_A05.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TCH01_0076_C06.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVR01_0036_E07.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
MLN01_0084_F02.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TCH01_0076_C09.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
SPL01_0075_D05.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
ITT01_0010_D12.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
CLNT1_0031_E05.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVRM1_0196_G11.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0027_B02.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0029_H05.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
SMG01_0091_B04.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVR01_0030_D09.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0005_G08.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TCH01_0059_F07.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0109_E02.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
PST01_0095_A08.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
LNG01_0091_C01.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0072_B11.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0049_D02.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0016_F05.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0036_A07.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
PST01_0037_B08.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*GAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0067_A03.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0024_F06.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCC*CAGAGGAA*GAACTGGTGGGGCTCAT
TES01_0045_C04.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0038_D11.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
PTG01_0087_C04.b : AACTGGCACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVR01_0041_A02.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVR01_0005_A01.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0031_F08.b : AAACGCACCAAAAGTTCAAGAATGAGACCTTCC*CATATGAA*GAACTGGTGGGGCTCAA
TES01_0018_A09.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0095_D02.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
PST01_0060_E11.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
MLN01_0100_F10.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0029_F01.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0109_G01.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0105_G12.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
SMG01_0022_H05.b : AACTGCAACAGAAGTTTCAGAGTGAGACCATCA*CAGAAGGA*GAGCTGGTGGGGCTCAT
TES01_0045_D09.b : AACTGCAACAGATGTTCAAGAGTGAGACCATCA*CAAAGGAA*GAGCTGGTGGGGCTCAT
PST01_0037_G06.b : AACTGCAACAGAAGTCCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0011_H10.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVR01_0070_A07.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
SKNB1_0064_E09.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0014_D01.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
PST01_0087_G02.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
SMG01_0042_C06.b : AACTGCAACAGAAGTTTCAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TES01_0074_G04.b : aattgcaactataaatttcaaaagtgaaacctatcaccaatgaaaaccttgtggggctcc
PST01_0097_G12.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
SMG01_0100_F02.b : ggaaacaaaattccaaagtggaaccttcccaaaggaaaactggggggggcccaaaaaaaa
LVRM1_0033_F06.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVRM1_0182_A05.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
LVRM1_0140_G12.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
UTR01_0011_C01.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVR01_0102_E07.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVR01_0096_C02.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
LVR01_0044_H06.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
SPL01_0098_H05.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
LVR01_0052_B04.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
ITT01_0101_B05.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TCH01_0017_D05.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVR01_0085_D03.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
PST01_0049_B09.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
PST01_0021_B11.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
PST01_0057_B10.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
PST01_0041_E05.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
KDN01_0058_E02.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCGT
TES01_0010_B12.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
SKNB1_0065_H11.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
TCH01_0092_E03.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
PST01_0059_D12.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
PST01_0039_B10.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
PST01_0077_F09.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
LVRM1_0022_H05.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
OVRT1_0112_C08.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
ITT01_0066_F05.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
LVR01_0074_A02.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
PST01_0054_E09.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
KDN01_0033_C01.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
KDN01_0033_A09.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
LVRM1_0157_B07.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
PST01_0086_B08.b : AACTGCAACAGAAGTTCAAGAGTGAGACCATCA*CAGAGGAA*GAGCTGGTGGGGCTCAT
20110601C-001812 : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
---------+---------+---------+---------+---------+---------+ 885
OVRM1_0182_B09.b :
OVR01_0005_B10.b : GAACCATTTTGTGG*AAGACACAAAGAACCGAGTC*CCTAAGAAAGAAGGCTGG*CCAAG
TES01_0009_D01.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCCAG
TES01_0018_B10.b : GATCAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAATGCTGG*CCAGT
TES01_0042_B10.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCCAG
TES01_0030_A09.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAAGAAGGCTGG*CCAAG
TES01_0038_G06.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0106_F04.b : GAACAAGTTTGTGA*AAGACACCAAGAACGGAGTC*CATAAAAAGGAAAGGCTG*GCAAG
TES01_0045_A10.b : NGACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CCATAGAAGGAAGGCTGG*GCCAG
OVR01_0020_B10.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
SPL01_0043_D12.b : GAACAAGTTTGTGG*AAGAACCAAAGAACGGAATCCCATAAGAAGGAAAGCTGG*CCCAG
OVR01_0025_A11.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0073_E06.b : accaatttgggggaaaaacccaaaaacggggtccctaaaaaaggaagggtgggccaatac
TES01_0104_H07.b : GAACNAGTTTGTGG*AAGACACNAAGAACGGAGTC*CCATAGAGGGAA*GCTGG*CCNAG
OVR01_0052_C08.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGGAGT*CATAAGAAGGAAGGCTGG*CCAAG
LVR01_0058_C02.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0076_A03.b : GAAACAGTTTtgtgaaagacccaaagaccggattccttaaaaaggaaagctggcccaatt
TES01_0069_H01.b : GAACA*GTTTGTGG*AAGACACAAGAAacggatccttaaaaaggaagctggcaaataccc
TES01_0043_A01.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
OVR01_0048_G07.b : GAACAAATTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0109_A11.b : GAACAATTTTGTGG*AAGACACCAAGAAACGAGTC*CCTAAGAAGGAAAGCTGG*CCAAG
TES01_0024_B03.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0110_C07.b : ctggttggggctctcaatgaacaatgtttggttggaataacactaattaactggatccct
TES01_0036_H09.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAAGGAAGCTGG*CCAAG
TES01_0061_D07.b : GAACAAGTTGGTGG*AAGACACAAAGAACGGATTC*CTTAAAAAGGAAAGCTtggccatt
TES01_0055_E01.b : GAACAAGTTTGTGG*AAGACACAAAGAAACGAGTC*CATAAGAAGGAAAGCTGG*CCAAG
CBLT1_0100_B01.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0069_F05.b : ttttgggggaaaaaccaaagaacgggtcccttaaaaagggaaggtgggccaattcccgcc
TES01_0020_D09.b : TGACAAGTTTGTGG*AAGAAACAATTAACGGATTC*CACTAGAAGGAAGGCTGG*GCCAA
TES01_0003_G08.b : GAACAAGTTTGTGGGAAGACACAAAGAACGGAGTC*CTTTAGAAGGAAAGCTGG*TCAAG
SMG01_0072_G10.b : aagttggtgaagacccaagaaccgagtcctatagaagggaaggtggcccagtaccccgta
OVR01_0048_F06.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*GCAAG
PST01_0028_G03.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0036_G05.b : GAACAAGT*TGTGG*AAAACACA*AGAACGGAGTC*CCTAAGAAGGAAGGCTGGGCCAAT
TES01_0060_A10.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CTTAAGAAGGAAGGCTGG*GCAAG
TES01_0088_E12.b : GAACCAGTTTGTGA*ANNACCCCAAGAACGGAGTC*CATAAAAAGGAAGGCTGG*CCAAG
TES01_0109_H01.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAGGGAAAGCTGG*CCAAG
TES01_0006_H02.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAAGCTGG*CCAAG
TES01_0094_B03.b : GAACAAGTTTG*GGAAAGACACAA*GAACGGAGTC*CATAGAAAGGAAGGCTGG*CCAAG
TES01_0091_D09.b : GAANCAGTTTGTGG*NAAGACACAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCCAG
TES01_0002_B06.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAATAAGGAAGGCTGG*CCAAG
TES01_0080_E03.b : GAACAAGTTTGTGG*AAGAACCAAAGAACGGAGTC*CATTAGAAGGAAGGCTGG*CCAAG
TES01_0098_E01.b : GAACCAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAAAAAGAAGGGCTGGCCAAG
TES01_0030_B11.b : GAACAAGTTTGTGG*AAGACACAAAGAAAGGAGTC*CTTAAGAACGAAAGCTGG*CCAAG
TES01_0071_F04.b : acaatttggggaaaacacaaaaaagggttcccttaaaagggaggttggccaagtaccccc
TES01_0100_F11.b : GAACAAGTTGGTGG*AGGACCCAAGAAACGGAGTC*CCTAAGAAGGAAGGGCTG*GCAAG
TES01_0100_H01.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAGGGAAGGCTGGCCCAAG
TES01_0097_H04.b : GAACAAGTTTGTGG*AAGACACAAAGAAACGAGTC*CATAAGAAGGAAAGCTGC*CCAAG
TES01_0014_F06.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0024_D10.b : GAACAAGTTTGTGG*AAGAAACCAAGAACGGAGTC*CTTAATAAGGGAGGCTGGGCCAAG
TES01_0105_B06.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAAGAAGGCTGG*GCAAG
TES01_0008_A03.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0051_G05.b : GAACAAGTTTGTGG*AAAACCCAAAGAACGGAGTCCCttaaaaaggaaggctgggcaaat
TES01_0058_C01.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0026_H09.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0063_A09.b : GAACAAGTTTGTGG*AATACACAAAGAACGAAGTC*TTAAAAAGGGAAGGCTGG*CCCAG
PTG01_0101_A06.b : ttaaaaagaaggggggccaacaccccccgaggggggaaaaaaaaggggggccttgtttcc
ITT01_0032_G06.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
OVR01_0058_D12.b : GAACAAGTTTGTGG*AAGACACAACGAACGGAGTC*CATAGAAAAGAAGGCTGG*CCAAG
TES01_0039_F08.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
ADR01_0101_H11.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCCAG
TES01_0072_D11.b : gaacaatttgggggagaaccccagaacggagtccatagaaaggaaggcgggccagttccc
TES01_0078_C06.b : GAACAAGTTTGTGGAAGACACCATAGAACGGATCC*ATTAAAAGGGAAGGCTGGGCCAAT
TES01_0072_C03.b : GAACAAGTTGGTGG*AAAACCCCAAAAACGAAGTC*CATAAAAGGGAAGGCTGGGCCAAT
TES01_0090_E10.b : GGAACAATTTGTGG*GAGAAACAAAGAACGGGAGCCCTTAAAAGGGAAGGCGGG*CCCAG
TES01_0098_C06.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CCATAGAAGGAAAGCTGG*CCNAG
TES01_0059_D08.b : GAACAAGTTTTGTGGAAGACACAAAGAACGGAGTC*CATAAGAAGGAAAGGCTG*GCAAG
TES01_0039_D03.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0091_F12.b : NGACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAAGGAAGCTGG*CCAAG
TES01_0086_E08.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0016_B02.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0011_A11.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0049_D11.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
KDN01_0065_E01.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0033_E11.b : tgaaccaattttgtggaaaaaaccatataaacggattcccttaataaaggaaggttgggc
TES01_0025_E04.b : atcaattttgtggaataacaccattaacggagtccttattaatgagggcgggtcaaatac
TES01_0007_E09.b : GAACCAGTTTGTGG*AAGACCCATAGAACGGAGTC*CATTAGAAGGAAGGCTGG*TCATG
TES01_0070_C11.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAAAAGGAGGGCTGG*CAAGT
TES01_0059_G09.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAAGCTGG*CCAAG
TES01_0018_F11.b : GAACAAGTTTGTGG*AAGACACTAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCCAG
TES01_0083_C04.b : NGACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CCATAGAAGGAAGGCTGG*GCAAG
TES01_0069_D07.b : GAACCAATTTGTGG*AAGACcctaataacgggagtcctttaaaaaggaagggctgggcaa
TES01_0006_F12.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAAAAGGAAGGCTGG*CCAAG
TES01_0072_B04.b : GAAACAGTTTGTGG*AAGACACAAAGA*CCGAGTC*CATAAGAAGAAAGGCTGC*CCA*G
TES01_0076_F02.b : attttgggaagaaccaaaaaacgaattccttaaaaggagggctgccaataccccctacgg
TCH01_0023_E11.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0061_E09.b : GAACAATTTgtggaaaaacaaaaaacggattccttaagaaggaaggtgggccattacccc
TES01_0046_G10.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAAGAAGGCTGG*CCAAG
TES01_0096_F05.b : GAACAAGTTTGCGG*AAGACACAAAGAACGGAGTC*CATAAGAATGAAGGCTGG*CCAAG
TES01_0054_C03.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CCATAGAAGGAACGCTGG*CCAAG
TES01_0094_B09.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0003_C11.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0005_B09.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
PST01_0077_D12.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
PST01_0095_E07.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
KDN01_0071_A11.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0078_F12.b : GAACAAGTTTGTGG*AATACACATAGAACGGAGTC*CTTAAAAAGGATGGCTGG*CCAAG
TES01_0066_E10.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCATG
THY01_0016_B07.b : GTACCActttgcgcgacactccacgaacgggtccttaagaaagaaggttggtccatacct
TES01_0014_G11.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAATAAGGAAGGCTGG*CCAAG
UTR01_0102_D12.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
LNG01_0085_B08.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
ITT01_0049_A02.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
THY01_0118_B07.b :
TES01_0097_F08.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
SPL01_0104_E06.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0016_G11.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0107_G12.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAAGCTGG*CCAAG
TES01_0022_E12.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0093_H08.b : GAACTAGTTTGTGG*AAGAACACAAGAACGGAGTC*CCTAAAAAGGAAGGCTGGGCCAT*
SPL01_0001_H02.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
OVR01_0085_C11.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAAGAAGGCTGG*CCAAG
OVR01_0034_G04.b : GAACAAGTTTGGTGGAAGACACAAAagaacggagtccataacaaggaaaggctgggccaa
LVRM1_0099_C05.b : GAACAAGTTTGTGG*AAGACCAAAAGACCGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
OVRM1_0020_H04.b : GAACAAGTTTGTGG*AAGACACANAGAACGGAGTC*CATANAAAGGAAGGCTGG*CCAAG
OVRM1_0114_D01.b : GAANCAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
SMG01_0048_C10.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CTTAAGAAGGGAGGGTGG*CCAAG
OVRM1_0116_E11.b : GAACAAGTTTGTGG*AAGACAC*AAGAACGGAGTC*CCATAGAAGGAAGGCTGG*CCNAG
UTR01_0013_A04.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
OVR01_0098_B04.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCCAG
THY01_0051_C04.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
SPL01_0044_D11.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCT***CCAAG
OVR01_0059_A05.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAAGAAGGCTGG*CCAAG
ADR01_0022_C09.b : GANCAAGTTTGTGG*AAGACACAAGAAACGGAGTC*CATANGAAGGAAGCTGG**CCAAG
OVR01_0101_H08.b : GAACNAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
OVR01_0063_E06.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
THY01_0059_F04.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
SMG01_0035_B11.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCCAG
MLN01_0041_A05.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCCAG
TCH01_0076_C06.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
OVR01_0036_E07.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
MLN01_0084_F02.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TCH01_0076_C09.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
SPL01_0075_D05.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
ITT01_0010_D12.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
CLNT1_0031_E05.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
OVRM1_0196_G11.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCCAG
TES01_0027_B02.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0029_H05.b : GAACAAGTTTGTGG*AAAACACAAAGAACGGAGTC*CATAAGAAAGAAAGCTGG*CCAAG
SMG01_0091_B04.b : GAACAAGTTTGTGG*AAGACACATAGAACGGAGTC*CATAAAAAGGAAGGCTGG*NCAAG
OVR01_0030_D09.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0005_G08.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TCH01_0059_F07.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0109_E02.b : GAACCATTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAAAAGGAAGGTGGG*CCA*G
PST01_0095_A08.b : GAACAAGTTTGTGG*AAGGCACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
LNG01_0091_C01.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAGGGAAAGCTGG*CCAAG
TES01_0072_B11.b : GAACCAGTTTGTGG*AAGACANCAAGAAACGAGTC*CATAAGAAGGAAGGCTGG*GCAAA
TES01_0049_D02.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCCAG
TES01_0016_F05.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0036_A07.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
PST01_0037_B08.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0067_A03.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0024_F06.b : GAACAAGTTTGTGGAAGACCACAAAAAACGGAGTC*CATAATAAAGAAAGCTTGGCCAAG
TES01_0045_C04.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0038_D11.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
PTG01_0087_C04.b : GAACAAGTTTGTGG*A*GACACAAAGAACGGAGTC*CATANGAAGGAAGGCTTG*GCAAG
OVR01_0041_A02.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
OVR01_0005_A01.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0031_F08.b : GAACCAATTTtgtggatgaaccaaaaaagggagtccttaaaaatgaaggctggcccaata
TES01_0018_A09.b : GAACAAGTTTGTGG*AAGACACATAGAACGGAGTC*CATAAGATGGAAGGCTGG*CCAAG
TES01_0095_D02.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CCATAGAAGGAAGGCTGG*CCAAG
PST01_0060_E11.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
MLN01_0100_F10.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0029_F01.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0109_G01.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0105_G12.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAAGCTGG*CCAAG
SMG01_0022_H05.b : GAAACAGTTTGTGG*AAGACACCAAGAACCGGAGT*CATAAGAAGGAAAGgctggncaag
TES01_0045_D09.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTCCCTTAAAAAGGAAGGCTGG*CCAAG
PST01_0037_G06.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGGAGGCTGG*CCAAG
TES01_0011_H10.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
OVR01_0070_A07.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAAGAAAGCTGG*CCAAG
SKNB1_0064_E09.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0014_D01.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
PST01_0087_G02.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
SMG01_0042_C06.b : GAAACAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAAGCTGG*CCNAG
TES01_0074_G04.b : cgaacaatttttgtgtaataatacaaatttcggaattccatataatgaaaggttggtcca
PST01_0097_G12.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
SMG01_0100_F02.b : tttttgggaaaaccccaaaaaggggttcccttaaaaagagagggtggccaaattcccggt
LVRM1_0033_F06.b : GAACAAGTTTGTGG*AAGACACGAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
OVRM1_0182_A05.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGTAGGCTGG*CCTAG
LVRM1_0140_G12.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
UTR01_0011_C01.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
OVR01_0102_E07.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
OVR01_0096_C02.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
LVR01_0044_H06.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
SPL01_0098_H05.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
LVR01_0052_B04.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
ITT01_0101_B05.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TCH01_0017_D05.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGGAGGCTGG*CCAAG
OVR01_0085_D03.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
PST01_0049_B09.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
PST01_0021_B11.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
PST01_0057_B10.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
PST01_0041_E05.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
KDN01_0058_E02.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TES01_0010_B12.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
SKNB1_0065_H11.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
TCH01_0092_E03.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
PST01_0059_D12.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
PST01_0039_B10.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
PST01_0077_F09.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
LVRM1_0022_H05.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
OVRT1_0112_C08.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
ITT01_0066_F05.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
LVR01_0074_A02.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
PST01_0054_E09.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
KDN01_0033_C01.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
KDN01_0033_A09.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
LVRM1_0157_B07.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
PST01_0086_B08.b : GAACAAGTTTGTGG*AAGACACAAAGAACGGAGTC*CATAAGAAGGAAGGCTGG*CCAAG
20110601C-001812 : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
---------+---------+---------+---------+---------+---------+ 942
OVRM1_0182_B09.b :
OVR01_0005_B10.b : TACCCCCTACGGAGTGACAAAAAT*CCGGGTCACTGTACTCTCC*CG*ATCTATGCC*CA
TES01_0009_D01.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0018_B10.b : AACCCCTTAC*GAGTGACAAATAT*CGGGGTCTCTGGACTCTCC*AGGATCTATGCC*CA
TES01_0042_B10.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*CA
TES01_0030_A09.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0038_G06.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0106_F04.b : TACCGCCTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTTTGCC*AG
TES01_0045_A10.b : TACCGCGTACGGAGTGACAAA*AT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*CA
OVR01_0020_B10.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
SPL01_0043_D12.b : TACCcccttacggaatggacaaaaatcggggtcatggtaccccccagggatctatgcccg
OVR01_0025_A11.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0073_E06.b : cccctaacgggtggaaaaaaatccgggggcccgtgattcccccgggtttttggcccgaaa
TES01_0104_H07.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AAGATCTATGCC*AG
OVR01_0052_C08.b : TACCCCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*CA
LVR01_0058_C02.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0076_A03.b : accgcgtacggaagggcaaaaatcggggtcccggtatcccccggatctttgccggaaacc
TES01_0069_H01.b : gctaaggatggaccaaaatcgggggcactgtacccccccgggattcttgccgggaaactg
TES01_0043_A01.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
OVR01_0048_G07.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*CA
TES01_0109_A11.b : TACCGCGTACCGAGTGACAAAAAT*CGGGGTCACTGTACTCCCC*AGAATCTTTGCC*GG
TES01_0024_B03.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0110_C07.b : ttttttaagaaagggtttggtgccatatacccgcgtacccgaagtgacaaaaatctgggg
TES01_0036_H09.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*CAGATCTATGCC*AG
TES01_0061_D07.b : tcccccttacggggggacaaaaaacgggagtcctggacccccccgggacctttggccgga
TES01_0055_E01.b : TACCGCGTACGGAGTGACTAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
CBLT1_0100_B01.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0069_F05.b : atagggtggaaaaaaattggggggccctggtctccccggtatttttccctggaaactgtg
TES01_0020_D09.b : TACCTCGTACGGAGTGACAAAGAT*CGGGGTCACTGTACTCTTC*CGGAatctatgctct
TES01_0003_G08.b : TACCGCGTACGGAGTGACAAAAATTCGGGGTCACTGTACTCCCC*AGGATCTATGCC*AG
SMG01_0072_G10.b : cggagtgacaaaaatcgggtcccggtactcccaggatctttgccggaaactgaatggaca
OVR01_0048_F06.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
PST01_0028_G03.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0036_G05.b : TACCGCGTACGGAGTGGCAAAAAT*CGGGGGCCCTGGACTCTCC*CGGATCTTTtgcccg
TES01_0060_A10.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGGTCACTGACTCTCC*AGGATCTATGCC*AG
TES01_0088_E12.b : TTCCGgcgtacggagtgaccaaaaatcggggtcactggtaccccccaggatctttgcccg
TES01_0109_H01.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*CA
TES01_0006_H02.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0094_B03.b : TACCGCGTACGGGATGACAAAAAT*CGGGGTCACTGTCCTCTCC*AGGATCTTTcccggg
TES01_0091_D09.b : TACCGCGTACCGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AAGATCTATGCC*CA
TES01_0002_B06.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*CGGATCTTTGCC*AG
TES01_0080_E03.b : TTACCCGTACGGgagggccaaaaatcggggtccctgttatcccccggaatctttgcccgg
TES01_0098_E01.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*CAGATCTATGCC*CG
TES01_0030_B11.b : TCCCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AAGgatcttggccgg
TES01_0071_F04.b : ttacggggggcaaaaaacggggggcctggacctccccggattttttcccggaaacctggt
TES01_0100_F11.b : TACCGCGTACGGAGTGACAAAAAC*CGGGGTCACTGTtactccccgggatctttgcccgg
TES01_0100_H01.b : TACCGCGTACGGAGTGACCAAAAT*CGGGGTCACTGTACTCTCC*CAGATCTATGCC*CG
TES01_0097_H04.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCCCC*AGAATCTTGCCC*GG
TES01_0014_F06.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0024_D10.b : TACCCCGTACGGGGTGAACAAAAATCCGGGTCACTGTACTCTCCcaggatctttgcccgg
TES01_0105_B06.b : TACCGCGTACGGAGTGACAAAAAT*CCGGGTCACTGTTCTCTTC*CAGATCTATGCC*AG
TES01_0008_A03.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0051_G05.b : tacccgttacggagtgacaaaattcggggtccctggactctcccggatctatgcccggaa
TES01_0058_C01.b : TACCGCGTACGGAGTGAC*AAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0026_H09.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGCCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0063_A09.b : TACCGCGTACGGAATGACAAAATC*CGGGTCCCCGGTACTCTCC*CGGATCTTTGCC*GG
PTG01_0101_A06.b : ccccaattttttccgaaaaatttgtgtgaaaaaaagggggggaaaaaatttccccttttt
ITT01_0032_G06.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
OVR01_0058_D12.b : TACCGCGTACGGAATGACAAAAAT*CAGGGTCACTGTACTCTGC*AAGATCTATGCC*CA
TES01_0039_F08.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
ADR01_0101_H11.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0072_D11.b : cctacggggtggaaaaaatcgggggcccctgtatcctcccggatctttgcccggaaactg
TES01_0078_C06.b : TACCGCGTACGGAGTGACGAAAAtccggggtcctggtcctctccaggaatcttgcccgga
TES01_0072_C03.b : TCCCGCGTACGGGAGGACAAAAAT*CGGGGGCCCTTGACTCCCC*CGGATTTTTGCC*CG
TES01_0090_E10.b : TACCCCGTACGGAATGACAAAATT*CGGGGCCATGGTCCTCTCC*AGGATCTTTGCC*GG
TES01_0098_C06.b : TACCGCGTACGGAGTGACAAAAAT*CG*GGTTACTGTACTCTCC*CGGATCTATGCC*AG
TES01_0059_D08.b : TACCGCGTACGGAGTGAC*AAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC**G
TES01_0039_D03.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0091_F12.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*CA
TES01_0086_E08.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0016_B02.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0011_A11.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0049_D11.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
KDN01_0065_E01.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0033_E11.b : tattcacccccctaaggtaattgaaaaaaaaatttgtggtcattgttttctatccggtat
TES01_0025_E04.b : cgcgttctgtatgtccattatctggggcattgtattctccaggatttagctcggaaactt
TES01_0007_E09.b : TACCGCGTACGGAGTGACAAAAAA*CCGGGggtcacttgtactctccaggatctatgcca
TES01_0070_C11.b : ACCGCCGTCCGAATTGGCAAAATC*CGGGGTCCCTGTACTCCCC*GGGATCTTTGCC*CG
TES01_0059_G09.b : TACCGCGTACGGAGTGACCAAAAT*CGGGGTCACTGTACTCCTC*AGGATCTATGGCAGG
TES01_0018_F11.b : TACCGCGTACTGAGTGACAAAATT*CGGGGTCCCTGTACTCTCC*AGGATCTATGCC*AT
TES01_0083_C04.b : TACCGCGTACGGAGTGACAAAAAT*CAGGGTCACTGTACTCTCC*AGGATCTATGCC*AN
TES01_0069_D07.b : ttaccccctacggagtgacaaaaatccggggccccggtaccttcccggattctttccccg
TES01_0006_F12.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*CGGATCTTTGCC*AG
TES01_0072_B04.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCATTGTACTCTCC*AGGATCTTTGCC*CG
TES01_0076_F02.b : agtgacaaaaaccggggcccggtccctccccggtttttgcccggaaactgtgtgggccaa
TCH01_0023_E11.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0061_E09.b : taacggagtgaccaaaacccggggtcctgtacctcccaggatttttgcccaggaaaactt
TES01_0046_G10.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AN
TES01_0096_F05.b : TACCGCGTACGGAGTGACAAAATT*CGGGGTCACTGTACTCTCC*CGGATCTATGCC*AG
TES01_0054_C03.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCCCTGTACTCTCC*AGGATCTATGCC*AG
TES01_0094_B09.b : TACCGCGTACGGGGTGACAAAAAT*CGGGGTCACTGTACCCTCC*AGGATCTATGCCAAG
TES01_0003_C11.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0005_B09.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
PST01_0077_D12.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
PST01_0095_E07.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
KDN01_0071_A11.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0078_F12.b : TACCGCGAACGGAGTGACAAAATT*CGGGGTCCCTGTACTCCCC*AGGATTCATGCC*CG
TES01_0066_E10.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
THY01_0016_B07.b : cgcacgcggagaccataatcgggggcactggcctctccggaatcattgcccgaaactgct
TES01_0014_G11.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
UTR01_0102_D12.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
LNG01_0085_B08.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
ITT01_0049_A02.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
THY01_0118_B07.b :
TES01_0097_F08.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*CA
SPL01_0104_E06.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0016_G11.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0107_G12.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTTC*CGGATCTATGCCCAG
TES01_0022_E12.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0093_H08.b : TCCCGCGTACGGgagggcaaataaccggggtccctgtactcccccagattcttgcccgga
SPL01_0001_H02.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
OVR01_0085_C11.b : TACCGCGTACGGAGTGAC*AAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
OVR01_0034_G04.b : gcaccccgcaacgagtggacaacattcgggtcactgtactcctcccggatctattgccag
LVRM1_0099_C05.b : TAC
OVRM1_0020_H04.b : TACCGCGTACGGAGTGACAAAATC*GGG
OVRM1_0114_D01.b : TACCGCGTACGGAGTGAC*AAAAT*CGGGGTCACT
SMG01_0048_C10.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGatctatgccggga
OVRM1_0116_E11.b : TACCGCGTACGGAGTGGACAAAAT*CGGGGTCACTGTACTCTCC*AGGATC
UTR01_0013_A04.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
OVR01_0098_B04.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCCCTGTACTCTCC*CGGATTTATGCC*AG
THY01_0051_C04.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
SPL01_0044_D11.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACGGTACTCTCC*AGGATCTATGCC*AG
OVR01_0059_A05.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*CG
ADR01_0022_C09.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*CA
OVR01_0101_H08.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
OVR01_0063_E06.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
THY01_0059_F04.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
SMG01_0035_B11.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*CA
MLN01_0041_A05.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TCH01_0076_C06.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
OVR01_0036_E07.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
MLN01_0084_F02.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TCH01_0076_C09.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
SPL01_0075_D05.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
ITT01_0010_D12.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
CLNT1_0031_E05.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
OVRM1_0196_G11.b : TACCGCGTACGGAG
TES01_0027_B02.b : TACCGCGTACGGAGTGACAAGAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*CA
TES01_0029_H05.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCCCAGAATCTATGCCCAG
SMG01_0091_B04.b : TACCGCGTACGGAGTGAC*AAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
OVR01_0030_D09.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0005_G08.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TCH01_0059_F07.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0109_E02.b : TACCCCGTACGGAGTGACAAAAAT*CGGGGGCACTGgtcctctcccagatctatgccagg
PST01_0095_A08.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
LNG01_0091_C01.b : TACCGCGTAAGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCCTTGCC*AG
TES01_0072_B11.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*CGGATCTATGCCCAG
TES01_0049_D02.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0016_F05.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0036_A07.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
PST01_0037_B08.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0067_A03.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0024_F06.b : TACCGCGTACGGAGTGACAAAAAATCGGGGTCACTGTACTCTCC*AGGAATCTTGCC*AG
TES01_0045_C04.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*CG
TES01_0038_D11.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
PTG01_0087_C04.b : TACCGCGTACGGATTGG*ACAAAT*CGGGGTCACTG*ACTCTCC*AGGATCTATGCC*AG
OVR01_0041_A02.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
OVR01_0005_A01.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0031_F08.b : ccccctaagggatggacaaaaattggggtcatgtactcttccggaatctttgccaggaaa
TES01_0018_A09.b : TACCGCGTACGGAGTGACAAAAAT*CTGGGTCACTGTACTCTCC*AGGATCTATGCC*AA
TES01_0095_D02.b : TACCGCGTACCGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
PST01_0060_E11.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
MLN01_0100_F10.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0029_F01.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0109_G01.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*CGGATCTATGCC*AG
TES01_0105_G12.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
SMG01_0022_H05.b : tacgccgtaacgaatgacaaaaatccggggtcatgtacttccccgggatcctggcccgga
TES01_0045_D09.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCCCTGTACTCTCCCaggatctatgcccag
PST01_0037_G06.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0011_H10.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
OVR01_0070_A07.b : TACCGCGTACGGAGTGAACAAAAT*CGGGGTCACTGTACTCTTC*AGGATCTATGCC*AG
SKNB1_0064_E09.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0014_D01.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
PST01_0087_G02.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
SMG01_0042_C06.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0074_G04.b : gttaccactattgaattgacaaaattcgggttcactcgatctccccctgaatctatgcca
PST01_0097_G12.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
SMG01_0100_F02.b : aagggggggcaaaaaaagggggggctttgttttctcccggattttttgcccgaaaatttt
LVRM1_0033_F06.b : TACCGCGTACGGAGTGGACAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
OVRM1_0182_A05.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
LVRM1_0140_G12.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
UTR01_0011_C01.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
OVR01_0102_E07.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*CGGATCTATGCC*AG
OVR01_0096_C02.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
LVR01_0044_H06.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
SPL01_0098_H05.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
LVR01_0052_B04.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
ITT01_0101_B05.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TCH01_0017_D05.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
OVR01_0085_D03.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
PST01_0049_B09.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
PST01_0021_B11.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
PST01_0057_B10.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
PST01_0041_E05.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
KDN01_0058_E02.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TES01_0010_B12.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
SKNB1_0065_H11.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
TCH01_0092_E03.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
PST01_0059_D12.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
PST01_0039_B10.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
PST01_0077_F09.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
LVRM1_0022_H05.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
OVRT1_0112_C08.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
ITT01_0066_F05.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
LVR01_0074_A02.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
PST01_0054_E09.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
KDN01_0033_C01.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
KDN01_0033_A09.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
LVRM1_0157_B07.b : TACCGCGTACGGAGTGACAAA*AT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
PST01_0086_B08.b : TACCGCGTACGGAGTGACAAAAAT*CGGGGTCACTGTACTCTCC*AGGATCTATGCC*AG
20110601C-001812 : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
---------+---------+---------+---------+---------+---------+ 999
OVRM1_0182_B09.b :
OVR01_0005_B10.b : GAAACTGAATGACC*AAAGACC*AGGGGACAAAATCCCCCTGAATGCCTG*CTGCCCCGG
TES01_0009_D01.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0018_B10.b : GGAACTTATTGAGC*TGAAAGC*AAGGGACTAGTATCTCCTGAATGCCTG*CTGGCCCAG
TES01_0042_B10.b : GGAACTGAGTGAGC*AGAGAGC*AGGGGGACAGATCCTCCTGAAATGCTG*CTGCCNNAG
TES01_0030_A09.b : GATACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTGGCTGCCAAGG
TES01_0038_G06.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTGCTGCCCAGGG
TES01_0106_F04.b : GAAAtgagggagcaaaaaacaggggaaaaaatccccctgatgcctgctgcccaggggggt
TES01_0045_A10.b : GAAACTGAATGAGC*AGAGAGC*AGGGGGACAGATCCTCCTGAATGCCTG**CTGCCCAG
OVR01_0020_B10.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCCAG
SPL01_0043_D12.b : gaaacttgagtgaaccaaaaagcaggggaacaaaaacctcctgaaatgcccgcttgccca
OVR01_0025_A11.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCCAG
TES01_0073_E06.b : acttgggggaccaaaagccgggggggaaaaacccctccaaagccctgtccccccgggggg
TES01_0104_H07.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGGACAGATCCTCCTGAATGCCTG*CTGCCCAGG
OVR01_0052_C08.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCCTAATGCCTG*CTGCCCAGG
LVR01_0058_C02.b : GAAACTGAGTGAGC*AGAGAGC*CAGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0076_A03.b : ggatggaccaaaaacggggggaaaaatccccccgaaagcccgcccgcccggggggggtag
TES01_0069_H01.b : aaggaaccaaaaacaggggaaaaaaacccccctgaaggcctggctggcccaggggggggg
TES01_0043_A01.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
OVR01_0048_G07.b : GAAACTGAGTGAGC*AAAAAGC*AGGGGACAAAATCCTCCTGAATGCCTGCTGCCCAAGG
TES01_0109_A11.b : GAAACTGATTGAGC*AAAGAGC*AGGGGACAAGATCCTCCCGAATGCCTGCCGGCCCA*G
TES01_0024_B03.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0110_C07.b : atcccggttctccctccccaggacttcaattcccttaaactctttcgcacctatataccg
TES01_0036_H09.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGGATGCCTG*CTGCCCAGG
TES01_0061_D07.b : aaactgaatggccaaaaaacagggggaaaaaatcccccggaaagcctggcggccaggggg
TES01_0055_E01.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACCAGATCTTCCTGAATGCCTG*CTGCCCAGG
CBLT1_0100_B01.b : GAAACTGAGTGAGC*AAAGAGC*AGGGGAACAGAATCTCCTGAATGCCTG*CTGCCCAGG
TES01_0069_F05.b : gtgccctaagccggggaaaaaaacccccccaaatccctccccccccggggggtggaaaaa
TES01_0020_D09.b : gaaactgattgaacattaaagaaggggacaagatccctcctgaatgccctgctgcccatg
TES01_0003_G08.b : GAAACTGTATGAGC*CAAAAGCCAGGGGACAAGATCCTCCCGAATGCCTGCTGCCCAAGG
SMG01_0072_G10.b : aaaacggggaaaaaatcccctgaatgccgcggcccaggggggggaaaaataatggttgga
OVR01_0048_F06.b : GAAACTGATTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTGCTGCCCAGGG
PST01_0028_G03.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0036_G05.b : gaaactgattgaagccaaaagcaggggacagaatcttcccgaaagcccgctgcccaaggg
TES01_0060_A10.b : GAAACTGATTGAGC*CGAGAGC*AGGGGACAAGATCCTCCCGAATGCCTG*CTGCCCCAG
TES01_0088_E12.b : ggaaactgattgagccaaaagccaggggacaagaaccctccggaaggcctggcggccaag
TES01_0109_H01.b : GAAACTGAATGAGC*AGAAAGCAGGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0006_H02.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0094_B03.b : aactgattggaccaaaaccgggggacaaaatcccccggatgcccggtgcccagggggggg
TES01_0091_D09.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGGACAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0002_B06.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTGCTGCCCAGGG
TES01_0080_E03.b : aaactgatggagccaaaacccggggaaaaaatctccctgaatgccgcctgcccggggggg
TES01_0098_E01.b : GAAACTGAGTGAAC*AGAGAGC*AGGGGAACAGATCCCCCTGAATGCCTGCTGCCCAGGG
TES01_0030_B11.b : aaacttgattgacatagaaccaggggacaagatccctcctgaatggcctgctgccccagg
TES01_0071_F04.b : ggggccaaaacccggggaaacaaatccccctagatccctctcccccccggggggggggga
TES01_0100_F11.b : gaaactggatgggccaaaggccggggaacaaaatccccccgaatggctgcctgccccggg
TES01_0100_H01.b : GAAACTGAATGAGC*AAAGAGC*AGGGGACAAAtcctcctgaaagcccgctggcccgggt
TES01_0097_H04.b : AAAACTGATTGACC*AGAAAGC*AGGGGGACAGGATCCTCTGAATGCCTGGCTGCCCAGG
TES01_0014_F06.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGGACAGATCCTCCTGAATGCCTG*CTGCCCANG
TES01_0024_D10.b : aaaactgtatgagcaaaaaagcaggggacaagaaccctcctgaaggcctgctgccccagg
TES01_0105_B06.b : GAAACTGAGTGACC*AAAAAGC*AGGGGACAAAATCCTCCTGGAAGCCTG*CGGCCCAGG
TES01_0008_A03.b : GAAACTGAGTGAGC*AGAGAGC*AGGNNGTCAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0051_G05.b : acctgaatggaccaaaagccgggggaatgaatcctccctaaatgccggctggcccggggg
TES01_0058_C01.b : GGAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTG*ATGCCTG*CTGCCCAGG
TES01_0026_H09.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGGACAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0063_A09.b : GAAACGGATTGAGC*CAAAACC*AGGGGAAAAAATCTTCCCGAATGgcctgcgcccaggt
PTG01_0101_A06.b : tttcctcccccggggggggggaaaaaaaaaaaggggggggcccacccccccccccccccc
ITT01_0032_G06.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTNGCCAGG
OVR01_0058_D12.b : GAAACTGATTGAGC*AGAGAGC*AGGGGACCAGATTCGCCCTGAatgcctgctgacccag
TES01_0039_F08.b : GAAACTGAGTGAGC*AGAGAGC*AGGCNGACAGATCCTCCTGAATGCCTG*CTGCCCAGG
ADR01_0101_H11.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0072_D11.b : atttggccaaaagccggggaacaaaattcccccgaaaggcccggggccccaggggggggg
TES01_0078_C06.b : aacttgattgacccaaaagccggggaaaaaaatcccccttaaatgcctgctgccccaggg
TES01_0072_C03.b : GAAAattaattgacccaaaaaccaggggaacaaaacccccccgaaaagcccgcctccccc
TES01_0090_E10.b : GAACCTGAATGAcccaaaaccagggaaacaaaccctccctgatgccggctgccccggggg
TES01_0098_C06.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCCGG
TES01_0059_D08.b : GAAACTGATTGACC*CAAAAGC*AGGGGGACAGATCCTCCTGATGCCCG**CTGCCCAGG
TES01_0039_D03.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTGCTGCCCCNNG
TES01_0091_F12.b : GGAACTGAGTGAGC*AGAGAGC*CAGGGGACAGATCCTCCTGAATGCCTGCTGCCCANGG
TES01_0086_E08.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0016_B02.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0011_A11.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0049_D11.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGANCAGATCCTCCCTGATGCCTG*CTGCCCAGG
KDN01_0065_E01.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0033_E11.b : ttattgcctggaaaaacttgatttagtctaaatatctggggaataaatttcttcctgtaa
TES01_0025_E04.b : aattttacatatagatcgggacagaatccttccgtatgcccgttgtccatggggggtgta
TES01_0007_E09.b : tgaaacttaatgaacaatatagctggggacaagatcctccctgattgcctgctgccccag
TES01_0070_C11.b : GGAACTGAATGACC*AAAAACC*AGGGGACAAAATCCTCCCGAATGCCctgcgcccccgg
TES01_0059_G09.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGGCCAGG
TES01_0018_F11.b : GAAACTGAGTGTGC*AAACAGT*CAGTGAACAGATCCTCCTGAATGCCTG*CTGCCCTGG
TES01_0083_C04.b : GAAACTGATTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCANG
TES01_0069_D07.b : gaaactgatttgaccaaaaacccggggcacaaattccccccttaaatccctctgccccgg
TES01_0006_F12.b : GAAACTGAGTGCAC*CTTAAAGCAGGGGACAAGATCCTCCTGAATGCCTGCTGCCCTGGG
TES01_0072_B04.b : GGAACTGAATGGAG*CAAAAGC*AGGGAACCAGATCCCCCCGAATGGCTG*CTGCCCAGG
TES01_0076_F02.b : aaccgggggaaaaaatccccccgaaagccccccgcccccgggggggggaaaaactaaaat
TCH01_0023_E11.b : GAAACTGAGTGAGC*AGAGAGC*AAGGGACAAGAATCTCCTGAATGCCTG*CTGCCCAGG
TES01_0061_E09.b : aattgacaaaaatccaggtgaaaaaatcctccttaatgcctgctgcccaggtgggaggaa
TES01_0046_G10.b : GAAACTGATTGAGC*CGAGAGC*CAGGGACAAAATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0096_F05.b : GAAACTGATTGAGC*ATAAAGC*CAGGGACAAGATCCTCCTGAATGCCGG*CTGCCCAGG
TES01_0054_C03.b : GAAACTGATTGAGC*ACAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0094_B09.b : GAAACTGAATGAGC*AAAGAGC*AGGGGACAAGATCCTTCTGAAATGGCGGCTGCCCAGG
TES01_0003_C11.b : GGAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCTTGAATGCCTG*CTGCCCCAG
TES01_0005_B09.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
PST01_0077_D12.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
PST01_0095_E07.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
KDN01_0071_A11.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0078_F12.b : GAAACTGATTGAGC*CAAGAcccggtgaacaaatttctcctaattgcctgctgccccggg
TES01_0066_E10.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
THY01_0016_B07.b : cgatcctaaagtcgggggccaaatcctcttgaatgctcgctgcccccggcgtgccg
TES01_0014_G11.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGGCCAGG
UTR01_0102_D12.b : GAAACTGAGTGAGC*AGAGAGC*AGGGAACAAGATCCTCCTGAATGCCTGCTGCCCAGGG
LNG01_0085_B08.b : GGAACTGAGTGAGC*AGAGAGC*AGGGGACNAGATCCTCCTGAATGCCTG*CTGCCCAGG
ITT01_0049_A02.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTNGCCAGG
THY01_0118_B07.b :
TES01_0097_F08.b : GGAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
SPL01_0104_E06.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0016_G11.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0107_G12.b : GAAACTGAGTGAGC*CGAGAGC*AGGGGACCAGATCCTCCTGAATGCCTGCTGGCCCGGG
TES01_0022_E12.b : GAAACTGAGTGAGC*AGAAAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0093_H08.b : aaactgattgaaccaaaaaccaggggaacaaaatccccccgaaaggcctgtcgccccagg
SPL01_0001_H02.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
OVR01_0085_C11.b : GAAACTGAGTGAGC*AAAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCCAG
OVR01_0034_G04.b : gaaactgtgtgagtagagaccaggcgacaacatcctccttgattgcctgctgcccagcgg
LVRM1_0099_C05.b :
OVRM1_0020_H04.b :
OVRM1_0114_D01.b :
SMG01_0048_C10.b : actgattgagcagagagcaggggccaagatccccctgatgccggctgccccaggtgggtg
OVRM1_0116_E11.b :
UTR01_0013_A04.b : GAA
OVR01_0098_B04.b : GAAACTGAATGAGC*CAAAAGC*CGGGGACAAATTCCTCCgaatgcccgcggcccagggg
THY01_0051_C04.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCg
SPL01_0044_D11.b : GAAACTGAATGAGC*AGAGAGC*AGGGGACAAGATCCTCCGGAATGCCTG*CTGCCCCGG
OVR01_0059_A05.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
ADR01_0022_C09.b : GAAACTGATTGAGC*AAAGAGC*AAGGGACCAGATCTTCCTGAATGCCTG*CTGCCCCAG
OVR01_0101_H08.b : GAAACTGAGTGAGC*AGAGAGC*AAGGGACAAGATCTTCCTGAATGCCTG*CTGCCCAGG
OVR01_0063_E06.b : GAAACTGAGTGAGC*AGAGAGC*AAGGGACAAGATCCTCCCTGATGCTTG*CTGCCCAGG
THY01_0059_F04.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
SMG01_0035_B11.b : GAAACTGAGTGAAC*AGAAAAC*AGGGGAACAGATCCTCCTGAATGCCTG*CTGCCCAGG
MLN01_0041_A05.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTGCTGCCCAGGG
TCH01_0076_C06.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCCAG
OVR01_0036_E07.b : GAAACTGAGTGAGCCAGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTGCTGCCCCAGG
MLN01_0084_F02.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TCH01_0076_C09.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGGACAGATCCCTCTGAAATGCTGCTGCCCAGGG
SPL01_0075_D05.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACNAGATCCTCCTGAATGCCTG*CTGCCCAGG
ITT01_0010_D12.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCCTGATGCCTG*CTGCCCAGG
CLNT1_0031_E05.b : GGAACCGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCCTGATGCCTG*CTGCCCAGG
OVRM1_0196_G11.b :
TES01_0027_B02.b : GGAACTGAGTGAAC*AGAGAGC*AGGGGACAAGATCCTTCTGAATGCCTG*CTGCCCAGG
TES01_0029_H05.b : GAAACTGATTGAGC*AGAGAGC*ATGGGAAAAGATCCTCCTGAATGCCTG*CTGCCCCAG
SMG01_0091_B04.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGGACAGATCCCTCTGAATGCCTG*CTGCCCAGG
OVR01_0030_D09.b : GAAACTGAGTGAGC*AGAGAGC*GGGGGACCAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0005_G08.b : GAAACTGAGTGAGC*AGAGAGC*AAGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TCH01_0059_F07.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGGACAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0109_E02.b : gaaaactgattgagccaaaagaaggggacaagaaccccccgaatggccgggtgccccagg
PST01_0095_A08.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
LNG01_0091_C01.b : GAAACTGAGTGAAC*AGAGAAC*AGGGGACAAAATCCTCCTGAATGCCTGCTTGCCCAGG
TES01_0072_B11.b : GAACctgaatggaccaagagccaggggaacagaccctcctgaaggcctgctggcccaggt
TES01_0049_D02.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCANG
TES01_0016_F05.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0036_A07.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
PST01_0037_B08.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCANG
TES01_0067_A03.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCCTGATGCCTG*CTGCCCCAG
TES01_0024_F06.b : GAAACTGATTGAGC*AGAAAGC*AGGGGACAAGATCCTCCTGAATGCCGGCTGCCC**GG
TES01_0045_C04.b : GAAACTGAGTGAGC*AGGGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0038_D11.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
PTG01_0087_C04.b : GAAACTGAGTGACC*AAAGAGC*AGGGAACAGATCCTCCCTGAATGCTTG*CTGCCCAGG
OVR01_0041_A02.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGAACAGATCCTCCTGAATGCCTG*CTGCCCAGG
OVR01_0005_A01.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0031_F08.b : ctgaatgaactaaaagcatgggaaaaaaaaccccctgaaagcccgctggcctaggagggg
TES01_0018_A09.b : GAAACTGAGTGAGC*TTAAAGC*AGGGGACAATATCCTCCTGAATGCCTG*CTGCCCAGT
TES01_0095_D02.b : GAAACTGAGTGAAC*AGAGAGC*AGGGAACAAGATCCTCCTGAAAGCCTG*CTGCCCAGG
PST01_0060_E11.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
MLN01_0100_F10.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0029_F01.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCCAG
TES01_0109_G01.b : GAAAactgagtgagcaaaaaggcagggaacaaatcctcttgaaggcctgctgcctagggg
TES01_0105_G12.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGAACCTCCTGAATGCCTGCTGCCCAGGG
SMG01_0022_H05.b : acctgaatggaccaaaaaccggggaacaaatccccctgaatgccggcggcccaggggggg
TES01_0045_D09.b : gaaactgaattgagcaaataacatggcaacagatcctccctgaatgcctgctgcccaagg
PST01_0037_G06.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0011_H10.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
OVR01_0070_A07.b : GAAACTGAATGAGC*AGAGAGC*CAGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
SKNB1_0064_E09.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0014_D01.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
PST01_0087_G02.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
SMG01_0042_C06.b : GA*ACTGAGTGAGC*AGAGAGC*AGGGGACCAGATCCTCCTGAATGCTTG*CTGCCCAGG
TES01_0074_G04.b : cagaaattatatttactaaaaacattgggaaaataaactcccctaaattcctgcttcacc
PST01_0097_G12.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
SMG01_0100_F02.b : tttgggcaaaaaaagcggggaaaaaaattcccccttgaaacccgccccccccgggggggg
LVRM1_0033_F06.b : GAAACTGAGTG
OVRM1_0182_A05.b : GTAACTGAATGAGC
LVRM1_0140_G12.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAAATGCTG*CTGCCCAGG
UTR01_0011_C01.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
OVR01_0102_E07.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCTTGAATGCCTG*CTGCCCCAG
OVR01_0096_C02.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
LVR01_0044_H06.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
SPL01_0098_H05.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
LVR01_0052_B04.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
ITT01_0101_B05.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TCH01_0017_D05.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGGACAGATCCTCCTGAATGCCTG*CTGCCNAGG
OVR01_0085_D03.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
PST01_0049_B09.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
PST01_0021_B11.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
PST01_0057_B10.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
PST01_0041_E05.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
KDN01_0058_E02.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TES01_0010_B12.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
SKNB1_0065_H11.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
TCH01_0092_E03.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
PST01_0059_D12.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
PST01_0039_B10.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
PST01_0077_F09.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
LVRM1_0022_H05.b : GAAACTGAGTGAGC*AGAAGAG*CAGGGACAAGATCCTCCTGAATGCCTG*CTGCCCANG
OVRT1_0112_C08.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
ITT01_0066_F05.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
LVR01_0074_A02.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
PST01_0054_E09.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
KDN01_0033_C01.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
KDN01_0033_A09.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
LVRM1_0157_B07.b : GAAACTGAGTGAGC*AGAGAGC*AAGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
PST01_0086_B08.b : GAAACTGAGTGAGC*AGAGAGC*AGGGGACAAGATCCTCCTGAATGCCTG*CTGCCCAGG
20110601C-001812 : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
---------+---------+---------+---------+---------+---------+ 1056
OVRM1_0182_B09.b :
OVR01_0005_B10.b : GTGGGTG*AAAACTAACTTGGCTTGACCCCAA*ACCCCCCcaaaacccccaaagaaagga
TES01_0009_D01.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAG*CCCCCCAG**AGCC*CAGAGGAAGAGC
TES01_0018_B10.b : GTGGGggaaaacttaatgggtgggacccaattcccctaaaaccctaaggaaaggcccaaa
TES01_0042_B10.b : GTGGGTG*AGAACTGACATGGCTGGACCCANG*GCCCCN*AGAGCCC*ATGAGATGGAGC
TES01_0030_A09.b : GTGGGGG*AGAACTGACCTGGCTGGGCCCAAA*GCCCCCCAGAACCC*AGAAGTAAGAGC
TES01_0038_G06.b : TGGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCC*AGAGCCC*AGAGGAAGGAGC
TES01_0106_F04.b : taaaaacgaaatggctggacccaaacccccccaaaccccaaggaagggaccaaaaccccc
TES01_0045_A10.b : GTGGGTT*GAAACTGACATGGCTGGACCCAAG*CCCCCAGAGCCcgaagaaggagcaaag
OVR01_0020_B10.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAACCC*CAAAGAAAGAGC
SPL01_0043_D12.b : gggggggggaaaaaatggaaatgggctggacccaaaaccccccaaaaacccaaaaagaag
OVR01_0025_A11.b : GGGGGTG*AAAACTGACATGGCTGGACCCAAA*ACCCCCCAAGAGCCcaaaagaaaggaa
TES01_0073_E06.b : ggggaaaaaataaaagggtggggccccaaccccccccaaaaccccggagagaggggaaaa
TES01_0104_H07.b : GTGGGTG*AGAACTGACATGGCTGGACNNNCA*AGCCCCCAGAGCCC*AGANGGAAGAGC
OVR01_0052_C08.b : GGGGGTG*AAAACTGA*ATGGCTGGACCCAAG*CCCCCCAagaaccccgaagaagggggc
LVR01_0058_C02.b : GTGGGTG*AGACCTGACATGGCTGGACCCAAA*GCCCCCAAAAACCC*AAAGGAAAGAGC
TES01_0076_A03.b : aaaaggaatgggggggaccccaaaccccccaaaaaccccaagaaaagggccaaaaacccc
TES01_0069_H01.b : aaaactgaactgggctgggacccaaaaccccccaaaacccctagggaaagggccaaaaac
TES01_0043_A01.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAG*CCCCCAGAG***CC*CAGAGAAGGAGC
OVR01_0048_G07.b : GGGGGTG*AAAATTGACATGGGTTGACCCAAaagccccccaaaaacccaaaagaaaggag
TES01_0109_A11.b : GTGGGGG*AAAACTGAAATGGCTGGGGCCCAA*ACCCCCAAGAACCC*Ccaaggaaggga
TES01_0024_B03.b : GTGGGTG*AGAACTGACATGGCTGGACCCCAA*CCCCCCAGAGCCCC*GAGGAAGAGCCG
TES01_0110_C07.b : gggtaacaaatattccccccttaaatgccctccttccccccgggtgtgggttaaaaactg
TES01_0036_H09.b : GTGGTTG*AGAACTGAAATGGCTGGACCCCAG*CCCCCAAGAGACCC*GAAGGAGGGCCA
TES01_0061_D07.b : ggggagaaactgaacttggctggaccccaagcccccccataaaccccaaagaaagggatt
TES01_0055_E01.b : GTGGGTG*AAAACTGACATGGCTGGACCCAAG*CCCCCAAAGAGCCC*Caagaaaggagc
CBLT1_0100_B01.b : GTGGGTG*AGAACGGACATGGCTGGGACCAAA*GCCCCCAG**AGCC*CAAAGGAAGGAC
TES01_0069_F05.b : taataggtggggccccaaccccccttaaccctcaagaaggggaaaaaaccccccggtacg
TES01_0020_D09.b : gtgggggataaatgacatggctggacccgtagcccccagtagcccctaggaaaggggcca
TES01_0003_G08.b : GGGGGTG*AAAACTGACATGGCTGGgaccctaagccccccaaaagcccggaggaagggac
SMG01_0072_G10.b : ccaaaccccccaagcccaggaaaggaaaaaaaccccgggaccggccttttaccccaaaga
OVR01_0048_F06.b : GGGGGTG*AGAAATGACATGGCTGAACCCAAA*GCCCCCCAagaccccaaaagaaagaac
PST01_0028_G03.b : GTGGGTG*AGAACTGACATGGCTGGGACCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
TES01_0036_G05.b : tgggtgaaaaatgaatggggtggaccaaaaccccccaaaagccctaggaagggaccaaaa
TES01_0060_A10.b : GTGGGTG*AAACCTGACATGGGTGGACCCAAA*GCCCCCCAAAAGCCccaaggagggacc
TES01_0088_E12.b : ggggggtggaaaaatggaacttggtgggaacccaaagccccccagaagccccaggggaag
TES01_0109_H01.b : GTGGGTG*GAAACTGACATGGGTGGACCCCAA*GCCCCCCAAAACCC*CAAAGGAAGGAC
TES01_0006_H02.b : TGGGGTG*AAAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*CGAGGAAAGAGC
TES01_0094_B03.b : gaaaatggaatgggtgggccccaagcccccaaacccaaagaaaggaccaaaacccccggg
TES01_0091_D09.b : GGGGGTG*AGActgacatggtgggcccaaagccccccanagcccgaggaaggagcagaac
TES01_0002_B06.b : TTGGGTG*AGAACTGACCTGGCTGGAACCCAA*GCCCCCAAGgagcccctaaggaaagag
TES01_0080_E03.b : ggaaaaatggaatgggggggaccaaaccccccaagaccccgaggaaggggcaaaaccccc
TES01_0098_E01.b : GGGGTGG*AAAACTGACATGGTGGGCCCCAAA*GCCCCCCAGAGCCC*AAAGGAAGGACC
TES01_0030_B11.b : tggggggaaaaacctgacattgcgtgggccccaagccccccctaaatccccttaagtaag
TES01_0071_F04.b : aaaattaatgtggggggccccaaacccccaaaagccccaaagagaaggggaaaacccccc
TES01_0100_F11.b : gggggggaaaactgacttgctgggaccccaaccccccaaaacccaaaggaaggaacaaaa
TES01_0100_H01.b : gggggaaaactgaatgcctgggacccaagccccccaaagcccaaggagggggccaaaacc
TES01_0097_H04.b : G*GGGTG*AAAACTGACATGGCTGGCCCCAAA*GCCCCCAAaaccccaaggaaagggcca
TES01_0014_F06.b : GTGGGTG*AGAACTGACATGGCTGGACCC*AA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
TES01_0024_D10.b : gggggggagaaactgacatgggctgggaccccaagcccccccataacccccgaggaaagg
TES01_0105_B06.b : TTGGGTG*AAAACTGAACTGCCTGGGACCCcaagcccccaaaacccccaaggaggggcca
TES01_0008_A03.b : GTGGGTG*AGAACTGACATGGCTGGGACCAAA*GCCCCCNAGAGCCC*AGAGGAAGGAGC
TES01_0051_G05.b : gggtgaaaaccggcatgtgttggaccccaaagccccccataactccaaagaaaaggactt
TES01_0058_C01.b : GGGGTTG*AGAACTGACATGCCTGGACCCAAG*CCCCCAAAAGCCCC*AAgaaagaccaa
TES01_0026_H09.b : GTGGGTG*AGAACTGACATGGCTGGACCC*AA*GCCCCCCAGAGCCC*AGAGGAAGGAGC
TES01_0063_A09.b : gggggaaaaatggactgggttggaccccaagcctccaaaaacccccaagaaagggccaaa
PTG01_0101_A06.b : ccggggggggggggaaaaaaccccccggggggggggtttttttctcttaaaaaaaaagag
ITT01_0032_G06.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA**CCCCCCAGAGCCC*AGA*GAAGGAGC
OVR01_0058_D12.b : ggggggtgagaaaatgacatgggctggaacccataaccccccaaaaaccctttagggaag
TES01_0039_F08.b : GTGGGTG*AAGACTTGACTGGCTGAACCCCAA*GCCTCCAAGAGCCC*CGAGGAAGGAGC
ADR01_0101_H11.b : GTGGGTG*AGGACTGACATGGCTGGACCC*AA*GCCCCCCAGAGCCC*AGAGGAAG*AGC
TES01_0072_D11.b : gaaaaaggaaatgggtggggcccaaaacccccccaaagccccaggggagggggggaaaac
TES01_0078_C06.b : ggggggaaaacgtgactgggttggacccaaacccccccaaaaccccgaagggaggggcca
TES01_0072_C03.b : ggggggggggaaaactgaaatgggttgggacccaaacccccccagaacccccaagggaag
TES01_0090_E10.b : gggggaaaactgaattggctggaccccaaaccccccaagaccccaaagaaaggggccaaa
TES01_0098_C06.b : GTGGGTG*GAGACTGACATGGCTGGACCC*AA*GCCCCCAAGAGCCT*AGAGGAAGGAcc
TES01_0059_D08.b : GTGGGGG*AGAACTGACTTGGTTGGACCCCAA*GCCCCCCAGAACCC*AAAGGAAGGAca
TES01_0039_D03.b : GTGGGTG*AGAACTGACATGGCTGGACCC*AA*GCCCCCAAGAGCCC*AGAGGAAAGAGC
TES01_0091_F12.b : GTGGGTG*AGAACTGACATGGCTGGACCCCAA*GCCCCC*AGAGCCC*CGAGGAGGGACC
TES01_0086_E08.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAAGCCCCCCAAGAGCCC*AGAGGAAGGAGC
TES01_0016_B02.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCCAGAGCCC*AGAGGAAGGAGC
TES01_0011_A11.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
TES01_0049_D11.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCC*AGAGCCC*CGAGGAAGGAGC
KDN01_0065_E01.b : GTGGGTG*AGAACTGACATGGCTGGACCC*AA*GCCCCCCAGAGCCC*AGAGGAAGGAGC
TES01_0033_E11.b : tcccctgttccccacgggtggggtgtatatcttaaattatggtgggaccccatacccccc
TES01_0025_E04.b : aaatttacttggctggacctaaattccccatagccccaagtaatgaataaataccctccg
TES01_0007_E09.b : gtggggtgagaactgactgtgctggacccttaaccccccataaccccataggtagggagc
TES01_0070_C11.b : ggggggggaaaactgaattgggtgggacccaaacccccccagaaccccaaaggaaggagc
TES01_0059_G09.b : GGGGGgaagactggaagggctggacccaagcccccaaagccccgaagaaaggaccaaaac
TES01_0018_F11.b : GGGGGTG*AAATCTGAATTGGCTGGACCCAAA*GCCCCCA*GAGCCC*AGAGGAAAGATC
TES01_0083_C04.b : GTGGGTG*AAGACTGACATGCCTGGACCCAAA*GCCCCC**GGAGCC*AAGAGGAGGAGC
TES01_0069_D07.b : ggggggtgaaaattgaattggttggacccaatgccccccagaccccttaggaagggtcta
TES01_0006_F12.b : TGGGTTG*AGAACTGACTTGGCctggacccaaagcccccaaaaacccttaaggaatggac
TES01_0072_B04.b : G*GGGTG*AAAACTGAATTGGCTGGACCC*AA*GCCCCCCAAAGCCC*CAAGGAAGGAGC
TES01_0076_F02.b : gggtggggcccaaaccccccccaaaaccccagagaaaggaggaaaaaaacccccggggac
TCH01_0023_E11.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCCAGAGCCC*AGA*GAAGGAGC
TES01_0061_E09.b : aactgaatagggtggaccccaaacccccaaaaacccaaagaaaggacaaaaacccccgtg
TES01_0046_G10.b : GTGGGTG*AGAAATGACATGGGctgggacccaaaccccccaagaacccagaaggaaggag
TES01_0096_F05.b : *TGGGTG*AAAACTGACTTGGCTGGACCCAAA*GCCCCCAA*AGCCC*CGAGGAAGGGAC
TES01_0054_C03.b : GTGGGTG*AGAACTGACATGGCTGGGACCCAA*GCCCCCCAAAACCCCAGAGGAATGACC
TES01_0094_B09.b : GTGGGTG*AAAACTGAACTGGCTGGACCCCAAAGCCCCCAAAACCCC*AAAGAAGGGATC
TES01_0003_C11.b : GTGGGTG*AGAACTGACAGGGCTGGACCCCAA*GCCCCCAAGAGCCC*AGAGGAAAGAGC
TES01_0005_B09.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAAAGCCC*AGAGGAAGGAGC
PST01_0077_D12.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCCAGAAGAAAGGAAC
PST01_0095_E07.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCCAGAGCCC*AGAGGAAGGAGC
KDN01_0071_A11.b : GTGGGTG*AGAACTGACATGGCTNGACCCAAA*GCCCCCAAGAGCCC*AGAGAAAGGAGC
TES01_0078_F12.b : tgggtgaaaaactgactttgccgggacccaaagcccccagataccccaaagaatggacct
TES01_0066_E10.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCC*AGAGCCC*AGAGGAAGGAGC
THY01_0016_B07.b :
TES01_0014_G11.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAAAGCCC*CAAGAAGGGACA
UTR01_0102_D12.b : GTGGGTG*AGAACTGAACTGGTTGGACCCCAA*GCCCCCAAGAACCCCGAAGGAAGGGAC
LNG01_0085_B08.b : GTGGGTG*AGAACTGACATGGCTGGACCCCAA*GCCCCCCAGAGCCC*AGA*GAAGGAGC
ITT01_0049_A02.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*CGAAGAAGGAGC
THY01_0118_B07.b :
TES01_0097_F08.b : GTG*GTG*AGAACTGACATGGCTGGACCCCAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
SPL01_0104_E06.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGA*GAAGGAGC
TES01_0016_G11.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCC*AGAGCCC*AGAGGAAGGAGC
TES01_0107_G12.b : TGGGTTG*AGAATGGACATGGCTGGgacccaaaccccccaagaagccccaaggaaaggag
TES01_0022_E12.b : GTGGGGGGAGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAACCC*AGAGGAAGGAGC
TES01_0093_H08.b : gggggtggaaaacggacttggttggggacccaagccccctaaaacccccaaggtaagaga
SPL01_0001_H02.b : GTGGGTG*AGAACTGACATGGCTGGACCCCAA*GCCCCCAAGAGCCC*AGAAGAAAGAGC
OVR01_0085_C11.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGA*CCC*AGAGGAAGGAGC
OVR01_0034_G04.b : cgggtgagaactgacctggctgggacccaaagcccccaataagtccacaacaaagggacc
LVRM1_0099_C05.b :
OVRM1_0020_H04.b :
OVRM1_0114_D01.b :
SMG01_0048_C10.b : aaaatgaactgggtgggcccaaagcccccaaagcccagaggaggggcaaaaaccccctgg
OVRM1_0116_E11.b :
UTR01_0013_A04.b :
OVR01_0098_B04.b : gggtgaaaatgaaatggctggacccaaaccccccaaaacccccagggagggcccaaaacc
THY01_0051_C04.b :
SPL01_0044_D11.b : GTGGGgtgaaaatggattggctgggacccaaagccccccagaagcccctagggaaggacc
OVR01_0059_A05.b : GTGGGGGgaaaactgacatgggtgggacccaaagccccccaaagcccaaaaggaaggagc
ADR01_0022_C09.b : GTGGGTG*AAAACTGACATGGCTGGACCCAAG*CCCCCCAGAACCCAaagaaagaccgaa
OVR01_0101_H08.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAAAGCCCCCCAGAGCCC*AGAGGGAGGAGC
OVR01_0063_E06.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCCAGAGCCC*AAAGGAAGGGGC
THY01_0059_F04.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCCCAAAGGAAGGAGC
SMG01_0035_B11.b : GTGGGTG*AGA*CTGAAATGGCTGAACCCAAA*GCCCCCAAGAGCCC*GAAGGAAGGAGC
MLN01_0041_A05.b : GTGGGTG*AGAACTGACATGGCTGGACCCAA***GCCCCAAGAGCCC*AGAGGAAG*AGC
TCH01_0076_C06.b : GTGGGTG*GGGACTGACATGGCTGGACCCAAG*CCCCCAGAAG***C*CAGAAGAAGAGC
OVR01_0036_E07.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCCAGAACCC*AAAGGAAGGAGC
MLN01_0084_F02.b : GTGGGTG*AGAACTGACATGGCTGGACCCCAA*GCCCCCAG**AGCC*AGAGGAAGGAGC
TCH01_0076_C09.b : GTGGGTG*GGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAAGAAGGAGC
SPL01_0075_D05.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCCAGAGCCC*AGAGGAAGGAGC
ITT01_0010_D12.b : GTGGGTG*AGAACTGACATGGCTGGACCCCAA*GCCCCCCAGAGCCC*AGAAGAAGGAGC
CLNT1_0031_E05.b : GTGGGTG*AGAACTGACATGGCTGGACCC*AA*GCCCCCAAGAGCCC*AGAGG*AGGAGC
OVRM1_0196_G11.b :
TES01_0027_B02.b : GTGGGTG*AGAACTGACATGGCTGGACCCCAA*GCCCCCCAGAGGCCCAAAGGAAGGAGC
TES01_0029_H05.b : GGGGGTG*AAAACTGACATGGCTGGAACCAAA*GCCCCCCAAAACCCcaaaggaagggac
SMG01_0091_B04.b : NGGGTTG*AAAACTGAACTGGCTGGACC*AAA*GCCCCCCAGAACCC*CGAGGAGGGACA
OVR01_0030_D09.b : GTGGGTG*AGAACTGACATGGCTGGTCCCAAA*GCCCCCAAAAGCCCAGAAGGAGGAAGC
TES01_0005_G08.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AAAGGAAGGAGC
TCH01_0059_F07.b : GTGGGTG*AGAACTGACATGGCTGGGACCAAA*GCCCCCCAGAGCCC*AGAGGAAGGAGC
TES01_0109_E02.b : gggggggaaaaatggactggggtggaacccaagccccccaaaaaccccgaagaaagggcc
PST01_0095_A08.b : GTGGGTG*AGAACTGACATGGCTGGACCCAA***GCCCCCAGAGCCC*AGAGGAAGGAGC
LNG01_0091_C01.b : TGGGTGA*GAAactgaatggctggacccaaacctcccagaacccgaggaaggacaaaaga
TES01_0072_B11.b : gggtgaaaactgaccttggcgggaccccaagcccccagaaaccccaaggagggaccaaag
TES01_0049_D02.b : GTGGGTG*AGAACTGACATGGCTGGGCCCAA**GCCCCCCAGAGCCC*CGAAGAAGGAGC
TES01_0016_F05.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCTCCAGAGCCC*AGAGGAAGGAGC
TES01_0036_A07.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCNAGAGCCC*AGAGGAAAGAGC
PST01_0037_B08.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
TES01_0067_A03.b : GTGGGTG*AGAACTGACATGGCTGGGACCAAA*GCCCCCAGGAGC*C*AGAAGAAGGAGC
TES01_0024_F06.b : GTGGGTT*GAAAACGACATGGCTGGACCCAAA*CCCCCAAGAaccccaaggaaggacaga
TES01_0045_C04.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*CCCCCCAA*AACCC*CAAAGAAAGAGC
TES01_0038_D11.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
PTG01_0087_C04.b : GTGGGTG*Aaaaatggaatgggctggacccaaagcccccaaaacccaaaggaagggcaaa
OVR01_0041_A02.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
OVR01_0005_A01.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
TES01_0031_F08.b : gaaaaaatggaatgggcggaccccataccccccaaaatccccaaagaaaggaactaaaaa
TES01_0018_A09.b : TTGGGTG*Aaaaacttgacttggttgggacccaaagccccccaaagcccatatgaaggag
TES01_0095_D02.b : GTGGGTG*AAAACTGAACTGGTTGGACCCAAA*GCCCCCAAGACCCC*AAAGGAAGGAAC
PST01_0060_E11.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAAGAGC
MLN01_0100_F10.b : GTGGGTG*AGAACTGACATGGCTGGACC*AAA*GCCCCCCAGAGCCC*AGAGGAAAGGAC
TES01_0029_F01.b : GTGGGTG*AGAACTGACATGGCTGGGACCCAA*GCCCCCAAGAGCCC*CGAGGAAAGAAC
TES01_0109_G01.b : gggtggaaaacgaacatggctggaccccaaccccccaaaacccccaagaaagggaacaaa
TES01_0105_G12.b : GGGGGTG*AAAACTGAACTGGTTGGACCCAAA*GCCCCCAAAAACCCCCAAGGAAAGAGC
SMG01_0022_H05.b : ggaaaaaggaaatggttgggacccaagcccccagaacccaaagaaaggggcaaaaacccc
TES01_0045_D09.b : tggggtgaaaaatgaacatggctgggaccccaaagccccctaaaatcccctaagaaagga
PST01_0037_G06.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
TES01_0011_H10.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
OVR01_0070_A07.b : GTGGGTG*AAAAactgacatgggctggaccccaaagccccccaaaaccccaaaggaagga
SKNB1_0064_E09.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
TES01_0014_D01.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCCAGAGCCC*AGGGGAAGGAGC
PST01_0087_G02.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
SMG01_0042_C06.b : GTGGGTG*GAAACTGAACTGGCTGAACCCAAA*GCCCCCAAAGCCCCGAGGAGGgacgga
TES01_0074_G04.b : aggtggggtggaaaattgtaattgtgtggcaccctatttcctctcatatcccacatgaga
PST01_0097_G12.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
SMG01_0100_F02.b : ggaaaaaaaaaaattggggggccccaaaccccccccaaacccccgagaaggggggagaaa
LVRM1_0033_F06.b :
OVRM1_0182_A05.b :
LVRM1_0140_G12.b : GTGG
UTR01_0011_C01.b : GTGGn
OVR01_0102_E07.b : GTGGGTG*AGAAATGACATGGCTGGACCCAAA*GCCCCCAAGAAGCCCAAAGGAAGGAGC
OVR01_0096_C02.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGGAGGGAC
LVR01_0044_H06.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
SPL01_0098_H05.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*AGCCCCCAGAGCCC*AGAGGAAGGAGC
LVR01_0052_B04.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
ITT01_0101_B05.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAAGAGC
TCH01_0017_D05.b : GTGGGTG*AGAACTGACATGGCTGGGACCCAA*GCCCCCCAGAGCCC*AGAGGAAGGAGC
OVR01_0085_D03.b : GTGGGTG*AGAACTGACATGGCTGGACCC*AA*GCCCCCAAGAGCCC*AGAGGAAAGAGC
PST01_0049_B09.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
PST01_0021_B11.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
PST01_0057_B10.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
PST01_0041_E05.b : GTGGGTG*AGAACTGACATGGCTGGACCCCAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
KDN01_0058_E02.b : GTGGGTG*AGAACTGACATGGCTGGACCC*AA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
TES01_0010_B12.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
SKNB1_0065_H11.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCCAGAGCCC*AGAGGAAAGAGC
TCH01_0092_E03.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCCAGAGCCC*AGAAGAAGGAGC
PST01_0059_D12.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
PST01_0039_B10.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
PST01_0077_F09.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
LVRM1_0022_H05.b : GTG
OVRT1_0112_C08.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAAGAAGGAGC
ITT01_0066_F05.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
LVR01_0074_A02.b : GTGGGTG*AGAACTGACATGGCTGGACTCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
PST01_0054_E09.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
KDN01_0033_C01.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
KDN01_0033_A09.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
LVRM1_0157_B07.b : GTGGGTG*AGAACTGACATGGCTGGACCCCAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
PST01_0086_B08.b : GTGGGTG*AGAACTGACATGGCTGGACCCAAA*GCCCCCAAGAGCCC*AGAGGAAGGAGC
20110601C-001812 : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
---------+---------+---------+---------+---------+---------+ 1111
OVRM1_0182_B09.b :
OVR01_0005_B10.b : accaaaaaaccccccccctacccctgccccctttttccccccccaaaacccaaaagggcc
TES01_0009_D01.b : AGG*ACCCCCGT**GTACCTGCC**CTTTTaccctcgatgcagaggggctcacgtccagt
TES01_0018_B10.b : tcccccgtgtacttggcccttttaccccctaatcaaatgggctctccggactctttgttt
TES01_0042_B10.b : AGA*GACCCCGT**GTACCTGGC**CCTTTTACCCTCGATGCAGA*GGGcctcacgtcag
TES01_0030_A09.b : AAA*GACCCCCG**Ttgttactggccctttttccctccaaatgccaaggggcctccccgg
TES01_0038_G06.b : AGA*GACCCCGT**GTACCTGCC**CTTTTACctcaaatgcaaaggggctcaccgtcagt
TES01_0106_F04.b : ggtacctggcctttttcccccaaagccaagggccccagggccttttttttgaaaaaaaat
TES01_0045_A10.b : accccgtgtactggcccttttaccctccaagcaaaggggcccccggcccatttgtttctg
OVR01_0020_B10.b : AGA*GACCCCCGCCGTACCTGGCCCCTTTTGCCCTCAAATGCAAA*GGGGGCC*TCACGG
SPL01_0043_D12.b : ggaacaaaaaccccccgggtccctgggcccttttaaccctccaaaacagaaaggcccccc
OVR01_0025_A11.b : caaaaaccccccgtgtaactgggccctttttacccctcaaaaatgcaaagggggccctca
TES01_0073_E06.b : aacccccgggggccccggcccttttttcccccaaaaaaaaggagggccccccgggctttt
TES01_0104_H07.b : AGA*GACCCCCGT*GTACCTGGTCCTTTACCCTCgatgcaaaggggctcacgtcagtttg
OVR01_0052_C08.b : aaaaacccccggcgtacttgggcccttttgccccccaaatccaaaaggggccctcccggg
LVR01_0058_C02.b : CAA*AACCCCCCC*GTACCTGGCCCCTTTTGCCCTCAatgccaaaggggcctccagggtc
TES01_0076_A03.b : ccggaaccggggcccttttcccctcagaggacagagggccccccgggcccattttttttt
TES01_0069_H01.b : ccccggtgaaccggggccttttttccccccaaaaagaaaaaggggcccccccgggcattt
TES01_0043_A01.b : AGA*GACCCCGT**GTACCTGGCCCTTTACcctcgatgccaaggggcctcaggccagttt
OVR01_0048_G07.b : caaaaaacccccgcgaaccctggcccttttggccctcaaaatgcaaaaggggccctcccg
TES01_0109_A11.b : ccaaaacccccttggacctggccctttcccctctaaaggcaaaggggcccccccgggcca
TES01_0024_B03.b : AGA*CCCCccgtgtactggcccctttacctccgatgcaaaggggcccccggtcagtttgt
TES01_0110_C07.b : attattgctctgggaccttatatcccccctataacccccttaataagtgatcctatatac
TES01_0036_H09.b : AAA*ACCCCCGT**GTACCTGGCCTTTTTccctcaaaggcaaggggctcagggtcgtttg
TES01_0061_D07.b : aaaaacccccgtgtgacttggcccctttttcctctaaatgtaaaaggggccccaccgggc
TES01_0055_E01.b : gaaaccccgtgtaccggcccttttacctcagatgcaaagggcctcaggtcagttggttct
CBLT1_0100_B01.b : AGA*GACCCCCGC*GTACCTGGCCCTTTTGgcctacgatgcggagggggcttccgggtca
TES01_0069_F05.b : gggccctttttcctaaaaaaaaaaagggccccccgcgtttttttttttttaaaaaaaatt
TES01_0020_D09.b : aaactccccttggtccttggcctttttacccctcaaggtcaaagggcctctcgggccatt
TES01_0003_G08.b : cgaaaaccccccttgtacttgggcccttttaacctcaaaatccatagggggccctcccgg
SMG01_0072_G10.b : aagggcccccgggtatttttttaaaaaaaaatttaaaaagggggtccccccaaaaccccg
OVR01_0048_F06.b : aaaagacccccgtggaacctgggccccttttaccctcaaaatcaaaaagggccctcacgg
PST01_0028_G03.b : AGA*GACCCCCGT*GTACCTGGCCCTTTT**ACTTCAAATGCAAA*GGG*GCC*TCACGT
TES01_0036_G05.b : acccccgggacctggcccttttacccccaaaacaaaagggccccccggtccatttgtttt
TES01_0060_A10.b : aagacccccgtggtcctggcccctttcccctcaatgcaaaggggcccccggtccatttgt
TES01_0088_E12.b : ggggcaaaaaaccccccgggtacccgggcccttttttcccctcaaaagcccaagggggcc
TES01_0109_H01.b : CAA*AAACCCCCGTGGACCTGGCCCTTTTccctccaaaggcaaaggggccccccgggcca
TES01_0006_H02.b : CGA*GACCCCCCTTGTAACTGGCCCCTTTTTACCTCAGATGCAAA*GGGGCCctcacggt
TES01_0094_B03.b : gacgggcccttttacccttaaaggaaaagggccccccgggcaatttgtttttaaaaaaaa
TES01_0091_D09.b : ccccctggacctgggccttttaccctcgatgcaaggggcctccggccagttgtttctgag
TES01_0002_B06.b : ccaaaaacccccgtggtactgggcccttttaccccccaatgcaaaaggggcctctcgggt
TES01_0080_E03.b : ggggaccgggccccttttaccccaaaaaaaaaggggcccccccggctctttgtttctcaa
TES01_0098_E01.b : AAA*GACCCCCGG*GTACTGGGCC**TTTTTCCCTCCAATGCAAA*GGGGCCccccgggc
TES01_0030_B11.b : gagctaaaaacccccggggtacctggccctctttttccctccaatgcaaaaggggcctcc
TES01_0071_F04.b : cgggatacggggccttttttccccccaaaagaaaggggggccctcggggatttttttttt
TES01_0100_F11.b : acccccgggtgactggccctttttccccccaaagcaaaggggccccggggcattttgttt
TES01_0100_H01.b : ccctggacctgggccctttacccctcaaaggaaaagggccccccggtcatttgttctaaa
TES01_0097_H04.b : aaacccccggggtcccgggccctttttccctccaatgcgaagggggcccccgggtcattt
TES01_0014_F06.b : AGA*GACCCCCGT*GTACCTGGC**CTTTTTACCTCAGATGCAGA*GGGGCCT*CACGGT
TES01_0024_D10.b : agcaaaaaacccccctgttactgggccctttttcccctccaaagcaaaaggggcctcccg
TES01_0105_B06.b : aaaccccccgggtacctgggcctttttcccccaaatgcaaaggggccccccggcccattt
TES01_0008_A03.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
TES01_0051_G05.b : aaaaccccctgtgatcctgcccccttttcccctcccaaggcggaggggccccccctggcc
TES01_0058_C01.b : agacccccgggaactggccctttaacccctcaatgccagggggcctcccggccgtttgtt
TES01_0026_H09.b : AGA*GACCCCCGT*GTACCTGGGCCCTTTA*CCNTCAGATGCAGA*AGGGCCT*CACGGT
TES01_0063_A09.b : acccccctgtgtctgggcccttttccccccaaatacaaggggcccccgggtcattttgtt
PTG01_0101_A06.b : agggggcccccccccttttttttttttttaaaaaaaaaaaaaaaaagggaggggggggtt
ITT01_0032_G06.b : AGA*GA*CCCCGT*GTACCTGGCCTTTTaccctcaatgcaaagggcctcacgtcagtttg
OVR01_0058_D12.b : gaaaccgaaaacccccccgcgttactgggccccttttttgccttccaaaatgttaaaggg
TES01_0039_F08.b : AAA*AACCCCCGT*GTACCCGGCCCCTTTACCCTCgaagccgaagggcctcccggtcgtt
ADR01_0101_H11.b : AGA*GAC*CCCGT*GTACCTGGCCCTTTACCtcagagcagagggcctcacgtcagtttgt
TES01_0072_D11.b : cccccgggatccgggccccttttacccccaataaaaaagggggcccccccggccattttt
TES01_0078_C06.b : aaaaacccccgtgttcctgggccttttttccctccaaagcagaagggccccccgggtcct
TES01_0072_C03.b : gggcaaaaaccccccggtgacccggcccctttttcccccaagaagaaaggggcccccccg
TES01_0090_E10.b : accccccgggccccgggccttttttcccccaaacccaaaggggcctccgggccttttttt
TES01_0098_C06.b : aagacccccgtgtcctggcccttttaccctcaaagccgagggcccttcccggccatttgt
TES01_0059_D08.b : aaaacccccggggacctggccccttttcccccgaaggccaaagggccccccggtcaattt
TES01_0039_D03.b : AGA*GACCCCCGT*GTACCTGGCCCTTTT**ACCTCAGATGCAGA*GGGGCC**CACGGT
TES01_0091_F12.b : GAA*ACCCCCGT**GTACCTGGC**CTTTTACCCTCAAATGCCGA*AGGGGCT*CCCGGT
TES01_0086_E08.b : AGA*GACCCCCGG*TGTACCTGCCCTTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
TES01_0016_B02.b : AGA*GACCCCCGT*GTACCTGGCCCTTTTTA*CCTCAGATGCAGA*GGGGCCT*CACGGT
TES01_0011_A11.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
TES01_0049_D11.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCA*ATGCCGA*GGGGGCT*CAC*GT
KDN01_0065_E01.b : AGA*GACCCCCGT*GTACCTGCCCCTTTAN**CCTCAGATGCAGA*GGGGTCT*CACGGT
TES01_0033_E11.b : ataataccctcgtgttaagtgttcataaaacccccctggtcacttgattcccttttttcc
TES01_0025_E04.b : tgtaacttggccttttatcttccaaatctaaggggcccttcggtcatttgttttcttgaa
TES01_0007_E09.b : aaaaacccccgctgatcttggccctttttccctccaaatgcaaagggccctcccggcccg
TES01_0070_C11.b : aaaaaacccccggtgtaccgggccctcttttccccccaaaacaaaagggggccccccggg
TES01_0059_G09.b : ccccctgaccctgggccttttacccccaaagcaaggggcctcccgggccgtttgtttctg
TES01_0018_F11.b : CAA*ATCTCCCGG*GTACCTGGCCCTTTttaccttcaatgtctatggggcctcacggtct
TES01_0083_C04.b : CGA*GACCCCGT**GTACCTGccctttttacctcaatgcagaagggctcccggtccgttg
TES01_0069_D07.b : ataccccccgttttctgggccccttttccccttattctaaaggggccccccgttcttttt
TES01_0006_F12.b : cttagacccccctggacactggcccttttttcccttcgaatagctaagggggcctccccg
TES01_0072_B04.b : caaaaccccccgggaccctggcccttttcccccaaaagccaagggcctcccggccatttt
TES01_0076_F02.b : cggggccctttttcccccaaaaatggggggggcccccccggccttttgttttttaaaaaa
TCH01_0023_E11.b : AAA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAAATGCA*A*GGGGCCT*CACGGT
TES01_0061_E09.b : tacctggccctttttcccttaatgcaaaggggcctctggtctttttttttttttaataaa
TES01_0046_G10.b : ccaagaccccccttgtacctggccccttttaccctccgaatgcaaaggggccctcccggg
TES01_0096_F05.b : AGA*AACCCCCCG*GGACCTGGGCCTTTTTCCCctcaatgcaaagggcccctccggtcct
TES01_0054_C03.b : AGA*AACCCCCCTTGTACCTGGCC*CTTTTACCCTCAAATGCCAA*AGGGCCctcacggt
TES01_0094_B09.b : AAA*AACCCCCCT*GTTCCTTGCCCTTTTTACCCTCAAATTCAAA*GGGGCCctccggtc
TES01_0003_C11.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAAATGCAAAAGGGGCCT*CCCGGT
TES01_0005_B09.b : AGA*GA*CCCCGT*GTACCTGGCC*CTTTTACCCTCA*ATGCAAA*GGGGCC**CCCGGT
PST01_0077_D12.b : AGA*GACCCCCGT*GTACCTGGCCCTTTTTA*CCTCAGATGCAGA*GGGGCCT*CACGGT
PST01_0095_E07.b : AGA*GACCCCCGT*GTACCTGGCCCTTTT**ACCTCAGATGCAGA*GGGCCTT*CACGGT
KDN01_0071_A11.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*AGGGGCT*CACGGT
TES01_0078_F12.b : aaaacccccagttacctggcccttttacccttaaagtgcaaggggccctatggtcatttt
TES01_0066_E10.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCA*ATGCCGA*GGGGCCT*CACCGT
THY01_0016_B07.b :
TES01_0014_G11.b : TAA*GACTCCCGG*GTCCCGGGCC*CTTTTACCCTCCAATGCAAA*GGGcctcccggtcc
UTR01_0102_D12.b : CAA*GACCCCCGT*GGACCTTGGCCCTTTTACCCTCAaaagcaaaaggggcctcccgggc
LNG01_0085_B08.b : AGA**AACCCCGT*GTACCTGGCCC**TTTACCCTCAGAGGCCGA*GGGGCCT*CACGGc
ITT01_0049_A02.b : AGA*GGCCCCCGT*GTACCTGCCCC**TTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
THY01_0118_B07.b :
TES01_0097_F08.b : AGA*GACCCCCGT*GTACCTGGCCCTTTT**ACCTCAAATGCAAA*GGGG*CT*CACGGT
SPL01_0104_E06.b : AGA*GACCCCCGT*GTACCTGCCCCTTTACCCTCgatgcagaggggctcacggtcagttg
TES01_0016_G11.b : AGA*GACCCCCGT*GTACCTGGCCC**TTTACCCTCCGATGCAGA*GGGGCCT*CACGGT
TES01_0107_G12.b : cagaaacccccgtgtacctgggcctttttaccctcaaaagcaaagggccccccacggtcc
TES01_0022_E12.b : AGA*GACCCCCGT*GTACCTGGCCCCTTTACCCCTCAAATGCAAAGGGGGCCTCCCGGGC
TES01_0093_H08.b : ccaaaacccccgggttcctgggcccttttttcccccaatattgaaagggggcctcccggt
SPL01_0001_H02.b : AGAAGACCCCCGT*GTACCTGGGCCCTTTTACCCTCAGATGCAGAGGGGGCCT*CACGgg
OVR01_0085_C11.b : AGA*GACCCCCGC*GTACCTGGCCCCTTTGCCCTC**GAAGCAAA*GGGCCCT*CACGGT
OVR01_0034_G04.b : agaagaaccccccgggaacctcgcccccctttacccctcacaacgccaggggccctcccg
LVRM1_0099_C05.b :
OVRM1_0020_H04.b :
OVRM1_0114_D01.b :
SMG01_0048_C10.b : taccgggccttttccccccaaaacaaagggccctccggccatttttttctaaaaaaaagt
OVRM1_0116_E11.b :
UTR01_0013_A04.b :
OVR01_0098_B04.b : cccggggacctggccctttttacctcccaaagccaaagggggctccccgggccatttttt
THY01_0051_C04.b :
SPL01_0044_D11.b : aaaaaccccccgtggtaccgggccccttttaccctccaaaaggcaaagggggccccccgg
OVR01_0059_A05.b : caaaaacccccgggttccctgggccctttttccccccagatggccaaaggggccctcccg
ADR01_0022_C09.b : aacccccggtactggcccttttaccctcaatgcaaaggggcctcccgtcaatttggttcg
OVR01_0101_H08.b : CGA*GAACCCCcgcgtacctgggcccttttgccccccaaatgccaaaggggccctcccgg
OVR01_0063_E06.b : AAA*AACCCCCCgcggtactggcccttttgccccccgaatgcaaagggggcctcagggtc
THY01_0059_F04.b : AGA*GACCCCCcttgtaacctggccccttttaccctcaaatgcaaaaggggcctcacggg
SMG01_0035_B11.b : AGA*ACCCCCCG**GTCCCTGGCCCTTTTACCCTCAAAgcgaaggggcctcaggtccatt
MLN01_0041_A05.b : AGA*GACC*CCGT*GTACCTGGCCCTTTTACCtcaaatgcaaggggctcacggtcgtttg
TCH01_0076_C06.b : AGA*GACCCCGT**GTACCTGGCCCTTTTACCtcagagcagagggcctcacggtcagttt
OVR01_0036_E07.b : AGA*GACCCCCGT*GTACCTGGCCCCTTTTACCTTCAAAAGCAGAAGGGGCCT*CCCGGg
MLN01_0084_F02.b : AGA*GA*CCCCGT*GTACTTGGCC**TTTTTACCTCAGATGCAGAGGGGGC***TCCGGT
TCH01_0076_C09.b : AGA*GACCCCCGT*GTACCTGGC**CTTTTTACCTCAGATGCAGA*GGGG*CT*CACGGT
SPL01_0075_D05.b : AGA*GACCCCCGT*GTACTTGGCC*CTTTTACCCTCGATTGCAAA*GGGGCCT*C*CGGG
ITT01_0010_D12.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCANA*GGGGCCT*CACGGT
CLNT1_0031_E05.b : AGA*GACCCCCGC*GTGCCTGGCCCTTTT**GCCTCAGATGCAAAGGGGGCT***CCGGT
OVRM1_0196_G11.b :
TES01_0027_B02.b : AGA*AACCCCCGTGTAACCTGGCC**TTTTTCCCTCCGAAGCCAA*AGGGGCT*CACCGG
TES01_0029_H05.b : caaaacccccctggttcctgggcccttttaccccccaaatgccaaggggccctccggtcc
SMG01_0091_B04.b : GAG*ACCCCcgtggacctggccttttacctcaaaggaaagggcctcccggtcatttgttt
OVR01_0030_D09.b : AGA*GACCCCCGT*GTAACTGGGCCCTTTTACCCTCCAATGCCAAGGGGGCCT*CAgggt
TES01_0005_G08.b : AGA*GACCCCCCGTGTACCTGGGCCCTTTTACCCTTCGATGCAGAAGGGCCCT*Cacggt
TCH01_0059_F07.b : AAA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCCAATGCAAA**GGGGCT*CCCGGT
TES01_0109_E02.b : caaaacccccctggacctgggcccttttacccctcgaaagcaaaggggcctcacgggtct
PST01_0095_A08.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
LNG01_0091_C01.b : ccccgtgtacctggccctttttacctcagatgcaaagggccctacggcagttttgttcca
TES01_0072_B11.b : ccccccgtgaaccttggcccttttacccccaaatcaaaggggccccccgggccgtttgtt
TES01_0049_D02.b : AGA*GACCCCCGT*GTACCTGGCCCTTTACCCTCgatgcgaaggggctcacggtcagttt
TES01_0016_F05.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
TES01_0036_A07.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAAATGCAGA*GGGGCCT*CACCGT
PST01_0037_B08.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
TES01_0067_A03.b : AGA**ACCCCCGT*GTACCTGGCCCTTTTA**CCTCCGATGCAAA**GGGCCC*TCACGT
TES01_0024_F06.b : aaccccctggtaccgggcctttttcccctcaaagcaaagagggcccccggccattttttt
TES01_0045_C04.b : AGA*GACCCCCGT*GTACCTGGCCC*TTTTACCCTCAAATGCCAA*GGGCCCT*CACGGC
TES01_0038_D11.b : AAA*GACCCCGT**GTACCTGGCCCTTTT**ACCTCAAATGCAAA*GGGG*CT*CACGGG
PTG01_0087_C04.b : aacccccggtacctggccctttgcccccaaaggcaagggcccccggggcattttgttcct
OVR01_0041_A02.b : CAA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAAAGGGGGCCT*CCCGGT
OVR01_0005_A01.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGAAGGGGCCTCCCCGGT
TES01_0031_F08.b : ccccccctgtaccttggcccttttaacccccaaaaccaaaagggccctccggttcatttt
TES01_0018_A09.b : catagaaccccttgtacttggcccttttaccctctaaagcaaagggccctcgggtcagtt
TES01_0095_D02.b : AAA*AACCCCCCGGTACCctggccccttttcccctaaaatcaaaaggggccctccgggcc
PST01_0060_E11.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
MLN01_0100_F10.b : AGA*GACCCCCGT*GTACT**GGCCCTTTTACCCTCAAATGC*GA*GGGGCCT*CCCGGT
TES01_0029_F01.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAAATGCAGA*GGGGCCT*CACGGG
TES01_0109_G01.b : aacccccggttcccggccccttttacccctcaaagccaaaggggcctcccgggcaatttg
TES01_0105_G12.b : AAA*AACCCCCGG*GAACCTGGCCCTTTTaccctccgaatgcaaaaggggcctccccggc
SMG01_0022_H05.b : cggtgcccggccccttttcccccaaaagaaaagggccccccgggccattttgtttcgaaa
TES01_0045_D09.b : agcaaaaaccccccctgtaacctggcccctttttacccnccaatgtccaagggggcctcc
PST01_0037_G06.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*AGGGCCT*CACGGT
TES01_0011_H10.b : AGA*GACCCCCGT*GTACCTG*CCCCTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
OVR01_0070_A07.b : accaaaaaccccccccgtacctgggccccttttgcccttcaaaatgcaaaaggggccctc
SKNB1_0064_E09.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGGCT*CACGGT
TES01_0014_D01.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
PST01_0087_G02.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
SMG01_0042_C06.b : accccccgtgtacctgggcctttaccctcaaaagcaaaggggcctcccgtcccatttgtt
TES01_0074_G04.b : ggcttcaaaataccccccctttaatttggccctttattctcctcccattttaattaggag
PST01_0097_G12.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
SMG01_0100_F02.b : aaaccccggggggggggggtcttttttttcccaaaaaaaaagaggggccccccccccctt
LVRM1_0033_F06.b :
OVRM1_0182_A05.b :
LVRM1_0140_G12.b :
UTR01_0011_C01.b :
OVR01_0102_E07.b : CAA*AACCCCCgggacctggcccttttaccctcaaaagcaaaggggccctcccggccatt
OVR01_0096_C02.b : AGA*GACCCCCGT*GGACCTGGCCCCTTT*ACCCTCAGATGCCGA*GGGGCCTTCCCGGT
LVR01_0044_H06.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
SPL01_0098_H05.b : AGA*GACCCCCGT*GTACCTG**CCCTTTTACCCTCAGATGCAGA**GGGCCT*CACGGT
LVR01_0052_B04.b : AGA*GACTCCCGT*GTACCTGGTC*CTTTTACCCTCAGATGCAGA*GGGGGCT*CACGGT
ITT01_0101_B05.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
TCH01_0017_D05.b : AGA*GACCCCCGT*GTACCTGGCCCTTTTTA*CCTCAGATGCAGA*GGGGCCT*CACGGT
OVR01_0085_D03.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGGCT*CACGGT
PST01_0049_B09.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
PST01_0021_B11.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
PST01_0057_B10.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
PST01_0041_E05.b : AGA*GACCCCCGT*GTACCTGGCCCTTTTTACC*TCAGATGCAGA*AGGGCCT*CACGGT
KDN01_0058_E02.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAAA*GGGGCCT*CACGGT
TES01_0010_B12.b : AGA*GACCCCCGT*GTACCTGGGCCCTTTTACCCTCAGATGCAGA*GGGGCCC*TCCGGT
SKNB1_0065_H11.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTGCCCTCANATGCAGA**GGGGCT*CACGGT
TCH01_0092_E03.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
PST01_0059_D12.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
PST01_0039_B10.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
PST01_0077_F09.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
LVRM1_0022_H05.b :
OVRT1_0112_C08.b : AGA*GA*CCCCGT*GTACCTGGCCCTTTT**ACCTCAAATGCAGA*GGGGCCT*CACGTC
ITT01_0066_F05.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCC*TCACGT
LVR01_0074_A02.b : AGA*GACCCCCGT*GTACCTGGCCCTTT**ACCCTCAGATGCAGA*GGGGGCT*CACGGT
PST01_0054_E09.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGGCT*CACGGT
KDN01_0033_C01.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
KDN01_0033_A09.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCT*CACGTT
LVRM1_0157_B07.b : ATA*GA*CCCCGT*GTAC
PST01_0086_B08.b : AGA*GACCCCCGT*GTACCTGGCC*CTTTTACCCTCAGATGCAGA*GGGGCCT*CACGGT
20110601C-001812 : CA*GTTTGTTTCTGAAAAAAAAGTGT***AAAATGGGGTGTTCCCCCTTAGAGCTACCCC
---------+---------+---------+---------+---------+---------+ 1167
OVRM1_0182_B09.b :
OVR01_0005_B10.b : ccccccccccccaaatttttttttttctcaaaaaaaaaaag
TES01_0009_D01.b : ttgtttcgaaaaaaagtgtaaaatgggtggtccccttaagctaccctgggccatgctaat
TES01_0018_B10.b : ctgaaaataaaacgttaaaaaggagggttcccccatataagctaccctggggcatagctt
TES01_0042_B10.b : tttgttctgagaaaaagtgttnaatggggtgtccccctaaactacccctggtcaagcata
TES01_0030_A09.b : ccagtttggtttcgtaaaaaaaagttgttaaaagggggggttcccccttaaaacttcccc
TES01_0038_G06.b : tgtttctgaaaaaaagtgtaaatggggtgttccccttaaactaacctgggtcaggcaaat
TES01_0106_F04.b : ttgaaaaggggggttcccccttaaaacccccgggggaaagggaaaatttgggccgggttt
TES01_0045_A10.b : aaaaaaaatttgtaaagggggggttcccccttaaactcccccggggcaaggccaaatttt
OVR01_0020_B10.b : ccaattttgttttctgaaaaaaaagttggaaaaaagggggggggttccccctttaaaaac
SPL01_0043_D12.b : cgggcaatttgtgtttctaaaaaaaaaaattgtaaaaaggggggggtttccccccttaaa
OVR01_0025_A11.b : cgggttcaattttggtttttttaaaaaaaaaaaatttgtaaaaaaatggggggggggttc
TES01_0073_E06.b : tttttctttaaaaaaaaatattaaaaaggggggggtccccccctaaagacccccgcgggg
TES01_0104_H07.b : ttctgagaaaaaatgtaaaaggggcgttccccttaagctaccctgggtcagggcaaattg
OVR01_0052_C08.b : ccaatttggtttctaaaaaaaaaagttttaaaaaatggggggttc
LVR01_0058_C02.b : agttttgttttttaaaaaaaaaatttggtaaaaagggggttgtttccccccctttaaaac
TES01_0076_A03.b : cgaaaaaaaaatttgtaaaaaggggggtgccccccaaaaaaacaccccggggaaagaaaa
TES01_0069_H01.b : ttttttctcaaaaaaaattttgtaaaaaggggggtgtccccccttaagaacacccccggg
TES01_0043_A01.b : gttctgagaaaaagtgtaaaaggggggtcccccttaaactaccccgggtcatgcataatt
OVR01_0048_G07.b : gtcaattttggttttttaaaaaaaaaatttgtaaaaaaaggggggggggttccccccctt
TES01_0109_A11.b : ttttgtttttaaaaaaaaattttaaaatgggggggtcccccctttaagactcacccctgg
TES01_0024_B03.b : tctgaaaaaaaattgtgaatggggtgttcccccttaaactaccccggggcaaggcaaaat
TES01_0110_C07.b : ccccttgttccctgggccctttttcccctcaaatgtacaggggtccctatcgtccatttt
TES01_0036_H09.b : ttctgagaaaaagttgtaaaatgggggtgtccccttagactaccccgggtcaagcaaaat
TES01_0061_D07.b : actttgtttttcaaaaacaaaaatgttaaaagggggggggtccccccttagagacccccc
TES01_0055_E01.b : gaaaaaaagttgaaaagggggtgtccccctgagctccccgggtcaagcctaatgggtctg
CBLT1_0100_B01.b : gttggttccgaaaaaaaagttttaaaagggggggttcccccttaaacctaccctgggtca
TES01_0069_F05.b : tttaaggggggggtcccccctaaaaacccccggggtagagaaattttgtgtcgcttgctc
TES01_0020_D09.b : ttgtttcggaaaaaaaatttggttaaatggtggtgttcccaccttaaattacccctgggg
TES01_0003_G08.b : gccagttttttttcttgaaaaaaagagtttacaaaatggggtgtttcccctttataaatc
SMG01_0072_G10.b : ggagaaaaaatttgtcggggttccccaggggtcttccctcaaaatttccgggcaaaaaaa
OVR01_0048_F06.b : ccaaattttgtttttgaaaaaaaaaattgtgaaaaaaggggggtgttccccccccttaaa
PST01_0028_G03.b : CA*GTTTGTTTCTGAGAAAAAGTTGT***AGAtggggtgtcccccttaaactaccctggg
TES01_0036_G05.b : ctgaaaaaaaatttttaaaagggggggttcccccttaaaactccccctgggccaaggaaa
TES01_0060_A10.b : ttctgaaaaaaaaaatttgaaaatggggtggttcccccttaagccccccccgggggcagg
TES01_0088_E12.b : ccccggggtcctttttgttttcggaaaaaaaaatttttaaaaagggggggtttccccctt
TES01_0109_H01.b : tttttgtttctggaaaaaaagctgttaaaatgggggggtttcccccttaaaacctaccct
TES01_0006_H02.b : ccgttttgttttcgaaaaaaaaaattggtagaatggggtgttcccccctttaaacttccc
TES01_0094_B03.b : attgtaaaagggggggtcccccctaaagaccccccgggggcaaggaaaatttggggcccg
TES01_0091_D09.b : aaaaagttgtagaatggggtgtcccccttagagctaccccgggtcaagcctaattggggt
TES01_0002_B06.b : cagttttggttctgagaaaaaaatttgtaaaaagggggggttcccccctttaaactaccc
TES01_0080_E03.b : aaaaaaatttgtaaaaggggggtccccccttaaaacccccccgggggaaagggaaatttt
TES01_0098_E01.b : cgttggtttttgaaaaaaaatttgaaaaggggggttccccctttaaacacccccgggggc
TES01_0030_B11.b : cggtccttttttgttcttgaaaaaaaatttgttaaaaggggggtgtttccccctttaaac
TES01_0071_F04.b : taaaaaaaaaatttgtaaaaggggggggtcccccttaaagaccccccgggggaaaaaaaa
TES01_0100_F11.b : cggaaaaaaaattggaaaaggggggggtcccccctaaaactaccccggggtcaaggcaaa
TES01_0100_H01.b : aaaaaaattttaaatgggggggtcccccctaaagcccccccggggccaagggaaattttg
TES01_0097_H04.b : tggtccctgaaaaaaaatttgtaaaaggggggggtccccccttaaaccccccccgggggc
TES01_0014_F06.b : CA*GTTTGT*TCTGAGAAAAAGTTGT***AAAATGGGGTGTCCCCCCT*AGAGCTACCCt
TES01_0024_D10.b : ggccagtttggtttctgaaaaaaaaatttttagaagggggggggttccccctctaaagcc
TES01_0105_B06.b : ggttcttgaaaaaaattttaaaaagggggatatcccccttaaagccccccctggggacaa
TES01_0008_A03.b : CA*GTTTGTTCTNGAGAAAAAGTGTA***GAATGGGGTGGGTCCCCTT*AGAGCTACCCC
TES01_0051_G05.b : attttttgtttttgaaaaaaaaacttgttaaaaggggggggtttcccccttaaaaatctc
TES01_0058_C01.b : ccggaaaaaagttggtaaagggggggttcccccttaaactcccccgggcacggcaaaatt
TES01_0026_H09.b : CA*GTTTGTTTCTGAGAAAAAAGTGT***AGAATGGGGTGGTCCCCTT*AGAGCTACCCT
TES01_0063_A09.b : ttttaaaaaaaaattttaaagggggggtgcccccctaaaatccccccgggggcaaggcaa
PTG01_0101_A06.b : ctccccataaaaaaaaaccgggcgggggggaaaaataatattttttgtttgttctccccc
ITT01_0032_G06.b : tttctgagaaaagtgtagatggggtgttcccctagagctaccctggtcatgcatattgtt
OVR01_0058_D12.b : ggccctcaggggtacagttt
TES01_0039_F08.b : tgtttctaaaaaaagttgtaaaaggggtgttccccttagagcacccctgggcaagccaaa
ADR01_0101_H11.b : tctgagaaaaaagtgtagaatggggggtccccctaaagctaccctgggtcatgcaaaatt
TES01_0072_D11.b : tttttaaaaaaaaaatttttaaaagggggggttccccctttaaaaacccccgggggggag
TES01_0078_C06.b : tttgttttctaaaaaaaagtttttaaaatggggggttcccccctataaagccccccgggg
TES01_0072_C03.b : gccttttttgtttctcaaaaaaaaatttttaaaaagggggggtcccccccctaaaaaacc
TES01_0090_E10.b : ttttcgaaaaaaaatttttaaaagggggggcccccctttaaaccccccgggggaaaggga
TES01_0098_C06.b : ttctgaaaaaaaattgtaaaaggggggttccccttaaaactaccccgggcaagggcaaat
TES01_0059_D08.b : gtttctgaaaaaaaggttttaaaagggggggtcccccttaaagctaccccgggggcaagg
TES01_0039_D03.b : CA*GTTTGTTctgagaaaaagttgtaaatgggggggtcccccctagactacccctgggca
TES01_0091_F12.b : CA*GTTTGTTTCTGAGAAAAAAGTGT***AAAATGGGGTGTTCCCCCT*TAAGCTACCCt
TES01_0086_E08.b : CA*GTTTGTTTCTGAAAAAAAAGTTGT**AGAATGGGGTGTTCCCCCCTTGAACTACCCC
TES01_0016_B02.b : CA*GTTTGTTTCTGAGAAAAAAGTGT***AGGATGGGGTGGTCCCCCCTAGAGCTACCCC
TES01_0011_A11.b : CA*GTTTGTTTCTGAGAAAAAAATTG***GTAAATGGGGTGTTCCCCTTTGAGCTCCCCC
TES01_0049_D11.b : CA*GTTTGTTTCTGAGAAAAAAGTTGT**AGAATGGGGTGTTCCCCCTTAGAGCTACCCC
KDN01_0065_E01.b : CA*GTTTGTTTCTGAAGAAAAAGTGT***AGAATGGGGTGTTTCCCCTTAAAGCTACCCC
TES01_0033_E11.b : ccagaaatctaaagggtcctcctatggtacttttttgttttagataaaaattgtttatat
TES01_0025_E04.b : aatatttgttaatgggggtttctccccctaatgctccctctgggttatgtaaatttttgg
TES01_0007_E09.b : tttgtttcttaaaataaatttgtaaaatggggaggttccccctaaaactacccctggggc
TES01_0070_C11.b : cacattttgtttccaaaaaaaaattttttaaaagggggggtgcccccccttagacccccc
TES01_0059_G09.b : aaaaaaaagtggtaaaatggggggtcccccttaaactacccggggccaaggcaaattggt
TES01_0018_F11.b : ttttgttttctgaaaaaaaagtttgattaagggggtgttccccccttaaaatccacccct
TES01_0083_C04.b : tttcgagaaaaagttgtaaatgggggggtctcccttaaagctaccctggggcaaggcaaa
TES01_0069_D07.b : gttttctaaaaaaaatttttaaaatgggggggttcccccctataaacccccctggtatca
TES01_0006_F12.b : ggccatttttttttcttaataaaaaaaattttttaaaaatgggggggtttcccccctttt
TES01_0072_B04.b : gtttttgaaaaaagttgtaaaaggggggttcccctttaaaatcccccggggcagggaaaa
TES01_0076_F02.b : aaaattttaaaaagggggggtggcccccctaaaaacccccccgggggggagagaaatttt
TCH01_0023_E11.b : CA*GTTTGTTTCTGAAAAAAAGTTtaaaatgggtggtcccccttaaactacccctgggca
TES01_0061_E09.b : attttttaaaaggtggtgttcccccttaaatcaccctggggtataagaaaattttgtgtc
TES01_0046_G10.b : ccattttgttttctgaaaaaaaaaatttttaaaatggggggggttcccccctttaaaccc
TES01_0096_F05.b : tttgtttctgaaaaaaaaatttaaaaatgggggggtccccctttaaacctcccccggggc
TES01_0054_C03.b : cctttgtttccgaaaaaaaagttttaaaatgggggggttcccctttaaacctaccctggg
TES01_0094_B09.b : cattttgttttcgaaaaaaaagttgtgaaaaggggggggttcccccttaaaatcttcccc
TES01_0003_C11.b : CA*GTTTGTTTCTGAAAAAAAAGTTGTA*AAATGGGGTGTTCCCCCCTTAAAACTTCCCC
TES01_0005_B09.b : CA*GTTTGTTTCTGAAAAAAAAGTTGT**AAATGGGGGGGTTCCCCCCTTAACCTACCCC
PST01_0077_D12.b : CA*GTTTGTTTCTGAAAAAAAAGTTGT**AGAATGGGGTGTTCCCCCTTAAACCTCCCCT
PST01_0095_E07.b : CA*GTTTGTTTCTGAAAAAAAGTTGT***AGAATGGGGTGGTCCCCCCTAAAGCTACCCC
KDN01_0071_A11.b : CA*GTTTGTTTCTGAGAAAAAGTTGT****AAATGGGGTGTTCCCCCT*AGAACTACCCC
TES01_0078_F12.b : ttttttagaaaaaaagttttaaaatgggaatttccctctttaaacctacccggggatata
TES01_0066_E10.b : CA*TTTTGTTTCTGAGAAAAAAGTTG****TAAATGGGGTGTCCCCCTTAGAACTACCCC
THY01_0016_B07.b :
TES01_0014_G11.b : atttttttccgaaaaaaaatttgttaaatggggggttcccccttaaactacccctggggt
UTR01_0102_D12.b : cattttgtttctgaaaaaaaaattgtaaaaagggggggttccccctttaaagcccccccc
LNG01_0085_B08.b : atttgtttctgagaaaaagttgaaaatggggtgtccccctaaagctaccctggtcaatgc
ITT01_0049_A02.b : CA*GTTTGTTTCTGAGAAAAAGTTGT***AGAATGGGGTGGTTCCCCTTAAAGCTACCCC
THY01_0118_B07.b :
TES01_0097_F08.b : CA*GTTTGTTctgaggaaaaagtgtaaaatggggtgtcccccttaagctaccctgggtca
SPL01_0104_E06.b : gttctgagaaaaagtgtagaatggggtgtccccctaaagctacccctgggtcatggcata
TES01_0016_G11.b : CA*GTTTGTTTCTGAAAAAAAAGTTGT**AAAATGGGGTGTTTCCCCTTAGAGCTACCCC
TES01_0107_G12.b : atttggtttctgaaaaaaaagttgtaaaaggggggggttcccccttaaaacctccccctg
TES01_0022_E12.b : CA*GTTTGTTTCTGAAAAAAAAAttgtaagaatggggtggttccccttaaaaacttcccc
TES01_0093_H08.b : ctttttttttttttaaaaaataatttgcaaattgggggggttcccccctttaaaatttcc
SPL01_0001_H02.b : tcagttttgtttctgaggaaaaaagttgttaaaaatgggggtgtttccccccttaggagc
OVR01_0085_C11.b : CC*GTTTGTTTCTGAGAAAAAATTGTAAAAgg
OVR01_0034_G04.b : cgccccctttctttttcccgcctcaaaaactcctgacaaaatgcggttctcccccacctc
LVRM1_0099_C05.b :
OVRM1_0020_H04.b :
OVRM1_0114_D01.b :
SMG01_0048_C10.b : tgtaaaaggggggtcccccttaaaccccccggggaaaggaaatttggtccggattcccca
OVRM1_0116_E11.b :
UTR01_0013_A04.b :
OVR01_0098_B04.b : ttttgaaaaaaaaattgtaaaaaggggggggttcccccctctaagacctcccccgggggg
THY01_0051_C04.b :
SPL01_0044_D11.b : cccagtttggtttcctagaaaaaaaaatttttaaaaagggggtggtttccccctttaaaa
OVR01_0059_A05.b : ggccatttggttttctgaaaaaaaaaaatttttaaaaatgggggggttctccacttttaa
ADR01_0022_C09.b : gaaaaaaattttaaaaaggggggcccccccttaaaataccccggggccaaggcaaattgg
OVR01_0101_H08.b : tccagtttgttttctgaaaaaaaaaatttttaaagatggggggggttctcccccttaaaa
OVR01_0063_E06.b : agttttgtttctgaaaaaaaaaattgtaaaaaggggggggtcccccccttaaacctcccc
THY01_0059_F04.b : tcaggtttgtttctgaaaaaaaagtttgtagaatgggggggttccccccttagagctacc
SMG01_0035_B11.b : tggtttgaaaaaaaaattgtaaaagggggggttccccttaaacctccccgggggccaagg
MLN01_0041_A05.b : ttctgaaaaaagttgaaaaaaggggtgttccccttaaactacctgggtcatggttaattg
TCH01_0076_C06.b : gttctgagaaaaagttgtagaatggggtatcccccttaagctaccccgggtcatgcaaat
OVR01_0036_E07.b : ccagtttggtttttgaaaaaaaaagtggaaaaatgggggggttcccccctaaaactttcc
MLN01_0084_F02.b : CA*GTTTGTTTCTGAGAAAAAgtgtagaatgggntgttccccttaaagctaccctgggtc
TCH01_0076_C09.b : CA*GTTTGTTTCTGAAAAAAAGTTGT***AGAATGGGTATTCCCCCTagaactaccctgg
SPL01_0075_D05.b : CC*GTTTGTTTCTGAAAAAAAAAGTTGT*AAATGGGGGTGTTCCCCCTTAAAGCTACCCC
ITT01_0010_D12.b : CA*GTTTGGTTCTGAGAAAAAGTTGT***AGAATGGGGTGGCCCCCCTTAGAGCTACCCC
CLNT1_0031_E05.b : CA*GTTTGTTTCTGAAAAAAAGTTGT****AAAATGGGGTGTTCCCCCTAAAGCTACCCC
OVRM1_0196_G11.b :
TES01_0027_B02.b : CA*GTTTTTTTCTGAAAAAAAATTGT****AAAAGGGGTGGTTCCCCTTAAAAGCTCCCC
TES01_0029_H05.b : tttttgtttttgaaaaaaaaaatttttaaaaaggggtggtccccccttaaaacctccccc
SMG01_0091_B04.b : cgaaaaaaattgtgaaaggggtgtccccctaaaataccccggggcaaggaaaatttgggc
OVR01_0030_D09.b : cagtttgttttttgagaaaaaagtttgtagaaagggggtggttccccctttaaagcttcc
TES01_0005_G08.b : ccagtttgtttcctaaaaaaaaagttgtaaaatgggggggttcccccctttaaacctacc
TCH01_0059_F07.b : CA*GTTTGTTTCTGAAAAAAAATTTTT**AAAATGGGGTGTTCCCCCCTTAAACCTCCCC
TES01_0109_E02.b : tttgttttttaaaaaaaaattttaaaaaggggggtttccccctttgaaccacccccgggg
PST01_0095_A08.b : CA*GTTTGTTTCTGAGAAAAAAGTTG***TAAAAGGGGGTTTTCCCCTTAGAGCTACCCC
LNG01_0091_C01.b : aaaaaaaagttgtaaatggggtgtccccctttaactccccggggtcaacgaaaattgtgc
TES01_0072_B11.b : ttctaaaaaaaaattttaaaaggggggggtcccccttataagcccccccgggggaaaggc
TES01_0049_D02.b : gttctgaagaaaaagtgtagaatggggtgttccccttaagctaccccggggtcaatgcta
TES01_0016_F05.b : CA*GTTTGTTctgagaaaaagtgtagaatggggtgtccccctanagctacccctggtcat
TES01_0036_A07.b : CA*GTTTGTTTCTGAAAAAAAAGTGT***AAAATGGGGTGTTCCCCCTTAAAGCTACCCC
PST01_0037_B08.b : CA*GTTTGTTCCTGAGAAAAAAGTTG***TAGAATGGGGTGTCCCCCTTAGAACT*CCCC
TES01_0067_A03.b : CA*GTTTGTTTCGAAAAAAAAATTGTTAAATGGGGtgttcccctttaaacctccccttgg
TES01_0024_F06.b : tctaaaaaaaaattttaaaatggggggtcccccttaaaacaaccccgggggccaggcaaa
TES01_0045_C04.b : CA*GTTTGTTTCCTAAAAAAAAATTTGTAAAAGGGGGGGTTCCCCCTT*AAAACTTCCCC
TES01_0038_D11.b : CA*GTTTGTTTCTGAAAAAAAGTTGT***AGAATGGGGTGGTCCCCCT*AGAGCTACCC*
PTG01_0087_C04.b : aaaaaaaaatttgaaaagggggggtcccccttaaagccccccggggcaagggaaatttgg
OVR01_0041_A02.b : CA*GTTTGGTTCTGAAAAAAAAagttgtaaaatgggggggtccccccttagaacttaccc
OVR01_0005_A01.b : CA*GTTTGTTTCTGAAAAAAaaagttgaaaaataggggtggttccccccttagacctacc
TES01_0031_F08.b : gttctaaaaaaaaaattttaaaaagggaggggtccccccataaaaaaaccctgggaaaaa
TES01_0018_A09.b : ttgttctgaaaaaaaagtttagaatgggggggttcccccctaaaaactacccctggggta
TES01_0095_D02.b : attttggttcttaaaaaaaaattttaaaaagggggtggttcccccttaaaaactcccccg
PST01_0060_E11.b : CA*GTTTGTTTCTGAGAAAAAAGTTGT**AGAATGGGGTGTCCCCCCTTANAGCTACCCC
MLN01_0100_F10.b : TC*ATTTGTTTCTGAAAAAAAGTTGG***TAAATGGGGTGTTCCCCCTTA*AGCTACCCC
TES01_0029_F01.b : CA*GTTTGGTTCTGAAGAAAAAAGTTGAAGGATGGGGTGGTCCCCCCTTAAAGCTACCCC
TES01_0109_G01.b : ttttctaaaaaaaaattttaataaaagggggggtccccccttaacactacccccgggggc
TES01_0105_G12.b : cttttggttccgaaaaaaaaaattggaaaaatggggggttccccccttataaaccccccc
SMG01_0022_H05.b : aaaaaattttaaaagggggggtcccccctaaaaaccccccgggggaaggaaaatttgggg
TES01_0045_D09.b : ccggccaagtttttttttctaaaaaaaaaatttgtaaaaatgggggtgttccccccctta
PST01_0037_G06.b : CA*GTTTGTTTCTGAAAAAAAGTTGT****AGAATGGGTGTTCCCCCTTAGAGCTACCCT
TES01_0011_H10.b : CA*GTTTGTTTCTGAAAAAAAGTTGT***AGAATGGGGTGTTCCCCCCTAAAGCTACCCC
OVR01_0070_A07.b : ccgggccagtttggttttctaaaaaaaaaaagttgttaaaaatggggggggttccctccc
SKNB1_0064_E09.b : CA*GTTTGTTTCTGAGAAAAAAGTGT***AGAATGGGGTGGTCCCCCTTAGAGCTACCCC
TES01_0014_D01.b : CA*GTTTGTTTCTGAGAAAAAAGTGT***AGAATGGGGTGTTTCCCCTTAGAGCTACCCC
PST01_0087_G02.b : CA*GTTTGTTTCTGAGAAAAAAGTTGT**AGAATGGGGTGTTCCCCCTTAGAGCTACCCC
SMG01_0042_C06.b : tcttaaaaaaaatttgaaaaaggggggttcccccttaaaagcccccccggggccaaggaa
TES01_0074_G04.b : ctcacactgtctattatgatttttaaaaaaaaacttttaataaggggtgggtttccccca
PST01_0097_G12.b : CA*GTTTGTTTCTGAGAAAAAAGTGT***AAAATGGGGTGTTCCCCCTTA*AGCTACCCC
SMG01_0100_F02.b : tttttttttttaaaaaaaaaaaaattaagagaggggggggtggcccccccaaaaaaaacc
LVRM1_0033_F06.b :
OVRM1_0182_A05.b :
LVRM1_0140_G12.b :
UTR01_0011_C01.b :
OVR01_0102_E07.b : ttgttttcttaaaaaaaaatttgtaaaaaggggggggttccccctttaaagcctcccccg
OVR01_0096_C02.b : CA*GTTTGTTTCTGAAAAAAAAGT*TGTAAAATGGGGTTGTTCCCCCTTAGAGCTTCCCC
LVR01_0044_H06.b : CA*GTTTGTTTCTGAAAAAAAAGTTGT**AGAATGGGGTGTTCCCCCTTAAAGCTACCCC
SPL01_0098_H05.b : CA*GTTTGTTTCTGAGAAAAAAGTTGGT*AAATGGGGGTGTTTCCCCCTAGAGCTACCCC
LVR01_0052_B04.b : CA*GTTTGTTTCTGAGAAAAAAGTTGTAGAAATGGGGTGGTTCCCCTTTAGAGCTACCCC
ITT01_0101_B05.b : CA*GTTTGTTTCTGAGAAAAAAGTGG***TAGATGGGGTGTTCCCCCTTAGAGCTACCCC
TCH01_0017_D05.b : CA*GTTTGTTTCTGAGNAAAGGTTGT***AGAATGGGGGTGTTCCCCNTAGAGCTACCCC
OVR01_0085_D03.b : CA*GTTTGTTTCTGAGAAAAAAGTGT***AGAATGGGGTGTTCCCCCTTAGAGCTACCCC
PST01_0049_B09.b : CA*GTTTGTTTCTGAGAAAAAAGTGT***AGAATGGGGTGTTCCCCTT*AGAGCTACCC*
PST01_0021_B11.b : CA*GTTTGTTTCTGAGAAAAAAGTGT****AAAATGGGGTGTTCCCCTTAGAGCTACCCC
PST01_0057_B10.b : CA*GTTTGTTTCTGAAGAAAAATTGT***AGAATGGGGTGTTCCCCCT*AGAGCTACCCC
PST01_0041_E05.b : CA*GTTTGTTTCTGAGAAAAAAGTGT***AGAATGGGGTGTTCCCCCT*AGAGCTACCCC
KDN01_0058_E02.b : CA*GTTTGTTTCTGAAAAAAAATTGT***AAAATGGGGTGTTCCCCCTTAGAGCTACCCC
TES01_0010_B12.b : CA*GTTTGTTTCTGAGAAAAAGTTGT***AGAATGGGGTGTTCCCCCTTAGAGCTACCCC
SKNB1_0065_H11.b : CA*GTTTGTTTCTGAGAAAAAGGTGT***AAAAATGGGGTGTTCCCCCTAGAGCTACCCC
TCH01_0092_E03.b : CA*GTTTGTTTCTGAGAAAAAAGTGT***AGAATGGGGTGGTCCCCCCTAGAGCTACCCC
PST01_0059_D12.b : CA*GTTTGTTTCTGAGAAAAAAGTGT***AGAATGGGGTGTTCCCCCTTAGAGCTACCCC
PST01_0039_B10.b : CAAGTTTGTTTCTGAGAAAAAGTTGT***AGAATGGGGTGTTCCCCCTTAGAGCTACCCC
PST01_0077_F09.b : CA*GTTTGTTTCTGAGAAAAAAGTGT***AAAATGGGGTGTTCCCCCT*AGAGCTACCCC
LVRM1_0022_H05.b :
OVRT1_0112_C08.b : AG*TTTGTTCTGAGAAAAAagtgtaaaatggggggttccccttaaaactcccccggggca
ITT01_0066_F05.b : CA*GTTTGTTTCTGAGAAAAAAGTTGT**AGAATGGGGTGTTTCCCCCTAGAGCTACCCC
LVR01_0074_A02.b : CA*GTTTGTTTCTGAGAAAAAAGT*TGTAAAATGGGGTGTTTCCCCCTTAAAACTACCCC
PST01_0054_E09.b : CA*GTTTGTTTCTGAGAAAAAAGTTGT**AGAATGGGGTGTTCCCCCTTAGAGCTACCCC
KDN01_0033_C01.b : CA*GTTTGTTTCTGAAGAAAAAGTTGT**AGAATGGGGTGTTCCCCCTTAGAGCTACCCC
KDN01_0033_A09.b : CA*GTTTGTTTCTGAGAAAAAAGTTGT**AGAATGGGGTGTTTCCCCTTAGAGCTACCCN
LVRM1_0157_B07.b :
PST01_0086_B08.b : CA*GTTTGTTTCTGAGAAAAAAGTGT***AGAATGGGGTGTTCCCCCTTAGAGCTACCCC
20110601C-001812 : TGGGTCAATGCATAATTTGTGTCCTGATTTCC*CCAAAGGA*TACTTACCCTATCAAAAA
---------+---------+---------+---------+---------+---------+ 1225
OVRM1_0182_B09.b :
OVR01_0005_B10.b :
TES01_0009_D01.b : tgtgtctgattccccaaagatactccctatcaaaattctgggccaaaaaaaaaaaaaaaa
TES01_0018_B10.b : aattgggggcctgattttcccaaaggatcatctcccaattaaaaattcccgtgcataaaa
TES01_0042_B10.b : tttgtgtctgatttcccaaaggatctcccctttcaaatatctgggcaaaaaaaaaaaaag
TES01_0030_A09.b : cgggcacaggccaaattttgtgtcccggttttccccaaagggaaattaccttatccaaaa
TES01_0038_G06.b : ttggggcctgattccccaaaggataattcccatccaaaatttcctgggcgaaaaaaaaaa
TES01_0106_F04.b : tccccaaggacttttcccctcaaaaatttccggggcaaaaaaaaaaaaggcccttggctc
TES01_0045_A10.b : ggtccggattccccaagagggaacttccctttccaaaatattcgg
OVR01_0020_B10.b : ttccccccctggggctcaatggcaaaaatttttggggtcccctggaatttttccccccaa
SPL01_0043_D12.b : aaccaccccccggggaaaaagacaaaatttggggccggagtttcccccaa
OVR01_0025_A11.b : c
TES01_0073_E06.b : aaaaaaaaataatggtggggccgtttctcacaggggggtttctccccttacataaatttg
TES01_0104_H07.b : ggtcccgatttccccaagggaatttcctttcaaaaattccggggcaaaaaaaaaaaaagc
OVR01_0052_C08.b :
LVR01_0058_C02.b : tacccccctgggggtcaaaagtcaaaaaatt
TES01_0076_A03.b : aatttgggccccggttctcccaaggaggatctctcccccccaaaattttccggggaaaaa
TES01_0069_H01.b : ggacaaggacaaaatttggggcccgggtttccccccaagggggaattttccctctctccc
TES01_0043_A01.b : gggtctgatttcccaaaggaacttaccctacaaatattctggtgcaaaaaaaaaaaaagg
OVR01_0048_G07.b : taaaaactttcccccccggggggtcaaaatggccaaaaaatttttttggggtcccccgaa
TES01_0109_A11.b : gtcaaaggaaaaatttggccccggattttcccacaaggggaacttctcctttccaaaaaa
TES01_0024_B03.b : tggggccggatcccccaaaggaacttccctttccaaaatttccggggcaaaaaaaaaaaa
TES01_0110_C07.b : tttttttaagaaaaaaaattgaaattaggggtgattccactccataatcatccccggagt
TES01_0036_H09.b : tgtgcccggattcccaaagggattctacctttcaaaatattccggtcaaaaaaaaaaaaa
TES01_0061_D07.b : gggaggaaagaataattttggggcctgagtatccctatgggggtctcttctctttccaag
TES01_0055_E01.b : attccccaaagaactacccttccaaattcccgggcaaaaaaaaaaaaggcacgtgcccaa
CBLT1_0100_B01.b : agcaaaaattgggtccgggtttccccaaagggaattaccctaccaaaaatttctggtgca
TES01_0069_F05.b : ccaaagggtacttcctaacaaaaattctggggtaaaaaaaaaaaaaggggctggtttttt
TES01_0020_D09.b : aaatgccatattttgggggccggattctctcagagggaactcttagcccatccgaaattt
TES01_0003_G08.b : ctccccctggggcaaaggcataaattttgggtcccggtgtttctccccaaggggaatcat
SMG01_0072_G10.b : aaaaaaaaatttgaaaaaaaccctttcctttattccccggggagggcccctttgggggtt
OVR01_0048_F06.b : agcttacccccggggggcccaattggcaaaaattttggggggcccctgaattttccccca
PST01_0028_G03.b : gcaatgctaattggtgtctgattcaccaaaggatacttacctatcaaatatcctgtgcaa
TES01_0036_G05.b : atttggcgccggatttcccccaagggaactttccctttccaaaaaattcctgggcaaaaa
TES01_0060_A10.b : caaaattggtgccccggtttccccccaagggaactttccccttccaaaaattctcggtgc
TES01_0088_E12.b : taaggccccccccgggggaccaagggaaatttttggggtccggatttcccccaaaagggg
TES01_0109_H01.b : gggggccaaggcaaaaattgggggccgggtttcccccaaagggaacccttccccttccaa
TES01_0006_H02.b : cctggggtcaatgccaaaattggggcccggattttccccaaaagggaaacttaccctttt
TES01_0094_B03.b : gtttccccaaaggggattttcccttccaaaattttccggggaaaaaaaaaaaaaaaggcc
TES01_0091_D09.b : ctgattccccaaaaggatcttacctatcaaaaatttctgggcaaaaaaaaaaaaaaaagg
TES01_0002_B06.b : cccggggccatgccataatttggggtcccggaattccccccaagggaactctttcatttt
TES01_0080_E03.b : gtggcccgatttcccccaagggagttctccccctcaaaaattttccgtgcgaaaaaaaat
TES01_0098_E01.b : aggccaaaatttgggtttgattttcccaaagggaccttccctctcaaaaaattccggggg
TES01_0030_B11.b : ctccacccgggggcacaggcatgatttgtggtcccgggtttctcccaaaggctattttac
TES01_0071_F04.b : tattttgtgcgtgatttcccccagggggattctctcccccacaaaaatttctgcgggggg
TES01_0100_F11.b : tttgggcccgggttcccccaagggatctttcctttccaaaatattcctggggcaaaaaaa
TES01_0100_H01.b : ggccggggtttccccaagggaactttcccttttcaaaaatttcccggggcaaaaaaaaaa
TES01_0097_H04.b : aaggcaaattttggggccgcggtttcccccaaggggatccttccccttccaaaaatttcc
TES01_0014_F06.b : gggtcatgcatatttgtgtctggattccccaaaggatactacctatcaaaatattctgtg
TES01_0024_D10.b : tccccccggggcaagggaaaaattggtggcccggtttttccccaaagggaatcttatccc
TES01_0105_B06.b : ggcaattttgggccccgagttcccccaggggacttttcccctttcaaaaattcccggggc
TES01_0008_A03.b : TGGGGTC*ATGCATATTTGTGTCCTGATTTCC*CAAAAGGA*TAC**TACCTATCAAAAT
TES01_0051_G05.b : cccctgggggcaaggccaaaaattgtgttcccggattttcccccagagagatctcttccc
TES01_0058_C01.b : tgggccgcgattccccaaagggactttccctttcaaaaatttcccgggcaaaaaaaaaaa
TES01_0026_H09.b : GGGTCAT*TGCATAATTTGTGTCCTGACTTCC*CCAAAGGA*TACNTACCCTATCAAAAT
TES01_0063_A09.b : aaatttgggccccgtttccccccaaggggattttctccctcctaaaatttccttggggca
PTG01_0101_A06.b : ccccgccaaaaacaaacccccccacaaaaaaaattgttgggggggggaagaaaaaaaaaa
ITT01_0032_G06.b : gtctgattccccaaaggatactaccttcaaaaaatccggggcaaaaaaaaaaaaaagcca
OVR01_0058_D12.b :
TES01_0039_F08.b : ttgtgtccgattcccccaaaatacttacctttcaaaattttcggggcaaaaaaaaaaaaa
ADR01_0101_H11.b : gtgtccgatttcccaaaggaatctccctttcaaaaaatccgggcaaaaaaaaaaaaaaaa
TES01_0072_D11.b : gagaatatttgtgcgcggggtttcccccaaggggacttcccccctcccaaaaatattccg
TES01_0078_C06.b : gaaaagggaaatttgtgggccgggtttcccccaaagggaatctctcccccccaaaaattt
TES01_0072_C03.b : ccccgggggaaagagaaatttttgtgcccgtttttcccccaaggggttttccttccctta
TES01_0090_E10.b : aatttggggccggtttcccccaagggggttctcccctccaaaaattctccgtggaaaaaa
TES01_0098_C06.b : tgggcccggtttccccaaagggatcttccctttcaaaatttcggggcaaaaaaaaaaaaa
TES01_0059_D08.b : caaatttggggcccgggttcccccagggggtatttcccttcccaaaattttcctggggca
TES01_0039_D03.b : agcataattgtgtctgattccccaaaggatactacccttccaaatatcccggggcaaaaa
TES01_0091_F12.b : ggttcatgcataattggggtccgatttccccaagggtaccttccctatcaaaaatttccg
TES01_0086_E08.b : TGGGTCAATGCATAATTTGGGCCCTGATTTCC*CCCAAggaaccttacccttccaaattt
TES01_0016_B02.b : TGGGGCCATGCAT*ATTTGTGTCCTGATTTCC*CAAAGGGA*T*CTTACCCTTTCAAAAT
TES01_0011_A11.b : TGGGCCAATGCATAATTGGTGTCCTGATTTCC*CAAAGGAT*ACTTTACCTTTTCAAAAT
TES01_0049_D11.b : TGGGTCAATGCATAATTTGTGGTCCGATTCCC*CAAAAGGG*ATTCTACCCTTTCAAAAA
KDN01_0065_E01.b : TGGGTCA*TGCATANTTTGTGTCCTGATTTCA*CCAAAAGG*ATACTACACTATCAAAAA
TES01_0033_E11.b : aagggggtttttcccctcttaaagtatcccttggggattatataaaaatttgtgtgtgcc
TES01_0025_E04.b : tcgggtattcttcccttgtatctctctctttcataacaattccgtgtgccctaaaaacaa
TES01_0007_E09.b : aaaggattattttggtccgggtttcccacatgggatcttaccctaccaaaaatattccgg
TES01_0070_C11.b : gcggggcaagggaaatttggggcccgtgtttccccaaggggaattcccccttcccaaaaa
TES01_0059_G09.b : gcccggtttcccccaagggtcttacccttccaaaatatccctggcaaaaaaaaaaaaaag
TES01_0018_F11.b : ggagcaatgcctaatttggtgcccggattctcctaaaggaaacttctcccttttaaaaat
TES01_0083_C04.b : ttggggcccgatttccccaagggaacttccccttccaaatttccggtgcaaaaaaaaaaa
TES01_0069_D07.b : ggcatattttttgcccggtttttcccctggggatacttctcctttaaaaatttttctggg
TES01_0006_F12.b : aaactttcccccttggggctaaatggccttaaatatggtgtgcccggaattttccccctc
TES01_0072_B04.b : ttggggcccggtttccccaaagggactttcccttccaaatttccgggccaaaaaaaaaaa
TES01_0076_F02.b : tgggcgccgcttttccccaagggaggactcccccccccaaaaaaattctccgggggaaaa
TCH01_0023_E11.b : atgcaattttgggcccgtttccccaaaggtacttaccctatcaaaattttcctgggcaaa
TES01_0061_E09.b : cgattttcccaaaggaaacattctcttttaaaaaaattcccggcgcgcataaaaaataaa
TES01_0046_G10.b : tacccctggggtccaaggccaaattttggggtcccgggaattcccccccaaaagggaaat
TES01_0096_F05.b : caatgctaaattttgggctcggtttctccaaggggaatttttccctttcaaaattttccg
TES01_0054_C03.b : gcaaagccaaaattggggcccgatttcccaaaaggacccttcccctttcaaaatttcctg
TES01_0094_B09.b : cggggacaagggcatattttgggcccggattcccccaaagggatcttttcccttacaaag
TES01_0003_C11.b : cggggccaatgctaaatttgttgtcctgatttctccaaaagggatactttccccttataa
TES01_0005_B09.b : TGGGTCAAAGCATAAATTGTGgtccggatttcccccaaaggaatctttaccctttccaaa
PST01_0077_D12.b : GGGGTCAA*GCATAATTTGGGTCCGGATTTCC*CAAAAAGG*AATTTACCCTTTCAAAAA
PST01_0095_E07.b : TGGGTCA*TGCATAA*TTGTGTCCTGATTTCC*CAAAAG*A*TACTTACCCTATCAAAAT
KDN01_0071_A11.b : TGGGTCA*TGCATAATTTGGGTCTTGATTTCC*CAAAAAGA*TACTTACCCTATCAAAAT
TES01_0078_F12.b : tgaaaaaatgtgatacggaattcaaccaatgaaattcttacacttactaattatatcttt
TES01_0066_E10.b : gggtcaatgcctaattgggtccggatttccccaaggaatctaccctttcaaaaattcctg
THY01_0016_B07.b :
TES01_0014_G11.b : aaggactaattgggcccggatttcccccaacggatattttcctctttcaaaattattccg
UTR01_0102_D12.b : tggggcaaaggccaaattttgggttccgga
LNG01_0085_B08.b : tattgggtccgatttcccaaaggatctacctataaaatatctggcaaaaaaaaaaaaaaa
ITT01_0049_A02.b : TGGGTCA**TGCATATTTGTGTCCTGATTTCA*CAAAGGGA*TACT*ACCCTTCAAAAAT
THY01_0118_B07.b :
TES01_0097_F08.b : tgcataaattgggtcctgatttcccaaagggatcttaccctttcaaaaatttccgggcaa
SPL01_0104_E06.b : tttgtgtcctgatttcccaaaaggaatctacccttcaaaaaaattctgtgcaaaaaaaaa
TES01_0016_G11.b : TGGGTCA*TGCATAATTTGTGTCCTGATTTCC*CCAAAAGA*TACTTCCCCTATCAAAAA
TES01_0107_G12.b : gggcaatgcataatttgggtcccggtttccccaaaaaggatcttaccctttcaaaaatat
TES01_0022_E12.b : cggggcaaaggaaaatttggggcccggattttccccaaaggataactttccctttcaaaa
TES01_0093_H08.b : cccgggcataagtctaattttgggcgcctgatttccccaaaggggaatcttactcttcca
SPL01_0001_H02.b : taaccccttgg
OVR01_0085_C11.b :
OVR01_0034_G04.b : tcaaccctcacccctcggccccactgtctttaatttcggtctccttcatttttccctcca
LVRM1_0099_C05.b :
OVRM1_0020_H04.b :
OVRM1_0114_D01.b :
SMG01_0048_C10.b : gagggttttccctttaaaatattctgggcaaaaaaaaaaaaaggcccatttcctcatcgg
OVRM1_0116_E11.b :
UTR01_0013_A04.b :
OVR01_0098_B04.b : caagggcaaaatttttgggcccgggatttcccccaaggggggatcttttccctttcaaaa
THY01_0051_C04.b :
SPL01_0044_D11.b : cctacccccgggggtcaaaggcgaaaattttggggtcccgggattctccccacaaaggga
OVR01_0059_A05.b : aagcaccccccgcggggccaagggcaaaaattggtgggccccgggatc
ADR01_0022_C09.b : ggcccggatttcccaaagggactttccctatccaaaatttctgggcaaaaaaaaaaaaaa
OVR01_0101_H08.b : gctacc
OVR01_0063_E06.b : cgggggccaaaggcaaaaattgtggggcccggattttcccccaaagggaatctttaccct
THY01_0059_F04.b : cccgggggccaatggcaaatttttgggtcctggaattttccccaaaaggaatcattttac
SMG01_0035_B11.b : aaaattggtgcccgggttccccaaaggaaccttcccttccaaaaattccggggcaaaaaa
MLN01_0041_A05.b : gtcccatttcccaaagggtactacccttcaaaatatcctgtgcaaaaaaaaaaaaaaagg
TCH01_0076_C06.b : ttgggtccgatttccccaaagatacttcctttccaaaaattccgggccaaaaaaaaaaaa
OVR01_0036_E07.b : cccgggggtcaagggaataaatttggggtcccggattttcccccaaaaaggaaaacattt
MLN01_0084_F02.b : atgcaatatttgtgtcggatttcccaaaagatccttcctttcaaaatttcctgggaaaaa
TCH01_0076_C09.b : gtcatgcataattgggtctgatttcccaaaagaaattacctatcaaaatatccgtgcaaa
SPL01_0075_D05.b : GGGGTCAAGGCAAAATTTGggtctgatttccacca
ITT01_0010_D12.b : TGGGTCAATGCATAATTTGTGTCCTGATT*CA*CCAAAGGA*TACTTACCCTATCCAAAA
CLNT1_0031_E05.b : TGGGTCA*TGCACTATTGGGGGTCTGATTCCC*CAAAGGGA*A**TTTCCCTTTCAAAAT
OVRM1_0196_G11.b :
TES01_0027_B02.b : CGGGCCAATGAATAA*TTGTGTCTGGGATTCC*CCAAAGGA*AACTTTCCCTTCCAAAAT
TES01_0029_H05.b : cggggcaaaggaaatatttgtggcctgattttcccccaaagggatctttccccttttcaa
SMG01_0091_B04.b : cggatttcccaagggaactcccctatcaaatttccggggaaaaaaaaaaaagccattgtg
OVR01_0030_D09.b : ccctggggtccaatgcataaattttggggtcctgaattttccccaaaaaaggaatacttt
TES01_0005_G08.b : ccttggggccagtgcaaaatttgggtcccgaatttcccccaaagaggatactttaccctt
TCH01_0059_F07.b : TGGGTCAAGGCAAAATTTGGGTCCCGATTTCCCCACAGGGA*TACTTTCCCTTTCAAAAA
TES01_0109_E02.b : gcaaaggaaaatttggtggcccggtttccccccagggagttctctccctttcaaaaaatt
PST01_0095_A08.b : TGGGTCA*TGCATAATTTGTGTCCTGATTTCC*CCAAAAGA*AACTTACCTATTCAAATA
LNG01_0091_C01.b : ccgattctccagaggaacttccctttcaaaatttccgtggcaaaaaaaaaaaaaaaggcc
TES01_0072_B11.b : aaaatttgggcccgggttttccccaagggattctttcccctcccaaaaatttcccgggcc
TES01_0049_D02.b : atttgtgtcctgattcaccaaaggatcttacctatcaaattatcctgtgcaaaaaaaaaa
TES01_0016_F05.b : gcatattngtgtctgattccccaaagatactacctacaaaaatatctgtgcaaaaaaaaa
TES01_0036_A07.b : TGGGTCA**TGCATAATTGTGGTCTGAATTCC*CCAAAAGA*TACTTACCCTATCCAAAT
PST01_0037_B08.b : TGGGTCAATGCATAATTTGTGTC*TGATTTCA*CCAAAGGG*AACTTACACTATCCAAAT
TES01_0067_A03.b : gtcaatgcaaattttgggcccgatttcccaaaaggatccttcccttcccaaaatttccgg
TES01_0024_F06.b : atttgggccgcgttcccccaaagggtattttccctctcaaaaattcctgggcaaaaataa
TES01_0045_C04.b : TGGGgtcaaagcataattttgggccccgaatttcccaaaaggataccttcccctatccaa
TES01_0038_D11.b : TGGGGTC*ATGCAAAATTGGGGTCTGATTTCC*CCAAAGGA*TCT**TACCCTACCAAAA
PTG01_0087_C04.b : gcccggttcccccagggggatctttccttccaaaattttccgggcgaaaaaaaaaaaaaa
OVR01_0041_A02.b : ctggggccaatgcattattttgtgggcgtgattttccccaaaaaggaaacttttacactt
OVR01_0005_A01.b : ccctgggtcccatgccttaaattttttgtccccaatttcccccccaaaaggtaccttttc
TES01_0031_F08.b : acaaaatttggggcccggatttccccaaagggaaatttcccttttctaaaaaattcctgg
TES01_0018_A09.b : tatgctaattttgtgtccttatttcacacataggataattaaacctaaataaaattttcc
TES01_0095_D02.b : ggggcaaaggcaaaaattggggccccggaatttcccaaaggggaattttccccttccaaa
PST01_0060_E11.b : TGGGTCAATGCAT*ATTTGGGTCCTGGATTCC*CCAAAGGA*TACTTACACTATCAAAAA
MLN01_0100_F10.b : GGGGCCAAGGCA*AATTTGGTGCCGGATTTCC*CCAAAGGA*TACTTCCCCTTCCAAAAT
TES01_0029_F01.b : ggggtcaaggcaaaatttgggcccggaatttcccaaaaaggaatacttcccctatccaaa
TES01_0109_G01.b : aaaggcaaaatttggtgccccgatttcccccaagagggaattttatccctttccaaaaaa
TES01_0105_G12.b : cgggggcatggcaaaatttggggcccgggattcccccaaagggatacttcccctttccaa
SMG01_0022_H05.b : ccgcgtctccccaagggagtttcccttttaaaaatttctgggggaaaaaaaaaaaaaaaa
TES01_0045_D09.b : aaacctccccccttgggtcaaggccaaaattttgtggctccggaatttccccccaaaggg
PST01_0037_G06.b : GGGTCAA**TGCTAATTTGTGTCCCGATTCAC*CAAAAGAA*TACTTACCTATCAAAATA
TES01_0011_H10.b : CGGGGCAATGCATAATTTGTGGTCTGAATTCCCCCAAAGGAATACTAACCCTATCAAAAT
OVR01_0070_A07.b : tttaaaaaccacccccccggggtcaaaggcccaaaatttgtggggtccctggaattttcc
SKNB1_0064_E09.b : TGGGTCA*TGCATAATTTGTGTCTGATTTCAC*CAAAAGGA*TACTACACTATCAAAAAT
TES01_0014_D01.b : TGGGTTCATGCGTAATTTGTGTCCTGATTTCA*CCAAAGGA*TACTTACACTATCAAAAT
PST01_0087_G02.b : TGGGTCAATGCATAATTTGTGTCCTGATTTCA*CAAAAGGA*TACCTACCCTATCAAAAA
SMG01_0042_C06.b : aattgggcccggttcccccaaggggatcttccctttcaaaaatttccggggcaaaaaaaa
TES01_0074_G04.b : ataaaacaacacctgtgtgtctcattctaattttcatgtctctatattcaccttaagatg
PST01_0097_G12.b : TGGGTCAATGCATAATTTGGGGTCTGATTTCC*CAAAAGGA*TACTTACACTATCAAAAA
SMG01_0100_F02.b : cccggggggggaaaaaaaattttttttcgtgtctctctcccccccaaaggggattcttcc
LVRM1_0033_F06.b :
OVRM1_0182_A05.b :
LVRM1_0140_G12.b :
UTR01_0011_C01.b :
OVR01_0102_E07.b : gggttcaatgccaaaaatttgggtccggaatttccccccaaagggaatctttcctctctt
OVR01_0096_C02.b : gggggtcaaggcaaatttgggggccctgattttcccccaaagggatactttccccttttc
LVR01_0044_H06.b : TGGGTtcaatggcatattttgtgtcctgattttccccaaaagggataccttacactaatc
SPL01_0098_H05.b : TGGGGCAATGCctaaattggggtccggatttccccaaaagggatctttaccctttccaaa
LVR01_0052_B04.b : TGGGTCAATGCATAATTTGgtgtcctgaatttccccaaaaaggatacttacacttatcca
ITT01_0101_B05.b : GGGTCCA*TGCATAA*TTGTGTCTTGATTTCA*CAAAAGAA*T**CTACCCTATCAAAAT
TCH01_0017_D05.b : TGGGTCA*TGCATANTTNGTGTCCTGATTTCC*CAAAAGGA*TCTT**CACTATCAAAAT
OVR01_0085_D03.b : TGGGTNCATGCCATATTTGTGTCCTGATTTCA*CCAAAGGA*TACTACCCTATCAAAATT
PST01_0049_B09.b : TGGGTCA*TGCATAA*TTGTGTCCTGATT**C*ACAAAAGG*AACNTACACTATCAAAAA
PST01_0021_B11.b : TGGGTCAATGCATAATTTGTGTCCTGATTTCCACAAAAGGA*TACTTACCCTAATCAAAA
PST01_0057_B10.b : TGGGTCA*TGCATAATTTGTGTC*TGATTTCA*CCAAAGGA*TACTTCACTATTCAAAAT
PST01_0041_E05.b : TGGGTAA**TGCATATTTGTGTCCTGAATTCA*CCAAAGGA*TACTTACCTATCAAAATA
KDN01_0058_E02.b : TGGTCCA*TGCATAATTTGTGTCCTGATTTCA*CCAAAGGA*TACTTACCCTATCAAAAT
TES01_0010_B12.b : TGGGTCAATGCATAATTTGTGTCCTGAATTCACCAAAAGGA*TACTTACCCTATCAAAAA
SKNB1_0065_H11.b : TGGGTCAATGCATAATT*GTGGTCTGATTTCA*CCAAAAGA*TACTTAACTATCAAAAAT
TCH01_0092_E03.b : TGGGTCA*TGCATAATTTGTGTCCTGATTTCC*CAAAAGGA*TACTTACCCTATCAAAAT
PST01_0059_D12.b : TGGGTCA*TGCATAATTTGTGTCCTGATTTCA*CCAAAGGA*TACTTACACTATCAAAAA
PST01_0039_B10.b : TGGGTCA*TGCATAATTTGTGTCCTGATTTCC*CCAAAGGA*AACTTACACTATCAAAAA
PST01_0077_F09.b : TGGGTCAATGCATAATTTGTGTCCTGATTTCCCCAAAAGGA*TACTTACACTATCAAAAA
LVRM1_0022_H05.b :
OVRT1_0112_C08.b : agcataatttgggtccgattccccaaagggatattcccttacaaaatttccggggcaaaa
ITT01_0066_F05.b : TGGGTCAATGCATAATTTGTGtcctgattncanncaaaggatactacactatcaaaaata
LVR01_0074_A02.b : TGGGTCA*ATGCATAATTTtgtgtcctggatttcacaaaaaggaaacttaacact
PST01_0054_E09.b : TGGGTCA*TGCATAATTTGTGTCCCTGATTCA*CAAAAGGA*TACTTACACTATCAAAAT
KDN01_0033_C01.b : TGNNGTCATGCATAATTTGTGTCCTGATTTCANCCAAAGGA*TACTTACACTATCAAAAA
KDN01_0033_A09.b : TGGGTCAATGCATAATTTGTGTCCTGATTTCACCAAAAGGA*TACTTACACTATCAAAAA
LVRM1_0157_B07.b :
PST01_0086_B08.b : TGGGTCAATGCATAATTTGTGTCCTGATTTCA*CCAAAGGA*TACTTACACTATCAAAAA
20110601C-001812 : TTTCCCTGTCAAAAAAAAAAAAAAAAAAAAAAAAATTTGCCCCAACTTCAGGTCCCGGCC
---------+---------+---------+---------+---------+---------+ 1285
OVRM1_0182_B09.b :
OVR01_0005_B10.b :
TES01_0009_D01.b : ggccctggctcaactgcgtcgggcccctaatatcttgaaaaaacttcccactccccgaac
TES01_0018_B10.b : aaaaaaaaaagactatttgtctcagctcagtttcagcctacttaaaatattataaaaaaa
TES01_0042_B10.b : gcccagggctcgactcggtccgccccttaatatctaaaaaacccccaactccccgaccga
TES01_0030_A09.b : tatttccggtgcacaaaaaaaaaaaaataaaaaagagccatttgtgcctaaccttcggtc
TES01_0038_G06.b : aaaaaaagggcattggtccaactgcgggtcgggccccaaaattttaaaaaaacccccccc
TES01_0106_F04.b : aacgtgggtccggccccaaaattttttaaaaaaacctccccccccccggaaaaaaaaaaa
TES01_0045_A10.b :
OVR01_0020_B10.b : aaaaggggaaaaaaatttttttacacctttatataaaaaaaaaaaaaaaaat
SPL01_0043_D12.b :
OVR01_0025_A11.b :
TES01_0073_E06.b : tgggcgaaaaaaaaaaaaataaaaaaaatctttgttctctttagtgtgcggggcgcccta
TES01_0104_H07.b : cctgtggtcaactgcgggcggcccccaacaatttaaaaaaaccccccccccccgacccaa
OVR01_0052_C08.b :
LVR01_0058_C02.b :
TES01_0076_A03.b : aaaaaaaaaaaggccctgtgtctccactggtggggggggcccccttatatattttaaaaa
TES01_0069_H01.b : aaaaatttctccggtgccaaaaaaaaaaaaaaaaagcgccctgtgtgtctcaaaagcaga
TES01_0043_A01.b : cacttggccgactgcggtccggccctaacattcaaaaaaactcccccccccccgaccgaa
OVR01_0048_G07.b : aatttttccacccacaaaaaaagggggaaaaaatcttttattaacacta
TES01_0109_A11.b : ttcccgcgggcacaaaaataaaaaaaaaaggcccccatggttcctcaccttcgggtcggg
TES01_0024_B03.b : aaaaggccaattggctgaactgcgttccggcccctaactactctaaaaaaacctcccccc
TES01_0110_C07.b : gcaggataattttttttccctttttctccccaagagcatgcttcttctctctataaattc
TES01_0036_H09.b : aaaaggccagtgtgccagattgaggtccggcccttaatattttaaaaaaaaccccccccc
TES01_0061_D07.b : aatatttccgctggaaataaaaaaaaaaaaagagcccttttgtctctatactcgagtggc
TES01_0055_E01.b : tgcagccggcccctaaaaactaaaaaaaaccccaccccctgaccgaaaaaaagaagcatt
CBLT1_0100_B01.b : aaaaaaaaaaaaaaaaaaaaaaaattttggaaagaaccaatcttccctataatccccgtg
TES01_0069_F05.b : tctattgggttgccgctttaatttttaaaaaaaaccccccccccccccgggcaaaaaaat
TES01_0020_D09.b : tcccggtgtataaaaaacaaaaaaagcgccatatttgtctgtctcttaggtcgtgatcta
TES01_0003_G08.b : ttaccttatacaaaatattttcctgttgctcaaaaataataaaaaaaaaaaggcgcctct
SMG01_0072_G10.b : tttttttttccctccgggggggaggggggtcctcgaaaaaaaaaaaaatattatttttct
OVR01_0048_F06.b : caaaaaggaaaaaatatttaaacacattaaattaaaaaaaaaaaaatttttccccctttt
PST01_0028_G03.b : aaaaaaaaaaaaaaggcccatgtgcccactggagtccgggccctaaataacctaaaaaaa
TES01_0036_G05.b : aaaaaataaaaaaagagccctttgtgtcccaatttaggtggcggccctctaatattttta
TES01_0060_A10.b : caaaaaaaaaataaaagaggcctttgttcctcacctgcggtgccggccccctaataaatt
TES01_0088_E12.b : aaccttcacctcttccaaaaaattttctctggggccaaaaaaaaaaaaaaaagaggcccc
TES01_0109_H01.b : aaaatttccggggcaaaaaaaaaaaaaaaaaaggcccattggtgcctcaacctccgggtt
TES01_0006_H02.b : ccaaaattc
TES01_0094_B03.b : cattgggcttaaatgtagggcggcggcctaaaatttttataaaaaaaccccccccacccc
TES01_0091_D09.b : ccctgtgctcactgcagggccggccccaaacttctcaaaaaaacctccccccccccccga
TES01_0002_B06.b : ccaaaaatttttctgtgtcaaaaaaaaaaaaaataatggcccatgtgggttctaatctca
TES01_0080_E03.b : aaaaaaaaaggccctttgttccagttcgggggggcgcgcccctaattttattaaaaaaac
TES01_0098_E01.b : caaaaaaaaaaaaaaagggccatggtgttcaaaccaggggccggggcgcctaaaatattt
TES01_0030_B11.b : cacttctctaaattttccgtggtcaaaaacaaataacaaaataattgggcctcgtgtggc
TES01_0071_F04.b : aaaaaaaaaaataaaggcccctttttttcttttttcttggggcggcgccgccttttattt
TES01_0100_F11.b : aaaaaaaaaaaaggcccagtggtcccaactggaggtcgggccccctaattatttaaaaaa
TES01_0100_H01.b : aaaaaaaaaaaaagggcccagtggtctccacttgcgggggcggcccccctaaatatctta
TES01_0097_H04.b : gggggaaaaaaaaaaaaaaaaaaagggccctttgggctaaatcttggggccgggcccctt
TES01_0014_F06.b : caaaaaaaaaaaaaaggcactgtgtccagcgcaggtccggcccctaaacaatcaaggaaa
TES01_0024_D10.b : tttccacaaaatattccgggtgccaaaaaaaaataaaaaggccccattttgctcaaattg
TES01_0105_B06.b : aaaaaaaaaaaaaaagggcccattgtctcccagcttggggtgcgggccccttaaattttt
TES01_0008_A03.b : TATCCTGTGCaaaaaaaaaaaaaaaaaaaaaggccccatgtgcccaaactgcagtccggg
TES01_0051_G05.b : ttttcaaaaaattttccggggcacaaaaaaacaaaaaaaaaagcgccccttgtgtctccc
TES01_0058_C01.b : aaaggccttgtgcccaccgccggtccgcccctaaatttttagaaaaacctcccactcccc
TES01_0026_H09.b : ATTTCTGTGGAAAAAAAAAAAAAAAAggccactgtgctccactggcggtcccggccccta
TES01_0063_A09.b : aaaaaaaaaaaaaaaagggccatattttttccatactgtgggggtgcggcccataaattt
PTG01_0101_A06.b : aaaaaaaaaaaaaaaaannnttttttttttttgtgtggcggggggccccctcccttttta
ITT01_0032_G06.b : ctggtgtccactgcagtccggccccttaaaatccttcaggggccaggttagctacccgtt
OVR01_0058_D12.b :
TES01_0039_F08.b : aggcccctgtgtctcacctccgttcgggccctaaacatttaagaaaaacccccccccccc
ADR01_0101_H11.b : aaacttggtaaaaaatcaatctcccccttttatccccctgggaaacggggctctttggga
TES01_0072_D11.b : ggggggaaaaaaaaaaaaaaggggccttttttttcttatttgtggggcgggcgccctttt
TES01_0078_C06.b : tcccgggcggaaaaaaaaaaaaaaaaagggcccctgtgttttaatttgagggtgcgccgc
TES01_0072_C03.b : caaatatttcctggggccaaaaaaaaaaaaaagagccctttgtgtctccttcgggggggg
TES01_0090_E10.b : aaaaaaaaaaagggccctttgttcttccttcaggggggcccgcccataatttttttataa
TES01_0098_C06.b : aaaggccccgtgtcctcacttcggtccggccctaaatattcctaaaaaaaccccccactc
TES01_0059_D08.b : aaaaaaaaaaaaaaaaggcccttgtggcccagctgcgggcccggcccctaaatttttcta
TES01_0039_D03.b : aaaaaaaaaagccacttggtccactgtcggcccggcgctaattattaagaaaaactcccc
TES01_0091_F12.b : ggcaaaaaaaaaaaaaaaaaacttttggaaaaaaaaaaaaaaaagggcctgtggtctaac
TES01_0086_E08.b : tccggtgccaaaaaaaaaaaaaaaggccctggtgtctaccttcaggcccggcgcccaaaa
TES01_0016_B02.b : AATCCTGTGCAAAAAAAAAAAAAAAAggcacctgtgctcaaactgcagtcccggcccctt
TES01_0011_A11.b : ATCCCTGGGCAAAAAAAAAAAAAAAAAAggccccttgtcctnagcttgcggtccggcccc
TES01_0049_D11.b : TTTTCCGGTGCAAAAAAAAAAAAAAAAAAgcccatgtgcccaagctgcggtcccggcccc
KDN01_0065_E01.b : TATTCGGTTGCaaaaaaaaaaaaaaaaaaaaaaactttggtaaagaatcaaatcttcctc
TES01_0033_E11.b : ttattccccctctacgtaacctttaatttcatctaataatatctttcgtggttcttcata
TES01_0025_E04.b : aaagtgctctttgatccgatctcaggatctgtcgctaaacttaattgtgaaaaaaattct
TES01_0007_E09.b : gtcctaaaaaaaataataaaggtcctctgtgtctttgtcgtcagggcgggccccttaatc
TES01_0070_C11.b : tttccgggggacaaaaaaaaaaaaaaaaaaaaaaagggccattgttcccaattggggggg
TES01_0059_G09.b : gcccatttgtctcaactcgggtccggcgcccaaaatattaaaaaaaaactcccccccccc
TES01_0018_F11.b : attctgggccaaaaaaaaaaaaatggccccttgtgtccttatcttcgggtcctggctccc
TES01_0083_C04.b : aaaaaggcccatgtgctcactgcaggtccggcgctaaatttcagaaaaaacctccaacct
TES01_0069_D07.b : taaataaaaaaaaaaaaacgcccttttcctcactttttgagttggcgcccctttcttttt
TES01_0006_F12.b : taagggaatctcttttccccttattctcaaaaattattctccggcgggcccaataaaata
TES01_0072_B04.b : aaaaaaggccttgttctacctgggggcgggccccaaatattttaaaaaaacccccccccc
TES01_0076_F02.b : aaaaaaaaaaaaagccctttttttcccctcctggggggcggcgcccctttttttttttta
TCH01_0023_E11.b : aaaaaaaaaaaaaaaagccccatgtctccaatctggggccgcgcctccttaaatacctct
TES01_0061_E09.b : aaaaaaagggccttttgttcattgtttaagtggtggcccgttatatatttataaaaataa
TES01_0046_G10.b : ctttctccttatctcaaaaaattatttcttggggcccaaaaaataaaaatattataatct
TES01_0096_F05.b : gggccaaaaaaaaaaaaaataggccctttgttctcaactctggggcggggccccaaaaat
TES01_0054_C03.b : tgcaaaaaaaaaaaaaaggcccttgtgctccacctgcagtcccggcccctaaatattcta
TES01_0094_B09.b : attttccctggtgcaaaaaaaaaaaaaaaaaaaaagcgccttttttttccatatttagtg
TES01_0003_C11.b : aaaaatttccctggtcaaaaaaaaaaaaaaaaaaaaaagggccctttgtgctcccaactc
TES01_0005_B09.b : aattttccctgggcaaaaaaaaaaaaaaaaaagggccacctggtgcctcaacctgcaagt
PST01_0077_D12.b : ATTCCCGGTCCaaaaaaaaaaaaaaaaaaaagggccatttccccaaactcaggccccggc
PST01_0095_E07.b : ATTCCTGGTGCAAAAAAAAAAAAAAAggcacattgctcaacttcaagtcccgcccctaac
KDN01_0071_A11.b : TTTTCCTNTGCAAAAAAAAAAAAAAAAAggcnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0078_F12.b : gtgttaataaactaaaataaattacctacattttttccatctgtttgttcttagccgcaa
TES01_0066_E10.b : tgaaaaaaaaaaaaaaaggccattgggctcaactgcggtcccgccgctaaacaactaaaa
THY01_0016_B07.b :
TES01_0014_G11.b : gggccaataaaaaaaaaaaaaaaaaaagggcccatttgttctaacctccaggtcctgtgc
UTR01_0102_D12.b :
LNG01_0085_B08.b : aaggcattggcccaactcagtccgccgcttaatatcccgagggccagctacgtcccgttt
ITT01_0049_A02.b : ATTCTGTGCaaaaaaaaaaaaaaaaaaaaaaagccccttgtgcccaactgccgtcccgcc
THY01_0118_B07.b :
TES01_0097_F08.b : aaaaaaaaaaaagggccaagtgttccaactgtcggtgcggccgcctaatatttttaaaaa
SPL01_0104_E06.b : aaaaagggcaactgtgctccagctgcagtcccggcccctctaataatcctcaggggccaa
TES01_0016_G11.b : TTTCCTGGTGCAAAAAAAAAAAAAAAggccctggggctcaacttcaggtcccggccccaa
TES01_0107_G12.b : tccgggggaaaaaaaaaaaaaaaaaggccccctgttttccaaccttcaggtcccggcccc
TES01_0022_E12.b : aatttcctgggtcaaaaaaaaaaaaaaaaaaaggccccatttggcctccaactttcaggt
TES01_0093_H08.b : aaaaatttcctgggcggaaaaaaaaataaaaaggccatcttggtcccaattttctgagtc
SPL01_0001_H02.b :
OVR01_0085_C11.b :
OVR01_0034_G04.b : acacgtatctctttcaccttctcccccaatactctcctccctcgttcgccaactctaaac
LVRM1_0099_C05.b :
OVRM1_0020_H04.b :
OVRM1_0114_D01.b :
SMG01_0048_C10.b : ggcgcgccccttaatatccccgggggccaaattaagcaccctttttgaaaaggggccctt
OVRM1_0116_E11.b :
UTR01_0013_A04.b :
OVR01_0098_B04.b : aaatttccgggggcaaaaaaaaaaaaaaaaagg
THY01_0051_C04.b :
SPL01_0044_D11.b : accttttccctt
OVR01_0059_A05.b :
ADR01_0022_C09.b : aaaaatttggaaaaatccaattctcccttttaacccccgggggaagggggtctttttggg
OVR01_0101_H08.b :
OVR01_0063_E06.b : tttcaaaaatatctccgtgggcaaannnaaaaaanntaaanataataaaaaggggctcca
THY01_0059_F04.b : ccctatccaaaat
SMG01_0035_B11.b : aaaaaaaagggcccatggtctcaattgggggcccgggcctctaaaattcctccgggggcc
MLN01_0041_A05.b : ccatggtcaactcagcccggcccttaaattcctaggggccactaacgaaccctttttgaa
TCH01_0076_C06.b : aaggcccatgggtccaactgcgggggggccccctaaaattccccaggggccaggttccgg
OVR01_0036_E07.b : taccctttttaaaaaaaaattttccccgggggcaaaaaaaaaaaaaaaaaaaaaaaaaaa
MLN01_0084_F02.b : aaaaaaaaaaaaaagcccatggtccaactgcagtccggcccccaaaattcctcaggggcc
TCH01_0076_C09.b : aaaaaaaaaaaaggcccatggcccaactgcggtccgggcctttaaggttcctcgagggcc
SPL01_0075_D05.b :
ITT01_0010_D12.b : Ttattctgtacnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
CLNT1_0031_E05.b : TTTCCTGGGCAAAAAAAAAAAAAAgccccatggcctcactgcaggtccggcccttaacaa
OVRM1_0196_G11.b :
TES01_0027_B02.b : TTCCCGTGCCAAAAAAAAAAAAAAaaaaaggcccatttgcccaacttcgggccggcccct
TES01_0029_H05.b : aatttttcccggtgccaaaacataaaaaaaataaggcacattgggccctaactgccgggt
SMG01_0091_B04.b : ccaacttgggtccgcccccctaaattccctggggggccaattaacggacccttttttgtg
OVR01_0030_D09.b : taaccctttctcaaaaaaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0005_G08.b : atcaaaaaatttttcctggtgccaaacaaaaataaaaataaaaggcccattgtttcccca
TCH01_0059_F07.b : TTTTCCGGTGCCAAAAAAAAAAAAAAAAAAggcccattgggccccaaccttccgggttcg
TES01_0109_E02.b : tccggggtggcaaataaattattaataaataaaaagggccctttggtctctatgtgagtg
PST01_0095_A08.b : TTCCTGTGCAAAAAAAAAAAAAAAGgcccctgtgctcaacctgcagtccggcccttaact
LNG01_0091_C01.b : atgtctcaagtgagctggggcccctaaattccctcggggccaattaactacacctttttg
TES01_0072_B11.b : aaaaaaaaaaaaaaagggccattgtgtcttaccttgggggcccggcccttatatttttta
TES01_0049_D02.b : aaaaaggccctgtgctcaactgcaggtccggccccaaactatctaagaaaaacctccaca
TES01_0016_F05.b : aaaagcccattgctcnactgcagtccggccctaataatcagagaaaacccaaactccctg
TES01_0036_A07.b : TTTTCTGTGCAAAAAAAAAAAAAAAggacctgtggcccagctgccagtcccgccgctaaa
PST01_0037_B08.b : TATCCTGTGCAAAAAANNAAAAAAAAAAgcccaatgtgctccaactgcagtcccggcgct
TES01_0067_A03.b : tgcaaaaaaaaaaaaaggccattgtgccaaacgcaggtccggcccctaaatattctaaaa
TES01_0024_F06.b : aaaaaaaaaaaaagccccttggtgccaactgccggtcccgcctctaaaatttctaaaaaa
TES01_0045_C04.b : aaatttcctgggcaaaaaaaaaaaaaaaaaaaaaaactttgttaaaaaatccaaatccct
TES01_0038_D11.b : AATCCGGGCAAAAAAAAAAAAAAAAacttgtaaaggatccaatcctccctttaatccccc
PTG01_0087_C04.b : ggcccctgttgtccaactcggagcggggccccttaaaattcctcgggggggccaatttag
OVR01_0041_A02.b : attcaaaaaattttctctgttgcaaaaaaaaaaaaaaaaaaaaaaaggcccccctgtggg
OVR01_0005_A01.b : cccctattcccaaaaaaatttccctttttcgcaaaaaaaaaaaaaaaaaaaaaaaaaggc
TES01_0031_F08.b : ggaaaaaaaaaaaaaaaaaggcccatttggtcccctatttatgggtacgcccccctataa
TES01_0018_A09.b : tgtgtcataaaaataaagaatatatattcccttaaaaattccatatctctcctcaaaaag
TES01_0095_D02.b : aatttttccgggcaaaaaaaaaaaaaaaaaaaaaagagccccatgttcctcaaagctgtg
PST01_0060_E11.b : TATTCCTGTGCcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0100_F10.b : TTTCCTGGTCAAAAAAAAAAAAAAAAAggccccattgtcccaaactgcaggttcggcccc
TES01_0029_F01.b : attttcctggtggccaaaaaaaaaaaaaaaggccactttttgcttcannnnnnnnnnnnn
TES01_0109_G01.b : ttttcgtggtaaaaaaaaaaaaaaaaaaaagccccctttgttctccaacttggagggtcc
TES01_0105_G12.b : aaaatattcctgggcccccnnaaaaatataaaataaaaggggccctttgtgtctcaaatt
SMG01_0022_H05.b : aaaaattttgaaaaaaaccaactctctccttaaatacccccgcgggaaagagggcctttc
TES01_0045_D09.b : aagattttccccctatccacataatattcccggttgccaaaaaattaaataatatattaa
PST01_0037_G06.b : TTCCTGTGCaaaaaaaaaaaaaaaaaaaagggccaatgggctcaaactgcaggtcccggc
TES01_0011_H10.b : ATTCCCGTGCAAAAAAAAAAAAAAAAAGGCGCCCATTTGCCCCAACTTCAGGTCCCGGCC
OVR01_0070_A07.b : ccccaaaggggaatacctttccccctttttccaaaaaatatttcctctgggggtcaacaa
SKNB1_0064_E09.b : ATTCCTGTGCnnnnanaaannnnnnnnnnaaanaaaggccccagtgctccacctgcaggt
TES01_0014_D01.b : ATCCCTGTGCAAAAAAAAAAAAAAAAAnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0087_G02.b : TATTCCTGTGCANNNNAAAANNNNNAAANAAAAaaaaaagggcccctgtgcctaacctgc
SMG01_0042_C06.b : aaaaaaaaaacttttaaaaaaaccaaatctctctccttaaatccccccgggaaaacgggg
TES01_0074_G04.b : ttttcttctcctactcataaatttctatcttgtcaacaaaatatataaataatgtggcct
PST01_0097_G12.b : TATCCTGTGCAAAAAAAAAAAAAAAAAAnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0100_F02.b : tcccccaaaaaattatttgggtgggggaaaaaaaaaaaaaaaaaaaaaaatttttgtttt
LVRM1_0033_F06.b :
OVRM1_0182_A05.b :
LVRM1_0140_G12.b :
UTR01_0011_C01.b :
OVR01_0102_E07.b : tcaaaaaatttttcctgtgtgcaaaaaaaaaaaaaaaaaaaaaaaggggccacattgtgc
OVR01_0096_C02.b : aaaattttttccggggcaaaaaaaaaa
LVR01_0044_H06.b : aaaaaatatttcctggtgcaaaaaaaaaaaaaaaaaaaaaaaaagggcccccattggtgc
SPL01_0098_H05.b : attttcccgggccaaaaaaaaaaaaaaaaagggcccaatggggcccgagcttccggtt
LVR01_0052_B04.b : aaaatatttcc
ITT01_0101_B05.b : ATCCTGTGCAAAAAAAAAAAAAAAAggcccctgtgctcaacctcaggtccggccctctaa
TCH01_0017_D05.b : ATTCTGTGCAAAAAAAAAAAAAAAAggcactgtgctcaactgcaggtccggcccttctaa
OVR01_0085_D03.b : ATCCTGTGCAAAAAAAAAAAAAAAAAAActttggaaagaattcaatccccctccttaagt
PST01_0049_B09.b : TATCTGTGCaaaaaaaaaaaaaaaaaaaaaagcacatgtgctcaactgcagtcgcggccg
PST01_0021_B11.b : TATTCCTGTGCAAAAAAAAAAAAAAAAAAAnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0057_B10.b : ATTCTGTGCAAAAAAAAAAAAAAAgggcacatgtgctcaactgcaggtgcggccgctaaa
PST01_0041_E05.b : ATCCTGTGCAAAAAAAAAAAAAAAGcccatgtgctcaactgaggtcccggcgctaaataa
KDN01_0058_E02.b : TATTCTTGTGCaaaaaaaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0010_B12.b : TATTCCTGTGCaaaaaaaaaaaaaaaaaaaaaaaagcccaatgtgctcaaactgccggtc
SKNB1_0065_H11.b : ATTCCCGTGCaaaaaaaaaaaaaaaaaaaagcacatgtgctccaactgcaggtcgggccc
TCH01_0092_E03.b : ATTCCTGTGCaaaaaaaaaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0059_D12.b : TATTCTTGTGCnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0039_B10.b : TATCCTGTGCAAAAAAAAAAAAAAAAAAAgccacatgtgctcaaacttcggtcccggccg
PST01_0077_F09.b : TATCCCTGTGGCaaaaaaaaaaaaaaaaaaaaggccacctgtgctccaactgcaggtccc
LVRM1_0022_H05.b :
OVRT1_0112_C08.b : aaaaaaaaaaaaaaggcacttggcccaactgaggtccggcccaaaaaattcaaaaaaaac
ITT01_0066_F05.b : tcctgtgcaaaaaaaaaaaaaaaaaaactttgtaaaagatccaatctctctccataagtc
LVR01_0074_A02.b :
PST01_0054_E09.b : ATTCTTGGTGCaaaaaaaaaaaaaaaaaaaacttggtaaaaattcaatctctctctatta
KDN01_0033_C01.b : TATTCCTGTGCaaaaaaaaaaaaaaaaaaaaaaggxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0033_A09.b : TATTCCTGTGCaaaaaaaaaaaaaaaaaaaaaagxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_B07.b :
PST01_0086_B08.b : TATTCCTGGTGCAAAAAAAAAAAAAAAxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-001812 : CCCTAACTAATCTAAAAAAAAACCCCCCCCACCCCCCCCGAAC.................
---------+---------+---------+---------+---------+---------+ 1328
OVRM1_0182_B09.b :
OVR01_0005_B10.b :
TES01_0009_D01.b : cgaaaaaaagaagcaatgtggtgcactgttttccccttaaggtacaaaaac
TES01_0018_B10.b : acctccaccctccccgtgacctataaataaagaaggactattttggttacttgtatgcgc
TES01_0042_B10.b : acaaagaggcattttgtgtacggtttgcccttaagtccaaaacaaccccctttcaaaa
TES01_0030_A09.b : tcgggcgcctaaatatttcttagaaaaaaacccccccccccccccggaacaaagaaaaat
TES01_0038_G06.b : ccccccgaccggaaaaaaaaaagaaaggggtgtatatgtttttcgccttaagggaaaaaa
TES01_0106_F04.b : aagaagcattgttgttaacttttttcgccccaataggtacaaaan
TES01_0045_A10.b :
OVR01_0020_B10.b :
SPL01_0043_D12.b :
OVR01_0025_A11.b :
TES01_0073_E06.b : ttatttttataaaaaacacccccccccctctccgaaaaaaaaaaaaaaagaacggggggt
TES01_0104_H07.b : caaaaaaaagaatgggggttaatttttttcccctaagggacaaaaa
OVR01_0052_C08.b :
LVR01_0058_C02.b :
TES01_0076_A03.b : aaaacccccccccccccccccgacgagaaaaaaaagagggagattgtttgttttt
TES01_0069_H01.b : gggcggcgcgccctctttattattttttaaaaaaaacctccccccccacccc
TES01_0043_A01.b : aaaaaagagcatgttttgtaatttttg
OVR01_0048_G07.b :
TES01_0109_A11.b : ggcccccttatatatttttataaaaaaaccccc
TES01_0024_B03.b : tccccggaccgaaaataaagaagcgatttggtgtaacttggtatgccccttatgggtcaa
TES01_0110_C07.b : tcgtggtcaaaataaaaataataatcgggctcctttttttcttacaatactgctccgtcc
TES01_0036_H09.b : cccccgaacggaaaaaaaagaaggaattggggtgtactgtttttggccccaaggggttta
TES01_0061_D07.b : gccgcgcctatttatattcagaaaaaaaatcctcccccctcccccggcgacgggaaaaaa
TES01_0055_E01.b : tgtggacctgtttgcccctagggtcaaaaagaaacccccattccaaaaactttttccgct
CBLT1_0100_B01.b : gaaagcgcgccttttggggagtttggtttcttcttctcccggggagaaggggtgggcccc
TES01_0069_F05.b : aaatatagtagtgtttgttttctttcttatcattttgtataaattaaacaacccttctct
TES01_0020_D09.b : tataattattgtaaaaataaactccccctcctccccggtactgaaaacaatattatctct
TES01_0003_G08.b : gtgtcctccgatattcatatgtttcggg
SMG01_0072_G10.b : tcgcgcaaaaaaaaaaaagtgtgtggggggggcgcttttaattgggggacaccctttttg
OVR01_0048_F06.b : ggggtgcaacaaaaaaaaaaaaaaaaa
PST01_0028_G03.b : ctccccacctccctgaaccgaacaaaagaaggatttggggtgaactgttttggccctaag
TES01_0036_G05.b : aaaaaaaaactccccacctcccctcggaatggaaaaataaaaagaggaagtggtgtgtaa
TES01_0060_A10.b : tataagaaaacacccccccctcccccctcgcctgaaaaaaaaaagaggggcatgtgtggt
TES01_0088_E12.b : ctgtgtcctcccaacctgcgggggccct
TES01_0109_H01.b : cgcgcccccttaaa
TES01_0006_H02.b :
TES01_0094_B03.b : ccgcaagcgagaaaaaaaagaggaaagttggggtataatttttttggccctttagtggtc
TES01_0091_D09.b : acggaaaaaaaagaagcatggtgttggtactgttttggcctttaggggtcaaaaaaaaac
TES01_0002_B06.b : aggtccgcgcccctttaaattattcttaagaaaaaacctcccccccc
TES01_0080_E03.b : ccccccccccccccgaaagaaaaaaaagaagaaaatggtgtgttttcttgtttttgcccc
TES01_0098_E01.b : aagaaaaaaacccccccccccccccgagccggaaacaaaaagagggaagtgggggggaaa
TES01_0030_B11.b : tctacatttagtgttcggcccccatataatctctatagaaaaaccttcctccactctcct
TES01_0071_F04.b : ttttaaaaaaaacaccccccccccccccccacaaaagaaaaaaaaaaagaaaggtgtggt
TES01_0100_F11.b : aaacctcccccctcccccgaaccgaaaaaaaaaagaggcaatggttttgttatctgtttt
TES01_0100_H01.b : taaaaaaaaacttccccaccccccccgcgaacacgaaaaaa
TES01_0097_H04.b : aaatttctttaaaaaaaacctccccccccccccggaaccgggaaaaaaagaagaaggcct
TES01_0014_F06.b : acccccacttccccggaccgaactaaagaaagcattggggtgtactggttttggccctta
TES01_0024_D10.b : cgggtgccgggccccttaaaatttttataaaaaaaaacctccccaccctccccccgaacc
TES01_0105_B06.b : ataaaaaaaaccccccccccttcccctaaaggaaaaaaaaaaagagggcgttggttgttg
TES01_0008_A03.b : ccctaacctatcagaaaaaacctcccaccccccccgaccggaaaaaaaaggaaggaagtg
TES01_0051_G05.b : tccgaggatcccgccccctctgaaaaatttttaaaaaaaaacactcccctctcccccccc
TES01_0058_C01.b : cgaccggaaaaaaagaaggcaatgggtgttacttttttggcccttaaggtccaaaagcaa
TES01_0026_H09.b : actatcttaaaaaaaaactcccaccctcccccgaaccggaacaaaaaggaaggcatgggg
TES01_0063_A09.b : ctttgaaaaaaaacctctccctcctccccgaagagaggaaaaaaaagaagatggctctgt
PTG01_0101_A06.b : tttatattttggggggggggggggagggaacacccacccccctcttctcttttttttttt
ITT01_0032_G06.b : tttgtaaagggcccctagggggctattaacagggcgggccggctttaacccggagggaaa
OVR01_0058_D12.b :
TES01_0039_F08.b : cgacacgaaataaaaaagcccttgtggtttactgttttccccctaaggggacaaaagcca
ADR01_0101_H11.b : gggttttggatttttctattcccggggggaaaggtagt
TES01_0072_D11.b : ttttttattaaaaaaaaacccccccccccccgccggggaggaaaaaaaaagaaagagaca
TES01_0078_C06.b : ccttattattttcttataaataaccccccccctctccccagaaaaaaaaaataaaaaaaa
TES01_0072_C03.b : gggcccctatattttttataaaaaaaaaccccccccctcccccgccaagaaaaaaaaaaa
TES01_0090_E10.b : aaaacccttccccccccccccggactgagaaaaaaagagggcacaggtgggttattcttt
TES01_0098_C06.b : cccggaccgaaacaaaaggaaggcatgggttgtaactgtttttggcccttaaggtacaaa
TES01_0059_D08.b : aaaaaaacccccccaccccccccgggaccgaaaataagggaaggattttgtgggttaacg
TES01_0039_D03.b : cctcccccgaccgaaaaaaaaaaaggaatggggtgtcattgtttggcccttagggtcaaa
TES01_0091_F12.b : ttgggggcggggcctaacaattttgagaaaaaccccccacctcccccggaccgggaaata
TES01_0086_E08.b : tatttctaagaaaaacccccccccctccccccggaaccggaaaaaaaaggaaggcgattt
TES01_0016_B02.b : actagcttaagaaaaaccttccaaccttccccgaacccgaaactaaaatgatgcattggt
TES01_0011_A11.b : taactattctaaaaaaaaccccccaccctccccggaacctgaacctaaaggaaggccttg
TES01_0049_D11.b : taaactattgaagaaaaaactccccccttccccggaactggaacttaatgaatgt
KDN01_0065_E01.b : cattagtcccccctggaaaacgctgctctttcgggaaagctttgtggattcctctattct
TES01_0033_E11.b : atttatatttctcctctttgttttccttctttaatgatgtgatggggcttaaatatattc
TES01_0025_E04.b : cactttcccctgatttgaatttaatataaggtcattgttgcggttctttcttctttgccc
TES01_0007_E09.b : atttttaataaataactttctctcccccctcggaacgttaatatataatgatgccattgt
TES01_0070_C11.b : gggcgcccccaatttattttatataaaaacccccccccccccccggggaagaaaaaaaaa
TES01_0059_G09.b : ccggacctaaaaaaaatgaaagcatttggttgtaactttatttggcctatgggggtccaa
TES01_0018_F11.b : ttatattcttctgaaataaaacttccacactctccccttgatctgttattctataagaaa
TES01_0083_C04.b : ccccgaacggaaataaaagaagcaatggggggtttactgttttggccttaagggttcaaa
TES01_0069_D07.b : ttaataaaacccctccctcccccccccatctcatcataaataaagtgcattgtgtgttat
TES01_0006_F12.b : aaa
TES01_0072_B04.b : ccccgaacgggaaaaaagaaggccttgggttttatttttttgcccttaaggggacaaaaa
TES01_0076_F02.b : aaaaaaaaaccccccccccccccccagaaggagaaaaaaaaaagaagagaagtgtgtggt
TCH01_0023_E11.b : aggggccaagctaaccgtaccccttttttggagaaggggccccaaagggggctaataaac
TES01_0061_E09.b : ctcccaacctccccttgacataaataattaaaaggcttttttttgaatcgttttatgccg
TES01_0046_G10.b : ttg
TES01_0096_F05.b : tttaaaaaaaaacccccaccctcccccgtgacttaaaataaaagagagcattgtttgttt
TES01_0054_C03.b : aaaaaaaaccccccccctcccccggacctgaaaaaaaaataaggcattgttgtttaatct
TES01_0094_B09.b : gtctggccccatatatatttttaataaaaacatcccccccctcccccgcggactgaaata
TES01_0003_C11.b : tcaggttccgcgccctcttaaatattta
TES01_0005_B09.b : tcccgggcccctaaaacaaatccaaaaaaaaaaacctcccacccc
PST01_0077_D12.b : ccctaaaatattctaaaaaaaaccccccaccctcccccgaaacggaaaaaaaaagaagag
PST01_0095_E07.b : tatctaaaaaaaacctcccaacctccccgaacggaaataaagaatgcatgtgttttactt
KDN01_0071_A11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0078_F12.b : ataacttgatatatataaactccaacaactttctcctcattagtgatacaattattaaat
TES01_0066_E10.b : aaaaccttcccccctccctgaactgaaataaaggaggcatgttgtgttaatgttatggcg
THY01_0016_B07.b :
TES01_0014_G11.b : cccttaacttattttcaaaaaaaacccctcccacctccccctggaccggaaacttaaacg
UTR01_0102_D12.b :
LNG01_0085_B08.b : tttaaagggccctaaggggaattaacaggcggcctttttacccgatgaaacccattggct
ITT01_0049_A02.b : cccctaaggttccttcaggggcaagttaaccgtaccagctttttgtaaaaggggcctata
THY01_0118_B07.b :
TES01_0097_F08.b : aaaaaccccccccccccccggaccggaaaaaaaggaaggggcgggggggtgttactgttt
SPL01_0104_E06.b : cttaccgtacccgctt
TES01_0016_G11.b : actttcttaaagaaaacctccaacctccccctgaactgaaaataaatgaaagcaatggtg
TES01_0107_G12.b : ataactaacttaaaaaaaaacccccccaccccccccggaacgggaaacaaaaaggaaagc
TES01_0022_E12.b : ccggccccccaaaaatattttataaaaaaaaacccccccaccctcccccggaacctgaaa
TES01_0093_H08.b : cgtcgtccctctaaatttgttaataaaaataaccctcccccctcccccccgtgagctgaa
SPL01_0001_H02.b :
OVR01_0085_C11.b :
OVR01_0034_G04.b : aataaaacat
LVRM1_0099_C05.b :
OVRM1_0020_H04.b :
OVRM1_0114_D01.b :
SMG01_0048_C10.b : ggggcattaaaaaggggcggggcttttaaacacgggggaaaaacctttgtttttttgaaa
OVRM1_0116_E11.b :
UTR01_0013_A04.b :
OVR01_0098_B04.b :
THY01_0051_C04.b :
SPL01_0044_D11.b :
OVR01_0059_A05.b :
ADR01_0022_C09.b : ggttttggatttcctcttcccccggggaaaaggggggttcctgtggctaaaaccagaaga
OVR01_0101_H08.b :
OVR01_0063_E06.b : tggggcctcaacg
THY01_0059_F04.b :
SMG01_0035_B11.b : acattaagggacccgttttttgaaaaaggggcccaaaggggctattaaaaaaggggcggg
MLN01_0041_A05.b : agggccccaagagcaataacaggacggcgcctttaacccgcggaaactcattggttttga
TCH01_0076_C06.b : acccactttttgtaaagagggcccaaggaagctt
OVR01_0036_E07.b : aaaaaaaaaaagggggccccacccttgggggggcccttctcccaagaagctgtttggctc
MLN01_0084_F02.b : agcttacgacccactttttgaaaagggcccttaggggctattaagc
TCH01_0076_C09.b : cagttaccgtaccctttctggaaaa
SPL01_0075_D05.b :
ITT01_0010_D12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
CLNT1_0031_E05.b : cttaaagaaaaacctcccaacccccccggaaccgaacaaaaggaaggcattgtggttgta
OVRM1_0196_G11.b :
TES01_0027_B02.b : aaaaatctaaaaaaaaacctccaccccccccggaaccgaaaaaaaaaaaagcattgtttg
TES01_0029_H05.b : ccggcccccttaaatatttttaaaaaaaaacctccccaccctctcccctgatcttgaaaa
SMG01_0091_B04.b : aagggcccctagggggttttaactggggcgggcgcttttaaccctgtgggaaaaggcttt
OVR01_0030_D09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0005_G08.b : accttcagggtcgcgggccccctaaaattatttcgagaaaaaaaaactctcctaaactcc
TCH01_0059_F07.b : ggccctcttagaatacccctcgggggggccaagcttagccttc
TES01_0109_E02.b : gggtgggccccaataaatttttaaagaaaaaaacctccctccacccccctcgataggtgg
PST01_0095_A08.b : attcaaaaaaaaacctcccacctcccttgaactgaaaaaaaagaaggcattgttgtttta
LNG01_0091_C01.b : taaaggtcctaaagtagcgataaacgagcctggcctttttaacccgccgggaacgcaatg
TES01_0072_B11.b : aaaaaaaacccccccccccccccgcggaggctaaaaaaaaaaggaggccactggttggtt
TES01_0049_D02.b : ctcccctgaacctaaaataaaagaagcgattgtggtgttacttgtttatggacccataag
TES01_0016_F05.b : actgaactaaagaggcatgtggtgtactgttttgggctaaaggtcaaaaacaagcctcca
TES01_0036_A07.b : tagtctaaaaaaaaacttcccacctcccccgaactgaaactaaaggaggcaattgttttg
PST01_0037_B08.b : aaactatctaaagaaaaacctccacaccttccctgaacctgaacaaaaaggatgaatgtt
TES01_0067_A03.b : aaaacttccaacctccccggaaacgaaaaaaaataaaggaatgttttttttacttgtttt
TES01_0024_F06.b : aacccccccccccccccgaaccggaaaaaaaagaaagcgattggtggttaaacttttttt
TES01_0045_C04.b : cctcttttaaaaccccccctgtgaaaaaggggtgccttttctttgtaaagcctttggggg
TES01_0038_D11.b : ctggaaaggcgccccttcgtgaaggcttgggattctccttttcccggggggaaagggagg
PTG01_0087_C04.b : gcgaccctttttttgaaaagggggcccaaggggggcgttaaaaaaggggggggggccttt
OVR01_0041_A02.b : ctt
OVR01_0005_A01.b : ccccccctttttctcccccacaccctttcccctccgtttcccccgcccccccct
TES01_0031_F08.b : ttttctataaaaataatatcctacaccctcccttgaaactgaaaattaaaaaaaaagaca
TES01_0018_A09.b : ttccactcgggaaataagttccccaaccgtagagagactttgttgattttttcctaatct
TES01_0095_D02.b : gggccgcgcccctaataaaattttagaaaaaaaaaccccccaccctccccccgaaaccgg
PST01_0060_E11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0100_F10.b : tctaaaatttccttcagggggccaagtttaccttaaccagtttttgtgtaaagggggccc
TES01_0029_F01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0109_G01.b : ggggccccataaacaatttttaataagaaaaaaatctccaaaaactcctcccggtgaaat
TES01_0105_G12.b : tgcaggtcccggccccctaaatatattttataaaaaaaactccccaccccctccccctga
SMG01_0022_H05.b : tggaggagtttttgtgtttttttttttcctccgggggggaggaggggtgtcccccagaaa
TES01_0045_D09.b : attgggcccattttgtgtctttaactctcagagtttccgcgccccctatataatatttct
PST01_0037_G06.b : ccttaactaatctaaaaaaaaactcccaacctcccctgaactgaaactaaaatgagtgca
TES01_0011_H10.b : CCCTAACTAATCTAAAAAAAAACCCCCCCCACCCCCCCCGAACcggaaaaataaaagaat
OVR01_0070_A07.b : aaggaaaatantaatataacacatacacagaaacacccctctcttgtggtaaaaagaaca
SKNB1_0064_E09.b : cccggcccctaaacaatctagaaaaaaaactccccaactcccctggaactgaacactaaa
TES01_0014_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0087_G02.b : aagtcccgccgcctaaatattctaaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0042_C06.b : cccttttgagaggtttttggtttttttttttcccgggggggaaagggagggtctcctggg
TES01_0074_G04.b : cttttgcttctatccacatatgtatcgtacgccttttaatcattattatcataaaataat
PST01_0097_G12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0100_F02.b : ttttttttttgtgggggcgcccccccctccttaatatatttgcgggggggggggggagaa
LVRM1_0033_F06.b :
OVRM1_0182_A05.b :
LVRM1_0140_G12.b :
UTR01_0011_C01.b :
OVR01_0102_E07.b : ttctcaactctccagggtcccgcg
OVR01_0096_C02.b :
LVR01_0044_H06.b : cttccaaccctttcggggtcccccgggcccccctcctctaaaaaatttttcccccctccc
SPL01_0098_H05.b :
LVR01_0052_B04.b :
ITT01_0101_B05.b : atattcctcaggggcccagcttaccgaacccgctttctggaaagggggtccctaaaggag
TCH01_0017_D05.b : gtatccctcaagggccaagcttagcgaccaccttcttgaaaaagggccctataagggtcg
OVR01_0085_D03.b : cccccctgggaaacgggcctctcttggaggctttggaattcttcattatcccgggaggga
PST01_0049_B09.b : ctaatatctaaaaaaaactccacactcccctgaactgaaactaatgatgcattgtgtgta
PST01_0021_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0057_B10.b : tagtctgagaaaaacctcaacactccccctaacctgacataaatgaatgcatgttgtgnt
PST01_0041_E05.b : tctaaaaaaaactccaaacttcccctgactgaaaaaaaatgatggattgtgtggtaattg
KDN01_0058_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0010_B12.b : cggcccctataaaaatctaaaaaaaaaaccccccacccttcccctgaactgaaactaaaa
SKNB1_0065_H11.b : ctaaacaattccaaaaaaaaacctccaaccttcccctgaaccgaaacaaaaagaaggcat
TCH01_0092_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgaacaagggtcccc
PST01_0059_D12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0039_B10.b : cttaataaccaaaaaaaaaactccacacctcccctgaaactgaaaaaaaaggaatgcatt
PST01_0077_F09.b : ggccgctaaactatcaaaaaaaaaccctccaaactcccctggactgaaactaaaagaatg
LVRM1_0022_H05.b :
OVRT1_0112_C08.b : cccaaccccccggaactgaaacaaaaaaggcattgttgttactttttatgccttaagggt
ITT01_0066_F05.b : gcactgggaaacgctgctcatctgggaagctttgtgattcttctatattcccggagggaa
LVR01_0074_A02.b :
PST01_0054_E09.b : atcccctgggaaacgctgctcatcggtaaggctttgggattctctattatccaggaggaa
KDN01_0033_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0033_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_B07.b :
PST01_0086_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-001812 : ............................................................
---------+---------+---------+---------+---------+---------+ 1328
OVRM1_0182_B09.b :
OVR01_0005_B10.b :
TES01_0009_D01.b :
TES01_0018_B10.b : gactaatgtgctaaataaga
TES01_0042_B10.b :
TES01_0030_A09.b : aaaaaaagtaatgtgttttgttaactttttattgcccctatattggta
TES01_0038_G06.b : aaaaccccattccaaaaaattttctgtcctctggggtgccccaaact
TES01_0106_F04.b :
TES01_0045_A10.b :
OVR01_0020_B10.b :
SPL01_0043_D12.b :
OVR01_0025_A11.b :
TES01_0073_E06.b : gttattatgttttgcgccccgggggagaaaaaaaaacacctctctccaccaacaaatttc
TES01_0104_H07.b :
OVR01_0052_C08.b :
LVR01_0058_C02.b :
TES01_0076_A03.b :
TES01_0069_H01.b :
TES01_0043_A01.b :
OVR01_0048_G07.b :
TES01_0109_A11.b :
TES01_0024_B03.b : atagcaaacccccaatttcaaaaagcatttttccgcgttcagtgggtgtgccacccaa
TES01_0110_C07.b : tcatttatactctagataatatatttctcatgtgtccctcgtaggttgaatataatatag
TES01_0036_H09.b : taaacat
TES01_0061_D07.b : attggaggcgggtgtgttggggtaaatctattatgccgcctatcaaggtgactacagaaa
TES01_0055_E01.b : ttgggggttcaacacaagactt
CBLT1_0100_B01.b : aggggacaaatccagagaatttcttttaccgcgcccnaaagaaagaacaagagaataaaa
TES01_0069_F05.b : aactaactttctttttcctctttgtgtggtccactag
TES01_0020_D09.b : atttggcatttcatgtgtattggctgctaagggtgtctattaancatcatcctcaattct
TES01_0003_G08.b :
SMG01_0072_G10.b : ggggat
OVR01_0048_F06.b :
PST01_0028_G03.b : gtgcaaaagcaaaacctcaatccacaaaaactttttcggcctaggtgggtgcacaccaag
TES01_0036_G05.b : cactgttttgcccttaaagggtgccaaaagacaaacctcacaatttcactaaaatgtttt
TES01_0060_A10.b : tcaacctgtttctgtgcctttaagggttacaaaaacaccaccccccaatttttcaaaaga
TES01_0088_E12.b :
TES01_0109_H01.b :
TES01_0006_H02.b :
TES01_0094_B03.b : acaaagaacatctccccatt
TES01_0091_D09.b : ccccaatttcaaaaaacttttttcgcgctccgtggggggcaccccaagaattatggtggt
TES01_0002_B06.b :
TES01_0080_E03.b : ctgtgggcaaaaaaaaacacccctcctttctcaaaaaagtttttcgtcgcccaggtgggg
TES01_0098_E01.b : acgtttatgg
TES01_0030_B11.b : ctgttctcgtacataaaagggatggcttggtgtgttatttttgctattagcatcttcatc
TES01_0071_F04.b : gtctcatttttttgccccccgtggggggaaaaataacaacccccccctctttacacaaat
TES01_0100_F11.b : tggccccttaggggtcaaaaaaaaaaaacccccccattttcaat
TES01_0100_H01.b :
TES01_0097_H04.b : gtgtgggtttacctgtgttatgga
TES01_0014_F06.b : gggtccaaaaccaagccccaatttcaaaaagctttttccgccttccgttgtgtggcaccc
TES01_0024_D10.b : ggaaaataaaaaaaaaggaaatggttgttgttaatctgtgttttcgcgcctttagggggt
TES01_0105_B06.b : acacttgttttgcgcctaatggggatcaaagagagaagtcccccaatttttctaaaaagt
TES01_0008_A03.b : tgtttgtacttgttttggccctttaggggtacaaaagccaaccccccatttctaaaaagc
TES01_0051_G05.b : atgaccctgaaaaataaatgagagggcaatttgtgtttttcatcatgtattttgtccacc
TES01_0058_C01.b : cccccaatttccaaaagcttttcccggactcagggggtccccccccagggaattatgtgg
TES01_0026_H09.b : tggttaatggttatggcccctaaagggtccaaaaagcaaaacctcccattttcaaaataa
TES01_0063_A09.b : gtgtttaaaactctgttttcgcaccaataagtgctccaaaaacaactatacttcctctat
PTG01_0101_A06.b : ttggggggggcgccaccaaaaaaat
ITT01_0032_G06.b : agccacctggttttttgagaacttcttcggggggcaatgggaaccccccgagtagccccg
OVR01_0058_D12.b :
TES01_0039_F08.b : gcctccctttcaacaagctttttccgcctctttgtggtgtgcccccataggtctttctgg
ADR01_0101_H11.b :
TES01_0072_D11.b : gtgtggttgttatcttttttgtgtccctcggggggtataaaaaaaaaatccccccccttc
TES01_0078_C06.b : ggaaatggtgggatacaatttttgttcccctatggggtcacaaaagaataagcctcacca
TES01_0072_C03.b : gagagacggggggtgtgaaaatttgtgtcgccctctttggggccaaaaaaacaccccccc
TES01_0090_E10.b : ttctctcgccctatagggtccaaaaaaaaagagtctccttaatttcaaaaaaactttttt
TES01_0098_C06.b : tagcaaagctccaatttccaaaagacctttttccgccctcaaggggggtgcaaacccaag
TES01_0059_D08.b : tttttggcccctaaggggtacaaaaaacgaaaccccccattttccaaaaggctttttttc
TES01_0039_D03.b : aacaaacccccatttcaaaaagtttttccgcccctttgggtgggaccaaaggtttattgg
TES01_0091_F12.b : agataggg
TES01_0086_E08.b : ggggtgtaaactggttttt
TES01_0016_B02.b : gttgtacctgttttggcgccttaaggttccataaagcatacccccaatttcccaaaaggc
TES01_0011_A11.b : gtggttttacttggtttttggccctttaaaggttccaataagcaatacttcccaatttcc
TES01_0049_D11.b :
KDN01_0065_E01.b : cccgggagaaaatgaatggttcccaggggcctaaactcaagaggaataaagttcttttct
TES01_0033_E11.b : tgtaagaaaaaaatattctttactcccctctatgatcagttaatttataatgaaggcatg
TES01_0025_E04.b : atatagggaccaattttcaaatccgtctatttccagagaaatttttattcttacttattt
TES01_0007_E09.b : gtattgaacttgtttattccccttctttggctaaaattgccaattcaccctatttctcta
TES01_0070_C11.b : aaaaaaaggagtgtgtgttatttgttttggccctcttgggggcaaaaaaaggaagccccc
TES01_0059_G09.b : aaggaaatcccccaattttcaaaaaacttttttccgcccccctgtggggggcaacccccc
TES01_0018_F11.b : gcccttgtgtggtcaatccggtaaatgccccataatggtgtctcactaacgctatttctc
TES01_0083_C04.b : aagaaagactccaattcccaaaaggttttttccgggtccaaggggg
TES01_0069_D07.b : actttctctgccatcttagtggcacaacaaatatgcccctctcctttcctagtctgtttt
TES01_0006_F12.b :
TES01_0072_B04.b : aaaaccccaattccaaaagtttttttcgcctctggtggggccacccagttttttatgggg
TES01_0076_F02.b : tggttttttttttcgccccccctgggggccacaaaaaaaaaacctcccc
TCH01_0023_E11.b : gcggcccggccgccttttaaaccccggacaggaaaacc
TES01_0061_E09.b : cttatcggtctaaattatgacttctcctatctttcaaaacaatttttaccctccattgcg
TES01_0046_G10.b :
TES01_0096_F05.b : actgtttttttgcctctaagggtcccaaaaaaaatactcctcattttcaaaaaagcattt
TES01_0054_C03.b : gtttatgccccttaagggctcacaaaccaatgccctccaatttcaaataaagctttcttt
TES01_0094_B09.b : aaagaagagaaccttgtgtgtatactttgttttgtgccccttaatgtgttaatataaaga
TES01_0003_C11.b :
TES01_0005_B09.b :
PST01_0077_D12.b : ccatgttgttgttaactttttttgccgctttaatgggtacaaataaacaataccctccaa
PST01_0095_E07.b : gttatggcctaaaagggtacaaaaccaaaccccctttccaaaaactttttccgcatcaaa
KDN01_0071_A11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0078_F12.b : ccctataattgttactcatagtttatagccctcctatatagtcacgtaagagcactctgt
TES01_0066_E10.b : ctaaagggtaacatagcatacccccatttcacaaaactttttccggctctgtgggttggc
THY01_0016_B07.b :
TES01_0014_G11.b : gaaggccccgtttgttggaacctgtatatttcccctctaaatggtgacaacaagactata
UTR01_0102_D12.b :
LNG01_0085_B08.b : taagacctttcggggatttgaacccccagtaaccggaaaattttgtagggaacccccccg
ITT01_0049_A02.b : aggagccaattaaccagggccggccgtccttttaaacccggacgggaaacgctatctgga
THY01_0118_B07.b :
TES01_0097_F08.b : ttggggccctaagggggcaaaaaaaaaaaactccccatttctaataaaagttttttccgt
SPL01_0104_E06.b :
TES01_0016_G11.b : tgttaacttgttattgccccttaaaggttccaaaaaagcaaaccctccaaattcccaaaa
TES01_0107_G12.b : atttgtgtgtttttctttgttttggcgcctttaagg
TES01_0022_E12.b : aaaaaaaagaaatccctttgtttttggtta
TES01_0093_H08.b : tattatatagattgctgcctgttttttgtaatctttttttctccactcttaagtgtattc
SPL01_0001_H02.b :
OVR01_0085_C11.b :
OVR01_0034_G04.b :
LVRM1_0099_C05.b :
OVRM1_0020_H04.b :
OVRM1_0114_D01.b :
SMG01_0048_C10.b : accctttgggggggttgtggaccccccaaaaatccgggggaatatttttgggggggcccc
OVRM1_0116_E11.b :
UTR01_0013_A04.b :
OVR01_0098_B04.b :
THY01_0051_C04.b :
SPL01_0044_D11.b :
OVR01_0059_A05.b :
ADR01_0022_C09.b : aaattttttaccgaaaaaaaaaaaagcctttgtccatacgtgccccccttaaacccgggg
OVR01_0101_H08.b :
OVR01_0063_E06.b :
THY01_0059_F04.b :
SMG01_0035_B11.b : gcctgttttaacccttggggggaaaactttctggggttttttagaacacctttttggtgg
MLN01_0041_A05.b : gaactttctggggggaataaat
TCH01_0076_C06.b :
OVR01_0036_E07.b : gaggggg
MLN01_0084_F02.b :
TCH01_0076_C09.b :
SPL01_0075_D05.b :
ITT01_0010_D12.b : nnnnnnnnnnnnnnnn
CLNT1_0031_E05.b : attgtttttgcgcttaaagggttccaaagccaatgccccaatttccaaaaggcctttttc
OVRM1_0196_G11.b :
TES01_0027_B02.b : ttacatttttttgaccttaagggtcaaaaaaaataagctcccatttctcaaaagaaattt
TES01_0029_H05.b : taaaaggaaaggcaatgtttgtgtgttaaccttgtttttgcccctttaaatggtttcaaa
SMG01_0091_B04.b : gggttttgagaacttctttggggggatttggaaaaccccacgatagcccggggaaaaatt
OVR01_0030_D09.b :
TES01_0005_G08.b : ccccctga
TCH01_0059_F07.b :
TES01_0109_E02.b : aaaaaaagaatagagggacctggttggtttatacgttttgtcgtcctaaaagtgtctatc
PST01_0095_A08.b : cttgttatgccctttaagggttccaaaaacaagcctccaattctcaaaaagcctttttcc
LNG01_0091_C01.b : gattttttggaaatttcttggtgaatttcaatccctcaattactcaggaaaaatttttga
TES01_0072_B11.b : aaacttgtttttggccctcataggggtcaaaaaaaacaaatcccccaattttcaacaaga
TES01_0049_D02.b : ggtaca
TES01_0016_F05.b : atccaaaagcttttcgggcctctgggttgcaccccaggttataggggccgggcgacggaa
TES01_0036_A07.b : taacttgtttatgccccttaatggttcaataaacaaacctccaatttcccaaaaagtttt
PST01_0037_B08.b : gttgtaactgtttatggcccctaaagggttcaataagcctacctccaaatcccaacaaag
TES01_0067_A03.b : ggccttaaagggttcaaaaagccatgcctcaaatttccaaaaaacctttttccgccatca
TES01_0024_F06.b : ggccctaaaggttccaaaaaaaaagaccccaaattttcaaaaaacattttttcccactcc
TES01_0045_C04.b : aattctccccaataaccccagggaggg
TES01_0038_D11.b : gttcccatggggctaaacccaagaataaagtgtctttactcgaaaaaaaaaaaaaggcca
PTG01_0087_C04.b : tttaccccggggggaaaaaacttttttgattttttagaaaaacattttggggggggaggt
OVR01_0041_A02.b :
OVR01_0005_A01.b :
TES01_0031_F08.b : tgtgtgtgtatacatctgtttacgcgccctataaggtgatcataaaaaaaagatacctca
TES01_0018_A09.b : ccaagagagtaaatatgtaagatcgtcccagtgatatcattacactaacaatttacttaa
TES01_0095_D02.b : aaaaaaaaaaagaaagcgcattttgggttgaatcttgtttttggccccctattaaggggc
PST01_0060_E11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0100_F10.b : tatgggggccattttaaccctggcctgggcccctc
TES01_0029_F01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0109_G01.b : gttaaataaaaaataaaaagaccactttgttgtttttataaacatgattattatggtccc
TES01_0105_G12.b : aacctaaaaaaataaagaaagcgcattgtgggtgttaacctgtttttttgccgccttaat
SMG01_0022_H05.b : aaccaacaaaaaaaagaaataattcttttccctctcgaaaaaaaaaaaaaaaaaaaaaaa
TES01_0045_D09.b : taaaaaaaaaaatcttccttatactttctcccctgataatgtggtaacaatatatagata
PST01_0037_G06.b : tggggtgttacttgttatggcccttaaagggtccaaaaaacaatacttccaatttccaaa
TES01_0011_H10.b : gccattgttgtttgtaaatttgtttttgccccttaaagggttcaaaataagccatactct
OVR01_0070_A07.b : atccccaat
SKNB1_0064_E09.b : ggaaggcaatggggttgttaattggttatggcccctaaaggggtccaaaaaagcatagct
TES01_0014_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0087_G02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0042_C06.b : ggccaaaacccgagaaataaattttttttttccgggnaaaannnnaanaannaannaaaa
TES01_0074_G04.b : ctctctctctctcctctttttattaataaaaatatacaaaatatacagttttttatgcta
PST01_0097_G12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0100_F02.b : aaacaacacaactcttttttcttttttgtagggggcgccccccctgattttaaaatttat
LVRM1_0033_F06.b :
OVRM1_0182_A05.b :
LVRM1_0140_G12.b :
UTR01_0011_C01.b :
OVR01_0102_E07.b :
OVR01_0096_C02.b :
LVR01_0044_H06.b : agg
SPL01_0098_H05.b :
LVR01_0052_B04.b :
ITT01_0101_B05.b : ccattaaaaccagcccgggccgctttttaaacctcgacgggaaaacgccactgtgatttt
TCH01_0017_D05.b : aattaagcaaggccgggccccttttaacccctgacggggacgcttacttggaactgtgaa
OVR01_0085_D03.b : atggatggttcccatggtgctcaaacaaa
PST01_0049_B09.b : actggtttgccctaaatggtacaaaagcaatactccaatccaaaaagctttttccgcgtc
PST01_0021_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0057_B10.b : aactgtttatgcccttatagggttaaataaccatacctcccattccacaaaaagcttttt
PST01_0041_E05.b : gtatgcccttaaaggtacaaaaagcaaactcccaattccaaaaagctttttcccggttca
KDN01_0058_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctcccaatt
TES01_0010_B12.b : gaaggcatttgtttttgtaacttgttattggcccctataaggtttccaataagccatacc
SKNB1_0065_H11.b : tggtggtgttaactgtt
TCH01_0092_E03.b : tagggatcgaattaagctaggcctggccgtcttttaaaaccccggacggaaaacgccacc
PST01_0059_D12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0039_B10.b : gtggggttacttcttattgcccctaaaagggttccaataaccataacctcccaattccaa
PST01_0077_F09.b : gcattgtgnttgtaactgttattgcccttaaaggtttcaaataagcaatcctccaaattc
LVRM1_0022_H05.b :
OVRT1_0112_C08.b : aaaaaagcaaacccccattcaaaaaactttttcccggcctattggggtgcaaacccaagg
ITT01_0066_F05.b : atggatggnttcnatgatgctaaaatccaatgaaaaatgttccttacccgtcaaaaaaaa
LVR01_0074_A02.b :
PST01_0054_E09.b : atggnatggttcaatgtggctaaatcaaaagaataatgttttaatcgtgcaaaaaaaaaa
KDN01_0033_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctcccaa
KDN01_0033_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_B07.b :
PST01_0086_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-001812 : ............................................................
---------+---------+---------+---------+---------+---------+ 1328
OVRM1_0182_B09.b :
OVR01_0005_B10.b :
TES01_0009_D01.b :
TES01_0018_B10.b :
TES01_0042_B10.b :
TES01_0030_A09.b :
TES01_0038_G06.b :
TES01_0106_F04.b :
TES01_0045_A10.b :
OVR01_0020_B10.b :
SPL01_0043_D12.b :
OVR01_0025_A11.b :
TES01_0073_E06.b : tcttctctggggtgtggggg
TES01_0104_H07.b :
OVR01_0052_C08.b :
LVR01_0058_C02.b :
TES01_0076_A03.b :
TES01_0069_H01.b :
TES01_0043_A01.b :
OVR01_0048_G07.b :
TES01_0109_A11.b :
TES01_0024_B03.b :
TES01_0110_C07.b : actgatcttgtgtactacttctcctttatcctattgtatgtccn
TES01_0036_H09.b :
TES01_0061_D07.b : taatca
TES01_0055_E01.b :
CBLT1_0100_B01.b : aactcggccgcggccgtttgtgggtagtagtgat
TES01_0069_F05.b :
TES01_0020_D09.b : cacaaatatttttctgtgctcatgat
TES01_0003_G08.b :
SMG01_0072_G10.b :
OVR01_0048_F06.b :
PST01_0028_G03.b : agtttagggggtcggagacaccaaatcctccttcctccataacggcgggtgggggg
TES01_0036_G05.b : ttctc
TES01_0060_A10.b : agattttttccggcctcttcatgggtggcacaccccaactg
TES01_0088_E12.b :
TES01_0109_H01.b :
TES01_0006_H02.b :
TES01_0094_B03.b :
TES01_0091_D09.b : ccggcgcact
TES01_0002_B06.b :
TES01_0080_E03.b : gagcacacaaaaatattatgtgg
TES01_0098_E01.b :
TES01_0030_B11.b : gtgtttaca
TES01_0071_F04.b : ttttttcttccttgcgggtggggggccaacaccacattatatttg
TES01_0100_F11.b :
TES01_0100_H01.b :
TES01_0097_H04.b :
TES01_0014_F06.b : caggattttttggggtccgggccggccattatctcccctccccaaaagcggggggggggg
TES01_0024_D10.b : ccaaaataaaccaagccttcacaatttctcaataaaa
TES01_0105_B06.b : t
TES01_0008_A03.b : ttttttcgccccccattgggtgtgccaacccagaggtttttggtggggccgc
TES01_0051_G05.b : ttctcgggcgctatcataatactctataatccct
TES01_0058_C01.b : ggcccgggcgcccgaaattc
TES01_0026_H09.b : gcttttttt
TES01_0063_A09.b : tttctattta
PTG01_0101_A06.b :
ITT01_0032_G06.b : ggaaaaatt
OVR01_0058_D12.b :
TES01_0039_F08.b : ggtcccgcccg
ADR01_0101_H11.b :
TES01_0072_D11.b : tctctaaaaattttttttttccgccttcggt
TES01_0078_C06.b : tcttaataaaaagatttttctcccgctctatggtggggtcgcccacacaagagtctttta
TES01_0072_C03.b : ttcttttctaaaaaatattttttccccctcttgggggggtggaacccacattattattgt
TES01_0090_E10.b : ctcccgcccccggcgtgtgtgc
TES01_0098_C06.b : gattttttttg
TES01_0059_D08.b : cgggcccagggggggtgccacaccaaagtgttttatgttggggaccgggggcgcccaata
TES01_0039_D03.b : gtcccgggagcgaaattttcctctccaccccccggtgggggggggccccggggtcttggt
TES01_0091_F12.b :
TES01_0086_E08.b :
TES01_0016_B02.b : tttttcccgcctctaagtggttggccaacccagggtttataggggggaaccgggccgagc
TES01_0011_A11.b : aaaataacattttttcc
TES01_0049_D11.b :
KDN01_0065_E01.b : ggaaaaaaaaaaaaggccatgttccaaattgggccggccctaatatttaaaaaacccccc
TES01_0033_E11.b : tgtggttt
TES01_0025_E04.b : gtgtctgcgtgactctctattatatataatatattcatggttcataatatattttactcc
TES01_0007_E09.b : taaacnctttttccactcattcagtggagtgttcaaccactttctgtttttg
TES01_0070_C11.b : ccttttctaaaaaaatatttttcttc
TES01_0059_G09.b : ggttttttatttgtccccggct
TES01_0018_F11.b : ctcgatttctatataaaatatttttctctcc
TES01_0083_C04.b :
TES01_0069_D07.b : ttctcgcttttgatgtggttgtccatccatgatctttcttgtgtgcg
TES01_0006_F12.b :
TES01_0072_B04.b : gccgggcaccataatattttctn
TES01_0076_F02.b :
TCH01_0023_E11.b :
TES01_0061_E09.b : gtagttcaacacatctcgttatttttgg
TES01_0046_G10.b :
TES01_0096_F05.b : ttcccctttactgtggggtgacacacacagaagtactttagggtggcccgg
TES01_0054_C03.b : cggctcttcattgggtgtgcaaacatacaagtttttctttgtggacccgggccaagacga
TES01_0094_B09.b : ttctttccttttttctaaaaaagacttttttctcggaatacaaatgggtgcgtccatca
TES01_0003_C11.b :
TES01_0005_B09.b :
PST01_0077_D12.b : tttctcaaataagcattttttccggcatctcaagtggggttcccaa
PST01_0095_E07.b : tgggtgccaaccaaaggtttaaagggggacccggacgagccaatatccttcttccccaaa
KDN01_0071_A11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0078_F12.b : gtcaaaagttcttactgccaatacaatgcnatcaggtggctaactt
TES01_0066_E10.b : accccaagttctaaagggggtccgggcgagcaaatttctctcctccccaaacccggcggg
THY01_0016_B07.b :
TES01_0014_G11.b : cgcctccaaattttcataaaaaacgtcttctttccgcgcctctaagtgggggg
UTR01_0102_D12.b :
LNG01_0085_B08.b : gggttcctcgaaaaaaaacacagcttttgttttaaaccgttgcccccgtaaccatgttta
ITT01_0049_A02.b : ttttgtaagaaccctttcgggggggccaattggaacacccacagattagcccggggaaaa
THY01_0118_B07.b :
TES01_0097_F08.b : t
SPL01_0104_E06.b :
TES01_0016_G11.b : agacttttttcccgcttccagtggggttggca
TES01_0107_G12.b :
TES01_0022_E12.b :
TES01_0093_H08.b : aaataatacg
SPL01_0001_H02.b :
OVR01_0085_C11.b :
OVR01_0034_G04.b :
LVRM1_0099_C05.b :
OVRM1_0020_H04.b :
OVRM1_0114_D01.b :
SMG01_0048_C10.b : cccccgcgggggttcttcaaaaaaaaaaaccgg
OVRM1_0116_E11.b :
UTR01_0013_A04.b :
OVR01_0098_B04.b :
THY01_0051_C04.b :
SPL01_0044_D11.b :
OVR01_0059_A05.b :
ADR01_0022_C09.b : cantataaaaaatttttgaggggccctagggataaaaacggccccttatctggggaaaat
OVR01_0101_H08.b :
OVR01_0063_E06.b :
THY01_0059_F04.b :
SMG01_0035_B11.b : ggcgtttggaacccccccgaattattccgcggagaaaaattttgggggagggacaacccc
MLN01_0041_A05.b :
TCH01_0076_C06.b :
OVR01_0036_E07.b :
MLN01_0084_F02.b :
TCH01_0076_C09.b :
SPL01_0075_D05.b :
ITT01_0010_D12.b :
CLNT1_0031_E05.b : gggtctcgtggggttggccaacccaggtttttattgtgggaccccggcagatcat
OVRM1_0196_G11.b :
TES01_0027_B02.b : ttccgcctccatggggtggccaaccaaatgatatttattttgggtccccgcccaaatcaa
TES01_0029_H05.b : taaaaataattcctccaattattctcaaaaagaaactttttttcggccct
SMG01_0091_B04.b : tttggatggggtaccacccccgggggggaatttctcgaatattaaaaacaccgggttttt
OVR01_0030_D09.b :
TES01_0005_G08.b :
TCH01_0059_F07.b :
TES01_0109_E02.b : cataaaaaaatgttacccaaattgctctcaattata
PST01_0095_A08.b : gcatctaggtggtttccaaccacaagaatttaagttgggacccggacacaccgaatattc
LNG01_0091_C01.b : tggtaaccgcgaccccggcaattgttcatatataagaacaacattgttttgttatttatt
TES01_0072_B11.b : agctttttccccgccccaggtgggggtggccccn
TES01_0049_D02.b :
TES01_0016_F05.b : tccctcctctcccaacagccggtggggggggggcccgggatgttcacgacaaataagcag
TES01_0036_A07.b : tttccggatccaatggggtgtgccacccccaagatcttatggtgggac
PST01_0037_B08.b : cttttttccggtttcattgggttgtccaccacaagagttttaatttgggacccgggacag
TES01_0067_A03.b : agtgggttcccaacccaaagtttttatatggtggttccgggcacccccatattttcccct
TES01_0024_F06.b : atggggtgtgccaacctcatgttttatattgtggaccgcggacgaaccaaaaattccttc
TES01_0045_C04.b :
TES01_0038_D11.b : tttgttcagttgggcgggcctaatatttaaaaaaaccccccccccct
PTG01_0087_C04.b : gggcccaccccccaatttttgcccgggggaaaaatttttttgggggggggcaaccccccc
OVR01_0041_A02.b :
OVR01_0005_A01.b :
TES01_0031_F08.b : atattccaaaaagagaattttataccccgtctatgggggggtggccacaaacatatgaat
TES01_0018_A09.b : tttctctttaacctgctgctaataaaaatacaatagtcccatgattttctccttcatgcc
TES01_0095_D02.b : aacaaaaaaaaagaacccccaatatttctaaaaaaaagtttttttccgccgccccctagg
PST01_0060_E11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0100_F10.b :
TES01_0029_F01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0109_G01.b : tcttatgaggtgggatacaaaaatatatcagaatattccctag
TES01_0105_G12.b : gggttacaaataagcacaatccctccccaa
SMG01_0022_H05.b : aaaaaaaangtggttttttttggtgggggcccctttataatttgggggggggaaaacaac
TES01_0045_D09.b : gagccactcttgtgtctgcttctaaacttcgatttttgccgcctcttaa
PST01_0037_G06.b : aagcttttttccggatccatggggttgccaaccccatgttttattgntcggaccccggac
TES01_0011_H10.b : ccattttccaaataaagccttttttcccggcctccaaggtgggtttggccaacccccagg
OVR01_0070_A07.b :
SKNB1_0064_E09.b : cccaaatttccacaatagcatttttt
TES01_0014_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0087_G02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0042_C06.b : agccttttttttccttgttgggggccctctaatttccttggggggaaaatcacacccttt
TES01_0074_G04.b : tcatcttttttagcatccacatcatattctcacaacatcattaatctctctattaacttc
PST01_0097_G12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0100_F02.b : aaaaaaaggggggggggggcgctgtgttttttttttttaaagaggaaggggaaaaaaact
LVRM1_0033_F06.b :
OVRM1_0182_A05.b :
LVRM1_0140_G12.b :
UTR01_0011_C01.b :
OVR01_0102_E07.b :
OVR01_0096_C02.b :
LVR01_0044_H06.b :
SPL01_0098_H05.b :
LVR01_0052_B04.b :
ITT01_0101_B05.b : tgtaaagaccttttcttggtggggacaatggccacacccccgaatttagcccgggaaaaa
TCH01_0017_D05.b : gaacctttttgggggggcatttgggaaaccccccaagatagcccgggaaaaaaatttatg
OVR01_0085_D03.b :
PST01_0049_B09.b : catgggttgcacccacagatttaagtggatccgaacgagcaaatatcctcctcccccaaa
PST01_0021_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0057_B10.b : tcggcatccagtgggttggccaaccaccagtttttatttgctggatcccggtaccaacca
PST01_0041_E05.b : atgggtttgccaacacaaggtctacggctgatccgggacagacgaatttccttcctctcc
KDN01_0058_E02.b : tcccaaaaagactttttcccgggattcagtggggtgggccaaccccaaaggatttttagg
TES01_0010_B12.b : ctcccaatttccacaaaaagctttttttcccgcatccaagttggggttggcccacccctc
SKNB1_0065_H11.b :
TCH01_0092_E03.b : tggggattggtgagaacctattctgggggggccaatggaacaacctccgaatttgccctg
PST01_0059_D12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0039_B10.b : aaaaacattttttcacggattcaagttggggtggccaacccccaggtttttataggcgtg
PST01_0077_F09.b : caaaaaaccatttttcccggatccaattggggttggcaaacccaaggtacttactggcgg
LVRM1_0022_H05.b :
OVRT1_0112_C08.b : taatagggtggaccggggagagaaatttttcccctctccaaaaaacgcgggggttggggg
ITT01_0066_F05.b : aaaaaaaagccaatggtccactgagtgcggcccttaatacctcgggccagctacgacacc
LVR01_0074_A02.b :
PST01_0054_E09.b : aaaagccattggtcaactcggccggccctacatttaaaaaaaccccacctccccgacgaa
KDN01_0033_C01.b : tttccacaaaagcttttttcccggcatctaatggggtggccaacacctcaggattttaca
KDN01_0033_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_B07.b :
PST01_0086_B08.b : xxxxxxxxxxxxxxxxccggcatccattggggtttgccaacccccaggttcttacatgcg
20110601C-001812 : ............................................................
---------+---------+---------+---------+---------+---------+ 1328
OVRM1_0182_B09.b :
OVR01_0005_B10.b :
TES01_0009_D01.b :
TES01_0018_B10.b :
TES01_0042_B10.b :
TES01_0030_A09.b :
TES01_0038_G06.b :
TES01_0106_F04.b :
TES01_0045_A10.b :
OVR01_0020_B10.b :
SPL01_0043_D12.b :
OVR01_0025_A11.b :
TES01_0073_E06.b :
TES01_0104_H07.b :
OVR01_0052_C08.b :
LVR01_0058_C02.b :
TES01_0076_A03.b :
TES01_0069_H01.b :
TES01_0043_A01.b :
OVR01_0048_G07.b :
TES01_0109_A11.b :
TES01_0024_B03.b :
TES01_0110_C07.b :
TES01_0036_H09.b :
TES01_0061_D07.b :
TES01_0055_E01.b :
CBLT1_0100_B01.b :
TES01_0069_F05.b :
TES01_0020_D09.b :
TES01_0003_G08.b :
SMG01_0072_G10.b :
OVR01_0048_F06.b :
PST01_0028_G03.b :
TES01_0036_G05.b :
TES01_0060_A10.b :
TES01_0088_E12.b :
TES01_0109_H01.b :
TES01_0006_H02.b :
TES01_0094_B03.b :
TES01_0091_D09.b :
TES01_0002_B06.b :
TES01_0080_E03.b :
TES01_0098_E01.b :
TES01_0030_B11.b :
TES01_0071_F04.b :
TES01_0100_F11.b :
TES01_0100_H01.b :
TES01_0097_H04.b :
TES01_0014_F06.b : ggaagaaaggaaaaaaaaagt
TES01_0024_D10.b :
TES01_0105_B06.b :
TES01_0008_A03.b :
TES01_0051_G05.b :
TES01_0058_C01.b :
TES01_0026_H09.b :
TES01_0063_A09.b :
PTG01_0101_A06.b :
ITT01_0032_G06.b :
OVR01_0058_D12.b :
TES01_0039_F08.b :
ADR01_0101_H11.b :
TES01_0072_D11.b :
TES01_0078_C06.b : tgtggccccgcgcacaaccttattta
TES01_0072_C03.b : gggggcccgccggggagattta
TES01_0090_E10.b :
TES01_0098_C06.b :
TES01_0059_D08.b : ttttctcctctcctccccacaacacgccgggggggggggggagagtctctccgagggggg
TES01_0039_D03.b : agaataagagaccacgttcct
TES01_0091_F12.b :
TES01_0086_E08.b :
TES01_0016_B02.b : caaatttccttg
TES01_0011_A11.b :
TES01_0049_D11.b :
KDN01_0065_E01.b : cccccgaacaaaaaaaaaagaatttgttatttt
TES01_0033_E11.b :
TES01_0025_E04.b : cgtcactttccttcatagccttgctttgg
TES01_0007_E09.b :
TES01_0070_C11.b :
TES01_0059_G09.b :
TES01_0018_F11.b :
TES01_0083_C04.b :
TES01_0069_D07.b :
TES01_0006_F12.b :
TES01_0072_B04.b :
TES01_0076_F02.b :
TCH01_0023_E11.b :
TES01_0061_E09.b :
TES01_0046_G10.b :
TES01_0096_F05.b :
TES01_0054_C03.b : aattcccctcnctctcaccctaacaccgcgcctggcatggtgtgtggggacttctctctc
TES01_0094_B09.b :
TES01_0003_C11.b :
TES01_0005_B09.b :
PST01_0077_D12.b :
PST01_0095_E07.b : ccccgccggttgggggagggtctctcagggtatgttccaacggatcgaatattaaggcaa
KDN01_0071_A11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0078_F12.b :
TES01_0066_E10.b : gtggggggaggatttctcggggaatgtt
THY01_0016_B07.b :
TES01_0014_G11.b :
UTR01_0102_D12.b :
LNG01_0085_B08.b : ccccgaaagtttgggggaaaacattcttcct
ITT01_0049_A02.b : aattttggttaggggtaacccccccccgccgcgaaatttcccgaagattaaaaaacac
THY01_0118_B07.b :
TES01_0097_F08.b :
SPL01_0104_E06.b :
TES01_0016_G11.b :
TES01_0107_G12.b :
TES01_0022_E12.b :
TES01_0093_H08.b :
SPL01_0001_H02.b :
OVR01_0085_C11.b :
OVR01_0034_G04.b :
LVRM1_0099_C05.b :
OVRM1_0020_H04.b :
OVRM1_0114_D01.b :
SMG01_0048_C10.b :
OVRM1_0116_E11.b :
UTR01_0013_A04.b :
OVR01_0098_B04.b :
THY01_0051_C04.b :
SPL01_0044_D11.b :
OVR01_0059_A05.b :
ADR01_0022_C09.b : tgtttttgaacttttgggactaaccaaatactgaaaaattttgttagccttgtggttt
OVR01_0101_H08.b :
OVR01_0063_E06.b :
THY01_0059_F04.b :
SMG01_0035_B11.b : ggctggggggaat
MLN01_0041_A05.b :
TCH01_0076_C06.b :
OVR01_0036_E07.b :
MLN01_0084_F02.b :
TCH01_0076_C09.b :
SPL01_0075_D05.b :
ITT01_0010_D12.b :
CLNT1_0031_E05.b :
OVRM1_0196_G11.b :
TES01_0027_B02.b : atttcccccc
TES01_0029_H05.b :
SMG01_0091_B04.b : tttgttttaaacgcagggtgcgcccccgtgtttaaccacttgtgtttgtcacccccgaag
OVR01_0030_D09.b :
TES01_0005_G08.b :
TCH01_0059_F07.b :
TES01_0109_E02.b :
PST01_0095_A08.b : tctccctcccccaaacgcgccgggttggggggaggtttcttctagggttattttccacat
LNG01_0091_C01.b : gctccccccagttatttcataatgtttttaccacgtaaaatgttttttataatacaaatt
TES01_0072_B11.b :
TES01_0049_D02.b :
TES01_0016_F05.b : cacaccctc
TES01_0036_A07.b :
PST01_0037_B08.b : acaaaatatcccttcctctcccccaaacccgcgcggggtgtgggggggaggtatctctca
TES01_0067_A03.b : ccttccccaaaaacccacccgggtttgtggtgggaa
TES01_0024_F06.b : cccttcccaaccac
TES01_0045_C04.b :
TES01_0038_D11.b :
PTG01_0087_C04.b : gcgcgcggggaatttttcagaatttataaaacaccacggggtgttctttttgttttttaa
OVR01_0041_A02.b :
OVR01_0005_A01.b :
TES01_0031_F08.b : ttataatgtgggagcccggtgatcataaaa
TES01_0018_A09.b : ttatcccctcatactctttattataatactctctacatctcccgtgaattggaataatat
TES01_0095_D02.b : ggggtggtcccaat
PST01_0060_E11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
MLN01_0100_F10.b :
TES01_0029_F01.b : nnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0109_G01.b :
TES01_0105_G12.b :
SMG01_0022_H05.b : ctcttttttttggagggcccgaggagaaatataaaagcggcgccgtgttcttttcccgga
TES01_0045_D09.b :
PST01_0037_G06.b : cagacgaaaattccttcccttccccaaaaaccccccgggtttgggcgggaggttccccca
TES01_0011_H10.b : gttcttattgggggggaaccggggtaccgacccaaat
OVR01_0070_A07.b :
SKNB1_0064_E09.b :
TES01_0014_D01.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0087_G02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0042_C06.b : tttgaaagggccctgaagaattaaaa
TES01_0074_G04.b : aattaacatacattttattttccatatcctaattcttcagtacatttacacctatagtcc
PST01_0097_G12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0100_F02.b : ctgtgggtttttttttaataaaacaaaacaccactgccgggcggtggagagagaaacaca
LVRM1_0033_F06.b :
OVRM1_0182_A05.b :
LVRM1_0140_G12.b :
UTR01_0011_C01.b :
OVR01_0102_E07.b :
OVR01_0096_C02.b :
LVR01_0044_H06.b :
SPL01_0098_H05.b :
LVR01_0052_B04.b :
ITT01_0101_B05.b : aattttatggtaagggttaacaccgcaccccgcccgaaatttctccggaaatttaaaata
TCH01_0017_D05.b : gtaggggaaacccgcagcgcgcggggagtttctcggaatataaaataacagacggtcatt
OVR01_0085_D03.b :
PST01_0049_B09.b : ccgcccgggtgggggggggtactctcagggtagttccatctgtaagaaaattaagccagc
PST01_0021_B11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0057_B10.b : aatattccctcccttcccccacaaacccgccccgggttggtggggagggttccctctcaa
PST01_0041_E05.b : ccaaaccggcccgggttggggggggttactctcagggaagtttcccacggaaccgaaatt
KDN01_0058_E02.b : gttgaaccgcggaaccaaccaaaatttccctctcctcctccacagaaacaaggccgggga
TES01_0010_B12.b : aaggttctataaaggtggatcccgcggaacca
SKNB1_0065_H11.b :
TCH01_0092_E03.b :
PST01_0059_D12.b : nnnnnnnnnnnnnnn
PST01_0039_B10.b : gacccgggaccaaccaaaatatccttctccttctcccacaaaaccccgcccggggttggg
PST01_0077_F09.b : accccggaacaaaccaaaaattccctcccttcccccacaacccggcccgggtttgggggg
LVRM1_0022_H05.b :
OVRT1_0112_C08.b : gggggtcctccggggggtttcccccngggaacaaaattattgagggggaaaaggggtgtt
ITT01_0066_F05.b : ttttttgaaaggcctatagagcctataaaggcgggcccttaaacccgcgaaaacactgat
LVR01_0074_A02.b :
PST01_0054_E09.b : aaaaaaaacattgtgttaactgtttggcttaaggtcaaaaaaacccaattcaaaactttt
KDN01_0033_C01.b : tgtttggatccggggacaacccaattattcctctcgctcccctcataaccctggccgggg
KDN01_0033_A09.b : xxxxxxxtgtctggatccgggttaccaactcaataatcctttcgtttcccctcatgaacc
LVRM1_0157_B07.b :
PST01_0086_B08.b : ggtcccgggaacgacccaataaattccctcctttccccaaagaacctggcctggtttcgg
20110601C-001812 : ............................................................
---------+---------+---------+---------+---------+---------+ 1328
OVRM1_0182_B09.b :
OVR01_0005_B10.b :
TES01_0009_D01.b :
TES01_0018_B10.b :
TES01_0042_B10.b :
TES01_0030_A09.b :
TES01_0038_G06.b :
TES01_0106_F04.b :
TES01_0045_A10.b :
OVR01_0020_B10.b :
SPL01_0043_D12.b :
OVR01_0025_A11.b :
TES01_0073_E06.b :
TES01_0104_H07.b :
OVR01_0052_C08.b :
LVR01_0058_C02.b :
TES01_0076_A03.b :
TES01_0069_H01.b :
TES01_0043_A01.b :
OVR01_0048_G07.b :
TES01_0109_A11.b :
TES01_0024_B03.b :
TES01_0110_C07.b :
TES01_0036_H09.b :
TES01_0061_D07.b :
TES01_0055_E01.b :
CBLT1_0100_B01.b :
TES01_0069_F05.b :
TES01_0020_D09.b :
TES01_0003_G08.b :
SMG01_0072_G10.b :
OVR01_0048_F06.b :
PST01_0028_G03.b :
TES01_0036_G05.b :
TES01_0060_A10.b :
TES01_0088_E12.b :
TES01_0109_H01.b :
TES01_0006_H02.b :
TES01_0094_B03.b :
TES01_0091_D09.b :
TES01_0002_B06.b :
TES01_0080_E03.b :
TES01_0098_E01.b :
TES01_0030_B11.b :
TES01_0071_F04.b :
TES01_0100_F11.b :
TES01_0100_H01.b :
TES01_0097_H04.b :
TES01_0014_F06.b :
TES01_0024_D10.b :
TES01_0105_B06.b :
TES01_0008_A03.b :
TES01_0051_G05.b :
TES01_0058_C01.b :
TES01_0026_H09.b :
TES01_0063_A09.b :
PTG01_0101_A06.b :
ITT01_0032_G06.b :
OVR01_0058_D12.b :
TES01_0039_F08.b :
ADR01_0101_H11.b :
TES01_0072_D11.b :
TES01_0078_C06.b :
TES01_0072_C03.b :
TES01_0090_E10.b :
TES01_0098_C06.b :
TES01_0059_D08.b : gttt
TES01_0039_D03.b :
TES01_0091_F12.b :
TES01_0086_E08.b :
TES01_0016_B02.b :
TES01_0011_A11.b :
TES01_0049_D11.b :
KDN01_0065_E01.b :
TES01_0033_E11.b :
TES01_0025_E04.b :
TES01_0007_E09.b :
TES01_0070_C11.b :
TES01_0059_G09.b :
TES01_0018_F11.b :
TES01_0083_C04.b :
TES01_0069_D07.b :
TES01_0006_F12.b :
TES01_0072_B04.b :
TES01_0076_F02.b :
TCH01_0023_E11.b :
TES01_0061_E09.b :
TES01_0046_G10.b :
TES01_0096_F05.b :
TES01_0054_C03.b : gggatatgttcctccatgtgttcctcataattataacgcctagcgtacca
TES01_0094_B09.b :
TES01_0003_C11.b :
TES01_0005_B09.b :
PST01_0077_D12.b :
PST01_0095_E07.b : gcaaaaaggttgtttttcccccaaaaaaaagaagaaga
KDN01_0071_A11.b :
TES01_0078_F12.b :
TES01_0066_E10.b :
THY01_0016_B07.b :
TES01_0014_G11.b :
UTR01_0102_D12.b :
LNG01_0085_B08.b :
ITT01_0049_A02.b :
THY01_0118_B07.b :
TES01_0097_F08.b :
SPL01_0104_E06.b :
TES01_0016_G11.b :
TES01_0107_G12.b :
TES01_0022_E12.b :
TES01_0093_H08.b :
SPL01_0001_H02.b :
OVR01_0085_C11.b :
OVR01_0034_G04.b :
LVRM1_0099_C05.b :
OVRM1_0020_H04.b :
OVRM1_0114_D01.b :
SMG01_0048_C10.b :
OVRM1_0116_E11.b :
UTR01_0013_A04.b :
OVR01_0098_B04.b :
THY01_0051_C04.b :
SPL01_0044_D11.b :
OVR01_0059_A05.b :
ADR01_0022_C09.b :
OVR01_0101_H08.b :
OVR01_0063_E06.b :
THY01_0059_F04.b :
SMG01_0035_B11.b :
MLN01_0041_A05.b :
TCH01_0076_C06.b :
OVR01_0036_E07.b :
MLN01_0084_F02.b :
TCH01_0076_C09.b :
SPL01_0075_D05.b :
ITT01_0010_D12.b :
CLNT1_0031_E05.b :
OVRM1_0196_G11.b :
TES01_0027_B02.b :
TES01_0029_H05.b :
SMG01_0091_B04.b : aggtgttgttggaaaaaattttgtacc
OVR01_0030_D09.b :
TES01_0005_G08.b :
TCH01_0059_F07.b :
TES01_0109_E02.b :
PST01_0095_A08.b : gggaaccgaaattgcaagcccaggccccaaaccgtt
LNG01_0091_C01.b : tatantnntnnnnncaatttaactgcttcgcctttgcattgggnnatgccgtnncnnt
TES01_0072_B11.b :
TES01_0049_D02.b :
TES01_0016_F05.b :
TES01_0036_A07.b :
PST01_0037_B08.b : ggggtatttctccaaatggtaaccgaaattttaacgccagagcacaaaaggtgtgtt
TES01_0067_A03.b :
TES01_0024_F06.b :
TES01_0045_C04.b :
TES01_0038_D11.b :
PTG01_0087_C04.b : aaaggaattcccccccccc
OVR01_0041_A02.b :
OVR01_0005_A01.b :
TES01_0031_F08.b :
TES01_0018_A09.b : tatggaa
TES01_0095_D02.b :
PST01_0060_E11.b :
MLN01_0100_F10.b :
TES01_0029_F01.b :
TES01_0109_G01.b :
TES01_0105_G12.b :
SMG01_0022_H05.b : gagagaagtttgtgtgtataatattt
TES01_0045_D09.b :
PST01_0037_G06.b : aggggtaagttctccaatcggaaacaaaaatgttaagcccaggcacaaaagcggtg
TES01_0011_H10.b :
OVR01_0070_A07.b :
SKNB1_0064_E09.b :
TES01_0014_D01.b :
PST01_0087_G02.b :
SMG01_0042_C06.b :
TES01_0074_G04.b : tttacatgtgtgttggttacatatttaatttactttatatcattctc
PST01_0097_G12.b :
SMG01_0100_F02.b : acacaaaaaaccat
LVRM1_0033_F06.b :
OVRM1_0182_A05.b :
LVRM1_0140_G12.b :
UTR01_0011_C01.b :
OVR01_0102_E07.b :
OVR01_0096_C02.b :
LVR01_0044_H06.b :
SPL01_0098_H05.b :
LVR01_0052_B04.b :
ITT01_0101_B05.b : cccggcgcggtcttttgtggttttttcccccgggtttgcgcccccccctgtgtata
TCH01_0017_D05.b : ttgttttataaaccgggttgcccccccctgttgttaccatttggtttttaccccccccca
OVR01_0085_D03.b :
PST01_0049_B09.b : gaaaaaggtggtttctccccaaacaaaagaagaaaaaaaannnnnntcctccccccctct
PST01_0021_B11.b : nnnnnnn
PST01_0057_B10.b : gggattagttt
PST01_0041_E05.b : gtagagcaggggaaaagccttgtttatccccgcgacaaacccgaggcacgaaaacgcccc
KDN01_0058_E02.b : ttgggtgggggaggatttttctctaggggtaaattttccaaaacgggaaacgaaaaattg
TES01_0010_B12.b :
SKNB1_0065_H11.b :
TCH01_0092_E03.b :
PST01_0059_D12.b :
PST01_0039_B10.b : tgggggaggtttctctccaagggggataatgttctcaaacgggaaacggagaaggg
PST01_0077_F09.b : ggaggtttcctcccagggggaatgttctccaaacgggaaaccagaaattgaa
LVRM1_0022_H05.b :
OVRT1_0112_C08.b : ttctcccccaccacaacgtgtggagatatataccgccccgctctccgt
ITT01_0066_F05.b : ttgagactatctgggcattgaaccccaatacccgaaaaattttggtgaccccgcgcgttc
LVR01_0074_A02.b :
PST01_0054_E09.b : tcgcctcgggggggaccacggatatagtggccggagcgaaatctctctcccaaccccggg
KDN01_0033_C01.b : tttgggtgggaaggtattttcctagggggatatgttcccaaacgggtacccgaaaaatgg
KDN01_0033_A09.b : tggccggggttcgggtgggaaggttttttcctaagggggatatgttccacaaaccggaaa
LVRM1_0157_B07.b :
PST01_0086_B08.b : ggcggaaggtttccctcttaggggtatcgtttctccaatcgggtcaccggaaaattggaa
20110601C-001812 : ............................................................
---------+---------+---------+---------+---------+---------+ 1328
OVRM1_0182_B09.b :
OVR01_0005_B10.b :
TES01_0009_D01.b :
TES01_0018_B10.b :
TES01_0042_B10.b :
TES01_0030_A09.b :
TES01_0038_G06.b :
TES01_0106_F04.b :
TES01_0045_A10.b :
OVR01_0020_B10.b :
SPL01_0043_D12.b :
OVR01_0025_A11.b :
TES01_0073_E06.b :
TES01_0104_H07.b :
OVR01_0052_C08.b :
LVR01_0058_C02.b :
TES01_0076_A03.b :
TES01_0069_H01.b :
TES01_0043_A01.b :
OVR01_0048_G07.b :
TES01_0109_A11.b :
TES01_0024_B03.b :
TES01_0110_C07.b :
TES01_0036_H09.b :
TES01_0061_D07.b :
TES01_0055_E01.b :
CBLT1_0100_B01.b :
TES01_0069_F05.b :
TES01_0020_D09.b :
TES01_0003_G08.b :
SMG01_0072_G10.b :
OVR01_0048_F06.b :
PST01_0028_G03.b :
TES01_0036_G05.b :
TES01_0060_A10.b :
TES01_0088_E12.b :
TES01_0109_H01.b :
TES01_0006_H02.b :
TES01_0094_B03.b :
TES01_0091_D09.b :
TES01_0002_B06.b :
TES01_0080_E03.b :
TES01_0098_E01.b :
TES01_0030_B11.b :
TES01_0071_F04.b :
TES01_0100_F11.b :
TES01_0100_H01.b :
TES01_0097_H04.b :
TES01_0014_F06.b :
TES01_0024_D10.b :
TES01_0105_B06.b :
TES01_0008_A03.b :
TES01_0051_G05.b :
TES01_0058_C01.b :
TES01_0026_H09.b :
TES01_0063_A09.b :
PTG01_0101_A06.b :
ITT01_0032_G06.b :
OVR01_0058_D12.b :
TES01_0039_F08.b :
ADR01_0101_H11.b :
TES01_0072_D11.b :
TES01_0078_C06.b :
TES01_0072_C03.b :
TES01_0090_E10.b :
TES01_0098_C06.b :
TES01_0059_D08.b :
TES01_0039_D03.b :
TES01_0091_F12.b :
TES01_0086_E08.b :
TES01_0016_B02.b :
TES01_0011_A11.b :
TES01_0049_D11.b :
KDN01_0065_E01.b :
TES01_0033_E11.b :
TES01_0025_E04.b :
TES01_0007_E09.b :
TES01_0070_C11.b :
TES01_0059_G09.b :
TES01_0018_F11.b :
TES01_0083_C04.b :
TES01_0069_D07.b :
TES01_0006_F12.b :
TES01_0072_B04.b :
TES01_0076_F02.b :
TCH01_0023_E11.b :
TES01_0061_E09.b :
TES01_0046_G10.b :
TES01_0096_F05.b :
TES01_0054_C03.b :
TES01_0094_B09.b :
TES01_0003_C11.b :
TES01_0005_B09.b :
PST01_0077_D12.b :
PST01_0095_E07.b :
KDN01_0071_A11.b :
TES01_0078_F12.b :
TES01_0066_E10.b :
THY01_0016_B07.b :
TES01_0014_G11.b :
UTR01_0102_D12.b :
LNG01_0085_B08.b :
ITT01_0049_A02.b :
THY01_0118_B07.b :
TES01_0097_F08.b :
SPL01_0104_E06.b :
TES01_0016_G11.b :
TES01_0107_G12.b :
TES01_0022_E12.b :
TES01_0093_H08.b :
SPL01_0001_H02.b :
OVR01_0085_C11.b :
OVR01_0034_G04.b :
LVRM1_0099_C05.b :
OVRM1_0020_H04.b :
OVRM1_0114_D01.b :
SMG01_0048_C10.b :
OVRM1_0116_E11.b :
UTR01_0013_A04.b :
OVR01_0098_B04.b :
THY01_0051_C04.b :
SPL01_0044_D11.b :
OVR01_0059_A05.b :
ADR01_0022_C09.b :
OVR01_0101_H08.b :
OVR01_0063_E06.b :
THY01_0059_F04.b :
SMG01_0035_B11.b :
MLN01_0041_A05.b :
TCH01_0076_C06.b :
OVR01_0036_E07.b :
MLN01_0084_F02.b :
TCH01_0076_C09.b :
SPL01_0075_D05.b :
ITT01_0010_D12.b :
CLNT1_0031_E05.b :
OVRM1_0196_G11.b :
TES01_0027_B02.b :
TES01_0029_H05.b :
SMG01_0091_B04.b :
OVR01_0030_D09.b :
TES01_0005_G08.b :
TCH01_0059_F07.b :
TES01_0109_E02.b :
PST01_0095_A08.b :
LNG01_0091_C01.b :
TES01_0072_B11.b :
TES01_0049_D02.b :
TES01_0016_F05.b :
TES01_0036_A07.b :
PST01_0037_B08.b :
TES01_0067_A03.b :
TES01_0024_F06.b :
TES01_0045_C04.b :
TES01_0038_D11.b :
PTG01_0087_C04.b :
OVR01_0041_A02.b :
OVR01_0005_A01.b :
TES01_0031_F08.b :
TES01_0018_A09.b :
TES01_0095_D02.b :
PST01_0060_E11.b :
MLN01_0100_F10.b :
TES01_0029_F01.b :
TES01_0109_G01.b :
TES01_0105_G12.b :
SMG01_0022_H05.b :
TES01_0045_D09.b :
PST01_0037_G06.b :
TES01_0011_H10.b :
OVR01_0070_A07.b :
SKNB1_0064_E09.b :
TES01_0014_D01.b :
PST01_0087_G02.b :
SMG01_0042_C06.b :
TES01_0074_G04.b :
PST01_0097_G12.b :
SMG01_0100_F02.b :
LVRM1_0033_F06.b :
OVRM1_0182_A05.b :
LVRM1_0140_G12.b :
UTR01_0011_C01.b :
OVR01_0102_E07.b :
OVR01_0096_C02.b :
LVR01_0044_H06.b :
SPL01_0098_H05.b :
LVR01_0052_B04.b :
ITT01_0101_B05.b :
TCH01_0017_D05.b : aacgggtgttttgtgtaaaaaaaataatttttttttttttttttttacgggtgtgacccg
OVR01_0085_D03.b :
PST01_0049_B09.b : ncctcttattgcgccccactaaataagactaannnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0021_B11.b :
PST01_0057_B10.b :
PST01_0041_E05.b : ccccgcgcccacactctcgnttttcttntgcggcgcagctctacaaaataagtnatactt
KDN01_0058_E02.b : aaaca
TES01_0010_B12.b :
SKNB1_0065_H11.b :
TCH01_0092_E03.b :
PST01_0059_D12.b :
PST01_0039_B10.b :
PST01_0077_F09.b :
LVRM1_0022_H05.b :
OVRT1_0112_C08.b :
ITT01_0066_F05.b : ttataaaaaaacacgttgtttaccgcgcccccgcnccntggttcccgaagtttaatatgt
LVR01_0074_A02.b :
PST01_0054_E09.b : gggggaa
KDN01_0033_C01.b : aaaagcgcaaacgcacctagaagccttg
KDN01_0033_A09.b : ccgaaaaattttaaggccaagaggcaaacaaagcggttggtgtttatatcccccaaaaca
LVRM1_0157_B07.b :
PST01_0086_B08.b : aagccccagggcggacaaaagcgcgtgggtttttaagccccccgaaacaaaaagccctcg
20110601C-001812 : ............................................................
---------+---------+---------+---------+---------+---------+ 1328
OVRM1_0182_B09.b :
OVR01_0005_B10.b :
TES01_0009_D01.b :
TES01_0018_B10.b :
TES01_0042_B10.b :
TES01_0030_A09.b :
TES01_0038_G06.b :
TES01_0106_F04.b :
TES01_0045_A10.b :
OVR01_0020_B10.b :
SPL01_0043_D12.b :
OVR01_0025_A11.b :
TES01_0073_E06.b :
TES01_0104_H07.b :
OVR01_0052_C08.b :
LVR01_0058_C02.b :
TES01_0076_A03.b :
TES01_0069_H01.b :
TES01_0043_A01.b :
OVR01_0048_G07.b :
TES01_0109_A11.b :
TES01_0024_B03.b :
TES01_0110_C07.b :
TES01_0036_H09.b :
TES01_0061_D07.b :
TES01_0055_E01.b :
CBLT1_0100_B01.b :
TES01_0069_F05.b :
TES01_0020_D09.b :
TES01_0003_G08.b :
SMG01_0072_G10.b :
OVR01_0048_F06.b :
PST01_0028_G03.b :
TES01_0036_G05.b :
TES01_0060_A10.b :
TES01_0088_E12.b :
TES01_0109_H01.b :
TES01_0006_H02.b :
TES01_0094_B03.b :
TES01_0091_D09.b :
TES01_0002_B06.b :
TES01_0080_E03.b :
TES01_0098_E01.b :
TES01_0030_B11.b :
TES01_0071_F04.b :
TES01_0100_F11.b :
TES01_0100_H01.b :
TES01_0097_H04.b :
TES01_0014_F06.b :
TES01_0024_D10.b :
TES01_0105_B06.b :
TES01_0008_A03.b :
TES01_0051_G05.b :
TES01_0058_C01.b :
TES01_0026_H09.b :
TES01_0063_A09.b :
PTG01_0101_A06.b :
ITT01_0032_G06.b :
OVR01_0058_D12.b :
TES01_0039_F08.b :
ADR01_0101_H11.b :
TES01_0072_D11.b :
TES01_0078_C06.b :
TES01_0072_C03.b :
TES01_0090_E10.b :
TES01_0098_C06.b :
TES01_0059_D08.b :
TES01_0039_D03.b :
TES01_0091_F12.b :
TES01_0086_E08.b :
TES01_0016_B02.b :
TES01_0011_A11.b :
TES01_0049_D11.b :
KDN01_0065_E01.b :
TES01_0033_E11.b :
TES01_0025_E04.b :
TES01_0007_E09.b :
TES01_0070_C11.b :
TES01_0059_G09.b :
TES01_0018_F11.b :
TES01_0083_C04.b :
TES01_0069_D07.b :
TES01_0006_F12.b :
TES01_0072_B04.b :
TES01_0076_F02.b :
TCH01_0023_E11.b :
TES01_0061_E09.b :
TES01_0046_G10.b :
TES01_0096_F05.b :
TES01_0054_C03.b :
TES01_0094_B09.b :
TES01_0003_C11.b :
TES01_0005_B09.b :
PST01_0077_D12.b :
PST01_0095_E07.b :
KDN01_0071_A11.b :
TES01_0078_F12.b :
TES01_0066_E10.b :
THY01_0016_B07.b :
TES01_0014_G11.b :
UTR01_0102_D12.b :
LNG01_0085_B08.b :
ITT01_0049_A02.b :
THY01_0118_B07.b :
TES01_0097_F08.b :
SPL01_0104_E06.b :
TES01_0016_G11.b :
TES01_0107_G12.b :
TES01_0022_E12.b :
TES01_0093_H08.b :
SPL01_0001_H02.b :
OVR01_0085_C11.b :
OVR01_0034_G04.b :
LVRM1_0099_C05.b :
OVRM1_0020_H04.b :
OVRM1_0114_D01.b :
SMG01_0048_C10.b :
OVRM1_0116_E11.b :
UTR01_0013_A04.b :
OVR01_0098_B04.b :
THY01_0051_C04.b :
SPL01_0044_D11.b :
OVR01_0059_A05.b :
ADR01_0022_C09.b :
OVR01_0101_H08.b :
OVR01_0063_E06.b :
THY01_0059_F04.b :
SMG01_0035_B11.b :
MLN01_0041_A05.b :
TCH01_0076_C06.b :
OVR01_0036_E07.b :