[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-001821

Length: 1,704

Sequence [FASTA format sequence]
GAGAGGGGGC GGGAGCGGGT TCCGGGCGGT AGGCGGGGCT TCCTTGAGGA CCCCGGGCTG
GGCGCCGCCG CCGGCTCGTC TACCCTTTCC CTCAGCAGCC TCCTTTCAAC CTTGTCCCCC
CCCCAAGCCA GCGCGGCTTC TGGGGCAGCG GCGGCGGCAG CTCCCGTTCC TGCCGCATTT
CTCTTCCCTC CTTCCCTCCC CGCCAGATCT CCGAATTCGC CTGCCATGGC CTTACTCACT
GCGGCCGCCC GGCTCTTCGG AGCCAAGAAT GCATCCTGTC TTGTTCTTGC TGCCCGGCAT
GCCAGTGCTT CTTCCACGAA CTTAAAAGAC ATTTTGGCTG ACCTGATACC TAAGGAGCAA
GCCAGAATTA AGACCTTCAG GCAGCAACAC GGCAACACCG TGGTGGGCCA AATCACTGTG
GACATGATGT ATGGTGGCAT GAGAGGCATG AAGGGATTGG TGTATGAAAC ATCGGTTCTT
GATCCTGATG AGGGCATCCG TTTCCGAGGC TACAGTATCC CTGAATGCCA GAAAATGCTG
CCCAAGGCTA AGGGTGGGGA AGAACCGCTG CCAGAGGGCT TATTTTGGCT GCTGGTAACT
GGACAGATCC CAACAGAGGA GCAGGTGTCT TGGCTCTCAA AAGAGTGGGC AAAGAGGGCA
GCTCTGCCTT CCCATGTGGT CACCATGCTG GACAACTTTC CCACGAATCT ACACCCCATG
TCTCAGCTCA GTGCAGCCAT TACAGCCCTC AACAGTGAAA GTAACTTTGC CCGAGCATAT
GCAGAGGGTA TCCACCGAAC CAAGTACTGG GAGTTGATTT ATGAAGACTG TATGGATCTG
ATCGCAAAGC TACCTTGTGT TGCAGCAAAG ATCTACCGGA ATCTCTACCG GGAGGGCAGC
AGTATTGGGG CCATTGATTC TAAACTGGAC TGGTCCCACA ATTTCACCAA CATGTTAGGC
TATACTGATG CTCAGTTCAC GGAGCTCATG CGCTTGTACC TCACCATCCA CAGTGACCAT
GAAGGTGGCA ATGTAAGTGC TCATACCAGC CATTTGGTGG GCAGTGCCCT TTCAGACCCC
TACTTGTCCT TTGCAGCAGC CATGAATGGG CTGGCAGGGC CCCTACATGG GCTGGCAAAT
CAGGAAGTGC TTGTTTGGCT GACACAGCTG CAGAAGGAAG TCGGCAAAGA TGTGTCAGAT
GAGAAGTTAC GAGACTACAT CTGGAATACA CTCAACTCAG GACGGGTTGT CCCAGGCTAT
GGCCACGCAG TACTAAGGAA GACTGATCCA CGATATACCT GTCAAAGAGA GTTTGCTCTG
AAACACCTGC CTCATGACCC CATGTTTAAG CTGGTTGCTC AGCTGTACAA GATTGTGCCC
AATGTCCTCC TGGAACAGGG CAAGGCTAAG AATCCTTGGC CCAATGTGGA TGCTCACAGT
GGGGTGCTGC TCCAGTACTA TGGCATGACG GAGATGAACT ACTACACAGT CCTGTTCGGG
GTATCACGGG CACTGGGTGT ATTAGCACAG CTCATCTGGA GCCGAGCCTT AGGCTTCCCT
CTAGAGAGGC CCAAGTCCAT GAGCACAGAC GGTCTGATAA AACTTGTGGA CTCTAAGTGA
GGGTGAAACT GAAGACTGGG AAGAAACTAA CTACCAGAAA GTGAGGGATC TTTAAAAAAA
AAAAAAAAAG TATACTTTTG TTTC


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCScitrate synthase, mitochondrial precursor [Homo sapiens]. 9060.0O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCscitrate synthase, mitochondrial precursor [Mus musculus]. 9090.0O
Contig/Assembly ProteinCslcitrate synthase-like protein [Mus musculus]. 8600.0O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC474403PREDICTED: similar to citrate synthase [Canis familiaris]. 9290.0O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCScitrate synthase, mitochondrial precursor [Bos taurus]. 9130.0O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCScitrate synthase, mitochondrial precursor [Sus scrofa]. 9400.0O
Contig/Assembly ProteinLOC100621743PREDICTED: citrate synthase, mitochondrial-like [Sus scrofa]. 549e-156O
Contig/Assembly ProteinLOC100621640PREDICTED: citrate synthase, mitochondrial-like [Sus scrofa]. 2725e-73O
Contig/Assembly ProteinLOC100621942PREDICTED: hypothetical protein LOC100621942 [Sus scrofa]. 66.64e-11


Assembly Members: 806      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010004C04ADR01_0004_C04.bDB781858 
ADR010011C07ADR01_0011_C07.bDB782485 
ADR010017A02ADR01_0017_A02.bDB782979 
ADR010022B10ADR01_0022_B10.bDB783405 
ADR010033B01ADR01_0033_B01.bDB784393 
ADR010036C11ADR01_0036_C11.bDB784675 
ADR010047A04ADR01_0047_A04.bDB785640 
ADR010053D02ADR01_0053_D02.bDB786210 
ADR010053D12ADR01_0053_D12.bDB786220 AK389361
ADR010056E03ADR01_0056_E03.bDB786489 
ADR010077B03ADR01_0077_B03.bDB788314 
ADR010093C01ADR01_0093_C01.bDB789743 
AMP010073H05AMP01_0073_H05.bBW960279 
AMP010087F04AMP01_0087_F04.bBW961365 
BFLT10008A04BFLT1_0008_A04.bFS640584 
BFLT10011H08BFLT1_0011_H08.bFS640915 
BFLT10012B10BFLT1_0012_B10.bFS640936 
BFLT10014B06BFLT1_0014_B06.bFS641101 
BFLT10014D01BFLT1_0014_D01.bFS641118 
BFLT10017A02BFLT1_0017_A02.bFS641340 
BFLT10022A10BFLT1_0022_A10.bFS641757 
BFLT10026A02BFLT1_0026_A02.bFS642082 
BFLT10028G09BFLT1_0028_G09.bFS642312 
BFLT10034G05BFLT1_0034_G05.bFS642808 AK390176
BFLT10036F10BFLT1_0036_F10.bFS642957 
BFLT10038G04BFLT1_0038_G04.b  
BFLT10039G12BFLT1_0039_G12.bFS643216 
BFLT10045H02BFLT1_0045_H02.bFS643550 
BFLT10047A10BFLT1_0047_A10.bFS643659 
BFLT10048D09BFLT1_0048_D09.bFS643775 
BFLT10051A02BFLT1_0051_A02.bFS643992 
BFLT10054A04BFLT1_0054_A04.bFS644239 
BFLT10072G07BFLT1_0072_G07.bFS645744 
BFLT10074D04BFLT1_0074_D04.bFS645865 
BFLT10075A02BFLT1_0075_A02.bFS645908 
BFLT10076C04BFLT1_0076_C04.b  
BFLT10078F09BFLT1_0078_F09.bFS646175 
BFLT10080C06BFLT1_0080_C06.bFS646307 
BFLT10083B10BFLT1_0083_B10.bFS646542 
BFLT10084C08BFLT1_0084_C08.bFS646630 
BFLT10091G11BFLT1_0091_G11.bFS647254 
BFLT10094G11BFLT1_0094_G11.bFS647506 
BFLT10099B02BFLT1_0099_B02.bFS647873 
BFLT10099F12BFLT1_0099_F12.bFS647924 
BFLT10100B12BFLT1_0100_B12.bFS647965 
BFLT10101E01BFLT1_0101_E01.bHX201818 
BFLT10105A08BFLT1_0105_A08.bHX202112 
BFLT10106G08BFLT1_0106_G08.bHX202259 
BFLT10109D09BFLT1_0109_D09.bHX202488 
BFLT10112H09BFLT1_0112_H09.bHX202768 
BFLT10113C11BFLT1_0113_C11.bHX202804 
BFLT10115A10BFLT1_0115_A10.bHX202952 
BFLT10117A08BFLT1_0117_A08.bHX203112 
BFLT10118H01BFLT1_0118_H01.bHX203265 
BFLT10123F06BFLT1_0123_F06.bHX203658 
BFLT10125D10BFLT1_0125_D10.bHX203799 
BFLT10129D10BFLT1_0129_D10.bHX204117 
BFLT10133A07BFLT1_0133_A07.b  
BFLT10136B10BFLT1_0136_B10.bHX204589 
BFLT10138B01BFLT1_0138_B01.bHX204718 
BFLT10144F03BFLT1_0144_F03.bHX205126 
BFLT10145B08BFLT1_0145_B08.bHX205165 
BFLT10147C06BFLT1_0147_C06.bHX205278 
BFLT10148E06BFLT1_0148_E06.bHX205344 
BFLT10149D10BFLT1_0149_D10.bHX205401 
BFLT10149G09BFLT1_0149_G09.bHX205425 
CLNT10021C04CLNT1_0021_C04.bFS658697 
CLNT10043C12CLNT1_0043_C12.bFS660436 
CLNT10045B03CLNT1_0045_B03.bFS660584 
CLNT10065G10CLNT1_0065_G10.bFS662207 
CLNT10087C01CLNT1_0087_C01.bFS663313 
CLNT10093C02CLNT1_0093_C02.bFS663776 
CLNT10140B07CLNT1_0140_B07.bHX222205 
CLNT10150B12CLNT1_0150_B12.bHX222994 
CLNT10152G01CLNT1_0152_G01.bHX223195 
HTMT10133F03HTMT1_0133_F03.b  
ITT010001G11ITT01_0001_G11.bBW976115 
ITT010006H06ITT01_0006_H06.bBW976578 
ITT010009G02ITT01_0009_G02.bBW976837 
ITT010010D07ITT01_0010_D07.bBW976901 
ITT010011B07ITT01_0011_B07.bBW976972 
ITT010032E10ITT01_0032_E10.bBW978892 
ITT010033E04ITT01_0033_E04.bBW978977 
ITT010038F07ITT01_0038_F07.bBW979447 
ITT010051E01ITT01_0051_E01.bBW980522 
ITT010057F02ITT01_0057_F02.bBW981082 
ITT010058H06ITT01_0058_H06.bBW981199 
ITT010060A10ITT01_0060_A10.bBW981304 
ITT010075C12ITT01_0075_C12.bBW982667 
ITT010078D08ITT01_0078_D08.bBW982930 
ITT010080A08ITT01_0080_A08.bBW983073 
ITT010081E02ITT01_0081_E02.bBW983204 
ITT010081H12ITT01_0081_H12.bBW983248 
ITT010083A11ITT01_0083_A11.bBW983349 
ITT010083A12ITT01_0083_A12.bBW983350 
ITT010089A11ITT01_0089_A11.bBW983870 
ITT010093C01ITT01_0093_C01.bBW984245 
ITT010095F03ITT01_0095_F03.bBW984459 
ITT010102C12ITT01_0102_C12.bBW985072 
KDN010001B10KDN01_0001_B10.b  
KDN010002E08KDN01_0002_E08.bFS671420 
KDN010004G02KDN01_0004_G02.bFS671510 
KDN010006A05KDN01_0006_A05.bFS671599 
KDN010006D10KDN01_0006_D10.bFS671634 
KDN010007G01KDN01_0007_G01.bFS671738 
KDN010008B07KDN01_0008_B07.bFS671771 
KDN010009B04KDN01_0009_B04.bFS671849 
KDN010010E11KDN01_0010_E11.bFS671948 
KDN010010F03KDN01_0010_F03.bFS671952 
KDN010011G04KDN01_0011_G04.bFS672040 
KDN010018E04KDN01_0018_E04.bFS672555 
KDN010019E02KDN01_0019_E02.bFS672626 
KDN010021E09KDN01_0021_E09.bFS672772 
KDN010021H06KDN01_0021_H06.bFS672800 
KDN010022E04KDN01_0022_E04.bHX234756 
KDN010023B10KDN01_0023_B10.bFS672907 
KDN010024B07KDN01_0024_B07.bFS672983 
KDN010024B10KDN01_0024_B10.bFS672986 
KDN010024G05KDN01_0024_G05.bFS673035 
KDN010025D12KDN01_0025_D12.bFS673085 
KDN010025G04KDN01_0025_G04.bFS673109 
KDN010028G12KDN01_0028_G12.bFS673348 
KDN010029E10KDN01_0029_E10.bFS673408 
KDN010030E11KDN01_0030_E11.bFS673490 
KDN010033A04KDN01_0033_A04.bFS673680 
KDN010033B07KDN01_0033_B07.bFS673693 
KDN010033C03KDN01_0033_C03.bFS673700 
KDN010034H07KDN01_0034_H07.bFS673827 
KDN010034H12KDN01_0034_H12.bFS673830 
KDN010037A07KDN01_0037_A07.b  
KDN010040C10KDN01_0040_C10.b  
KDN010041D12KDN01_0041_D12.b  
KDN010042B04KDN01_0042_B04.bFS674106 
KDN010043C02KDN01_0043_C02.bFS674181 
KDN010045C06KDN01_0045_C06.b  
KDN010045D10KDN01_0045_D10.b  
KDN010045E10KDN01_0045_E10.bFS674344 
KDN010045G06KDN01_0045_G06.bFS674349 
KDN010050E07KDN01_0050_E07.bFS674511 
KDN010052F10KDN01_0052_F10.bFS674609 
KDN010052G01KDN01_0052_G01.bFS674610 
KDN010053B05KDN01_0053_B05.bFS674637 
KDN010053C03KDN01_0053_C03.bFS674646 
KDN010054F11KDN01_0054_F11.bFS674759 
KDN010055B02KDN01_0055_B02.bFS674792 
KDN010055B05KDN01_0055_B05.bFS674794 
KDN010055E06KDN01_0055_E06.bFS674823 
KDN010057D10KDN01_0057_D10.bFS674969 
KDN010058G02KDN01_0058_G02.bFS675073 
KDN010059E04KDN01_0059_E04.bFS675136 
KDN010060A11KDN01_0060_A11.bFS675178 
KDN010061C03KDN01_0061_C03.bFS675270 
KDN010063C12KDN01_0063_C12.bFS675447 
KDN010064E01KDN01_0064_E01.bFS675544 
KDN010066H08KDN01_0066_H08.bFS675737 
KDN010067A12KDN01_0067_A12.bFS675752 
KDN010067C10KDN01_0067_C10.bFS675771 
KDN010067F02KDN01_0067_F02.bFS675791 
KDN010068B03KDN01_0068_B03.bFS675833 
KDN010068C06KDN01_0068_C06.bFS675846 
KDN010068H07KDN01_0068_H07.bFS675883 
KDN010069F11KDN01_0069_F11.bFS675944 
KDN010070H10KDN01_0070_H10.bFS676045 
KDN010073E10KDN01_0073_E10.bFS676257 
KDN010073F12KDN01_0073_F12.bFS676271 
KDN010073G01KDN01_0073_G01.bFS676272 
KDN010075B06KDN01_0075_B06.bFS676392 
KDN010078D04KDN01_0078_D04.bFS676642 
KDN010080A09KDN01_0080_A09.bFS676768 
KDN010080H04KDN01_0080_H04.bFS676834 
KDN010081E03KDN01_0081_E03.bFS676882 
KDN010082D02KDN01_0082_D02.bFS676948 
KDN010083C09KDN01_0083_C09.bFS677015 
KDN010085D05KDN01_0085_D05.bFS677182 
KDN010087C11KDN01_0087_C11.bFS677328 
KDN010087D01KDN01_0087_D01.bFS677330 
KDN010088B07KDN01_0088_B07.bFS677400 
KDN010088C11KDN01_0088_C11.bFS677412 
KDN010089H02KDN01_0089_H02.bFS677541 
KDN010090D02KDN01_0090_D02.bFS677579 
KDN010091C07KDN01_0091_C07.bFS677655 
KDN010091E03KDN01_0091_E03.bFS677672 
KDN010091F10KDN01_0091_F10.bFS677689 
KDN010092E12KDN01_0092_E12.bFS677762 
KDN010093F05KDN01_0093_F05.bFS677849 
KDN010094H06KDN01_0094_H06.bFS677956 
KDN010095D07KDN01_0095_D07.bFS678001 
KDN010096B04KDN01_0096_B04.bFS678059 
KDN010096H05KDN01_0096_H05.bFS678113 
KDN010098F02KDN01_0098_F02.bFS678238 
KDN010099B10KDN01_0099_B10.bFS678287 
KDN010099E09KDN01_0099_E09.bFS678319 
LNG010002D01LNG01_0002_D01.bBP435941 
LNG010004D01LNG01_0004_D01.bBP435943 AK231644
LNG010009H08LNG01_0009_H08.bBP440531 
LNG010011A09LNG01_0011_A09.bBP433669 
LNG010011F12LNG01_0011_F12.bBP438882 
LNG010017E09LNG01_0017_E09.bBP437610 
LNG010019A06LNG01_0019_A06.bBP433427 
LNG010022C09LNG01_0022_C09.bBP435633 
LNG010030E10LNG01_0030_E10.bBP437709 
LNG010056E07LNG01_0056_E07.bBP437461 
LNG010057B09LNG01_0057_B09.bBP434663 
LNG010064G12LNG01_0064_G12.bBP439914 
LNG010065C04LNG01_0065_C04.bBP435236 
LNG010080H04LNG01_0080_H04.bBP440264 
LNG010088D04LNG01_0088_D04.bBP436257 
LNG010099B05LNG01_0099_B05.bBP434375 
LNG010108F10LNG01_0108_F10.bBP438786 
LVR010001C04LVR01_0001_C04.bBP443012 
LVR010036G04LVR01_0036_G04.bBP446566 
LVR010054G10LVR01_0054_G10.bBP447021 
LVR010066A08LVR01_0066_A08.bBP441540 
LVRM10004G10LVRM1_0004_G10.bCJ001127 
LVRM10033B01LVRM1_0033_B01.bCJ001217 
LVRM10033F02LVRM1_0033_F02.bCJ001262 
LVRM10053F06LVRM1_0053_F06.bBP140020 
LVRM10081B03LVRM1_0081_B03.bCJ002428 
LVRM10087C04LVRM1_0087_C04.bCJ002945 
LVRM10087C11LVRM1_0087_C11.bCJ002952 
LVRM10093B09LVRM1_0093_B09.bCJ003439 
LVRM10111C05LVRM1_0111_C05.bBP449999 
LVRM10114C09LVRM1_0114_C09.bBP450282 
LVRM10116H07LVRM1_0116_H07.bBP454250 
LVRM10135E07LVRM1_0135_E07.bBP451826 
LVRM10148G01LVRM1_0148_G01.bBP453031 
LVRM10154D01LVRM1_0154_D01.bBP450605 
LVRM10174D07LVRM1_0174_D07.bCJ004972 
LVRM10185E01LVRM1_0185_E01.bCJ005869 
LVRM10197E10LVRM1_0197_E10.bCJ006775 
MLN010006G10MLN01_0006_G10.b  
MLN010009G04MLN01_0009_G04.bCJ008419 
MLN010021C05MLN01_0021_C05.bCJ009221 
MLN010028B02MLN01_0028_B02.bCJ009782 
MLN010037D12MLN01_0037_D12.bCJ010538 
MLN010082A04MLN01_0082_A04.bCJ014138 
MLN010088B08MLN01_0088_B08.bCJ014665 
MLTL10009G08MLTL1_0009_G08.bFS679213 
MLTL10099G07MLTL1_0099_G07.bFS686278 
OVR010010H06OVR01_0010_H06.bBP144589 
OVR010013H03OVR01_0013_H03.bBP144475 
OVR010020G06OVR01_0020_G06.bBP144145 
OVR010028H06OVR01_0028_H06.bBP144601 
OVR010031C03OVR01_0031_C03.bBP142227 
OVR010033E10OVR01_0033_E10.bBP143389 
OVR010035G05OVR01_0035_G05.bBP144122 
OVR010040F04OVR01_0040_F04.bBP143620 
OVR010055B10OVR01_0055_B10.bBW964496 
OVR010056C05OVR01_0056_C05.bBW964591 
OVR010060C11OVR01_0060_C11.bBW964959 
OVR010061C07OVR01_0061_C07.bBW965046 
OVR010065A09OVR01_0065_A09.bBW965375 
OVR010065F08OVR01_0065_F08.bBW965429 
OVR010067A10OVR01_0067_A10.bBW965552 
OVR010067D07OVR01_0067_D07.bBW965581 
OVR010076F06OVR01_0076_F06.bBW966402 
OVR010081B03OVR01_0081_B03.bBW966737 
OVR010094H03OVR01_0094_H03.bBW967713 
OVR010101F03OVR01_0101_F03.bBW968243 
OVRM10002C06OVRM1_0002_C06.bBP456925 
OVRM10009A08OVRM1_0009_A08.bBP145585 
OVRM10012D10OVRM1_0012_D10.bBP149601 
OVRM10014C12OVRM1_0014_C12.bBP148554 
OVRM10018D12OVRM1_0018_D12.bBP458375 
OVRM10019F06OVRM1_0019_F06.bBP459824 
OVRM10028D12OVRM1_0028_D12.bBP149834 
OVRM10031A05OVRM1_0031_A05.bBP145273 
OVRM10037H07OVRM1_0037_H07.bBP461823 
OVRM10041A11OVRM1_0041_A11.bBP455406 
OVRM10041G05OVRM1_0041_G05.bBP460734 
OVRM10046F02OVRM1_0046_F02.bBP151258 
OVRM10047C12OVRM1_0047_C12.bBP148570 
OVRM10047H06OVRM1_0047_H06.bBP154239 
OVRM10048H01OVRM1_0048_H01.bBP461378 
OVRM10055E09OVRM1_0055_E09.bBP150736 
OVRM10058E05OVRM1_0058_E05.bBP150337 
OVRM10058F11OVRM1_0058_F11.bBP152210 
OVRM10059E12OVRM1_0059_E12.bBP151075 
OVRM10060G04OVRM1_0060_G04.bBP152706 
OVRM10061D02OVRM1_0061_D02.bBP148782 
OVRM10072A05OVRM1_0072_A05.bBP145302 
OVRM10072D03OVRM1_0072_D03.bBP148898 
OVRM10078E11OVRM1_0078_E11.bBP150979 
OVRM10078G04OVRM1_0078_G04.bBP152723 
OVRM10079B12OVRM1_0079_B12.bBP147356 
OVRM10080G08OVRM1_0080_G08.bBP153153 
OVRM10081F08OVRM1_0081_F08.bBP151910 
OVRM10081G11OVRM1_0081_G11.bBP153500 
OVRM10082H09OVRM1_0082_H09.bBP154612 
OVRM10083D08OVRM1_0083_D08.bBP149431 
OVRM10088A11OVRM1_0088_A11.bBP145976 
OVRM10093A05OVRM1_0093_A05.bBP145321 
OVRM10094G06OVRM1_0094_G06.bBP152953 
OVRM10100C03OVRM1_0100_C03.bBP147650 
OVRM10103D04OVRM1_0103_D04.bBP149037 
OVRM10112G08OVRM1_0112_G08.bBP153183 
OVRM10113H08OVRM1_0113_H08.bBP154532 
OVRM10116B01OVRM1_0116_B01.b  
OVRM10120E06OVRM1_0120_E06.bBP150493 
OVRM10127B01OVRM1_0127_B01.bBP146224 
OVRM10130A10OVRM1_0130_A10.bBP145901 
OVRM10133G04OVRM1_0133_G04.bBP152772 
OVRM10152C07OVRM1_0152_C07.bBP457026 
OVRM10152E10OVRM1_0152_E10.bBP459187 
OVRM10156D09OVRM1_0156_D09.bBP458148 
OVRM10162D08OVRM1_0162_D08.bBP458070 
OVRM10166H10OVRM1_0166_H10.bBP462095 
OVRM10167G02OVRM1_0167_G02.bBP460511 
OVRM10169H04OVRM1_0169_H04.bBP461626 
OVRM10172F02OVRM1_0172_F02.bBP459516 
OVRM10172F03OVRM1_0172_F03.bBP459597 
OVRM10173A01OVRM1_0173_A01.bBP454682 
OVRM10175C07OVRM1_0175_C07.bBP457049 
OVRM10179A12OVRM1_0179_A12.bCJ016124 
OVRM10184C10OVRM1_0184_C10.bBP457281 
OVRM10185E01OVRM1_0185_E01.bBP458496 
OVRM10186G01OVRM1_0186_G01.bBP460443 
OVRM10187E02OVRM1_0187_E02.bBP458574 
OVRM10189G10OVRM1_0189_G10.bBP461172 
OVRM10194A11OVRM1_0194_A11.bBP455444 
OVRM10196E03OVRM1_0196_E03.bBP458665 
OVRM10196H10OVRM1_0196_H10.bBP462113 
OVRM10203H09OVRM1_0203_H09.bBP462043 
OVRM10209H05OVRM1_0209_H05.bBP461728 
OVRM10214D07OVRM1_0214_D07.bBP458031 
OVRM10219F08OVRM1_0219_F08.bBP460060 
OVRM10221H09OVRM1_0221_H09.bBP462061 
OVRM10225E07OVRM1_0225_E07.bBP459010 
OVRT10002A07OVRT1_0002_A07.bFS686504 
OVRT10003B02OVRT1_0003_B02.bFS686596 
OVRT10004G06OVRT1_0004_G06.bFS686735 
OVRT10005F08OVRT1_0005_F08.bFS686809 
OVRT10006A03OVRT1_0006_A03.bFS686832 
OVRT10008A04OVRT1_0008_A04.bFS687011 
OVRT10008H09OVRT1_0008_H09.bFS687089 
OVRT10009C03OVRT1_0009_C03.bFS687112 
OVRT10009E09OVRT1_0009_E09.bFS687138 
OVRT10010D12OVRT1_0010_D12.bFS687206 
OVRT10012B05OVRT1_0012_B05.bFS687346 
OVRT10013D01OVRT1_0013_D01.bFS687450 
OVRT10016D12OVRT1_0016_D12.bFS687714 
OVRT10016H01OVRT1_0016_H01.bFS687748 
OVRT10018A11OVRT1_0018_A11.bFS687841 
OVRT10018G12OVRT1_0018_G12.bFS687902 
OVRT10022B01OVRT1_0022_B01.bFS688165 
OVRT10028A12OVRT1_0028_A12.bFS688672 
OVRT10028G02OVRT1_0028_G02.bFS688710 
OVRT10031B04OVRT1_0031_B04.bFS688892 
OVRT10034G05OVRT1_0034_G05.bFS689190 
OVRT10039D08OVRT1_0039_D08.bFS689582 
OVRT10039E05OVRT1_0039_E05.bFS689591 
OVRT10041B05OVRT1_0041_B05.bFS689723 
OVRT10041G02OVRT1_0041_G02.bFS689771 
OVRT10044E05OVRT1_0044_E05.bFS690005 
OVRT10045A03OVRT1_0045_A03.bFS690044 
OVRT10046C03OVRT1_0046_C03.bFS690133 
OVRT10046G06OVRT1_0046_G06.bFS690182 
OVRT10053A12OVRT1_0053_A12.bFS690702 
OVRT10055D05OVRT1_0055_D05.bFS690891 
OVRT10056A02OVRT1_0056_A02.bFS690936 
OVRT10056E10OVRT1_0056_E10.bFS690987 
OVRT10057B04OVRT1_0057_B04.bFS691033 
OVRT10057C01OVRT1_0057_C01.bFS691038 
OVRT10058E10OVRT1_0058_E10.bFS691155 
OVRT10059C09OVRT1_0059_C09.bFS691211 
OVRT10062H10OVRT1_0062_H10.bFS691512 
OVRT10063B03OVRT1_0063_B03.bFS691525 
OVRT10066B06OVRT1_0066_B06.bFS691785 
OVRT10066E09OVRT1_0066_E09.bFS691817 
OVRT10068D03OVRT1_0068_D03.bFS691967 
OVRT10069E11OVRT1_0069_E11.bFS692064 
OVRT10069G08OVRT1_0069_G08.bFS692084 
OVRT10071A04OVRT1_0071_A04.bFS692180 
OVRT10075C09OVRT1_0075_C09.bFS692510 
OVRT10076B09OVRT1_0076_B09.bFS692579 
OVRT10076F10OVRT1_0076_F10.bFS692621 
OVRT10077B10OVRT1_0077_B10.bFS692660 
OVRT10082A02OVRT1_0082_A02.bFS693054 
OVRT10082D12OVRT1_0082_D12.bFS693092 
OVRT10083A03OVRT1_0083_A03.bFS693132 
OVRT10087B03OVRT1_0087_B03.bFS693469 
OVRT10088C07OVRT1_0088_C07.bFS693562 
OVRT10089G01OVRT1_0089_G01.bFS693682 
OVRT10094G01OVRT1_0094_G01.bFS694096 
OVRT10095G09OVRT1_0095_G09.bFS694186 
OVRT10096F05OVRT1_0096_F05.bFS694252 
OVRT10098D12OVRT1_0098_D12.bFS694407 
OVRT10100A09OVRT1_0100_A09.bFS694544 
OVRT10101F07OVRT1_0101_F07.bHX234886 
OVRT10101G04OVRT1_0101_G04.bHX234895 
OVRT10108D06OVRT1_0108_D06.bHX235437 
OVRT10110B01OVRT1_0110_B01.bHX235580 
OVRT10110D10OVRT1_0110_D10.bHX235609 
OVRT10110E01OVRT1_0110_E01.bHX235612 
OVRT10111D10OVRT1_0111_D10.bHX235693 
OVRT10113D04OVRT1_0113_D04.bHX235853 
OVRT10113D06OVRT1_0113_D06.bHX235855 
OVRT10113G02OVRT1_0113_G02.bHX235883 
OVRT10115A10OVRT1_0115_A10.bHX235999 
OVRT10116E04OVRT1_0116_E04.bHX236117 
OVRT10118C11OVRT1_0118_C11.bHX236275 
OVRT10119A09OVRT1_0119_A09.b  
OVRT10120A07OVRT1_0120_A07.bHX236412 
OVRT10121B10OVRT1_0121_B10.bHX236489 
OVRT10122C01OVRT1_0122_C01.bHX236569 
OVRT10126B09OVRT1_0126_B09.bHX236880 
OVRT10128D02OVRT1_0128_D02.bHX237053 
OVRT10128D07OVRT1_0128_D07.bHX237057 
OVRT10132G05OVRT1_0132_G05.bHX237404 
OVRT10133E08OVRT1_0133_E08.bHX237460 
OVRT10139A11OVRT1_0139_A11.bHX237911 
OVRT10140G11OVRT1_0140_G11.bHX238053 
OVRT10142A10OVRT1_0142_A10.bHX238161 
OVRT10144B10OVRT1_0144_B10.bHX238343 
OVRT10146C04OVRT1_0146_C04.bHX238510 
OVRT10151F01OVRT1_0151_F01.bHX238953 
PBL010003D12PBL01_0003_D12.bBP155806 
PBL010010C09PBL01_0010_C09.bBW969102 
PBL010011G03PBL01_0011_G03.bBW969231 
PBL010017F04PBL01_0017_F04.bBW969532 
PBL010068G08PBL01_0068_G08.bBW972288 
PBL010080F06PBL01_0080_F06.bBW973295 
PBL010103F12PBL01_0103_F12.bBW975263 
PCT010007A05PCT01_0007_A05.bFS695057 
PCT010009A10PCT01_0009_A10.b  
PCT010011A09PCT01_0011_A09.bFS695362 
PCT010014F06PCT01_0014_F06.bFS695592 
PCT010018H11PCT01_0018_H11.b  
PCT010021E09PCT01_0021_E09.bFS696033 
PCT010022F06PCT01_0022_F06.bFS696111 
PCT010022H02PCT01_0022_H02.bFS696127 
PCT010023F06PCT01_0023_F06.bFS696185 
PCT010031C07PCT01_0031_C07.bFS696679 
PCT010032F12PCT01_0032_F12.bFS696765 
PCT010035E09PCT01_0035_E09.b  
PCT010036A12PCT01_0036_A12.bFS697004 
PCT010036C09PCT01_0036_C09.bFS697022 
PST010001G09PST01_0001_G09.bFS697125 
PST010002B04PST01_0002_B04.bFS697148 
PST010002B11PST01_0002_B11.bFS697155 
PST010002G08PST01_0002_G08.bFS697192 
PST010003B12PST01_0003_B12.bFS697217 
PST010003C05PST01_0003_C05.bFS697222 
PST010003F08PST01_0003_F08.b  
PST010004C05PST01_0004_C05.bFS697298 
PST010004G07PST01_0004_G07.bFS697335 
PST010004G12PST01_0004_G12.bFS697340 
PST010005E05PST01_0005_E05.bFS697393 
PST010006G08PST01_0006_G08.bFS697490 
PST010007B09PST01_0007_B09.bFS697523 
PST010007C03PST01_0007_C03.bFS697528 
PST010007D04PST01_0007_D04.bFS697539 
PST010007F07PST01_0007_F07.bFS697561 
PST010008D07PST01_0008_D07.bFS697620 
PST010009C05PST01_0009_C05.bFS697683 
PST010009H10PST01_0009_H10.bFS697739 
PST010010H06PST01_0010_H06.bFS697818 
PST010012A07PST01_0012_A07.bFS697910 
PST010012B03PST01_0012_B03.bFS697915 
PST010012B07PST01_0012_B07.bFS697919 
PST010013A02PST01_0013_A02.bFS697979 
PST010013G12PST01_0013_G12.bFS698044 
PST010013H03PST01_0013_H03.bFS698047 
PST010014B06PST01_0014_B06.bFS698071 
PST010014E11PST01_0014_E11.bFS698104 
PST010015D05PST01_0015_D05.bFS698167 
PST010015E01PST01_0015_E01.bFS698174 
PST010016H11PST01_0016_H11.bFS698279 
PST010017A04PST01_0017_A04.bFS698282 
PST010017F07PST01_0017_F07.bFS698333 
PST010018B03PST01_0018_B03.bFS698368 
PST010018C11PST01_0018_C11.bFS698386 
PST010019E03PST01_0019_E03.bFS698476 
PST010019F10PST01_0019_F10.bFS698492 
PST010020D02PST01_0020_D02.bFS698546 
PST010020F03PST01_0020_F03.bFS698568 
PST010022A01PST01_0022_A01.bFS698675 
PST010022C10PST01_0022_C10.bFS698705 
PST010022H09PST01_0022_H09.bFS698758 
PST010023A11PST01_0023_A11.bFS698770 
PST010023F04PST01_0023_F04.bFS698818 
PST010024A10PST01_0024_A10.bFS698855 
PST010024B02PST01_0024_B02.bFS698858 AK396408
PST010025F02PST01_0025_F02.bFS698965 
PST010025G01PST01_0025_G01.bFS698976 
PST010026D01PST01_0026_D01.bFS699028 
PST010026G08PST01_0026_G08.bFS699063 
PST010026H07PST01_0026_H07.bFS699073 
PST010027G11PST01_0027_G11.bFS699142 
PST010027H03PST01_0027_H03.bFS699146 
PST010029D01PST01_0029_D01.b  
PST010029D05PST01_0029_D05.b  
PST010029F01PST01_0029_F01.bFS699252 
PST010029G03PST01_0029_G03.bFS699257 
PST010031F03PST01_0031_F03.b  
PST010031G02PST01_0031_G02.bFS699340 
PST010032B07PST01_0032_B07.b  
PST010032G01PST01_0032_G01.b  
PST010033A07PST01_0033_A07.bFS699396 
PST010033C12PST01_0033_C12.bFS699423 
PST010033G06PST01_0033_G06.bFS699458 
PST010034B02PST01_0034_B02.bFS699482 
PST010034G06PST01_0034_G06.bFS699532 
PST010035E12PST01_0035_E12.bFS699593 
PST010035F02PST01_0035_F02.bFS699595 
PST010035F10PST01_0035_F10.bFS699601 
PST010036C10PST01_0036_C10.bFS699648 
PST010038D05PST01_0038_D05.bFS699803 
PST010038D08PST01_0038_D08.bFS699806 
PST010038F03PST01_0038_F03.bFS699823 
PST010038H05PST01_0038_H05.bFS699845 
PST010039G07PST01_0039_G07.bFS699918 
PST010040A03PST01_0040_A03.bFS699935 
PST010040B09PST01_0040_B09.bFS699948 
PST010042A09PST01_0042_A09.bFS700101 
PST010042D09PST01_0042_D09.bFS700135 
PST010042E06PST01_0042_E06.bFS700141 
PST010042H12PST01_0042_H12.bFS700177 
PST010043E01PST01_0043_E01.bFS700217 
PST010043H03PST01_0043_H03.bFS700251 
PST010044B07PST01_0044_B07.bFS700277 
PST010046B03PST01_0046_B03.bFS700427 
PST010047G11PST01_0047_G11.bFS700561 
PST010048B12PST01_0048_B12.bFS700594 
PST010048F02PST01_0048_F02.bFS700627 
PST010049H12PST01_0049_H12.bFS700738 
PST010050G05PST01_0050_G05.bFS700806 
PST010051D06PST01_0051_D06.bFS700858 
PST010051G01PST01_0051_G01.bFS700885 
PST010052B03PST01_0052_B03.bFS700917 
PST010052F01PST01_0052_F01.bFS700956 
PST010052H08PST01_0052_H08.bFS700981 
PST010053A12PST01_0053_A12.bFS700996 
PST010054G04PST01_0054_G04.bFS701132 
PST010056B02PST01_0056_B02.bFS701240 
PST010056H01PST01_0056_H01.bFS701295 
PST010057A05PST01_0057_A05.bFS701307 
PST010057F09PST01_0057_F09.bFS701359 
PST010058B06PST01_0058_B06.bFS701397 
PST010058C05PST01_0058_C05.bFS701408 
PST010058F03PST01_0058_F03.bFS701435 
PST010059C04PST01_0059_C04.bFS701487 
PST010059G12PST01_0059_G12.bFS701533 
PST010060C08PST01_0060_C08.bFS701569 
PST010061A04PST01_0061_A04.bFS701620 
PST010061B11PST01_0061_B11.bFS701634 
PST010062A11PST01_0062_A11.bFS701706 
PST010062C02PST01_0062_C02.bFS701719 
PST010062G03PST01_0062_G03.bFS701765 
PST010062H02PST01_0062_H02.bFS701772 
PST010063A11PST01_0063_A11.bFS701792 
PST010063G03PST01_0063_G03.bFS701845 
PST010066C09PST01_0066_C09.bFS702042 
PST010067B03PST01_0067_B03.bFS702107 
PST010069F01PST01_0069_F01.bFS702305 
PST010070B08PST01_0070_B08.bFS702342 
PST010070C12PST01_0070_C12.bFS702351 
PST010070E12PST01_0070_E12.bFS702372 
PST010071B01PST01_0071_B01.bFS702408 
PST010071F03PST01_0071_F03.b  
PST010071H08PST01_0071_H08.bFS702469 
PST010072C06PST01_0072_C06.bFS702495 
PST010073A09PST01_0073_A09.bFS702548 
PST010074D10PST01_0074_D10.bFS702662 
PST010074F04PST01_0074_F04.bFS702678 
PST010074H05PST01_0074_H05.bFS702701 
PST010074H10PST01_0074_H10.bFS702706 
PST010075H09PST01_0075_H09.bFS702791 
PST010076E11PST01_0076_E11.bFS702840 
PST010077F01PST01_0077_F01.bFS702929 
PST010077H04PST01_0077_H04.bFS702955 
PST010079H09PST01_0079_H09.bFS703122 
PST010080F07PST01_0080_F07.bFS703176 
PST010080G05PST01_0080_G05.bFS703184 
PST010082D11PST01_0082_D11.b  
PST010082E02PST01_0082_E02.bFS703326 
PST010083E12PST01_0083_E12.bFS703419 
PST010083F03PST01_0083_F03.bFS703422 
PST010084F06PST01_0084_F06.bFS703504 
PST010085C09PST01_0085_C09.bFS703559 
PST010085D02PST01_0085_D02.b  
PST010086C01PST01_0086_C01.bFS703633 
PST010086C05PST01_0086_C05.b  
PST010086H08PST01_0086_H08.bFS703686 
PST010087B09PST01_0087_B09.bFS703711 
PST010088B05PST01_0088_B05.bFS703788 
PST010088B11PST01_0088_B11.bFS703792 
PST010088D03PST01_0088_D03.bFS703806 
PST010088H03PST01_0088_H03.bFS703846 
PST010089D07PST01_0089_D07.bFS703885 
PST010089H06PST01_0089_H06.bFS703923 
PST010091F05PST01_0091_F05.b  
PST010092H03PST01_0092_H03.bFS704159 
PST010093B02PST01_0093_B02.bFS704176 
PST010093G10PST01_0093_G10.bFS704227 
PST010094D03PST01_0094_D03.bFS704268 
PST010094G04PST01_0094_G04.bFS704299 
PST010095C09PST01_0095_C09.bFS704339 
PST010095F01PST01_0095_F01.bFS704361 
PST010095F02PST01_0095_F02.bFS704362 
PST010097C03PST01_0097_C03.bFS704482 
PST010097H12PST01_0097_H12.bFS704524 
PST010098C09PST01_0098_C09.bFS704548 
PST010099A01PST01_0099_A01.bFS704587 
PST010099A06PST01_0099_A06.bFS704591 
PST010099F03PST01_0099_F03.bFS704637 
PST010100G08PST01_0100_G08.b  
PST010100G09PST01_0100_G09.b  
PST010100H07PST01_0100_H07.bFS704727 
PTG010018D07PTG01_0018_D07.bFS705996 
PTG010022H06PTG01_0022_H06.bFS706374 
PTG010027H03PTG01_0027_H03.bFS706821 
PTG010033G06PTG01_0033_G06.bFS707341 
PTG010064C11PTG01_0064_C11.bFS709976 
PTG010104F10PTG01_0104_F10.bFS712875 
SKNB10048F09SKNB1_0048_F09.bDB802778 
SKNB10060C09SKNB1_0060_C09.bDB803596 
SKNB10081G02SKNB1_0081_G02.b  
SMG010013D07SMG01_0013_D07.bFS714373 
SMG010013H04SMG01_0013_H04.bFS714417 
SMG010016G08SMG01_0016_G08.bFS714678 
SMG010024D06SMG01_0024_D06.bFS715363 
SMG010027C09SMG01_0027_C09.bFS715630 
SMG010049C04SMG01_0049_C04.bFS717532 
SMG010061B10SMG01_0061_B10.bFS718517 
SMG010064F06SMG01_0064_F06.bFS718811 
SMG010071C07SMG01_0071_C07.bFS719391 
SMG010078F09SMG01_0078_F09.bFS720033 
SMG010087B08SMG01_0087_B08.bFS720766 
SMG010095G08SMG01_0095_G08.bFS721493 
SPL010009H06SPL01_0009_H06.bBP159188 
SPL010025C04SPL01_0025_C04.bBP157430 
SPL010030G02SPL01_0030_G02.bCJ016364 
SPL010055H02SPL01_0055_H02.bCJ018006 
SPL010067A09SPL01_0067_A09.bCJ019009 
SPL010083F11SPL01_0083_F11.bCJ020523 
SPL010088H11SPL01_0088_H11.bCJ020991 
SPL010091B01SPL01_0091_B01.bCJ021180 
SPL010103B02SPL01_0103_B02.bCJ022234 
SPL010103D09SPL01_0103_D09.bCJ022262 
SPL010104B05SPL01_0104_B05.bCJ022321 
SPLT10013F02SPLT1_0013_F02.bHX240210 
TCH010023H11TCH01_0023_H11.bCJ024168 
TCH010027D07TCH01_0027_D07.bCJ024437 
TCH010041A06TCH01_0041_A06.bCJ025468 
TCH010103F06TCH01_0103_F06.bCJ030000 
TES010001C12TES01_0001_C12.bCJ030045 
TES010002E08TES01_0002_E08.bCJ030121 
TES010002G02TES01_0002_G02.bCJ030136 
TES010002G04TES01_0002_G04.bCJ030138 
TES010003C12TES01_0003_C12.bCJ030184 
TES010004F04TES01_0004_F04.bCJ030265 
TES010005B08TES01_0005_B08.bFS722155 
TES010006A08TES01_0006_A08.bCJ030370 
TES010006B05TES01_0006_B05.bCJ030375 
TES010006C11TES01_0006_C11.bCJ030390 
TES010007C06TES01_0007_C06.bCJ030451 
TES010008H07TES01_0008_H07.bCJ030556 
TES010009A01TES01_0009_A01.bCJ030562 
TES010009A11TES01_0009_A11.bCJ030572 
TES010009B03TES01_0009_B03.bCJ030574 
TES010010C01TES01_0010_C01.bCJ030656 
TES010010E04TES01_0010_E04.bCJ030674 
TES010011D12TES01_0011_D12.bCJ030736 
TES010012C05TES01_0012_C05.bCJ030793 
TES010012G01TES01_0012_G01.bCJ030819 
TES010013E03TES01_0013_E03.bCJ030874 
TES010014G06TES01_0014_G06.bCJ030964 
TES010015E10TES01_0015_E10.bCJ031020 
TES010017B12TES01_0017_B12.bCJ031130 
TES010017C03TES01_0017_C03.bCJ031132 
TES010018A05TES01_0018_A05.bCJ031184 
TES010018E03TES01_0018_E03.bCJ031217 
TES010019B05TES01_0019_B05.bCJ031262 
TES010019C02TES01_0019_C02.bCJ031269 
TES010019D03TES01_0019_D03.b  
TES010019E04TES01_0019_E04.b  
TES010019G10TES01_0019_G10.bCJ031305 
TES010022E04TES01_0022_E04.bCJ031480 
TES010022F08TES01_0022_F08.bCJ031492 
TES010022F09TES01_0022_F09.bCJ031493 
TES010023C03TES01_0023_C03.bCJ031534 
TES010025D03TES01_0025_D03.bCJ031675 
TES010025D08TES01_0025_D08.bCJ031676 
TES010025D09TES01_0025_D09.bCJ031677 
TES010026B01TES01_0026_B01.bCJ031709 
TES010027C12TES01_0027_C12.bCJ031783 
TES010029A04TES01_0029_A04.bCJ031886 
TES010030D01TES01_0030_D01.bCJ031981 
TES010031H08TES01_0031_H08.bCJ032086 
TES010033A04TES01_0033_A04.bCJ032156 
TES010033C03TES01_0033_C03.bCJ032173 
TES010034A11TES01_0034_A11.bCJ032217 
TES010034B07TES01_0034_B07.bCJ032223 
TES010037C02TES01_0037_C02.bCJ032434 
TES010037H11TES01_0037_H11.bCJ032472 
TES010039E09TES01_0039_E09.bCJ032559 
TES010041A03TES01_0041_A03.bCJ032634 
TES010041F10TES01_0041_F10.bFS722202 
TES010041G12TES01_0041_G12.bCJ032681 
TES010042F07TES01_0042_F07.bCJ032730 
TES010043C04TES01_0043_C04.bCJ032777 
TES010043C06TES01_0043_C06.bCJ032778 
TES010043E01TES01_0043_E01.bCJ032791 
TES010047A04TES01_0047_A04.b  
TES010047A09TES01_0047_A09.b  
TES010049E11TES01_0049_E11.bCJ033136 
TES010050B01TES01_0050_B01.bCJ033168 
TES010050C02TES01_0050_C02.bCJ033179 
TES010050H09TES01_0050_H09.bCJ033227 
TES010051F07TES01_0051_F07.bCJ033277 
TES010052E06TES01_0052_E06.bCJ033337 
TES010053G10TES01_0053_G10.bCJ033402 
TES010053G11TES01_0053_G11.bCJ033403 
TES010054B05TES01_0054_B05.bCJ033424 
TES010054E08TES01_0054_E08.bCJ033442 
TES010054G03TES01_0054_G03.bCJ033454 
TES010054H04TES01_0054_H04.bCJ033460 
TES010055D02TES01_0055_D02.bCJ033488 
TES010057A02TES01_0057_A02.bCJ033610 
TES010057D12TES01_0057_D12.bCJ033637 
TES010057G08TES01_0057_G08.bCJ033662 
TES010058C06TES01_0058_C06.bCJ033701 
TES010059C10TES01_0059_C10.bCJ033769 
TES010059H03TES01_0059_H03.bCJ033811 
TES010060C05TES01_0060_C05.bCJ033841 
TES010062E09TES01_0062_E09.bCJ033993 
TES010062E10TES01_0062_E10.bCJ033994 
TES010064A09TES01_0064_A09.bFS722233 
TES010064E05TES01_0064_E05.bCJ034130 
TES010067E01TES01_0067_E01.bCJ034318 
TES010067H01TES01_0067_H01.bCJ034347 
TES010068E08TES01_0068_E08.bCJ034399 
TES010072C10TES01_0072_C10.bCJ034644 
TES010072D06TES01_0072_D06.bCJ034648 
TES010072H01TES01_0072_H01.bCJ034682 
TES010074B02TES01_0074_B02.bCJ034753 
TES010077C02TES01_0077_C02.bCJ034949 
TES010077G08TES01_0077_G08.bCJ034977 
TES010078E08TES01_0078_E08.bCJ035020 
TES010078E09TES01_0078_E09.bCJ035021 
TES010079E07TES01_0079_E07.bCJ035093 
TES010081D05TES01_0081_D05.bCJ035221 
TES010081G12TES01_0081_G12.bCJ035249 
TES010081H11TES01_0081_H11.bCJ035257 
TES010082D03TES01_0082_D03.bCJ035289 
TES010082E05TES01_0082_E05.bCJ035299 
TES010084D06TES01_0084_D06.bCJ035429 
TES010084G03TES01_0084_G03.bCJ035449 
TES010085H05TES01_0085_H05.b  
TES010086G12TES01_0086_G12.bCJ035590 
TES010088F01TES01_0088_F01.bCJ035704 
TES010089E01TES01_0089_E01.bCJ035770 
TES010089F06TES01_0089_F06.bCJ035783 
TES010091E10TES01_0091_E10.bCJ035902 
TES010091F01TES01_0091_F01.bCJ035905 
TES010091H08TES01_0091_H08.b  
TES010092E05TES01_0092_E05.bCJ035969 
TES010094F08TES01_0094_F08.bCJ036126 
TES010095D06TES01_0095_D06.bCJ036183 
TES010099B08TES01_0099_B08.bCJ036462 
TES010099E04TES01_0099_E04.bCJ036490 
TES010101F02TES01_0101_F02.bCJ036641 
TES010102D03TES01_0102_D03.bCJ036698 
TES010102E10TES01_0102_E10.bCJ036716 
TES010104B01TES01_0104_B01.bCJ036828 
TES010105C06TES01_0105_C06.bCJ036918 
TES010105H06TES01_0105_H06.bCJ036962 
TES010107C05TES01_0107_C05.bCJ037054 
TES010108D11TES01_0108_D11.b  
TES010110G03TES01_0110_G03.bCJ037278 
TES010110H05TES01_0110_H05.bCJ037287 
TES010112B08TES01_0112_B08.bCJ037379 
TES010112H07TES01_0112_H07.bCJ037431 
THY010007D06THY01_0007_D06.bBP163602 
THY010007E02THY01_0007_E02.bBP164438 
THY010010A04THY01_0010_A04.bBP159675 
THY010016C06THY01_0016_C06.bBP162362 
THY010032H03THY01_0032_H03.bBP168335 
THY010034B10THY01_0034_B10.bBP161540 
THY010038E12THY01_0038_E12.bBP165496 
THY010051G01THY01_0051_G01.bBP166862 
THY010056B10THY01_0056_B10.bBP161561 
THY010058B09THY01_0058_B09.bBP161457 
THY010068C05THY01_0068_C05.bBP162308 
THY010084G02THY01_0084_G02.bBP166994 
THY010091C11THY01_0091_C11.bBP162940 
THY010093H04THY01_0093_H04.bBP168491 
THY010096H11THY01_0096_H11.bBP169250 
THY010099D08THY01_0099_D08.bBP163875 
THY010100B06THY01_0100_B06.bBP161172 
THY010104D01THY01_0104_D01.bBP163161 
THY010108F09THY01_0108_F09.bBP166495 
THY010120B12THY01_0120_B12.bBP161818 
THY010121E01THY01_0121_E01.bBP164424 
THY010123G05THY01_0123_G05.bBP167347 
THY010203E03THY01_0203_E03.bBP164644 
THY010207A07THY01_0207_A07.bBP462495 
UTR010008C08UTR01_0008_C08.bBP170743 
UTR010021A05UTR01_0021_A05.bBP169548 
UTR010026E09UTR01_0026_E09.bBP171874 
UTR010032E06UTR01_0032_E06.bBP171745 
UTR010047D09UTR01_0047_D09.bBP171364 
UTR010054G08UTR01_0054_G08.bBP464569 
UTR010102A10UTR01_0102_A10.bCJ039291 
UTR010107A08UTR01_0107_A08.bCJ039750 

  

SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
345G507250.677OSCTG/L
T193610.323CTT/L


Alignment:      TOP

20110601C-001821 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
BFLT1_0034_G05.b : nggactcgtcagctgtacgaggxxxxxxxxxxxxxxxxxxxxxx
ADR01_0004_C04.b : nnttgtgaacaxxxxxxxxxxx
OVR01_0067_D07.b : nggattgtgctaagacx
SPL01_0067_A09.b : ttttagctaggactaaaacx
BFLT1_0105_A08.b : nnccccgatag
BFLT1_0129_D10.b : nnnnccgtc
TES01_0057_A02.b :
BFLT1_0017_A02.b : gggat
OVRM1_0196_H10.b :
LNG01_0080_H04.b : nnnttttgatagg
LNG01_0004_D01.b : gcatatcgctgacxxxx
OVRT1_0056_E10.b : nnngcgcttnnnnn
BFLT1_0011_H08.b : nga
ADR01_0053_D12.b :
ADR01_0053_D02.b :
THY01_0056_B10.b : txxxxxxxxxx
TES01_0037_C02.b :
HTMT1_0133_F03.b :
OVRM1_0179_A12.b :
TES01_0089_F06.b :
BFLT1_0112_H09.b : nnnnnnn
TES01_0019_D03.b :
CLNT1_0045_B03.b :
BFLT1_0038_G04.b :
OVRM1_0186_G01.b :
SMG01_0064_F06.b :
OVRT1_0140_G11.b : nngggcatt
OVRT1_0110_B01.b :
OVRT1_0094_G01.b : nggcc
ADR01_0033_B01.b :
TES01_0054_G03.b :
KDN01_0092_E12.b :
KDN01_0001_B10.b :
KDN01_0040_C10.b :
TES01_0008_H07.b :
KDN01_0073_G01.b :
OVRT1_0009_E09.b :
OVRT1_0005_F08.b :
SPLT1_0013_F02.b :
OVR01_0010_H06.b : caaacaaatgxxxxxxxxxx
ITT01_0057_F02.b :
OVRM1_0214_D07.b :
BFLT1_0106_G08.b :
LNG01_0088_D04.b :
AMP01_0087_F04.b : aaggaatttatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0087_B08.b :
OVRM1_0037_H07.b :
OVR01_0067_A10.b :
TES01_0043_C04.b :
BFLT1_0094_G11.b :
TES01_0072_C10.b :
PST01_0018_B03.b :
THY01_0093_H04.b :
TES01_0074_B02.b :
LVRM1_0081_B03.b :
OVRM1_0061_D02.b :
TES01_0082_D03.b :
TES01_0022_F08.b :
TES01_0005_B08.b :
CLNT1_0140_B07.b :
OVRT1_0004_G06.b :
KDN01_0066_H08.b :
KDN01_0060_A11.b :
TES01_0041_F10.b :
TES01_0004_F04.b :
BFLT1_0028_G09.b :
PST01_0035_F02.b :
PST01_0018_C11.b :
BFLT1_0099_F12.b :
TES01_0079_E07.b :
PST01_0040_A03.b :
TES01_0050_C02.b :
PST01_0054_G04.b :
OVRM1_0046_F02.b :
THY01_0123_G05.b :
OVRM1_0162_D08.b :
OVRM1_0088_A11.b :
THY01_0038_E12.b :
BFLT1_0076_C04.b :
OVRT1_0044_E05.b :
OVR01_0028_H06.b :
ITT01_0058_H06.b :
MLN01_0028_B02.b :
PTG01_0104_F10.b :
OVRT1_0132_G05.b :
UTR01_0021_A05.b :
BFLT1_0123_F06.b :
THY01_0121_E01.b :
SMG01_0095_G08.b :
SMG01_0071_C07.b :
PST01_0004_C05.b :
OVR01_0035_G05.b : ctttttttttttttttc
PCT01_0036_A12.b :
PST01_0063_A11.b :
KDN01_0004_G02.b :
PST01_0038_D08.b :
PCT01_0032_F12.b :
PST01_0058_B06.b :
PST01_0059_G12.b :
KDN01_0053_C03.b :
PST01_0087_B09.b :
KDN01_0095_D07.b :
PST01_0056_H01.b :
PST01_0080_G05.b :
PST01_0026_H07.b :
PST01_0051_G01.b :
KDN01_0019_E02.b :
PST01_0058_C05.b :
PST01_0091_F05.b :
PST01_0007_B09.b :
PST01_0085_C09.b :
OVRT1_0034_G05.b :
BFLT1_0080_C06.b :
TES01_0006_B05.b :
TES01_0089_E01.b :
OVRM1_0093_A05.b :
PTG01_0022_H06.b :
OVRM1_0184_C10.b :
TES01_0072_H01.b :
PST01_0002_B11.b :
TES01_0060_C05.b :
PCT01_0009_A10.b :
OVRT1_0142_A10.b :
OVR01_0060_C11.b :
SMG01_0013_D07.b :
PST01_0097_H12.b :
OVRT1_0028_G02.b :
PST01_0073_A09.b :
PST01_0100_G08.b :
TES01_0050_B01.b :
KDN01_0007_G01.b :
OVR01_0031_C03.b :
PST01_0095_C09.b :
KDN01_0091_F10.b :
BFLT1_0026_A02.b :
UTR01_0054_G08.b :
SKNB1_0081_G02.b :
TES01_0059_C10.b :
KDN01_0028_G12.b :
PST01_0057_F09.b :
PST01_0049_H12.b :
KDN01_0083_C09.b :
KDN01_0059_E04.b :
SKNB1_0048_F09.b :
PST01_0048_F02.b :
PST01_0050_G05.b :
PST01_0083_F03.b :
OVRT1_0057_C01.b :
OVRM1_0048_H01.b :
PTG01_0064_C11.b :
LVRM1_0087_C04.b :
OVRM1_0009_A08.b :
OVRM1_0081_G11.b :
SMG01_0049_C04.b :
OVRM1_0187_E02.b :
TES01_0064_A09.b :
OVRM1_0078_G04.b :
OVRM1_0002_C06.b :
OVRM1_0072_D03.b :
BFLT1_0145_B08.b :
TES01_0107_C05.b :
PCT01_0035_E09.b :
SPL01_0030_G02.b :
OVRT1_0110_E01.b :
ADR01_0022_B10.b :
TES01_0033_A04.b :
UTR01_0032_E06.b :
BFLT1_0109_D09.b :
PST01_0001_G09.b :
BFLT1_0074_D04.b :
BFLT1_0091_G11.b :
OVRT1_0088_C07.b :
OVRT1_0151_F01.b :
KDN01_0089_H02.b :
BFLT1_0047_A10.b :
KDN01_0045_C06.b :
CLNT1_0152_G01.b :
BFLT1_0008_A04.b :
BFLT1_0036_F10.b :
SMG01_0027_C09.b :
ITT01_0075_C12.b :
BFLT1_0113_C11.b :
BFLT1_0117_A08.b :
OVRT1_0062_H10.b :
PST01_0070_B08.b :
BFLT1_0115_A10.b :
ITT01_0081_E02.b :
PST01_0029_G03.b :
KDN01_0057_D10.b :
PST01_0074_H10.b :
PST01_0042_A09.b :
PST01_0066_C09.b :
PST01_0067_B03.b :
PST01_0071_B01.b :
KDN01_0010_F03.b :
PST01_0023_A11.b :
PST01_0047_G11.b :
TES01_0002_G04.b :
ITT01_0009_G02.b :
ITT01_0038_F07.b :
OVRT1_0046_C03.b :
KDN01_0055_B05.b :
ITT01_0001_G11.b :
TCH01_0103_F06.b :
OVRT1_0018_A11.b :
PST01_0098_C09.b :
SPL01_0103_B02.b :
LNG01_0057_B09.b :
SMG01_0016_G08.b :
OVRM1_0196_E03.b :
OVR01_0065_F08.b :
OVR01_0076_F06.b :
TES01_0112_H07.b :
OVRM1_0152_C07.b :
LVRM1_0087_C11.b :
OVRM1_0130_A10.b :
OVRM1_0058_F11.b :
UTR01_0102_A10.b :
SPL01_0025_C04.b :
TES01_0084_G03.b :
THY01_0007_D06.b :
UTR01_0008_C08.b :
PCT01_0022_F06.b :
SMG01_0024_D06.b :
BFLT1_0148_E06.b :
OVR01_0033_E10.b :
TES01_0051_F07.b :
OVRT1_0139_A11.b :
PBL01_0010_C09.b :
SPL01_0104_B05.b :
OVRT1_0101_G04.b :
OVRT1_0031_B04.b :
OVRT1_0016_H01.b :
ITT01_0093_C01.b :
PTG01_0033_G06.b :
OVRT1_0077_B10.b :
PST01_0002_G08.b :
PCT01_0018_H11.b :
BFLT1_0045_H02.b :
CLNT1_0021_C04.b :
TES01_0014_G06.b :
BFLT1_0022_A10.b :
BFLT1_0012_B10.b :
CLNT1_0093_C02.b :
OVRT1_0121_B10.b :
TES01_0042_F07.b :
PST01_0023_F04.b :
OVRT1_0058_E10.b :
PST01_0080_F07.b :
THY01_0203_E03.b :
PST01_0043_E01.b :
PST01_0060_C08.b :
PST01_0083_E12.b :
PST01_0031_G02.b :
PST01_0013_G12.b :
PST01_0100_H07.b :
SPL01_0103_D09.b :
LVR01_0001_C04.b :
KDN01_0006_D10.b :
CLNT1_0087_C01.b :
OVR01_0094_H03.b :
PST01_0082_D11.b :
PST01_0056_B02.b :
PST01_0035_E12.b :
PST01_0075_H09.b :
KDN01_0080_A09.b :
PST01_0006_G08.b :
PST01_0005_E05.b :
BFLT1_0078_F09.b :
OVRT1_0069_E11.b :
MLN01_0082_A04.b :
ITT01_0089_A11.b :
MLN01_0021_C05.b :
OVRT1_0041_G02.b :
OVRT1_0066_B06.b :
TCH01_0023_H11.b :
ITT01_0081_H12.b :
LNG01_0064_G12.b :
ITT01_0083_A12.b :
LVRM1_0111_C05.b :
BFLT1_0147_C06.b :
TES01_0062_E09.b :
TES01_0091_H08.b :
PST01_0071_F03.b :
TES01_0003_C12.b :
KDN01_0067_C10.b :
SKNB1_0060_C09.b :
OVRM1_0059_E12.b :
KDN01_0045_E10.b :
KDN01_0063_C12.b :
KDN01_0030_E11.b :
TES01_0095_D06.b :
TES01_0078_E09.b :
KDN01_0068_H07.b :
PST01_0052_F01.b :
PST01_0013_H03.b :
KDN01_0068_C06.b :
KDN01_0034_H07.b :
TES01_0062_E10.b :
TES01_0067_E01.b :
PST01_0086_C05.b :
KDN01_0008_B07.b :
PCT01_0014_F06.b :
TES01_0039_E09.b :
TES01_0052_E06.b :
PST01_0076_E11.b :
PST01_0085_D02.b :
PST01_0062_G03.b :
BFLT1_0099_B02.b :
MLN01_0006_G10.b :
PST01_0070_E12.b :
PST01_0094_D03.b :
OVRM1_0080_G08.b :
KDN01_0024_B10.b :
OVRT1_0119_A09.b :
LVRM1_0053_F06.b :
TES01_0081_D05.b :
LNG01_0002_D01.b :
LVRM1_0004_G10.b :
LVRM1_0154_D01.b :
OVRM1_0189_G10.b :
OVR01_0101_F03.b :
OVRT1_0063_B03.b :
PST01_0003_F08.b :
BFLT1_0138_B01.b :
LVR01_0066_A08.b :
KDN01_0052_F10.b :
SPL01_0088_H11.b :
OVRT1_0010_D12.b :
PST01_0017_F07.b :
OVRT1_0002_A07.b :
KDN01_0053_B05.b :
TES01_0029_A04.b :
PST01_0035_F10.b :
KDN01_0090_D02.b :
PST01_0038_D05.b :
KDN01_0068_B03.b :
PST01_0029_D05.b :
PST01_0088_B11.b :
KDN01_0055_B02.b :
PST01_0097_C03.b :
PST01_0026_G08.b :
OVRT1_0082_D12.b :
PST01_0089_H06.b :
ITT01_0033_E04.b :
ADR01_0077_B03.b :
ADR01_0056_E03.b :
PCT01_0031_C07.b :
KDN01_0037_A07.b :
TES01_0019_C02.b :
PST01_0040_B09.b :
KDN01_0021_E09.b :
PST01_0039_G07.b :
KDN01_0021_H06.b :
PST01_0020_F03.b :
BFLT1_0149_G09.b :
THY01_0058_B09.b :
LVRM1_0114_C09.b :
OVRT1_0009_C03.b :
PST01_0061_B11.b :
THY01_0096_H11.b :
KDN01_0075_B06.b :
THY01_0108_F09.b :
LVRM1_0185_E01.b :
LVRM1_0033_B01.b :
OVRM1_0028_D12.b :
OVRM1_0058_E05.b :
OVRM1_0203_H09.b :
OVRT1_0122_C01.b :
OVRT1_0053_A12.b :
OVRT1_0008_H09.b :
BFLT1_0083_B10.b :
OVRT1_0126_B09.b :
KDN01_0081_E03.b :
TES01_0043_E01.b :
PST01_0022_C10.b :
CLNT1_0150_B12.b :
TES01_0019_B05.b :
PST01_0062_C02.b :
KDN01_0070_H10.b :
TES01_0013_E03.b :
KDN01_0042_B04.b :
OVRT1_0055_D05.b :
OVRT1_0076_F10.b :
OVRT1_0083_A03.b :
LNG01_0065_C04.b :
PST01_0070_C12.b :
TES01_0102_E10.b :
OVRM1_0060_G04.b :
TES01_0082_E05.b :
LNG01_0009_H08.b :
TES01_0017_B12.b :
PTG01_0027_H03.b :
TES01_0022_E04.b :
OVRT1_0016_D12.b :
OVRT1_0108_D06.b :
PST01_0031_F03.b :
PST01_0077_F01.b :
PST01_0099_A01.b :
TES01_0009_A01.b :
PST01_0089_D07.b :
PST01_0059_C04.b :
PST01_0007_D04.b :
TES01_0054_E08.b :
KDN01_0098_F02.b :
PST01_0093_G10.b :
CLNT1_0043_C12.b :
OVR01_0081_B03.b :
OVR01_0013_H03.b :
OVRM1_0019_F06.b :
OVRM1_0185_E01.b :
OVRM1_0079_B12.b :
OVRM1_0047_C12.b :
THY01_0051_G01.b :
TES01_0099_E04.b :
OVRT1_0118_C11.b :
BFLT1_0084_C08.b :
OVRT1_0110_D10.b :
PST01_0004_G12.b :
BFLT1_0075_A02.b :
KDN01_0080_H04.b :
LNG01_0011_F12.b :
PST01_0051_D06.b :
UTR01_0047_D09.b :
PST01_0017_A04.b :
PBL01_0017_F04.b :
PST01_0004_G07.b :
TES01_0015_E10.b :
THY01_0091_C11.b :
KDN01_0094_H06.b :
PST01_0088_H03.b :
KDN01_0033_C03.b :
KDN01_0073_E10.b :
KDN01_0010_E11.b :
KDN01_0067_F02.b :
OVRT1_0059_C09.b :
OVRT1_0045_A03.b :
KDN01_0091_C07.b :
PST01_0062_A11.b :
PST01_0099_F03.b :
OVRT1_0082_A02.b :
OVR01_0020_G06.b :
THY01_0100_B06.b :
ITT01_0051_E01.b :
OVRT1_0096_F05.b :
OVRM1_0219_F08.b :
OVRM1_0156_D09.b :
THY01_0104_D01.b :
OVRM1_0221_H09.b :
TES01_0025_D09.b :
PBL01_0003_D12.b :
OVRM1_0175_C07.b :
LVRM1_0174_D07.b :
TES01_0064_E05.b :
OVRM1_0166_H10.b :
OVRM1_0113_H08.b :
OVRM1_0152_E10.b :
LVRM1_0197_E10.b :
LVRM1_0148_G01.b :
OVRM1_0133_G04.b :
OVRM1_0225_E07.b :
THY01_0016_C06.b :
OVRM1_0209_H05.b :
OVRM1_0169_H04.b :
OVRM1_0014_C12.b :
OVRM1_0120_E06.b :
OVRM1_0103_D04.b :
OVRM1_0072_A05.b :
OVRM1_0112_G08.b :
OVRM1_0041_A11.b :
OVRM1_0018_D12.b :
OVRM1_0012_D10.b :
TES01_0034_B07.b :
THY01_0007_E02.b :
OVR01_0065_A09.b :
UTR01_0026_E09.b :
SMG01_0061_B10.b :
SMG01_0078_F09.b :
OVRT1_0144_B10.b :
OVRT1_0006_A03.b :
OVRT1_0115_A10.b :
KDN01_0045_D10.b :
OVRT1_0113_G02.b :
OVRT1_0116_E04.b :
PBL01_0103_F12.b :
LNG01_0030_E10.b :
OVRT1_0039_E05.b :
PBL01_0011_G03.b :
THY01_0032_H03.b :
OVRT1_0076_B09.b :
SMG01_0013_H04.b :
KDN01_0069_F11.b :
THY01_0034_B10.b :
OVR01_0040_F04.b :
SPL01_0009_H06.b :
OVR01_0056_C05.b :
OVR01_0061_C07.b :
OVRT1_0113_D06.b :
OVRT1_0128_D02.b :
OVRT1_0128_D07.b :
THY01_0084_G02.b :
OVRT1_0008_A04.b :
OVRT1_0100_A09.b :
OVRT1_0095_G09.b :
TES01_0057_G08.b :
OVRT1_0057_B04.b :
LNG01_0099_B05.b :
OVRT1_0098_D12.b :
PCT01_0007_A05.b :
PST01_0042_D09.b :
PST01_0052_H08.b :
THY01_0207_A07.b :
PST01_0086_H08.b :
TES01_0054_B05.b :
OVRT1_0028_A12.b :
PST01_0093_B02.b :
KDN01_0041_D12.b :
TES01_0012_G01.b :
OVRT1_0013_D01.b :
PST01_0095_F01.b :
PST01_0034_B02.b :
PST01_0036_C10.b :
PST01_0094_G04.b :
TES01_0049_E11.b :
PST01_0052_B03.b :
KDN01_0096_H05.b :
PST01_0088_D03.b :
PST01_0092_H03.b :
PST01_0071_H08.b :
PST01_0084_F06.b :
OVRT1_0022_B01.b :
PBL01_0080_F06.b :
PST01_0012_A07.b :
PBL01_0068_G08.b :
TES01_0104_B01.b :
CLNT1_0065_G10.b :
ITT01_0010_D07.b :
ITT01_0060_A10.b :
OVRT1_0146_C04.b :
OVRT1_0071_A04.b :
BFLT1_0048_D09.b :
ITT01_0095_F03.b :
OVRT1_0041_B05.b :
BFLT1_0100_B12.b :
OVRT1_0113_D04.b :
PST01_0074_H05.b :
PST01_0063_G03.b :
ITT01_0080_A08.b :
ITT01_0032_E10.b :
TES01_0007_C06.b :
SPL01_0091_B01.b :
ITT01_0006_H06.b :
OVRT1_0087_B03.b :
OVRT1_0068_D03.b :
TCH01_0027_D07.b :
LNG01_0056_E07.b :
ITT01_0011_B07.b :
ITT01_0083_A11.b :
KDN01_0088_C11.b :
KDN01_0073_F12.b :
TES01_0110_H05.b :
KDN01_0002_E08.b :
OVRM1_0082_H09.b :
OVRM1_0167_G02.b :
THY01_0010_A04.b : tttttt
TES01_0057_D12.b :
TES01_0047_A09.b :
KDN01_0050_E07.b :
TES01_0091_F01.b :
TES01_0091_E10.b :
TES01_0019_G10.b :
TES01_0084_D06.b :
PST01_0013_A02.b :
PST01_0025_G01.b :
TES01_0002_E08.b :
OVRT1_0120_A07.b :
PST01_0003_B12.b :
PST01_0025_F02.b :
LNG01_0022_C09.b :
KDN01_0055_E06.b :
PST01_0033_G06.b :
PST01_0079_H09.b :
PST01_0033_A07.b :
TES01_0018_E03.b :
PST01_0022_A01.b :
TES01_0023_C03.b :
PCT01_0021_E09.b :
KDN01_0024_G05.b :
PST01_0072_C06.b :
PST01_0027_G11.b :
PST01_0038_H05.b :
PST01_0007_F07.b :
KDN01_0093_F05.b :
PST01_0029_F01.b :
PST01_0034_G06.b :
PST01_0019_E03.b :
TES01_0041_A03.b :
PST01_0014_E11.b :
PST01_0058_F03.b :
KDN01_0078_D04.b :
KDN01_0085_D05.b :
PST01_0015_E01.b :
KDN01_0054_F11.b :
PST01_0007_C03.b :
PST01_0061_A04.b :
PST01_0008_D07.b :
KDN01_0009_B04.b :
KDN01_0087_C11.b :
KDN01_0023_B10.b :
PST01_0088_B05.b :
PST01_0024_A10.b :
PST01_0024_B02.b :
KDN01_0082_D02.b :
OVRM1_0172_F02.b :
OVRM1_0055_E09.b :
THY01_0068_C05.b :
TES01_0033_C03.b :
TES01_0112_B08.b :
TES01_0022_F09.b :
PST01_0002_B04.b :
KDN01_0006_A05.b :
THY01_0099_D08.b :
KDN01_0011_G04.b :
PCT01_0011_A09.b :
KDN01_0087_D01.b :
PST01_0014_B06.b :
KDN01_0067_A12.b :
TES01_0027_C12.b :
OVRM1_0081_F08.b :
TES01_0067_H01.b :
PST01_0009_C05.b :
KDN01_0025_D12.b :
KDN01_0033_B07.b :
PST01_0012_B03.b :
PST01_0053_A12.b :
ADR01_0093_C01.b :
TES01_0053_G11.b :
ADR01_0011_C07.b :
KDN01_0064_E01.b :
PST01_0026_D01.b :
THY01_0120_B12.b :
TES01_0001_C12.b :
OVRM1_0116_B01.b :
OVRM1_0041_G05.b :
LNG01_0011_A09.b :
TES01_0072_D06.b :
TES01_0102_D03.b :
TES01_0010_E04.b :
TES01_0009_A11.b :
TES01_0026_B01.b :
KDN01_0091_E03.b :
KDN01_0061_C03.b :
OVRT1_0003_B02.b :
KDN01_0022_E04.b :
KDN01_0029_E10.b :
LVRM1_0093_B09.b :
TES01_0077_G08.b :
TES01_0088_F01.b :
TES01_0085_H05.b :
OVRM1_0094_G06.b :
TES01_0099_B08.b :
TES01_0025_D03.b :
TES01_0006_C11.b :
TES01_0034_A11.b :
KDN01_0025_G04.b :
TES01_0050_H09.b :
PST01_0029_D01.b :
PST01_0042_H12.b :
OVRM1_0173_A01.b :
ADR01_0017_A02.b :
OVRM1_0100_C03.b :
OVRM1_0047_H06.b :
OVRM1_0172_F03.b :
LVRM1_0116_H07.b :
OVRM1_0078_E11.b :
OVRM1_0031_A05.b :
OVRM1_0083_D08.b :
SPL01_0083_F11.b :
BFLT1_0118_H01.b :
TES01_0105_C06.b :
PTG01_0018_D07.b :
SPL01_0055_H02.b :
OVRT1_0101_F07.b :
ITT01_0102_C12.b :
BFLT1_0149_D10.b :
OVRT1_0089_G01.b :
PST01_0069_F01.b :
LVR01_0054_G10.b :
OVRT1_0111_D10.b :
KDN01_0058_G02.b :
OVRT1_0039_D08.b :
OVRT1_0056_A02.b :
PST01_0057_A05.b :
OVRT1_0018_G12.b :
OVRT1_0069_G08.b :
OVRT1_0075_C09.b :
OVRT1_0012_B05.b :
OVRT1_0046_G06.b :
UTR01_0107_A08.b :
ITT01_0078_D08.b :
TES01_0086_G12.b :
TES01_0058_C06.b :
BFLT1_0125_D10.b :
ADR01_0036_C11.b :
PST01_0062_H02.b :
PST01_0074_F04.b :
LNG01_0019_A06.b :
PST01_0043_H03.b :
PST01_0077_H04.b :
PST01_0012_B07.b :
PST01_0009_H10.b :
PST01_0046_B03.b :
TES01_0041_G12.b :
PST01_0086_C01.b :
PST01_0032_G01.b :
KDN01_0033_A04.b :
PST01_0038_F03.b :
PST01_0015_D05.b :
PST01_0022_H09.b :
KDN01_0096_B04.b :
PST01_0095_F02.b :
PST01_0074_D10.b :
KDN01_0018_E04.b :
KDN01_0088_B07.b :
PST01_0010_H06.b :
KDN01_0099_E09.b :
PST01_0099_A06.b :
PST01_0048_B12.b :
PST01_0082_E02.b :
TES01_0047_A04.b :
TES01_0055_D02.b :
PST01_0100_G09.b :
PST01_0027_H03.b :
KDN01_0043_C02.b :
TES01_0017_C03.b :
PST01_0016_H11.b :
KDN01_0034_H12.b :
LVRM1_0135_E07.b :
TES01_0059_H03.b :
TES01_0031_H08.b :
PST01_0044_B07.b :
PCT01_0022_H02.b :
BFLT1_0072_G07.b :
TES01_0002_G02.b :
PST01_0020_D02.b :
TES01_0010_C01.b :
TES01_0077_C02.b :
TES01_0110_G03.b :
BFLT1_0101_E01.b :
TES01_0081_G12.b :
OVRM1_0127_B01.b :
OVRT1_0133_E08.b :
BFLT1_0054_A04.b :
TES01_0011_D12.b :
BFLT1_0144_F03.b :
TES01_0078_E08.b :
TES01_0092_E05.b :
TES01_0025_D08.b :
LVRM1_0033_F02.b :
OVR01_0055_B10.b :
OVRM1_0194_A11.b :
ADR01_0047_A04.b :
BFLT1_0051_A02.b :
BFLT1_0014_B06.b :
OVRT1_0066_E09.b :
BFLT1_0039_G12.b :
BFLT1_0014_D01.b :
TES01_0081_H11.b :
TES01_0101_F02.b :
TES01_0037_H11.b :
PCT01_0023_F06.b :
PST01_0003_C05.b :
PST01_0042_E06.b :
PST01_0019_F10.b :
KDN01_0024_B07.b :
TES01_0006_A08.b :
KDN01_0099_B10.b :
MLTL1_0099_G07.b : n
TES01_0053_G10.b :
KDN01_0045_G06.b :
PST01_0033_C12.b :
LVR01_0036_G04.b :
MLTL1_0009_G08.b :
PCT01_0036_C09.b :
PST01_0032_B07.b :
TES01_0094_F08.b :
TES01_0009_B03.b :
TES01_0054_H04.b :
LNG01_0108_F10.b :
KDN01_0052_G01.b :
TES01_0030_D01.b :
TES01_0018_A05.b :
TCH01_0041_A06.b :
LNG01_0017_E09.b :
TES01_0043_C06.b :
TES01_0108_D11.b :
TES01_0105_H06.b :
TES01_0012_C05.b :
TES01_0019_E04.b :
TES01_0068_E08.b :
MLN01_0037_D12.b :
BFLT1_0136_B10.b :
MLN01_0088_B08.b :
BFLT1_0133_A07.b :
AMP01_0073_H05.b :
MLN01_0009_G04.b :
20110601C-001821 : ...............................GAGAGGGGGCGGGAGCGGGTTCCGGGCGG
---------+---------+---------+---------+---------+---------+ 29
BFLT1_0034_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxtcttGAGAGGGGGCGGGAGCGGGTTCCGGGCGG
ADR01_0004_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGGGGCGGGAGCGGGTTCCGGGCGG
OVR01_0067_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0067_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0105_A08.b : cggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0129_D10.b : agcgnacgnatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxc
TES01_0057_A02.b : ttttncctgctgtggctct
BFLT1_0017_A02.b : ccgttagctgtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0196_H10.b : agttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0080_H04.b : ataagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0004_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0056_E10.b : nnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0011_H08.b : tttctatagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0053_D12.b : nnnnccttnnaaaaaagtacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0053_D02.b : ccccnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0056_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0037_C02.b :
HTMT1_0133_F03.b : nccgctttttnnnggacgagagacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0179_A12.b : agttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0089_F06.b : tttttcctgctgtggctatgggagtc
BFLT1_0112_H09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxx
TES01_0019_D03.b : cgcggtggc
CLNT1_0045_B03.b : nggaaccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0038_G04.b : aactcgtttgcgcacggatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0186_G01.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0064_F06.b : nnccgatatnnnngggataaagcagcggnaxxxxxxxxxxxxxxx
OVRT1_0140_G11.b : annnnnnnnccgctcagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0110_B01.b : nnnccccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0094_G01.b : tttnnnnnnnccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0033_B01.b : nnnnaaaactaaannnnggataaagcagcggtaxxxxxxxxxxxxxxxxxx
TES01_0054_G03.b :
KDN01_0092_E12.b : nttttttc
KDN01_0001_B10.b : ncgcgttnnnnnnnnggctgcgt
KDN01_0040_C10.b : n
TES01_0008_H07.b :
KDN01_0073_G01.b : nnnnncctgct
OVRT1_0009_E09.b : nnccgttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0005_F08.b : nnntttcgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0013_F02.b : nnggcaagtagaggccgtagtattaaxxxxxx
OVR01_0010_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0057_F02.b : nttgtgxxxxxxxxxxxxxxxxxxxx
OVRM1_0214_D07.b : gagtttgtcxxxxxxxxxxxxxxx
BFLT1_0106_G08.b : nnccccgttagctgaggxxxxxxxxxxxxxxxxxx
LNG01_0088_D04.b : ttcggggatggactxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0087_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0087_B08.b : nggggctnntttaagagtaagcag
OVRM1_0037_H07.b : agttgtxxxxxxx
OVR01_0067_A10.b : nggctagtgacttgacagtttgacxxxxxx
TES01_0043_C04.b :
BFLT1_0094_G11.b : nttttcgtcagcgnacgxxxxxxxxxx
TES01_0072_C10.b :
PST01_0018_B03.b :
THY01_0093_H04.b : ggcccnaaacagctttgtgxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0074_B02.b :
LVRM1_0081_B03.b : agttgtcxxxx
OVRM1_0061_D02.b : tagttgacxxxx
TES01_0082_D03.b :
TES01_0022_F08.b :
TES01_0005_B08.b :
CLNT1_0140_B07.b : nnnnccgttcgcgnacgxxxxxx
OVRT1_0004_G06.b : nnnttccgttagctgacgxxxxxx
KDN01_0066_H08.b :
KDN01_0060_A11.b :
TES01_0041_F10.b :
TES01_0004_F04.b :
BFLT1_0028_G09.b : ggaatcctatagcgnacgxxxxxx
PST01_0035_F02.b :
PST01_0018_C11.b :
BFLT1_0099_F12.b : gactccgttcagcgtacgagtgxxx
TES01_0079_E07.b :
PST01_0040_A03.b :
TES01_0050_C02.b :
PST01_0054_G04.b :
OVRM1_0046_F02.b : cxxxxxxxxxxxx
THY01_0123_G05.b :
OVRM1_0162_D08.b : nagttgtcxx
OVRM1_0088_A11.b : agttgtcxx
THY01_0038_E12.b : gggggaacctaxxxxxxxxxxxxxxxxxxxxx
BFLT1_0076_C04.b : ggaatcgttcagcgacgxxxxxx
OVRT1_0044_E05.b : nnnnnggtttagcggacgx
OVR01_0028_H06.b : gggccatcaxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0058_H06.b : nnng
MLN01_0028_B02.b : aggnnnnggcatggaataagacxxxxxxxxxxx
PTG01_0104_F10.b : gcgtcannnnnnng
OVRT1_0132_G05.b : nnnggcgtacnnnnnnnnccgttagcgnacg
UTR01_0021_A05.b : gggaxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0123_F06.b : nnnccgttagctgacgxxx
THY01_0121_E01.b :
SMG01_0095_G08.b : nncccttttttaaangg
SMG01_0071_C07.b : nggcttannnnn
PST01_0004_C05.b :
OVR01_0035_G05.b : ttttttttttatttttttttttttttttttttttttccagataggacaaaacxxxxxxxx
PCT01_0036_A12.b :
PST01_0063_A11.b :
KDN01_0004_G02.b :
PST01_0038_D08.b :
PCT01_0032_F12.b :
PST01_0058_B06.b :
PST01_0059_G12.b :
KDN01_0053_C03.b :
PST01_0087_B09.b :
KDN01_0095_D07.b :
PST01_0056_H01.b :
PST01_0080_G05.b :
PST01_0026_H07.b :
PST01_0051_G01.b :
KDN01_0019_E02.b :
PST01_0058_C05.b :
PST01_0091_F05.b :
PST01_0007_B09.b :
PST01_0085_C09.b :
OVRT1_0034_G05.b : nnnnccgtcagcgta
BFLT1_0080_C06.b : ggaaccgtcagcgtacgagt
TES01_0006_B05.b :
TES01_0089_E01.b :
OVRM1_0093_A05.b : taatttgtcx
PTG01_0022_H06.b : tttt
OVRM1_0184_C10.b : gcgttgt
TES01_0072_H01.b :
PST01_0002_B11.b :
TES01_0060_C05.b :
PCT01_0009_A10.b :
OVRT1_0142_A10.b : nnggagatatnnnnnnnnccgttagcgcacgxx
OVR01_0060_C11.b : nnttggcttggactatgacxxxxxxxx
SMG01_0013_D07.b : ngagatctnnn
PST01_0097_H12.b :
OVRT1_0028_G02.b : nnnnnggtatagccgtacga
PST01_0073_A09.b :
PST01_0100_G08.b :
TES01_0050_B01.b :
KDN01_0007_G01.b :
OVR01_0031_C03.b : aaagcaataaggtgxxxxxxxxxxxxxxxxxxxxx
PST01_0095_C09.b :
KDN01_0091_F10.b :
BFLT1_0026_A02.b : ggattccgttcagcgtacgag
UTR01_0054_G08.b : ggcttttgggtgcxxxxxxxxxxxxxxxxxxx
SKNB1_0081_G02.b :
TES01_0059_C10.b :
KDN01_0028_G12.b :
PST01_0057_F09.b :
PST01_0049_H12.b :
KDN01_0083_C09.b :
KDN01_0059_E04.b :
SKNB1_0048_F09.b :
PST01_0048_F02.b :
PST01_0050_G05.b :
PST01_0083_F03.b :
OVRT1_0057_C01.b : nccgtttnnnnnnnnnnccgttcagcgtacgag
OVRM1_0048_H01.b : gcgctg
PTG01_0064_C11.b : nnnnnnnnnnnnnn
LVRM1_0087_C04.b :
OVRM1_0009_A08.b : xxxxxxxxx
OVRM1_0081_G11.b : ag
SMG01_0049_C04.b : nnccgtttttntta
OVRM1_0187_E02.b : tagttg
TES01_0064_A09.b :
OVRM1_0078_G04.b : cgt
OVRM1_0002_C06.b : nagttg
OVRM1_0072_D03.b : cxxxxxxxxx
BFLT1_0145_B08.b : ncccactcnnnnnnnnccgtcagcgnacg
TES01_0107_C05.b :
PCT01_0035_E09.b :
SPL01_0030_G02.b : nnnnggcatggactatgacxxxxxxxx
OVRT1_0110_E01.b : ntttccgtcagcgnacgxx
ADR01_0022_B10.b :
TES01_0033_A04.b :
UTR01_0032_E06.b : catttgggtgatxxxxxxxxxxxxxxxxxxx
BFLT1_0109_D09.b : nnnnnccgtcagcgnacg
PST01_0001_G09.b :
BFLT1_0074_D04.b : ggaaccgttagctgtcg
BFLT1_0091_G11.b : ggattcgtctctgcgtcgg
OVRT1_0088_C07.b : nntttcttttnnnnnnccgttagcgnacg
OVRT1_0151_F01.b : nnnncccgttagctgtang
KDN01_0089_H02.b :
BFLT1_0047_A10.b : nttttggtatagcgnacg
KDN01_0045_C06.b :
CLNT1_0152_G01.b : nnnnnccgtcagcgnag
BFLT1_0008_A04.b : ggattacgtcagcgnacg
BFLT1_0036_F10.b : ggatacgttcagcgtacg
SMG01_0027_C09.b : ngcgctttatnn
ITT01_0075_C12.b : nn
BFLT1_0113_C11.b : nnnnccgttagctg
BFLT1_0117_A08.b : naaccctcagctnac
OVRT1_0062_H10.b : ngggtcttnnnngnnnccgttcgcgnac
PST01_0070_B08.b :
BFLT1_0115_A10.b : nnnnnccgtcagcgnacg
ITT01_0081_E02.b : n
PST01_0029_G03.b :
KDN01_0057_D10.b :
PST01_0074_H10.b :
PST01_0042_A09.b :
PST01_0066_C09.b :
PST01_0067_B03.b :
PST01_0071_B01.b :
KDN01_0010_F03.b :
PST01_0023_A11.b :
PST01_0047_G11.b :
TES01_0002_G04.b :
ITT01_0009_G02.b :
ITT01_0038_F07.b :
OVRT1_0046_C03.b : nnnnccgtctgcgnacg
KDN01_0055_B05.b :
ITT01_0001_G11.b : nn
TCH01_0103_F06.b : nnnnggctaggactataacxxxxxx
OVRT1_0018_A11.b : ngtctccgttcngcgnacg
PST01_0098_C09.b :
SPL01_0103_B02.b : nntttgcatggactatgacxxxxxxx
LNG01_0057_B09.b : nggccaatnnttcggctggacatgacagtttg
SMG01_0016_G08.b : nnnggtttctaa
OVRM1_0196_E03.b : nagtt
OVR01_0065_F08.b : nnggcttgtgacttgacxxxxxx
OVR01_0076_F06.b : cxxxxxxxxxxxxxxxxxxxxx
TES01_0112_H07.b :
OVRM1_0152_C07.b : nagtt
LVRM1_0087_C11.b : tt
OVRM1_0130_A10.b : tcagt
OVRM1_0058_F11.b : ag
UTR01_0102_A10.b : cttgggactataaxxxxxxx
SPL01_0025_C04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0084_G03.b :
THY01_0007_D06.b :
UTR01_0008_C08.b : ctttagggtgxxxxxxxxxxxxxxxxxxx
PCT01_0022_F06.b :
SMG01_0024_D06.b : nngggcttttnn
BFLT1_0148_E06.b : nnnnaactttagcgnac
OVR01_0033_E10.b : aaggacacxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0051_F07.b :
OVRT1_0139_A11.b : nngggcaaaannnnnnnncccttagcgnacg
PBL01_0010_C09.b : nggggtg
SPL01_0104_B05.b : nnntttgcatgtgacttgacxxxxxxx
OVRT1_0101_G04.b : nnnnccctcagcgnagg
OVRT1_0031_B04.b : nnnnnccgttcagcgnacg
OVRT1_0016_H01.b : nntttcgttcagcgtcg
ITT01_0093_C01.b :
PTG01_0033_G06.b : t
OVRT1_0077_B10.b : nggtttctattgcgcga
PST01_0002_G08.b :
PCT01_0018_H11.b :
BFLT1_0045_H02.b : ggtatacgttcgcgnac
CLNT1_0021_C04.b : gcgcttatnnnnnnnccgttagcgnac
TES01_0014_G06.b :
BFLT1_0022_A10.b : ggattacgtttgctnac
BFLT1_0012_B10.b : ngaatccgttagcgnac
CLNT1_0093_C02.b : nggccttttnnggggnccgtcgcgnac
OVRT1_0121_B10.b : nncctttagctgag
TES01_0042_F07.b :
PST01_0023_F04.b :
OVRT1_0058_E10.b : nccctttttnngggaaccgttagcgnacg
PST01_0080_F07.b :
THY01_0203_E03.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0043_E01.b :
PST01_0060_C08.b :
PST01_0083_E12.b :
PST01_0031_G02.b :
PST01_0013_G12.b :
PST01_0100_H07.b :
SPL01_0103_D09.b : nnnnggctaggactatgacxxxxxxx
LVR01_0001_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0006_D10.b :
CLNT1_0087_C01.b : nnnggtcttnnnnnttccgtcagcgta
OVR01_0094_H03.b : nnnnggctaggactaaaacxxxxxx
PST01_0082_D11.b :
PST01_0056_B02.b :
PST01_0035_E12.b :
PST01_0075_H09.b :
KDN01_0080_A09.b :
PST01_0006_G08.b :
PST01_0005_E05.b :
BFLT1_0078_F09.b : gggatccgtcagcgnac
OVRT1_0069_E11.b : nnnttccgttcgcgnacg
MLN01_0082_A04.b : nnnggctagtgacttgacxxxxx
ITT01_0089_A11.b : n
MLN01_0021_C05.b : nnnnggtaggacttgacagtt
OVRT1_0041_G02.b : nnnnnccgttagcgnac
OVRT1_0066_B06.b : nnnccccgttagcgnacg
TCH01_0023_H11.b : nngggctggactataacxxxxxx
ITT01_0081_H12.b : n
LNG01_0064_G12.b : nnttggattggactataacxxxxxxxx
ITT01_0083_A12.b :
LVRM1_0111_C05.b : nagt
BFLT1_0147_C06.b : nnnccgtttgcgna
TES01_0062_E09.b :
TES01_0091_H08.b :
PST01_0071_F03.b :
TES01_0003_C12.b :
KDN01_0067_C10.b :
SKNB1_0060_C09.b :
OVRM1_0059_E12.b :
KDN01_0045_E10.b :
KDN01_0063_C12.b :
KDN01_0030_E11.b :
TES01_0095_D06.b :
TES01_0078_E09.b :
KDN01_0068_H07.b :
PST01_0052_F01.b :
PST01_0013_H03.b :
KDN01_0068_C06.b :
KDN01_0034_H07.b :
TES01_0062_E10.b :
TES01_0067_E01.b :
PST01_0086_C05.b :
KDN01_0008_B07.b :
PCT01_0014_F06.b :
TES01_0039_E09.b :
TES01_0052_E06.b :
PST01_0076_E11.b :
PST01_0085_D02.b :
PST01_0062_G03.b :
BFLT1_0099_B02.b : gaatccgttagcg
MLN01_0006_G10.b : nnnnnnnnnnnnnnnnnn
PST01_0070_E12.b :
PST01_0094_D03.b :
OVRM1_0080_G08.b :
KDN01_0024_B10.b :
OVRT1_0119_A09.b : cagctgtc
LVRM1_0053_F06.b :
TES01_0081_D05.b :
LNG01_0002_D01.b : ggcxxxxxxxxxxxxxxxxx
LVRM1_0004_G10.b :
LVRM1_0154_D01.b :
OVRM1_0189_G10.b :
OVR01_0101_F03.b : aaaaggctaggactat
OVRT1_0063_B03.b : nnnnncct
PST01_0003_F08.b :
BFLT1_0138_B01.b : nntcccgt
LVR01_0066_A08.b : gggtxxxxxxxxxxxxxxxxxx
KDN01_0052_F10.b :
SPL01_0088_H11.b : tttggctaggactat
OVRT1_0010_D12.b : ttttccg
PST01_0017_F07.b :
OVRT1_0002_A07.b : naaatcctc
KDN01_0053_B05.b :
TES01_0029_A04.b :
PST01_0035_F10.b :
KDN01_0090_D02.b :
PST01_0038_D05.b :
KDN01_0068_B03.b :
PST01_0029_D05.b :
PST01_0088_B11.b :
KDN01_0055_B02.b :
PST01_0097_C03.b :
PST01_0026_G08.b :
OVRT1_0082_D12.b : tgtatcc
PST01_0089_H06.b :
ITT01_0033_E04.b :
ADR01_0077_B03.b :
ADR01_0056_E03.b :
PCT01_0031_C07.b :
KDN01_0037_A07.b :
TES01_0019_C02.b :
PST01_0040_B09.b :
KDN01_0021_E09.b :
PST01_0039_G07.b :
KDN01_0021_H06.b :
PST01_0020_F03.b :
BFLT1_0149_G09.b : nnn
THY01_0058_B09.b : cttttggctgaacxx
LVRM1_0114_C09.b :
OVRT1_0009_C03.b :
PST01_0061_B11.b :
THY01_0096_H11.b : cgcattagggtgxxx
KDN01_0075_B06.b :
THY01_0108_F09.b :
LVRM1_0185_E01.b :
LVRM1_0033_B01.b :
OVRM1_0028_D12.b :
OVRM1_0058_E05.b :
OVRM1_0203_H09.b :
OVRT1_0122_C01.b :
OVRT1_0053_A12.b : nntttttnnnnnnn
OVRT1_0008_H09.b : nnn
BFLT1_0083_B10.b :
OVRT1_0126_B09.b : n
KDN01_0081_E03.b :
TES01_0043_E01.b :
PST01_0022_C10.b :
CLNT1_0150_B12.b :
TES01_0019_B05.b :
PST01_0062_C02.b :
KDN01_0070_H10.b :
TES01_0013_E03.b :
KDN01_0042_B04.b :
OVRT1_0055_D05.b : nntttttt
OVRT1_0076_F10.b :
OVRT1_0083_A03.b : nnggt
LNG01_0065_C04.b : nntttggg
PST01_0070_C12.b :
TES01_0102_E10.b :
OVRM1_0060_G04.b :
TES01_0082_E05.b :
LNG01_0009_H08.b : gccttttgggtgxxxx
TES01_0017_B12.b :
PTG01_0027_H03.b :
TES01_0022_E04.b :
OVRT1_0016_D12.b : ttt
OVRT1_0108_D06.b :
PST01_0031_F03.b :
PST01_0077_F01.b :
PST01_0099_A01.b :
TES01_0009_A01.b :
PST01_0089_D07.b :
PST01_0059_C04.b :
PST01_0007_D04.b :
TES01_0054_E08.b :
KDN01_0098_F02.b :
PST01_0093_G10.b :
CLNT1_0043_C12.b :
OVR01_0081_B03.b : gcaxxxxxxxx
OVR01_0013_H03.b : gggctttttgggcgxx
OVRM1_0019_F06.b :
OVRM1_0185_E01.b :
OVRM1_0079_B12.b :
OVRM1_0047_C12.b :
THY01_0051_G01.b : cattagggtgx
TES01_0099_E04.b :
OVRT1_0118_C11.b :
BFLT1_0084_C08.b :
OVRT1_0110_D10.b :
PST01_0004_G12.b :
BFLT1_0075_A02.b :
KDN01_0080_H04.b :
LNG01_0011_F12.b : ggcctttatgg
PST01_0051_D06.b :
UTR01_0047_D09.b : ctttgggtga
PST01_0017_A04.b :
PBL01_0017_F04.b :
PST01_0004_G07.b :
TES01_0015_E10.b :
THY01_0091_C11.b : ggcttctcggtg
KDN01_0094_H06.b :
PST01_0088_H03.b :
KDN01_0033_C03.b :
KDN01_0073_E10.b :
KDN01_0010_E11.b :
KDN01_0067_F02.b :
OVRT1_0059_C09.b :
OVRT1_0045_A03.b :
KDN01_0091_C07.b :
PST01_0062_A11.b :
PST01_0099_F03.b :
OVRT1_0082_A02.b : nccctttt
OVR01_0020_G06.b : gggggggacc
THY01_0100_B06.b : ggggcxxxxxxxx
ITT01_0051_E01.b :
OVRT1_0096_F05.b : nccctttttn
OVRM1_0219_F08.b :
OVRM1_0156_D09.b :
THY01_0104_D01.b :
OVRM1_0221_H09.b :
TES01_0025_D09.b :
PBL01_0003_D12.b :
OVRM1_0175_C07.b :
LVRM1_0174_D07.b :
TES01_0064_E05.b :
OVRM1_0166_H10.b :
OVRM1_0113_H08.b :
OVRM1_0152_E10.b :
LVRM1_0197_E10.b :
LVRM1_0148_G01.b :
OVRM1_0133_G04.b :
OVRM1_0225_E07.b :
THY01_0016_C06.b : xx
OVRM1_0209_H05.b :
OVRM1_0169_H04.b :
OVRM1_0014_C12.b :
OVRM1_0120_E06.b :
OVRM1_0103_D04.b :
OVRM1_0072_A05.b :
OVRM1_0112_G08.b :
OVRM1_0041_A11.b :
OVRM1_0018_D12.b :
OVRM1_0012_D10.b :
TES01_0034_B07.b :
THY01_0007_E02.b : t
OVR01_0065_A09.b : atttttt
UTR01_0026_E09.b : ggggcac
SMG01_0061_B10.b :
SMG01_0078_F09.b :
OVRT1_0144_B10.b : nnagatcttn
OVRT1_0006_A03.b :
OVRT1_0115_A10.b :
KDN01_0045_D10.b :
OVRT1_0113_G02.b :
OVRT1_0116_E04.b :
PBL01_0103_F12.b :
LNG01_0030_E10.b : ggcatatggt
OVRT1_0039_E05.b :
PBL01_0011_G03.b :
THY01_0032_H03.b : ttgggggg
OVRT1_0076_B09.b :
SMG01_0013_H04.b :
KDN01_0069_F11.b :
THY01_0034_B10.b : xxxxxxxxx
OVR01_0040_F04.b : gggacxxxxxxxx
SPL01_0009_H06.b : ttxxxxxxxxxxx
OVR01_0056_C05.b : nnnngg
OVR01_0061_C07.b : nnnngg
OVRT1_0113_D06.b :
OVRT1_0128_D02.b :
OVRT1_0128_D07.b :
THY01_0084_G02.b : cxxxxxxxxxxx
OVRT1_0008_A04.b :
OVRT1_0100_A09.b :
OVRT1_0095_G09.b : ncgttttt
TES01_0057_G08.b :
OVRT1_0057_B04.b : ncggtttnn
LNG01_0099_B05.b :
OVRT1_0098_D12.b :
PCT01_0007_A05.b :
PST01_0042_D09.b :
PST01_0052_H08.b :
THY01_0207_A07.b : ccxxxxxxxx
PST01_0086_H08.b :
TES01_0054_B05.b :
OVRT1_0028_A12.b : nngggtttt
PST01_0093_B02.b :
KDN01_0041_D12.b :
TES01_0012_G01.b :
OVRT1_0013_D01.b :
PST01_0095_F01.b :
PST01_0034_B02.b :
PST01_0036_C10.b :
PST01_0094_G04.b :
TES01_0049_E11.b :
PST01_0052_B03.b :
KDN01_0096_H05.b :
PST01_0088_D03.b :
PST01_0092_H03.b :
PST01_0071_H08.b :
PST01_0084_F06.b :
OVRT1_0022_B01.b : nggtcttn
PBL01_0080_F06.b :
PST01_0012_A07.b :
PBL01_0068_G08.b :
TES01_0104_B01.b :
CLNT1_0065_G10.b :
ITT01_0010_D07.b :
ITT01_0060_A10.b :
OVRT1_0146_C04.b :
OVRT1_0071_A04.b : nnggccttt
BFLT1_0048_D09.b :
ITT01_0095_F03.b :
OVRT1_0041_B05.b : ngggtttn
BFLT1_0100_B12.b :
OVRT1_0113_D04.b :
PST01_0074_H05.b :
PST01_0063_G03.b :
ITT01_0080_A08.b :
ITT01_0032_E10.b :
TES01_0007_C06.b :
SPL01_0091_B01.b : nnnnngg
ITT01_0006_H06.b :
OVRT1_0087_B03.b : nnnggttttt
OVRT1_0068_D03.b : nnngggctnnn
TCH01_0027_D07.b : nnnn
LNG01_0056_E07.b : n
ITT01_0011_B07.b :
ITT01_0083_A11.b :
KDN01_0088_C11.b :
KDN01_0073_F12.b :
TES01_0110_H05.b :
KDN01_0002_E08.b :
OVRM1_0082_H09.b :
OVRM1_0167_G02.b :
THY01_0010_A04.b : ttttttnttnnntttccttcccctnntcctcnnccctccccccccnccctagcctxxxxx
TES01_0057_D12.b :
TES01_0047_A09.b :
KDN01_0050_E07.b :
TES01_0091_F01.b :
TES01_0091_E10.b :
TES01_0019_G10.b :
TES01_0084_D06.b :
PST01_0013_A02.b :
PST01_0025_G01.b :
TES01_0002_E08.b :
OVRT1_0120_A07.b :
PST01_0003_B12.b :
PST01_0025_F02.b :
LNG01_0022_C09.b : gcxx
KDN01_0055_E06.b :
PST01_0033_G06.b :
PST01_0079_H09.b :
PST01_0033_A07.b :
TES01_0018_E03.b :
PST01_0022_A01.b :
TES01_0023_C03.b :
PCT01_0021_E09.b :
KDN01_0024_G05.b :
PST01_0072_C06.b :
PST01_0027_G11.b :
PST01_0038_H05.b :
PST01_0007_F07.b :
KDN01_0093_F05.b :
PST01_0029_F01.b :
PST01_0034_G06.b :
PST01_0019_E03.b :
TES01_0041_A03.b :
PST01_0014_E11.b :
PST01_0058_F03.b :
KDN01_0078_D04.b :
KDN01_0085_D05.b :
PST01_0015_E01.b :
KDN01_0054_F11.b :
PST01_0007_C03.b :
PST01_0061_A04.b :
PST01_0008_D07.b :
KDN01_0009_B04.b :
KDN01_0087_C11.b :
KDN01_0023_B10.b :
PST01_0088_B05.b :
PST01_0024_A10.b :
PST01_0024_B02.b :
KDN01_0082_D02.b :
OVRM1_0172_F02.b :
OVRM1_0055_E09.b :
THY01_0068_C05.b : cxxxxxxxx
TES01_0033_C03.b :
TES01_0112_B08.b :
TES01_0022_F09.b :
PST01_0002_B04.b :
KDN01_0006_A05.b :
THY01_0099_D08.b : ctxxxxxx
KDN01_0011_G04.b :
PCT01_0011_A09.b :
KDN01_0087_D01.b :
PST01_0014_B06.b :
KDN01_0067_A12.b :
TES01_0027_C12.b :
OVRM1_0081_F08.b :
TES01_0067_H01.b :
PST01_0009_C05.b :
KDN01_0025_D12.b :
KDN01_0033_B07.b :
PST01_0012_B03.b :
PST01_0053_A12.b :
ADR01_0093_C01.b :
TES01_0053_G11.b :
ADR01_0011_C07.b :
KDN01_0064_E01.b :
PST01_0026_D01.b :
THY01_0120_B12.b :
TES01_0001_C12.b :
OVRM1_0116_B01.b :
OVRM1_0041_G05.b :
LNG01_0011_A09.b : g
TES01_0072_D06.b :
TES01_0102_D03.b :
TES01_0010_E04.b :
TES01_0009_A11.b :
TES01_0026_B01.b :
KDN01_0091_E03.b :
KDN01_0061_C03.b :
OVRT1_0003_B02.b : nccgt
KDN01_0022_E04.b :
KDN01_0029_E10.b :
LVRM1_0093_B09.b :
TES01_0077_G08.b :
TES01_0088_F01.b :
TES01_0085_H05.b :
OVRM1_0094_G06.b :
TES01_0099_B08.b :
TES01_0025_D03.b :
TES01_0006_C11.b :
TES01_0034_A11.b :
KDN01_0025_G04.b :
TES01_0050_H09.b :
PST01_0029_D01.b :
PST01_0042_H12.b :
OVRM1_0173_A01.b :
ADR01_0017_A02.b :
OVRM1_0100_C03.b :
OVRM1_0047_H06.b :
OVRM1_0172_F03.b :
LVRM1_0116_H07.b :
OVRM1_0078_E11.b :
OVRM1_0031_A05.b :
OVRM1_0083_D08.b :
SPL01_0083_F11.b :
BFLT1_0118_H01.b :
TES01_0105_C06.b :
PTG01_0018_D07.b :
SPL01_0055_H02.b : n
OVRT1_0101_F07.b :
ITT01_0102_C12.b :
BFLT1_0149_D10.b :
OVRT1_0089_G01.b :
PST01_0069_F01.b :
LVR01_0054_G10.b : gca
OVRT1_0111_D10.b : nc
KDN01_0058_G02.b :
OVRT1_0039_D08.b : ng
OVRT1_0056_A02.b : nngg
PST01_0057_A05.b :
OVRT1_0018_G12.b : n
OVRT1_0069_G08.b : nng
OVRT1_0075_C09.b :
OVRT1_0012_B05.b :
OVRT1_0046_G06.b :
UTR01_0107_A08.b :
ITT01_0078_D08.b :
TES01_0086_G12.b :
TES01_0058_C06.b :
BFLT1_0125_D10.b :
ADR01_0036_C11.b :
PST01_0062_H02.b :
PST01_0074_F04.b :
LNG01_0019_A06.b :
PST01_0043_H03.b :
PST01_0077_H04.b :
PST01_0012_B07.b :
PST01_0009_H10.b :
PST01_0046_B03.b :
TES01_0041_G12.b :
PST01_0086_C01.b :
PST01_0032_G01.b :
KDN01_0033_A04.b :
PST01_0038_F03.b :
PST01_0015_D05.b :
PST01_0022_H09.b :
KDN01_0096_B04.b :
PST01_0095_F02.b :
PST01_0074_D10.b :
KDN01_0018_E04.b :
KDN01_0088_B07.b :
PST01_0010_H06.b :
KDN01_0099_E09.b :
PST01_0099_A06.b :
PST01_0048_B12.b :
PST01_0082_E02.b :
TES01_0047_A04.b :
TES01_0055_D02.b :
PST01_0100_G09.b :
PST01_0027_H03.b :
KDN01_0043_C02.b :
TES01_0017_C03.b :
PST01_0016_H11.b :
KDN01_0034_H12.b :
LVRM1_0135_E07.b :
TES01_0059_H03.b :
TES01_0031_H08.b :
PST01_0044_B07.b :
PCT01_0022_H02.b :
BFLT1_0072_G07.b :
TES01_0002_G02.b :
PST01_0020_D02.b :
TES01_0010_C01.b :
TES01_0077_C02.b :
TES01_0110_G03.b :
BFLT1_0101_E01.b :
TES01_0081_G12.b :
OVRM1_0127_B01.b :
OVRT1_0133_E08.b :
BFLT1_0054_A04.b :
TES01_0011_D12.b :
BFLT1_0144_F03.b :
TES01_0078_E08.b :
TES01_0092_E05.b :
TES01_0025_D08.b :
LVRM1_0033_F02.b :
OVR01_0055_B10.b :
OVRM1_0194_A11.b :
ADR01_0047_A04.b :
BFLT1_0051_A02.b :
BFLT1_0014_B06.b :
OVRT1_0066_E09.b :
BFLT1_0039_G12.b :
BFLT1_0014_D01.b :
TES01_0081_H11.b :
TES01_0101_F02.b :
TES01_0037_H11.b :
PCT01_0023_F06.b :
PST01_0003_C05.b :
PST01_0042_E06.b :
PST01_0019_F10.b :
KDN01_0024_B07.b :
TES01_0006_A08.b :
KDN01_0099_B10.b :
MLTL1_0099_G07.b : nnnggctttnnnnnnnncgaaccctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0053_G10.b :
KDN01_0045_G06.b :
PST01_0033_C12.b :
LVR01_0036_G04.b :
MLTL1_0009_G08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxx
PCT01_0036_C09.b :
PST01_0032_B07.b :
TES01_0094_F08.b :
TES01_0009_B03.b :
TES01_0054_H04.b :
LNG01_0108_F10.b :
KDN01_0052_G01.b :
TES01_0030_D01.b :
TES01_0018_A05.b :
TCH01_0041_A06.b :
LNG01_0017_E09.b :
TES01_0043_C06.b :
TES01_0108_D11.b :
TES01_0105_H06.b :
TES01_0012_C05.b :
TES01_0019_E04.b :
TES01_0068_E08.b :
MLN01_0037_D12.b :
BFLT1_0136_B10.b :
MLN01_0088_B08.b :
BFLT1_0133_A07.b :
AMP01_0073_H05.b :
MLN01_0009_G04.b :
20110601C-001821 : TAGGCGGGGCTTCCTTGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
---------+---------+---------+---------+---------+---------+ 89
BFLT1_0034_G05.b : TAGGCGGTGCTTCCTTGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
ADR01_0004_C04.b : TAGGCGGGGCTTCCTTGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
OVR01_0067_D07.b : xxGGCGGGGCTTCCTTGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
SPL01_0067_A09.b : xxGGCGGGGCTTCCTTGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
BFLT1_0105_A08.b : xxGGCGGGGCTTCCTTGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
BFLT1_0129_D10.b : gatGCGGGGCTTCCTTGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
TES01_0057_A02.b : ggaGCGGGGCTTCCTTGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
BFLT1_0017_A02.b : xxxxxxxGGCTTCCTTGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
OVRM1_0196_H10.b : xxxxxxxxGCTTCCTTGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
LNG01_0080_H04.b : xxxxxxxxGCTTCCTTGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
LNG01_0004_D01.b : xxxxxxxxGCTTCCTTGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
OVRT1_0056_E10.b : xxxxxxxxxxTTCCTTGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
BFLT1_0011_H08.b : xxxxxxxxxxTTCCTTGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
ADR01_0053_D12.b : xxxxxxxxxxxxxCTTGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
ADR01_0053_D02.b : xxxxxxxxxxxxxCTTGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
THY01_0056_B10.b : xxxxxxxxxxxxxCTTGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
TES01_0037_C02.b : cgcgttggctctgGGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
HTMT1_0133_F03.b : xxxxxxxxxxxxxxxGGAGGACCCCCGTTTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
OVRM1_0179_A12.b : xxxxxxxxxxxxxxxxGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
TES01_0089_F06.b : gccttgttggccactgGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
BFLT1_0112_H09.b : xxxxxxxxxxxxxxxxGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
TES01_0019_D03.b : tctgggtggcctctggGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
CLNT1_0045_B03.b : xxxxxxxxxxxxxxxxGAGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
BFLT1_0038_G04.b : xxxxxxxxxxcccctaaAGGAGCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
OVRM1_0186_G01.b : xxxxxxxxxxxxxxxxxxGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
SMG01_0064_F06.b : xxxxxxxxxxxxxxxctgGGAccccgggccgggcgccgccgccggcTCGTCTACCCTTTC
OVRT1_0140_G11.b : xxxxxxxxxxxxxxxxxxGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
OVRT1_0110_B01.b : xxxxxxxxxxxxxxxxxxGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
OVRT1_0094_G01.b : xxxxxxxxxxxxxxxxxxGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
ADR01_0033_B01.b : xxxxxxxxxxxxxxxxxxGGACCCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
TES01_0054_G03.b : ttctgctgtggctcgGGACCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
KDN01_0092_E12.b : ctgaggtggctctggcttgGGACCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
KDN01_0001_B10.b : tgtgctgggggcttcttgagGACCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
KDN01_0040_C10.b : tagcgttggcactggcttgaGACCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
TES01_0008_H07.b : acgtggctctggggaGACCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
KDN01_0073_G01.b : gtggctatgggcttcttgagGACCCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
OVRT1_0009_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
OVRT1_0005_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxCGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
SPLT1_0013_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxgGGGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
OVR01_0010_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
ITT01_0057_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
OVRM1_0214_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggGCCGCCGGCTCGTCTACCCTTTC
BFLT1_0106_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxactggGCCGCCGGCTCGTCTACCCTTTC
LNG01_0088_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCGCCGGCTCGTCTACCCTTTC
AMP01_0087_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCGCCGGCTCGTCTACCCTTTC
SMG01_0087_B08.b : cggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCGGCTCGTCTACCCTTTC
OVRM1_0037_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGTCTACCCTTTC
OVR01_0067_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGTCTACCCTTTC
TES01_0043_C04.b : ncgctttGGCTCTGGCCTTTC
BFLT1_0094_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGTCTACCCTTTC
TES01_0072_C10.b : ttactgcgtggctatggttGGCTCTGGCTTTC
PST01_0018_B03.b : tgtGGCTCTGGCTTTT
THY01_0093_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCGTCTACCCTTTC
TES01_0074_B02.b : tcgctgtgGCTCTGGCTTTC
LVRM1_0081_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTACCCTTTC
OVRM1_0061_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTACCCTTTC
TES01_0082_D03.b : tttctgcggtGGCTCTGGTTTT
TES01_0022_F08.b : tcgctttGGCTCTGGTTTT
TES01_0005_B08.b : nccgcgttGGCTCTGGTTTT
CLNT1_0140_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTACCCTTTC
OVRT1_0004_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTACCCTTTC
KDN01_0066_H08.b : nnnnnggctgcgttgGCTCTGGCTTTT
KDN01_0060_A11.b : nnnnggctgaggtGGCTCTGGCTTT
TES01_0041_F10.b : tgtGGCTCTGGTTTC
TES01_0004_F04.b : nttcgcggtgGCTCTGGCTTTC
BFLT1_0028_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTACCCTTTC
PST01_0035_F02.b : ttttatcgctgtgGCTCTGGCTTTT
PST01_0018_C11.b : GGCTCTGGCTTT
BFLT1_0099_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTACCCTTTC
TES01_0079_E07.b : ntttgcctgcgtgGCTCTGGTTTT
PST01_0040_A03.b : nctcgctgtgGCTCTGGTTTT
TES01_0050_C02.b : nttactgttGCTCTGGCTTT
PST01_0054_G04.b : nnnnttcgctgtgGCTCTGGTTTT
OVRM1_0046_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT*TTTTTTC
THY01_0123_G05.b : gttgtcaaagcggcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaCTACCCTTTC
OVRM1_0162_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT*TTTTTTC
OVRM1_0088_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT*TTTTTTC
THY01_0038_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGCCTTTC
BFLT1_0076_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcccttgggCTACCCTTTC
OVRT1_0044_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaCTGGCTTTTC
OVR01_0028_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctgtacaaCTGGCCTTTC
ITT01_0058_H06.b : gtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT*TTTTTTC
MLN01_0028_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT*TTTTTTC
PTG01_0104_F10.b : gctaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACCCTTTC
OVRT1_0132_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCCTTTC
UTR01_0021_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACCCTTTC
BFLT1_0123_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgTACCCTTTC
THY01_0121_E01.b : agtgtcaaaaacagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTTTC
SMG01_0095_G08.b : agtaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGGCCTTTC
SMG01_0071_C07.b : ttgataaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTTC
PST01_0004_C05.b : nggccgcggtggctaTGGCTTTC
OVR01_0035_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccgtcaacTGGCTTTC
PCT01_0036_A12.b : nngggggatgcaannnnactgcgttggctcgggncTCCCTTTC
PST01_0063_A11.b : ctgcgttggctcTGGCTTTC
KDN01_0004_G02.b : nggcttttttttttcctgaggtggccacGGCCTTTC
PST01_0038_D08.b : tcgcgttggctTGGCTTTT
PCT01_0032_F12.b : nnnaaggattnnnnnnnncctgaggtggcacgggncTCCCTTTC
PST01_0058_B06.b : nnnnncctgctgtggctaTGGCTTTC
PST01_0059_G12.b : nnntttcctgctgtggctcGGCCTTTC
KDN01_0053_C03.b : cgttggctaTGGCTTTT
PST01_0087_B09.b : nnnncctgaggtggcacGGCCTTTC
KDN01_0095_D07.b : nnnncctgcgtggctaTGGCTTTT
PST01_0056_H01.b : nnnnggtggctgtggcacGGCCTTTC
PST01_0080_G05.b : nncctgcgtggctcGGCCTTTC
PST01_0026_H07.b : ntttactgctgtggctaTGGCTTTT
PST01_0051_G01.b : nnnttcgctgtggctctGGCCTTTC
KDN01_0019_E02.b : nnggatattnnnnnnncctacgttggctacggCTTTTTTT
PST01_0058_C05.b : nnnncctgctgtggctaTGGCTTTT
PST01_0091_F05.b : nnnncctgctgtggctcTGGCTTTT
PST01_0007_B09.b : nnnnnncctgctgtggctcGGCCTTTC
PST01_0085_C09.b : nnnnactgaggtggcacGGCCTTTC
OVRT1_0034_G05.b : cgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTTTT
BFLT1_0080_C06.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttTTTTTTTC
TES01_0006_B05.b : ttttcccgctgtggctatggGGCCTTTC
TES01_0089_E01.b : tttaccgctgttgctctGGCTTTC
OVRM1_0093_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTC
PTG01_0022_H06.b : ataactaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTTTC
OVRM1_0184_C10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTTTC
TES01_0072_H01.b : tttcctgcgtggctctGGCTTTC
PST01_0002_B11.b : nctgacgttggctctGGCTTTC
TES01_0060_C05.b : ncctgcgttggctaTGGCTTT
PCT01_0009_A10.b : ttggnnnactgcggtggctcGGCTTTC
OVRT1_0142_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTC
OVR01_0060_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTC
SMG01_0013_D07.b : nggataaagcagcggtccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTC
PST01_0097_H12.b : ntttcctgacgtggctacgggtcaCCCTTTC
OVRT1_0028_G02.b : gtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTC
PST01_0073_A09.b : nncctgcgttggctcGGCTTTT
PST01_0100_G08.b : nnncctgctgtggctacgGCTTTTT
TES01_0050_B01.b : nnctactgcgtggctatGGCTTTC
KDN01_0007_G01.b : nccctttnnnnnnncctgcgttggccacGGCTTTC
OVR01_0031_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTC
PST01_0095_C09.b : nnnnncctgcggtggctatgggtctaCCCTTTC
KDN01_0091_F10.b : nttttgctgagtggctcggACCTTTC
BFLT1_0026_A02.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCTTTTTC
UTR01_0054_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTTTC
SKNB1_0081_G02.b : nnnnnnnnnnnnnnnnncccgcgcgtgcaGGCTTTC
TES01_0059_C10.b : ntttactgcggtggcacgGGCTTTT
KDN01_0028_G12.b : ntttacggcggtggctatgggtctCCCTTTC
PST01_0057_F09.b : tttttgctgcgttggcacgggtctCCCTTTC
PST01_0049_H12.b : tcgcgttggctatggcgtctCCCTTTC
KDN01_0083_C09.b : nnnncctgcggtggctcggctTTTTTTT
KDN01_0059_E04.b : nnnncctacggtggctcgggtctCCCTTTC
SKNB1_0048_F09.b : nnnnncctgccgtggctatGGCTTTC
PST01_0048_F02.b : ttttttactgcggtggctatGGCTTTC
PST01_0050_G05.b : nnnnttcgcgttggctctggCTTTTTT
PST01_0083_F03.b : nnnncctgcggtggctcggCTTTTTT
OVRT1_0057_C01.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcCCCTTTC
OVRM1_0048_H01.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTCTC
PTG01_0064_C11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxGCTTTC
LVRM1_0087_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
OVRM1_0009_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
OVRM1_0081_G11.b : ttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
SMG01_0049_C04.b : tgagtaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
OVRM1_0187_E02.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
TES01_0064_A09.b : tttttctgcgtggctcgGCTTTT
OVRM1_0078_G04.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
OVRM1_0002_C06.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
OVRM1_0072_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
BFLT1_0145_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGCTTTC
TES01_0107_C05.b : nnttagcgttggctcgGCTTTT
PCT01_0035_E09.b : ngggatccccnnnncctacgctgtgcacgGCTTTT
SPL01_0030_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
OVRT1_0110_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
ADR01_0022_B10.b : taaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
TES01_0033_A04.b : ctgcgttggcatGCTTTC
UTR01_0032_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcCTTTTC
BFLT1_0109_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
PST01_0001_G09.b : ncccttaactttnnncctacgtgtgctcgggnctaCCTTTC
BFLT1_0074_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGCTTTC
BFLT1_0091_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTTTC
OVRT1_0088_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
OVRT1_0151_F01.b : agtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
KDN01_0089_H02.b : ttactgcggtgcacgggtcaCCTTTC
BFLT1_0047_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
KDN01_0045_C06.b : agaagcattggcctcgGCTTTT
CLNT1_0152_G01.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
BFLT1_0008_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
BFLT1_0036_F10.b : agtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGCTTTC
SMG01_0027_C09.b : nggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcCTTTTC
ITT01_0075_C12.b : nnggagtaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
BFLT1_0113_C11.b : acgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
BFLT1_0117_A08.b : gnatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
OVRT1_0062_H10.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
PST01_0070_B08.b : nnnttcgctgtggcacggCCTTTC
BFLT1_0115_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
ITT01_0081_E02.b : nnggatatacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
PST01_0029_G03.b : tttttcctgcggtggctcgggtctaCCTTTC
KDN01_0057_D10.b : nnaatgcgttggctctggCTTTTT
PST01_0074_H10.b : nnnncctgcggtggctcgGCTTTT
PST01_0042_A09.b : tttttctcgcggtggctatgGCTTTT
PST01_0066_C09.b : nnnnttcgctgtggctatggCTTTTT
PST01_0067_B03.b : ttttgcccgcgttggctatgGCTTTT
PST01_0071_B01.b : ttttactgcggtggctctggCTTTTT
KDN01_0010_F03.b : nnggcttnnnnnnncctgcgttggctcGGCTTT
PST01_0023_A11.b : nnnnnaacctgcgttggctatGGCTTT
PST01_0047_G11.b : nntttgctgcgttggctatgGCTTTT
TES01_0002_G04.b : ntttcctgcgtggctatggaCCTTTC
ITT01_0009_G02.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
ITT01_0038_F07.b : nnggagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
OVRT1_0046_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
KDN01_0055_B05.b : ncctgctgtggctctgGCTTTT
ITT01_0001_G11.b : nnggtgtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
TCH01_0103_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
OVRT1_0018_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTTC
PST01_0098_C09.b : nnaactgctgtggctatgGCTTTT
SPL01_0103_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
LNG01_0057_B09.b : tacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
SMG01_0016_G08.b : tnnggataaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVRM1_0196_E03.b : gtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVR01_0065_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVR01_0076_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGGTTC
TES01_0112_H07.b : tttctgctgtggctatGGCTT
OVRM1_0152_C07.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
LVRM1_0087_C11.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVRM1_0130_A10.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTC
OVRM1_0058_F11.b : ttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
UTR01_0102_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
SPL01_0025_C04.b : nnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaggTTTTC
TES01_0084_G03.b : ttttcctgaggtggctctGGCTT
THY01_0007_D06.b : gaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
UTR01_0008_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
PCT01_0022_F06.b : nnnncccatttnnnnnnagcagcgggtgcactGGCTT
SMG01_0024_D06.b : nngggctaaagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
BFLT1_0148_E06.b : gagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVR01_0033_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
TES01_0051_F07.b : cctacgtggctctGGCTT
OVRT1_0139_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
PBL01_0010_C09.b : ntaanggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
SPL01_0104_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVRT1_0101_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVRT1_0031_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVRT1_0016_H01.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
ITT01_0093_C01.b : taactatacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
PTG01_0033_G06.b : aattnggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVRT1_0077_B10.b : gagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
PST01_0002_G08.b : cattttnnnnnnncctgcgttgtgcactGGCTT
PCT01_0018_H11.b : nnnngggagtnnnnnnnncctgcgttggcacggcTTTTT
BFLT1_0045_H02.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTC
CLNT1_0021_C04.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
TES01_0014_G06.b : ntttcgcgttggctctgaGTTTT
BFLT1_0022_A10.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
BFLT1_0012_B10.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
CLNT1_0093_C02.b : gagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCTTTC
OVRT1_0121_B10.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
TES01_0042_F07.b : ttttcctgctgtggctatGGCTT
PST01_0023_F04.b : nttttatcgctgtggctatGGCTT
OVRT1_0058_E10.b : agtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
PST01_0080_F07.b : nnncctgctgtggctatGGCTT
THY01_0203_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
PST01_0043_E01.b : nnnnggtcgctgtggctaGGCTT
PST01_0060_C08.b : nttttcctgcgttggcatGGCTT
PST01_0083_E12.b : nnttaactgcggtggctcggCTTTT
PST01_0031_G02.b : aaacctgctgtggctctGGCTT
PST01_0013_G12.b : ttgtaannncctgcgttggctcGGCTT
PST01_0100_H07.b : nnnaactgcgttggctatggCTTTT
SPL01_0103_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
LVR01_0001_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
KDN01_0006_D10.b : nnnntgctgcggtggctatGGCTT
CLNT1_0087_C01.b : cgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVR01_0094_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTC
PST01_0082_D11.b : nnnnncctgaggtggctacggCTTTT
PST01_0056_B02.b : nnncctgctgtggctaggtaCCTTT
PST01_0035_E12.b : tttatcgctgtggctctGGCTT
PST01_0075_H09.b : nnnnggctgcgtggctcggCTTTT
KDN01_0080_A09.b : nncccgcggtggctcggCTTTT
PST01_0006_G08.b : nnccctttnnnnnnncctgcggtggctctggaCTTTC
PST01_0005_E05.b : ncccttttnnnnnnactgcgttggctcggCTTTT
BFLT1_0078_F09.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCTTTC
OVRT1_0069_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
MLN01_0082_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
ITT01_0089_A11.b : nnggcgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
MLN01_0021_C05.b : tgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVRT1_0041_G02.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVRT1_0066_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcggtCTTTC
TCH01_0023_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
ITT01_0081_H12.b : naagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTC
LNG01_0064_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
ITT01_0083_A12.b : nnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
LVRM1_0111_C05.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTC
BFLT1_0147_C06.b : cgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccttgaTTTC
TES01_0062_E09.b : ttttcgcgtggctatgGTTT
TES01_0091_H08.b : nttttaactgacttggctatgggaTTTC
PST01_0071_F03.b : tcgcgttggctctgGTTT
TES01_0003_C12.b : ttttcgctgtggctctgGTTT
KDN01_0067_C10.b : nnntttgctgcgttggctatggTTTT
SKNB1_0060_C09.b : nnnngggtttnnntanggacgcgttggctaCCTT
OVRM1_0059_E12.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTC
KDN01_0045_E10.b : tggTTT
KDN01_0063_C12.b : ttttttgctgcgttggctatgggTTT
KDN01_0030_E11.b : nggtggcgttggcactggTTT
TES01_0095_D06.b : tttttcccgctgtggctctggTT
TES01_0078_E09.b : tttttgctgcgtggctctggTT
KDN01_0068_H07.b : nnaaactgctgtggctatggTT
PST01_0052_F01.b : nnatcgctgtggctatggTT
PST01_0013_H03.b : nttttttcctgcgttggctatggTT
KDN01_0068_C06.b : nnnnggctgctgtggctctggTT
KDN01_0034_H07.b : nggttttnnnnnnncctgcgttggctatggTT
TES01_0062_E10.b : ttcccgcgtggctcggC
TES01_0067_E01.b : ttttactgctgtggctctgcT
PST01_0086_C05.b : nnncctgcgtggctcggcC
KDN01_0008_B07.b : aggggncctagcgtggctctggC
PCT01_0014_F06.b : nnnggcgtctnnnnnnncctgcgttggcactggT
TES01_0039_E09.b : tttttctgcgttgctctggT
TES01_0052_E06.b : nggggcctgcgtggctC
PST01_0076_E11.b : nnnnncctgaggtggctctgnT
PST01_0085_D02.b : nncctgcggtggcttggcC
PST01_0062_G03.b : tcgcgttggctcggC
BFLT1_0099_B02.b : nacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
MLN01_0006_G10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0070_E12.b : tttttgctgcggtggctct
PST01_0094_D03.b : nnnncctgcgtggctctggt
OVRM1_0080_G08.b : agttgatcaaagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0024_B10.b : ttttccgctgtggctc
OVRT1_0119_A09.b : gnatgttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcctat
LVRM1_0053_F06.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0081_D05.b : cgctgtg
LNG01_0002_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0004_G10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0154_D01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0189_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0101_F03.b : nacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0063_B03.b : tctgcgtaggagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0003_F08.b : nnnaactgcagt
BFLT1_0138_B01.b : tcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0052_F10.b : agctgtg
SPL01_0088_H11.b : nacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0010_D12.b : ttcgcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0017_F07.b :
OVRT1_0002_A07.b : tagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0053_B05.b : ntcgcgtg
TES01_0029_A04.b : ctttg
PST01_0035_F10.b : ttcctgctgtt
KDN01_0090_D02.b : nnnnncctgcgtg
PST01_0038_D05.b : ctggcgttg
KDN01_0068_B03.b : nnnnnggctgcgttg
PST01_0029_D05.b : ttttcctgctgtg
PST01_0088_B11.b : nnnncctgctgtt
KDN01_0055_B02.b : tagcgttg
PST01_0097_C03.b : nnnggtgctgtg
PST01_0026_G08.b : ntttcctgacgtg
OVRT1_0082_D12.b : gttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0089_H06.b : nnnncctgctgtg
ITT01_0033_E04.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0077_B03.b : nnnnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0056_E03.b : nnnnnggatgaacagcggtacggtxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0031_C07.b : nnnaattgtgttnnnnngccagcggtggcactggt
KDN01_0037_A07.b : ntttcctacgtggctacggct
TES01_0019_C02.b : cgcgttgg
PST01_0040_B09.b :
KDN01_0021_E09.b : tttttcccgctgtggc
PST01_0039_G07.b :
KDN01_0021_H06.b : nnnnnnncctgcgttgg
PST01_0020_F03.b :
BFLT1_0149_G09.b : ccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0058_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0114_C09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0009_C03.b : nnnnccgtcgctgacgagtgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0061_B11.b :
THY01_0096_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0075_B06.b : nnnncc
THY01_0108_F09.b : gttgcaaaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0185_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_B01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0028_D12.b : atttttggcaactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0058_E05.b : cgttgatcaaagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0203_H09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0122_C01.b : naaaccgttcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0053_A12.b : nnccgatagcggacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0008_H09.b : ttccgttcagctntangagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0083_B10.b : cgtctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0126_B09.b : nnnccctttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0081_E03.b : ncctacggtggctct
TES01_0043_E01.b : g
PST01_0022_C10.b : t
CLNT1_0150_B12.b : nncccctcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0019_B05.b : c
PST01_0062_C02.b : ttt
KDN01_0070_H10.b : nccc
TES01_0013_E03.b : nnnnnt
KDN01_0042_B04.b : nnnnnnggc
OVRT1_0055_D05.b : nnnnnnnccccttagcgttacgaggttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0076_F10.b : tggatccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0083_A03.b : tttnnnnnccccgttcgcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0065_C04.b : ctggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0070_C12.b : ntttac
TES01_0102_E10.b :
OVRM1_0060_G04.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0082_E05.b :
LNG01_0009_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0017_B12.b :
PTG01_0027_H03.b : nnnccagtannnnnnggagtaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0022_E04.b : nc
OVRT1_0016_D12.b : ttccgatagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0108_D06.b : nnnnccgtcagctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0031_F03.b : n
PST01_0077_F01.b : ttttcc
PST01_0099_A01.b : nnnggc
TES01_0009_A01.b : ttt
PST01_0089_D07.b : nnnnc
PST01_0059_C04.b : nnnnnc
PST01_0007_D04.b : nnggctttnnnnnnc
TES01_0054_E08.b : nttttc
KDN01_0098_F02.b : nnntttnnnnnnnnnc
PST01_0093_G10.b : nnnnnc
CLNT1_0043_C12.b : nttccgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0081_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0013_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0019_F06.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0185_E01.b : gagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0079_B12.b : cgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0047_C12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0051_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0099_E04.b : ntttcc
OVRT1_0118_C11.b : nnnnccgttctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0084_C08.b : cgtcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0110_D10.b : nnnccccgttcagcgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0004_G12.b : g
BFLT1_0075_A02.b : gggattcgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0080_H04.b : n
LNG01_0011_F12.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0051_D06.b : tc
UTR01_0047_D09.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0017_A04.b :
PBL01_0017_F04.b : gaagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0004_G07.b : nttgct
TES01_0015_E10.b : nnnnc
THY01_0091_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0094_H06.b : nnnn
PST01_0088_H03.b : nnnnggc
KDN01_0033_C03.b : tttttncctg
KDN01_0073_E10.b : nnnncct
KDN01_0010_E11.b : ncctttnnnnnnna
KDN01_0067_F02.b : nnnnncct
OVRT1_0059_C09.b : nnnnncctatagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0045_A03.b : nnnnncctcagcgnacgnatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0091_C07.b : tttttgct
PST01_0062_A11.b : nnngg
PST01_0099_F03.b : nnnaact
OVRT1_0082_A02.b : tnnnnnnccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0020_G06.b : tatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0100_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0051_E01.b : nnttgatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0096_F05.b : nnnncccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0219_F08.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0156_D09.b : agttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0104_D01.b : gtttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0221_H09.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0025_D09.b :
PBL01_0003_D12.b : gtgtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0175_C07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0174_D07.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0064_E05.b : c
OVRM1_0166_H10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0113_H08.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0152_E10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0197_E10.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0148_G01.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0133_G04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0225_E07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0016_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0209_H05.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0169_H04.b : gcgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0014_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0120_E06.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0103_D04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0072_A05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0112_G08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0041_A11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0018_D12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0012_D10.b : cagattgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0034_B07.b : tttt
THY01_0007_E02.b : gacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0065_A09.b : gcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0026_E09.b : ctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0061_B10.b : ttttagctaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0078_F09.b : tacanncggataaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0144_B10.b : nnnnnnnccgttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0006_A03.b : nnntttcgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0115_A10.b : nntttcgtttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0045_D10.b : aataac
OVRT1_0113_G02.b : nnnnccgtcagctgtagagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0116_E04.b : nnnnnccgacagcggaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0103_F12.b : naaaagataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0030_E10.b : gantacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0039_E05.b : nnnnccgtcagcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0011_G03.b : nnngggctaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0032_H03.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0076_B09.b : ggaacccgttagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0013_H04.b : nggatcttannntgataaagcagcggtaxxxxxxxxxxxxxxxxxxxxxx
KDN01_0069_F11.b : nn
THY01_0034_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0040_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0009_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0056_C05.b : ctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0061_C07.b : cttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0113_D06.b : nnnccccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0128_D02.b : nnnnccgttagctgtangagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0128_D07.b : nnnnccgtttagcgtangxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0084_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0008_A04.b : nnnttcgtctagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0100_A09.b : nnntttcttctgcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0095_G09.b : tnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0057_G08.b :
OVRT1_0057_B04.b : nnnnnnccgtcttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0099_B05.b : nnnaaagatggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0098_D12.b : ggggtccttctgcgcacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0007_A05.b : nnggcgtttnnnnn
PST01_0042_D09.b : nttcct
PST01_0052_H08.b : nnnncc
THY01_0207_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0086_H08.b : nnn
TES01_0054_B05.b :
OVRT1_0028_A12.b : nnnncnnccgttagcgttacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0093_B02.b : nnnncc
KDN01_0041_D12.b : tt
TES01_0012_G01.b : n
OVRT1_0013_D01.b : nnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0095_F01.b : ttt
PST01_0034_B02.b : nt
PST01_0036_C10.b : nn
PST01_0094_G04.b : nnncct
TES01_0049_E11.b : ttt
PST01_0052_B03.b : nn
KDN01_0096_H05.b : nnn
PST01_0088_D03.b : nnn
PST01_0092_H03.b : nnnaa
PST01_0071_H08.b : nnnn
PST01_0084_F06.b : nnnncc
OVRT1_0022_B01.b : nnnnnncccgttagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0080_F06.b : nnnaatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0012_A07.b : ctttnnnnnnn
PBL01_0068_G08.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0104_B01.b : ntt
CLNT1_0065_G10.b : ntttccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0010_D07.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0060_A10.b : nnnaatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0146_C04.b : nnnnnccgatagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0071_A04.b : nnnnnnnccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0048_D09.b : gggatggtatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0095_F03.b : nnaactgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0041_B05.b : nnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0100_B12.b : gacttccgttcagcgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0113_D04.b : nnnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0074_H05.b : nt
PST01_0063_G03.b : ntt
ITT01_0080_A08.b : nnnggtcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0032_E10.b : nnnngatgaacagctggtxxxxxxxxxxxxxxxxxxxxxx
TES01_0007_C06.b : ntttc
SPL01_0091_B01.b : ctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0006_H06.b : nnnaagagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0087_B03.b : nnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0068_D03.b : nnggggnacgttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0027_D07.b : ggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0056_E07.b : nttcggctaggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0011_B07.b : nngggtgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0083_A11.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0088_C11.b : t
KDN01_0073_F12.b : nn
TES01_0110_H05.b :
KDN01_0002_E08.b : nggcctttnnnnnnnncc
OVRM1_0082_H09.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0167_G02.b : ncgttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0010_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0057_D12.b : tt
TES01_0047_A09.b : agacagttg
KDN01_0050_E07.b : ttttat
TES01_0091_F01.b : ttttn
TES01_0091_E10.b : ntt
TES01_0019_G10.b :
TES01_0084_D06.b : t
PST01_0013_A02.b : ttttttt
PST01_0025_G01.b : nnnn
TES01_0002_E08.b : n
OVRT1_0120_A07.b : nnccgtttgcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0003_B12.b : nntt
PST01_0025_F02.b : tttt
LNG01_0022_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0055_E06.b :
PST01_0033_G06.b :
PST01_0079_H09.b : nn
PST01_0033_A07.b : n
TES01_0018_E03.b : t
PST01_0022_A01.b :
TES01_0023_C03.b :
PCT01_0021_E09.b : ngggcacttnnnnnn
KDN01_0024_G05.b : nttt
PST01_0072_C06.b : nnnn
PST01_0027_G11.b : nnn
PST01_0038_H05.b :
PST01_0007_F07.b : nggggncc
KDN01_0093_F05.b : nnnngg
PST01_0029_F01.b : tttttaa
PST01_0034_G06.b : naa
PST01_0019_E03.b : cttaatt
TES01_0041_A03.b : t
PST01_0014_E11.b : ttttattnt
PST01_0058_F03.b : nnnncctgc
KDN01_0078_D04.b : nn
KDN01_0085_D05.b : nnnn
PST01_0015_E01.b : gcttattnnnn
KDN01_0054_F11.b :
PST01_0007_C03.b : nnggctttnnnnn
PST01_0061_A04.b : n
PST01_0008_D07.b : nnngggttttnnnnnn
KDN01_0009_B04.b : nnnaattnnnnn
KDN01_0087_C11.b : ttt
KDN01_0023_B10.b : t
PST01_0088_B05.b : n
PST01_0024_A10.b : nn
PST01_0024_B02.b : ncc
KDN01_0082_D02.b : nn
OVRM1_0172_F02.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0055_E09.b : cgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0068_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0033_C03.b : naatcgatnnn
TES01_0112_B08.b : ttt
TES01_0022_F09.b :
PST01_0002_B04.b : cctccannnn
KDN01_0006_A05.b : nnnngg
THY01_0099_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0011_G04.b : nggctctnnnn
PCT01_0011_A09.b : nnggcttannnnnnnc
KDN01_0087_D01.b : nnnttg
PST01_0014_B06.b : nccttttnn
KDN01_0067_A12.b : nn
TES01_0027_C12.b :
OVRM1_0081_F08.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0067_H01.b : ttaactg
PST01_0009_C05.b : gtatnnnnnnncctgc
KDN01_0025_D12.b : ttt
KDN01_0033_B07.b : tttt
PST01_0012_B03.b : tttnnnnn
PST01_0053_A12.b : nnnn
ADR01_0093_C01.b : ccccnggatgaacxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0053_G11.b :
ADR01_0011_C07.b : nnnaatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0064_E01.b : nn
PST01_0026_D01.b : ttttnnn
THY01_0120_B12.b : gttgcaaaaacagctgtxxxxxxxxxxx
TES01_0001_C12.b :
OVRM1_0116_B01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0041_G05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0011_A09.b : tcatttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0072_D06.b :
TES01_0102_D03.b :
TES01_0010_E04.b :
TES01_0009_A11.b :
TES01_0026_B01.b :
KDN01_0091_E03.b : nnn
KDN01_0061_C03.b :
OVRT1_0003_B02.b : tttnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0022_E04.b :
KDN01_0029_E10.b :
LVRM1_0093_B09.b : cxxxxxxxxxxxxxxxxxxxxxxx
TES01_0077_G08.b :
TES01_0088_F01.b :
TES01_0085_H05.b :
OVRM1_0094_G06.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0099_B08.b :
TES01_0025_D03.b :
TES01_0006_C11.b :
TES01_0034_A11.b :
KDN01_0025_G04.b :
TES01_0050_H09.b : n
PST01_0029_D01.b :
PST01_0042_H12.b :
OVRM1_0173_A01.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0017_A02.b : gtgaaacaxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0100_C03.b : taattgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0047_H06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0172_F03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0116_H07.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0078_E11.b : cgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0031_A05.b : cactttgaggaactxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0083_D08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0083_F11.b : nggcttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0118_H01.b : nnnccccttagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0105_C06.b :
PTG01_0018_D07.b : nnggctttttnnnnggcgtaagcagcxxxxxxxxxxxxxxxxxxx
SPL01_0055_H02.b : ntttcgataggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0101_F07.b : nnnnccgtctgctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0102_C12.b : nnnnggacgtaacaxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0149_D10.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0089_G01.b : nttccgttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0069_F01.b :
LVR01_0054_G10.b : aaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0111_D10.b : ttttttnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0058_G02.b :
OVRT1_0039_D08.b : gttttttnnnnnnnccctcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0056_A02.b : cttnnnnnnnnnnnacgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0057_A05.b :
OVRT1_0018_G12.b : ggttttnnnnnnnnccgttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0069_G08.b : gctttnnnnnnnnnccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0075_C09.b : nggaaccgttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0012_B05.b : naaacctttagctnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0046_G06.b : nnnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0107_A08.b : nnnnggcatgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0078_D08.b : nnnnggctgaacaxxxxxxxxxxxxxxxxxxxxxx
TES01_0086_G12.b : t
TES01_0058_C06.b :
BFLT1_0125_D10.b : nnnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0036_C11.b : nnnggtgaaacxxxxxxxxxxxxxxxxxxxx
PST01_0062_H02.b :
PST01_0074_F04.b :
LNG01_0019_A06.b : agctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0043_H03.b :
PST01_0077_H04.b :
PST01_0012_B07.b :
PST01_0009_H10.b :
PST01_0046_B03.b :
TES01_0041_G12.b :
PST01_0086_C01.b :
PST01_0032_G01.b :
KDN01_0033_A04.b :
PST01_0038_F03.b :
PST01_0015_D05.b :
PST01_0022_H09.b :
KDN01_0096_B04.b :
PST01_0095_F02.b :
PST01_0074_D10.b :
KDN01_0018_E04.b : nccctt
KDN01_0088_B07.b :
PST01_0010_H06.b : cctt
KDN01_0099_E09.b :
PST01_0099_A06.b :
PST01_0048_B12.b :
PST01_0082_E02.b :
TES01_0047_A04.b :
TES01_0055_D02.b :
PST01_0100_G09.b :
PST01_0027_H03.b :
KDN01_0043_C02.b :
TES01_0017_C03.b :
PST01_0016_H11.b : ggg
KDN01_0034_H12.b :
LVRM1_0135_E07.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0059_H03.b :
TES01_0031_H08.b :
PST01_0044_B07.b :
PCT01_0022_H02.b : nnnaac
BFLT1_0072_G07.b : gaatcgttaggcgtacgagtgxxxxxxxxxxxxxxxxxxxxx
TES01_0002_G02.b :
PST01_0020_D02.b :
TES01_0010_C01.b :
TES01_0077_C02.b :
TES01_0110_G03.b :
BFLT1_0101_E01.b : nntttgcctcagctgtcgxxxxxxxxxxxx
TES01_0081_G12.b :
OVRM1_0127_B01.b : nagttgtcxxxxxxxxxxxx
OVRT1_0133_E08.b : nnnaccctgcnnnnnnnnccgttcgcgttacgaggxxxxxxxxx
BFLT1_0054_A04.b : nnnggcggggnnggncctcgttagcgnacgxxxxxxxxxxxxxx
TES01_0011_D12.b :
BFLT1_0144_F03.b : nnttcaccgtcgctgtcgxxxxxxxxxxxxx
TES01_0078_E08.b :
TES01_0092_E05.b :
TES01_0025_D08.b :
LVRM1_0033_F02.b : cgttgtcxxxxxx
OVR01_0055_B10.b : nttgcttggactatnacxxxxxxxxxxxxxxx
OVRM1_0194_A11.b : agttgtcxxxxxx
ADR01_0047_A04.b : nttttaagagta
BFLT1_0051_A02.b : ggatccgtcagcgnacggaggxxx
BFLT1_0014_B06.b : nggatccgttagcgnacgxxxxxxxxxx
OVRT1_0066_E09.b : nnaaaccgtcagcgnacgxxxxxxxx
BFLT1_0039_G12.b : gattccgttcagcgtaggxxxxxxxx
BFLT1_0014_D01.b : gaactccgttagcggacgxxxxxxxx
TES01_0081_H11.b :
TES01_0101_F02.b :
TES01_0037_H11.b :
PCT01_0023_F06.b :
PST01_0003_C05.b :
PST01_0042_E06.b :
PST01_0019_F10.b :
KDN01_0024_B07.b :
TES01_0006_A08.b :
KDN01_0099_B10.b :
MLTL1_0099_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0053_G10.b :
KDN01_0045_G06.b :
PST01_0033_C12.b :
LVR01_0036_G04.b :
MLTL1_0009_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0036_C09.b :
PST01_0032_B07.b :
TES01_0094_F08.b :
TES01_0009_B03.b :
TES01_0054_H04.b :
LNG01_0108_F10.b :
KDN01_0052_G01.b :
TES01_0030_D01.b :
TES01_0018_A05.b :
TCH01_0041_A06.b :
LNG01_0017_E09.b :
TES01_0043_C06.b :
TES01_0108_D11.b :
TES01_0105_H06.b :
TES01_0012_C05.b :
TES01_0019_E04.b :
TES01_0068_E08.b :
MLN01_0037_D12.b :
BFLT1_0136_B10.b :
MLN01_0088_B08.b :
BFLT1_0133_A07.b :
AMP01_0073_H05.b :
MLN01_0009_G04.b :
20110601C-001821 : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
---------+---------+---------+---------+---------+---------+ 142
BFLT1_0034_G05.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ADR01_0004_C04.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVR01_0067_D07.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SPL01_0067_A09.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0105_A08.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0129_D10.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**C*CCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0057_A02.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0017_A02.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0196_H10.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LNG01_0080_H04.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LNG01_0004_D01.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0056_E10.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0011_H08.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ADR01_0053_D12.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ADR01_0053_D02.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
THY01_0056_B10.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0037_C02.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
HTMT1_0133_F03.b : CCTCATCAC*CCTCCTTTGA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0179_A12.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0089_F06.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0112_H09.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0019_D03.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
CLNT1_0045_B03.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0038_G04.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGGTCTTCTG
OVRM1_0186_G01.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SMG01_0064_F06.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCCG
OVRT1_0140_G11.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0110_B01.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**C*CCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0094_G01.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ADR01_0033_B01.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0054_G03.b : CCTCAGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0092_E12.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0001_B10.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0040_C10.b : CCCCCTTTA*CAGGCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCCT*TTTCTG
TES01_0008_H07.b : CCTCC*CAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0073_G01.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0009_E09.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0005_F08.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SPLT1_0013_F02.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVR01_0010_H06.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0057_F02.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0214_D07.b : CCTCAGCAGACCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0106_G08.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LNG01_0088_D04.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
AMP01_0087_F04.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SMG01_0087_B08.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0037_H07.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVR01_0067_A10.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0043_C04.b : CTC**GCAG*CCTCCTTTCA***CCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0094_G11.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0072_C10.b : CCTC*GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0018_B03.b : CCTC*GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
THY01_0093_H04.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0074_B02.b : CTC**GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LVRM1_0081_B03.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0061_D02.b : CCTCAGCAG*CCTCCTTTCA**ACCTCGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0082_D03.b : CCTCAGCAG*CCTCCTTTCA***CCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0022_F08.b : CCTCAGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0005_B08.b : TCCTCGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
CLNT1_0140_B07.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0004_G06.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0066_H08.b : CCTC*GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0060_A11.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0041_F10.b : CCTC*GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0004_F04.b : CTC**GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0028_G09.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0035_F02.b : CCTC*GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0018_C11.b : CCTCAGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0099_F12.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0079_E07.b : CCTC*GCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0040_A03.b : CCTC*GCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*TTTCTG
TES01_0050_C02.b : CCTCAGCAG*CCTCCTTTCA***CCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0054_G04.b : TCCTCGCAG*CCTCCTTTCA***CCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRM1_0046_F02.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGCTCAGCGCGG*CTTCTG
THY01_0123_G05.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0162_D08.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRM1_0088_A11.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
THY01_0038_E12.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0076_C04.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0044_E05.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVR01_0028_H06.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGCC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0058_H06.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
MLN01_0028_B02.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTCCTG
PTG01_0104_F10.b : CCTCAGCGG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0132_G05.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
UTR01_0021_A05.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0123_F06.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
THY01_0121_E01.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SMG01_0095_G08.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SMG01_0071_C07.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0004_C05.b : CCTC*GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCA*GC*CAGCGCGG*CTTCTG
OVR01_0035_G05.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC***CCCCCCCAAGC*CAGCGCGG*CTTCTG
PCT01_0036_A12.b : CTC**GCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0063_A11.b : CTC**GCAG*CCTCCTTTCA**ACCTTGTC***CCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0004_G02.b : CTC**GCAG*CCTCCTTTCA**CCTTGT****CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0038_D08.b : CCCCAGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PCT01_0032_F12.b : CTC**GCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0058_B06.b : CCTC*GCAG*CCTCCTTTCA***CCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0059_G12.b : C**TCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0053_C03.b : CCTCAGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCC**AGC*CAGCGCGG*CTTCTG
PST01_0087_B09.b : C**TCGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0095_D07.b : CCTC*GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0056_H01.b : C**TCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0080_G05.b : CTC**GCAG*CCTCCTTTCA***CCTTGTCC*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0026_H07.b : CCTC*GCAG*CCTCCTTTCA**ACCTTGTC***CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0051_G01.b : C**TCGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0019_E02.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0058_C05.b : CCTC*GCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0091_F05.b : CCTC*GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCCG*TTTCTG
PST01_0007_B09.b : C**TCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0085_C09.b : C**TCGCAG*CCTCCTTTCA***CCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRT1_0034_G05.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0080_C06.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0006_B05.b : C**TCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0089_E01.b : CTC**GCAG*CCTCCTTTCA***CCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRM1_0093_A05.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
PTG01_0022_H06.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0184_C10.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0072_H01.b : C**TCGCAG*CCTCCTTTCA***CCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0002_B11.b : CTC**GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0060_C05.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PCT01_0009_A10.b : CNCANC**A*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0142_A10.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVR01_0060_C11.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTCC*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SMG01_0013_D07.b : CCTCACCAG*CCTCCTTTCA**ACCTTGTC***CCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0097_H12.b : CTC**GCAG*CCTCCTTTCA***CCTTGTC***CCCCCCCCACC*CTGCGCGG*CTTCTG
OVRT1_0028_G02.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0073_A09.b : CCTCAGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0100_G08.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCCCGG*CTTCTG
TES01_0050_B01.b : CTC**GCAG*CCTCCTTTCA***CCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0007_G01.b : CTC**GCAG*CCTCCTTTCA***CCTTGTC***CCCCCCCAAGC*CAGCGCGG*CTTCTG
OVR01_0031_C03.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTCCCCCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0095_C09.b : CTC**GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0091_F10.b : CTC**GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0026_A02.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
UTR01_0054_G08.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SKNB1_0081_G02.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0059_C10.b : CCTC*GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0028_G12.b : CCTC*GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0057_F09.b : CTC**GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CATCGCGG*CTTCTG
PST01_0049_H12.b : CTC**GCAG*CCTCCTTTCA***CCTTGTC**TCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0083_C09.b : CCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0059_E04.b : CCTCAGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SKNB1_0048_F09.b : CTC**GCAG*CCTCCTTTCA***CCTTGT***CCCCCCCCCCGC*CAGCGCGG*CTTCTG
PST01_0048_F02.b : CTC**GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0050_G05.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0083_F03.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0057_C01.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0048_H01.b : CCTCAGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PTG01_0064_C11.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LVRM1_0087_C04.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRM1_0009_A08.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0081_G11.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SMG01_0049_C04.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0187_E02.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0064_A09.b : CCTC*GCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0078_G04.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRM1_0002_C06.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRM1_0072_D03.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTCC*CCCCCCCCAGNC*CAGCGCGG*CTTCTG
BFLT1_0145_B08.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0107_C05.b : CCTC*GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PCT01_0035_E09.b : CCTC*GCAC*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGTGTTTCTG
SPL01_0030_G02.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0110_E01.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ADR01_0022_B10.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0033_A04.b : CTC**GCAG*CCTCCTTTCA***CCTTGT***TCCCCCCCCAGC*CAGCGCGG*CTTCTG
UTR01_0032_E06.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0109_D09.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0001_G09.b : CTC**GCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0074_D04.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0091_G11.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0088_C07.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0151_F01.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0089_H02.b : C**TCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0047_A10.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0045_C06.b : CCTC*GCAG*CCTCCTTTCA***CCTTGTC***CCCCCCCCAGC*CAGCCCGT*TTTCTG
CLNT1_0152_G01.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0008_A04.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0036_F10.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SMG01_0027_C09.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0075_C12.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0113_C11.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0117_A08.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0062_H10.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0070_B08.b : CCTC*GCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCCCGG*CTTCTG
BFLT1_0115_A10.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0081_E02.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0029_G03.b : CCTC*GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CACCTCGG*CTTCTG
KDN01_0057_D10.b : TCCTCGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0074_H10.b : CCTC*GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0042_A09.b : CCTC*GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0066_C09.b : CCTCAGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0067_B03.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCCCTG*CTTCTG
PST01_0071_B01.b : CCTCAGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0010_F03.b : CCTCAGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0023_A11.b : CCTC*GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0047_G11.b : CCTC*GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0002_G04.b : CTC**GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0009_G02.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0038_F07.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0046_C03.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0055_B05.b : TCCTCGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0001_G11.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*TTTCTG
TCH01_0103_F06.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0018_A11.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0098_C09.b : CCTC*GCAG*CCTCCTTTCA***CCTTGTC***CCCCCCCCAGC*CAGCGCGG*CTTCTG
SPL01_0103_B02.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LNG01_0057_B09.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SMG01_0016_G08.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0196_E03.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVR01_0065_F08.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVR01_0076_F06.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0112_H07.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0152_C07.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
LVRM1_0087_C11.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRM1_0130_A10.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0058_F11.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
UTR01_0102_A10.b : CCTCAGCAT*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SPL01_0025_C04.b : CCTCAGCAG*CCTCCTTTCA**ACCTAGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0084_G03.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
THY01_0007_D06.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
UTR01_0008_C08.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PCT01_0022_F06.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC***CCCCCCCAAGC*CAGCGCGG*CTTCTG
SMG01_0024_D06.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0148_E06.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVR01_0033_E10.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0051_F07.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC***CCCCCCCCAGC*CAGCGCGC*CTTCTG
OVRT1_0139_A11.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PBL01_0010_C09.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SPL01_0104_B05.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0101_G04.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0031_B04.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0016_H01.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0093_C01.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PTG01_0033_G06.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0077_B10.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0002_G08.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PCT01_0018_H11.b : TCCTCGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0045_H02.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
CLNT1_0021_C04.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0014_G06.b : CCTC*GCAG*CCTCCTTTCA***CCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
BFLT1_0022_A10.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0012_B10.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
CLNT1_0093_C02.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0121_B10.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0042_F07.b : TCCTCGCAG*CCTCCTTTCA***CCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0023_F04.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCCCCT*TTTCTG
OVRT1_0058_E10.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0080_F07.b : TCCTCGCAG*CCTCCTTTCA**ACCTTGTC***CCCCCCCCAGC*CAGCGCCG*CTTCTG
THY01_0203_E03.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0043_E01.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0060_C08.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0083_E12.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0031_G02.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGC*CTTTTG
PST01_0013_G12.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0100_H07.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SPL01_0103_D09.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LVR01_0001_C04.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0006_D10.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
CLNT1_0087_C01.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVR01_0094_H03.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0082_D11.b : TCCTCGCAG*CCTCGTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0056_B02.b : CCTC*GCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0035_E12.b : TCCTCGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0075_H09.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0080_A09.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0006_G08.b : C**TCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0005_E05.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0078_F09.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0069_E11.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
MLN01_0082_A04.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0089_A11.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
MLN01_0021_C05.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0041_G02.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0066_B06.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TCH01_0023_H11.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0081_H12.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LNG01_0064_G12.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0083_A12.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LVRM1_0111_C05.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0147_C06.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0062_E09.b : CCTCAGCAG*CCTCCTTTCA***CCTTGT***CCCCCCCCCAGC*CAGCGCGG*CCTCTG
TES01_0091_H08.b : CCTC*GCAG*CCTCCTTTCA***CCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0071_F03.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCCC*TTTCTG
TES01_0003_C12.b : CCTCAGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0067_C10.b : CCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SKNB1_0060_C09.b : TCCTCGCAG*CCTCCTTTCA***CCTTGT*****CCCCCCCAGC*CAGCGCGG*CTTCTG
OVRM1_0059_E12.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0045_E10.b : CCTCA*CAG*CCTCCTTTCA**ACCTTGTC***CCCCCCCCAGC*CAGCCCGT*TTTCTG
KDN01_0063_C12.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0030_E11.b : TCCTCGCAG*CCTCCTTTCA***CCTCGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0095_D06.b : TCCTCGCAG*CCTCCTTTCA**ACCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0078_E09.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0068_H07.b : TCCTCGCAG*CCTCCTTTCA**ACCTTGTC***CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0052_F01.b : TCCTCGCAG*CCTCCTTTCA***CCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0013_H03.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0068_C06.b : TCCTCGCAG*CCTCCTTTCA***CCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0034_H07.b : TCCTCGCAG*CCTCCTTTCA***CCTCGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0062_E10.b : TTTCCTCACGCCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0067_E01.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0086_C05.b : TTTCCTCACACCTCCTTTCA**ACCTTGTC***CCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0008_B07.b : TTTCCTCGCACCTCCTTTCA***CCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
PCT01_0014_F06.b : TCCTCGCAG*CCTCCTTTCA**ACCTTGTC***CCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0039_E09.b : CCTCAGCAG*CCTCCTTTCA***CCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0052_E06.b : TTTCCTCACGCCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0076_E11.b : TCCTCGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0085_D02.b : TTTCCTCGCACCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0062_G03.b : TTTCCTCACGCCTCCTTTCA***CCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
BFLT1_0099_B02.b : CCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
MLN01_0006_G10.b : CCTCAGCAG*CCTCCTTTCA**ACTTGTNC****CCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0070_E12.b : TTTCCTCGCACCTCCTTTCA**ACCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0094_D03.b : TTTCCTCACACCTCCTTTCA**ACCTAGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0080_G08.b : gCTCAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0024_B10.b : tggCTCACG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0119_A09.b : acagAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CCTTTCAG*CTTCTG
LVRM1_0053_F06.b : xxagAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0081_D05.b : gctcTGGACACCTCCTTTCA***CCTTGTC***CCCCCCCCAGC*CAGCGCGG*CTTCTG
LNG01_0002_D01.b : xtggAGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LVRM1_0004_G10.b : xxxxxGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LVRM1_0154_D01.b : xxxxxGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRM1_0189_G10.b : xxxxxGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVR01_0101_F03.b : xxxxxGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0063_B03.b : xxxxxGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0003_F08.b : tgctcGGACACCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0138_B01.b : xcggtGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LVR01_0066_A08.b : xxxxxGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0052_F10.b : gctctGGACACCTCCTTTC***ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SPL01_0088_H11.b : xxxxxGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0010_D12.b : xxxxxGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0017_F07.b : tatGGACACCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0002_A07.b : xxxxxGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0053_B05.b : gctatGGACACCTCCTTTCA***CCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0029_A04.b : gctatGGACACCTCCTTTCA***CCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0035_F10.b : gctatGGACACCTCCTTTCA***CCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0090_D02.b : gctatGGACACCTCCTTTCA***CCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0038_D05.b : gctctGGACACCTCCTTTCA***CCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0068_B03.b : gctatGGACACCTCCTTTCA***CCTTGTCC*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0029_D05.b : gctctGGACACCTCCTTTCA***CCTTGTC***CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0088_B11.b : gctctGGACACCTCCTTTC***ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTTTG
KDN01_0055_B02.b : gctatGGACACCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0097_C03.b : gctatGGACACCTCCTTTCA***CCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0026_G08.b : gctatGGACACCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0082_D12.b : xxxxxGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0089_H06.b : gctctGGACACCTCCTTTCA***CCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
ITT01_0033_E04.b : xxxxxGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ADR01_0077_B03.b : xxxxxGCAG*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ADR01_0056_E03.b : xxxxxGCAG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PCT01_0031_C07.b : tcctcagCG*CCTCCTTTC***ACCTTGTC***CCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0037_A07.b : tccccatCA*CCTCCTTTCA***CCTTGTC***CCCCCCCAAGC*CAGNGCGG*CCCCTT
TES01_0019_C02.b : ctctgagCA*CCTCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0040_B09.b : cgttGG*CTCTGGCTTC**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0021_E09.b : tctggagCA*CCTCCTTTCA**ACCTTGTC***CCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0039_G07.b : gtTGGCTCTGGCTTC**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0021_H06.b : ctatgggCG*CCTCCTTTCA***CCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0020_F03.b : gGCTATGGCTTTC**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
BFLT1_0149_G09.b : xxxxxxxxG*CCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
THY01_0058_B09.b : xxxxxxxxxxCTTTTTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LVRM1_0114_C09.b : xxxxxxxxxxCTGGCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0009_C03.b : xxxxxxxxxxCTGGCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0061_B11.b : tgtggctCTGGCTTTCA***CCTTGTC***CCCCCCCCAGC*CAGCGCGG*CTTCTG
THY01_0096_H11.b : xxxxxxxxxxCTGGCTTTCA**ACCTTGT****CCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0075_B06.b : tgacgtggctCTGGCTTTCA***CCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
THY01_0108_F09.b : xxxxxxxxtggCTCCTTT*A**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LVRM1_0185_E01.b : xxxxxxxxxxxCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LVRM1_0033_B01.b : xxxxxxxxxxxCT*TTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0028_D12.b : xxxxxxxxxxtTTTTTTTCA**ACCTTGT***CCCCCCAACAGC*CAGCGCGG*CTTCTG
OVRM1_0058_E05.b : xxxxxxxxxxcTTTTTTTCA**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0203_H09.b : xxxxxxxxxxxCTTTTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0122_C01.b : xxxxxxxxxxxGGCTTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0053_A12.b : xxxxxxxxxctTTTTTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0008_H09.b : xxxxxxxxxxxCT*TTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0083_B10.b : xxxxxxxxxxxTGGCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0126_B09.b : xxxxxxxxxxxCTTTTTTTC**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0081_E03.b : ggtatggcctcTGGCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*TTTCTG
TES01_0043_E01.b : ctttggcactgTGGCTTTCA***CCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0022_C10.b : cgcgttggctaTGGCTTTCA***CCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
CLNT1_0150_B12.b : xxxxxxxxxxxCTCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0019_B05.b : cgctgtggctcTGGCTTTTC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0062_C02.b : tcactgtggctCTGGCTTTC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0070_H10.b : tgcgttggctcTGGCTTTCA***CCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0013_E03.b : tcactgttgctCTGGCTTTC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0042_B04.b : tgcggtggctaTGGCTTTCA***CCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRT1_0055_D05.b : xxxxxxxxxxxTGGCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0076_F10.b : xxxxxxxxcatTGGCTTTTC**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0083_A03.b : xxxxxxxxxxxCTGGCTTTC**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LNG01_0065_C04.b : xxxxxxxxxxxCT*TTTTCA**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0070_C12.b : tgcgttggctaTGGCTTTCA***CCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0102_E10.b : nttggcgtggctATGGCTTC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CCTCTG
OVRM1_0060_G04.b : xxxxxxxxxxxcTTTTTTCA**ACCTTGTC**CCCCCCCC*AGC*CAGCGCGG*CTTCTG
TES01_0082_E05.b : tgtggctcTGGCTTTC**ACCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
LNG01_0009_H08.b : xxxxxxxxxxctTTTTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0017_B12.b : tgtggctatgGGCTTTCA***CCTTGT***CCCCCCCCGAGC*CAGCGCGG*CTTCTG
PTG01_0027_H03.b : xxxxxxxxxxxxGGCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0022_E04.b : ctgcgttggctaTGGCTTTC**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRT1_0016_D12.b : xxxxxxxxxcttTCCTTTCA**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0108_D06.b : xxxxxxxxxxxxTCCTTTCA**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0031_F03.b : ctgcgttggctcTGGCTTTC**ACCCTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0077_F01.b : tgcggttgctatGGCTTTTC**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0099_A01.b : tgctgtggctcgGGCTTTTTTCACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0009_A01.b : tcctgcgtggctATGGCTTC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0089_D07.b : ctgacgtggctaTGGCTTTC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0059_C04.b : ctgctgtggctaTGGCTTTC**ACCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0007_D04.b : ctgcgtttgcacGGCTTTTC**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0054_E08.b : ctgctgtggctaTGGCTTTC**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0098_F02.b : ctgcgttggctaTGGCTTTC**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0093_G10.b : ctgctgtggctaTGGCTTTC**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
CLNT1_0043_C12.b : xxxxxxxxxxxaGCTTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVR01_0081_B03.b : xxxxxxxxxxxxxCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVR01_0013_H03.b : xxxxxxxxxxxxxTTTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0019_F06.b : xxxxxxxxxxxxxCTTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0185_E01.b : xxxxxxxxxxxxxCTTTTCA**ACCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRM1_0079_B12.b : xxxxxxxxxxxxxCTTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0047_C12.b : xxxxxxxxxxxxxGCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
THY01_0051_G01.b : xxxxxxxxxxxxxCTTTTCA**ACCTTGTC***CCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0099_E04.b : tgcgtggctctggCTTTTTC**ACCTTGT***CCCCCCCCGAGC*CAGCGCGG*CTTCTG
OVRT1_0118_C11.b : xxxxxxxxxxxxxCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0084_C08.b : xxxxxxxxxccttGCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0110_D10.b : xxxxxxxxxxxxxCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0004_G12.b : tagcggtggctacGGCTTTC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0075_A02.b : xxxxxxxxxxxtgCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0080_H04.b : ctgcagttgctatGGCCTTC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LNG01_0011_F12.b : xxxxxxxxxxxxtGCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0051_D06.b : acgttggctatggCTTTTTTC*ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
UTR01_0047_D09.b : xxxxxxxxxxxxxCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0017_A04.b : cggtggctatGGCCTTC**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PBL01_0017_F04.b : xxxxxxxxxxxxxCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0004_G07.b : gacgtgtgctatgGCTTTTTC*ACCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0015_E10.b : cttctgttgctacGGCTTTC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
THY01_0091_C11.b : xxxxxxxxxxxxxCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0094_H06.b : ggctgaggttgctCTTTTTT**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0088_H03.b : tgcgttggctatgGCTTTTTC*ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0033_C03.b : cgttggctctggtTTTTTTTC*ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0073_E10.b : gatgtggctctggCTTTTTTC*ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0010_E11.b : ctgcgttgcctcgGCTTTTTC*ACCTTGT***CCCCCCCCAA*C*CAGCGCGG*CTTCTG
KDN01_0067_F02.b : gctgtggctctggCTTTTTTTCACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRT1_0059_C09.b : xxxxxxxxxxxxxCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0045_A03.b : xxxxxxxxxxxxxCTTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0091_C07.b : gcggtggctatggCTTTTTTC*ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0062_A11.b : ctgctgtggctggCTTTTTC**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0099_F03.b : gctgtggctacggCCTTTCA***CCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRT1_0082_A02.b : xxxxxxxxxxxxxCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVR01_0020_G06.b : xxxxxxxxxxxxxCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
THY01_0100_B06.b : xxxxxxxxxxxxxCTTTTCA**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0051_E01.b : xxxxxxxxxxxxxCCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0096_F05.b : xxxxxxxxxxxxxCCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0219_F08.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0156_D09.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
THY01_0104_D01.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGCCCAGCGCGG*CCTCTG
OVRM1_0221_H09.b : xxxxxxxxxxxxxxCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0025_D09.b : CTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PBL01_0003_D12.b : xxxxxxxxxxxxxxCTTTTTTCACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0175_C07.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCTAAGC*CAGCGCGG*CTTCTG
LVRM1_0174_D07.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0064_E05.b : cactgttgctctggCTTTTTC*ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0166_H10.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRM1_0113_H08.b : xxxxxxxxxxxxxxTTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0152_E10.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LVRM1_0197_E10.b : xxxxxxxxxxxxxxTTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LVRM1_0148_G01.b : xxxxxxxxxxxxxxCTTTTC**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0133_G04.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0225_E07.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
THY01_0016_C06.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0209_H05.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0169_H04.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC***CCCCCCC*AGC*CAGCGCGG*CTTCTG
OVRM1_0014_C12.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0120_E06.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0103_D04.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0072_A05.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0112_G08.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRM1_0041_A11.b : xxxxxxxxxxxxxxTTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0018_D12.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRM1_0012_D10.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0034_B07.b : actgcgttggctatATGGCTTCACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
THY01_0007_E02.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVR01_0065_A09.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
UTR01_0026_E09.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SMG01_0061_B10.b : xxxxxxxxxxxxxcCCTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SMG01_0078_F09.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0144_B10.b : xxxxxxxxxxxxxxCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0006_A03.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0115_A10.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0045_D10.b : tgacttggccactgGCTTTC**ACCTGTTC****CCCCCCCAGC*CAGCGCGG*CTTCTG
OVRT1_0113_G02.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0116_E04.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PBL01_0103_F12.b : xxxxxxxxxxxxxxCTTTTTTCACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LNG01_0030_E10.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0039_E05.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PBL01_0011_G03.b : xxxxxxxxxxxxxxCTTTCA***CCATGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
THY01_0032_H03.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0076_B09.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SMG01_0013_H04.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0069_F11.b : nncctgaggtggctATGGCTTCACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
THY01_0034_B10.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVR01_0040_F04.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SPL01_0009_H06.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVR01_0056_C05.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVR01_0061_C07.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0113_D06.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC****CCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0128_D02.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0128_D07.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**C*CCCCCCAAGC*CAGCGCGG*CTTCTG
THY01_0084_G02.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0008_A04.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0100_A09.b : xxxxxxxxxxxxxxTTTTTC**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0095_G09.b : xxxxxxxxxxxxxxCTTTTTTCACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0057_G08.b : nncctgctgtggctATGGCTTTACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRT1_0057_B04.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LNG01_0099_B05.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0098_D12.b : xxxxxxxxxxxxxxTTTTTTC*ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PCT01_0007_A05.b : ncctgcgggtgcacGGCTTC**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0042_D09.b : gactgtggctatggCTTTCTTCACCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0052_H08.b : tgcgttggctctggCTTTTTTCACCTTGT*****CCCCCCCAGC*CAGCGCGG*CTTCTG
THY01_0207_A07.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0086_H08.b : aactgagttggctaGGCTTC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0054_B05.b : naacgctgtggctATGGCTTCACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0028_A12.b : xxxxxxxxxxxxxxCTTTTC**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0093_B02.b : tgctgttgctatggCTTTTC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0041_D12.b : ttcctgcggtggctATGGCTTCACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0012_G01.b : cctgctgtggctctGGGTTC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0013_D01.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0095_F01.b : ttcctgcgttggctATGGCTTTACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0034_B02.b : tactgacgtggctcGGCTTC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0036_C10.b : naactgctgtggctATGGCTTTACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0094_G04.b : gctgtggctatggtCTTATC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0049_E11.b : nnccagcgttggctATGGCTTCACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0052_B03.b : nttctgctgtggctATGGCTTTACCTTGT***CCCCCCCCAAGC*CAGCGCGA*CTTCTG
KDN01_0096_H05.b : nncctgctgtggctATGGCTTTACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0088_D03.b : nncctgagttggctATGGCTTTACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0092_H03.b : cgacgttgctatggCTTTTTC*ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0071_H08.b : ggctgcgttggctcGGCTTT**ACCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0084_F06.b : tgcggtggctctggCTTTTTC*ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRT1_0022_B01.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PBL01_0080_F06.b : xxxxxxxxxxxxxxCTTTTC**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0012_A07.b : gctgcgttggctacGGCTTC**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PBL01_0068_G08.b : xxxxxxxxxxxxxxCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0104_B01.b : ttcttgcgttgctaCCTTTC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
CLNT1_0065_G10.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0010_D07.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0060_A10.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0146_C04.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0071_A04.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0048_D09.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0095_F03.b : xxxxxxxxxxxxxxCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0041_B05.b : xxxxxxxxxxxxxxCTTTTTTCACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0100_B12.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0113_D04.b : xxxxxxxxxxxxxxCTTTTC**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0074_H05.b : ttcctgaggttgctATGGCTTCACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0063_G03.b : cgcgttggctctggCTTTTC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0080_A08.b : xxxxxxxxxxxxxxCTTTTTTCACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0032_E10.b : xxxxxxxxxxxxxxCTTTCA***CCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0007_C06.b : ctgcgtggctatggCTTTTTC*ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SPL01_0091_B01.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0006_H06.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0087_B03.b : xxxxxxxxxxxxxaCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0068_D03.b : xxxxxxxxxxxxxxCTTTTC**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TCH01_0027_D07.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LNG01_0056_E07.b : xxxxxxxxxxxxxxCTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0011_B07.b : xxxxxxxxxxxxxxCTTTTC**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0083_A11.b : xxxxxxxxxxxxxxCTTTCA***CCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0088_C11.b : tttggctgaggttgCTTTTTTCACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0073_F12.b : nnactgcgttggctATGGCTTCACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0110_H05.b : ccgctttggctcTGGCTTCACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0002_E08.b : tgcaggtggctctggCTTTTTCACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0082_H09.b : xxxxxxxxxxxxxxxTTTTC**ACCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRM1_0167_G02.b : xxxxxxxxxxxxxxxTTTCA**ACCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
THY01_0010_A04.b : xxxxxxxxxxxxxxxTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0057_D12.b : tactgctgttgctacTGGCTTCACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0047_A09.b : gcacggaagagccccTTTCA***CCTTGTCC*CCCCC****AGC*TACTGCGG*CTTCTG
KDN01_0050_E07.b : tctgcgtgtgctcggTTTTC**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0091_F01.b : cctagcgttgctaggCCTTT**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0091_E10.b : ttccatgcgttgctaTGGCTTTACCTTGT****CCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0019_G10.b : cgcgttggctcTGGCTTCACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0084_D06.b : ttcctgctgttgctaTGGCTTCACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0013_A02.b : nncctgcggtggctcTGGCTTCACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0025_G01.b : naactgcggtggctcTGGCTTCACCTTGTC****CCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0002_E08.b : ttctgcgttggctatGCTTC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0120_A07.b : xxxxxxxxxxxxxxxCTTTT**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0003_B12.b : tagctgcggtggctcTGGCTTTACCTTNT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0025_F02.b : ttactgcgttggctcTGGCTTCACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
LNG01_0022_C09.b : xxxxxxxxxxxxxxxTTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0055_E06.b : nnttcgctgtggctcTGGCTTCACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0033_G06.b : nnatgactgtggctcTGGCTTCACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0079_H09.b : nncctgctgttgctaTGGCTTTACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0033_A07.b : nnttcgctgtggctcTGGCTTCACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0018_E03.b : tcccgcgtggctcggCCTTC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0022_A01.b : tcgcgttggctcTGGCTTCACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0023_C03.b : nccgcgttggctatGGGTTC*ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PCT01_0021_E09.b : ncctgcagtgtgcacTGGCTTCACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0024_G05.b : tttctgctgtggctcTGGCTTTACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0072_C06.b : cctgcggtggctcggCCTTC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0027_G11.b : nncctgctgtggctaTGGCTTTACCTTGT****CCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0038_H05.b : tggcgttggctcTGGCTTCACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0007_F07.b : tcacggtggctcggnCCTTC**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0093_F05.b : ctgcggtggctatggTTTTC**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0029_F01.b : ctgcgttggctctggTTTTC**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0034_G06.b : ccgcggtggctatggCCTTC**ACCTTGT****CCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0019_E03.b : ttactgctgtggctcTGGCTTCACCTTGT****CCCCCCCCCGC*CAGCGCGG*CTTCTG
TES01_0041_A03.b : ttcctgcgttggctcTGGCTTCACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0014_E11.b : tngctgcgttggctcTGGCTTCACCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0058_F03.b : tgtggctctggacctCCTTC**ACCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0078_D04.b : nnttcgcggttgctaTGGCTTTACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0085_D05.b : nncctgaggtggctcTGGCTTTACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0015_E01.b : nngctgcgttggctcTGGCTTCACCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0054_F11.b : gttggctatGGCCTTCACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0007_C03.b : ntgctgcgttggctaTGGCTTTACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0061_A04.b : nngctgctgttgctaTGGCTTCACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0008_D07.b : cctgcgttggctcggCCTTC**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0009_B04.b : nncctgcgttggctcTGGCTTCACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0087_C11.b : ttactgcggttgctaTGGCTTCACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0023_B10.b : ttcctgctgtggctcTGGCTTCACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0088_B05.b : nnncctgcgttggcaTGGCTTCACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0024_A10.b : nggctgctgttgctaTGGCTTCACCTTGT****CCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0024_B02.b : ccgctgtggctctggCTTTTTCACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0082_D02.b : nnncctacggtggcaTGGCTTCACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0172_F02.b : xxxxxxxxxxxxxxxxTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0055_E09.b : xxxxxxxxxxxxxxxxTTCA**ACCTTGTCC*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
THY01_0068_C05.b : xxxxxxxxxxxxxxxxTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0033_C03.b : nccgcgtttgcacggaTTTC**ACCTTGT*****CCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0112_B08.b : ttcgctgttgctatggTTTC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0022_F09.b : ggctttggcTACTG*GACTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0002_B04.b : nncctgcgtttggcacGGCTTCACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0006_A05.b : ctacagtggctctggtCTTC**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
THY01_0099_D08.b : xxxxxxxxxxxxxxxxTTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0011_G04.b : nnncctgcgtttgctcGGCTTTACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PCT01_0011_A09.b : ctacgttggctctggaCTTC**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0087_D01.b : cctgcggttgctctggTTTT**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0014_B06.b : nnncctgcgttggctcGGCTTTACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0067_A12.b : nnngctgcgttggctaGGCTTCACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0027_C12.b : tgtggctctgtgGCTTCACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0081_F08.b : xxxxxxxxxxxxxxxxgTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0067_H01.b : ctgtggctctgacacctCCTTCACCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0009_C05.b : gttggctatgggcgcctCCTTCACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0025_D12.b : tactgctgtggctatggCCTTTACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0033_B07.b : ttcctgcggtggctnggCCTTCACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0012_B03.b : ncctgcgttggctctggTTC**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0053_A12.b : ccctgctgtggctctggCCTTTACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
ADR01_0093_C01.b : xxxxxxxxxxxxxxxxxTCA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0053_G11.b : actgcgttggctatgggTC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ADR01_0011_C07.b : xxxxxxxxxxxxxxxxxtCTTCACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0064_E01.b : nncctgaggtggctatgaTTC*ACCTTGT***CCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0026_D01.b : nncctgcgttggctatggTTTCACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
THY01_0120_B12.b : xxxxxxxxxxxxxxxxxxxA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0001_C12.b : tttattactgttgctatggA**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0116_B01.b : xxxxxxxxxxxxxxxtttgA**ACCTTGGCC*CCCCCCCCAGGC*CAGCGCGG*CTTCGG
OVRM1_0041_G05.b : xxxxxxxxxxxxxxxxxxxA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LNG01_0011_A09.b : xxxxxxxxxxxxxxxxxxxA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0072_D06.b : ttccggcgttggctATGGCTTCACCTTGTCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0102_D03.b : ncctgctttggctctggggTT*ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0010_E04.b : nnttggcgttggctactG**GACTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0009_A11.b : ttcctgctgtggctactgG**GACTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0026_B01.b : ncctgcggtggctactG**GACTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0091_E03.b : nnggctgcggtggctacggC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0061_C03.b : ctgacgtggctatgaTTCACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0003_B02.b : xxxxxxxxxxxxxxxxxxgA**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0022_E04.b : nttttccgctgtggctctggT*TTCACCTTG*ACCCCCCCTAGC*CAGCGCGG*CTTCTG
KDN01_0029_E10.b : tcgcgttggctactG*GACTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
LVRM1_0093_B09.b : xxxxxxxxxxxxxxxxxxxxxtACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0077_G08.b : gtggctactGACTTGTC****CCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0088_F01.b : nttcctgctgttgctactGACTTGTC**CCCCCCC**AGC*CAGCGCGG*CTTCTG
TES01_0085_H05.b : naactgctgtggctctggctggACCTTGTC***CCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0094_G06.b : xxxxxxxxxxxxxxxxxxxxxtACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0099_B08.b : ttttactgcgtggctactggGACTTGTC**CCCCCCC**AGC*CAGCGCGG*CTTCTG
TES01_0025_D03.b : ggctctggAACTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0006_C11.b : ttttggcgttggctatgACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0034_A11.b : ccgcgttggctctggACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0025_G04.b : nccctgcgttggctctggACCTTGT****CCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0050_H09.b : nnnaactgctgttgctatggggACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0029_D01.b : tagcggtggctatggACCTTGTC*****CCCCCCCGC*CAGCGCGG*CTTCTG
PST01_0042_H12.b : ttttgctcgctgtggctatggACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0173_A01.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ADR01_0017_A02.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGT***CCCCCCCCTAGC*CAGCGCGG*CTTCTG
OVRM1_0100_C03.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0047_H06.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0172_F03.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
LVRM1_0116_H07.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0078_E11.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRM1_0031_A05.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRM1_0083_D08.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
SPL01_0083_F11.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0118_H01.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0105_C06.b : tttccctgctgtggctactggACTTGTC***CCCCCCCAAGC*CAGCGCGG*CTTCTG
PTG01_0018_D07.b : xxxxxxxxxxxxxxxxxxxxxggCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SPL01_0055_H02.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0101_F07.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0102_C12.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0149_D10.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTCCCCCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0089_G01.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0069_F01.b : tttgctacgttggctatgnaACTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LVR01_0054_G10.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0111_D10.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0058_G02.b : tttttgctgcgttggctatgnAACCCTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0039_D08.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0056_A02.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0057_A05.b : nntttcctactgtggctactggACTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0018_G12.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0069_G08.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0075_C09.b : xxxxxxxxxxxxxxxxxxcccttCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0012_B05.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0046_G06.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
UTR01_0107_A08.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0078_D08.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0086_G12.b : taatctgcgttggctctgctgggtCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0058_C06.b : ccactttggctactGGACTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
BFLT1_0125_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTGTCC*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ADR01_0036_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTGTC**CCCCTCCCAAGC*CAGCGCGG*CTTCTG
PST01_0062_H02.b : nttctgcgttggctactGGACTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0074_F04.b : attacctgctgttgctatgaaCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LNG01_0019_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0043_H03.b : nnttgctcgctgtggctactGGACTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0077_H04.b : ttttcctgcagtggctactGGACTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0012_B07.b : tattnnnnncctgcgttggctactGGACTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0009_H10.b : nttttnccctgcgttggctactGGACTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0046_B03.b : ntttttcctacggttgctatggaCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0041_G12.b : tttcctgctgttgctactGGACTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0086_C01.b : nnnaactgcgttggctatGGACTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0032_G01.b : nnnaactgcgttggctactGGACTTG*TCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0033_A04.b : nnntttggctgcggtggctctGGACTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0038_F03.b : nnaatggctgtggctactggaACTTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0015_D05.b : ttgggttaatcacgttggctactggACTTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0022_H09.b : ttttcctcgcgttggctactggACTTGT*CCCCCCCCAAGC*TAGCGCGG*CTTCTG
KDN01_0096_B04.b : nnnncctgctgtggctatggACTTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0095_F02.b : nnnnggctgcgtttgctactggACTTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0074_D10.b : ntttcctgagtttgctactggACTTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0018_E04.b : tcttnnnnncctgcgttggctctggACCTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0088_B07.b : nnnnnggctacgtttgctactggACTTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0010_H06.b : tctnnnnncctgcgttggctactggACTTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0099_E09.b : nnnnggctgcggtggctactggACTTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0099_A06.b : nnnncctgacgtggctactggACTTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0048_B12.b : nnnnggctacggtggctactggACTTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0082_E02.b : ttttgctgaggttgctatggACTTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0047_A04.b : cgttggctctggaACTTG*TCCCCCCCCCGC*CATCACGT*TTTCTG
TES01_0055_D02.b : tttgncctacgtttgctatggaACTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0100_G09.b : nnttcctgcggtggctactggaACTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0027_H03.b : nnaactgctgtggctatgatCCTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0043_C02.b : nnnnncccgctgtggctactggACTTGTCCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0017_C03.b : cgcgttggctatggtACTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0016_H11.b : tttnnnnnngctgcgttggctactggACTTGTCCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0034_H12.b : nttttgctgacgttgctctggaACTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
LVRM1_0135_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0059_H03.b : nnnnncctacgtttgctatggGTCC*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0031_H08.b : gctttggctctggaaCTT**GTCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0044_B07.b : ttttggctacggtggctatggatCTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
PCT01_0022_H02.b : ttttnnnnnnncctgcgttggctctggcTG**TCCCCCCCCAGC*CAGCGCGG*CTTCTG
BFLT1_0072_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxcgTGTCCCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0002_G02.b : tttcctgctgtggctatgCTTGTCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0020_D02.b : ttttttnnntncctgcgttggctctggTG*TCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0010_C01.b : nntctacgttggctactggaCTTGTCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0077_C02.b : ncccctgtggctatggggaG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0110_G03.b : ttccgcttttgctatggctgnCCCCCCCAGC*CAGCGCGG*CTTCTG
BFLT1_0101_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggCAGC*CAGCGCGG*CTTCTG
TES01_0081_G12.b : AGC*CAGCGCGG*CTTCTG
OVRM1_0127_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC*CAGCGCGG*CTTCTG
OVRT1_0133_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC*CAGCGCGG*CTTCTG
BFLT1_0054_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC*CAGCGCGG*CTTCTG
TES01_0011_D12.b : ttttcgcgttggctcT*GGACGCGG*CTTCTG
BFLT1_0144_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgatC*CAGCGCGG*CTTCTG
TES01_0078_E08.b : ttttaatgctgttgctatggagCAGCGCGG*CTTCTG
TES01_0092_E05.b : ttttcctgctgttgctatggagCAGCGCGG*CTTCTG
TES01_0025_D08.b : gtgagccGCGCGG*CTTCTG
LVRM1_0033_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGCGG*CTTCTG
OVR01_0055_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGCGG*CTTCTG
OVRM1_0194_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGCGG*CTTCTG
ADR01_0047_A04.b : acaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGCGG*CTTCTG
BFLT1_0051_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGCGG*CTTCTG
BFLT1_0014_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGCGG*CTTCTG
OVRT1_0066_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcggtGCGCGG*CTTCTG
BFLT1_0039_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGCGG*CTTCTG
BFLT1_0014_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGCGG*CTTCTG
TES01_0081_H11.b : gttggctctggtggaCGCGG*CTTCTG
TES01_0101_F02.b : tttcctgcgttgctatggaCGCGG*CTTCTG
TES01_0037_H11.b : tttggctctggaCGCGG*CTTCTG
PCT01_0023_F06.b : nnnnggcattttnnnnnnncctacggtgtgcacggnaCGCGG*CTTCTG
PST01_0003_C05.b : ttttcctcacggtggccactggaCGCGG*CTTCTG
PST01_0042_E06.b : nnncctgacgatggctatggaCGCGG*CTTCTG
PST01_0019_F10.b : gcgttggctatggaCGCGG*CTTCTG
KDN01_0024_B07.b : nnnnnccggctgtggctctggaCGCGG*CTTCTG
TES01_0006_A08.b : tttttcgctgttgctatggaCGCGG*CTTCTG
KDN01_0099_B10.b : nttttgctgctgttgctatggaCGCGG*CTTCTG
MLTL1_0099_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTCTG
TES01_0053_G10.b : ccttctaG
KDN01_0045_G06.b : cccttttacaG
PST01_0033_C12.b : ntggcgttggctatggggcttcG
LVR01_0036_G04.b : ctccaagcctgctggcttacttgg
MLTL1_0009_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0036_C09.b :
PST01_0032_B07.b :
TES01_0094_F08.b :
TES01_0009_B03.b :
TES01_0054_H04.b :
LNG01_0108_F10.b :
KDN01_0052_G01.b :
TES01_0030_D01.b :
TES01_0018_A05.b :
TCH01_0041_A06.b :
LNG01_0017_E09.b :
TES01_0043_C06.b :
TES01_0108_D11.b :
TES01_0105_H06.b :
TES01_0012_C05.b :
TES01_0019_E04.b :
TES01_0068_E08.b :
MLN01_0037_D12.b :
BFLT1_0136_B10.b :
MLN01_0088_B08.b :
BFLT1_0133_A07.b :
AMP01_0073_H05.b :
MLN01_0009_G04.b :
20110601C-001821 : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
---------+---------+---------+---------+---------+---------+ 198
BFLT1_0034_G05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ADR01_0004_C04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVR01_0067_D07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SPL01_0067_A09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0105_A08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0129_D10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0057_A02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0017_A02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0196_H10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LNG01_0080_H04.b : GGGC*AGCGGC*GGCGGT*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LNG01_0004_D01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0056_E10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0011_H08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ADR01_0053_D12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ADR01_0053_D02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0056_B10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0037_C02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
HTMT1_0133_F03.b : GGGC*AGCGGC*GGCGGC*AGCTCCAGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0179_A12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0089_F06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0112_H09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0019_D03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
CLNT1_0045_B03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0038_G04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0186_G01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SMG01_0064_F06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0140_G11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0110_B01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0094_G01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ADR01_0033_B01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0054_G03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0092_E12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0001_B10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0040_C10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0008_H07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0073_G01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0009_E09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0005_F08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SPLT1_0013_F02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVR01_0010_H06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0057_F02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0214_D07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0106_G08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCAT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LNG01_0088_D04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
AMP01_0087_F04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SMG01_0087_B08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0037_H07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVR01_0067_A10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0043_C04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0094_G11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0072_C10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0018_B03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0093_H04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0074_B02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LVRM1_0081_B03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCCTCCCTC
OVRM1_0061_D02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0082_D03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0022_F08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0005_B08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
CLNT1_0140_B07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0004_G06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0066_H08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0060_A11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0041_F10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0004_F04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0028_G09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0035_F02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0018_C11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0099_F12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0079_E07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0040_A03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0050_C02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0054_G04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0046_F02.b : GGGCTAGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0123_G05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0162_D08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0088_A11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0038_E12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0076_C04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0044_E05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVR01_0028_H06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0058_H06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
MLN01_0028_B02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PTG01_0104_F10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0132_G05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
UTR01_0021_A05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0123_F06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0121_E01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SMG01_0095_G08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SMG01_0071_C07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0004_C05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVR01_0035_G05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PCT01_0036_A12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0063_A11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0004_G02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0038_D08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PCT01_0032_F12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0058_B06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0059_G12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0053_C03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0087_B09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0095_D07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0056_H01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0080_G05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0026_H07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0051_G01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0019_E02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0058_C05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0091_F05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCCCATTTCTCTTCCCTCCTTCCCTC
PST01_0007_B09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0085_C09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0034_G05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0080_C06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0006_B05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0089_E01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0093_A05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PTG01_0022_H06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0184_C10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0072_H01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0002_B11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0060_C05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PCT01_0009_A10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0142_A10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVR01_0060_C11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SMG01_0013_D07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0097_H12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGTCTCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0028_G02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0073_A09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0100_G08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0050_B01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0007_G01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVR01_0031_C03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0095_C09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0091_F10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0026_A02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
UTR01_0054_G08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SKNB1_0081_G02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCTGCATTTCTCTTCCCTCCTTCCCTC
TES01_0059_C10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0028_G12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0057_F09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0049_H12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0083_C09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0059_E04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SKNB1_0048_F09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCTGCATTTCTCTTCCCTCCTTCCCTC
PST01_0048_F02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0050_G05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0083_F03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0057_C01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0048_H01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PTG01_0064_C11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LVRM1_0087_C04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0009_A08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0081_G11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SMG01_0049_C04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0187_E02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0064_A09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0078_G04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0002_C06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0072_D03.b : GGGCCAGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0145_B08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0107_C05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PCT01_0035_E09.b : GGGC*AGCGGCCGGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SPL01_0030_G02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0110_E01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ADR01_0022_B10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0033_A04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
UTR01_0032_E06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0109_D09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0001_G09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0074_D04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0091_G11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0088_C07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0151_F01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0089_H02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0047_A10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTTTTCCCTCCTTCCCTC
KDN01_0045_C06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCTCATTTCTCTTCCCTCCTTCCCTC
CLNT1_0152_G01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0008_A04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0036_F10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SMG01_0027_C09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0075_C12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0113_C11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0117_A08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0062_H10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0070_B08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0115_A10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0081_E02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0029_G03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0057_D10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0074_H10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0042_A09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0066_C09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0067_B03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0071_B01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0010_F03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0023_A11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0047_G11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0002_G04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0009_G02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0038_F07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0046_C03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0055_B05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0001_G11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TCH01_0103_F06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0018_A11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0098_C09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SPL01_0103_B02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LNG01_0057_B09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SMG01_0016_G08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0196_E03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVR01_0065_F08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTTTTCCCTCCTTCCCTC
OVR01_0076_F06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0112_H07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0152_C07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LVRM1_0087_C11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0130_A10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0058_F11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
UTR01_0102_A10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SPL01_0025_C04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0084_G03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0007_D06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
UTR01_0008_C08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PCT01_0022_F06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SMG01_0024_D06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0148_E06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVR01_0033_E10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0051_F07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0139_A11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PBL01_0010_C09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SPL01_0104_B05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0101_G04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0031_B04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0016_H01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0093_C01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PTG01_0033_G06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0077_B10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0002_G08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PCT01_0018_H11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0045_H02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
CLNT1_0021_C04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0014_G06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0022_A10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0012_B10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
CLNT1_0093_C02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0121_B10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0042_F07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0023_F04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCCCTTTTCTCTTCCCTCCTTCCCTC
OVRT1_0058_E10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0080_F07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0203_E03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0043_E01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0060_C08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0083_E12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0031_G02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0013_G12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0100_H07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SPL01_0103_D09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LVR01_0001_C04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0006_D10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
CLNT1_0087_C01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVR01_0094_H03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0082_D11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0056_B02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0035_E12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0075_H09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0080_A09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0006_G08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0005_E05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0078_F09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0069_E11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
MLN01_0082_A04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0089_A11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
MLN01_0021_C05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0041_G02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0066_B06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TCH01_0023_H11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0081_H12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LNG01_0064_G12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0083_A12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LVRM1_0111_C05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0147_C06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0062_E09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATCTCTCTTCCCTCCTTCCCTC
TES01_0091_H08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0071_F03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCCTATTTCTCTTCCCTCCTTCCCTC
TES01_0003_C12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0067_C10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SKNB1_0060_C09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCTGCACTTCTCTTCCCTCCTTCCCTC
OVRM1_0059_E12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0045_E10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0063_C12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0030_E11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0095_D06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0078_E09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0068_H07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0052_F01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0013_H03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0068_C06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0034_H07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0062_E10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0067_E01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0086_C05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0008_B07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PCT01_0014_F06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0039_E09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCCCCTTCCCTC
TES01_0052_E06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0076_E11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0085_D02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0062_G03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0099_B02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
MLN01_0006_G10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTTCCTCCTTCNNCT
PST01_0070_E12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0094_D03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0080_G08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0024_B10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0119_A09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LVRM1_0053_F06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0081_D05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LNG01_0002_D01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LVRM1_0004_G10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LVRM1_0154_D01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0189_G10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVR01_0101_F03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0063_B03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0003_F08.b : GGGC*AGCGGC*AGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0138_B01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LVR01_0066_A08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0052_F10.b : CTTT*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SPL01_0088_H11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0010_D12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0017_F07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0002_A07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0053_B05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0029_A04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0035_F10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0090_D02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0038_D05.b : GGGT*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0068_B03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0029_D05.b : GGGC*CGTGGA*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0088_B11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0055_B02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0097_C03.b : GCGC*ATCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0026_G08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0082_D12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0089_H06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0033_E04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ADR01_0077_B03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ADR01_0056_E03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PCT01_0031_C07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0037_A07.b : AAAG*GGCGGN*GGNGGN*AGCTCCCGN*TCCTGCCGCATCTTTCTTCCCTCCTTCCCTC
TES01_0019_C02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTTCTTCCCTC
PST01_0040_B09.b : GGGC*AGCGGC*GGTGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0021_E09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0039_G07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0021_H06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTTTCTTCCCTCCTTCCCTC
PST01_0020_F03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0149_G09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0058_B09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LVRM1_0114_C09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0009_C03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0061_B11.b : GGGC*AGCGGC*GGTGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0096_H11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCTTTCCCTC
KDN01_0075_B06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0108_F09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LVRM1_0185_E01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LVRM1_0033_B01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0028_D12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0058_E05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0203_H09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0122_C01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0053_A12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0008_H09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0083_B10.b : GGGC*AGCAGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0126_B09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0081_E03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0043_E01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0022_C10.b : GGGC*AGCCGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
CLNT1_0150_B12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0019_B05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0062_C02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0070_H10.b : GGGC*AGCGGC*GGCGTG*CGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0013_E03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0042_B04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0055_D05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0076_F10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0083_A03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LNG01_0065_C04.b : GGGC*AGCGGC*GGCGGC*AGCCCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0070_C12.b : GGGC*AGCGCC*TGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0102_E10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0060_G04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0082_E05.b : GGGC*AGCGGC*CGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LNG01_0009_H08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0017_B12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PTG01_0027_H03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0022_E04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0016_D12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0108_D06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0031_F03.b : GGGC*AGCGGC*CCCTGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0077_F01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0099_A01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0009_A01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0089_D07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0059_C04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0007_D04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0054_E08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0098_F02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0093_G10.b : GGGC*AGCGCGCTGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
CLNT1_0043_C12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVR01_0081_B03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVR01_0013_H03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0019_F06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0185_E01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0079_B12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0047_C12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0051_G01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0099_E04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0118_C11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0084_C08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0110_D10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0004_G12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0075_A02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0080_H04.b : GGGC*AGCGGC*GCCGTC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LNG01_0011_F12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0051_D06.b : GGGC*AGCGTT*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
UTR01_0047_D09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0017_A04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PBL01_0017_F04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0004_G07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0015_E10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0091_C11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0094_H06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0088_H03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0033_C03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0073_E10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0010_E11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0067_F02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0059_C09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0045_A03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0091_C07.b : GGGC*AGCGCC*TGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0062_A11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0099_F03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0082_A02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVR01_0020_G06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0100_B06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0051_E01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0096_F05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0219_F08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0156_D09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0104_D01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0221_H09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0025_D09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCAT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PBL01_0003_D12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0175_C07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LVRM1_0174_D07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0064_E05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0166_H10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0113_H08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0152_E10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LVRM1_0197_E10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LVRM1_0148_G01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0133_G04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0225_E07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0016_C06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0209_H05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0169_H04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0014_C12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0120_E06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0103_D04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0072_A05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0112_G08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0041_A11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0018_D12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0012_D10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0034_B07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0007_E02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVR01_0065_A09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
UTR01_0026_E09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SMG01_0061_B10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SMG01_0078_F09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0144_B10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0006_A03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0115_A10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0045_D10.b : GGGC*AGCCCT*TTTTGG*CGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0113_G02.b : GGGC*AGCGGC*GGCGGC*AGCTTCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0116_E04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PBL01_0103_F12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LNG01_0030_E10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0039_E05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PBL01_0011_G03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0032_H03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0076_B09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SMG01_0013_H04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0069_F11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0034_B10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVR01_0040_F04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SPL01_0009_H06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVR01_0056_C05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVR01_0061_C07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0113_D06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0128_D02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0128_D07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0084_G02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0008_A04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0100_A09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0095_G09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0057_G08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0057_B04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LNG01_0099_B05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0098_D12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PCT01_0007_A05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0042_D09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0052_H08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0207_A07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0086_H08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0054_B05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0028_A12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0093_B02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0041_D12.b : GGGC*AGCGGC*CGTGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCTCTC
TES01_0012_G01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0013_D01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0095_F01.b : GGGC*AGCGCG*CTCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0034_B02.b : GGGC*AGCGGC*CGCTGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0036_C10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0094_G04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0049_E11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0052_B03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0096_H05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0088_D03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0092_H03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0071_H08.b : GGGC*AGCGCC*TGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0084_F06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0022_B01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PBL01_0080_F06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0012_A07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PBL01_0068_G08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0104_B01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
CLNT1_0065_G10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0010_D07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0060_A10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0146_C04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0071_A04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0048_D09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0095_F03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0041_B05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0100_B12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0113_D04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0074_H05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0063_G03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0080_A08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TTCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0032_E10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0007_C06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SPL01_0091_B01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0006_H06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0087_B03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0068_D03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TCH01_0027_D07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LNG01_0056_E07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0011_B07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0083_A11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0088_C11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0073_F12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0110_H05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0002_E08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0082_H09.b : GGGC*AGCAGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0167_G02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0010_A04.b : GCGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0057_D12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0047_A09.b : GGCGTTAATGC*GGCGGC*AGCTCCCGT*TCCTGCCACATTTCACTTCTCTCCTTGCATC
KDN01_0050_E07.b : GGGC*AGCCCC*TTTTGG*CGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0091_F01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0091_E10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0019_G10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0084_D06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0013_A02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0025_G01.b : GGGC*AACGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0002_E08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0120_A07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0003_B12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0025_F02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LNG01_0022_C09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0055_E06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0033_G06.b : GGGC*AGCGGCCGTGTGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0079_H09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0033_A07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0018_E03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0022_A01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0023_C03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PCT01_0021_E09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0024_G05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0072_C06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0027_G11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0038_H05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0007_F07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0093_F05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0029_F01.b : GGGC*AGCGGC*CCCTTC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0034_G06.b : GGGC*AGCGGC*CTTGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0019_E03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0041_A03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0014_E11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0058_F03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0078_D04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0085_D05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0015_E01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0054_F11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0007_C03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0061_A04.b : GGGC*AGCGGC*CGCTGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0008_D07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0009_B04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0087_C11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0023_B10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0088_B05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0024_A10.b : GGGC*AGCGCC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0024_B02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0082_D02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0172_F02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0055_E09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0068_C05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0033_C03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0112_B08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0022_F09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0002_B04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0006_A05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0099_D08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0011_G04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PCT01_0011_A09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0087_D01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0014_B06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0067_A12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0027_C12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0081_F08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0067_H01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0009_C05.b : GGGC*AGCGGC*AGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0025_D12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0033_B07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0012_B03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0053_A12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ADR01_0093_C01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0053_G11.b : GGGC*AGCGGC*GGCCGT*TTCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ADR01_0011_C07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0064_E01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0026_D01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
THY01_0120_B12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0001_C12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0116_B01.b : GGGC*AGCGAC*GGCGGC*GGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0041_G05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LNG01_0011_A09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0072_D06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0102_D03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0010_E04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0009_A11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0026_B01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0091_E03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0061_C03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0003_B02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0022_E04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TACTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0029_E10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LVRM1_0093_B09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0077_G08.b : GGGC*AGCGGC*GGCGGC*GGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0088_F01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0085_H05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0094_G06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0099_B08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0025_D03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0006_C11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0034_A11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0025_G04.b : GGGC*AGCGGC*GGCCGT*TTCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0050_H09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0029_D01.b : GGGC*AGCGGC*GGCGGC*ACCTCTTAT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0042_H12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0173_A01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ADR01_0017_A02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0100_C03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0047_H06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0172_F03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LVRM1_0116_H07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0078_E11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0031_A05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0083_D08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SPL01_0083_F11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0118_H01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0105_C06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PTG01_0018_D07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
SPL01_0055_H02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0101_F07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0102_C12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTCCCCTC
BFLT1_0149_D10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0089_G01.b : GGGC*ATCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0069_F01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LVR01_0054_G10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0111_D10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0058_G02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0039_D08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0056_A02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0057_A05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0018_G12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0069_G08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0075_C09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0012_B05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0046_G06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
UTR01_0107_A08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*CCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ITT01_0078_D08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0086_G12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0058_C06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0125_D10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ADR01_0036_C11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0062_H02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0074_F04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LNG01_0019_A06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0043_H03.b : GGGC*AGCGGC*GGCGGT*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0077_H04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0012_B07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0009_H10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0046_B03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0041_G12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0086_C01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0032_G01.b : GGGC*AGCGGC*GGCGGC*CGTTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0033_A04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0038_F03.b : GGGC*AGCGGC*GGCGGC*TGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0015_D05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0022_H09.b : GGGC*AGCGGC*GGCGCGCTGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0096_B04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0095_F02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0074_D10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0018_E04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0088_B07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0010_H06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0099_E09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0099_A06.b : GGGC*AGCGGC*GGCGCC*ATCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0048_B12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0082_E02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0047_A04.b : GGGC*AGCGGC*AGCAGC*AGCTCCCGT*TCCTGCTGCATTTCTCTTCCCTCCTTCCCTC
TES01_0055_D02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0100_G09.b : GGGC*AGCGGC*GGCGGCTAGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0027_H03.b : GGGC*AGCGGC*GGCGGC*AGTTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0043_C02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0017_C03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0016_H11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0034_H12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
LVRM1_0135_E07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0059_H03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0031_H08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0044_B07.b : GGGC*AGCGGC*GGCGGC*ACCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PCT01_0022_H02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0072_G07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0002_G02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0020_D02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0010_C01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0077_C02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0110_G03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0101_E01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0081_G12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0127_B01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0133_E08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0054_A04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0011_D12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0144_F03.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0078_E08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0092_E05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0025_D08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCCCATTTCTCTTCCCTCCTTCCCTC
LVRM1_0033_F02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVR01_0055_B10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRM1_0194_A11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
ADR01_0047_A04.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0051_A02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0014_B06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
OVRT1_0066_E09.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0039_G12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
BFLT1_0014_D01.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0081_H11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0101_F02.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0037_H11.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PCT01_0023_F06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0003_C05.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0042_E06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PST01_0019_F10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0024_B07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0006_A08.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0099_B10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
MLTL1_0099_G07.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
TES01_0053_G10.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
KDN01_0045_G06.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCCCTTTTCTCTTCCCTCCTTCCCTC
PST01_0033_C12.b : GGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTTTCTCCTTCCCTC
LVR01_0036_G04.b : aGGC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
MLTL1_0009_G08.b : xxxC*AGCGGC*GGCGGC*AGCTCCCGT*TCCTGCCGCATTTCTCTTCCCTCCTTCCCTC
PCT01_0036_C09.b : nnnngggcatatannnnnncctacgttggccacgggcaTTCTCTTCCCTCCTTCC*TC
PST01_0032_B07.b : ncctgcggtggcactggattttcCTTCCCTCCTTCC*TC
TES01_0094_F08.b : nttttnctacagtggctatggatttcCTTCCTCCTTCCCTC
TES01_0009_B03.b : nnnnttgacgtggctctggatttctcttCCTCCTTCCCTC
TES01_0054_H04.b :
LNG01_0108_F10.b : nnnnncctagtacttgacagtttgtcxxxxxxxxxxxxxxxxxx
KDN01_0052_G01.b :
TES01_0030_D01.b :
TES01_0018_A05.b :
TCH01_0041_A06.b :
LNG01_0017_E09.b :
TES01_0043_C06.b :
TES01_0108_D11.b :
TES01_0105_H06.b :
TES01_0012_C05.b :
TES01_0019_E04.b :
TES01_0068_E08.b :
MLN01_0037_D12.b :
BFLT1_0136_B10.b :
MLN01_0088_B08.b :
BFLT1_0133_A07.b :
AMP01_0073_H05.b :
MLN01_0009_G04.b :
20110601C-001821 : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
---------+---------+---------+---------+---------+---------+ 258
BFLT1_0034_G05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ADR01_0004_C04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVR01_0067_D07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SPL01_0067_A09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0105_A08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0129_D10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0057_A02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0017_A02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0196_H10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LNG01_0080_H04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LNG01_0004_D01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0056_E10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0011_H08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ADR01_0053_D12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ADR01_0053_D02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0056_B10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0037_C02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
HTMT1_0133_F03.b : CACGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0179_A12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0089_F06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0112_H09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0019_D03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
CLNT1_0045_B03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0038_G04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0186_G01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SMG01_0064_F06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0140_G11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0110_B01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0094_G01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ADR01_0033_B01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0054_G03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0092_E12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0001_B10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0040_C10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGGTCTTC
TES01_0008_H07.b : CCCGCCAGATCTCCGAATTCGCCTGCCGTGGCCTTACTCACTGCGGCCGCCCGGCTCTTT
KDN01_0073_G01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0009_E09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0005_F08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SPLT1_0013_F02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVR01_0010_H06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0057_F02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0214_D07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0106_G08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LNG01_0088_D04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
AMP01_0087_F04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SMG01_0087_B08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0037_H07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVR01_0067_A10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0043_C04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTGCTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0094_G11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0072_C10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0018_B03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0093_H04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0074_B02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LVRM1_0081_B03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0061_D02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0082_D03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0022_F08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACCCACTGCGGCCGCCCGGCTCTTC
TES01_0005_B08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
CLNT1_0140_B07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0004_G06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0066_H08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0060_A11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0041_F10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0004_F04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0028_G09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0035_F02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0018_C11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0099_F12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0079_E07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0040_A03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0050_C02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0054_G04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0046_F02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0123_G05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0162_D08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0088_A11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0038_E12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0076_C04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0044_E05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVR01_0028_H06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0058_H06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
MLN01_0028_B02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PTG01_0104_F10.b : CCCGCCAGATCTCCGAATCCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0132_G05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
UTR01_0021_A05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0123_F06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0121_E01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SMG01_0095_G08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SMG01_0071_C07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0004_C05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVR01_0035_G05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PCT01_0036_A12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0063_A11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0004_G02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0038_D08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PCT01_0032_F12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACCCACTGCGGCCGCCCGGCTCTTC
PST01_0058_B06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0059_G12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0053_C03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0087_B09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0095_D07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0056_H01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0080_G05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0026_H07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0051_G01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0019_E02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0058_C05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0091_F05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0007_B09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0085_C09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0034_G05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0080_C06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0006_B05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0089_E01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0093_A05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PTG01_0022_H06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0184_C10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0072_H01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0002_B11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0060_C05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PCT01_0009_A10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0142_A10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVR01_0060_C11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SMG01_0013_D07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACCGCGGCCGCCCGGCTCTTC
PST01_0097_H12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0028_G02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0073_A09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0100_G08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0050_B01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0007_G01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVR01_0031_C03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0095_C09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0091_F10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0026_A02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
UTR01_0054_G08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SKNB1_0081_G02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0059_C10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0028_G12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0057_F09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0049_H12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0083_C09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0059_E04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SKNB1_0048_F09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0048_F02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0050_G05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0083_F03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0057_C01.b : TCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0048_H01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PTG01_0064_C11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LVRM1_0087_C04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0009_A08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0081_G11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SMG01_0049_C04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0187_E02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0064_A09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0078_G04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0002_C06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0072_D03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0145_B08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0107_C05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PCT01_0035_E09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SPL01_0030_G02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0110_E01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ADR01_0022_B10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0033_A04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
UTR01_0032_E06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0109_D09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0001_G09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0074_D04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0091_G11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0088_C07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0151_F01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0089_H02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0047_A10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0045_C06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
CLNT1_0152_G01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0008_A04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0036_F10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SMG01_0027_C09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0075_C12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0113_C11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0117_A08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0062_H10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0070_B08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0115_A10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0081_E02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0029_G03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0057_D10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0074_H10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0042_A09.b : CACGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0066_C09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0067_B03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0071_B01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0010_F03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0023_A11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0047_G11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0002_G04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0009_G02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0038_F07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0046_C03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0055_B05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0001_G11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TCH01_0103_F06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0018_A11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0098_C09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SPL01_0103_B02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LNG01_0057_B09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SMG01_0016_G08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0196_E03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVR01_0065_F08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVR01_0076_F06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0112_H07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0152_C07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LVRM1_0087_C11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0130_A10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0058_F11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
UTR01_0102_A10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SPL01_0025_C04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0084_G03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0007_D06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
UTR01_0008_C08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PCT01_0022_F06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SMG01_0024_D06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0148_E06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVR01_0033_E10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0051_F07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0139_A11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGTGGCCGCCCGGCTCTTC
PBL01_0010_C09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SPL01_0104_B05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0101_G04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0031_B04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0016_H01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0093_C01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PTG01_0033_G06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0077_B10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0002_G08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PCT01_0018_H11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0045_H02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
CLNT1_0021_C04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0014_G06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0022_A10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0012_B10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
CLNT1_0093_C02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0121_B10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0042_F07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0023_F04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0058_E10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0080_F07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0203_E03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGTCCGGCTCTTC
PST01_0043_E01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0060_C08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGTGGCCGCCCGGCTCTTC
PST01_0083_E12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0031_G02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0013_G12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0100_H07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SPL01_0103_D09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LVR01_0001_C04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0006_D10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
CLNT1_0087_C01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVR01_0094_H03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0082_D11.b : CCCGCCAGATCTCCGAATTCTCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0056_B02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0035_E12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0075_H09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0080_A09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0006_G08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0005_E05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0078_F09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTCC
OVRT1_0069_E11.b : CCCGCCAGATCTCTGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
MLN01_0082_A04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0089_A11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
MLN01_0021_C05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0041_G02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0066_B06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TCH01_0023_H11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0081_H12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGGCTTACTCACTGCGGCCGCCCGGCTCTTC
LNG01_0064_G12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0083_A12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LVRM1_0111_C05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0147_C06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0062_E09.b : CCCGCCAGATCTCCGGATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0091_H08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0071_F03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0003_C12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0067_C10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SKNB1_0060_C09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0059_E12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0045_E10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0063_C12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0030_E11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0095_D06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0078_E09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0068_H07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0052_F01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0013_H03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0068_C06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0034_H07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0062_E10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0067_E01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0086_C05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0008_B07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PCT01_0014_F06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0039_E09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0052_E06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0076_E11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0085_D02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0062_G03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0099_B02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
MLN01_0006_G10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0070_E12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0094_D03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0080_G08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0024_B10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0119_A09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LVRM1_0053_F06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0081_D05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LNG01_0002_D01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LVRM1_0004_G10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LVRM1_0154_D01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0189_G10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVR01_0101_F03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0063_B03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0003_F08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0138_B01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LVR01_0066_A08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0052_F10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SPL01_0088_H11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0010_D12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0017_F07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0002_A07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0053_B05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0029_A04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0035_F10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0090_D02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0038_D05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0068_B03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0029_D05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0088_B11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0055_B02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0097_C03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0026_G08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0082_D12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0089_H06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0033_E04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ADR01_0077_B03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ADR01_0056_E03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PCT01_0031_C07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0037_A07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0019_C02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0040_B09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0021_E09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0039_G07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0021_H06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0020_F03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0149_G09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0058_B09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LVRM1_0114_C09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0009_C03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0061_B11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0096_H11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0075_B06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0108_F09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LVRM1_0185_E01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LVRM1_0033_B01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0028_D12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0058_E05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0203_H09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0122_C01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0053_A12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0008_H09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0083_B10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0126_B09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0081_E03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0043_E01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0022_C10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
CLNT1_0150_B12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0019_B05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0062_C02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0070_H10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0013_E03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0042_B04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0055_D05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0076_F10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0083_A03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LNG01_0065_C04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0070_C12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0102_E10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0060_G04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0082_E05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LNG01_0009_H08.b : CCCGCCGGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0017_B12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PTG01_0027_H03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0022_E04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0016_D12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0108_D06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0031_F03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0077_F01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0099_A01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0009_A01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0089_D07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0059_C04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0007_D04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0054_E08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0098_F02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0093_G10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGTCTTACTCACTGCGGCCGCCCGGCTCTTC
CLNT1_0043_C12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVR01_0081_B03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVR01_0013_H03.b : CCCGCCAGATCTCCGAATTCGCCTGCCTTGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0019_F06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0185_E01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0079_B12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0047_C12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0051_G01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0099_E04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0118_C11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0084_C08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0110_D10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0004_G12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0075_A02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0080_H04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LNG01_0011_F12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0051_D06.b : CCCGCCAGACCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
UTR01_0047_D09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0017_A04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PBL01_0017_F04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0004_G07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0015_E10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0091_C11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0094_H06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0088_H03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0033_C03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0073_E10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0010_E11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0067_F02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0059_C09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0045_A03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0091_C07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0062_A11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0099_F03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0082_A02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVR01_0020_G06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0100_B06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0051_E01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0096_F05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0219_F08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0156_D09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCGCTGCGGCCGCCCGGCTCTTC
THY01_0104_D01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0221_H09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0025_D09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PBL01_0003_D12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0175_C07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LVRM1_0174_D07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0064_E05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0166_H10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0113_H08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0152_E10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LVRM1_0197_E10.b : CCCGCCAGATCTCCGAACTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LVRM1_0148_G01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0133_G04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0225_E07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0016_C06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0209_H05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0169_H04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0014_C12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0120_E06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0103_D04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0072_A05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0112_G08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0041_A11.b : CCCGCTAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0018_D12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0012_D10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0034_B07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0007_E02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVR01_0065_A09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
UTR01_0026_E09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SMG01_0061_B10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SMG01_0078_F09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0144_B10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0006_A03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0115_A10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0045_D10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0113_G02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0116_E04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PBL01_0103_F12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LNG01_0030_E10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0039_E05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PBL01_0011_G03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0032_H03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0076_B09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SMG01_0013_H04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0069_F11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0034_B10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVR01_0040_F04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SPL01_0009_H06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVR01_0056_C05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVR01_0061_C07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0113_D06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0128_D02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0128_D07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0084_G02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0008_A04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0100_A09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0095_G09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0057_G08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0057_B04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCAGCTCTTC
LNG01_0099_B05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0098_D12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PCT01_0007_A05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0042_D09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0052_H08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0207_A07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0086_H08.b : TCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0054_B05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0028_A12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0093_B02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0041_D12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0012_G01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0013_D01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0095_F01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0034_B02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0036_C10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0094_G04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0049_E11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0052_B03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0096_H05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0088_D03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0092_H03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0071_H08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0084_F06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0022_B01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PBL01_0080_F06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0012_A07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PBL01_0068_G08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0104_B01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
CLNT1_0065_G10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0010_D07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0060_A10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0146_C04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0071_A04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0048_D09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0095_F03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0041_B05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0100_B12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0113_D04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0074_H05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0063_G03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0080_A08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0032_E10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0007_C06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SPL01_0091_B01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0006_H06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0087_B03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0068_D03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TCH01_0027_D07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LNG01_0056_E07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0011_B07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0083_A11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0088_C11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0073_F12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0110_H05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0002_E08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0082_H09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0167_G02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0010_A04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0057_D12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0047_A09.b : CCCGCTAAATCTCCCAATTCGCCTGACATGGCCTTACTCACTGCGGCCGCCCTGCTCTTC
KDN01_0050_E07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0091_F01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0091_E10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0019_G10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0084_D06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTCACTCACTGCGGCCGCCCGGCTCTTC
PST01_0013_A02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0025_G01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCAGCCGCCCGGATCTTC
TES01_0002_E08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0120_A07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0003_B12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0025_F02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LNG01_0022_C09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0055_E06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0033_G06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0079_H09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0033_A07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0018_E03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0022_A01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0023_C03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PCT01_0021_E09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0024_G05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0072_C06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0027_G11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0038_H05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0007_F07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0093_F05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0029_F01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0034_G06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0019_E03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0041_A03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0014_E11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0058_F03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0078_D04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0085_D05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0015_E01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0054_F11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0007_C03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0061_A04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0008_D07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0009_B04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0087_C11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0023_B10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0088_B05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0024_A10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0024_B02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0082_D02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0172_F02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0055_E09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0068_C05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0033_C03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGTGGCCGCCCGGCTCTTC
TES01_0112_B08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0022_F09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0002_B04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0006_A05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0099_D08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0011_G04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PCT01_0011_A09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0087_D01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0014_B06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0067_A12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0027_C12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0081_F08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTGC
TES01_0067_H01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0009_C05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0025_D12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0033_B07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0012_B03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0053_A12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ADR01_0093_C01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0053_G11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ADR01_0011_C07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0064_E01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0026_D01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
THY01_0120_B12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0001_C12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0116_B01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0041_G05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LNG01_0011_A09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0072_D06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0102_D03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0010_E04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0009_A11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0026_B01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0091_E03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0061_C03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0003_B02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0022_E04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0029_E10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LVRM1_0093_B09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0077_G08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0088_F01.b : CCCGCCAGATCTCCGAATTCGCCTGCCGTGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0085_H05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0094_G06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0099_B08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0025_D03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0006_C11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0034_A11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0025_G04.b : CCCGCCAGATCCCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0050_H09.b : CCCGCCAGATCTCCGAATCCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0029_D01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0042_H12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0173_A01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ADR01_0017_A02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0100_C03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0047_H06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0172_F03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LVRM1_0116_H07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0078_E11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0031_A05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0083_D08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SPL01_0083_F11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0118_H01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0105_C06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PTG01_0018_D07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
SPL01_0055_H02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0101_F07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0102_C12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0149_D10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0089_G01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0069_F01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LVR01_0054_G10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0111_D10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0058_G02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0039_D08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0056_A02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0057_A05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0018_G12.b : CCCGCCTGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0069_G08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0075_C09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0012_B05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0046_G06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
UTR01_0107_A08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ITT01_0078_D08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0086_G12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0058_C06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0125_D10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ADR01_0036_C11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0062_H02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0074_F04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LNG01_0019_A06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0043_H03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0077_H04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0012_B07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0009_H10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0046_B03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0041_G12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0086_C01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0032_G01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0033_A04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0038_F03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0015_D05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0022_H09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0096_B04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0095_F02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0074_D10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0018_E04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0088_B07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0010_H06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0099_E09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0099_A06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0048_B12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0082_E02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0047_A04.b : CCCGCAAGATCTCCGAATTCTCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0055_D02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0100_G09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0027_H03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0043_C02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0017_C03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0016_H11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0034_H12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LVRM1_0135_E07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0059_H03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0031_H08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0044_B07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PCT01_0022_H02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0072_G07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0002_G02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0020_D02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0010_C01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0077_C02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0110_G03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0101_E01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0081_G12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0127_B01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0133_E08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0054_A04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0011_D12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0144_F03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0078_E08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0092_E05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0025_D08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LVRM1_0033_F02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVR01_0055_B10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRM1_0194_A11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
ADR01_0047_A04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0051_A02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0014_B06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
OVRT1_0066_E09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0039_G12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
BFLT1_0014_D01.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0081_H11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0101_F02.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0037_H11.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PCT01_0023_F06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0003_C05.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCTCGGCTCTTC
PST01_0042_E06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0019_F10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0024_B07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0006_A08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0099_B10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
MLTL1_0099_G07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0053_G10.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
KDN01_0045_G06.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0033_C12.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LVR01_0036_G04.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
MLTL1_0009_G08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PCT01_0036_C09.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
PST01_0032_B07.b : CCCGCCAGATCTCCGAATTCGCCTGCCATCGTTTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0094_F08.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0009_B03.b : CCCGCCAGATCTCCGAATTCGCCTGCCATGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
TES01_0054_H04.b : nactgcgttggctcgaattccctgccTGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LNG01_0108_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtatggCTGCGGCCGCCCGGCTCTTC
KDN01_0052_G01.b : ggggtgaaggagtgctactcgcctttattg
TES01_0030_D01.b :
TES01_0018_A05.b :
TCH01_0041_A06.b :
LNG01_0017_E09.b :
TES01_0043_C06.b :
TES01_0108_D11.b :
TES01_0105_H06.b :
TES01_0012_C05.b :
TES01_0019_E04.b :
TES01_0068_E08.b :
MLN01_0037_D12.b :
BFLT1_0136_B10.b :
MLN01_0088_B08.b :
BFLT1_0133_A07.b :
AMP01_0073_H05.b :
MLN01_0009_G04.b :
20110601C-001821 : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
---------+---------+---------+---------+---------+---------+ 318
BFLT1_0034_G05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
ADR01_0004_C04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVR01_0067_D07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
SPL01_0067_A09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0105_A08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0129_D10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0057_A02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0017_A02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0196_H10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
LNG01_0080_H04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
LNG01_0004_D01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0056_E10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0011_H08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
ADR01_0053_D12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
ADR01_0053_D02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
THY01_0056_B10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0037_C02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
HTMT1_0133_F03.b : GGAGCCAAGAATGAATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0179_A12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0089_F06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0112_H09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0019_D03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTCCTTCCACG
CLNT1_0045_B03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0038_G04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0186_G01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
SMG01_0064_F06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0140_G11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0110_B01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0094_G01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
ADR01_0033_B01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0054_G03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0092_E12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0001_B10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0040_C10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0008_H07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0073_G01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0009_E09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0005_F08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
SPLT1_0013_F02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVR01_0010_H06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
ITT01_0057_F02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0214_D07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0106_G08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
LNG01_0088_D04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
AMP01_0087_F04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
SMG01_0087_B08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0037_H07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVR01_0067_A10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0043_C04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0094_G11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0072_C10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0018_B03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
THY01_0093_H04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0074_B02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
LVRM1_0081_B03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0061_D02.b : GGAGCCNAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0082_D03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0022_F08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0005_B08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
CLNT1_0140_B07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0004_G06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0066_H08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0060_A11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0041_F10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0004_F04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0028_G09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0035_F02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0018_C11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0099_F12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0079_E07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0040_A03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0050_C02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0054_G04.b : GGAGCCGAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0046_F02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
THY01_0123_G05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0162_D08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0088_A11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
THY01_0038_E12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0076_C04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0044_E05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVR01_0028_H06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
ITT01_0058_H06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
MLN01_0028_B02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PTG01_0104_F10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0132_G05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
UTR01_0021_A05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0123_F06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
THY01_0121_E01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
SMG01_0095_G08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
SMG01_0071_C07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0004_C05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVR01_0035_G05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PCT01_0036_A12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0063_A11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0004_G02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0038_D08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PCT01_0032_F12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0058_B06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0059_G12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0053_C03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0087_B09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0095_D07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0056_H01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0080_G05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0026_H07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0051_G01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0019_E02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGCGCTTCTTCCACG
PST01_0058_C05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0091_F05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0007_B09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0085_C09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0034_G05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0080_C06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0006_B05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0089_E01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0093_A05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PTG01_0022_H06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0184_C10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0072_H01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0002_B11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0060_C05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PCT01_0009_A10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0142_A10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVR01_0060_C11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
SMG01_0013_D07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0097_H12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0028_G02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0073_A09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0100_G08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0050_B01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0007_G01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVR01_0031_C03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0095_C09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0091_F10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0026_A02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
UTR01_0054_G08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
SKNB1_0081_G02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0059_C10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0028_G12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0057_F09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0049_H12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0083_C09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0059_E04.b : GGAGCCAAGAATGTATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
SKNB1_0048_F09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0048_F02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0050_G05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0083_F03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0057_C01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0048_H01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PTG01_0064_C11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
LVRM1_0087_C04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0009_A08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0081_G11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
SMG01_0049_C04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0187_E02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0064_A09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0078_G04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0002_C06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0072_D03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0145_B08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0107_C05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PCT01_0035_E09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACA
SPL01_0030_G02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0110_E01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
ADR01_0022_B10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0033_A04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
UTR01_0032_E06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0109_D09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0001_G09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0074_D04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0091_G11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0088_C07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0151_F01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0089_H02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0047_A10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0045_C06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
CLNT1_0152_G01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0008_A04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0036_F10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
SMG01_0027_C09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
ITT01_0075_C12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0113_C11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0117_A08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0062_H10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0070_B08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0115_A10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
ITT01_0081_E02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0029_G03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCGGGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0057_D10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0074_H10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0042_A09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0066_C09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0067_B03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0071_B01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0010_F03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0023_A11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0047_G11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0002_G04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
ITT01_0009_G02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACA
ITT01_0038_F07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0046_C03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0055_B05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
ITT01_0001_G11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TCH01_0103_F06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0018_A11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0098_C09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
SPL01_0103_B02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
LNG01_0057_B09.b : GGAGCCAAGAATGCATCCTGTCATGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
SMG01_0016_G08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0196_E03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVR01_0065_F08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVR01_0076_F06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0112_H07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0152_C07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
LVRM1_0087_C11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0130_A10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0058_F11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
UTR01_0102_A10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
SPL01_0025_C04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0084_G03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
THY01_0007_D06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
UTR01_0008_C08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PCT01_0022_F06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
SMG01_0024_D06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0148_E06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVR01_0033_E10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0051_F07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0139_A11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PBL01_0010_C09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
SPL01_0104_B05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0101_G04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0031_B04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0016_H01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
ITT01_0093_C01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PTG01_0033_G06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0077_B10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0002_G08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PCT01_0018_H11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0045_H02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
CLNT1_0021_C04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0014_G06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0022_A10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0012_B10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
CLNT1_0093_C02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0121_B10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0042_F07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0023_F04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0058_E10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0080_F07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
THY01_0203_E03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0043_E01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0060_C08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0083_E12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0031_G02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGGGCGGCATGCCAGTGCTTCTTCCACG
PST01_0013_G12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0100_H07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
SPL01_0103_D09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
LVR01_0001_C04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0006_D10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
CLNT1_0087_C01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVR01_0094_H03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0082_D11.b : GGAGCCAAAAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0056_B02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0035_E12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0075_H09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0080_A09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0006_G08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0005_E05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0078_F09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0069_E11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
MLN01_0082_A04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
ITT01_0089_A11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
MLN01_0021_C05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0041_G02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0066_B06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TCH01_0023_H11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
ITT01_0081_H12.b : GGAGCCAAGAATGCATCCTGTTTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
LNG01_0064_G12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
ITT01_0083_A12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
LVRM1_0111_C05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0147_C06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0062_E09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0091_H08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0071_F03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0003_C12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0067_C10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
SKNB1_0060_C09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0059_E12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0045_E10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0063_C12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0030_E11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0095_D06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0078_E09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0068_H07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0052_F01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0013_H03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0068_C06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0034_H07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0062_E10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0067_E01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0086_C05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0008_B07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PCT01_0014_F06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0039_E09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0052_E06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0076_E11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0085_D02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0062_G03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0099_B02.b : GGAGCCAAGAATGCATCCTGTCTTGCTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
MLN01_0006_G10.b : GGAGCTAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0070_E12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0094_D03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0080_G08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0024_B10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0119_A09.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
LVRM1_0053_F06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0081_D05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
LNG01_0002_D01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
LVRM1_0004_G10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
LVRM1_0154_D01.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRM1_0189_G10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVR01_0101_F03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0063_B03.b : GGAGCCAAGAATGCATCTTGTCTTGTTCTTGCTGCCCGGCGTGCCAGTGCTTCTTCCACG
PST01_0003_F08.b : TGATCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
BFLT1_0138_B01.b : GGAGCCTAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
LVR01_0066_A08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0052_F10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
SPL01_0088_H11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0010_D12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0017_F07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0002_A07.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0053_B05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
TES01_0029_A04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0035_F10.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0090_D02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0038_D05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0068_B03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0029_D05.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGGCGGGGCTTCTTCCACG
PST01_0088_B11.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
KDN01_0055_B02.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0097_C03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0026_G08.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
OVRT1_0082_D12.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
PST01_0089_H06.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
ITT01_0033_E04.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
ADR01_0077_B03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG
ADR01_0056_E03.b : GGAGCCAAGAATGCATCCTGTCTTGTTCTTGCTGCCCGGCATGCCAGTGCTTCTTCCACG