
[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-001821

Length: 1,704

Sequence [FASTA format sequence]

SNP mapping information
SNP IDRel.Chr.Location (cM)

Assembly Overview:      TOP
Change score limit to  

BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCScitrate synthase, mitochondrial precursor [Homo sapiens]. 9060.0O

BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCscitrate synthase, mitochondrial precursor [Mus musculus]. 9090.0O
Contig/Assembly ProteinCslcitrate synthase-like protein [Mus musculus]. 8600.0O

BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC474403PREDICTED: similar to citrate synthase [Canis familiaris]. 9290.0O

BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCScitrate synthase, mitochondrial precursor [Bos taurus]. 9130.0O

BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCScitrate synthase, mitochondrial precursor [Sus scrofa]. 9400.0O
Contig/Assembly ProteinLOC100621743PREDICTED: citrate synthase, mitochondrial-like [Sus scrofa]. 549e-156O
Contig/Assembly ProteinLOC100621640PREDICTED: citrate synthase, mitochondrial-like [Sus scrofa]. 2725e-73O
Contig/Assembly ProteinLOC100621942PREDICTED: hypothetical protein LOC100621942 [Sus scrofa]. 66.64e-11

Assembly Members: 806      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010053D12ADR01_0053_D12.bDB786220 AK389361
BFLT10034G05BFLT1_0034_G05.bFS642808 AK390176
LNG010004D01LNG01_0004_D01.bBP435943 AK231644
PST010024B02PST01_0024_B02.bFS698858 AK396408


SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change

Alignment:      TOP

20110601C-001821 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
BFLT1_0034_G05.b : nggactcgtcagctgtacgaggxxxxxxxxxxxxxxxxxxxxxx
ADR01_0004_C04.b : nnttgtgaacaxxxxxxxxxxx
OVR01_0067_D07.b : nggattgtgctaagacx
SPL01_0067_A09.b : ttttagctaggactaaaacx
BFLT1_0105_A08.b : nnccccgatag
BFLT1_0129_D10.b : nnnnccgtc
TES01_0057_A02.b :
BFLT1_0017_A02.b : gggat
OVRM1_0196_H10.b :
LNG01_0080_H04.b : nnnttttgatagg
LNG01_0004_D01.b : gcatatcgctgacxxxx
OVRT1_0056_E10.b : nnngcgcttnnnnn
BFLT1_0011_H08.b : nga
ADR01_0053_D12.b :
ADR01_0053_D02.b :
THY01_0056_B10.b : txxxxxxxxxx
TES01_0037_C02.b :
HTMT1_0133_F03.b :
OVRM1_0179_A12.b :
TES01_0089_F06.b :
BFLT1_0112_H09.b : nnnnnnn
TES01_0019_D03.b :
CLNT1_0045_B03.b :
BFLT1_0038_G04.b :
OVRM1_0186_G01.b :
SMG01_0064_F06.b :
OVRT1_0140_G11.b : nngggcatt
OVRT1_0110_B01.b :
OVRT1_0094_G01.b : nggcc
ADR01_0033_B01.b :
TES01_0054_G03.b :
KDN01_0092_E12.b :
KDN01_0001_B10.b :
KDN01_0040_C10.b :
TES01_0008_H07.b :
KDN01_0073_G01.b :
OVRT1_0009_E09.b :
OVRT1_0005_F08.b :
SPLT1_0013_F02.b :
OVR01_0010_H06.b : caaacaaatgxxxxxxxxxx
ITT01_0057_F02.b :
OVRM1_0214_D07.b :
BFLT1_0106_G08.b :
LNG01_0088_D04.b :
AMP01_0087_F04.b : aaggaatttatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0087_B08.b :
OVRM1_0037_H07.b :
OVR01_0067_A10.b :
TES01_0043_C04.b :
BFLT1_0094_G11.b :
TES01_0072_C10.b :
PST01_0018_B03.b :
THY01_0093_H04.b :
TES01_0074_B02.b :
LVRM1_0081_B03.b :
OVRM1_0061_D02.b :
TES01_0082_D03.b :
TES01_0022_F08.b :
TES01_0005_B08.b :
CLNT1_0140_B07.b :
OVRT1_0004_G06.b :
KDN01_0066_H08.b :
KDN01_0060_A11.b :
TES01_0041_F10.b :
TES01_0004_F04.b :
BFLT1_0028_G09.b :
PST01_0035_F02.b :
PST01_0018_C11.b :
BFLT1_0099_F12.b :
TES01_0079_E07.b :
PST01_0040_A03.b :
TES01_0050_C02.b :
PST01_0054_G04.b :
OVRM1_0046_F02.b :
THY01_0123_G05.b :
OVRM1_0162_D08.b :
OVRM1_0088_A11.b :
THY01_0038_E12.b :
BFLT1_0076_C04.b :
OVRT1_0044_E05.b :
OVR01_0028_H06.b :
ITT01_0058_H06.b :
MLN01_0028_B02.b :
PTG01_0104_F10.b :
OVRT1_0132_G05.b :
UTR01_0021_A05.b :
BFLT1_0123_F06.b :
THY01_0121_E01.b :
SMG01_0095_G08.b :
SMG01_0071_C07.b :
PST01_0004_C05.b :
OVR01_0035_G05.b : ctttttttttttttttc
PCT01_0036_A12.b :
PST01_0063_A11.b :
KDN01_0004_G02.b :
PST01_0038_D08.b :
PCT01_0032_F12.b :
PST01_0058_B06.b :
PST01_0059_G12.b :
KDN01_0053_C03.b :
PST01_0087_B09.b :
KDN01_0095_D07.b :
PST01_0056_H01.b :
PST01_0080_G05.b :
PST01_0026_H07.b :
PST01_0051_G01.b :
KDN01_0019_E02.b :
PST01_0058_C05.b :
PST01_0091_F05.b :
PST01_0007_B09.b :
PST01_0085_C09.b :
OVRT1_0034_G05.b :
BFLT1_0080_C06.b :
TES01_0006_B05.b :
TES01_0089_E01.b :
OVRM1_0093_A05.b :
PTG01_0022_H06.b :
OVRM1_0184_C10.b :
TES01_0072_H01.b :
PST01_0002_B11.b :
TES01_0060_C05.b :
PCT01_0009_A10.b :
OVRT1_0142_A10.b :
OVR01_0060_C11.b :
SMG01_0013_D07.b :
PST01_0097_H12.b :
OVRT1_0028_G02.b :
PST01_0073_A09.b :
PST01_0100_G08.b :
TES01_0050_B01.b :
KDN01_0007_G01.b :
OVR01_0031_C03.b :
PST01_0095_C09.b :
KDN01_0091_F10.b :
BFLT1_0026_A02.b :
UTR01_0054_G08.b :
SKNB1_0081_G02.b :
TES01_0059_C10.b :
KDN01_0028_G12.b :
PST01_0057_F09.b :
PST01_0049_H12.b :
KDN01_0083_C09.b :
KDN01_0059_E04.b :
SKNB1_0048_F09.b :
PST01_0048_F02.b :
PST01_0050_G05.b :
PST01_0083_F03.b :
OVRT1_0057_C01.b :
OVRM1_0048_H01.b :
PTG01_0064_C11.b :
LVRM1_0087_C04.b :
OVRM1_0009_A08.b :
OVRM1_0081_G11.b :
SMG01_0049_C04.b :
OVRM1_0187_E02.b :
TES01_0064_A09.b :
OVRM1_0078_G04.b :
OVRM1_0002_C06.b :
OVRM1_0072_D03.b :
BFLT1_0145_B08.b :
TES01_0107_C05.b :
PCT01_0035_E09.b :
SPL01_0030_G02.b :
OVRT1_0110_E01.b :
ADR01_0022_B10.b :
TES01_0033_A04.b :
UTR01_0032_E06.b :
BFLT1_0109_D09.b :
PST01_0001_G09.b :
BFLT1_0074_D04.b :
BFLT1_0091_G11.b :
OVRT1_0088_C07.b :
OVRT1_0151_F01.b :
KDN01_0089_H02.b :
BFLT1_0047_A10.b :
KDN01_0045_C06.b :
CLNT1_0152_G01.b :
BFLT1_0008_A04.b :
BFLT1_0036_F10.b :
SMG01_0027_C09.b :
ITT01_0075_C12.b :
BFLT1_0113_C11.b :
BFLT1_0117_A08.b :
OVRT1_0062_H10.b :
PST01_0070_B08.b :
BFLT1_0115_A10.b :
ITT01_0081_E02.b :
PST01_0029_G03.b :
KDN01_0057_D10.b :
PST01_0074_H10.b :
PST01_0042_A09.b :
PST01_0066_C09.b :
PST01_0067_B03.b :
PST01_0071_B01.b :
KDN01_0010_F03.b :
PST01_0023_A11.b :
PST01_0047_G11.b :
TES01_0002_G04.b :
ITT01_0009_G02.b :
ITT01_0038_F07.b :
OVRT1_0046_C03.b :
KDN01_0055_B05.b :
ITT01_0001_G11.b :
TCH01_0103_F06.b :
OVRT1_0018_A11.b :
PST01_0098_C09.b :
SPL01_0103_B02.b :
LNG01_0057_B09.b :
SMG01_0016_G08.b :
OVRM1_0196_E03.b :
OVR01_0065_F08.b :
OVR01_0076_F06.b :
TES01_0112_H07.b :
OVRM1_0152_C07.b :
LVRM1_0087_C11.b :
OVRM1_0130_A10.b :
OVRM1_0058_F11.b :
UTR01_0102_A10.b :
SPL01_0025_C04.b :
TES01_0084_G03.b :
THY01_0007_D06.b :
UTR01_0008_C08.b :
PCT01_0022_F06.b :
SMG01_0024_D06.b :
BFLT1_0148_E06.b :
OVR01_0033_E10.b :
TES01_0051_F07.b :
OVRT1_0139_A11.b :
PBL01_0010_C09.b :
SPL01_0104_B05.b :
OVRT1_0101_G04.b :
OVRT1_0031_B04.b :
OVRT1_0016_H01.b :
ITT01_0093_C01.b :
PTG01_0033_G06.b :
OVRT1_0077_B10.b :
PST01_0002_G08.b :
PCT01_0018_H11.b :
BFLT1_0045_H02.b :
CLNT1_0021_C04.b :
TES01_0014_G06.b :
BFLT1_0022_A10.b :
BFLT1_0012_B10.b :
CLNT1_0093_C02.b :
OVRT1_0121_B10.b :
TES01_0042_F07.b :
PST01_0023_F04.b :
OVRT1_0058_E10.b :
PST01_0080_F07.b :
THY01_0203_E03.b :
PST01_0043_E01.b :
PST01_0060_C08.b :
PST01_0083_E12.b :
PST01_0031_G02.b :
PST01_0013_G12.b :
PST01_0100_H07.b :
SPL01_0103_D09.b :
LVR01_0001_C04.b :
KDN01_0006_D10.b :
CLNT1_0087_C01.b :
OVR01_0094_H03.b :
PST01_0082_D11.b :
PST01_0056_B02.b :
PST01_0035_E12.b :
PST01_0075_H09.b :
KDN01_0080_A09.b :
PST01_0006_G08.b :
PST01_0005_E05.b :
BFLT1_0078_F09.b :
OVRT1_0069_E11.b :
MLN01_0082_A04.b :
ITT01_0089_A11.b :
MLN01_0021_C05.b :
OVRT1_0041_G02.b :
OVRT1_0066_B06.b :
TCH01_0023_H11.b :
ITT01_0081_H12.b :
LNG01_0064_G12.b :
ITT01_0083_A12.b :
LVRM1_0111_C05.b :
BFLT1_0147_C06.b :
TES01_0062_E09.b :
TES01_0091_H08.b :
PST01_0071_F03.b :
TES01_0003_C12.b :
KDN01_0067_C10.b :
SKNB1_0060_C09.b :
OVRM1_0059_E12.b :
KDN01_0045_E10.b :
KDN01_0063_C12.b :
KDN01_0030_E11.b :
TES01_0095_D06.b :
TES01_0078_E09.b :
KDN01_0068_H07.b :
PST01_0052_F01.b :
PST01_0013_H03.b :
KDN01_0068_C06.b :
KDN01_0034_H07.b :
TES01_0062_E10.b :
TES01_0067_E01.b :
PST01_0086_C05.b :
KDN01_0008_B07.b :
PCT01_0014_F06.b :
TES01_0039_E09.b :
TES01_0052_E06.b :
PST01_0076_E11.b :
PST01_0085_D02.b :
PST01_0062_G03.b :
BFLT1_0099_B02.b :
MLN01_0006_G10.b :
PST01_0070_E12.b :
PST01_0094_D03.b :
OVRM1_0080_G08.b :
KDN01_0024_B10.b :
OVRT1_0119_A09.b :
LVRM1_0053_F06.b :
TES01_0081_D05.b :
LNG01_0002_D01.b :
LVRM1_0004_G10.b :
LVRM1_0154_D01.b :
OVRM1_0189_G10.b :
OVR01_0101_F03.b :
OVRT1_0063_B03.b :
PST01_0003_F08.b :
BFLT1_0138_B01.b :
LVR01_0066_A08.b :
KDN01_0052_F10.b :
SPL01_0088_H11.b :
OVRT1_0010_D12.b :
PST01_0017_F07.b :
OVRT1_0002_A07.b :
KDN01_0053_B05.b :
TES01_0029_A04.b :
PST01_0035_F10.b :
KDN01_0090_D02.b :
PST01_0038_D05.b :
KDN01_0068_B03.b :
PST01_0029_D05.b :
PST01_0088_B11.b :
KDN01_0055_B02.b :
PST01_0097_C03.b :
PST01_0026_G08.b :
OVRT1_0082_D12.b :
PST01_0089_H06.b :
ITT01_0033_E04.b :
ADR01_0077_B03.b :
ADR01_0056_E03.b :
PCT01_0031_C07.b :
KDN01_0037_A07.b :
TES01_0019_C02.b :
PST01_0040_B09.b :
KDN01_0021_E09.b :
PST01_0039_G07.b :
KDN01_0021_H06.b :
PST01_0020_F03.b :
BFLT1_0149_G09.b :
THY01_0058_B09.b :
LVRM1_0114_C09.b :
OVRT1_0009_C03.b :
PST01_0061_B11.b :
THY01_0096_H11.b :
KDN01_0075_B06.b :
THY01_0108_F09.b :
LVRM1_0185_E01.b :
LVRM1_0033_B01.b :
OVRM1_0028_D12.b :
OVRM1_0058_E05.b :
OVRM1_0203_H09.b :
OVRT1_0122_C01.b :
OVRT1_0053_A12.b :
OVRT1_0008_H09.b :
BFLT1_0083_B10.b :
OVRT1_0126_B09.b :
KDN01_0081_E03.b :
TES01_0043_E01.b :
PST01_0022_C10.b :
CLNT1_0150_B12.b :
TES01_0019_B05.b :
PST01_0062_C02.b :
KDN01_0070_H10.b :
TES01_0013_E03.b :
KDN01_0042_B04.b :
OVRT1_0055_D05.b :
OVRT1_0076_F10.b :
OVRT1_0083_A03.b :
LNG01_0065_C04.b :
PST01_0070_C12.b :
TES01_0102_E10.b :
OVRM1_0060_G04.b :
TES01_0082_E05.b :
LNG01_0009_H08.b :
TES01_0017_B12.b :
PTG01_0027_H03.b :
TES01_0022_E04.b :
OVRT1_0016_D12.b :
OVRT1_0108_D06.b :
PST01_0031_F03.b :
PST01_0077_F01.b :
PST01_0099_A01.b :
TES01_0009_A01.b :
PST01_0089_D07.b :
PST01_0059_C04.b :
PST01_0007_D04.b :
TES01_0054_E08.b :
KDN01_0098_F02.b :
PST01_0093_G10.b :
CLNT1_0043_C12.b :
OVR01_0081_B03.b :
OVR01_0013_H03.b :
OVRM1_0019_F06.b :
OVRM1_0185_E01.b :
OVRM1_0079_B12.b :
OVRM1_0047_C12.b :
THY01_0051_G01.b :
TES01_0099_E04.b :
OVRT1_0118_C11.b :
BFLT1_0084_C08.b :
OVRT1_0110_D10.b :
PST01_0004_G12.b :
BFLT1_0075_A02.b :
KDN01_0080_H04.b :
LNG01_0011_F12.b :
PST01_0051_D06.b :
UTR01_0047_D09.b :
PST01_0017_A04.b :
PBL01_0017_F04.b :
PST01_0004_G07.b :
TES01_0015_E10.b :
THY01_0091_C11.b :
KDN01_0094_H06.b :
PST01_0088_H03.b :
KDN01_0033_C03.b :
KDN01_0073_E10.b :
KDN01_0010_E11.b :
KDN01_0067_F02.b :
OVRT1_0059_C09.b :
OVRT1_0045_A03.b :
KDN01_0091_C07.b :
PST01_0062_A11.b :
PST01_0099_F03.b :
OVRT1_0082_A02.b :
OVR01_0020_G06.b :
THY01_0100_B06.b :
ITT01_0051_E01.b :
OVRT1_0096_F05.b :
OVRM1_0219_F08.b :
OVRM1_0156_D09.b :
THY01_0104_D01.b :
OVRM1_0221_H09.b :
TES01_0025_D09.b :
PBL01_0003_D12.b :
OVRM1_0175_C07.b :
LVRM1_0174_D07.b :
TES01_0064_E05.b :
OVRM1_0166_H10.b :
OVRM1_0113_H08.b :
OVRM1_0152_E10.b :
LVRM1_0197_E10.b :
LVRM1_0148_G01.b :
OVRM1_0133_G04.b :
OVRM1_0225_E07.b :
THY01_0016_C06.b :
OVRM1_0209_H05.b :
OVRM1_0169_H04.b :
OVRM1_0014_C12.b :
OVRM1_0120_E06.b :
OVRM1_0103_D04.b :
OVRM1_0072_A05.b :
OVRM1_0112_G08.b :
OVRM1_0041_A11.b :
OVRM1_0018_D12.b :
OVRM1_0012_D10.b :
TES01_0034_B07.b :
THY01_0007_E02.b :
OVR01_0065_A09.b :
UTR01_0026_E09.b :
SMG01_0061_B10.b :
SMG01_0078_F09.b :
OVRT1_0144_B10.b :
OVRT1_0006_A03.b :
OVRT1_0115_A10.b :
KDN01_0045_D10.b :
OVRT1_0113_G02.b :
OVRT1_0116_E04.b :
PBL01_0103_F12.b :
LNG01_0030_E10.b :
OVRT1_0039_E05.b :
PBL01_0011_G03.b :
THY01_0032_H03.b :
OVRT1_0076_B09.b :
SMG01_0013_H04.b :
KDN01_0069_F11.b :
THY01_0034_B10.b :
OVR01_0040_F04.b :
SPL01_0009_H06.b :
OVR01_0056_C05.b :
OVR01_0061_C07.b :
OVRT1_0113_D06.b :
OVRT1_0128_D02.b :
OVRT1_0128_D07.b :
THY01_0084_G02.b :
OVRT1_0008_A04.b :
OVRT1_0100_A09.b :
OVRT1_0095_G09.b :
TES01_0057_G08.b :
OVRT1_0057_B04.b :
LNG01_0099_B05.b :
OVRT1_0098_D12.b :
PCT01_0007_A05.b :
PST01_0042_D09.b :
PST01_0052_H08.b :
THY01_0207_A07.b :
PST01_0086_H08.b :
TES01_0054_B05.b :
OVRT1_0028_A12.b :
PST01_0093_B02.b :
KDN01_0041_D12.b :
TES01_0012_G01.b :
OVRT1_0013_D01.b :
PST01_0095_F01.b :
PST01_0034_B02.b :
PST01_0036_C10.b :
PST01_0094_G04.b :
TES01_0049_E11.b :
PST01_0052_B03.b :
KDN01_0096_H05.b :
PST01_0088_D03.b :
PST01_0092_H03.b :
PST01_0071_H08.b :
PST01_0084_F06.b :
OVRT1_0022_B01.b :
PBL01_0080_F06.b :
PST01_0012_A07.b :
PBL01_0068_G08.b :
TES01_0104_B01.b :
CLNT1_0065_G10.b :
ITT01_0010_D07.b :
ITT01_0060_A10.b :
OVRT1_0146_C04.b :
OVRT1_0071_A04.b :
BFLT1_0048_D09.b :
ITT01_0095_F03.b :
OVRT1_0041_B05.b :
BFLT1_0100_B12.b :
OVRT1_0113_D04.b :
PST01_0074_H05.b :
PST01_0063_G03.b :
ITT01_0080_A08.b :
ITT01_0032_E10.b :
TES01_0007_C06.b :
SPL01_0091_B01.b :
ITT01_0006_H06.b :
OVRT1_0087_B03.b :
OVRT1_0068_D03.b :
TCH01_0027_D07.b :
LNG01_0056_E07.b :
ITT01_0011_B07.b :
ITT01_0083_A11.b :
KDN01_0088_C11.b :
KDN01_0073_F12.b :
TES01_0110_H05.b :
KDN01_0002_E08.b :
OVRM1_0082_H09.b :
OVRM1_0167_G02.b :
THY01_0010_A04.b : tttttt
TES01_0057_D12.b :
TES01_0047_A09.b :
KDN01_0050_E07.b :
TES01_0091_F01.b :
TES01_0091_E10.b :
TES01_0019_G10.b :
TES01_0084_D06.b :
PST01_0013_A02.b :
PST01_0025_G01.b :
TES01_0002_E08.b :
OVRT1_0120_A07.b :
PST01_0003_B12.b :
PST01_0025_F02.b :
LNG01_0022_C09.b :
KDN01_0055_E06.b :
PST01_0033_G06.b :
PST01_0079_H09.b :
PST01_0033_A07.b :
TES01_0018_E03.b :
PST01_0022_A01.b :
TES01_0023_C03.b :
PCT01_0021_E09.b :
KDN01_0024_G05.b :
PST01_0072_C06.b :
PST01_0027_G11.b :
PST01_0038_H05.b :
PST01_0007_F07.b :
KDN01_0093_F05.b :
PST01_0029_F01.b :
PST01_0034_G06.b :
PST01_0019_E03.b :
TES01_0041_A03.b :
PST01_0014_E11.b :
PST01_0058_F03.b :
KDN01_0078_D04.b :
KDN01_0085_D05.b :
PST01_0015_E01.b :
KDN01_0054_F11.b :
PST01_0007_C03.b :
PST01_0061_A04.b :
PST01_0008_D07.b :
KDN01_0009_B04.b :
KDN01_0087_C11.b :
KDN01_0023_B10.b :
PST01_0088_B05.b :
PST01_0024_A10.b :
PST01_0024_B02.b :
KDN01_0082_D02.b :
OVRM1_0172_F02.b :
OVRM1_0055_E09.b :
THY01_0068_C05.b :
TES01_0033_C03.b :
TES01_0112_B08.b :
TES01_0022_F09.b :
PST01_0002_B04.b :
KDN01_0006_A05.b :
THY01_0099_D08.b :
KDN01_0011_G04.b :
PCT01_0011_A09.b :
KDN01_0087_D01.b :
PST01_0014_B06.b :
KDN01_0067_A12.b :
TES01_0027_C12.b :
OVRM1_0081_F08.b :
TES01_0067_H01.b :
PST01_0009_C05.b :
KDN01_0025_D12.b :
KDN01_0033_B07.b :
PST01_0012_B03.b :
PST01_0053_A12.b :
ADR01_0093_C01.b :
TES01_0053_G11.b :
ADR01_0011_C07.b :
KDN01_0064_E01.b :
PST01_0026_D01.b :
THY01_0120_B12.b :
TES01_0001_C12.b :
OVRM1_0116_B01.b :
OVRM1_0041_G05.b :
LNG01_0011_A09.b :
TES01_0072_D06.b :
TES01_0102_D03.b :
TES01_0010_E04.b :
TES01_0009_A11.b :
TES01_0026_B01.b :
KDN01_0091_E03.b :
KDN01_0061_C03.b :
OVRT1_0003_B02.b :
KDN01_0022_E04.b :
KDN01_0029_E10.b :
LVRM1_0093_B09.b :
TES01_0077_G08.b :
TES01_0088_F01.b :
TES01_0085_H05.b :
OVRM1_0094_G06.b :
TES01_0099_B08.b :
TES01_0025_D03.b :
TES01_0006_C11.b :
TES01_0034_A11.b :
KDN01_0025_G04.b :
TES01_0050_H09.b :
PST01_0029_D01.b :
PST01_0042_H12.b :
OVRM1_0173_A01.b :
ADR01_0017_A02.b :
OVRM1_0100_C03.b :
OVRM1_0047_H06.b :
OVRM1_0172_F03.b :
LVRM1_0116_H07.b :
OVRM1_0078_E11.b :
OVRM1_0031_A05.b :
OVRM1_0083_D08.b :
SPL01_0083_F11.b :
BFLT1_0118_H01.b :
TES01_0105_C06.b :
PTG01_0018_D07.b :
SPL01_0055_H02.b :
OVRT1_0101_F07.b :
ITT01_0102_C12.b :
BFLT1_0149_D10.b :
OVRT1_0089_G01.b :
PST01_0069_F01.b :
LVR01_0054_G10.b :
OVRT1_0111_D10.b :
KDN01_0058_G02.b :
OVRT1_0039_D08.b :
OVRT1_0056_A02.b :
PST01_0057_A05.b :
OVRT1_0018_G12.b :
OVRT1_0069_G08.b :
OVRT1_0075_C09.b :
OVRT1_0012_B05.b :
OVRT1_0046_G06.b :
UTR01_0107_A08.b :
ITT01_0078_D08.b :
TES01_0086_G12.b :
TES01_0058_C06.b :
BFLT1_0125_D10.b :
ADR01_0036_C11.b :
PST01_0062_H02.b :
PST01_0074_F04.b :
LNG01_0019_A06.b :
PST01_0043_H03.b :
PST01_0077_H04.b :
PST01_0012_B07.b :
PST01_0009_H10.b :
PST01_0046_B03.b :
TES01_0041_G12.b :
PST01_0086_C01.b :
PST01_0032_G01.b :
KDN01_0033_A04.b :
PST01_0038_F03.b :
PST01_0015_D05.b :
PST01_0022_H09.b :
KDN01_0096_B04.b :
PST01_0095_F02.b :
PST01_0074_D10.b :
KDN01_0018_E04.b :
KDN01_0088_B07.b :
PST01_0010_H06.b :
KDN01_0099_E09.b :
PST01_0099_A06.b :
PST01_0048_B12.b :
PST01_0082_E02.b :
TES01_0047_A04.b :
TES01_0055_D02.b :
PST01_0100_G09.b :
PST01_0027_H03.b :
KDN01_0043_C02.b :
TES01_0017_C03.b :
PST01_0016_H11.b :
KDN01_0034_H12.b :
LVRM1_0135_E07.b :
TES01_0059_H03.b :
TES01_0031_H08.b :
PST01_0044_B07.b :
PCT01_0022_H02.b :
BFLT1_0072_G07.b :
TES01_0002_G02.b :
PST01_0020_D02.b :
TES01_0010_C01.b :
TES01_0077_C02.b :
TES01_0110_G03.b :
BFLT1_0101_E01.b :
TES01_0081_G12.b :
OVRM1_0127_B01.b :
OVRT1_0133_E08.b :
BFLT1_0054_A04.b :
TES01_0011_D12.b :
BFLT1_0144_F03.b :
TES01_0078_E08.b :
TES01_0092_E05.b :
TES01_0025_D08.b :
LVRM1_0033_F02.b :
OVR01_0055_B10.b :
OVRM1_0194_A11.b :
ADR01_0047_A04.b :
BFLT1_0051_A02.b :
BFLT1_0014_B06.b :
OVRT1_0066_E09.b :
BFLT1_0039_G12.b :
BFLT1_0014_D01.b :
TES01_0081_H11.b :
TES01_0101_F02.b :
TES01_0037_H11.b :
PCT01_0023_F06.b :
PST01_0003_C05.b :
PST01_0042_E06.b :
PST01_0019_F10.b :
KDN01_0024_B07.b :
TES01_0006_A08.b :
KDN01_0099_B10.b :
MLTL1_0099_G07.b : n
TES01_0053_G10.b :
KDN01_0045_G06.b :
PST01_0033_C12.b :
LVR01_0036_G04.b :
MLTL1_0009_G08.b :
PCT01_0036_C09.b :
PST01_0032_B07.b :
TES01_0094_F08.b :
TES01_0009_B03.b :
TES01_0054_H04.b :
LNG01_0108_F10.b :
KDN01_0052_G01.b :
TES01_0030_D01.b :
TES01_0018_A05.b :
TCH01_0041_A06.b :
LNG01_0017_E09.b :
TES01_0043_C06.b :
TES01_0108_D11.b :
TES01_0105_H06.b :
TES01_0012_C05.b :
TES01_0019_E04.b :
TES01_0068_E08.b :
MLN01_0037_D12.b :
BFLT1_0136_B10.b :
MLN01_0088_B08.b :
BFLT1_0133_A07.b :
AMP01_0073_H05.b :
MLN01_0009_G04.b :
20110601C-001821 : ...............................GAGAGGGGGCGGGAGCGGGTTCCGGGCGG
---------+---------+---------+---------+---------+---------+ 29
BFLT1_0034_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxtcttGAGAGGGGGCGGGAGCGGGTTCCGGGCGG
ADR01_0004_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGGGGGCGGGAGCGGGTTCCGGGCGG
OVR01_0067_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0067_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0105_A08.b : cggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0129_D10.b : agcgnacgnatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxc
TES01_0057_A02.b : ttttncctgctgtggctct
BFLT1_0017_A02.b : ccgttagctgtacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0196_H10.b : agttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0080_H04.b : ataagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0004_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0056_E10.b : nnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0011_H08.b : tttctatagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0053_D12.b : nnnnccttnnaaaaaagtacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0053_D02.b : ccccnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0056_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0037_C02.b :
HTMT1_0133_F03.b : nccgctttttnnnggacgagagacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0179_A12.b : agttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0089_F06.b : tttttcctgctgtggctatgggagtc
BFLT1_0112_H09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxx
TES01_0019_D03.b : cgcggtggc
CLNT1_0045_B03.b : nggaaccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0038_G04.b : aactcgtttgcgcacggatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0186_G01.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0064_F06.b : nnccgatatnnnngggataaagcagcggnaxxxxxxxxxxxxxxx
OVRT1_0140_G11.b : annnnnnnnccgctcagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0110_B01.b : nnnccccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0094_G01.b : tttnnnnnnnccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0033_B01.b : nnnnaaaactaaannnnggataaagcagcggtaxxxxxxxxxxxxxxxxxx
TES01_0054_G03.b :
KDN01_0092_E12.b : nttttttc
KDN01_0001_B10.b : ncgcgttnnnnnnnnggctgcgt
KDN01_0040_C10.b : n
TES01_0008_H07.b :
KDN01_0073_G01.b : nnnnncctgct
OVRT1_0009_E09.b : nnccgttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0005_F08.b : nnntttcgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0013_F02.b : nnggcaagtagaggccgtagtattaaxxxxxx
OVR01_0010_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0057_F02.b : nttgtgxxxxxxxxxxxxxxxxxxxx
OVRM1_0214_D07.b : gagtttgtcxxxxxxxxxxxxxxx
BFLT1_0106_G08.b : nnccccgttagctgaggxxxxxxxxxxxxxxxxxx
LNG01_0088_D04.b : ttcggggatggactxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0087_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0087_B08.b : nggggctnntttaagagtaagcag
OVRM1_0037_H07.b : agttgtxxxxxxx
OVR01_0067_A10.b : nggctagtgacttgacagtttgacxxxxxx
TES01_0043_C04.b :
BFLT1_0094_G11.b : nttttcgtcagcgnacgxxxxxxxxxx
TES01_0072_C10.b :
PST01_0018_B03.b :
THY01_0093_H04.b : ggcccnaaacagctttgtgxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0074_B02.b :
LVRM1_0081_B03.b : agttgtcxxxx
OVRM1_0061_D02.b : tagttgacxxxx
TES01_0082_D03.b :
TES01_0022_F08.b :
TES01_0005_B08.b :
CLNT1_0140_B07.b : nnnnccgttcgcgnacgxxxxxx
OVRT1_0004_G06.b : nnnttccgttagctgacgxxxxxx
KDN01_0066_H08.b :
KDN01_0060_A11.b :
TES01_0041_F10.b :
TES01_0004_F04.b :
BFLT1_0028_G09.b : ggaatcctatagcgnacgxxxxxx
PST01_0035_F02.b :
PST01_0018_C11.b :
BFLT1_0099_F12.b : gactccgttcagcgtacgagtgxxx
TES01_0079_E07.b :
PST01_0040_A03.b :
TES01_0050_C02.b :
PST01_0054_G04.b :
OVRM1_0046_F02.b : cxxxxxxxxxxxx
THY01_0123_G05.b :
OVRM1_0162_D08.b : nagttgtcxx
OVRM1_0088_A11.b : agttgtcxx
THY01_0038_E12.b : gggggaacctaxxxxxxxxxxxxxxxxxxxxx
BFLT1_0076_C04.b : ggaatcgttcagcgacgxxxxxx
OVRT1_0044_E05.b : nnnnnggtttagcggacgx
OVR01_0028_H06.b : gggccatcaxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0058_H06.b : nnng
MLN01_0028_B02.b : aggnnnnggcatggaataagacxxxxxxxxxxx
PTG01_0104_F10.b : gcgtcannnnnnng
OVRT1_0132_G05.b : nnnggcgtacnnnnnnnnccgttagcgnacg
UTR01_0021_A05.b : gggaxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0123_F06.b : nnnccgttagctgacgxxx
THY01_0121_E01.b :
SMG01_0095_G08.b : nncccttttttaaangg
SMG01_0071_C07.b : nggcttannnnn
PST01_0004_C05.b :
OVR01_0035_G05.b : ttttttttttatttttttttttttttttttttttttccagataggacaaaacxxxxxxxx
PCT01_0036_A12.b :
PST01_0063_A11.b :
KDN01_0004_G02.b :
PST01_0038_D08.b :
PCT01_0032_F12.b :
PST01_0058_B06.b :
PST01_0059_G12.b :
KDN01_0053_C03.b :
PST01_0087_B09.b :
KDN01_0095_D07.b :
PST01_0056_H01.b :
PST01_0080_G05.b :
PST01_0026_H07.b :
PST01_0051_G01.b :
KDN01_0019_E02.b :
PST01_0058_C05.b :
PST01_0091_F05.b :
PST01_0007_B09.b :
PST01_0085_C09.b :
OVRT1_0034_G05.b : nnnnccgtcagcgta
BFLT1_0080_C06.b : ggaaccgtcagcgtacgagt
TES01_0006_B05.b :
TES01_0089_E01.b :
OVRM1_0093_A05.b : taatttgtcx
PTG01_0022_H06.b : tttt
OVRM1_0184_C10.b : gcgttgt
TES01_0072_H01.b :
PST01_0002_B11.b :
TES01_0060_C05.b :
PCT01_0009_A10.b :
OVRT1_0142_A10.b : nnggagatatnnnnnnnnccgttagcgcacgxx
OVR01_0060_C11.b : nnttggcttggactatgacxxxxxxxx
SMG01_0013_D07.b : ngagatctnnn
PST01_0097_H12.b :
OVRT1_0028_G02.b : nnnnnggtatagccgtacga
PST01_0073_A09.b :
PST01_0100_G08.b :
TES01_0050_B01.b :
KDN01_0007_G01.b :
OVR01_0031_C03.b : aaagcaataaggtgxxxxxxxxxxxxxxxxxxxxx
PST01_0095_C09.b :
KDN01_0091_F10.b :
BFLT1_0026_A02.b : ggattccgttcagcgtacgag
UTR01_0054_G08.b : ggcttttgggtgcxxxxxxxxxxxxxxxxxxx
SKNB1_0081_G02.b :
TES01_0059_C10.b :
KDN01_0028_G12.b :
PST01_0057_F09.b :
PST01_0049_H12.b :
KDN01_0083_C09.b :
KDN01_0059_E04.b :
SKNB1_0048_F09.b :
PST01_0048_F02.b :
PST01_0050_G05.b :
PST01_0083_F03.b :
OVRT1_0057_C01.b : nccgtttnnnnnnnnnnccgttcagcgtacgag
OVRM1_0048_H01.b : gcgctg
PTG01_0064_C11.b : nnnnnnnnnnnnnn
LVRM1_0087_C04.b :
OVRM1_0009_A08.b : xxxxxxxxx
OVRM1_0081_G11.b : ag
SMG01_0049_C04.b : nnccgtttttntta
OVRM1_0187_E02.b : tagttg
TES01_0064_A09.b :
OVRM1_0078_G04.b : cgt
OVRM1_0002_C06.b : nagttg
OVRM1_0072_D03.b : cxxxxxxxxx
BFLT1_0145_B08.b : ncccactcnnnnnnnnccgtcagcgnacg
TES01_0107_C05.b :
PCT01_0035_E09.b :
SPL01_0030_G02.b : nnnnggcatggactatgacxxxxxxxx
OVRT1_0110_E01.b : ntttccgtcagcgnacgxx
ADR01_0022_B10.b :
TES01_0033_A04.b :
UTR01_0032_E06.b : catttgggtgatxxxxxxxxxxxxxxxxxxx
BFLT1_0109_D09.b : nnnnnccgtcagcgnacg
PST01_0001_G09.b :
BFLT1_0074_D04.b : ggaaccgttagctgtcg
BFLT1_0091_G11.b : ggattcgtctctgcgtcgg
OVRT1_0088_C07.b : nntttcttttnnnnnnccgttagcgnacg
OVRT1_0151_F01.b : nnnncccgttagctgtang
KDN01_0089_H02.b :
BFLT1_0047_A10.b : nttttggtatagcgnacg
KDN01_0045_C06.b :
CLNT1_0152_G01.b : nnnnnccgtcagcgnag
BFLT1_0008_A04.b : ggattacgtcagcgnacg
BFLT1_0036_F10.b : ggatacgttcagcgtacg
SMG01_0027_C09.b : ngcgctttatnn
ITT01_0075_C12.b : nn
BFLT1_0113_C11.b : nnnnccgttagctg
BFLT1_0117_A08.b : naaccctcagctnac
OVRT1_0062_H10.b : ngggtcttnnnngnnnccgttcgcgnac
PST01_0070_B08.b :
BFLT1_0115_A10.b : nnnnnccgtcagcgnacg
ITT01_0081_E02.b : n
PST01_0029_G03.b :
KDN01_0057_D10.b :
PST01_0074_H10.b :
PST01_0042_A09.b :
PST01_0066_C09.b :
PST01_0067_B03.b :
PST01_0071_B01.b :
KDN01_0010_F03.b :
PST01_0023_A11.b :
PST01_0047_G11.b :
TES01_0002_G04.b :
ITT01_0009_G02.b :
ITT01_0038_F07.b :
OVRT1_0046_C03.b : nnnnccgtctgcgnacg
KDN01_0055_B05.b :
ITT01_0001_G11.b : nn
TCH01_0103_F06.b : nnnnggctaggactataacxxxxxx
OVRT1_0018_A11.b : ngtctccgttcngcgnacg
PST01_0098_C09.b :
SPL01_0103_B02.b : nntttgcatggactatgacxxxxxxx
LNG01_0057_B09.b : nggccaatnnttcggctggacatgacagtttg
SMG01_0016_G08.b : nnnggtttctaa
OVRM1_0196_E03.b : nagtt
OVR01_0065_F08.b : nnggcttgtgacttgacxxxxxx
OVR01_0076_F06.b : cxxxxxxxxxxxxxxxxxxxxx
TES01_0112_H07.b :
OVRM1_0152_C07.b : nagtt
LVRM1_0087_C11.b : tt
OVRM1_0130_A10.b : tcagt
OVRM1_0058_F11.b : ag
UTR01_0102_A10.b : cttgggactataaxxxxxxx
SPL01_0025_C04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0084_G03.b :
THY01_0007_D06.b :
UTR01_0008_C08.b : ctttagggtgxxxxxxxxxxxxxxxxxxx
PCT01_0022_F06.b :
SMG01_0024_D06.b : nngggcttttnn
BFLT1_0148_E06.b : nnnnaactttagcgnac
OVR01_0033_E10.b : aaggacacxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0051_F07.b :
OVRT1_0139_A11.b : nngggcaaaannnnnnnncccttagcgnacg
PBL01_0010_C09.b : nggggtg
SPL01_0104_B05.b : nnntttgcatgtgacttgacxxxxxxx
OVRT1_0101_G04.b : nnnnccctcagcgnagg
OVRT1_0031_B04.b : nnnnnccgttcagcgnacg
OVRT1_0016_H01.b : nntttcgttcagcgtcg
ITT01_0093_C01.b :
PTG01_0033_G06.b : t
OVRT1_0077_B10.b : nggtttctattgcgcga
PST01_0002_G08.b :
PCT01_0018_H11.b :
BFLT1_0045_H02.b : ggtatacgttcgcgnac
CLNT1_0021_C04.b : gcgcttatnnnnnnnccgttagcgnac
TES01_0014_G06.b :
BFLT1_0022_A10.b : ggattacgtttgctnac
BFLT1_0012_B10.b : ngaatccgttagcgnac
CLNT1_0093_C02.b : nggccttttnnggggnccgtcgcgnac
OVRT1_0121_B10.b : nncctttagctgag
TES01_0042_F07.b :
PST01_0023_F04.b :
OVRT1_0058_E10.b : nccctttttnngggaaccgttagcgnacg
PST01_0080_F07.b :
THY01_0203_E03.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0043_E01.b :
PST01_0060_C08.b :
PST01_0083_E12.b :
PST01_0031_G02.b :
PST01_0013_G12.b :
PST01_0100_H07.b :
SPL01_0103_D09.b : nnnnggctaggactatgacxxxxxxx
LVR01_0001_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0006_D10.b :
CLNT1_0087_C01.b : nnnggtcttnnnnnttccgtcagcgta
OVR01_0094_H03.b : nnnnggctaggactaaaacxxxxxx
PST01_0082_D11.b :
PST01_0056_B02.b :
PST01_0035_E12.b :
PST01_0075_H09.b :
KDN01_0080_A09.b :
PST01_0006_G08.b :
PST01_0005_E05.b :
BFLT1_0078_F09.b : gggatccgtcagcgnac
OVRT1_0069_E11.b : nnnttccgttcgcgnacg
MLN01_0082_A04.b : nnnggctagtgacttgacxxxxx
ITT01_0089_A11.b : n
MLN01_0021_C05.b : nnnnggtaggacttgacagtt
OVRT1_0041_G02.b : nnnnnccgttagcgnac
OVRT1_0066_B06.b : nnnccccgttagcgnacg
TCH01_0023_H11.b : nngggctggactataacxxxxxx
ITT01_0081_H12.b : n
LNG01_0064_G12.b : nnttggattggactataacxxxxxxxx
ITT01_0083_A12.b :
LVRM1_0111_C05.b : nagt
BFLT1_0147_C06.b : nnnccgtttgcgna
TES01_0062_E09.b :
TES01_0091_H08.b :
PST01_0071_F03.b :
TES01_0003_C12.b :
KDN01_0067_C10.b :
SKNB1_0060_C09.b :
OVRM1_0059_E12.b :
KDN01_0045_E10.b :
KDN01_0063_C12.b :
KDN01_0030_E11.b :
TES01_0095_D06.b :
TES01_0078_E09.b :
KDN01_0068_H07.b :
PST01_0052_F01.b :
PST01_0013_H03.b :
KDN01_0068_C06.b :
KDN01_0034_H07.b :
TES01_0062_E10.b :
TES01_0067_E01.b :
PST01_0086_C05.b :
KDN01_0008_B07.b :
PCT01_0014_F06.b :
TES01_0039_E09.b :
TES01_0052_E06.b :
PST01_0076_E11.b :
PST01_0085_D02.b :
PST01_0062_G03.b :
BFLT1_0099_B02.b : gaatccgttagcg
MLN01_0006_G10.b : nnnnnnnnnnnnnnnnnn
PST01_0070_E12.b :
PST01_0094_D03.b :
OVRM1_0080_G08.b :
KDN01_0024_B10.b :
OVRT1_0119_A09.b : cagctgtc
LVRM1_0053_F06.b :
TES01_0081_D05.b :
LNG01_0002_D01.b : ggcxxxxxxxxxxxxxxxxx
LVRM1_0004_G10.b :
LVRM1_0154_D01.b :
OVRM1_0189_G10.b :
OVR01_0101_F03.b : aaaaggctaggactat
OVRT1_0063_B03.b : nnnnncct
PST01_0003_F08.b :
BFLT1_0138_B01.b : nntcccgt
LVR01_0066_A08.b : gggtxxxxxxxxxxxxxxxxxx
KDN01_0052_F10.b :
SPL01_0088_H11.b : tttggctaggactat
OVRT1_0010_D12.b : ttttccg
PST01_0017_F07.b :
OVRT1_0002_A07.b : naaatcctc
KDN01_0053_B05.b :
TES01_0029_A04.b :
PST01_0035_F10.b :
KDN01_0090_D02.b :
PST01_0038_D05.b :
KDN01_0068_B03.b :
PST01_0029_D05.b :
PST01_0088_B11.b :
KDN01_0055_B02.b :
PST01_0097_C03.b :
PST01_0026_G08.b :
OVRT1_0082_D12.b : tgtatcc
PST01_0089_H06.b :
ITT01_0033_E04.b :
ADR01_0077_B03.b :
ADR01_0056_E03.b :
PCT01_0031_C07.b :
KDN01_0037_A07.b :
TES01_0019_C02.b :
PST01_0040_B09.b :
KDN01_0021_E09.b :
PST01_0039_G07.b :
KDN01_0021_H06.b :
PST01_0020_F03.b :
BFLT1_0149_G09.b : nnn
THY01_0058_B09.b : cttttggctgaacxx
LVRM1_0114_C09.b :
OVRT1_0009_C03.b :
PST01_0061_B11.b :
THY01_0096_H11.b : cgcattagggtgxxx
KDN01_0075_B06.b :
THY01_0108_F09.b :
LVRM1_0185_E01.b :
LVRM1_0033_B01.b :
OVRM1_0028_D12.b :
OVRM1_0058_E05.b :
OVRM1_0203_H09.b :
OVRT1_0122_C01.b :
OVRT1_0053_A12.b : nntttttnnnnnnn
OVRT1_0008_H09.b : nnn
BFLT1_0083_B10.b :
OVRT1_0126_B09.b : n
KDN01_0081_E03.b :
TES01_0043_E01.b :
PST01_0022_C10.b :
CLNT1_0150_B12.b :
TES01_0019_B05.b :
PST01_0062_C02.b :
KDN01_0070_H10.b :
TES01_0013_E03.b :
KDN01_0042_B04.b :
OVRT1_0055_D05.b : nntttttt
OVRT1_0076_F10.b :
OVRT1_0083_A03.b : nnggt
LNG01_0065_C04.b : nntttggg
PST01_0070_C12.b :
TES01_0102_E10.b :
OVRM1_0060_G04.b :
TES01_0082_E05.b :
LNG01_0009_H08.b : gccttttgggtgxxxx
TES01_0017_B12.b :
PTG01_0027_H03.b :
TES01_0022_E04.b :
OVRT1_0016_D12.b : ttt
OVRT1_0108_D06.b :
PST01_0031_F03.b :
PST01_0077_F01.b :
PST01_0099_A01.b :
TES01_0009_A01.b :
PST01_0089_D07.b :
PST01_0059_C04.b :
PST01_0007_D04.b :
TES01_0054_E08.b :
KDN01_0098_F02.b :
PST01_0093_G10.b :
CLNT1_0043_C12.b :
OVR01_0081_B03.b : gcaxxxxxxxx
OVR01_0013_H03.b : gggctttttgggcgxx
OVRM1_0019_F06.b :
OVRM1_0185_E01.b :
OVRM1_0079_B12.b :
OVRM1_0047_C12.b :
THY01_0051_G01.b : cattagggtgx
TES01_0099_E04.b :
OVRT1_0118_C11.b :
BFLT1_0084_C08.b :
OVRT1_0110_D10.b :
PST01_0004_G12.b :
BFLT1_0075_A02.b :
KDN01_0080_H04.b :
LNG01_0011_F12.b : ggcctttatgg
PST01_0051_D06.b :
UTR01_0047_D09.b : ctttgggtga
PST01_0017_A04.b :
PBL01_0017_F04.b :
PST01_0004_G07.b :
TES01_0015_E10.b :
THY01_0091_C11.b : ggcttctcggtg
KDN01_0094_H06.b :
PST01_0088_H03.b :
KDN01_0033_C03.b :
KDN01_0073_E10.b :
KDN01_0010_E11.b :
KDN01_0067_F02.b :
OVRT1_0059_C09.b :
OVRT1_0045_A03.b :
KDN01_0091_C07.b :
PST01_0062_A11.b :
PST01_0099_F03.b :
OVRT1_0082_A02.b : nccctttt
OVR01_0020_G06.b : gggggggacc
THY01_0100_B06.b : ggggcxxxxxxxx
ITT01_0051_E01.b :
OVRT1_0096_F05.b : nccctttttn
OVRM1_0219_F08.b :
OVRM1_0156_D09.b :
THY01_0104_D01.b :
OVRM1_0221_H09.b :
TES01_0025_D09.b :
PBL01_0003_D12.b :
OVRM1_0175_C07.b :
LVRM1_0174_D07.b :
TES01_0064_E05.b :
OVRM1_0166_H10.b :
OVRM1_0113_H08.b :
OVRM1_0152_E10.b :
LVRM1_0197_E10.b :
LVRM1_0148_G01.b :
OVRM1_0133_G04.b :
OVRM1_0225_E07.b :
THY01_0016_C06.b : xx
OVRM1_0209_H05.b :
OVRM1_0169_H04.b :
OVRM1_0014_C12.b :
OVRM1_0120_E06.b :
OVRM1_0103_D04.b :
OVRM1_0072_A05.b :
OVRM1_0112_G08.b :
OVRM1_0041_A11.b :
OVRM1_0018_D12.b :
OVRM1_0012_D10.b :
TES01_0034_B07.b :
THY01_0007_E02.b : t
OVR01_0065_A09.b : atttttt
UTR01_0026_E09.b : ggggcac
SMG01_0061_B10.b :
SMG01_0078_F09.b :
OVRT1_0144_B10.b : nnagatcttn
OVRT1_0006_A03.b :
OVRT1_0115_A10.b :
KDN01_0045_D10.b :
OVRT1_0113_G02.b :
OVRT1_0116_E04.b :
PBL01_0103_F12.b :
LNG01_0030_E10.b : ggcatatggt
OVRT1_0039_E05.b :
PBL01_0011_G03.b :
THY01_0032_H03.b : ttgggggg
OVRT1_0076_B09.b :
SMG01_0013_H04.b :
KDN01_0069_F11.b :
THY01_0034_B10.b : xxxxxxxxx
OVR01_0040_F04.b : gggacxxxxxxxx
SPL01_0009_H06.b : ttxxxxxxxxxxx
OVR01_0056_C05.b : nnnngg
OVR01_0061_C07.b : nnnngg
OVRT1_0113_D06.b :
OVRT1_0128_D02.b :
OVRT1_0128_D07.b :
THY01_0084_G02.b : cxxxxxxxxxxx
OVRT1_0008_A04.b :
OVRT1_0100_A09.b :
OVRT1_0095_G09.b : ncgttttt
TES01_0057_G08.b :
OVRT1_0057_B04.b : ncggtttnn
LNG01_0099_B05.b :
OVRT1_0098_D12.b :
PCT01_0007_A05.b :
PST01_0042_D09.b :
PST01_0052_H08.b :
THY01_0207_A07.b : ccxxxxxxxx
PST01_0086_H08.b :
TES01_0054_B05.b :
OVRT1_0028_A12.b : nngggtttt
PST01_0093_B02.b :
KDN01_0041_D12.b :
TES01_0012_G01.b :
OVRT1_0013_D01.b :
PST01_0095_F01.b :
PST01_0034_B02.b :
PST01_0036_C10.b :
PST01_0094_G04.b :
TES01_0049_E11.b :
PST01_0052_B03.b :
KDN01_0096_H05.b :
PST01_0088_D03.b :
PST01_0092_H03.b :
PST01_0071_H08.b :
PST01_0084_F06.b :
OVRT1_0022_B01.b : nggtcttn
PBL01_0080_F06.b :
PST01_0012_A07.b :
PBL01_0068_G08.b :
TES01_0104_B01.b :
CLNT1_0065_G10.b :
ITT01_0010_D07.b :
ITT01_0060_A10.b :
OVRT1_0146_C04.b :
OVRT1_0071_A04.b : nnggccttt
BFLT1_0048_D09.b :
ITT01_0095_F03.b :
OVRT1_0041_B05.b : ngggtttn
BFLT1_0100_B12.b :
OVRT1_0113_D04.b :
PST01_0074_H05.b :
PST01_0063_G03.b :
ITT01_0080_A08.b :
ITT01_0032_E10.b :
TES01_0007_C06.b :
SPL01_0091_B01.b : nnnnngg
ITT01_0006_H06.b :
OVRT1_0087_B03.b : nnnggttttt
OVRT1_0068_D03.b : nnngggctnnn
TCH01_0027_D07.b : nnnn
LNG01_0056_E07.b : n
ITT01_0011_B07.b :
ITT01_0083_A11.b :
KDN01_0088_C11.b :
KDN01_0073_F12.b :
TES01_0110_H05.b :
KDN01_0002_E08.b :
OVRM1_0082_H09.b :
OVRM1_0167_G02.b :
THY01_0010_A04.b : ttttttnttnnntttccttcccctnntcctcnnccctccccccccnccctagcctxxxxx
TES01_0057_D12.b :
TES01_0047_A09.b :
KDN01_0050_E07.b :
TES01_0091_F01.b :
TES01_0091_E10.b :
TES01_0019_G10.b :
TES01_0084_D06.b :
PST01_0013_A02.b :
PST01_0025_G01.b :
TES01_0002_E08.b :
OVRT1_0120_A07.b :
PST01_0003_B12.b :
PST01_0025_F02.b :
LNG01_0022_C09.b : gcxx
KDN01_0055_E06.b :
PST01_0033_G06.b :
PST01_0079_H09.b :
PST01_0033_A07.b :
TES01_0018_E03.b :
PST01_0022_A01.b :
TES01_0023_C03.b :
PCT01_0021_E09.b :
KDN01_0024_G05.b :
PST01_0072_C06.b :
PST01_0027_G11.b :
PST01_0038_H05.b :
PST01_0007_F07.b :
KDN01_0093_F05.b :
PST01_0029_F01.b :
PST01_0034_G06.b :
PST01_0019_E03.b :
TES01_0041_A03.b :
PST01_0014_E11.b :
PST01_0058_F03.b :
KDN01_0078_D04.b :
KDN01_0085_D05.b :
PST01_0015_E01.b :
KDN01_0054_F11.b :
PST01_0007_C03.b :
PST01_0061_A04.b :
PST01_0008_D07.b :
KDN01_0009_B04.b :
KDN01_0087_C11.b :
KDN01_0023_B10.b :
PST01_0088_B05.b :
PST01_0024_A10.b :
PST01_0024_B02.b :
KDN01_0082_D02.b :
OVRM1_0172_F02.b :
OVRM1_0055_E09.b :
THY01_0068_C05.b : cxxxxxxxx
TES01_0033_C03.b :
TES01_0112_B08.b :
TES01_0022_F09.b :
PST01_0002_B04.b :
KDN01_0006_A05.b :
THY01_0099_D08.b : ctxxxxxx
KDN01_0011_G04.b :
PCT01_0011_A09.b :
KDN01_0087_D01.b :
PST01_0014_B06.b :
KDN01_0067_A12.b :
TES01_0027_C12.b :
OVRM1_0081_F08.b :
TES01_0067_H01.b :
PST01_0009_C05.b :
KDN01_0025_D12.b :
KDN01_0033_B07.b :
PST01_0012_B03.b :
PST01_0053_A12.b :
ADR01_0093_C01.b :
TES01_0053_G11.b :
ADR01_0011_C07.b :
KDN01_0064_E01.b :
PST01_0026_D01.b :
THY01_0120_B12.b :
TES01_0001_C12.b :
OVRM1_0116_B01.b :
OVRM1_0041_G05.b :
LNG01_0011_A09.b : g
TES01_0072_D06.b :
TES01_0102_D03.b :
TES01_0010_E04.b :
TES01_0009_A11.b :
TES01_0026_B01.b :
KDN01_0091_E03.b :
KDN01_0061_C03.b :
OVRT1_0003_B02.b : nccgt
KDN01_0022_E04.b :
KDN01_0029_E10.b :
LVRM1_0093_B09.b :
TES01_0077_G08.b :
TES01_0088_F01.b :
TES01_0085_H05.b :
OVRM1_0094_G06.b :
TES01_0099_B08.b :
TES01_0025_D03.b :
TES01_0006_C11.b :
TES01_0034_A11.b :
KDN01_0025_G04.b :
TES01_0050_H09.b :
PST01_0029_D01.b :
PST01_0042_H12.b :
OVRM1_0173_A01.b :
ADR01_0017_A02.b :
OVRM1_0100_C03.b :
OVRM1_0047_H06.b :
OVRM1_0172_F03.b :
LVRM1_0116_H07.b :
OVRM1_0078_E11.b :
OVRM1_0031_A05.b :
OVRM1_0083_D08.b :
SPL01_0083_F11.b :
BFLT1_0118_H01.b :
TES01_0105_C06.b :
PTG01_0018_D07.b :
SPL01_0055_H02.b : n
OVRT1_0101_F07.b :
ITT01_0102_C12.b :
BFLT1_0149_D10.b :
OVRT1_0089_G01.b :
PST01_0069_F01.b :
LVR01_0054_G10.b : gca
OVRT1_0111_D10.b : nc
KDN01_0058_G02.b :
OVRT1_0039_D08.b : ng
OVRT1_0056_A02.b : nngg
PST01_0057_A05.b :
OVRT1_0018_G12.b : n
OVRT1_0069_G08.b : nng
OVRT1_0075_C09.b :
OVRT1_0012_B05.b :
OVRT1_0046_G06.b :
UTR01_0107_A08.b :
ITT01_0078_D08.b :
TES01_0086_G12.b :
TES01_0058_C06.b :
BFLT1_0125_D10.b :
ADR01_0036_C11.b :
PST01_0062_H02.b :
PST01_0074_F04.b :
LNG01_0019_A06.b :
PST01_0043_H03.b :
PST01_0077_H04.b :
PST01_0012_B07.b :
PST01_0009_H10.b :
PST01_0046_B03.b :
TES01_0041_G12.b :
PST01_0086_C01.b :
PST01_0032_G01.b :
KDN01_0033_A04.b :
PST01_0038_F03.b :
PST01_0015_D05.b :
PST01_0022_H09.b :
KDN01_0096_B04.b :
PST01_0095_F02.b :
PST01_0074_D10.b :
KDN01_0018_E04.b :
KDN01_0088_B07.b :
PST01_0010_H06.b :
KDN01_0099_E09.b :
PST01_0099_A06.b :
PST01_0048_B12.b :
PST01_0082_E02.b :
TES01_0047_A04.b :
TES01_0055_D02.b :
PST01_0100_G09.b :
PST01_0027_H03.b :
KDN01_0043_C02.b :
TES01_0017_C03.b :
PST01_0016_H11.b :
KDN01_0034_H12.b :
LVRM1_0135_E07.b :
TES01_0059_H03.b :
TES01_0031_H08.b :
PST01_0044_B07.b :
PCT01_0022_H02.b :
BFLT1_0072_G07.b :
TES01_0002_G02.b :
PST01_0020_D02.b :
TES01_0010_C01.b :
TES01_0077_C02.b :
TES01_0110_G03.b :
BFLT1_0101_E01.b :
TES01_0081_G12.b :
OVRM1_0127_B01.b :
OVRT1_0133_E08.b :
BFLT1_0054_A04.b :
TES01_0011_D12.b :
BFLT1_0144_F03.b :
TES01_0078_E08.b :
TES01_0092_E05.b :
TES01_0025_D08.b :
LVRM1_0033_F02.b :
OVR01_0055_B10.b :
OVRM1_0194_A11.b :
ADR01_0047_A04.b :
BFLT1_0051_A02.b :
BFLT1_0014_B06.b :
OVRT1_0066_E09.b :
BFLT1_0039_G12.b :
BFLT1_0014_D01.b :
TES01_0081_H11.b :
TES01_0101_F02.b :
TES01_0037_H11.b :
PCT01_0023_F06.b :
PST01_0003_C05.b :
PST01_0042_E06.b :
PST01_0019_F10.b :
KDN01_0024_B07.b :
TES01_0006_A08.b :
KDN01_0099_B10.b :
MLTL1_0099_G07.b : nnnggctttnnnnnnnncgaaccctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0053_G10.b :
KDN01_0045_G06.b :
PST01_0033_C12.b :
LVR01_0036_G04.b :
MLTL1_0009_G08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxx
PCT01_0036_C09.b :
PST01_0032_B07.b :
TES01_0094_F08.b :
TES01_0009_B03.b :
TES01_0054_H04.b :
LNG01_0108_F10.b :
KDN01_0052_G01.b :
TES01_0030_D01.b :
TES01_0018_A05.b :
TCH01_0041_A06.b :
LNG01_0017_E09.b :
TES01_0043_C06.b :
TES01_0108_D11.b :
TES01_0105_H06.b :
TES01_0012_C05.b :
TES01_0019_E04.b :
TES01_0068_E08.b :
MLN01_0037_D12.b :
BFLT1_0136_B10.b :
MLN01_0088_B08.b :
BFLT1_0133_A07.b :
AMP01_0073_H05.b :
MLN01_0009_G04.b :
---------+---------+---------+---------+---------+---------+ 89
SMG01_0064_F06.b : xxxxxxxxxxxxxxxctgGGAccccgggccgggcgccgccgccggcTCGTCTACCCTTTC
OVR01_0010_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
ITT01_0057_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGCTGGGCGCCGCCGCCGGCTCGTCTACCCTTTC
OVRM1_0214_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggGCCGCCGGCTCGTCTACCCTTTC
BFLT1_0106_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxactggGCCGCCGGCTCGTCTACCCTTTC
LNG01_0088_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCGCCGGCTCGTCTACCCTTTC
AMP01_0087_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCGCCGGCTCGTCTACCCTTTC
SMG01_0087_B08.b : cggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCGGCTCGTCTACCCTTTC
OVRM1_0037_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGTCTACCCTTTC
OVR01_0067_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGTCTACCCTTTC
TES01_0043_C04.b : ncgctttGGCTCTGGCCTTTC
BFLT1_0094_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGTCTACCCTTTC
TES01_0072_C10.b : ttactgcgtggctatggttGGCTCTGGCTTTC
PST01_0018_B03.b : tgtGGCTCTGGCTTTT
THY01_0093_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCGTCTACCCTTTC
TES01_0074_B02.b : tcgctgtgGCTCTGGCTTTC
LVRM1_0081_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTACCCTTTC
OVRM1_0061_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTACCCTTTC
TES01_0082_D03.b : tttctgcggtGGCTCTGGTTTT
TES01_0022_F08.b : tcgctttGGCTCTGGTTTT
TES01_0005_B08.b : nccgcgttGGCTCTGGTTTT
CLNT1_0140_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTACCCTTTC
OVRT1_0004_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTACCCTTTC
KDN01_0066_H08.b : nnnnnggctgcgttgGCTCTGGCTTTT
KDN01_0060_A11.b : nnnnggctgaggtGGCTCTGGCTTT
TES01_0041_F10.b : tgtGGCTCTGGTTTC
TES01_0004_F04.b : nttcgcggtgGCTCTGGCTTTC
BFLT1_0028_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTACCCTTTC
PST01_0035_F02.b : ttttatcgctgtgGCTCTGGCTTTT
BFLT1_0099_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTACCCTTTC
TES01_0079_E07.b : ntttgcctgcgtgGCTCTGGTTTT
PST01_0040_A03.b : nctcgctgtgGCTCTGGTTTT
TES01_0050_C02.b : nttactgttGCTCTGGCTTT
PST01_0054_G04.b : nnnnttcgctgtgGCTCTGGTTTT
OVRM1_0046_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT*TTTTTTC
THY01_0123_G05.b : gttgtcaaagcggcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaCTACCCTTTC
OVRM1_0162_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT*TTTTTTC
OVRM1_0088_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT*TTTTTTC
THY01_0038_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGCCTTTC
BFLT1_0076_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcccttgggCTACCCTTTC
OVRT1_0044_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaCTGGCTTTTC
OVR01_0028_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctgtacaaCTGGCCTTTC
ITT01_0058_H06.b : gtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT*TTTTTTC
MLN01_0028_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCT*TTTTTTC
PTG01_0104_F10.b : gctaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACCCTTTC
OVRT1_0132_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCCTTTC
UTR01_0021_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACCCTTTC
BFLT1_0123_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgTACCCTTTC
THY01_0121_E01.b : agtgtcaaaaacagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTTTC
SMG01_0095_G08.b : agtaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGGCCTTTC
SMG01_0071_C07.b : ttgataaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTTC
PST01_0004_C05.b : nggccgcggtggctaTGGCTTTC
OVR01_0035_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccgtcaacTGGCTTTC
PCT01_0036_A12.b : nngggggatgcaannnnactgcgttggctcgggncTCCCTTTC
PST01_0063_A11.b : ctgcgttggctcTGGCTTTC
KDN01_0004_G02.b : nggcttttttttttcctgaggtggccacGGCCTTTC
PST01_0038_D08.b : tcgcgttggctTGGCTTTT
PCT01_0032_F12.b : nnnaaggattnnnnnnnncctgaggtggcacgggncTCCCTTTC
PST01_0058_B06.b : nnnnncctgctgtggctaTGGCTTTC
PST01_0059_G12.b : nnntttcctgctgtggctcGGCCTTTC
KDN01_0053_C03.b : cgttggctaTGGCTTTT
PST01_0087_B09.b : nnnncctgaggtggcacGGCCTTTC
KDN01_0095_D07.b : nnnncctgcgtggctaTGGCTTTT
PST01_0056_H01.b : nnnnggtggctgtggcacGGCCTTTC
PST01_0080_G05.b : nncctgcgtggctcGGCCTTTC
PST01_0026_H07.b : ntttactgctgtggctaTGGCTTTT
PST01_0051_G01.b : nnnttcgctgtggctctGGCCTTTC
KDN01_0019_E02.b : nnggatattnnnnnnncctacgttggctacggCTTTTTTT
PST01_0058_C05.b : nnnncctgctgtggctaTGGCTTTT
PST01_0091_F05.b : nnnncctgctgtggctcTGGCTTTT
PST01_0007_B09.b : nnnnnncctgctgtggctcGGCCTTTC
PST01_0085_C09.b : nnnnactgaggtggcacGGCCTTTC
OVRT1_0034_G05.b : cgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGCTTTT
BFLT1_0080_C06.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttTTTTTTTC
TES01_0006_B05.b : ttttcccgctgtggctatggGGCCTTTC
TES01_0089_E01.b : tttaccgctgttgctctGGCTTTC
OVRM1_0093_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCTTTC
PTG01_0022_H06.b : ataactaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTTTC
OVRM1_0184_C10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCTTTC
TES01_0072_H01.b : tttcctgcgtggctctGGCTTTC
PST01_0002_B11.b : nctgacgttggctctGGCTTTC
TES01_0060_C05.b : ncctgcgttggctaTGGCTTT
PCT01_0009_A10.b : ttggnnnactgcggtggctcGGCTTTC
OVRT1_0142_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTC
OVR01_0060_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTC
SMG01_0013_D07.b : nggataaagcagcggtccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTC
PST01_0097_H12.b : ntttcctgacgtggctacgggtcaCCCTTTC
OVRT1_0028_G02.b : gtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTC
PST01_0073_A09.b : nncctgcgttggctcGGCTTTT
PST01_0100_G08.b : nnncctgctgtggctacgGCTTTTT
TES01_0050_B01.b : nnctactgcgtggctatGGCTTTC
KDN01_0007_G01.b : nccctttnnnnnnncctgcgttggccacGGCTTTC
OVR01_0031_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTTC
PST01_0095_C09.b : nnnnncctgcggtggctatgggtctaCCCTTTC
KDN01_0091_F10.b : nttttgctgagtggctcggACCTTTC
BFLT1_0026_A02.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCTTTTTC
UTR01_0054_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTTTC
SKNB1_0081_G02.b : nnnnnnnnnnnnnnnnncccgcgcgtgcaGGCTTTC
TES01_0059_C10.b : ntttactgcggtggcacgGGCTTTT
KDN01_0028_G12.b : ntttacggcggtggctatgggtctCCCTTTC
PST01_0057_F09.b : tttttgctgcgttggcacgggtctCCCTTTC
PST01_0049_H12.b : tcgcgttggctatggcgtctCCCTTTC
KDN01_0083_C09.b : nnnncctgcggtggctcggctTTTTTTT
KDN01_0059_E04.b : nnnncctacggtggctcgggtctCCCTTTC
SKNB1_0048_F09.b : nnnnncctgccgtggctatGGCTTTC
PST01_0048_F02.b : ttttttactgcggtggctatGGCTTTC
PST01_0050_G05.b : nnnnttcgcgttggctctggCTTTTTT
PST01_0083_F03.b : nnnncctgcggtggctcggCTTTTTT
OVRT1_0057_C01.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcCCCTTTC
OVRM1_0048_H01.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTCTC
PTG01_0064_C11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxGCTTTC
LVRM1_0087_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
OVRM1_0009_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
OVRM1_0081_G11.b : ttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
SMG01_0049_C04.b : tgagtaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
OVRM1_0187_E02.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
TES01_0064_A09.b : tttttctgcgtggctcgGCTTTT
OVRM1_0078_G04.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
OVRM1_0002_C06.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
OVRM1_0072_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
BFLT1_0145_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGCTTTC
TES01_0107_C05.b : nnttagcgttggctcgGCTTTT
PCT01_0035_E09.b : ngggatccccnnnncctacgctgtgcacgGCTTTT
SPL01_0030_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
OVRT1_0110_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
ADR01_0022_B10.b : taaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
TES01_0033_A04.b : ctgcgttggcatGCTTTC
UTR01_0032_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcCTTTTC
BFLT1_0109_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
PST01_0001_G09.b : ncccttaactttnnncctacgtgtgctcgggnctaCCTTTC
BFLT1_0074_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGCTTTC
BFLT1_0091_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTTTC
OVRT1_0088_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
OVRT1_0151_F01.b : agtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
KDN01_0089_H02.b : ttactgcggtgcacgggtcaCCTTTC
BFLT1_0047_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
KDN01_0045_C06.b : agaagcattggcctcgGCTTTT
CLNT1_0152_G01.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
BFLT1_0008_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
BFLT1_0036_F10.b : agtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGCTTTC
SMG01_0027_C09.b : nggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcCTTTTC
ITT01_0075_C12.b : nnggagtaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
BFLT1_0113_C11.b : acgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
BFLT1_0117_A08.b : gnatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
OVRT1_0062_H10.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
PST01_0070_B08.b : nnnttcgctgtggcacggCCTTTC
BFLT1_0115_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
ITT01_0081_E02.b : nnggatatacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
PST01_0029_G03.b : tttttcctgcggtggctcgggtctaCCTTTC
KDN01_0057_D10.b : nnaatgcgttggctctggCTTTTT
PST01_0074_H10.b : nnnncctgcggtggctcgGCTTTT
PST01_0042_A09.b : tttttctcgcggtggctatgGCTTTT
PST01_0066_C09.b : nnnnttcgctgtggctatggCTTTTT
PST01_0067_B03.b : ttttgcccgcgttggctatgGCTTTT
PST01_0071_B01.b : ttttactgcggtggctctggCTTTTT
KDN01_0010_F03.b : nnggcttnnnnnnncctgcgttggctcGGCTTT
PST01_0023_A11.b : nnnnnaacctgcgttggctatGGCTTT
PST01_0047_G11.b : nntttgctgcgttggctatgGCTTTT
TES01_0002_G04.b : ntttcctgcgtggctatggaCCTTTC
ITT01_0009_G02.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
ITT01_0038_F07.b : nnggagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
OVRT1_0046_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTTC
KDN01_0055_B05.b : ncctgctgtggctctgGCTTTT
ITT01_0001_G11.b : nnggtgtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
TCH01_0103_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
OVRT1_0018_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTTC
PST01_0098_C09.b : nnaactgctgtggctatgGCTTTT
SPL01_0103_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
LNG01_0057_B09.b : tacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTTTC
SMG01_0016_G08.b : tnnggataaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVRM1_0196_E03.b : gtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVR01_0065_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVR01_0076_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGGTTC
TES01_0112_H07.b : tttctgctgtggctatGGCTT
OVRM1_0152_C07.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
LVRM1_0087_C11.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVRM1_0130_A10.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTC
OVRM1_0058_F11.b : ttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
UTR01_0102_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
SPL01_0025_C04.b : nnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaggTTTTC
TES01_0084_G03.b : ttttcctgaggtggctctGGCTT
THY01_0007_D06.b : gaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
UTR01_0008_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
PCT01_0022_F06.b : nnnncccatttnnnnnnagcagcgggtgcactGGCTT
SMG01_0024_D06.b : nngggctaaagcagcggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
BFLT1_0148_E06.b : gagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVR01_0033_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
TES01_0051_F07.b : cctacgtggctctGGCTT
OVRT1_0139_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
PBL01_0010_C09.b : ntaanggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
SPL01_0104_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVRT1_0101_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVRT1_0031_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVRT1_0016_H01.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
ITT01_0093_C01.b : taactatacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
PTG01_0033_G06.b : aattnggagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVRT1_0077_B10.b : gagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
PST01_0002_G08.b : cattttnnnnnnncctgcgttgtgcactGGCTT
PCT01_0018_H11.b : nnnngggagtnnnnnnnncctgcgttggcacggcTTTTT
BFLT1_0045_H02.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTC
CLNT1_0021_C04.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
TES01_0014_G06.b : ntttcgcgttggctctgaGTTTT
BFLT1_0022_A10.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
BFLT1_0012_B10.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
CLNT1_0093_C02.b : gagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCTTTC
OVRT1_0121_B10.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
TES01_0042_F07.b : ttttcctgctgtggctatGGCTT
PST01_0023_F04.b : nttttatcgctgtggctatGGCTT
OVRT1_0058_E10.b : agtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
PST01_0080_F07.b : nnncctgctgtggctatGGCTT
THY01_0203_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
PST01_0043_E01.b : nnnnggtcgctgtggctaGGCTT
PST01_0060_C08.b : nttttcctgcgttggcatGGCTT
PST01_0083_E12.b : nnttaactgcggtggctcggCTTTT
PST01_0031_G02.b : aaacctgctgtggctctGGCTT
PST01_0013_G12.b : ttgtaannncctgcgttggctcGGCTT
PST01_0100_H07.b : nnnaactgcgttggctatggCTTTT
SPL01_0103_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
LVR01_0001_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
KDN01_0006_D10.b : nnnntgctgcggtggctatGGCTT
CLNT1_0087_C01.b : cgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVR01_0094_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTC
PST01_0082_D11.b : nnnnncctgaggtggctacggCTTTT
PST01_0056_B02.b : nnncctgctgtggctaggtaCCTTT
PST01_0035_E12.b : tttatcgctgtggctctGGCTT
PST01_0075_H09.b : nnnnggctgcgtggctcggCTTTT
KDN01_0080_A09.b : nncccgcggtggctcggCTTTT
PST01_0006_G08.b : nnccctttnnnnnnncctgcggtggctctggaCTTTC
PST01_0005_E05.b : ncccttttnnnnnnactgcgttggctcggCTTTT
BFLT1_0078_F09.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCTTTC
OVRT1_0069_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
MLN01_0082_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
ITT01_0089_A11.b : nnggcgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
MLN01_0021_C05.b : tgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVRT1_0041_G02.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
OVRT1_0066_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcggtCTTTC
TCH01_0023_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
ITT01_0081_H12.b : naagatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTC
LNG01_0064_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
ITT01_0083_A12.b : nnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTC
LVRM1_0111_C05.b : tgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTC
BFLT1_0147_C06.b : cgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccttgaTTTC
TES01_0062_E09.b : ttttcgcgtggctatgGTTT
TES01_0091_H08.b : nttttaactgacttggctatgggaTTTC
PST01_0071_F03.b : tcgcgttggctctgGTTT
TES01_0003_C12.b : ttttcgctgtggctctgGTTT
KDN01_0067_C10.b : nnntttgctgcgttggctatggTTTT
SKNB1_0060_C09.b : nnnngggtttnnntanggacgcgttggctaCCTT
OVRM1_0059_E12.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTC
KDN01_0045_E10.b : tggTTT
KDN01_0063_C12.b : ttttttgctgcgttggctatgggTTT
KDN01_0030_E11.b : nggtggcgttggcactggTTT
TES01_0095_D06.b : tttttcccgctgtggctctggTT
TES01_0078_E09.b : tttttgctgcgtggctctggTT
KDN01_0068_H07.b : nnaaactgctgtggctatggTT
PST01_0052_F01.b : nnatcgctgtggctatggTT
PST01_0013_H03.b : nttttttcctgcgttggctatggTT
KDN01_0068_C06.b : nnnnggctgctgtggctctggTT
KDN01_0034_H07.b : nggttttnnnnnnncctgcgttggctatggTT
TES01_0062_E10.b : ttcccgcgtggctcggC
TES01_0067_E01.b : ttttactgctgtggctctgcT
PST01_0086_C05.b : nnncctgcgtggctcggcC
KDN01_0008_B07.b : aggggncctagcgtggctctggC
PCT01_0014_F06.b : nnnggcgtctnnnnnnncctgcgttggcactggT
TES01_0039_E09.b : tttttctgcgttgctctggT
TES01_0052_E06.b : nggggcctgcgtggctC
PST01_0076_E11.b : nnnnncctgaggtggctctgnT
PST01_0085_D02.b : nncctgcggtggcttggcC
PST01_0062_G03.b : tcgcgttggctcggC
BFLT1_0099_B02.b : nacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
MLN01_0006_G10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0070_E12.b : tttttgctgcggtggctct
PST01_0094_D03.b : nnnncctgcgtggctctggt
OVRM1_0080_G08.b : agttgatcaaagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0024_B10.b : ttttccgctgtggctc
OVRT1_0119_A09.b : gnatgttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcctat
LVRM1_0053_F06.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0081_D05.b : cgctgtg
LNG01_0002_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0004_G10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0154_D01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0189_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0101_F03.b : nacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0063_B03.b : tctgcgtaggagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0003_F08.b : nnnaactgcagt
BFLT1_0138_B01.b : tcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0052_F10.b : agctgtg
SPL01_0088_H11.b : nacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0010_D12.b : ttcgcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0017_F07.b :
OVRT1_0002_A07.b : tagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0053_B05.b : ntcgcgtg
TES01_0029_A04.b : ctttg
PST01_0035_F10.b : ttcctgctgtt
KDN01_0090_D02.b : nnnnncctgcgtg
PST01_0038_D05.b : ctggcgttg
KDN01_0068_B03.b : nnnnnggctgcgttg
PST01_0029_D05.b : ttttcctgctgtg
PST01_0088_B11.b : nnnncctgctgtt
KDN01_0055_B02.b : tagcgttg
PST01_0097_C03.b : nnnggtgctgtg
PST01_0026_G08.b : ntttcctgacgtg
OVRT1_0082_D12.b : gttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0089_H06.b : nnnncctgctgtg
ITT01_0033_E04.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0077_B03.b : nnnnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0056_E03.b : nnnnnggatgaacagcggtacggtxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0031_C07.b : nnnaattgtgttnnnnngccagcggtggcactggt
KDN01_0037_A07.b : ntttcctacgtggctacggct
TES01_0019_C02.b : cgcgttgg
PST01_0040_B09.b :
KDN01_0021_E09.b : tttttcccgctgtggc
PST01_0039_G07.b :
KDN01_0021_H06.b : nnnnnnncctgcgttgg
PST01_0020_F03.b :
BFLT1_0149_G09.b : ccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0058_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0114_C09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0009_C03.b : nnnnccgtcgctgacgagtgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0061_B11.b :
THY01_0096_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0075_B06.b : nnnncc
THY01_0108_F09.b : gttgcaaaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0185_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_B01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0028_D12.b : atttttggcaactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0058_E05.b : cgttgatcaaagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0203_H09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0122_C01.b : naaaccgttcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0053_A12.b : nnccgatagcggacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0008_H09.b : ttccgttcagctntangagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0083_B10.b : cgtctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0126_B09.b : nnnccctttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0081_E03.b : ncctacggtggctct
TES01_0043_E01.b : g
PST01_0022_C10.b : t
CLNT1_0150_B12.b : nncccctcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0019_B05.b : c
PST01_0062_C02.b : ttt
KDN01_0070_H10.b : nccc
TES01_0013_E03.b : nnnnnt
KDN01_0042_B04.b : nnnnnnggc
OVRT1_0055_D05.b : nnnnnnnccccttagcgttacgaggttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0076_F10.b : tggatccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0083_A03.b : tttnnnnnccccgttcgcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0065_C04.b : ctggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0070_C12.b : ntttac
TES01_0102_E10.b :
OVRM1_0060_G04.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0082_E05.b :
LNG01_0009_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0017_B12.b :
PTG01_0027_H03.b : nnnccagtannnnnnggagtaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0022_E04.b : nc
OVRT1_0016_D12.b : ttccgatagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0108_D06.b : nnnnccgtcagctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0031_F03.b : n
PST01_0077_F01.b : ttttcc
PST01_0099_A01.b : nnnggc
TES01_0009_A01.b : ttt
PST01_0089_D07.b : nnnnc
PST01_0059_C04.b : nnnnnc
PST01_0007_D04.b : nnggctttnnnnnnc
TES01_0054_E08.b : nttttc
KDN01_0098_F02.b : nnntttnnnnnnnnnc
PST01_0093_G10.b : nnnnnc
CLNT1_0043_C12.b : nttccgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0081_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0013_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0019_F06.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0185_E01.b : gagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0079_B12.b : cgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0047_C12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0051_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0099_E04.b : ntttcc
OVRT1_0118_C11.b : nnnnccgttctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0084_C08.b : cgtcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0110_D10.b : nnnccccgttcagcgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0004_G12.b : g
BFLT1_0075_A02.b : gggattcgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0080_H04.b : n
LNG01_0011_F12.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0051_D06.b : tc
UTR01_0047_D09.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0017_A04.b :
PBL01_0017_F04.b : gaagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0004_G07.b : nttgct
TES01_0015_E10.b : nnnnc
THY01_0091_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0094_H06.b : nnnn
PST01_0088_H03.b : nnnnggc
KDN01_0033_C03.b : tttttncctg
KDN01_0073_E10.b : nnnncct
KDN01_0010_E11.b : ncctttnnnnnnna
KDN01_0067_F02.b : nnnnncct
OVRT1_0059_C09.b : nnnnncctatagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0045_A03.b : nnnnncctcagcgnacgnatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0091_C07.b : tttttgct
PST01_0062_A11.b : nnngg
PST01_0099_F03.b : nnnaact
OVRT1_0082_A02.b : tnnnnnnccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0020_G06.b : tatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0100_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0051_E01.b : nnttgatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0096_F05.b : nnnncccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0219_F08.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0156_D09.b : agttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0104_D01.b : gtttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0221_H09.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0025_D09.b :
PBL01_0003_D12.b : gtgtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0175_C07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0174_D07.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0064_E05.b : c
OVRM1_0166_H10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0113_H08.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0152_E10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0197_E10.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0148_G01.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0133_G04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0225_E07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0016_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0209_H05.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0169_H04.b : gcgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0014_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0120_E06.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0103_D04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0072_A05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0112_G08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0041_A11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0018_D12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0012_D10.b : cagattgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0034_B07.b : tttt
THY01_0007_E02.b : gacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0065_A09.b : gcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0026_E09.b : ctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0061_B10.b : ttttagctaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0078_F09.b : tacanncggataaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0144_B10.b : nnnnnnnccgttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0006_A03.b : nnntttcgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0115_A10.b : nntttcgtttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0045_D10.b : aataac
OVRT1_0113_G02.b : nnnnccgtcagctgtagagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0116_E04.b : nnnnnccgacagcggaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0103_F12.b : naaaagataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0030_E10.b : gantacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0039_E05.b : nnnnccgtcagcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0011_G03.b : nnngggctaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0032_H03.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0076_B09.b : ggaacccgttagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0013_H04.b : nggatcttannntgataaagcagcggtaxxxxxxxxxxxxxxxxxxxxxx
KDN01_0069_F11.b : nn
THY01_0034_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0040_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0009_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0056_C05.b : ctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0061_C07.b : cttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0113_D06.b : nnnccccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0128_D02.b : nnnnccgttagctgtangagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0128_D07.b : nnnnccgtttagcgtangxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0084_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0008_A04.b : nnnttcgtctagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0100_A09.b : nnntttcttctgcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0095_G09.b : tnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0057_G08.b :
OVRT1_0057_B04.b : nnnnnnccgtcttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0099_B05.b : nnnaaagatggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0098_D12.b : ggggtccttctgcgcacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0007_A05.b : nnggcgtttnnnnn
PST01_0042_D09.b : nttcct
PST01_0052_H08.b : nnnncc
THY01_0207_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0086_H08.b : nnn
TES01_0054_B05.b :
OVRT1_0028_A12.b : nnnncnnccgttagcgttacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0093_B02.b : nnnncc
KDN01_0041_D12.b : tt
TES01_0012_G01.b : n
OVRT1_0013_D01.b : nnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0095_F01.b : ttt
PST01_0034_B02.b : nt
PST01_0036_C10.b : nn
PST01_0094_G04.b : nnncct
TES01_0049_E11.b : ttt
PST01_0052_B03.b : nn
KDN01_0096_H05.b : nnn
PST01_0088_D03.b : nnn
PST01_0092_H03.b : nnnaa
PST01_0071_H08.b : nnnn
PST01_0084_F06.b : nnnncc
OVRT1_0022_B01.b : nnnnnncccgttagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0080_F06.b : nnnaatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0012_A07.b : ctttnnnnnnn
PBL01_0068_G08.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0104_B01.b : ntt
CLNT1_0065_G10.b : ntttccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0010_D07.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0060_A10.b : nnnaatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0146_C04.b : nnnnnccgatagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0071_A04.b : nnnnnnnccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0048_D09.b : gggatggtatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0095_F03.b : nnaactgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0041_B05.b : nnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0100_B12.b : gacttccgttcagcgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0113_D04.b : nnnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0074_H05.b : nt
PST01_0063_G03.b : ntt
ITT01_0080_A08.b : nnnggtcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0032_E10.b : nnnngatgaacagctggtxxxxxxxxxxxxxxxxxxxxxx
TES01_0007_C06.b : ntttc
SPL01_0091_B01.b : ctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0006_H06.b : nnnaagagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0087_B03.b : nnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0068_D03.b : nnggggnacgttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0027_D07.b : ggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0056_E07.b : nttcggctaggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0011_B07.b : nngggtgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0083_A11.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0088_C11.b : t
KDN01_0073_F12.b : nn
TES01_0110_H05.b :
KDN01_0002_E08.b : nggcctttnnnnnnnncc
OVRM1_0082_H09.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0167_G02.b : ncgttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0010_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0057_D12.b : tt
TES01_0047_A09.b : agacagttg
KDN01_0050_E07.b : ttttat
TES01_0091_F01.b : ttttn
TES01_0091_E10.b : ntt
TES01_0019_G10.b :
TES01_0084_D06.b : t
PST01_0013_A02.b : ttttttt
PST01_0025_G01.b : nnnn
TES01_0002_E08.b : n
OVRT1_0120_A07.b : nnccgtttgcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0003_B12.b : nntt
PST01_0025_F02.b : tttt
LNG01_0022_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0055_E06.b :
PST01_0033_G06.b :
PST01_0079_H09.b : nn
PST01_0033_A07.b : n
TES01_0018_E03.b : t
PST01_0022_A01.b :
TES01_0023_C03.b :
PCT01_0021_E09.b : ngggcacttnnnnnn
KDN01_0024_G05.b : nttt
PST01_0072_C06.b : nnnn
PST01_0027_G11.b : nnn
PST01_0038_H05.b :
PST01_0007_F07.b : nggggncc
KDN01_0093_F05.b : nnnngg
PST01_0029_F01.b : tttttaa
PST01_0034_G06.b : naa
PST01_0019_E03.b : cttaatt
TES01_0041_A03.b : t
PST01_0014_E11.b : ttttattnt
PST01_0058_F03.b : nnnncctgc
KDN01_0078_D04.b : nn
KDN01_0085_D05.b : nnnn
PST01_0015_E01.b : gcttattnnnn
KDN01_0054_F11.b :
PST01_0007_C03.b : nnggctttnnnnn
PST01_0061_A04.b : n
PST01_0008_D07.b : nnngggttttnnnnnn
KDN01_0009_B04.b : nnnaattnnnnn
KDN01_0087_C11.b : ttt
KDN01_0023_B10.b : t
PST01_0088_B05.b : n
PST01_0024_A10.b : nn
PST01_0024_B02.b : ncc
KDN01_0082_D02.b : nn
OVRM1_0172_F02.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0055_E09.b : cgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0068_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0033_C03.b : naatcgatnnn
TES01_0112_B08.b : ttt
TES01_0022_F09.b :
PST01_0002_B04.b : cctccannnn
KDN01_0006_A05.b : nnnngg
THY01_0099_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0011_G04.b : nggctctnnnn
PCT01_0011_A09.b : nnggcttannnnnnnc
KDN01_0087_D01.b : nnnttg
PST01_0014_B06.b : nccttttnn
KDN01_0067_A12.b : nn
TES01_0027_C12.b :
OVRM1_0081_F08.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0067_H01.b : ttaactg
PST01_0009_C05.b : gtatnnnnnnncctgc
KDN01_0025_D12.b : ttt
KDN01_0033_B07.b : tttt
PST01_0012_B03.b : tttnnnnn
PST01_0053_A12.b : nnnn
ADR01_0093_C01.b : ccccnggatgaacxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0053_G11.b :
ADR01_0011_C07.b : nnnaatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0064_E01.b : nn
PST01_0026_D01.b : ttttnnn
THY01_0120_B12.b : gttgcaaaaacagctgtxxxxxxxxxxx
TES01_0001_C12.b :
OVRM1_0116_B01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0041_G05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0011_A09.b : tcatttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0072_D06.b :
TES01_0102_D03.b :
TES01_0010_E04.b :
TES01_0009_A11.b :
TES01_0026_B01.b :
KDN01_0091_E03.b : nnn
KDN01_0061_C03.b :
OVRT1_0003_B02.b : tttnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0022_E04.b :
KDN01_0029_E10.b :
LVRM1_0093_B09.b : cxxxxxxxxxxxxxxxxxxxxxxx
TES01_0077_G08.b :
TES01_0088_F01.b :
TES01_0085_H05.b :
OVRM1_0094_G06.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0099_B08.b :
TES01_0025_D03.b :
TES01_0006_C11.b :
TES01_0034_A11.b :
KDN01_0025_G04.b :
TES01_0050_H09.b : n
PST01_0029_D01.b :
PST01_0042_H12.b :
OVRM1_0173_A01.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0017_A02.b : gtgaaacaxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0100_C03.b : taattgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0047_H06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0172_F03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0116_H07.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0078_E11.b : cgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0031_A05.b : cactttgaggaactxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0083_D08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0083_F11.b : nggcttggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0118_H01.b : nnnccccttagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0105_C06.b :
PTG01_0018_D07.b : nnggctttttnnnnggcgtaagcagcxxxxxxxxxxxxxxxxxxx
SPL01_0055_H02.b : ntttcgataggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0101_F07.b : nnnnccgtctgctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0102_C12.b : nnnnggacgtaacaxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0149_D10.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0089_G01.b : nttccgttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0069_F01.b :
LVR01_0054_G10.b : aaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0111_D10.b : ttttttnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0058_G02.b :
OVRT1_0039_D08.b : gttttttnnnnnnnccctcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0056_A02.b : cttnnnnnnnnnnnacgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0057_A05.b :
OVRT1_0018_G12.b : ggttttnnnnnnnnccgttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0069_G08.b : gctttnnnnnnnnnccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0075_C09.b : nggaaccgttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0012_B05.b : naaacctttagctnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0046_G06.b : nnnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0107_A08.b : nnnnggcatgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0078_D08.b : nnnnggctgaacaxxxxxxxxxxxxxxxxxxxxxx
TES01_0086_G12.b : t
TES01_0058_C06.b :
BFLT1_0125_D10.b : nnnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0036_C11.b : nnnggtgaaacxxxxxxxxxxxxxxxxxxxx
PST01_0062_H02.b :
PST01_0074_F04.b :
LNG01_0019_A06.b : agctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0043_H03.b :
PST01_0077_H04.b :
PST01_0012_B07.b :
PST01_0009_H10.b :
PST01_0046_B03.b :
TES01_0041_G12.b :
PST01_0086_C01.b :
PST01_0032_G01.b :
KDN01_0033_A04.b :
PST01_0038_F03.b :
PST01_0015_D05.b :
PST01_0022_H09.b :
KDN01_0096_B04.b :
PST01_0095_F02.b :
PST01_0074_D10.b :
KDN01_0018_E04.b : nccctt
KDN01_0088_B07.b :
PST01_0010_H06.b : cctt
KDN01_0099_E09.b :
PST01_0099_A06.b :
PST01_0048_B12.b :
PST01_0082_E02.b :
TES01_0047_A04.b :
TES01_0055_D02.b :
PST01_0100_G09.b :
PST01_0027_H03.b :
KDN01_0043_C02.b :
TES01_0017_C03.b :
PST01_0016_H11.b : ggg
KDN01_0034_H12.b :
LVRM1_0135_E07.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0059_H03.b :
TES01_0031_H08.b :
PST01_0044_B07.b :
PCT01_0022_H02.b : nnnaac
BFLT1_0072_G07.b : gaatcgttaggcgtacgagtgxxxxxxxxxxxxxxxxxxxxx
TES01_0002_G02.b :
PST01_0020_D02.b :
TES01_0010_C01.b :
TES01_0077_C02.b :
TES01_0110_G03.b :
BFLT1_0101_E01.b : nntttgcctcagctgtcgxxxxxxxxxxxx
TES01_0081_G12.b :
OVRM1_0127_B01.b : nagttgtcxxxxxxxxxxxx
OVRT1_0133_E08.b : nnnaccctgcnnnnnnnnccgttcgcgttacgaggxxxxxxxxx
BFLT1_0054_A04.b : nnnggcggggnnggncctcgttagcgnacgxxxxxxxxxxxxxx
TES01_0011_D12.b :
BFLT1_0144_F03.b : nnttcaccgtcgctgtcgxxxxxxxxxxxxx
TES01_0078_E08.b :
TES01_0092_E05.b :
TES01_0025_D08.b :
LVRM1_0033_F02.b : cgttgtcxxxxxx
OVR01_0055_B10.b : nttgcttggactatnacxxxxxxxxxxxxxxx
OVRM1_0194_A11.b : agttgtcxxxxxx
ADR01_0047_A04.b : nttttaagagta
BFLT1_0051_A02.b : ggatccgtcagcgnacggaggxxx
BFLT1_0014_B06.b : nggatccgttagcgnacgxxxxxxxxxx
OVRT1_0066_E09.b : nnaaaccgtcagcgnacgxxxxxxxx
BFLT1_0039_G12.b : gattccgttcagcgtaggxxxxxxxx
BFLT1_0014_D01.b : gaactccgttagcggacgxxxxxxxx
TES01_0081_H11.b :
TES01_0101_F02.b :
TES01_0037_H11.b :
PCT01_0023_F06.b :
PST01_0003_C05.b :
PST01_0042_E06.b :
PST01_0019_F10.b :
KDN01_0024_B07.b :
TES01_0006_A08.b :
KDN01_0099_B10.b :
MLTL1_0099_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0053_G10.b :
KDN01_0045_G06.b :
PST01_0033_C12.b :
LVR01_0036_G04.b :
MLTL1_0009_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0036_C09.b :
PST01_0032_B07.b :
TES01_0094_F08.b :
TES01_0009_B03.b :
TES01_0054_H04.b :
LNG01_0108_F10.b :
KDN01_0052_G01.b :
TES01_0030_D01.b :
TES01_0018_A05.b :
TCH01_0041_A06.b :
LNG01_0017_E09.b :
TES01_0043_C06.b :
TES01_0108_D11.b :
TES01_0105_H06.b :
TES01_0012_C05.b :
TES01_0019_E04.b :
TES01_0068_E08.b :
MLN01_0037_D12.b :
BFLT1_0136_B10.b :
MLN01_0088_B08.b :
BFLT1_0133_A07.b :
AMP01_0073_H05.b :
MLN01_0009_G04.b :
---------+---------+---------+---------+---------+---------+ 142
TES01_0047_A09.b : gcacggaagagccccTTTCA***CCTTGTCC*CCCCC****AGC*TACTGCGG*CTTCTG
TES01_0033_C03.b : nccgcgtttgcacggaTTTC**ACCTTGT*****CCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0012_B03.b : ncctgcgttggctctggTTC**ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0053_G11.b : actgcgttggctatgggTC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
THY01_0120_B12.b : xxxxxxxxxxxxxxxxxxxA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0001_C12.b : tttattactgttgctatggA**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LNG01_0011_A09.b : xxxxxxxxxxxxxxxxxxxA**ACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0102_D03.b : ncctgctttggctctggggTT*ACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0010_E04.b : nnttggcgttggctactG**GACTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0009_A11.b : ttcctgctgtggctactgG**GACTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0026_B01.b : ncctgcggtggctactG**GACTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0091_E03.b : nnggctgcggtggctacggC**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0003_B02.b : xxxxxxxxxxxxxxxxxxgA**ACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LVRM1_0093_B09.b : xxxxxxxxxxxxxxxxxxxxxtACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0088_F01.b : nttcctgctgttgctactGACTTGTC**CCCCCCC**AGC*CAGCGCGG*CTTCTG
TES01_0085_H05.b : naactgctgtggctctggctggACCTTGTC***CCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0094_G06.b : xxxxxxxxxxxxxxxxxxxxxtACCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0099_B08.b : ttttactgcgtggctactggGACTTGTC**CCCCCCC**AGC*CAGCGCGG*CTTCTG
TES01_0006_C11.b : ttttggcgttggctatgACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0034_A11.b : ccgcgttggctctggACCTTGT****CCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0025_G04.b : nccctgcgttggctctggACCTTGT****CCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0050_H09.b : nnnaactgctgttgctatggggACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0029_D01.b : tagcggtggctatggACCTTGTC*****CCCCCCCGC*CAGCGCGG*CTTCTG
PST01_0042_H12.b : ttttgctcgctgtggctatggACCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0173_A01.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ADR01_0017_A02.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGT***CCCCCCCCTAGC*CAGCGCGG*CTTCTG
OVRM1_0100_C03.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0047_H06.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0172_F03.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
LVRM1_0116_H07.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRM1_0078_E11.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRM1_0031_A05.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
OVRM1_0083_D08.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCCAGC*CAGCGCGG*CTTCTG
SPL01_0083_F11.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0118_H01.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0105_C06.b : tttccctgctgtggctactggACTTGTC***CCCCCCCAAGC*CAGCGCGG*CTTCTG
PTG01_0018_D07.b : xxxxxxxxxxxxxxxxxxxxxggCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
SPL01_0055_H02.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0101_F07.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0102_C12.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0089_G01.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0069_F01.b : tttgctacgttggctatgnaACTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LVR01_0054_G10.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0111_D10.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0058_G02.b : tttttgctgcgttggctatgnAACCCTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0039_D08.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0056_A02.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0057_A05.b : nntttcctactgtggctactggACTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0018_G12.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0069_G08.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0075_C09.b : xxxxxxxxxxxxxxxxxxcccttCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0012_B05.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
OVRT1_0046_G06.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
UTR01_0107_A08.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ITT01_0078_D08.b : xxxxxxxxxxxxxxxxxxxxxxxCCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0086_G12.b : taatctgcgttggctctgctgggtCTTGT***CCCCCCCCAAGC*CAGCGCGG*CTTCTG
BFLT1_0125_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTGTCC*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
ADR01_0036_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTGTC**CCCCTCCCAAGC*CAGCGCGG*CTTCTG
PST01_0074_F04.b : attacctgctgttgctatgaaCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
LNG01_0019_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0043_H03.b : nnttgctcgctgtggctactGGACTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0077_H04.b : ttttcctgcagtggctactGGACTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0012_B07.b : tattnnnnncctgcgttggctactGGACTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0009_H10.b : nttttnccctgcgttggctactGGACTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0046_B03.b : ntttttcctacggttgctatggaCTTGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0032_G01.b : nnnaactgcgttggctactGGACTTG*TCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0033_A04.b : nnntttggctgcggtggctctGGACTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0038_F03.b : nnaatggctgtggctactggaACTTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0015_D05.b : ttgggttaatcacgttggctactggACTTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0022_H09.b : ttttcctcgcgttggctactggACTTGT*CCCCCCCCAAGC*TAGCGCGG*CTTCTG
KDN01_0096_B04.b : nnnncctgctgtggctatggACTTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0095_F02.b : nnnnggctgcgtttgctactggACTTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0074_D10.b : ntttcctgagtttgctactggACTTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0018_E04.b : tcttnnnnncctgcgttggctctggACCTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0088_B07.b : nnnnnggctacgtttgctactggACTTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0010_H06.b : tctnnnnncctgcgttggctactggACTTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0099_E09.b : nnnnggctgcggtggctactggACTTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0099_A06.b : nnnncctgacgtggctactggACTTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0048_B12.b : nnnnggctacggtggctactggACTTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0082_E02.b : ttttgctgaggttgctatggACTTGT*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0055_D02.b : tttgncctacgtttgctatggaACTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0100_G09.b : nnttcctgcggtggctactggaACTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0027_H03.b : nnaactgctgtggctatgatCCTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
KDN01_0043_C02.b : nnnnncccgctgtggctactggACTTGTCCCCCCCCAAGC*CAGCGCGG*CTTCTG
PST01_0016_H11.b : tttnnnnnngctgcgttggctactggACTTGTCCCCCCCCAAGC*CAGCGCGG*CTTCTG
KDN01_0034_H12.b : nttttgctgacgttgctctggaACTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
LVRM1_0135_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGTC**CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0059_H03.b : nnnnncctacgtttgctatggGTCC*CCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0031_H08.b : gctttggctctggaaCTT**GTCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0044_B07.b : ttttggctacggtggctatggatCTTG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
PCT01_0022_H02.b : ttttnnnnnnncctgcgttggctctggcTG**TCCCCCCCCAGC*CAGCGCGG*CTTCTG
BFLT1_0072_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxcgTGTCCCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0002_G02.b : tttcctgctgtggctatgCTTGTCCCCCCCAGC*CAGCGCGG*CTTCTG
PST01_0020_D02.b : ttttttnnntncctgcgttggctctggTG*TCCCCCCCAAGC*CAGCGCGG*CTTCTG
TES01_0010_C01.b : nntctacgttggctactggaCTTGTCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0077_C02.b : ncccctgtggctatggggaG*TCCCCCCCCAGC*CAGCGCGG*CTTCTG
TES01_0110_G03.b : ttccgcttttgctatggctgnCCCCCCCAGC*CAGCGCGG*CTTCTG
BFLT1_0101_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggCAGC*CAGCGCGG*CTTCTG
OVRM1_0127_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC*CAGCGCGG*CTTCTG
OVRT1_0133_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC*CAGCGCGG*CTTCTG
BFLT1_0054_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGC*CAGCGCGG*CTTCTG
TES01_0011_D12.b : ttttcgcgttggctcT*GGACGCGG*CTTCTG
BFLT1_0144_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgatC*CAGCGCGG*CTTCTG
TES01_0078_E08.b : ttttaatgctgttgctatggagCAGCGCGG*CTTCTG
TES01_0092_E05.b : ttttcctgctgttgctatggagCAGCGCGG*CTTCTG
TES01_0025_D08.b : gtgagccGCGCGG*CTTCTG
LVRM1_0033_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGCGG*CTTCTG
OVR01_0055_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGCGG*CTTCTG
OVRM1_0194_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGCGG*CTTCTG
ADR01_0047_A04.b : acaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGCGG*CTTCTG
BFLT1_0051_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGCGG*CTTCTG
BFLT1_0014_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGCGG*CTTCTG
OVRT1_0066_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcggtGCGCGG*CTTCTG
BFLT1_0039_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGCGG*CTTCTG
BFLT1_0014_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGCGG*CTTCTG
TES01_0081_H11.b : gttggctctggtggaCGCGG*CTTCTG
TES01_0101_F02.b : tttcctgcgttgctatggaCGCGG*CTTCTG
TES01_0037_H11.b : tttggctctggaCGCGG*CTTCTG
PCT01_0023_F06.b : nnnnggcattttnnnnnnncctacggtgtgcacggnaCGCGG*CTTCTG
PST01_0003_C05.b : ttttcctcacggtggccactggaCGCGG*CTTCTG
PST01_0042_E06.b : nnncctgacgatggctatggaCGCGG*CTTCTG
PST01_0019_F10.b : gcgttggctatggaCGCGG*CTTCTG
KDN01_0024_B07.b : nnnnnccggctgtggctctggaCGCGG*CTTCTG
TES01_0006_A08.b : tttttcgctgttgctatggaCGCGG*CTTCTG
KDN01_0099_B10.b : nttttgctgctgttgctatggaCGCGG*CTTCTG
MLTL1_0099_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTCTG
TES01_0053_G10.b : ccttctaG
KDN01_0045_G06.b : cccttttacaG
PST01_0033_C12.b : ntggcgttggctatggggcttcG
LVR01_0036_G04.b : ctccaagcctgctggcttacttgg
MLTL1_0009_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0036_C09.b :
PST01_0032_B07.b :
TES01_0094_F08.b :
TES01_0009_B03.b :
TES01_0054_H04.b :
LNG01_0108_F10.b :
KDN01_0052_G01.b :
TES01_0030_D01.b :
TES01_0018_A05.b :
TCH01_0041_A06.b :
LNG01_0017_E09.b :
TES01_0043_C06.b :
TES01_0108_D11.b :
TES01_0105_H06.b :
TES01_0012_C05.b :
TES01_0019_E04.b :
TES01_0068_E08.b :
MLN01_0037_D12.b :
BFLT1_0136_B10.b :
MLN01_0088_B08.b :
BFLT1_0133_A07.b :
AMP01_0073_H05.b :
MLN01_0009_G04.b :
---------+---------+---------+---------+---------+---------+ 198
PCT01_0036_C09.b : nnnngggcatatannnnnncctacgttggccacgggcaTTCTCTTCCCTCCTTCC*TC
PST01_0032_B07.b : ncctgcggtggcactggattttcCTTCCCTCCTTCC*TC
TES01_0094_F08.b : nttttnctacagtggctatggatttcCTTCCTCCTTCCCTC
TES01_0009_B03.b : nnnnttgacgtggctctggatttctcttCCTCCTTCCCTC
TES01_0054_H04.b :
LNG01_0108_F10.b : nnnnncctagtacttgacagtttgtcxxxxxxxxxxxxxxxxxx
KDN01_0052_G01.b :
TES01_0030_D01.b :
TES01_0018_A05.b :
TCH01_0041_A06.b :
LNG01_0017_E09.b :
TES01_0043_C06.b :
TES01_0108_D11.b :
TES01_0105_H06.b :
TES01_0012_C05.b :
TES01_0019_E04.b :
TES01_0068_E08.b :
MLN01_0037_D12.b :
BFLT1_0136_B10.b :
MLN01_0088_B08.b :
BFLT1_0133_A07.b :
AMP01_0073_H05.b :
MLN01_0009_G04.b :
---------+---------+---------+---------+---------+---------+ 258
TES01_0054_H04.b : nactgcgttggctcgaattccctgccTGGCCTTACTCACTGCGGCCGCCCGGCTCTTC
LNG01_0108_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtatggCTGCGGCCGCCCGGCTCTTC
KDN01_0052_G01.b : ggggtgaaggagtgctactcgcctttattg
TES01_0030_D01.b :
TES01_0018_A05.b :
TCH01_0041_A06.b :
LNG01_0017_E09.b :
TES01_0043_C06.b :
TES01_0108_D11.b :
TES01_0105_H06.b :
TES01_0012_C05.b :
TES01_0019_E04.b :
TES01_0068_E08.b :
MLN01_0037_D12.b :
BFLT1_0136_B10.b :
MLN01_0088_B08.b :
BFLT1_0133_A07.b :
AMP01_0073_H05.b :
MLN01_0009_G04.b :
---------+---------+---------+---------+---------+---------+ 318