[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-001853

Length: 1,250

Sequence [FASTA format sequence]
TGGGCGGCAG CCACAGAGCG TTCTGTCGGC GGAGCCCGGG CGCGGGGTCC CTATAAAAGG
TAGCCGAGGT GGGGGCGCGC GCGCAAAAGA CGCAAACCGT TGTTGCGGCG GTTGTGGGCT
GCTGCGAAAT CGTCTGCCTG GCATCCGGGA GCGTCGCCGA GCCCACAGCG CCGCCAACAT
GGAGCCGGAA CCCGAGCCCG TCACGCTCCT GGTGAAGAGC CCCAACCAGC GCCATCGCGA
CTTGGAGCTG AGCGGCGACC GCAGCTGGAG CGTGGGCCGC CTCAAGGCCC ATCTGAGCCG
CGTCTACCCC GAGCGCCCGC GTCCAGAGGA CCAGAGGTTA ATTTATTCCG GGAAGCTGTT
GTTGGATCAC CAGTGTCTCA GGGACTTGCT TCCCAAGCAG GAAAAACGAC ATGTTTTGCA
TCTGGTGTGC AGTGTGAAGA GTCCTTCAAA AATACCAGAA GCTAGCACAA AGGTTGCTGA
ATCCAGAGAA CAGCCCGCCG GTCTTAATCA GGGACCGTCT CCTGGGGATT CCTCAAGTGA
TGGTTTAAGG CAAAGGGAGG TTGTTCGGAA CCCTTCTCCC TCTGGATGGG AGAACATCTC
CAGGTCAGAC GCTGCCCAGC TGGCATTCCA AGGCCTGGGG CCTGGTTTCT CAGGCTACAC
AACGTACGGA TGGCTGCAGC TCTCCTGGTT CCAGCAGATG TATGCACGGC AGTACTACAT
GCAGTATTTA GCAGCCACTG CTGCGTCAGG GGCTTTCGTC CCCTCTCCAA GTGCACAAGA
GATACCTGTG GTCTCTGCAC CCGCTCCAGC CCCTATCCAC AACCAGTTTC CAGCTGAAAA
CCAGCCAGCC AATCAGAATG CTGCTCCTCA AGTGGTGGTT AATCCTGGGG CCAATCAGAA
TTTGCGGATG AATGCACAAG GTGGCCCTAT TGTGGAAGAA GATGATGAGA TAAATCGAGA
TTGGTTGGAT TGGACCTATT CAGCAGCTAC ATTTTCTGTT TTTCTCTGTA TCCTCTACTT
CTACTCTTCC CTGAGCAGAT TCCTCATGGT CATGGGGGCC ACCATTGTTA TGTACCTGCA
TCACGTTGGG TGGGTTTCCG TTTCGACAGA GGCCAGTTCA GAACTTGCCC AACGATGGTC
CTCCTCAGGA AGCTGTGAAC CAGGACCCCA ACAATAACTT CCAGGAAGGC CCCGATCCTG
AAATCGAAGA CCCCAACCAC CTGCCTCCAA AAAGGGACGT ACTGGATGAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHERPUD1homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 1 protein isoform 1 [Homo sapiens]. 434e-145O
Contig/Assembly ProteinHERPUD1homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 1 protein isoform 2 [Homo sapiens]. 428e-143O
Contig/Assembly ProteinHERPUD1homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 1 protein isoform 3 [Homo sapiens]. 379e-128O
Contig/Assembly ProteinHERPUD2homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 2 protein [Homo sapiens]. 1633e-40O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHerpud1homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 1 protein [Mus musculus]. 438e-143O
Contig/Assembly ProteinHerpud2homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 2 protein [Mus musculus]. 1664e-41O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC478116PREDICTED: similar to Homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 1 protein (Methyl methanesulfonate (MMF)-inducible fragment protein 1) isoform 2 [Canis familiaris]. 444e-150O
Contig/Assembly ProteinLOC478116PREDICTED: similar to homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 isoform 3 [Canis familiaris]. 2163e-56O
Contig/Assembly ProteinLOC478116PREDICTED: similar to Homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 1 protein (Methyl methanesulfonate (MMF)-inducible fragment protein 1) isoform 1 [Canis familiaris]. 1876e-73O
Contig/Assembly ProteinLOC475283PREDICTED: similar to CG14536-PA, isoform A isoform 1 [Canis familiaris]. 1657e-41O
Contig/Assembly ProteinLOC475283PREDICTED: similar to CG14536-PA, isoform A isoform 2 [Canis familiaris]. 93.64e-19O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHERPUD1homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 1 protein [Bos taurus]. 445e-147O
Contig/Assembly ProteinHERPUD2homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 2 protein [Bos taurus]. 1624e-40O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100622579PREDICTED: homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 1 protein-like, partial [Sus scrofa]. 2512e-95O
Contig/Assembly ProteinLOC100524292PREDICTED: homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 2 protein-like [Sus scrofa]. 1663e-41O
Contig/Assembly ProteinLOC100626017PREDICTED: homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 1 protein-like, partial [Sus scrofa]. 1371e-32O


Assembly Members: 504      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010011G03ADR01_0011_G03.bDB782527 
ADR010026H11ADR01_0026_H11.bDB783831 
ADR010028E06ADR01_0028_E06.bDB783969 
ADR010045B12ADR01_0045_B12.bDB785476 
ADR010047C10ADR01_0047_C10.bDB785667 
ADR010055D06ADR01_0055_D06.bDB786393 
ADR010055E11ADR01_0055_E11.bDB786408 
ADR010060D10ADR01_0060_D10.bDB786851 
ADR010062H07ADR01_0062_H07.bDB787071 
ADR010064F08ADR01_0064_F08.bDB787224 
ADR010071C04ADR01_0071_C04.bDB787790 
ADR010078F09ADR01_0078_F09.bDB788460 
ADR010095B06ADR01_0095_B06.bDB789916 
ADR010097G07ADR01_0097_G07.bDB790155 
BFLT10001F12BFLT1_0001_F12.bFS640060 
BFLT10002G04BFLT1_0002_G04.bFS640149 
BFLT10010A11BFLT1_0010_A11.bFS640763 
BFLT10011C07BFLT1_0011_C07.bFS640861 
BFLT10015C05BFLT1_0015_C05.bFS641197 
BFLT10015F05BFLT1_0015_F05.bFS641230 
BFLT10019B03BFLT1_0019_B03.bFS641512 
BFLT10021B03BFLT1_0021_B03.bFS641680 
BFLT10021F04BFLT1_0021_F04.bFS641723 
BFLT10023E06BFLT1_0023_E06.bFS641881 
BFLT10028B09BFLT1_0028_B09.bFS642261 
BFLT10029C03BFLT1_0029_C03.bFS642350 
BFLT10030E03BFLT1_0030_E03.bFS642451 
BFLT10035H12BFLT1_0035_H12.bFS642903 
BFLT10039B06BFLT1_0039_B06.bFS643156 
BFLT10039E12BFLT1_0039_E12.bFS643195 AK390218
BFLT10041A05BFLT1_0041_A05.bFS643303 
BFLT10056B08BFLT1_0056_B08.bFS644414 
BFLT10056G09BFLT1_0056_G09.bFS644460 
BFLT10057C07BFLT1_0057_C07.bFS644501 
BFLT10058F10BFLT1_0058_F10.bFS644615 
BFLT10058H03BFLT1_0058_H03.bFS644632 
BFLT10063F09BFLT1_0063_F09.bFS645023 
BFLT10075D12BFLT1_0075_D12.bFS645943 
BFLT10076G10BFLT1_0076_G10.bFS646021 
BFLT10077C09BFLT1_0077_C09.bFS646057 
BFLT10080C09BFLT1_0080_C09.bFS646310 
BFLT10091B02BFLT1_0091_B02.bFS647198 
BFLT10096A12BFLT1_0096_A12.bFS647616 
BFLT10100F08BFLT1_0100_F08.bFS648001 
BFLT10111G09BFLT1_0111_G09.bHX202674 
BFLT10115G03BFLT1_0115_G03.bHX203006 
BFLT10141H08BFLT1_0141_H08.bHX204970 
BFLT10149C03BFLT1_0149_C03.bHX205391 
BMWN10098H07BMWN1_0098_H07.b  
CBLT10036G09CBLT1_0036_G09.b  
CBLT10039B01CBLT1_0039_B01.bHX214493 
CLNT10005H07CLNT1_0005_H07.bFS657473 
CLNT10006A02CLNT1_0006_A02.bFS657480 
CLNT10007E08CLNT1_0007_E08.bFS657605 
CLNT10007F07CLNT1_0007_F07.bFS657614 
CLNT10013B03CLNT1_0013_B03.bFS658072 
CLNT10020F10CLNT1_0020_F10.bFS658653 
CLNT10033A04CLNT1_0033_A04.bFS659608 
CLNT10037A04CLNT1_0037_A04.bFS659908 
CLNT10038D09CLNT1_0038_D09.bFS660028 
CLNT10059E07CLNT1_0059_E07.bFS661718 
CLNT10061E08CLNT1_0061_E08.bFS661887 
CLNT10062E08CLNT1_0062_E08.bFS661960 
CLNT10064A04CLNT1_0064_A04.bFS662066 
CLNT10066G09CLNT1_0066_G09.bFS662288 
CLNT10069C11CLNT1_0069_C11.bFS662502 
CLNT10071B01CLNT1_0071_B01.bFS662646 
CLNT10072H03CLNT1_0072_H03.bFS662793 
CLNT10073G11CLNT1_0073_G11.bFS662867 
CLNT10075F12CLNT1_0075_F12.bFS663027 
CLNT10077A04CLNT1_0077_A04.b  
CLNT10082G11CLNT1_0082_G11.b  
CLNT10086B02CLNT1_0086_B02.bFS663226 
CLNT10090D09CLNT1_0090_D09.bFS663557 
CLNT10114C01CLNT1_0114_C01.bHX220217 
CLNT10117F09CLNT1_0117_F09.bHX220480 
CLNT10119F11CLNT1_0119_F11.bHX220638 
CLNT10125F02CLNT1_0125_F02.bHX221090 
CLNT10125H02CLNT1_0125_H02.bHX221110 
CLNT10127F11CLNT1_0127_F11.bHX221244 
CLNT10128H05CLNT1_0128_H05.bHX221335 
CLNT10129D11CLNT1_0129_D11.bHX221380 
CLNT10130C12CLNT1_0130_C12.bHX221443 
CLNT10138H06CLNT1_0138_H06.bHX222100 
CLNT10140H06CLNT1_0140_H06.bHX222257 
CLNT10142B04CLNT1_0142_B04.bHX222362 
CLNT10144H02CLNT1_0144_H02.bHX222572 
CLNT10146A02CLNT1_0146_A02.bHX222659 
CLNT10146G05CLNT1_0146_G05.bHX222722 
CLNT10151D06CLNT1_0151_D06.bHX223085 
CLNT10151F11CLNT1_0151_F11.bHX223111 
CLNT10151H04CLNT1_0151_H04.bHX223126 
ITT010015B08ITT01_0015_B08.bBW977331 
ITT010034D10ITT01_0034_D10.bBW979061 
ITT010040A10ITT01_0040_A10.bBW979571 
ITT010043E06ITT01_0043_E06.bBW979882 
ITT010054H05ITT01_0054_H05.bBW980837 
ITT010058G06ITT01_0058_G06.bBW981187 
ITT010065C05ITT01_0065_C05.bBW981766 
ITT010074H10ITT01_0074_H10.bBW982637 
KDN010009A02KDN01_0009_A02.bFS671837 
KDN010022B09KDN01_0022_B09.bFS672825 
KDN010023G06KDN01_0023_G06.bFS672953 
KDN010024H12KDN01_0024_H12.b  
KDN010034A08KDN01_0034_A08.bFS673761 
KDN010037G08KDN01_0037_G08.b  
KDN010044D12KDN01_0044_D12.bFS674279 
KDN010049H09KDN01_0049_H09.bFS674486 
KDN010056F04KDN01_0056_F04.bFS674909 
KDN010058F04KDN01_0058_F04.bFS675064 
KDN010066D06KDN01_0066_D06.bFS675696 
KDN010069C10KDN01_0069_C10.bFS675916 
KDN010073C06KDN01_0073_C06.bFS676231 
KDN010080C07KDN01_0080_C07.bFS676787 
KDN010080F11KDN01_0080_F11.bFS676818 
KDN010081H10KDN01_0081_H10.bFS676914 
KDN010085B12KDN01_0085_B12.bFS677167 
KDN010094D06KDN01_0094_D06.bFS677913 
KDN010096B01KDN01_0096_B01.bFS678056 
KDN010098C05KDN01_0098_C05.bFS678215 
LNG010004E12LNG01_0004_E12.bBP437863 
LNG010006F02LNG01_0006_F02.bBP438042 
LNG010010D12LNG01_0010_D12.bBP436841 
LNG010025D02LNG01_0025_D02.bBP436041 
LNG010056F12LNG01_0056_F12.bBP438910 
LNG010069C07LNG01_0069_C07.bBP435491 
LNG010071F01LNG01_0071_F01.bBP438003 
LNG010074E03LNG01_0074_E03.bBP437143 
LNG010081D01LNG01_0081_D01.bBP435998 AK232113
LNG010084A12LNG01_0084_A12.bBP433958 
LVR010003E09LVR01_0003_E09.bBP445128 
LVR010009F10LVR01_0009_F10.bBP446089 
LVR010020B01LVR01_0020_B01.bBP441874 
LVR010021G04LVR01_0021_G04.bBP446556 
LVR010025F11LVR01_0025_F11.bBP446177 
LVR010028C02LVR01_0028_C02.bBP442881 
LVR010029D09LVR01_0029_D09.bBP444283 
LVR010036H08LVR01_0036_H08.b  
LVR010046G12LVR01_0046_G12.bBP447167 
LVR010051C06LVR01_0051_C06.bBP443200 
LVR010052G08LVR01_0052_G08.bBP446872 
LVR010054F05LVR01_0054_F05.bBP445766 
LVR010055G05LVR01_0055_G05.bBP446660 
LVR010055H05LVR01_0055_H05.bBP447567 
LVR010059B05LVR01_0059_B05.bBP442217 
LVR010060E06LVR01_0060_E06.bBP444972 
LVR010061D08LVR01_0061_D08.bBP444233 
LVR010061E07LVR01_0061_E07.bBP445032 
LVR010071G09LVR01_0071_G09.bBP446957 
LVR010079G10LVR01_0079_G10.bBP447041 
LVR010081D05LVR01_0081_D05.bBP444040 
LVR010090D03LVR01_0090_D03.bCJ000634 
LVR010091B07LVR01_0091_B07.bCJ000694 
LVR010091C06LVR01_0091_C06.bCJ000705 
LVR010091D07LVR01_0091_D07.bBW962753 
LVR010092B08LVR01_0092_B08.bCJ000772 
LVR010092C06LVR01_0092_C06.bCJ000781 
LVR010092E05LVR01_0092_E05.bCJ000804 
LVR010102H08LVR01_0102_H08.bBP447827 
LVR010104H05LVR01_0104_H05.bBP447597 
LVRM10002F09LVRM1_0002_F09.bBP140122 
LVRM10003B02LVRM1_0003_B02.bCJ001002 
LVRM10005C03LVRM1_0005_C03.bBP138497 
LVRM10007C07LVRM1_0007_C07.bBP138653 
LVRM10009D02LVRM1_0009_D02.bBP138943 
LVRM10010B07LVRM1_0010_B07.bBP138192 
LVRM10010G10LVRM1_0010_G10.bBP140625 
LVRM10011E08LVRM1_0011_E08.bBP451847 
LVRM10019C08LVRM1_0019_C08.bBP138698 
LVRM10019H04LVRM1_0019_H04.bBP140873 
LVRM10022E09LVRM1_0022_E09.bBP139665 
LVRM10023E02LVRM1_0023_E02.bBP139414 
LVRM10024E07LVRM1_0024_E07.bBP139597 
LVRM10026F10LVRM1_0026_F10.bBP140174 
LVRM10028E06LVRM1_0028_E06.bBP139561 
LVRM10032G08LVRM1_0032_G08.bBP140562 
LVRM10034H10LVRM1_0034_H10.bCJ001376 
LVRM10035F11LVRM1_0035_F11.bCJ001442 
LVRM10035G07LVRM1_0035_G07.bCJ001449 
LVRM10039B10LVRM1_0039_B10.bCJ001734 
LVRM10040E03LVRM1_0040_E03.bCJ001837 
LVRM10044D07LVRM1_0044_D07.bCJ002167 
LVRM10045H04LVRM1_0045_H04.bBW962904 
LVRM10047B09LVRM1_0047_B09.bCJ002280 
LVRM10053A10LVRM1_0053_A10.bBP137849 
LVRM10066F10LVRM1_0066_F10.bBP140190 
LVRM10071D03LVRM1_0071_D03.bBP450690 
LVRM10076D10LVRM1_0076_D10.bBP139288 
LVRM10077G01LVRM1_0077_G01.bBP140309 
LVRM10078B08LVRM1_0078_B08.bBP138268 
LVRM10080C08LVRM1_0080_C08.bBP138730 
LVRM10081F04LVRM1_0081_F04.bBW962939 
LVRM10081F12LVRM1_0081_F12.bCJ002481 
LVRM10081H12LVRM1_0081_H12.bBW962940 
LVRM10082H07LVRM1_0082_H07.bBW962945 
LVRM10085D04LVRM1_0085_D04.bCJ002796 
LVRM10085D09LVRM1_0085_D09.bCJ002801 
LVRM10091D10LVRM1_0091_D10.bCJ003293 
LVRM10091G06LVRM1_0091_G06.bCJ003324 
LVRM10092D03LVRM1_0092_D03.bBW962992 
LVRM10099E10LVRM1_0099_E10.bBW963075 
LVRM10100D04LVRM1_0100_D04.bCJ004014 
LVRM10103E02LVRM1_0103_E02.bBP451467 
LVRM10103H12LVRM1_0103_H12.bBP454592 
LVRM10104E09LVRM1_0104_E09.bBP451923 
LVRM10109F05LVRM1_0109_F05.bBP452457 
LVRM10110C10LVRM1_0110_C10.bBP450351 
LVRM10111F05LVRM1_0111_F05.bBP452459 
LVRM10114C08LVRM1_0114_C08.bBP450210 
LVRM10115C02LVRM1_0115_C02.bBP449800 
LVRM10121A01LVRM1_0121_A01.bBP448169 
LVRM10122H09LVRM1_0122_H09.bBP454398 
LVRM10123C05LVRM1_0123_C05.bBP450010 
LVRM10130H11LVRM1_0130_H11.bBP454550 
LVRM10134D12LVRM1_0134_D12.bBP451367 
LVRM10136F02LVRM1_0136_F02.bBP452283 
LVRM10137F08LVRM1_0137_F08.bBP452686 
LVRM10138C04LVRM1_0138_C04.bBP449954 
LVRM10141F10LVRM1_0141_F10.bBP452832 
LVRM10142F12LVRM1_0142_F12.bBP452961 
LVRM10143C09LVRM1_0143_C09.b  
LVRM10145B08LVRM1_0145_B08.bBP449447 
LVRM10145G10LVRM1_0145_G10.bBP453656 
LVRM10148F04LVRM1_0148_F04.bBP452426 
LVRM10154G07LVRM1_0154_G07.bBP453447 
LVRM10161F09LVRM1_0161_F09.bBP452780 
LVRM10166C02LVRM1_0166_C02.bCJ004321 
LVRM10166G05LVRM1_0166_G05.bCJ004365 
LVRM10171F01LVRM1_0171_F01.bCJ004748 
LVRM10172F10LVRM1_0172_F10.bCJ004838 
LVRM10178E08LVRM1_0178_E08.bCJ005286 
LVRM10181A05LVRM1_0181_A05.bBW963187 
LVRM10181D04LVRM1_0181_D04.bBW963189 
LVRM10185C01LVRM1_0185_C01.bCJ005846 
LVRM10194C10LVRM1_0194_C10.bBW963291 
LVRM10194H10LVRM1_0194_H10.bBW963295 
LVRM10195B08LVRM1_0195_B08.bCJ006572 
LVRM10198B08LVRM1_0198_B08.bCJ006831 
LVRM10199E12LVRM1_0199_E12.bCJ006952 
LVRM10205B08LVRM1_0205_B08.bCJ007408 
LVRM10205D03LVRM1_0205_D03.bCJ007426 
MLN010063B11MLN01_0063_B11.bCJ012582 
OVR010001H09OVR01_0001_H09.b  
OVR010006E01OVR01_0006_E01.bBP143037 
OVR010009F07OVR01_0009_F07.b  
OVR010028D04OVR01_0028_D04.bBP142719 
OVR010040F11OVR01_0040_F11.bBP143887 
OVR010058F09OVR01_0058_F09.bBW964807 
OVR010064D06OVR01_0064_D06.bBW965316 
OVR010066F10OVR01_0066_F10.bBW965518 
OVR010069B03OVR01_0069_B03.bBW965737 
OVR010077E02OVR01_0077_E02.bBW966472 
OVR010081D01OVR01_0081_D01.bBW966755 
OVR010090F06OVR01_0090_F06.b  
OVR010100F12OVR01_0100_F12.bBW968165 
OVRM10003C01OVRM1_0003_C01.bBP147409 
OVRM10010F12OVRM1_0010_F12.bBP152278 
OVRM10014D11OVRM1_0014_D11.bBP149712 
OVRM10021C11OVRM1_0021_C11.bBP148442 
OVRM10025F11OVRM1_0025_F11.bBP152189 
OVRM10034C08OVRM1_0034_C08.bBP148125 
OVRM10036E08OVRM1_0036_E08.bBP150628 
OVRM10048D10OVRM1_0048_D10.bBP458216 
OVRM10049A03OVRM1_0049_A03.bBW968541 
OVRM10057G05OVRM1_0057_G05.bBP152812 
OVRM10058G05OVRM1_0058_G05.bBP152813 
OVRM10062B06OVRM1_0062_B06.bBP146691 
OVRM10075A03OVRM1_0075_A03.bBP145088 
OVRM10083C09OVRM1_0083_C09.bBP148266 
OVRM10084B11OVRM1_0084_B11.bBP147255 
OVRM10091B01OVRM1_0091_B01.bBP146193 
OVRM10092C05OVRM1_0092_C05.bBP147853 
OVRM10093A12OVRM1_0093_A12.bBP146093 
OVRM10098H11OVRM1_0098_H11.bBP154845 
OVRM10105E03OVRM1_0105_E03.bBP150183 
OVRM10107F12OVRM1_0107_F12.bBP152354 
OVRM10108E10OVRM1_0108_E10.bBP150893 
OVRM10128A12OVRM1_0128_A12.bBP146124 
OVRM10150E03OVRM1_0150_E03.bBP458628 
OVRM10158H03OVRM1_0158_H03.bBP461548 
OVRM10163D10OVRM1_0163_D10.bBP458233 
OVRM10170C05OVRM1_0170_C05.bBP456878 
OVRM10172B06OVRM1_0172_B06.bBP456001 
OVRM10174B09OVRM1_0174_B09.bBP456251 
OVRM10193D05OVRM1_0193_D05.bBP457849 
OVRM10194H01OVRM1_0194_H01.bBP461413 
OVRM10196E11OVRM1_0196_E11.bBP459291 
OVRM10218E12OVRM1_0218_E12.bBP459389 
OVRT10003B09OVRT1_0003_B09.bFS686601 
OVRT10004A11OVRT1_0004_A11.bFS686672 
OVRT10006B04OVRT1_0006_B04.bFS686845 
OVRT10006G04OVRT1_0006_G04.bFS686898 
OVRT10009E06OVRT1_0009_E06.bFS687136 
OVRT10012F11OVRT1_0012_F11.bFS687395 
OVRT10013B01OVRT1_0013_B01.bFS687431 
OVRT10013B11OVRT1_0013_B11.bFS687439 
OVRT10013D03OVRT1_0013_D03.bFS687452 
OVRT10028H02OVRT1_0028_H02.bFS688718 
OVRT10029D07OVRT1_0029_D07.bFS688758 
OVRT10030F11OVRT1_0030_F11.bFS688856 
OVRT10032G02OVRT1_0032_G02.bFS689017 
OVRT10033A07OVRT1_0033_A07.bFS689043 
OVRT10035C11OVRT1_0035_C11.bFS689236 
OVRT10035H01OVRT1_0035_H01.bFS689283 
OVRT10038G01OVRT1_0038_G01.bFS689526 
OVRT10042B03OVRT1_0042_B03.bFS689803 
OVRT10042B07OVRT1_0042_B07.bFS689807 
OVRT10043C12OVRT1_0043_C12.bFS689902 
OVRT10043D05OVRT1_0043_D05.bFS689907 
OVRT10044D08OVRT1_0044_D08.bFS689997 
OVRT10044H04OVRT1_0044_H04.bFS690033 
OVRT10045H10OVRT1_0045_H10.bFS690110 
OVRT10047C06OVRT1_0047_C06.bFS690223 
OVRT10047D11OVRT1_0047_D11.bFS690235 
OVRT10048H07OVRT1_0048_H07.bFS690360 
OVRT10049E07OVRT1_0049_E07.bFS690416 
OVRT10050H10OVRT1_0050_H10.bFS690535 
OVRT10051B10OVRT1_0051_B10.bFS690556 
OVRT10053F03OVRT1_0053_F03.bFS690748 
OVRT10059G05OVRT1_0059_G05.bFS691251 
OVRT10062B09OVRT1_0062_B09.bFS691453 
OVRT10063B06OVRT1_0063_B06.bFS691528 
OVRT10063H04OVRT1_0063_H04.bFS691595 
OVRT10064A06OVRT1_0064_A06.bFS691606 
OVRT10065B05OVRT1_0065_B05.bFS691698 
OVRT10065D09OVRT1_0065_D09.bFS691725 
OVRT10065F03OVRT1_0065_F03.bFS691741 
OVRT10066A10OVRT1_0066_A10.bFS691778 
OVRT10067B01OVRT1_0067_B01.bFS691862 
OVRT10068H08OVRT1_0068_H08.bFS692012 
OVRT10073H06OVRT1_0073_H06.bFS692388 
OVRT10076H04OVRT1_0076_H04.bFS692636 
OVRT10079H04OVRT1_0079_H04.bFS692885 
OVRT10081C12OVRT1_0081_C12.bFS693000 
OVRT10081D10OVRT1_0081_D10.bFS693009 
OVRT10081G01OVRT1_0081_G01.bFS693032 
OVRT10082C05OVRT1_0082_C05.bFS693078 
OVRT10082D08OVRT1_0082_D08.bFS693089 
OVRT10083E04OVRT1_0083_E04.bFS693174 
OVRT10085D07OVRT1_0085_D07.bFS693328 
OVRT10085E05OVRT1_0085_E05.bFS693336 
OVRT10086D04OVRT1_0086_D04.bFS693410 
OVRT10087E04OVRT1_0087_E04.bFS693500 
OVRT10087E11OVRT1_0087_E11.bFS693507 
OVRT10087F12OVRT1_0087_F12.bFS693518 
OVRT10088E07OVRT1_0088_E07.bFS693584 
OVRT10091D02OVRT1_0091_D02.bFS693815 
OVRT10094D07OVRT1_0094_D07.bFS694068 
OVRT10095A12OVRT1_0095_A12.bFS694125 
OVRT10098H09OVRT1_0098_H09.bFS694447 
OVRT10100D01OVRT1_0100_D01.bFS694564 
OVRT10102B10OVRT1_0102_B10.bHX234928 
OVRT10102G01OVRT1_0102_G01.bHX234976 
OVRT10107F12OVRT1_0107_F12.bHX235382 
OVRT10111F08OVRT1_0111_F08.bHX235713 
OVRT10115H02OVRT1_0115_H02.bHX236062 
OVRT10116H07OVRT1_0116_H07.bHX236152 
OVRT10124A10OVRT1_0124_A10.bHX236709 
OVRT10125D02OVRT1_0125_D02.bHX236810 
OVRT10126C01OVRT1_0126_C01.bHX236884 
OVRT10129D10OVRT1_0129_D10.bHX237141 
OVRT10130B04OVRT1_0130_B04.bHX237199 
OVRT10130D09OVRT1_0130_D09.bHX237218 
OVRT10130G06OVRT1_0130_G06.bHX237248 
OVRT10131E09OVRT1_0131_E09.bHX237312 
OVRT10132H05OVRT1_0132_H05.bHX237415 
OVRT10134H02OVRT1_0134_H02.bHX237569 
OVRT10135G05OVRT1_0135_G05.bHX237647 
OVRT10135H10OVRT1_0135_H10.bHX237664 
OVRT10136B02OVRT1_0136_B02.bHX237679 
OVRT10136C07OVRT1_0136_C07.bHX237693 
OVRT10138C01OVRT1_0138_C01.bHX237843 
OVRT10141G10OVRT1_0141_G10.bHX238139 
OVRT10143H08OVRT1_0143_H08.bHX238319 
OVRT10144A09OVRT1_0144_A09.bHX238330 
OVRT10145D03OVRT1_0145_D03.bHX238436 
OVRT10147D01OVRT1_0147_D01.bHX238599 
OVRT10148H06OVRT1_0148_H06.bHX238731 
OVRT10150A07OVRT1_0150_A07.bHX238827 
OVRT10152B06OVRT1_0152_B06.bHX239000 
PBL010007B09PBL01_0007_B09.bBW968860 
PBL010011E05PBL01_0011_E05.bBW969209 
PBL010014H05PBL01_0014_H05.bBW969420 
PBL010032E08PBL01_0032_E08.bBP155925 
PBL010077H04PBL01_0077_H04.bBW973045 
PBL010094F09PBL01_0094_F09.bBW974469 
PBL010107A01PBL01_0107_A01.bBW975567 
PCT010004A06PCT01_0004_A06.bFS694835 
PCT010004D11PCT01_0004_D11.bFS694866 
PCT010005D05PCT01_0005_D05.bFS694936 
PCT010005E11PCT01_0005_E11.bFS694950 
PCT010006F12PCT01_0006_F12.bFS695031 
PCT010008E12PCT01_0008_E12.bFS695174 
PCT010009E06PCT01_0009_E06.bFS695247 
PCT010010A09PCT01_0010_A09.bFS695286 
PCT010010A12PCT01_0010_A12.bFS695289 
PCT010010D11PCT01_0010_D11.bFS695315 
PCT010010H01PCT01_0010_H01.bFS695347 
PCT010012E07PCT01_0012_E07.bFS695462 
PCT010014G04PCT01_0014_G04.bFS695601 
PCT010016B10PCT01_0016_B10.bFS695693 
PCT010016C12PCT01_0016_C12.bFS695704 
PCT010017E02PCT01_0017_E02.bFS695780 
PCT010017G06PCT01_0017_G06.bFS695800 
PCT010018D09PCT01_0018_D09.bFS695847 
PCT010019G02PCT01_0019_G02.bFS695921 
PCT010020H08PCT01_0020_H08.bFS695990 
PCT010022B12PCT01_0022_B12.bFS696078 
PCT010025G03PCT01_0025_G03.bFS696331 
PCT010026D09PCT01_0026_D09.bFS696373 
PCT010027D06PCT01_0027_D06.bFS696438 
PCT010027H04PCT01_0027_H04.bFS696470 
PCT010032F09PCT01_0032_F09.bFS696762 
PCT010033C04PCT01_0033_C04.bFS696797 
PCT010033D11PCT01_0033_D11.bFS696811 
PST010020H11PST01_0020_H11.bFS698591 
PST010021C07PST01_0021_C07.bFS698616 
PST010023G04PST01_0023_G04.bFS698829 
PST010026C09PST01_0026_C09.bFS699024 
PST010026G03PST01_0026_G03.bFS699059 
PST010030C07PST01_0030_C07.bFS699278 
PST010037C09PST01_0037_C09.bFS699724 
PST010039E12PST01_0039_E12.bFS699900 
PST010041C07PST01_0041_C07.bFS700038 
PST010045A07PST01_0045_A07.bFS700345 
PST010045H09PST01_0045_H09.bFS700412 
PST010055G07PST01_0055_G07.bFS701218 
PST010056G05PST01_0056_G05.b  
PST010059C11PST01_0059_C11.bFS701494 
PST010063B02PST01_0063_B02.bFS701795 
PST010069G10PST01_0069_G10.b  
PST010071A02PST01_0071_A02.bFS702398 
PST010081F11PST01_0081_F11.bFS703260 
PST010085B03PST01_0085_B03.bFS703544 
PST010090B12PST01_0090_B12.bFS703950 
PTG010025G02PTG01_0025_G02.bFS706627 
PTG010025G07PTG01_0025_G07.bFS706632 
PTG010034D02PTG01_0034_D02.bFS707391 
PTG010035B03PTG01_0035_B03.bFS707457 
PTG010038D05PTG01_0038_D05.bFS707751 
PTG010042E03PTG01_0042_E03.bFS708120 
PTG010047A06PTG01_0047_A06.bFS708529 
PTG010055E05PTG01_0055_E05.bFS709255 
PTG010057H01PTG01_0057_H01.bFS709453 
PTG010067E03PTG01_0067_E03.bFS710186 
PTG010069G11PTG01_0069_G11.bFS710356 
PTG010070C08PTG01_0070_C08.bFS710387 
PTG010105A09PTG01_0105_A09.bFS712905 
SKNB10001H12SKNB1_0001_H12.bDB800136 
SKNB10007B08SKNB1_0007_B08.b  
SKNB10015E01SKNB1_0015_E01.bDB800810 
SMG010089C05SMG01_0089_C05.bFS720942 
SPL010002C04SPL01_0002_C04.bBP157410 
SPL010008B02SPL01_0008_B02.bBP157023 
SPL010010A03SPL01_0010_A03.bBP156733 
SPL010010B08SPL01_0010_B08.bBP157192 
SPL010012B01SPL01_0012_B01.bBP156999 
SPL010030D09SPL01_0030_D09.bCJ016336 
SPL010035G04SPL01_0035_G04.bBP158815 
SPL010038C10SPL01_0038_C10.bBP157605 
SPL010046F01SPL01_0046_F01.bCJ017172 
SPL010052F05SPL01_0052_F05.bCJ017718 
SPL010059F05SPL01_0059_F05.bCJ018344 
SPL010066C08SPL01_0066_C08.bCJ018946 
SPL010078F12SPL01_0078_F12.bCJ020067 
SPL010084A09SPL01_0084_A09.bCJ020556 
SPL010096C03SPL01_0096_C03.bCJ021644 
SPL010103E10SPL01_0103_E10.bCJ022271 
SPLT10062B09SPLT1_0062_B09.bHX243988 
TCH010007H01TCH01_0007_H01.bCJ022996 
TCH010008F02TCH01_0008_F02.bCJ023052 
TCH010013A07TCH01_0013_A07.bCJ023369 
TCH010020B10TCH01_0020_B10.bCJ023893 
TCH010021H09TCH01_0021_H09.bCJ024025 
TCH010023G02TCH01_0023_G02.bCJ024153 
TCH010027H12TCH01_0027_H12.bCJ024481 
TCH010037D12TCH01_0037_D12.bCJ025192 
TCH010038H06TCH01_0038_H06.bCJ025303 
TCH010048D09TCH01_0048_D09.bCJ026022 
TCH010085D07TCH01_0085_D07.bCJ028608 
TCH010097G11TCH01_0097_G11.bCJ029556 
TCH010099B05TCH01_0099_B05.bCJ029657 
TES010017B10TES01_0017_B10.bCJ031129 
TES010029H03TES01_0029_H03.bCJ031944 
TES010053E02TES01_0053_E02.bCJ033394 
TES010098C03TES01_0098_C03.bCJ036395 
TES010101B11TES01_0101_B11.bCJ036615 
TES010111H06TES01_0111_H06.bCJ037355 
THY010007F03THY01_0007_F03.bBP165794 
THY010018B02THY01_0018_B02.bBP160691 
THY010038G04THY01_0038_G04.bBP167173 
THY010068B10THY01_0068_B10.bBP161573 
THY010074D01THY01_0074_D01.bBP163140 
THY010088G06THY01_0088_G06.bBP167423 
THY010090A11THY01_0090_A11.bBP160438 
THY010117E09THY01_0117_E09.bBP165246 
UTR010009F11UTR01_0009_F11.bBP172471 
UTR010049H04UTR01_0049_H04.bBP173274 
UTR010076F02UTR01_0076_F02.bBP464160 
UTR010081C01UTR01_0081_C01.bCJ037457 
UTR010082A01UTR01_0082_A01.bCJ037524 
UTR010085B10UTR01_0085_B10.bCJ037820 
UTR010096F05UTR01_0096_F05.bCJ038879 
UTR010099E01UTR01_0099_E01.bCJ039051 

  

SNPs: 4      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
129A28700.595W-
G881070.405
370C2821110.797WNCAC/H
G10000.203CAG/Q
497A3400.070WNACC/T
G3481050.930GCC/A
598C340870.916WSATC/I
T3900.084ATT/I


Alignment:      TOP

20110601C-001853 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
BFLT1_0039_E12.b : ggaatcctttagctgtcgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0080_C07.b :
TES01_0111_H06.b :
OVRM1_0128_A12.b :
SPLT1_0062_B09.b :
ADR01_0045_B12.b :
PCT01_0010_D11.b :
PCT01_0010_A09.b :
PCT01_0017_E02.b :
CBLT1_0036_G09.b :
PCT01_0010_A12.b :
PST01_0039_E12.b :
KDN01_0049_H09.b :
PST01_0026_G03.b :
KDN01_0024_H12.b :
PST01_0081_F11.b :
PST01_0071_A02.b :
LVRM1_0047_B09.b :
OVRM1_0098_H11.b :
CLNT1_0127_F11.b :
PST01_0021_C07.b :
KDN01_0081_H10.b :
LVRM1_0166_G05.b :
LVRM1_0032_G08.b :
LVR01_0091_D07.b :
BFLT1_0149_C03.b :
CBLT1_0039_B01.b :
CLNT1_0114_C01.b :
OVRT1_0088_E07.b :
PCT01_0004_D11.b :
KDN01_0023_G06.b :
SKNB1_0015_E01.b :
KDN01_0058_F04.b :
TES01_0017_B10.b :
OVRM1_0194_H01.b :
LVRM1_0023_E02.b : gcgggccgagtccgatcacgggaga
SPL01_0010_B08.b :
TCH01_0027_H12.b :
BFLT1_0011_C07.b :
THY01_0038_G04.b :
LNG01_0084_A12.b :
ADR01_0097_G07.b :
OVRT1_0062_B09.b :
PCT01_0027_H04.b :
PCT01_0027_D06.b :
PCT01_0016_B10.b :
TES01_0053_E02.b :
PCT01_0005_D05.b :
PCT01_0025_G03.b :
PCT01_0017_G06.b :
PCT01_0033_D11.b :
PTG01_0055_E05.b :
PST01_0045_H09.b :
PST01_0090_B12.b :
SKNB1_0007_B08.b :
PST01_0030_C07.b :
PST01_0056_G05.b :
TES01_0101_B11.b :
PCT01_0004_A06.b :
KDN01_0022_B09.b :
CLNT1_0077_A04.b :
PST01_0055_G07.b :
PCT01_0005_E11.b :
PST01_0041_C07.b :
PCT01_0033_C04.b :
KDN01_0056_F04.b :
PST01_0023_G04.b :
PST01_0063_B02.b :
KDN01_0009_A02.b :
PST01_0045_A07.b :
PST01_0037_C09.b :
SPL01_0066_C08.b :
KDN01_0073_C06.b :
KDN01_0094_D06.b :
PST01_0026_C09.b :
KDN01_0069_C10.b :
PCT01_0006_F12.b :
PST01_0069_G10.b :
PST01_0020_H11.b :
KDN01_0085_B12.b :
KDN01_0096_B01.b :
KDN01_0034_A08.b :
TCH01_0085_D07.b :
THY01_0117_E09.b :
LVR01_0036_H08.b :
LVRM1_0005_C03.b :
OVRT1_0102_G01.b :
PTG01_0069_G11.b :
LNG01_0069_C07.b : nnnnnccatgga
PTG01_0025_G02.b :
OVRT1_0098_H09.b :
OVRT1_0013_B11.b :
BFLT1_0077_C09.b :
CLNT1_0125_F02.b :
SPL01_0096_C03.b :
BFLT1_0100_F08.b :
LVR01_0092_B08.b :
OVRT1_0066_A10.b : nngcctttnnnggggnccg
KDN01_0066_D06.b :
TCH01_0097_G11.b :
UTR01_0096_F05.b :
LNG01_0081_D01.b : nnttttgctagtacttnacagtttgtcxxxxxxxxxxxxxxxxxxxx
ITT01_0065_C05.b :
ITT01_0054_H05.b :
TCH01_0007_H01.b :
KDN01_0044_D12.b :
LVRM1_0121_A01.b :
LVRM1_0040_E03.b :
OVRM1_0062_B06.b :
OVRM1_0084_B11.b :
PCT01_0032_F09.b :
PCT01_0016_C12.b :
PCT01_0026_D09.b :
OVRT1_0081_G01.b :
PCT01_0019_G02.b :
KDN01_0098_C05.b :
SPL01_0008_B02.b :
PST01_0085_B03.b :
OVRT1_0145_D03.b :
CLNT1_0005_H07.b :
CLNT1_0151_D06.b :
BFLT1_0039_B06.b :
PCT01_0010_H01.b :
PST01_0059_C11.b :
OVRM1_0174_B09.b :
LVRM1_0194_C10.b :
OVRM1_0036_E08.b :
LVRM1_0009_D02.b :
LVRM1_0194_H10.b :
LVRM1_0081_F04.b :
LVRM1_0085_D09.b :
OVRM1_0172_B06.b :
LVRM1_0045_H04.b :
LVRM1_0172_F10.b :
LVRM1_0011_E08.b :
LVRM1_0085_D04.b :
LVRM1_0181_D04.b :
OVRM1_0218_E12.b :
LVRM1_0044_D07.b :
OVRM1_0048_D10.b :
LVRM1_0092_D03.b :
LVRM1_0071_D03.b :
LVRM1_0100_D04.b :
LVRM1_0010_G10.b :
LVRM1_0130_H11.b :
OVR01_0066_F10.b :
OVR01_0081_D01.b :
LVRM1_0198_B08.b :
LVRM1_0082_H07.b :
OVR01_0077_E02.b :
ADR01_0062_H07.b :
LVRM1_0026_F10.b :
OVRM1_0075_A03.b :
ADR01_0026_H11.b :
OVRM1_0158_H03.b :
LVRM1_0028_E06.b :
LVRM1_0114_C08.b :
LVRM1_0076_D10.b :
LVRM1_0134_D12.b :
LVRM1_0010_B07.b :
OVRM1_0003_C01.b :
LVRM1_0103_H12.b :
LVRM1_0195_B08.b :
OVRM1_0163_D10.b :
LVRM1_0166_C02.b :
LVRM1_0103_E02.b :
LVRM1_0024_E07.b :
LVRM1_0185_C01.b :
LVRM1_0003_B02.b :
LVRM1_0136_F02.b :
LVRM1_0123_C05.b :
OVRM1_0105_E03.b :
LVRM1_0205_B08.b :
LVRM1_0205_D03.b :
LVRM1_0178_E08.b :
OVRM1_0150_E03.b :
LVRM1_0115_C02.b :
LVRM1_0171_F01.b :
THY01_0018_B02.b :
LVRM1_0161_F09.b :
LVRM1_0081_F12.b :
LVRM1_0109_F05.b :
PTG01_0038_D05.b :
LVRM1_0039_B10.b :
LVRM1_0122_H09.b :
LVRM1_0099_E10.b :
OVRM1_0196_E11.b :
LVRM1_0091_G06.b :
LVRM1_0053_A10.b :
LVRM1_0091_D10.b :
LVRM1_0181_A05.b : nnn
LVRM1_0035_G07.b :
THY01_0007_F03.b :
LVRM1_0199_E12.b :
LVRM1_0145_B08.b :
LVRM1_0110_C10.b :
LVRM1_0007_C07.b :
LVRM1_0066_F10.b :
ADR01_0028_E06.b :
LVRM1_0148_F04.b :
OVRM1_0170_C05.b :
LVRM1_0104_E09.b :
LVR01_0025_F11.b :
PTG01_0067_E03.b :
OVRM1_0058_G05.b :
LVRM1_0035_F11.b :
LVRM1_0137_F08.b :
LVRM1_0078_B08.b :
LVRM1_0077_G01.b :
LVRM1_0080_C08.b :
SMG01_0089_C05.b :
LVRM1_0154_G07.b :
OVRM1_0057_G05.b :
OVRM1_0091_B01.b :
OVRM1_0092_C05.b :
OVRM1_0034_C08.b :
LVRM1_0138_C04.b :
LVRM1_0019_H04.b :
SPL01_0046_F01.b :
OVRM1_0025_F11.b :
OVRM1_0014_D11.b :
OVRM1_0010_F12.b :
LVRM1_0142_F12.b :
OVRM1_0108_E10.b :
LVRM1_0022_E09.b :
LVRM1_0143_C09.b :
LVRM1_0145_G10.b :
OVRM1_0107_F12.b :
LVRM1_0141_F10.b :
OVRM1_0083_C09.b :
LVRM1_0019_C08.b :
OVRT1_0138_C01.b :
OVRM1_0093_A12.b :
THY01_0068_B10.b :
PTG01_0042_E03.b :
OVRM1_0021_C11.b :
OVR01_0090_F06.b :
LVRM1_0002_F09.b :
CLNT1_0129_D11.b :
UTR01_0009_F11.b :
SPL01_0084_A09.b :
OVRT1_0143_H08.b :
PBL01_0007_B09.b :
SPL01_0010_A03.b :
OVRT1_0144_A09.b :
SPL01_0012_B01.b :
ADR01_0011_G03.b :
CLNT1_0006_A02.b :
PTG01_0057_H01.b :
CLNT1_0140_H06.b :
OVR01_0058_F09.b :
OVRT1_0116_H07.b :
LVR01_0060_E06.b :
BFLT1_0111_G09.b :
PTG01_0070_C08.b :
LVR01_0029_D09.b :
UTR01_0085_B10.b :
CLNT1_0128_H05.b :
LVR01_0081_D05.b :
SPL01_0103_E10.b :
UTR01_0076_F02.b :
LVR01_0028_C02.b :
OVRT1_0148_H06.b :
LVR01_0009_F10.b :
OVR01_0069_B03.b :
PCT01_0022_B12.b :
OVRT1_0130_G06.b :
OVRT1_0136_B02.b :
CLNT1_0146_G05.b :
OVRT1_0012_F11.b :
OVRT1_0130_D09.b :
OVRT1_0065_D09.b :
TCH01_0021_H09.b :
OVRT1_0135_H10.b :
OVRT1_0132_H05.b :
OVRT1_0013_D03.b :
PTG01_0035_B03.b :
BFLT1_0058_H03.b :
CLNT1_0138_H06.b :
OVRT1_0100_D01.b :
PTG01_0047_A06.b :
OVRT1_0029_D07.b :
OVRT1_0125_D02.b :
BFLT1_0076_G10.b :
PTG01_0105_A09.b :
OVRT1_0136_C07.b :
OVRT1_0053_F03.b :
SPL01_0059_F05.b :
OVR01_0064_D06.b :
OVRT1_0152_B06.b :
CLNT1_0082_G11.b :
BFLT1_0015_F05.b :
CLNT1_0064_A04.b :
ITT01_0015_B08.b :
OVRT1_0141_G10.b :
BFLT1_0075_D12.b :
LVR01_0055_G05.b :
OVRT1_0028_H02.b :
OVRT1_0091_D02.b :
OVRT1_0009_E06.b :
PTG01_0025_G07.b :
UTR01_0099_E01.b :
OVRT1_0134_H02.b :
BFLT1_0063_F09.b :
CLNT1_0146_A02.b :
CLNT1_0151_F11.b :
BFLT1_0028_B09.b :
CLNT1_0117_F09.b :
OVRT1_0111_F08.b :
OVRT1_0115_H02.b :
OVRT1_0045_H10.b :
OVRT1_0047_D11.b :
OVRT1_0076_H04.b :
CLNT1_0072_H03.b :
OVRT1_0004_A11.b :
OVRT1_0006_B04.b :
OVRT1_0126_C01.b :
OVRT1_0065_B05.b :
OVRT1_0135_G05.b :
CLNT1_0151_H04.b :
OVRT1_0030_F11.b :
CLNT1_0130_C12.b :
OVRT1_0044_D08.b :
OVRT1_0124_A10.b :
OVRT1_0033_A07.b :
OVRT1_0150_A07.b :
BFLT1_0056_B08.b :
BFLT1_0057_C07.b :
CLNT1_0013_B03.b :
OVRT1_0102_B10.b :
OVRT1_0082_D08.b :
BFLT1_0115_G03.b :
CLNT1_0142_B04.b :
OVRT1_0063_H04.b :
OVRT1_0147_D01.b :
BFLT1_0029_C03.b :
TCH01_0048_D09.b :
LVR01_0054_F05.b :
CLNT1_0061_E08.b :
BFLT1_0015_C05.b :
OVRT1_0107_F12.b :
ITT01_0058_G06.b :
SPL01_0052_F05.b :
BFLT1_0096_A12.b :
CLNT1_0033_A04.b :
SPL01_0078_F12.b :
ADR01_0055_D06.b :
ADR01_0055_E11.b :
OVRT1_0073_H06.b :
OVRT1_0035_H01.b :
LVR01_0092_C06.b :
OVRT1_0129_D10.b :
OVRT1_0051_B10.b :
OVRT1_0130_B04.b :
OVRT1_0042_B07.b :
UTR01_0081_C01.b :
OVRT1_0065_F03.b :
SPL01_0038_C10.b :
CLNT1_0037_A04.b :
OVRT1_0042_B03.b :
OVRT1_0068_H08.b :
OVRT1_0086_D04.b :
BFLT1_0030_E03.b :
LVR01_0003_E09.b :
PCT01_0020_H08.b :
OVRT1_0044_H04.b :
LVR01_0052_G08.b :
OVRT1_0085_E05.b :
LVR01_0046_G12.b :
LVR01_0079_G10.b :
OVRT1_0043_C12.b :
LVR01_0092_E05.b :
OVRT1_0003_B09.b :
OVRT1_0079_H04.b :
OVR01_0040_F11.b :
BFLT1_0056_G09.b :
BFLT1_0019_B03.b :
OVR01_0100_F12.b :
OVRT1_0085_D07.b :
LVR01_0090_D03.b :
LVR01_0021_G04.b :
LVR01_0055_H05.b :
CLNT1_0144_H02.b :
THY01_0088_G06.b :
THY01_0074_D01.b :
LNG01_0004_E12.b :
SPL01_0035_G04.b :
OVR01_0006_E01.b :
OVR01_0001_H09.b : attgxx
LVR01_0071_G09.b :
LVR01_0061_E07.b :
BFLT1_0023_E06.b :
BFLT1_0058_F10.b :
OVRT1_0048_H07.b :
BFLT1_0021_B03.b :
PBL01_0011_E05.b :
CLNT1_0038_D09.b :
BFLT1_0091_B02.b :
BFLT1_0080_C09.b :
ADR01_0064_F08.b :
LVR01_0102_H08.b :
CLNT1_0125_H02.b :
OVR01_0028_D04.b :
ADR01_0047_C10.b :
LVR01_0091_C06.b :
UTR01_0082_A01.b :
LNG01_0006_F02.b :
OVRT1_0081_C12.b :
BFLT1_0010_A11.b :
PBL01_0032_E08.b :
LVR01_0061_D08.b :
OVRT1_0050_H10.b :
ITT01_0074_H10.b :
LNG01_0010_D12.b :
LVR01_0051_C06.b :
LVR01_0104_H05.b :
OVRT1_0082_C05.b :
PCT01_0012_E07.b :
LVR01_0091_B07.b :
SPL01_0002_C04.b :
OVRT1_0047_C06.b :
LVR01_0020_B01.b :
CLNT1_0090_D09.b :
LVR01_0059_B05.b :
CLNT1_0066_G09.b :
OVRT1_0013_B01.b :
CLNT1_0020_F10.b :
CLNT1_0075_F12.b :
LNG01_0074_E03.b :
TCH01_0023_G02.b :
LNG01_0025_D02.b :
OVRT1_0043_D05.b :
OVRT1_0087_E11.b :
LNG01_0071_F01.b :
OVRT1_0032_G02.b :
OVRT1_0087_E04.b :
OVRT1_0095_A12.b :
OVRT1_0081_D10.b :
LNG01_0056_F12.b :
OVRT1_0083_E04.b :
PBL01_0094_F09.b :
BFLT1_0035_H12.b :
UTR01_0049_H04.b :
CLNT1_0059_E07.b :
ADR01_0060_D10.b :
CLNT1_0086_B02.b :
BFLT1_0002_G04.b :
OVRT1_0087_F12.b :
BFLT1_0021_F04.b :
TCH01_0038_H06.b :
CLNT1_0007_E08.b :
OVRT1_0006_G04.b :
OVRT1_0059_G05.b :
OVRT1_0038_G01.b :
THY01_0090_A11.b :
CLNT1_0073_G11.b :
OVRT1_0035_C11.b :
MLN01_0063_B11.b :
TCH01_0020_B10.b :
PBL01_0014_H05.b :
CLNT1_0062_E08.b :
ITT01_0043_E06.b :
PBL01_0107_A01.b :
OVRT1_0094_D07.b :
ITT01_0040_A10.b :
CLNT1_0071_B01.b :
BFLT1_0001_F12.b :
ADR01_0095_B06.b :
ADR01_0071_C04.b :
OVRT1_0067_B01.b :
TCH01_0037_D12.b :
OVRT1_0049_E07.b :
TCH01_0099_B05.b :
CLNT1_0007_F07.b :
CLNT1_0069_C11.b :
OVR01_0009_F07.b : cagaacattgx
ADR01_0078_F09.b :
PBL01_0077_H04.b :
ITT01_0034_D10.b :
LVRM1_0081_H12.b :
LVRM1_0034_H10.b :
PCT01_0009_E06.b :
PCT01_0014_G04.b :
TES01_0029_H03.b :
KDN01_0080_F11.b :
TCH01_0013_A07.b :
BFLT1_0041_A05.b :
OVRM1_0193_D05.b :
OVRM1_0049_A03.b : ccccggggctttcctctccctcctac
OVRT1_0131_E09.b :
CLNT1_0119_F11.b :
OVRT1_0063_B06.b :
KDN01_0037_G08.b :
LVRM1_0111_F05.b :
OVRT1_0064_A06.b :
SKNB1_0001_H12.b :
BFLT1_0141_H08.b :
PCT01_0018_D09.b :
TES01_0098_C03.b :
PCT01_0008_E12.b :
BMWN1_0098_H07.b :
TCH01_0008_F02.b :
SPL01_0030_D09.b :
PTG01_0034_D02.b :
20110601C-001853 : ..............TGGGCGGCAGCCACAGAGCGTTCTGTCGGCGGAGCCCGGGCGCGGG
---------+---------+---------+---------+---------+---------+ 46
BFLT1_0039_E12.b : xxxxxxxxxxxxxxTGGGCGGCAGCCACAGAGCGTTCTGTCGGCGGAGCCCGGGCGCGGG
KDN01_0080_C07.b :
TES01_0111_H06.b :
OVRM1_0128_A12.b : nagttgtcxxxxxxxxxxxxxxxxxx
SPLT1_0062_B09.b : nnnncgcgagtagaggxxxxxxxxxxx
ADR01_0045_B12.b : nggtgaaacxxxxxxxxxxxxxxxxx
PCT01_0010_D11.b :
PCT01_0010_A09.b :
PCT01_0017_E02.b :
CBLT1_0036_G09.b : ntttgagacaagaagaggxxxxxxxxx
PCT01_0010_A12.b :
PST01_0039_E12.b :
KDN01_0049_H09.b :
PST01_0026_G03.b :
KDN01_0024_H12.b :
PST01_0081_F11.b :
PST01_0071_A02.b :
LVRM1_0047_B09.b : ccgttgtcxxxxxxxxxxxxxxxxxxxx
OVRM1_0098_H11.b : nagttgtcxxxxxxxxxxxxxxxxx
CLNT1_0127_F11.b : nnccgcttnnnnggnnnccgttcgcgnacgxxxxxxxxxxxxxxxxxxx
PST01_0021_C07.b :
KDN01_0081_H10.b :
LVRM1_0166_G05.b : gtcacxxxxxxxxxxxxxxxxxxxxx
LVRM1_0032_G08.b : nagttgtcxxxxxxxxxxxxx
LVR01_0091_D07.b : gtttttgctgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0149_C03.b : nnccgtttgctgaggxxxxxxxxxxxxxxxxxx
CBLT1_0039_B01.b : tttgcgaggtagaggxxxxxxx
CLNT1_0114_C01.b : nnnnccgttcngctgtcgxxxxxxxxxxxxxxxxxx
OVRT1_0088_E07.b : nncccgctnnnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxx
PCT01_0004_D11.b :
KDN01_0023_G06.b :
SKNB1_0015_E01.b :
KDN01_0058_F04.b :
TES01_0017_B10.b :
OVRM1_0194_H01.b : nagttgtcatxxxxxxxxxxxx
LVRM1_0023_E02.b : cggggaggggccggggggggcacgggcccgggccccnngcctttccattgtaagxxxxxx
SPL01_0010_B08.b : catxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0027_H12.b : nttttgcatggactatnacxxxxxxxxxxxxxxxxxxxx
BFLT1_0011_C07.b : nggatccgtttagctgtcgxxxxxxxxxxxxxxxxx
THY01_0038_G04.b : ggggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0084_A12.b : ntttttagttggacttgacagtttgtcxxxxxxxxxxxxxxx
ADR01_0097_G07.b : nnnctctanannntggtaacaxxxx
OVRT1_0062_B09.b : nnnnccgtctgctgtcgxxxxxxxxxxxxxxxxx
PCT01_0027_H04.b :
PCT01_0027_D06.b :
PCT01_0016_B10.b :
TES01_0053_E02.b :
PCT01_0005_D05.b :
PCT01_0025_G03.b :
PCT01_0017_G06.b :
PCT01_0033_D11.b :
PTG01_0055_E05.b : nccgctattnnnggggtaaagcagcxxxxx
PST01_0045_H09.b :
PST01_0090_B12.b :
SKNB1_0007_B08.b :
PST01_0030_C07.b :
PST01_0056_G05.b :
TES01_0101_B11.b :
PCT01_0004_A06.b :
KDN01_0022_B09.b :
CLNT1_0077_A04.b : ccgctttnnnnnnncccgttctgcgttcgxxxxxxxxxxxxxxxxx
PST01_0055_G07.b :
PCT01_0005_E11.b :
PST01_0041_C07.b :
PCT01_0033_C04.b :
KDN01_0056_F04.b :
PST01_0023_G04.b :
PST01_0063_B02.b :
KDN01_0009_A02.b :
PST01_0045_A07.b :
PST01_0037_C09.b :
SPL01_0066_C08.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxx
KDN01_0073_C06.b :
KDN01_0094_D06.b :
PST01_0026_C09.b :
KDN01_0069_C10.b :
PCT01_0006_F12.b :
PST01_0069_G10.b :
PST01_0020_H11.b :
KDN01_0085_B12.b :
KDN01_0096_B01.b :
KDN01_0034_A08.b :
TCH01_0085_D07.b : nnnnnggctagtgacttnacxxxxxxxxxxxxxxxxx
THY01_0117_E09.b : gttgtcaaagcgg
LVR01_0036_H08.b : gcctttgtgtaactcgg
LVRM1_0005_C03.b : atxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0102_G01.b : nnnnccgtcagcgtagagtgtxxxx
PTG01_0069_G11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0069_C07.b : taagacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0025_G02.b : nnggcggtttnnnnggagtxxxxxxxx
OVRT1_0098_H09.b : nttttccttcgcgcacgagtgxxxxxxxxx
OVRT1_0013_B11.b : naaaaccgtcagcgtacgagtgxxxxxxxxxxxx
BFLT1_0077_C09.b : ggattccgtcagcgncggxxxxxxxxxxxxxxx
CLNT1_0125_F02.b : nttccttcagcgnacgxxxxxxxxxxxxxxxx
SPL01_0096_C03.b : ttttccgcacggactatnxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0100_F08.b : ggatccgtctgcgnacgxxxxxxxxxxxxxxx
LVR01_0092_B08.b : gctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0066_A10.b : tctgcgcacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0066_D06.b :
TCH01_0097_G11.b : nnggctaggacttagacxxxxxxxxxxxxxxxxxx
UTR01_0096_F05.b : nnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0081_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxacataggccgtcttcagccgcagcatcgagtcgg
ITT01_0065_C05.b : nnnaatgaacaxxxxx
ITT01_0054_H05.b : nnnagtgaacaxxxx
TCH01_0007_H01.b : nnnggctagtgacttnacxxxxxxxxxxxxxxxxxx
KDN01_0044_D12.b :
LVRM1_0121_A01.b : nagttgtcxxxxxxxxxxxxxxxx
LVRM1_0040_E03.b : nagttgtcxxxxxxxxxxxxxx
OVRM1_0062_B06.b : agttgacxxxxxxxx
OVRM1_0084_B11.b : agttgtcxxxxxxxxxxxx
PCT01_0032_F09.b :
PCT01_0016_C12.b :
PCT01_0026_D09.b :
OVRT1_0081_G01.b : ngggtttttnngggttccgttagcgnacgxxxxxxxxxxxxxx
PCT01_0019_G02.b :
KDN01_0098_C05.b :
SPL01_0008_B02.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0085_B03.b :
OVRT1_0145_D03.b : nnnnccgttcagcgtaggxxxxxxxxxxxx
CLNT1_0005_H07.b : ncttcgtcagcgnacgxxxxxxxxxxxxx
CLNT1_0151_D06.b : nnnnccgtctgcgnaggxxxxxxxxxxxxxxx
BFLT1_0039_B06.b : ggactcgtttgcgnacgxxxxxxxxxxx
PCT01_0010_H01.b :
PST01_0059_C11.b :
OVRM1_0174_B09.b : cgttgtcxxxxxxxxxxxxxxxxx
LVRM1_0194_C10.b : cgttgtcxxxxxxxxxxx
OVRM1_0036_E08.b : txxxxxxxxxxxxxxxxxxxxx
LVRM1_0009_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0194_H10.b : cagttgtcxxxxxxxxxxxxx
LVRM1_0081_F04.b : ncgttgtcxxxxxxxxxxxxxxx
LVRM1_0085_D09.b : cagttgtcxxxxxxxxxxxxx
OVRM1_0172_B06.b : nagttgtcxxxxxxxxxxxxx
LVRM1_0045_H04.b : xxxxxxxxxxxxx
LVRM1_0172_F10.b : gcgttgtcxxxxxxxxxxxxxxxx
LVRM1_0011_E08.b : cgttgtcxxxxxxxxxxxxxxxxxxx
LVRM1_0085_D04.b : ncgttgtcxxxxxxxxxxxxxxxxxxx
LVRM1_0181_D04.b : ccgttgtcxxxxxxxxxxxxxxx
OVRM1_0218_E12.b : nagttgtcatxxxxxxxxxxxxxx
LVRM1_0044_D07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0048_D10.b : ttgtcxxxxxxxxxxxxx
LVRM1_0092_D03.b : cagttgtcxxxxxxxxxxxxxxx
LVRM1_0071_D03.b : nagttgtcxxxxxxxxxxxxxxx
LVRM1_0100_D04.b : cagttgtcxxxxxxxxxxxxxxxxx
LVRM1_0010_G10.b : cxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0130_H11.b : nagttgtcxxxxxxxxxxxxxxxx
OVR01_0066_F10.b : nggcttggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0081_D01.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0198_B08.b : axxxxxxx
LVRM1_0082_H07.b : ncgttgtcxxxxxxxxxxxxxx
OVR01_0077_E02.b : nnnttgattggacttagacxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0062_H07.b : cattgtcxxxxxxxxxxxxxxxx
LVRM1_0026_F10.b : agttgacxxxxxxxxxxxxxx
OVRM1_0075_A03.b : cxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0026_H11.b : nnnggagtaacggcxx
OVRM1_0158_H03.b : tagttgtcxxxxxxxxxxxxxxx
LVRM1_0028_E06.b : cgttgacacxxxxxxxxxxxx
LVRM1_0114_C08.b : cagttgtcxxxxxxxxxxxxxx
LVRM1_0076_D10.b : agttgacxxxxxxxxxxxxxx
LVRM1_0134_D12.b : nagttgtcxxxxxxxxxxxxxx
LVRM1_0010_B07.b : cxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0003_C01.b : xxxxxxxxxxxxxxxxxxxxxx
LVRM1_0103_H12.b : nagtttgtcxxxxxxxxxxxxxxxx
LVRM1_0195_B08.b : ttgtcxxxxxxxxxxxxxxxxxxxx
OVRM1_0163_D10.b : cagtttgtcxxxxxxxxxxxxx
LVRM1_0166_C02.b : tcxxxxxxxxxxxxxxx
LVRM1_0103_E02.b : nagttgtcxxxxxxxxxxxxxxx
LVRM1_0024_E07.b : ccttgxxxxxxxxxxxxxx
LVRM1_0185_C01.b : aattgtcxxxxxxxxxxxx
LVRM1_0003_B02.b : xxxxx
LVRM1_0136_F02.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0123_C05.b : tagttgtcxxxxxxxxxxxxxxx
OVRM1_0105_E03.b : cagttgtcxxxxxxxxxxxxxx
LVRM1_0205_B08.b : xxxxxxxxxx
LVRM1_0205_D03.b : xxxxxxxx
LVRM1_0178_E08.b : ttgtcxxxxxxxxxxxxx
OVRM1_0150_E03.b : nagtttgtcxxxxxxxxxxxxx
LVRM1_0115_C02.b : cagtgtxxxxxxxxxxxxxxx
LVRM1_0171_F01.b : cgttgtcxxxxxxxxxxxxxxxx
THY01_0018_B02.b : tagcaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0161_F09.b : cagttgtcxxxxxxxxxxxxxxxxxx
LVRM1_0081_F12.b : gtcxxxxxxxxxxxxxx
LVRM1_0109_F05.b : tagttgtcxxxxxxxxxxxxxxxx
PTG01_0038_D05.b : ttttgctaaacxxxx
LVRM1_0039_B10.b : cgttgtcxxxxxxxxxxx
LVRM1_0122_H09.b : nagttgtcxxxxxxxxxxxxx
LVRM1_0099_E10.b : agttgtcxxxxxxxxxxxxxxxx
OVRM1_0196_E11.b : agttgtcatxxxxxxxxxxx
LVRM1_0091_G06.b : cagttgtcxxxxxxxxxxxxxxx
LVRM1_0053_A10.b : nagttgtcxxxxxxxxxxxxxx
LVRM1_0091_D10.b : gtcxxxxxxxxxxxxxx
LVRM1_0181_A05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LVRM1_0035_G07.b : gagttgtcxxxxxxxxxxxx
THY01_0007_F03.b : xxxxxxx
LVRM1_0199_E12.b : cgttgtcxxxxxxxxxxxxxx
LVRM1_0145_B08.b : nagttgtcxxxxxxxxxxxxxxx
LVRM1_0110_C10.b : cagttgtcxxxxxxxxxxxxxx
LVRM1_0007_C07.b : xxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0066_F10.b : cxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0028_E06.b : aagaacag
LVRM1_0148_F04.b : tagttgtcxxxxxxxxxxxxxx
OVRM1_0170_C05.b : nagttgtcatxxxxxxxxxxxxxx
LVRM1_0104_E09.b : nagttgtcxxxxxxxxxxxxxxx
LVR01_0025_F11.b : tttggtgacctattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0067_E03.b : gtgtcattnnnnggagtaaagcagcxxx
OVRM1_0058_G05.b : agttgacxxxxxxxxxxxxxx
LVRM1_0035_F11.b : cgttgtcxxxxxxxxxxxxxxx
LVRM1_0137_F08.b : caattgtcxxxxxxxxxxxxxx
LVRM1_0078_B08.b : agttgaatxxxxxxxxxxx
LVRM1_0077_G01.b : cgttgxxxxxxxxxxxxxxx
LVRM1_0080_C08.b : agttgaatxxxxxxxxxxxxx
SMG01_0089_C05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnn
LVRM1_0154_G07.b : cagtgtcxxxxxxxxxxxxxxxx
OVRM1_0057_G05.b : cgttgacxxxxxxxxxxxx
OVRM1_0091_B01.b : agttgtcxxxxxxxxxxxxxx
OVRM1_0092_C05.b : cagttgtcxxxxxxxxxxxxxxxx
OVRM1_0034_C08.b : cxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0138_C04.b : nagttgtcxxxxxxxxxxxxx
LVRM1_0019_H04.b : agttgxxxxxxxxxxxxxx
SPL01_0046_F01.b : nntttgctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0025_F11.b : cxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0014_D11.b : xxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0010_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0142_F12.b : taattgtcxxxxxxxxxxxxxxx
OVRM1_0108_E10.b : cagttgtcxxxxxxxxxxxxxx
LVRM1_0022_E09.b : agttgaataaagxxxxxxxxx
LVRM1_0143_C09.b : ncagtgtcxxxxxxxxxxxxxx
LVRM1_0145_G10.b : nagttgtcxxxxxxxxxxxxxx
OVRM1_0107_F12.b : cagttgtcxxxxxxxxxxxxxxxxx
LVRM1_0141_F10.b : nagttgtcxxxxxxxxxxxxxxx
OVRM1_0083_C09.b : agttgtcxxxxxxxxxxxxxx
LVRM1_0019_C08.b : agttgxxxxxxxxxxxxxx
OVRT1_0138_C01.b : nnccgcttgcnnnnnnnacccttcgcgttcgxxxxxxxxxxxxxxx
OVRM1_0093_A12.b : nagtttgtcxxxxxxxxxxxxxx
THY01_0068_B10.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0042_E03.b : ncgtttattnnnggagtxxxxxxxxxx
OVRM1_0021_C11.b : cxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0090_F06.b : ggattgtgatatgacxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0002_F09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0129_D11.b : nnnncccttcagcgnacgxxxxxxxxxxxxxxx
UTR01_0009_F11.b : ggattttgcattagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0084_A09.b : nttggcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0143_H08.b : nncccggttcnnnnnnnnccgtttgcgttacgaggttxxxxxxxxxxx
PBL01_0007_B09.b : ctaanttcagataaacagctg
SPL01_0010_A03.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0144_A09.b : nnnccgattannnnnnnnccgttctgcgtangagtgxxxxxxxxxxxxx
SPL01_0012_B01.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0011_G03.b : nnnaatgaaag
CLNT1_0006_A02.b : nnnggccccnnnngggttccgttagcggacggaggxxxxxxxxxx
PTG01_0057_H01.b : ncccgttattnnnntgagtaaagcagcggn
CLNT1_0140_H06.b : nnncccctatagctgtcgxxxxxxxxxxxxxxxxx
OVR01_0058_F09.b : ttggcttgtgacttaacxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0116_H07.b : nnnnnacgtcagcgnaggxxxxxxxxxxxxxxxxxx
LVR01_0060_E06.b : ctttttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0111_G09.b : nnggcgccannnnnnnnccgttcgcgttagxxxxxxxxxxxxxxx
PTG01_0070_C08.b : nnnnnnnnnnnnnnnnnnnnn
LVR01_0029_D09.b : ttttggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0085_B10.b : nnttggcttgtgacttnacxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0128_H05.b : nnccgttttnnnnnnccccgttagcgnacgxxxxxxxxxxxxxxxxx
LVR01_0081_D05.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0103_E10.b : nnnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0076_F02.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_C02.b : caxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0148_H06.b : nnnnncctatagctgacgxxxxxxxxxxxxxxxxx
LVR01_0009_F10.b : gcttttcgggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0069_B03.b : nnnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxx
PCT01_0022_B12.b :
OVRT1_0130_G06.b : nnngggacttcnnnnnnnccgttcgcgnacgxxxxxxxxxxxxxxx
OVRT1_0136_B02.b : nnnccgtttannnnnnnnccgtttgcgttagxxxxxxxxxxxxxxxxx
CLNT1_0146_G05.b : nnnnnactcagcgtacgagtgxxxxxxxxxxxx
OVRT1_0012_F11.b : nnnnccgtttgcgnacgxxxxxxxxxxxxxxxx
OVRT1_0130_D09.b : nnnccgcgttcnnnnnnccgttcgcgnacgxxxxxxxxxxxxxxxx
OVRT1_0065_D09.b : nnnnnccgtcagcgcacgxxxxxxxxxxxxxxxxxxxx
TCH01_0021_H09.b : nnnttagacttgacagtttgtcxxxxxxxxxxxxxx
OVRT1_0135_H10.b : nnnaacgtcnnnnnnnnnnccgttagcgttagxxxxxxxxxxxxxxxx
OVRT1_0132_H05.b : nnnccggttccnnnnnnnccgttagcgcacgxxxxxxxxxxxxxxx
OVRT1_0013_D03.b : nnnnnccgttagctgtcgxxxxxxxxxxxxxxx
PTG01_0035_B03.b : nncccgccattnnnggataaagcagc
BFLT1_0058_H03.b : naaccccttctgctgtggagtgxxxxxxxxxxx
CLNT1_0138_H06.b : nnccttcgctgtcgaggttxxxxxxxxxx
OVRT1_0100_D01.b : nntttacgtctgcgtacgagtgxxxxxxxxxxxxx
PTG01_0047_A06.b : ngggcttannnngggagtaagcagcxxxxx
OVRT1_0029_D07.b : nnnnccttcgcgnacgaggttxxxxxxx
OVRT1_0125_D02.b : nnccgttagctgtggxxxxxxxxxxxxxxxx
BFLT1_0076_G10.b : cttcgtttgcgnacgxxxxxxxxxxxxxxx
PTG01_0105_A09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRT1_0136_C07.b : nnccccgtccnnnnnnnccgttagcgcacgxxxxxxxxxxxxxxxx
OVRT1_0053_F03.b : nggctttnnnnnnnnccgtttgcgnacgxxxxxxxxxxxxxxxxxx
SPL01_0059_F05.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0064_D06.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0152_B06.b : nnnccccgttagctgtaagxxxxxxxxxxxxxxxxx
CLNT1_0082_G11.b : ntttccgttcgcgtcgagtgtxxxxxxxx
BFLT1_0015_F05.b : atccgtatgcgnacgxxxxxxxxxxxxxxxx
CLNT1_0064_A04.b : nnnnccgtttgcgnacgxxxxxxxxxxxxxxx
ITT01_0015_B08.b : nnnggtgacacaxxxx
OVRT1_0141_G10.b : nnnaaccattttnnnnnnnacgttagcgnaggxxxxxxxxxxxxxxx
BFLT1_0075_D12.b : atccgtttgctgacgxxxxxxxxx
LVR01_0055_G05.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0028_H02.b : nntttcgttcagctgtcgxxxxxxxxxxxxxxxxx
OVRT1_0091_D02.b : nnaacccgtttgcgnacgxxxxxxxxxxxxxxxxx
OVRT1_0009_E06.b : nnnccttagctgacgaggxxxxxxxxxx
PTG01_0025_G07.b : nngggccttnnnnnggagtaacxxxxx
UTR01_0099_E01.b : nnnnttgctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0134_H02.b : nnngggtgttnnnnnnnnccccttcgcgttacgaggxxxxxxxxxxxxxxxxxx
BFLT1_0063_F09.b : aatccgcttgcgtacgagtgxxxxxxxxxxx
CLNT1_0146_A02.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxx
CLNT1_0151_F11.b : nnnncccgtcgcgnacgxxxxxxxxxxxxxx
BFLT1_0028_B09.b : ggatccgtttgctgtcgxxxxxxxxxxxxxxxx
CLNT1_0117_F09.b : nnnnnccgtcagcgnacgxxxxxxxxxxxxxxx
OVRT1_0111_F08.b : nnnnccgtcagctgtggxxxxxxxxxxxxxxxx
OVRT1_0115_H02.b : ntttccgtcagcgnacgxxxxxxxxxxxxxxx
OVRT1_0045_H10.b : ncttccgtctgcgnacgaggxxxxxxxxxx
OVRT1_0047_D11.b : nccgtctgctgtcgxxxxxxxxxxxxxxxx
OVRT1_0076_H04.b : ngggttacgttagcgnacgxxxxxxxxxxxxxxxx
CLNT1_0072_H03.b : nggattcgtttgcgnacgxxxxxxxxxxxxxxxx
OVRT1_0004_A11.b : nnnnncctctagctgacgxxxxxxxxxxxxxxxx
OVRT1_0006_B04.b : nnnnccgtctagctgtcngagtgxxxxxxxxxxx
OVRT1_0126_C01.b : nnnnccgttaggcgtaggagtgxxxxxxxxxxxx
OVRT1_0065_B05.b : nnnnccgtttgcgnaggxxxxxxxxxxxxxxx
OVRT1_0135_G05.b : nnncccgtttnnnnnnnnccgttagcgcacgxxxxxxxxxxxxxxxx
CLNT1_0151_H04.b : nnnccccgttagctgtcgxxxxxxxxxxxxxxx
OVRT1_0030_F11.b : ncccccgtcagcgnacgxxxxxxxxxxxxxxxx
CLNT1_0130_C12.b : nntttcgttagctgtcgxxxxxxxxxxxxxxx
OVRT1_0044_D08.b : naacccgttagctgtcgxxxxxxxxxxxxxxx
OVRT1_0124_A10.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxx
OVRT1_0033_A07.b : nnnnccgtcagcgacgnatgxxxxxxxxxx
OVRT1_0150_A07.b : nnnnnccgttagctgtacgagtgxxxxxxxxxxx
BFLT1_0056_B08.b : gatccgttagcgnaggnatgttxxxxxxxxxx
BFLT1_0057_C07.b : ggaaccgtctgctgtcgxxxxxxxxxxxxxxx
CLNT1_0013_B03.b : ggatncgtttgctgtcgxxxxxxxxxxxxxxx
OVRT1_0102_B10.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxx
OVRT1_0082_D08.b : nnnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxx
BFLT1_0115_G03.b : nnnnnccgtcagctgtggxxxxxxxxxxxxxxxx
CLNT1_0142_B04.b : nnnnnccgtcagctgtcgxxxxxxxxxxxxxxxx
OVRT1_0063_H04.b : nttttacgtcagcgnacgagtgxxxxxxxxxxxx
OVRT1_0147_D01.b : nnnnccgtttgctgtacgxxxxxxxxxxxxxxxx
BFLT1_0029_C03.b : nggatccgttagctgtcgxxxxxxxxxxxxxxx
TCH01_0048_D09.b : ngctaggactataacxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_F05.b : gcatttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0061_E08.b : nnnnncctatagctgtcgxxxxxxxxxxxxxxxxx
BFLT1_0015_C05.b : aatccgtcagcgncggxxxxxxxxxxxxxxxx
OVRT1_0107_F12.b : nnnccgtcagctgtggxxxxxxxxxxxxxxx
ITT01_0058_G06.b : nnggtgaagcagct
SPL01_0052_F05.b : nnnggcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0096_A12.b : aattccgttcagcgtacgagtgxxxxxxxxxxxx
CLNT1_0033_A04.b : gggtccgtttgctgtcgxxxxxxxxxxxxxxxx
SPL01_0078_F12.b : nnttgctaggacttanacxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0055_D06.b : nnnnnnnnnnnnnnnnnnnnnnnnnn
ADR01_0055_E11.b : nnnnnnnnnnnnnnnnnnnnnnnnnn
OVRT1_0073_H06.b : nccgcttttnnngaccccgttagcgnacgxxxxxxxxxxxxxxxx
OVRT1_0035_H01.b : nnttttcgttagctgacgxxxxxxxxxxxxxxx
LVR01_0092_C06.b : cattatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0129_D10.b : nngggcattcnnnnnnnccgtttgcgnacgxxxxxxxxxxxxxxx
OVRT1_0051_B10.b : nnngggtttnnnngnnnnccgttagcgnacgxxxxxxxxxxxxxxxxx
OVRT1_0130_B04.b : nnngggtttccnnnnnnnccgttcgcgnacgxxxxxxxxxxxxxxxxx
OVRT1_0042_B07.b : nttgcttnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxx
UTR01_0081_C01.b : nnnttggttggactatgacxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0065_F03.b : nnntttctttagcgnacgagtgxxxxxxxxxxx
SPL01_0038_C10.b : aggcacttatgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0037_A04.b : nnggttttnnnnnnnccgttagcgttcgxxxxxxxxxxxxxxxx
OVRT1_0042_B03.b : nnnncccttcagcgtcggxxxxxxxxxxxxxxx
OVRT1_0068_H08.b : nccccttnnngggnnccgttagcgnacgagtgxxxxxxxxxxxxxx
OVRT1_0086_D04.b : nnnggcttttnnnnnnnccgtttgcgnacgxxxxxxxxxxxxxxxx
BFLT1_0030_E03.b : nggactccgtttgctgtcgxxxxxxxxxxxxxxxx
LVR01_0003_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0020_H08.b :
OVRT1_0044_H04.b : ncctccgttagctgtcgxxxxxxxxxxxxxxx
LVR01_0052_G08.b : gctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0085_E05.b : nnnnggtccnnnnnggnnnccctcagcgttacgaggxxxxxxxxxxxxxxxxx
LVR01_0046_G12.b : ggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0079_G10.b : gcttatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0043_C12.b : nnnnnccgttagctgtcgxxxxxxxxxxxxxxxx
LVR01_0092_E05.b : ccttttgctgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0003_B09.b : nnccccctatagctgacgxxxxxxxxxxxxxxxxx
OVRT1_0079_H04.b : nncctctctctatttgcatgattgcgcggcagctc
OVR01_0040_F11.b : acgaggctcttgctgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0056_G09.b : gaatccgtctgcgnacgxxxxxxxxxxxxxxxx
BFLT1_0019_B03.b : nggactcgttagcgnacgxxxxxxxxxxxxxxxx
OVR01_0100_F12.b : nntttgcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0085_D07.b : nnccgctnnnnggggnccgttagcgcacgxxxxxxxxxxxxxxxx
LVR01_0090_D03.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0021_G04.b : gattttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0055_H05.b : gctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0144_H02.b : nnnnnccgtctgctgtggxxxxxxxxxxxxxxxx
THY01_0088_G06.b : tttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0074_D01.b : gccattttacgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0004_E12.b : gcctgtggttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0035_G04.b : aaggctcaggggncnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0006_E01.b : taggggcccctattttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0001_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_G09.b : tttgtggtttaacagcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_E07.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0023_E06.b : ngaactcgtttgcgnacgxxxxxxxxxxxxxxx
BFLT1_0058_F10.b : gaatccgttagcgnacgxxxxxxxxxxxxxx
OVRT1_0048_H07.b : nntttcgtctgcgnacgxxxxxxxxxxxxxx
BFLT1_0021_B03.b : nggatccgttagctgtcgxxxxxxxxxxxxxx
PBL01_0011_E05.b : nnnnggtgaagagct
CLNT1_0038_D09.b : gggggcgtttgcgnacgxxxxxxxxxxxxxxxx
BFLT1_0091_B02.b : nggtatccgtttgcggacgxxxxxxxxxxxxxxxxx
BFLT1_0080_C09.b : gattcgttagctgtcgxxxxxxxxxxxxxxxx
ADR01_0064_F08.b : nnnnggagaagag
LVR01_0102_H08.b : ctttttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0125_H02.b : nncctccgttagctgtcgxxxxxxxxxxxxxxx
OVR01_0028_D04.b : ggggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0047_C10.b : tttnaaatgaacag
LVR01_0091_C06.b : gcatttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0082_A01.b : nntttgcataggacttagacxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0006_F02.b : tggtttttttgcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0081_C12.b : ntttccgtctgcgnacgxxxxxxxxxxxxxxx
BFLT1_0010_A11.b : gattccgttcagcgnacgxxxxxxxxxxxxxxxxx
PBL01_0032_E08.b : nnggtgaacagct
LVR01_0061_D08.b : gtttcggagcttttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0050_H10.b : nnnccggctnnnnnnnnnccgttagcgttcgxxxxxxxxxxxxxxxx
ITT01_0074_H10.b : nnntgatgaacggctg
LNG01_0010_D12.b : gcatttgcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_C06.b : ggggggggccccccagcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_H05.b : gggccaccggcttcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0082_C05.b : nnnccccgtcagcgnacgxxxxxxxxxxxxxxx
PCT01_0012_E07.b :
LVR01_0091_B07.b : gcacaaggatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0002_C04.b : ctttgggtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0047_C06.b : nncctctctgcggacgxxxxxxxxxxxxxxxxxx
LVR01_0020_B01.b : ttatattaagcatagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0090_D09.b : ggggccgtcagctgtcggaggttxxxxxxxxx
LVR01_0059_B05.b : ttttaacgcatttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0066_G09.b : ggttccgtttgctgacgxxxxxxxxxxxxxxxx
OVRT1_0013_B01.b : nnnnnccgtcagcgnacgxxxxxxxxxxxxxxx
CLNT1_0020_F10.b : nttcttctgcgtcggagtgxxxxxxxxxxxxxxxxxx
CLNT1_0075_F12.b : ngtttccgttagcgnacgxxxxxxxxxxxxxxx
LNG01_0074_E03.b : nnntttgctggacttgacagtttgtcxxxxxxxxxxxxxxxx
TCH01_0023_G02.b : nnnggcttggactataacagtttgtacxxxxxxxxxxxx
LNG01_0025_D02.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0043_D05.b : nnaacccgtttgcgnacgxxxxxxxxxxxxxxxx
OVRT1_0087_E11.b : nnccgcttnnnnnttttccgtttgcgnacgxxxxxxxxxxxxxxx
LNG01_0071_F01.b : ttgtttgatcggacttgacxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0032_G02.b : ncctccgtcagcgnacgxxxxxxxxxxxxxxxx
OVRT1_0087_E04.b : nnnttcttttnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxx
OVRT1_0095_A12.b : ngggtttttnnnnnccgttagcgnacgxxxxxxxxxxxxxxxx
OVRT1_0081_D10.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxx
LNG01_0056_F12.b : nnngggacttnnttccgcatggacttgacagtttgtcxxxxxxxxxxxxxx
OVRT1_0083_E04.b : ngggaccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0094_F09.b : nnnggatgaacagcgg
BFLT1_0035_H12.b : aattccgtctgctgtacgaggxxxxxxxxxxx
UTR01_0049_H04.b : cttatggtggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0059_E07.b : nnttccgtctgctgacgxxxxxxxxxxxxxxx
ADR01_0060_D10.b : nnnttcctgaacagc
CLNT1_0086_B02.b : nggacccgtttgcggacgxxxxxxxxxxxxxxxxxxxx
BFLT1_0002_G04.b : ngggactcgtctgctgtcgxxxxxxxxxxxxxxx
OVRT1_0087_F12.b : nnnccccgatagcggacgxxxxxxxxxxxxxxxx
BFLT1_0021_F04.b : tggactcgatagctgtcgxxxxxxxxxxxxxxxx
TCH01_0038_H06.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0007_E08.b : ngggatcgtttgcgnacgxxxxxxxxxxxxxxxxx
OVRT1_0006_G04.b : nnnttccgttagctgtcngxxxxxxxxxxxxxxxx
OVRT1_0059_G05.b : nncccgttnnnnngaaaaacgttagcgcacgxxxxxxxxxxxxxxx
OVRT1_0038_G01.b : nnttttcgttagctgacgxxxxxxxxxxxxxxx
THY01_0090_A11.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0073_G11.b : nnccgcttnnnnncttccgtttgcgnacgagtgxxxxxxxxxxxx
OVRT1_0035_C11.b : nntttttnnnnnnnnccgttcgcggacgxxxxxxxxxxxxxxxx
MLN01_0063_B11.b : nggttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0020_B10.b : gcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0014_H05.b : gtgaagcagc
CLNT1_0062_E08.b : ggggccgtttgctgacgxxxxxxxxxxxxxxxx
ITT01_0043_E06.b : nnggatgaacaxxx
PBL01_0107_A01.b : nttagatgaacaxxx
OVRT1_0094_D07.b : nttgtcttttnnnnnccgttagcgnacgagtgxxxxxxxxxxx
ITT01_0040_A10.b : nnnggtgxxxxxxxxxxxxxxxx
CLNT1_0071_B01.b : nggatccgtcagctgtcgxxxxxxxxxxxxxxxxxx
BFLT1_0001_F12.b : ggactccgtcagcgnacgxxxxxxxxxxxxxxxx
ADR01_0095_B06.b : nnncctttaannngggagtaacaxxxxxx
ADR01_0071_C04.b : nnggcgtaannnnggcgtaacggcx
OVRT1_0067_B01.b : nngggcttnnnnnnnnccctcagcgnacgxxxxxxxxxxxxxxx
TCH01_0037_D12.b : tttttggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0049_E07.b : ncggtttnnnnnnnnccgttcgcgttcgxxxxxxxxxxxxxxxxx
TCH01_0099_B05.b : nnnggcttggactatnacxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0007_F07.b : ccgttttnnnngcactcgttagcgnacgxxxxxxxxxxxxxxxx
CLNT1_0069_C11.b : ttttccgtctgcgnacgxxxxxxxxxxxxxxx
OVR01_0009_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0078_F09.b : aaaanggatgaagxxxxx
PBL01_0077_H04.b : nnaagtgxxxxxxxxxx
ITT01_0034_D10.b : nnnaatgaacxxxxx
LVRM1_0081_H12.b :
LVRM1_0034_H10.b : gagttgtcxxxxxxxxxxxxxx
PCT01_0009_E06.b :
PCT01_0014_G04.b :
TES01_0029_H03.b :
KDN01_0080_F11.b :
TCH01_0013_A07.b : ttttggcatgtgacttgacxxxxxxxxxxxxxxxxxxx
BFLT1_0041_A05.b : ggattccgtttgctgacgxxxxxxxxxxxxxxx
OVRM1_0193_D05.b : nagttgtcxxxxxxxxxxxx
OVRM1_0049_A03.b : catttactcctttnttcccctacatttcattatttgtcgcnnacattgtacxxxxxxxxx
OVRT1_0131_E09.b : nnggggttttnnnnnnnccgttcgcgnacgxxxxxxxxxxxxxxx
CLNT1_0119_F11.b : nnnnnccgttagcgnacgxxxxxxxxxxxxxxx
OVRT1_0063_B06.b : nccggcttnnnnnncctccgtcgcgnacgxxxxxxxxxxxxxx
KDN01_0037_G08.b :
LVRM1_0111_F05.b : tcagtgtcxxxxxxxxxxxxxx
OVRT1_0064_A06.b : gtcgtttnnngnnnccgtctgcgnacgxxxxxxxxx
SKNB1_0001_H12.b :
BFLT1_0141_H08.b : ncaagcgtcgcgttcgagtgtcttcgct
PCT01_0018_D09.b :
TES01_0098_C03.b :
PCT01_0008_E12.b :
BMWN1_0098_H07.b : ttagatagtagaggxxx
TCH01_0008_F02.b :
SPL01_0030_D09.b :
PTG01_0034_D02.b :
20110601C-001853 : GTCCCTATAAAAGGTAGCCGAGGTGGGGGCGCGCGCGCAAAAGACGCAAACC*GTTGTTG
---------+---------+---------+---------+---------+---------+ 105
BFLT1_0039_E12.b : GTCCCTATAAAAGGTAGCCGAGGTGGGGGCGCGCGCCCCAAAGACGCAAACC*GTTGTTG
KDN01_0080_C07.b : tggcgttGGCTCTGGAAAGAGCAACC*GTTGTTG
TES01_0111_H06.b : tccgctgtgGCTCTGGAAAGAGCAACC*GTTGTTG
OVRM1_0128_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGAAAAAGACGCAAACC*GTTGTTG
SPLT1_0062_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGCCCCAAAGACGCAAACC*GTTGTCG
ADR01_0045_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxggcctacTGGAAAAAGACGCAAACC*GTTGTTG
PCT01_0010_D11.b : ncccctacnnnnnncctgcggtgGCTCTGGAAAGAGCAACC*GTTGTCG
PCT01_0010_A09.b : nnnccgatttnnnnnnncctgcggtgGCTCTGGGAAGAGCAACC*GTTGTTG
PCT01_0017_E02.b : nnngggttctttnnnnnactgcgggtGCTCTGGAAAGAGCAACC*GTTGTTG
CBLT1_0036_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGCCCCAAAGACCCCCATT*GTTGTCG
PCT01_0010_A12.b : nngggcgtttnnnttccctgcgggtGCTCTGGAAAGAGCAACC*GTTGTCG
PST01_0039_E12.b : cggtggctcTGGAAAAAGACGCAAACC*GTTGTTG
KDN01_0049_H09.b : cagcgttgGCTCTGGAAAGAGCAACC*GTTGTTG
PST01_0026_G03.b : ttcctgcggtgGCTCTGGAAAGAGCAACC*GTTGTTG
KDN01_0024_H12.b : tcgcgttgGCTCTGGAAAGACCAACC*GTTGTTG
PST01_0081_F11.b : nnnncctgcggtgGCTCTGGAAAGAGCAACC*GTTGTCG
PST01_0071_A02.b : ntcgcggtgGCTCTGGAAAGAGCAACC*GTTGTCG
LVRM1_0047_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtacTGGAAAAGACGCAAACC*GTTGTTG
OVRM1_0098_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGAAAAGACGCAAACC*GTTGTTG
CLNT1_0127_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCCAAAGACGCAAACC*GTTGTTG
PST01_0021_C07.b : tgtgGCTCTGGAAGAGCAACC*GTTGTCG
KDN01_0081_H10.b : ctgtgGCTCTGGAAGAGCAACC*GTTGTTG
LVRM1_0166_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxctactggGGAAAAGACGCAAACC*GTTGTTG
LVRM1_0032_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAAAAAGACGCAAACC*GTTGTTG
LVR01_0091_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAAAAGACGCAAACC*GTTGTTG
BFLT1_0149_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCAAAGACGCAAACC*GTTGTTG
CBLT1_0039_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggCCCCAAGACCCATTTC*GTTGTCG
CLNT1_0114_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCCAAAGACGCAAACT*GTTGTTG
OVRT1_0088_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCCCAGAGACGCAAACC*GTTGTTG
PCT01_0004_D11.b : nnncccgttannnnnncctgcgttggctactGGAAAAGACGCAAACC*GTTGTTG
KDN01_0023_G06.b : ntttcgcgttggctctGGAAAAGACGCAAACC*GTTGTTG
SKNB1_0015_E01.b : nnggggttnnnnnnggtgcgttggctctggaAAAAAAGACGCAAACC*GTTGTTG
KDN01_0058_F04.b : tttcctgcggtggctctggAAAAAAGACGCAAACC*GTTGTTG
TES01_0017_B10.b : ccgctgtggctctggaAAATAGACGCAAACC*GTTGTTG
OVRM1_0194_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggCCAAAGACGCAAACC*GTTGTTG
LVRM1_0023_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAAAAACGCAAACC*GTTGTTG
SPL01_0010_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGAAAAGACGCAAACC*GTTGTTG
TCH01_0027_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAAAAGACGCAAACC*GTTGTTG
BFLT1_0011_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCAAAGACGCAAACC*GTTGTCG
THY01_0038_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctGGAAAGACGCAAACC*GTTGTTG
LNG01_0084_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAAAGACGCAAACC*GTTGTTG
ADR01_0097_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCAAAGACGCAAACC*GTTGTTG
OVRT1_0062_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCAAAGACGCAAACC*GTTGTTG
PCT01_0027_H04.b : nnnnggggatatnnnnnncctgcgggtgcaCTGGAAGAGCAACC*GTTGTCG
PCT01_0027_D06.b : nnnaaccagtgnnnnnnncctgcgggtgctCTGGAAGAGCAACC*GTTGTTG
PCT01_0016_B10.b : nnnnaaggtttnnnnnnncctgcggtggctaCTGGAAGAGCAACC*GTTGTCG
TES01_0053_E02.b : nttctgctgtggctCTGGAAGAGCAACC*GTTGTTG
PCT01_0005_D05.b : nnnngggttannnnnnncctgcgttggctCTGGAAGAGCAACC*GTTGTTG
PCT01_0025_G03.b : nnnnggcggaatnnnnnnactgcggtggctCTGGAAGAGCAACC*GTTGTCG
PCT01_0017_G06.b : nnngggttttannnnnncctgcgttggctCTGGAAGAGCAACC*GTTGTTG
PCT01_0033_D11.b : nccccattannnnnncctgcgttggctCTGGAAGAGCAACC*GTTGTTG
PTG01_0055_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtAAAAGACGCAAACC*GTTGTTG
PST01_0045_H09.b : nnnaactgcggtggctaTGGAAAGAGCAACC*GTTGTCG
PST01_0090_B12.b : nncctgcggtggctCTGGAAGAGCAACC*GTTGTTG
SKNB1_0007_B08.b : nnngggtcgctgtggctCTGGAAGAGCAACC*GTTGTTG
PST01_0030_C07.b : nnncctgcgttggctCTGGAAGAGCAACC*GTTGTCG
PST01_0056_G05.b : nnnaatcgctgtggctCTGGAAGAGCAACC*GTTGTTG
TES01_0101_B11.b : tttcccgcgttgctCTGGAAGAGCAACC*GTTGTTG
PCT01_0004_A06.b : nnnggggtaatnnnnncctgcgtttgctCTGGAAGAGCAACC*GTTGTCG
KDN01_0022_B09.b : ggcgttggctCTGGAAGAGCAACC*GTTGTTG
CLNT1_0077_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctctactAAAAGACGCAAACC*GTTGTTG
PST01_0055_G07.b : nnnnggctgctgtggctCTGGAAGAGCAACC*GTTGTTG
PCT01_0005_E11.b : nnnnccgttttnnnnnncctgcggtggctaCTGGAAGAGCAACC*GTTGTCG
PST01_0041_C07.b : tttttcctggcgtttggctaCTGGAAGAGCAACC*GTTGTCG
PCT01_0033_C04.b : nnnggcgcttttaannncctgcgttggcaCTGGAAGAGCAACC*GTTGTCG
KDN01_0056_F04.b : ntcgcgttggctCTGGAAGAGCAACC*GTTGTTG
PST01_0023_G04.b : ttaatggctgtggctaCTGGAAGAGCAACC*GTTGTCG
PST01_0063_B02.b : nntccgctgtggctCTGGAAGACCAACC*GTTGTTG
KDN01_0009_A02.b : nncccttttnnnnncctgcgttggctCTGGAAGAGCAACC*GTTGTTG
PST01_0045_A07.b : nttttcggctgtggctCTGGAAGAGCAACC*GTTGTCG
PST01_0037_C09.b : ggctaCTGGAAGAGCAACC*GTTGTCG
SPL01_0066_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAAAGACGCAAACC*GTTGTTG
KDN01_0073_C06.b : nttcctgctgtggctCTGGAAGAGCAACC*GTTGTTG
KDN01_0094_D06.b : nnnnggctgcggtggctCTGGAAGACCAACC*GTTGTTG
PST01_0026_C09.b : nnncctgctgtggctCTGGAAGAGCAACC*GTTGTTG
KDN01_0069_C10.b : nttcgctgtggctCTGGAAGAGCAACC*GTTGTTG
PCT01_0006_F12.b : nnnncccgctannnnnncctgcggtggctaTGGAAAGAGCAACC*GTTGTCG
PST01_0069_G10.b : tttttcctgctgtggctCTGGAAGAGCAACC*GTTGTCG
PST01_0020_H11.b : ttttattccctgcggtggctCTGGAAGAGCAACC*GTTGTCG
KDN01_0085_B12.b : ntttttactgctgttgctCTGGAAGAGCAACC*GTTGTTG
KDN01_0096_B01.b : nnncctgctgtggctCTGGAAGAGCAACC*GTTGTTG
KDN01_0034_A08.b : nntttcctgctgtggctCTGGAAGAGCAACC*GTTGTTG
TCH01_0085_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAAAGACGCAAACC*GTTGTTG
THY01_0117_E09.b : cgtccggtccggaatcctcgagcacgtggcctactggaaAAAGACGCAAACC*GTTGTTG
LVR01_0036_H08.b : ggtccgcgaattcctccgagcactgccccgttctactggAAAGACGCAAACC*GTTGTTG
LVRM1_0005_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAAGACGCAAACC*GTTGTTG
OVRT1_0102_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAAGACGCAAACC*GTTGTCG
PTG01_0069_G11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnAAAGACGCAAACC*GTTGTTG
LNG01_0069_C07.b : xxxxatataaaaggtagccgaggtgggggcgcgcgccccAAAGACGCAAACC*GTTGTTG
PTG01_0025_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAAGACGCAAACC*GTTGTTG
OVRT1_0098_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggTAAGACGCAAACC*GTTGTCG
OVRT1_0013_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgtaTAAGACGCAAACC*GTTGTCG
BFLT1_0077_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgcgtTAAGACGCAAACC*GTTGTTG
CLNT1_0125_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAAGACGCAAACC*GTTGTCG
SPL01_0096_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAAGACGCAAACC*GTTGTTG
BFLT1_0100_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAAGACGCAAACC*GTTGTCG
LVR01_0092_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAAGACGCAAACC*GTTGTTG
OVRT1_0066_A10.b : xxxxxxxxxxxxggtagccgaggtgggggcgcgcgccccAAAGACGCAAACC*GTTGTCG
KDN01_0066_D06.b : nnnncccactgtggctTGGAAGAGCAACC*GTTGTTG
TCH01_0097_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAAGACGCAAACC*GTTGTTG
UTR01_0096_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAAGACGCAAACC*GTTGTTG
LNG01_0081_D01.b : ccgtcttcagccgcagcatcgagtcggccttgttggccaAAAGACGCAAACC*GTTGTTG
ITT01_0065_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccCAAGACGCAAACC*GTTGTTG
ITT01_0054_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAAGACGCAAACC*GTTGTTG
TCH01_0007_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAAGACGCAAACC*GTTGTTG
KDN01_0044_D12.b : ttttaccgctgtggctaTGGAAGAGCAACC*GTTGTTG
LVRM1_0121_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaatcAAGACGCAAACA*ATTGTTG
LVRM1_0040_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcAAGACGCAAACC*GTTGTTG
OVRM1_0062_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGACGCANACC*GTTGTTG
OVRM1_0084_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAAGACGCAAACC*GTTGTTG
PCT01_0032_F09.b : nnnngggggtaannnnnnccggcggtggcacGGAAGACCAACC*GTTGTCG
PCT01_0016_C12.b : nnnnccggtaannnnnaactgaggtggctntggGGAAGAGCAACC*GTTGTTG
PCT01_0026_D09.b : nnnccggcttnnnnnncctgcggttggccGGAAGACCAACC*GTTGTCG
OVRT1_0081_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgaTAGACGCAAACC*GTTGTCG
PCT01_0019_G02.b : nnnaactgttnnnnnnnncctgcgttggctaGAAAGAGCAACC*GTTGTTG
KDN01_0098_C05.b : nnnnnggctgcgttggctctggaAAGACGC*AACC*GTTGTTG
SPL01_0008_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgggAAGACGCAAACC*GTTGTTG
PST01_0085_B03.b : tttcctgcgttggctctggaAAGACGC*AACC*GTTGTCG
OVRT1_0145_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggAGACGCAAACC*GTTGTTG
CLNT1_0005_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtcgtttAGACGCAAACC*GTTGTTG
CLNT1_0151_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgatAGACGCAAACC*GTTGTCG
BFLT1_0039_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccttAGACGCAAACC*GTTGTCG
PCT01_0010_H01.b : nnnccggtttttngttcctgcggtggcAAAGAGCAACC*GTTGTCG
PST01_0059_C11.b : tttttcctgcgttggctctggtAAAGAGCAACC*GTTGTCG
OVRM1_0174_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0194_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgaaGACGC*AACC*GTTGTTG
OVRM1_0036_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0009_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0194_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0081_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0085_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0172_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0045_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0172_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACACAAACC*GTTGTTG
LVRM1_0011_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0085_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0181_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0218_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0044_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0048_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0092_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0071_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0100_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0010_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0130_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVR01_0066_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVR01_0081_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0198_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0082_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVR01_0077_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGC*AACC*GTTGTTG
ADR01_0062_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0026_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0075_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
ADR01_0026_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0158_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0028_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0114_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0076_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0134_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0010_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0003_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0103_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0195_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0163_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0166_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0103_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0024_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0185_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0003_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0136_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0123_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0105_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0205_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0205_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0178_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0150_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0115_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0171_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
THY01_0018_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0161_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0081_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0109_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
PTG01_0038_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0039_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0122_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0099_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0196_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0091_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0053_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0091_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0181_A05.b : nnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACCNGTTGTTG
LVRM1_0035_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
THY01_0007_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0199_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0145_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0110_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0007_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0066_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
ADR01_0028_E06.b : ctggacggtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0148_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0170_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0104_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVR01_0025_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
PTG01_0067_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0058_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0035_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0137_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0078_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGC*AACC*GTTGTTG
LVRM1_0077_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0080_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
SMG01_0089_C05.b : nnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0154_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0057_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0091_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0092_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0034_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0138_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0019_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
SPL01_0046_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0025_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0014_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0010_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACG*GTTGTTG
LVRM1_0142_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0108_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0022_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0143_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCATACC*GTTGTTG
LVRM1_0145_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0107_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0141_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0083_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0019_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0138_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0093_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
THY01_0068_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
PTG01_0042_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRM1_0021_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVR01_0090_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0002_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
CLNT1_0129_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
UTR01_0009_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
SPL01_0084_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0143_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
PBL01_0007_B09.b : gaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
SPL01_0010_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0144_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
SPL01_0012_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
ADR01_0011_G03.b : ctggacggtcggaattxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
CLNT1_0006_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
PTG01_0057_H01.b : tcggntccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
CLNT1_0140_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVR01_0058_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0116_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVR01_0060_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
BFLT1_0111_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
PTG01_0070_C08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxGACGCAAACCGNTTGTTG
LVR01_0029_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
UTR01_0085_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
CLNT1_0128_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVR01_0081_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
SPL01_0103_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
UTR01_0076_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVR01_0028_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0148_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
LVR01_0009_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVR01_0069_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
PCT01_0022_B12.b : nnncccgcnnnnannnncctgcgttggctcggnAAGAGCAACC*GTTGTCG
OVRT1_0130_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0136_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
CLNT1_0146_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0012_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0130_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0065_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
TCH01_0021_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0135_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0132_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0013_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
PTG01_0035_B03.b : ggnaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
BFLT1_0058_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
CLNT1_0138_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0100_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
PTG01_0047_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0029_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0125_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
BFLT1_0076_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
PTG01_0105_A09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0136_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0053_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
SPL01_0059_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVR01_0064_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0152_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
CLNT1_0082_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctacaccgGACGCAAANN*GTTGTCG
BFLT1_0015_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
CLNT1_0064_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
ITT01_0015_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0141_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
BFLT1_0075_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctttGACGCAAACC*GTTGTCG
LVR01_0055_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0028_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0091_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0009_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
PTG01_0025_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
UTR01_0099_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0134_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
BFLT1_0063_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
CLNT1_0146_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
CLNT1_0151_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGACGCAAACC*GTTGTCG
BFLT1_0028_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
CLNT1_0117_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0111_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0115_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0045_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0047_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0076_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
CLNT1_0072_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0004_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0006_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0126_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0065_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0135_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
CLNT1_0151_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgatGACGCAAACC*GTTGTTG
OVRT1_0030_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
CLNT1_0130_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0044_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0124_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0033_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0150_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
BFLT1_0056_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
BFLT1_0057_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGACGCAAACC*GTTGTCG
CLNT1_0013_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0102_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0082_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
BFLT1_0115_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
CLNT1_0142_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0063_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0147_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
BFLT1_0029_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
TCH01_0048_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVR01_0054_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
CLNT1_0061_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
BFLT1_0015_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0107_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
ITT01_0058_G06.b : ggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
SPL01_0052_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
BFLT1_0096_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
CLNT1_0033_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
SPL01_0078_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
ADR01_0055_D06.b : nnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
ADR01_0055_E11.b : nnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0073_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0035_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
LVR01_0092_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0129_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0051_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0130_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0042_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
UTR01_0081_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0065_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
SPL01_0038_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
CLNT1_0037_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0042_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0068_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0086_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
BFLT1_0030_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVR01_0003_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
PCT01_0020_H08.b : nnnggtcgttttnnnnnncctgcgttggctcgnAAGAGCAACC*GTTGTCG
OVRT1_0044_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVR01_0052_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0085_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
LVR01_0046_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVR01_0079_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0043_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
LVR01_0092_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0003_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0079_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVR01_0040_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
BFLT1_0056_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
BFLT1_0019_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVR01_0100_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0085_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
LVR01_0090_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVR01_0021_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVR01_0055_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
CLNT1_0144_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
THY01_0088_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
THY01_0074_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LNG01_0004_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
SPL01_0035_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVR01_0006_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVR01_0001_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GATGTTG
LVR01_0071_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVR01_0061_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
BFLT1_0023_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
BFLT1_0058_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0048_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
BFLT1_0021_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
PBL01_0011_E05.b : ggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
CLNT1_0038_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
BFLT1_0091_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
BFLT1_0080_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
ADR01_0064_F08.b : ctggacggtcggaattctccxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVR01_0102_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
CLNT1_0125_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVR01_0028_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
ADR01_0047_C10.b : ctggtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVR01_0091_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
UTR01_0082_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LNG01_0006_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0081_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
BFLT1_0010_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
PBL01_0032_E08.b : ggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
LVR01_0061_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0050_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
ITT01_0074_H10.b : gaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LNG01_0010_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVR01_0051_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVR01_0104_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0082_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
PCT01_0012_E07.b : nnngggttatnnnnnncctgcgtttggcAAGAGCAACC*GTTGTCG
LVR01_0091_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
SPL01_0002_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0047_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVR01_0020_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
CLNT1_0090_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVR01_0059_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
CLNT1_0066_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0013_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
CLNT1_0020_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
CLNT1_0075_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LNG01_0074_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
TCH01_0023_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LNG01_0025_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0043_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0087_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LNG01_0071_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0032_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0087_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0095_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0081_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LNG01_0056_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0083_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
PBL01_0094_F09.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
BFLT1_0035_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
UTR01_0049_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
CLNT1_0059_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
ADR01_0060_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
CLNT1_0086_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
BFLT1_0002_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0087_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
BFLT1_0021_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
TCH01_0038_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
CLNT1_0007_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0006_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0059_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0038_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
THY01_0090_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
CLNT1_0073_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0035_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
MLN01_0063_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
TCH01_0020_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
PBL01_0014_H05.b : tggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
CLNT1_0062_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
ITT01_0043_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
PBL01_0107_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVRT1_0094_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
ITT01_0040_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
CLNT1_0071_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
BFLT1_0001_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
ADR01_0095_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
ADR01_0071_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0067_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
TCH01_0037_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
OVRT1_0049_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
TCH01_0099_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
CLNT1_0007_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
CLNT1_0069_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
OVR01_0009_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
ADR01_0078_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
PBL01_0077_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTCG
ITT01_0034_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACGCAAACC*GTTGTTG
LVRM1_0081_H12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxtccACGCAAACC*GTTGTTG
LVRM1_0034_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgatacACGCAAACC*GTTGTTG
PCT01_0009_E06.b : gccttttnncctacgtggctatggAGAGCAACC*GTTGTTG
PCT01_0014_G04.b : nncccggttnnnnnnncctgcggtggctctggAGACCAACC*GTTGTCG
TES01_0029_H03.b : ctgtggctctggatAGAGCAACC*GTTGTTG
KDN01_0080_F11.b : nncctgctgtggctctggAGAGCAACC*GTTGTTG
TCH01_0013_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaACGCAAACC*GTTGTTG
BFLT1_0041_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGCAAACC*GTTGTTG
OVRM1_0193_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGCAAACC*GTTGTTG
OVRM1_0049_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGCANACC*GTTGTTG
OVRT1_0131_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGCAAACC*GTTGTCG
CLNT1_0119_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGCAAACC*GTTGTCG
OVRT1_0063_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGCAAACC*GTTGTTG
KDN01_0037_G08.b : aaaaaactgcggtggctctggaaaggCGC*AACC*GTTGTTG
LVRM1_0111_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgatGCAAACC*GTTGTTG
OVRT1_0064_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAAACC*GTTGTCG
SKNB1_0001_H12.b : cccactgttgctacggaagacCAAACC*GTTGTTG
BFLT1_0141_H08.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcccttAAACC*GTTGTTG
PCT01_0018_D09.b : nnnnccggatttnnnnnnggtgcgttggctctggaacCAACC*GTTGTCG
TES01_0098_C03.b : tttttccggcgtggctcggcaagaggAACC*GTTGTTG
PCT01_0008_E12.b : nnnggggttnnnnnnncctgcggtgtgcangggcaaC*GTTGTCG
BMWN1_0098_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaaaagacgccctttaTGTTG
TCH01_0008_F02.b : tggggggttggacttgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0030_D09.b : nnnnnggctaggacttanacxxxxxxxxxxxxxxxxx
PTG01_0034_D02.b :
20110601C-001853 : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
---------+---------+---------+---------+---------+---------+ 158
BFLT1_0039_E12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
KDN01_0080_C07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*TTGGCATCCGGG*AGCGTCGCC
TES01_0111_H06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0128_A12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
SPLT1_0062_B09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
ADR01_0045_B12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0010_D11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0010_A09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0017_E02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CBLT1_0036_G09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0010_A12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PST01_0039_E12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
KDN01_0049_H09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGCCTTC*CTGGCATCCGGG*AGCGTCGCC
PST01_0026_G03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGT*TTGGCATCCGGG*AGCGTCGCC
KDN01_0024_H12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PST01_0081_F11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PST01_0071_A02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCCCCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0047_B09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0098_H11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0127_F11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PST01_0021_C07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGT*CTGGCATCCGGG*AGCGTCGCC
KDN01_0081_H10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0166_G05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0032_G08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0091_D07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0149_C03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CBLT1_0039_B01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0114_C01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0088_E07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0004_D11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCGTCCGGG*AGCGTCGCC
KDN01_0023_G06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
SKNB1_0015_E01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
KDN01_0058_F04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
TES01_0017_B10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0194_H01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0023_E02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
SPL01_0010_B08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
TCH01_0027_H12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0011_C07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
THY01_0038_G04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LNG01_0084_A12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
ADR01_0097_G07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0062_B09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0027_H04.b : CGGCG*GTTGTGGG*ATGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0027_D06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0016_B10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
TES01_0053_E02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0005_D05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0025_G03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0017_G06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0033_D11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PTG01_0055_E05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PST01_0045_H09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PST01_0090_B12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
SKNB1_0007_B08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCCTCTGA*CTGGCCTCCGGG*AGCGTCGCC
PST01_0030_C07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTTGCATCCGGG*AGCGTCGCC
PST01_0056_G05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
TES01_0101_B11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0004_A06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
KDN01_0022_B09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0077_A04.b : CGGCG*GTTGTGGG*CTCTTGAGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCT
PST01_0055_G07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0005_E11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PST01_0041_C07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0033_C04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
KDN01_0056_F04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PST01_0023_G04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PST01_0063_B02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
KDN01_0009_A02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PST01_0045_A07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PST01_0037_C09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
SPL01_0066_C08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
KDN01_0073_C06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
KDN01_0094_D06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PST01_0026_C09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
KDN01_0069_C10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0006_F12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PST01_0069_G10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PST01_0020_H11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
KDN01_0085_B12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
KDN01_0096_B01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
KDN01_0034_A08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
TCH01_0085_D07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
THY01_0117_E09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0036_H08.b : CGGCG*GTTGTGGG*CTGCTGTGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0005_C03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0102_G01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PTG01_0069_G11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LNG01_0069_C07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PTG01_0025_G02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0098_H09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0013_B11.b : CGGCG*GTTGTGGG*CTGCTGTGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0077_C09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0125_F02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
SPL01_0096_C03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0100_F08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0092_B08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0066_A10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
KDN01_0066_D06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
TCH01_0097_G11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
UTR01_0096_F05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LNG01_0081_D01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
ITT01_0065_C05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
ITT01_0054_H05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
TCH01_0007_H01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
KDN01_0044_D12.b : TGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0121_A01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0040_E03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0062_B06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0084_B11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0032_F09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0016_C12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0026_D09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0081_G01.b : CGGCG*GTTGTGGG*CTGCTGCCAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0019_G02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
KDN01_0098_C05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
SPL01_0008_B02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PST01_0085_B03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCCCCTTC*ATGGCATCCGGG*AGCGTCGCC
OVRT1_0145_D03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0005_H07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0151_D06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0039_B06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0010_H01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PST01_0059_C11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0174_B09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0194_C10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0036_E08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0009_D02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0194_H10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0081_F04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0085_D09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0172_B06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0045_H04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0172_F10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0011_E08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0085_D04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0181_D04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0218_E12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0044_D07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0048_D10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0092_D03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0071_D03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0100_D04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0010_G10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0130_H11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVR01_0066_F10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVR01_0081_D01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0198_B08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0082_H07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVR01_0077_E02.b : CGGCG*CTTGTGGG*CTGCTGCCAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
ADR01_0062_H07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0026_F10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0075_A03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
ADR01_0026_H11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0158_H03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0028_E06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCAGG*AGCGTCGCC
LVRM1_0114_C08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0076_D10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0134_D12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0010_B07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0003_C01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0103_H12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0195_B08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0163_D10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0166_C02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0103_E02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0024_E07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0185_C01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0003_B02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0136_F02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0123_C05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0105_E03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0205_B08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0205_D03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0178_E08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0150_E03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0115_C02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0171_F01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
THY01_0018_B02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0161_F09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0081_F12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0109_F05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PTG01_0038_D05.b : CGGCG*GTTGTGGG*C*GCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0039_B10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0122_H09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0099_E10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0196_E11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0091_G06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0053_A10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0091_D10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0181_A05.b : CGGCGNGTTGTGGGNCTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGGAAGCGTCGCC
LVRM1_0035_G07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
THY01_0007_F03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0199_E12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0145_B08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0110_C10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0007_C07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0066_F10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
ADR01_0028_E06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGTGTCGCC
LVRM1_0148_F04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0170_C05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0104_E09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0025_F11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PTG01_0067_E03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0058_G05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0035_F11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0137_F08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0078_B08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0077_G01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0080_C08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
SMG01_0089_C05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0154_G07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0057_G05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0091_B01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0092_C05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0034_C08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0138_C04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0019_H04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
SPL01_0046_F01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0025_F11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0014_D11.b : CGGCG*GTTGTGGG*CTGCTGCGAATGGGTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0010_F12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0142_F12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0108_E10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0022_E09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0143_C09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0145_G10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0107_F12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0141_F10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0083_C09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0019_C08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0138_C01.b : CGGCG*GTTGTGGG*CTGCTCCTAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0093_A12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
THY01_0068_B10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PTG01_0042_E03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0021_C11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVR01_0090_F06.b : CGGCG*CCTGAGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0002_F09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0129_D11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
UTR01_0009_F11.b : CGGCG*GTTGTGGG*TTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
SPL01_0084_A09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0143_H08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PBL01_0007_B09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
SPL01_0010_A03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0144_A09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
SPL01_0012_B01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
ADR01_0011_G03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0006_A02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PTG01_0057_H01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0140_H06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVR01_0058_F09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0116_H07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0060_E06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0111_G09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PTG01_0070_C08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0029_D09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
UTR01_0085_B10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0128_H05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0081_D05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
SPL01_0103_E10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
UTR01_0076_F02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0028_C02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0148_H06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0009_F10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVR01_0069_B03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0022_B12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0130_G06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0136_B02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0146_G05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0012_F11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0130_D09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0065_D09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCGTCCGGG*AGCGTCGCC
TCH01_0021_H09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0135_H10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0132_H05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0013_D03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PTG01_0035_B03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0058_H03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0138_H06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0100_D01.b : CGGCG*GCTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PTG01_0047_A06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0029_D07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0125_D02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0076_G10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PTG01_0105_A09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0136_C07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0053_F03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
SPL01_0059_F05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVR01_0064_D06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0152_B06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0082_G11.b : CGGCG*GTTGTGGG*CTCCTTATAA***AGGGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0015_F05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0064_A04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
ITT01_0015_B08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0141_G10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0075_D12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0055_G05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0028_H02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0091_D02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0009_E06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PTG01_0025_G07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
UTR01_0099_E01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0134_H02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0063_F09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0146_A02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0151_F11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0028_B09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0117_F09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0111_F08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0115_H02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0045_H10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0047_D11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0076_H04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0072_H03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0004_A11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0006_B04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0126_C01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0065_B05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0135_G05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0151_H04.b : CGGCA*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0030_F11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0130_C12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0044_D08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0124_A10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0033_A07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0150_A07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0056_B08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0057_C07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0013_B03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0102_B10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0082_D08.b : CGGCG*GCTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0115_G03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0142_B04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0063_H04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0147_D01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0029_C03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
TCH01_0048_D09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0054_F05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0061_E08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0015_C05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0107_F12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
ITT01_0058_G06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
SPL01_0052_F05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0096_A12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0033_A04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
SPL01_0078_F12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
ADR01_0055_D06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
ADR01_0055_E11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0073_H06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0035_H01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0092_C06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*GGCGTCGCC
OVRT1_0129_D10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0051_B10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0130_B04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0042_B07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
UTR01_0081_C01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0065_F03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
SPL01_0038_C10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0037_A04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0042_B03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0068_H08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0086_D04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0030_E03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0003_E09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0020_H08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0044_H04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0052_G08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0085_E05.b : CGGCG*GTTGTGGC*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0046_G12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0079_G10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0043_C12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0092_E05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0003_B09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0079_H04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVR01_0040_F11.b : *GGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0056_G09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0019_B03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVR01_0100_F12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0085_D07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0090_D03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0021_G04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0055_H05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0144_H02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
THY01_0088_G06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
THY01_0074_D01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LNG01_0004_E12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
SPL01_0035_G04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVR01_0006_E01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVR01_0001_H09.b : CGGTG*GTTGTGGG*CTGCTGCTAA***GACGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0071_G09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0061_E07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0023_E06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0058_F10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0048_H07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0021_B03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PBL01_0011_E05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0038_D09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0091_B02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0080_C09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
ADR01_0064_F08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCCTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0102_H08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0125_H02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVR01_0028_D04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
ADR01_0047_C10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0091_C06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
UTR01_0082_A01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LNG01_0006_F02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0081_C12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0010_A11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PBL01_0032_E08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0061_D08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGCCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0050_H10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
ITT01_0074_H10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LNG01_0010_D12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0051_C06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0104_H05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0082_C05.b : CGGCG*GTTGCGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0012_E07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0091_B07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
SPL01_0002_C04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0047_C06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0020_B01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0090_D09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVR01_0059_B05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0066_G09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0013_B01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0020_F10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0075_F12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LNG01_0074_E03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
TCH01_0023_G02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LNG01_0025_D02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0043_D05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0087_E11.b : CGGCG*GTTGTGGG*CTGCCGCTAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LNG01_0071_F01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0032_G02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0087_E04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0095_A12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0081_D10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LNG01_0056_F12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0083_E04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PBL01_0094_F09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0035_H12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
UTR01_0049_H04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0059_E07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
ADR01_0060_D10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGACGCC
CLNT1_0086_B02.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0002_G04.b : CGGCG*GTTGTGGG*CTGCTGCTAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0087_F12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0021_F04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
TCH01_0038_H06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0007_E08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0006_G04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0059_G05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0038_G01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
THY01_0090_A11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0073_G11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0035_C11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
MLN01_0063_B11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
TCH01_0020_B10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PBL01_0014_H05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0062_E08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
ITT01_0043_E06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PBL01_0107_A01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0094_D07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
ITT01_0040_A10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0071_B01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0001_F12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
ADR01_0095_B06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
ADR01_0071_C04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0067_B01.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
TCH01_0037_D12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0049_E07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
TCH01_0099_B05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0007_F07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0069_C11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVR01_0009_F07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
ADR01_0078_F09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PBL01_0077_H04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
ITT01_0034_D10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
LVRM1_0081_H12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCCGG*AGCGTCGCC
LVRM1_0034_H10.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0009_E06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0014_G04.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
TES01_0029_H03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
KDN01_0080_F11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGCCTGTTCATCCGGG*AGCGTCGCC
TCH01_0013_A07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0041_A05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0193_D05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRM1_0049_A03.b : CGGTG*GCTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0131_E09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
CLNT1_0119_F11.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0063_B06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
KDN01_0037_G08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTC*CC*CTAAAATCCGGG*AGCGTCGCC
LVRM1_0111_F05.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
OVRT1_0064_A06.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
SKNB1_0001_H12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCCTCTGC*CTGGCATCCGGG*AGCGTCGCC
BFLT1_0141_H08.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCCTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0018_D09.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
TES01_0098_C03.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
PCT01_0008_E12.b : CGGCG*GTTGTGGG*CTGCTGCGAA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
BMWN1_0098_H07.b : CGGCG*GTTGTGGG*CTGCTGCGAA***GTCGTCCCCCCTGGCATCCGGG*AGCGTCGCC
TCH01_0008_F02.b : xxxxxxxxxxxxxxxxxxxxxxtgA***ATCGTCTGC*CTGGCATCCGGG*AGCGTCGCC
SPL01_0030_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCCGGG*AGCGTCGCC
PTG01_0034_D02.b :
20110601C-001853 : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
---------+---------+---------+---------+---------+---------+ 218
BFLT1_0039_E12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
KDN01_0080_C07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
TES01_0111_H06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0128_A12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
SPLT1_0062_B09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
ADR01_0045_B12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0010_D11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0010_A09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAGCCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0017_E02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CBLT1_0036_G09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0010_A12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PST01_0039_E12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
KDN01_0049_H09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PST01_0026_G03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
KDN01_0024_H12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PST01_0081_F11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PST01_0071_A02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0047_B09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0098_H11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0127_F11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PST01_0021_C07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
KDN01_0081_H10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0166_G05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0032_G08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0091_D07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0149_C03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CBLT1_0039_B01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0114_C01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0088_E07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0004_D11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
KDN01_0023_G06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
SKNB1_0015_E01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
KDN01_0058_F04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
TES01_0017_B10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0194_H01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0023_E02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
SPL01_0010_B08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
TCH01_0027_H12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0011_C07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
THY01_0038_G04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LNG01_0084_A12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
ADR01_0097_G07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCTTGGTGAAGA
OVRT1_0062_B09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0027_H04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0027_D06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0016_B10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
TES01_0053_E02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0005_D05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0025_G03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0017_G06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0033_D11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PTG01_0055_E05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PST01_0045_H09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PST01_0090_B12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
SKNB1_0007_B08.b : GAGCCCACAGCGCCCCTAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PST01_0030_C07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PST01_0056_G05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
TES01_0101_B11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0004_A06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
KDN01_0022_B09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0077_A04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PST01_0055_G07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0005_E11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PST01_0041_C07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0033_C04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
KDN01_0056_F04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PST01_0023_G04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PST01_0063_B02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
KDN01_0009_A02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PST01_0045_A07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PST01_0037_C09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
SPL01_0066_C08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
KDN01_0073_C06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
KDN01_0094_D06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PST01_0026_C09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
KDN01_0069_C10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0006_F12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PST01_0069_G10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PST01_0020_H11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
KDN01_0085_B12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
KDN01_0096_B01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
KDN01_0034_A08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
TCH01_0085_D07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
THY01_0117_E09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0036_H08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0005_C03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0102_G01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PTG01_0069_G11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LNG01_0069_C07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PTG01_0025_G02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0098_H09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0013_B11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0077_C09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0125_F02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
SPL01_0096_C03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0100_F08.b : GAGCCCACAGCGCCGCCAACGTGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0092_B08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0066_A10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
KDN01_0066_D06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
TCH01_0097_G11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
UTR01_0096_F05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LNG01_0081_D01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
ITT01_0065_C05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
ITT01_0054_H05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
TCH01_0007_H01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
KDN01_0044_D12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0121_A01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0040_E03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0062_B06.b : GAGCCCACAGCGCCGCCCACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0084_B11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0032_F09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0016_C12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0026_D09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0081_G01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0019_G02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAGGA
KDN01_0098_C05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
SPL01_0008_B02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PST01_0085_B03.b : GAGCCCACAGCGCCGCCTACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0145_D03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0005_H07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0151_D06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0039_B06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0010_H01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PST01_0059_C11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0174_B09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0194_C10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0036_E08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0009_D02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0194_H10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0081_F04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0085_D09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0172_B06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0045_H04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0172_F10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0011_E08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0085_D04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0181_D04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0218_E12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0044_D07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0048_D10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0092_D03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0071_D03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0100_D04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0010_G10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0130_H11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVR01_0066_F10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVR01_0081_D01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCATGGTGAAGA
LVRM1_0198_B08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0082_H07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVR01_0077_E02.b : GAGCCCACAGCGCCCCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
ADR01_0062_H07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0026_F10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0075_A03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
ADR01_0026_H11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0158_H03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0028_E06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0114_C08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0076_D10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0134_D12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0010_B07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0003_C01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0103_H12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0195_B08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0163_D10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0166_C02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0103_E02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0024_E07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0185_C01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0003_B02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0136_F02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0123_C05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0105_E03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0205_B08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0205_D03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0178_E08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0150_E03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0115_C02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0171_F01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
THY01_0018_B02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0161_F09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0081_F12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0109_F05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PTG01_0038_D05.b : GAGCCCACAGCGCCGCCAACAT**AGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0039_B10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0122_H09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0099_E10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0196_E11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0091_G06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0053_A10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0091_D10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0181_A05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0035_G07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
THY01_0007_F03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0199_E12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0145_B08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0110_C10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0007_C07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0066_F10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
ADR01_0028_E06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0148_F04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAACCCGTCACGCTCCTGGTGAAGA
OVRM1_0170_C05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0104_E09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0025_F11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PTG01_0067_E03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0058_G05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0035_F11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0137_F08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0078_B08.b : GAGCCCACAGCGCCGCCNACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0077_G01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAGGA
LVRM1_0080_C08.b : GAGCCCACAGCGCCGCCCACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
SMG01_0089_C05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0154_G07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0057_G05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0091_B01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0092_C05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCTGTCACGCTCCTGGTGAAGA
OVRM1_0034_C08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0138_C04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0019_H04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
SPL01_0046_F01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0025_F11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0014_D11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0010_F12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0142_F12.b : GAGCCCACAGCGCCGCGAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0108_E10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0022_E09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0143_C09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0145_G10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0107_F12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0141_F10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0083_C09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0019_C08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0138_C01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0093_A12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
THY01_0068_B10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PTG01_0042_E03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0021_C11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVR01_0090_F06.b : GAGCCCACAGCGCCTCCAACATGGACCCGCAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0002_F09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0129_D11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
UTR01_0009_F11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
SPL01_0084_A09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0143_H08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PBL01_0007_B09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
SPL01_0010_A03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0144_A09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
SPL01_0012_B01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
ADR01_0011_G03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0006_A02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PTG01_0057_H01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0140_H06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVR01_0058_F09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGCAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0116_H07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0060_E06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0111_G09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PTG01_0070_C08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0029_D09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
UTR01_0085_B10.b : GAGCCCACAGCGCCGCCAACGTGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0128_H05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0081_D05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
SPL01_0103_E10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
UTR01_0076_F02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0028_C02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0148_H06.b : GAGCCCACAGCGCCGCCAACATGGGGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0009_F10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVR01_0069_B03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGCAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0022_B12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0130_G06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0136_B02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0146_G05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0012_F11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0130_D09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0065_D09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCAAGCCCGTCACGCTCCTGGTGAAGA
TCH01_0021_H09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0135_H10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0132_H05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0013_D03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PTG01_0035_B03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0058_H03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0138_H06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0100_D01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PTG01_0047_A06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0029_D07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0125_D02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0076_G10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PTG01_0105_A09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0136_C07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0053_F03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
SPL01_0059_F05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVR01_0064_D06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGCAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0152_B06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0082_G11.b : GAGCCCACAGCGCCGCCAACATGGGGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0015_F05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0064_A04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGGACCCGAGCCCGTCACGCTCCTGGTGAAGA
ITT01_0015_B08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0141_G10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0075_D12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0055_G05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0028_H02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0091_D02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0009_E06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PTG01_0025_G07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTCGTGAAGA
UTR01_0099_E01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGCAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0134_H02.b : AAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0063_F09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0146_A02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0151_F11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0028_B09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0117_F09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0111_F08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0115_H02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0045_H10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0047_D11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0076_H04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0072_H03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0004_A11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0006_B04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0126_C01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGATGA
OVRT1_0065_B05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0135_G05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0151_H04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0030_F11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0130_C12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0044_D08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0124_A10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0033_A07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0150_A07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0056_B08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0057_C07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0013_B03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0102_B10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0082_D08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0115_G03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0142_B04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0063_H04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0147_D01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0029_C03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
TCH01_0048_D09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0054_F05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0061_E08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0015_C05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0107_F12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
ITT01_0058_G06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
SPL01_0052_F05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0096_A12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0033_A04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
SPL01_0078_F12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
ADR01_0055_D06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
ADR01_0055_E11.b : GAGCCTACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0073_H06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0035_H01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0092_C06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0129_D10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0051_B10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0130_B04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0042_B07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
UTR01_0081_C01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGCAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0065_F03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
SPL01_0038_C10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0037_A04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0042_B03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0068_H08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0086_D04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0030_E03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0003_E09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0020_H08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0044_H04.b : GAGCCCACAGCGCCGCCGACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0052_G08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0085_E05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0046_G12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0079_G10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0043_C12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0092_E05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0003_B09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0079_H04.b : GAGCCCACAGCGCCGCCAATATGGAGTCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVR01_0040_F11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0056_G09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0019_B03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVR01_0100_F12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGCAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0085_D07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0090_D03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0021_G04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0055_H05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0144_H02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
THY01_0088_G06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
THY01_0074_D01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LNG01_0004_E12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
SPL01_0035_G04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVR01_0006_E01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGCAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVR01_0001_H09.b : CAGCCCACAACGACGCCAACATGGAGCCTCAACCCGAGCCCGTCACGCTCCTGGGGAAGA
LVR01_0071_G09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0061_E07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0023_E06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0058_F10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0048_H07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0021_B03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PBL01_0011_E05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0038_D09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0091_B02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0080_C09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
ADR01_0064_F08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0102_H08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0125_H02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVR01_0028_D04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
ADR01_0047_C10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0091_C06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
UTR01_0082_A01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGCAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LNG01_0006_F02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0081_C12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0010_A11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PBL01_0032_E08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0061_D08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0050_H10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
ITT01_0074_H10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LNG01_0010_D12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0051_C06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0104_H05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0082_C05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0012_E07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0091_B07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
SPL01_0002_C04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0047_C06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0020_B01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0090_D09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVR01_0059_B05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0066_G09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0013_B01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0020_F10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0075_F12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LNG01_0074_E03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
TCH01_0023_G02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LNG01_0025_D02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0043_D05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0087_E11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LNG01_0071_F01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0032_G02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGCCACGCTCCTGGTGAAGA
OVRT1_0087_E04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0095_A12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0081_D10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LNG01_0056_F12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0083_E04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PBL01_0094_F09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0035_H12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
UTR01_0049_H04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGCAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0059_E07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
ADR01_0060_D10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0086_B02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0002_G04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0087_F12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0021_F04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
TCH01_0038_H06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0007_E08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0006_G04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0059_G05.b : GAGTCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0038_G01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
THY01_0090_A11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0073_G11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0035_C11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
MLN01_0063_B11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
TCH01_0020_B10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PBL01_0014_H05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0062_E08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
ITT01_0043_E06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PBL01_0107_A01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0094_D07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
ITT01_0040_A10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0071_B01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0001_F12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
ADR01_0095_B06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
ADR01_0071_C04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0067_B01.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
TCH01_0037_D12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0049_E07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
TCH01_0099_B05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0007_F07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0069_C11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVR01_0009_F07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
ADR01_0078_F09.b : GAGCCTACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PBL01_0077_H04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
ITT01_0034_D10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0081_H12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0034_H10.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0009_E06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0014_G04.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
TES01_0029_H03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
KDN01_0080_F11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
TCH01_0013_A07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0041_A05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0193_D05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRM1_0049_A03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0131_E09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGGGCCCGTCACGCTCCTGGTGAAGA
CLNT1_0119_F11.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0063_B06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
KDN01_0037_G08.b : GAGCCCACAGCGCCGCCCCCTTGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
LVRM1_0111_F05.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
OVRT1_0064_A06.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
SKNB1_0001_H12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BFLT1_0141_H08.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0018_D09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
TES01_0098_C03.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PCT01_0008_E12.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
BMWN1_0098_H07.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
TCH01_0008_F02.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
SPL01_0030_D09.b : GAGCCCACAGCGCCGCCAACATGGAGCCGGAACCCGAGCCCGTCACGCTCCTGGTGAAGA
PTG01_0034_D02.b : nnggcgattannnntgagtaagcagcggnaxxxxxxxxxxxxxxxxxxxxx
20110601C-001853 : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
---------+---------+---------+---------+---------+---------+ 278
BFLT1_0039_E12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
KDN01_0080_C07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
TES01_0111_H06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0128_A12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
SPLT1_0062_B09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
ADR01_0045_B12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0010_D11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0010_A09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0017_E02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CBLT1_0036_G09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0010_A12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PST01_0039_E12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
KDN01_0049_H09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PST01_0026_G03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
KDN01_0024_H12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PST01_0081_F11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PST01_0071_A02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0047_B09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0098_H11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0127_F11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PST01_0021_C07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
KDN01_0081_H10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0166_G05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0032_G08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0091_D07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0149_C03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CBLT1_0039_B01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0114_C01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0088_E07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0004_D11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
KDN01_0023_G06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
SKNB1_0015_E01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
KDN01_0058_F04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
TES01_0017_B10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0194_H01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0023_E02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
SPL01_0010_B08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
TCH01_0027_H12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0011_C07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
THY01_0038_G04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LNG01_0084_A12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
ADR01_0097_G07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0062_B09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0027_H04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0027_D06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0016_B10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
TES01_0053_E02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0005_D05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0025_G03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0017_G06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0033_D11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCT
PTG01_0055_E05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PST01_0045_H09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PST01_0090_B12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
SKNB1_0007_B08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PST01_0030_C07.b : GCCCCAACCAGCACCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PST01_0056_G05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
TES01_0101_B11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0004_A06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
KDN01_0022_B09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0077_A04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGTAGCTGGAGCGTGGGCC
PST01_0055_G07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0005_E11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PST01_0041_C07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0033_C04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
KDN01_0056_F04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PST01_0023_G04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PST01_0063_B02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
KDN01_0009_A02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PST01_0045_A07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PST01_0037_C09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
SPL01_0066_C08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
KDN01_0073_C06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
KDN01_0094_D06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PST01_0026_C09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
KDN01_0069_C10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0006_F12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PST01_0069_G10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PST01_0020_H11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
KDN01_0085_B12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
KDN01_0096_B01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
KDN01_0034_A08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
TCH01_0085_D07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
THY01_0117_E09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0036_H08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0005_C03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0102_G01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PTG01_0069_G11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LNG01_0069_C07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PTG01_0025_G02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0098_H09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0013_B11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0077_C09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0125_F02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
SPL01_0096_C03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0100_F08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0092_B08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0066_A10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
KDN01_0066_D06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
TCH01_0097_G11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
UTR01_0096_F05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LNG01_0081_D01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
ITT01_0065_C05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
ITT01_0054_H05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
TCH01_0007_H01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
KDN01_0044_D12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0121_A01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0040_E03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0062_B06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0084_B11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0032_F09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0016_C12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0026_D09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0081_G01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0019_G02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
KDN01_0098_C05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
SPL01_0008_B02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PST01_0085_B03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0145_D03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0005_H07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0151_D06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0039_B06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0010_H01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PST01_0059_C11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0174_B09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0194_C10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0036_E08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0009_D02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0194_H10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0081_F04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0085_D09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0172_B06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0045_H04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0172_F10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0011_E08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0085_D04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0181_D04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0218_E12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0044_D07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0048_D10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0092_D03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0071_D03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0100_D04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0010_G10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0130_H11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVR01_0066_F10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVR01_0081_D01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0198_B08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0082_H07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVR01_0077_E02.b : GCCCCAACGAGGGCCATCGCGACTTGGAGCTGAGCGGCGACCGCCGCTGGAGCGTGGGCC
ADR01_0062_H07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0026_F10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0075_A03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
ADR01_0026_H11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0158_H03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0028_E06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0114_C08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0076_D10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0134_D12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0010_B07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0003_C01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0103_H12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0195_B08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0163_D10.b : GCCCCAACCAGCGCCGTCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0166_C02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0103_E02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0024_E07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0185_C01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0003_B02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0136_F02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0123_C05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0105_E03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0205_B08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0205_D03.b : GCCCCAACCGGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0178_E08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0150_E03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0115_C02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0171_F01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
THY01_0018_B02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0161_F09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAACCGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0081_F12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0109_F05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PTG01_0038_D05.b : GCCCCAACCAGCGCCCTCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0039_B10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0122_H09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0099_E10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0196_E11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0091_G06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0053_A10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0091_D10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0181_A05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0035_G07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
THY01_0007_F03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0199_E12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0145_B08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0110_C10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0007_C07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0066_F10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
ADR01_0028_E06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0148_F04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0170_C05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0104_E09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0025_F11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PTG01_0067_E03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0058_G05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0035_F11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0137_F08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0078_B08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0077_G01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0080_C08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
SMG01_0089_C05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0154_G07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0057_G05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0091_B01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0092_C05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0034_C08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0138_C04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGCGGGCC
LVRM1_0019_H04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
SPL01_0046_F01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0025_F11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0014_D11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0010_F12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0142_F12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGCCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0108_E10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGATGGAGCGTGGGCC
LVRM1_0022_E09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0143_C09.b : GCCCCAACCAGCGCCGTCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0145_G10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0107_F12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0141_F10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0083_C09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0019_C08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0138_C01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0093_A12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
THY01_0068_B10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PTG01_0042_E03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0021_C11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVR01_0090_F06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0002_F09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0129_D11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
UTR01_0009_F11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
SPL01_0084_A09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0143_H08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PBL01_0007_B09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
SPL01_0010_A03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0144_A09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
SPL01_0012_B01.b : GCCCCAACCAGTGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
ADR01_0011_G03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0006_A02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PTG01_0057_H01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0140_H06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVR01_0058_F09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0116_H07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0060_E06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0111_G09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PTG01_0070_C08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0029_D09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
UTR01_0085_B10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0128_H05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0081_D05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
SPL01_0103_E10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
UTR01_0076_F02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0028_C02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0148_H06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGGGTGGGCC
LVR01_0009_F10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVR01_0069_B03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0022_B12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0130_G06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0136_B02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0146_G05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0012_F11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0130_D09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0065_D09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
TCH01_0021_H09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0135_H10.b : GCCCTAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGATCGCAGCTGGAGCGTGGGCC
OVRT1_0132_H05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0013_D03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PTG01_0035_B03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0058_H03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0138_H06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0100_D01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PTG01_0047_A06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0029_D07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0125_D02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0076_G10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PTG01_0105_A09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0136_C07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0053_F03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
SPL01_0059_F05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVR01_0064_D06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0152_B06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0082_G11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0015_F05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0064_A04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
ITT01_0015_B08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0141_G10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0075_D12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0055_G05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0028_H02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0091_D02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0009_E06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PTG01_0025_G07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
UTR01_0099_E01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0134_H02.b : GCCCCAACCAGCGCCATCGCGACTTGGAACTGAGCGGCGACCGCACCTGGAGCGTGGGCC
BFLT1_0063_F09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0146_A02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0151_F11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0028_B09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0117_F09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0111_F08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0115_H02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0045_H10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0047_D11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0076_H04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0072_H03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0004_A11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0006_B04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0126_C01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0065_B05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0135_G05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0151_H04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0030_F11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0130_C12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0044_D08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0124_A10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0033_A07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0150_A07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0056_B08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0057_C07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0013_B03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0102_B10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0082_D08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0115_G03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0142_B04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0063_H04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0147_D01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0029_C03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
TCH01_0048_D09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0054_F05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0061_E08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0015_C05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0107_F12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
ITT01_0058_G06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
SPL01_0052_F05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0096_A12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0033_A04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
SPL01_0078_F12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
ADR01_0055_D06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
ADR01_0055_E11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0073_H06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0035_H01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0092_C06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0129_D10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0051_B10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0130_B04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0042_B07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
UTR01_0081_C01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0065_F03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
SPL01_0038_C10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0037_A04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0042_B03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0068_H08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0086_D04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0030_E03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0003_E09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0020_H08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0044_H04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0052_G08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0085_E05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0046_G12.b : GCCCCAACCAGAGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0079_G10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0043_C12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0092_E05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0003_B09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0079_H04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVR01_0040_F11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0056_G09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0019_B03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVR01_0100_F12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0085_D07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0090_D03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0021_G04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0055_H05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0144_H02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
THY01_0088_G06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
THY01_0074_D01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LNG01_0004_E12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
SPL01_0035_G04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVR01_0006_E01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVR01_0001_H09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGGTGAGCGGTGACCGGAGCTGGAGCGTGGGCC
LVR01_0071_G09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0061_E07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0023_E06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0058_F10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0048_H07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0021_B03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PBL01_0011_E05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0038_D09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0091_B02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0080_C09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
ADR01_0064_F08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGGGGCGAGCGCAGCTGGAGCGTGGGCC
LVR01_0102_H08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0125_H02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVR01_0028_D04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
ADR01_0047_C10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0091_C06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
UTR01_0082_A01.b : GCTCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LNG01_0006_F02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0081_C12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0010_A11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PBL01_0032_E08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0061_D08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0050_H10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
ITT01_0074_H10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LNG01_0010_D12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0051_C06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0104_H05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0082_C05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0012_E07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0091_B07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
SPL01_0002_C04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0047_C06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0020_B01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0090_D09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVR01_0059_B05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0066_G09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0013_B01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0020_F10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0075_F12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LNG01_0074_E03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
TCH01_0023_G02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LNG01_0025_D02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0043_D05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0087_E11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LNG01_0071_F01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0032_G02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0087_E04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0095_A12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0081_D10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LNG01_0056_F12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0083_E04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PBL01_0094_F09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0035_H12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
UTR01_0049_H04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0059_E07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
ADR01_0060_D10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0086_B02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0002_G04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0087_F12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0021_F04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
TCH01_0038_H06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0007_E08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0006_G04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0059_G05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0038_G01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
THY01_0090_A11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0073_G11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0035_C11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
MLN01_0063_B11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
TCH01_0020_B10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PBL01_0014_H05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0062_E08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
ITT01_0043_E06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PBL01_0107_A01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0094_D07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
ITT01_0040_A10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0071_B01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0001_F12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
ADR01_0095_B06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
ADR01_0071_C04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0067_B01.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
TCH01_0037_D12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0049_E07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
TCH01_0099_B05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGGGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0007_F07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0069_C11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVR01_0009_F07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
ADR01_0078_F09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PBL01_0077_H04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
ITT01_0034_D10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0081_H12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0034_H10.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0009_E06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0014_G04.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
TES01_0029_H03.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
KDN01_0080_F11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
TCH01_0013_A07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0041_A05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0193_D05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRM1_0049_A03.b : GCCCCAACCAGCGCCCTCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0131_E09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
CLNT1_0119_F11.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0063_B06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
KDN01_0037_G08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
LVRM1_0111_F05.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
OVRT1_0064_A06.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
SKNB1_0001_H12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BFLT1_0141_H08.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0018_D09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
TES01_0098_C03.b : GCCCCAACCAGCGCCATCACGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PCT01_0008_E12.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
BMWN1_0098_H07.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
TCH01_0008_F02.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
SPL01_0030_D09.b : GCCCCAACCAGCGCCATCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
PTG01_0034_D02.b : xxxxxxxxxxxxxxxxTCGCGACTTGGAGCTGAGCGGCGACCGCAGCTGGAGCGTGGGCC
20110601C-001853 : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
---------+---------+---------+---------+---------+---------+ 338
BFLT1_0039_E12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
KDN01_0080_C07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
TES01_0111_H06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0128_A12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
SPLT1_0062_B09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
ADR01_0045_B12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0010_D11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0010_A09.b : GCCTCGAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGTGTCCAGAGGACCAGAGGT
PCT01_0017_E02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CBLT1_0036_G09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0010_A12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PST01_0039_E12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
KDN01_0049_H09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PST01_0026_G03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
KDN01_0024_H12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PST01_0081_F11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PST01_0071_A02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0047_B09.b : GCCCCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0098_H11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0127_F11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PST01_0021_C07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
KDN01_0081_H10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0166_G05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0032_G08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0091_D07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACGAGAGGT
BFLT1_0149_C03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CBLT1_0039_B01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0114_C01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0088_E07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0004_D11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
KDN01_0023_G06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
SKNB1_0015_E01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
KDN01_0058_F04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
TES01_0017_B10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0194_H01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0023_E02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
SPL01_0010_B08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
TCH01_0027_H12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0011_C07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
THY01_0038_G04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LNG01_0084_A12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
ADR01_0097_G07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0062_B09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0027_H04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0027_D06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0016_B10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
TES01_0053_E02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0005_D05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0025_G03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0017_G06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0033_D11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PTG01_0055_E05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PST01_0045_H09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PST01_0090_B12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
SKNB1_0007_B08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PST01_0030_C07.b : GCCTCAAGGCCCAGGGGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PST01_0056_G05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
TES01_0101_B11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0004_A06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
KDN01_0022_B09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0077_A04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PST01_0055_G07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0005_E11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PST01_0041_C07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0033_C04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
KDN01_0056_F04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PST01_0023_G04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PST01_0063_B02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
KDN01_0009_A02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PST01_0045_A07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PST01_0037_C09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
SPL01_0066_C08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
KDN01_0073_C06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
KDN01_0094_D06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PST01_0026_C09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
KDN01_0069_C10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0006_F12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PST01_0069_G10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PST01_0020_H11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
KDN01_0085_B12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
KDN01_0096_B01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
KDN01_0034_A08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
TCH01_0085_D07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
THY01_0117_E09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0036_H08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0005_C03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0102_G01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PTG01_0069_G11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LNG01_0069_C07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PTG01_0025_G02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0098_H09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0013_B11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0077_C09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0125_F02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGGGGACCAGAGGT
SPL01_0096_C03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0100_F08.b : GCCTCAAGGCCCATCTGAGTCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0092_B08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0066_A10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
KDN01_0066_D06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCTAGAGGACCAGAGGT
TCH01_0097_G11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
UTR01_0096_F05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LNG01_0081_D01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
ITT01_0065_C05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
ITT01_0054_H05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
TCH01_0007_H01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
KDN01_0044_D12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0121_A01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0040_E03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0062_B06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0084_B11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0032_F09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0016_C12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0026_D09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0081_G01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0019_G02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
KDN01_0098_C05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
SPL01_0008_B02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PST01_0085_B03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0145_D03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0005_H07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0151_D06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0039_B06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0010_H01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PST01_0059_C11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0174_B09.b : GCCTCAAGGCTCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0194_C10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0036_E08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0009_D02.b : GCCTCAAGGCCCATCTGAGCCGCGTGTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0194_H10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0081_F04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0085_D09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0172_B06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0045_H04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0172_F10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0011_E08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0085_D04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0181_D04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0218_E12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0044_D07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGA
OVRM1_0048_D10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0092_D03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0071_D03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0100_D04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0010_G10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0130_H11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVR01_0066_F10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVR01_0081_D01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0198_B08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0082_H07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVR01_0077_E02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
ADR01_0062_H07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0026_F10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0075_A03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
ADR01_0026_H11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0158_H03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0028_E06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0114_C08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0076_D10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0134_D12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0010_B07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0003_C01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0103_H12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0195_B08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0163_D10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0166_C02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0103_E02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0024_E07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0185_C01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0003_B02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0136_F02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0123_C05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0105_E03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0205_B08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0205_D03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0178_E08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0150_E03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0115_C02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0171_F01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
THY01_0018_B02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0161_F09.b : GCCTCAAGGGCCATCTGAACCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAAGT
LVRM1_0081_F12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0109_F05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PTG01_0038_D05.b : GCCTCCAGGGCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGAACAGAGGT
LVRM1_0039_B10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0122_H09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0099_E10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0196_E11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0091_G06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0053_A10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0091_D10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0181_A05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0035_G07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
THY01_0007_F03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0199_E12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0145_B08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0110_C10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0007_C07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0066_F10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
ADR01_0028_E06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0148_F04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0170_C05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0104_E09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0025_F11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PTG01_0067_E03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0058_G05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0035_F11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0137_F08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0078_B08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0077_G01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0080_C08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
SMG01_0089_C05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0154_G07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0057_G05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0091_B01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0092_C05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0034_C08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0138_C04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0019_H04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
SPL01_0046_F01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0025_F11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0014_D11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0010_F12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0142_F12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0108_E10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0022_E09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0143_C09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0145_G10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0107_F12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0141_F10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0083_C09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0019_C08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0138_C01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0093_A12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
THY01_0068_B10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PTG01_0042_E03.b : GCCTCAAGGGCCATCTGAACCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0021_C11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVR01_0090_F06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGGCCAGAGGT
LVRM1_0002_F09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0129_D11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
UTR01_0009_F11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
SPL01_0084_A09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0143_H08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PBL01_0007_B09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
SPL01_0010_A03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0144_A09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
SPL01_0012_B01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
ADR01_0011_G03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0006_A02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PTG01_0057_H01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0140_H06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVR01_0058_F09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0116_H07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0060_E06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0111_G09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PTG01_0070_C08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0029_D09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
UTR01_0085_B10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0128_H05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0081_D05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
SPL01_0103_E10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
UTR01_0076_F02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0028_C02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0148_H06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0009_F10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVR01_0069_B03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0022_B12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0130_G06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0136_B02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0146_G05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0012_F11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0130_D09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0065_D09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
TCH01_0021_H09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0135_H10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0132_H05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0013_D03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PTG01_0035_B03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0058_H03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0138_H06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0100_D01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PTG01_0047_A06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0029_D07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0125_D02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0076_G10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PTG01_0105_A09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0136_C07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCTGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0053_F03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
SPL01_0059_F05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVR01_0064_D06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0152_B06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0082_G11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0015_F05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0064_A04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
ITT01_0015_B08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0141_G10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0075_D12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0055_G05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0028_H02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0091_D02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0009_E06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PTG01_0025_G07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
UTR01_0099_E01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0134_H02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0063_F09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0146_A02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0151_F11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0028_B09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0117_F09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0111_F08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0115_H02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0045_H10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0047_D11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0076_H04.b : GCCTCAAGGCCCATCTGAGCCGCGTTTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0072_H03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0004_A11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0006_B04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGCCCAGAGGACCAGAGGT
OVRT1_0126_C01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0065_B05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0135_G05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0151_H04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0030_F11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0130_C12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0044_D08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0124_A10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0033_A07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0150_A07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0056_B08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGGGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0057_C07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0013_B03.b : GCCTCAAGGCCCATCCGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0102_B10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0082_D08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0115_G03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0142_B04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0063_H04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0147_D01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0029_C03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
TCH01_0048_D09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0054_F05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0061_E08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0015_C05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0107_F12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
ITT01_0058_G06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
SPL01_0052_F05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0096_A12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0033_A04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
SPL01_0078_F12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
ADR01_0055_D06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
ADR01_0055_E11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0073_H06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0035_H01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0092_C06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0129_D10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0051_B10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0130_B04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0042_B07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
UTR01_0081_C01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0065_F03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
SPL01_0038_C10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0037_A04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0042_B03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0068_H08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0086_D04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0030_E03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0003_E09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0020_H08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0044_H04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0052_G08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0085_E05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0046_G12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0079_G10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0043_C12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0092_E05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACAAGAGGT
OVRT1_0003_B09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0079_H04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVR01_0040_F11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0056_G09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0019_B03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVR01_0100_F12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0085_D07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0090_D03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0021_G04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0055_H05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0144_H02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
THY01_0088_G06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
THY01_0074_D01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LNG01_0004_E12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
SPL01_0035_G04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVR01_0006_E01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVR01_0001_H09.b : GCCTCAAGGCCCATCTGAGCCTCGACTACCCCCAGCGCCCGCGTCCAGAGGACCACAGGT
LVR01_0071_G09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0061_E07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0023_E06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0058_F10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0048_H07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0021_B03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PBL01_0011_E05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0038_D09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0091_B02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0080_C09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
ADR01_0064_F08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0102_H08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0125_H02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVR01_0028_D04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
ADR01_0047_C10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0091_C06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
UTR01_0082_A01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LNG01_0006_F02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0081_C12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0010_A11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PBL01_0032_E08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0061_D08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0050_H10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
ITT01_0074_H10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LNG01_0010_D12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0051_C06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0104_H05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0082_C05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0012_E07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0091_B07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
SPL01_0002_C04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0047_C06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0020_B01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0090_D09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVR01_0059_B05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0066_G09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0013_B01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0020_F10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0075_F12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LNG01_0074_E03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
TCH01_0023_G02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LNG01_0025_D02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0043_D05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0087_E11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LNG01_0071_F01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0032_G02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0087_E04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0095_A12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0081_D10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LNG01_0056_F12.b : GCCTCAAGGCCCATCTGAGCCGCGTCCACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0083_E04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PBL01_0094_F09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0035_H12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
UTR01_0049_H04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGGGGT
CLNT1_0059_E07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGCCCAGAGGACCAGAGGT
ADR01_0060_D10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0086_B02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0002_G04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0087_F12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0021_F04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
TCH01_0038_H06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0007_E08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0006_G04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0059_G05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0038_G01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
THY01_0090_A11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0073_G11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0035_C11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
MLN01_0063_B11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
TCH01_0020_B10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PBL01_0014_H05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0062_E08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
ITT01_0043_E06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PBL01_0107_A01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0094_D07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
ITT01_0040_A10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0071_B01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0001_F12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
ADR01_0095_B06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
ADR01_0071_C04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0067_B01.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
TCH01_0037_D12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0049_E07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
TCH01_0099_B05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0007_F07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0069_C11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVR01_0009_F07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
ADR01_0078_F09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PBL01_0077_H04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
ITT01_0034_D10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0081_H12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGGGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0034_H10.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0009_E06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0014_G04.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
TES01_0029_H03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
KDN01_0080_F11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
TCH01_0013_A07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0041_A05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0193_D05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRM1_0049_A03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0131_E09.b : GCCTCAAGGCCCATCTGGGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
CLNT1_0119_F11.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0063_B06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
KDN01_0037_G08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
LVRM1_0111_F05.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
OVRT1_0064_A06.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
SKNB1_0001_H12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BFLT1_0141_H08.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0018_D09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
TES01_0098_C03.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PCT01_0008_E12.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
BMWN1_0098_H07.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
TCH01_0008_F02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
SPL01_0030_D09.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
PTG01_0034_D02.b : GCCTCAAGGCCCATCTGAGCCGCGTCTACCCCGAGCGCCCGCGTCCAGAGGACCAGAGGT
20110601C-001853 : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
---------+---------+---------+---------+---------+---------+ 397
BFLT1_0039_E12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
KDN01_0080_C07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
TES01_0111_H06.b : TAATTTATTCCGGGAAGCTGTTGTTGGGTCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0128_A12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
SPLT1_0062_B09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
ADR01_0045_B12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0010_D11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0010_A09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGCCTCAGGGACTTGCTTCCCAAG
PCT01_0017_E02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CBLT1_0036_G09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0010_A12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PST01_0039_E12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
KDN01_0049_H09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PST01_0026_G03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
KDN01_0024_H12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PST01_0081_F11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PST01_0071_A02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0047_B09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCATGGACTTGCTTCCCAAG
OVRM1_0098_H11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0127_F11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCGGGGACTTGCTTCCCAAG
PST01_0021_C07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
KDN01_0081_H10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0166_G05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0032_G08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0091_D07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0149_C03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
CBLT1_0039_B01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0114_C01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0088_E07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0004_D11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
KDN01_0023_G06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
SKNB1_0015_E01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
KDN01_0058_F04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
TES01_0017_B10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0194_H01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0023_E02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCTAAG
SPL01_0010_B08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
TCH01_0027_H12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0011_C07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
THY01_0038_G04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LNG01_0084_A12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
ADR01_0097_G07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0062_B09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0027_H04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0027_D06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0016_B10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAA*
TES01_0053_E02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0005_D05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0025_G03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0017_G06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0033_D11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PTG01_0055_E05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PST01_0045_H09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PST01_0090_B12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
SKNB1_0007_B08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PST01_0030_C07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PST01_0056_G05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
TES01_0101_B11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0004_A06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
KDN01_0022_B09.b : TAATTTATTCCGGGAAGCTATTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0077_A04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
PST01_0055_G07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0005_E11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PST01_0041_C07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0033_C04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
KDN01_0056_F04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PST01_0023_G04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PST01_0063_B02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
KDN01_0009_A02.b : TAATTTATTCCGGGAAGCTGTTGTTGAATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PST01_0045_A07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PST01_0037_C09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
SPL01_0066_C08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
KDN01_0073_C06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
KDN01_0094_D06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PST01_0026_C09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
KDN01_0069_C10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0006_F12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PST01_0069_G10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PST01_0020_H11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
KDN01_0085_B12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
KDN01_0096_B01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
KDN01_0034_A08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
TCH01_0085_D07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
THY01_0117_E09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0036_H08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0005_C03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0102_G01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PTG01_0069_G11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
LNG01_0069_C07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PTG01_0025_G02.b : TGATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0098_H09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0013_B11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0077_C09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0125_F02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
SPL01_0096_C03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0100_F08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0092_B08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0066_A10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
KDN01_0066_D06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
TCH01_0097_G11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
UTR01_0096_F05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LNG01_0081_D01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
ITT01_0065_C05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
ITT01_0054_H05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
TCH01_0007_H01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
KDN01_0044_D12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0121_A01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0040_E03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0062_B06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0084_B11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0032_F09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0016_C12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0026_D09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0081_G01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0019_G02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
KDN01_0098_C05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
SPL01_0008_B02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PST01_0085_B03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0145_D03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0005_H07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0151_D06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0039_B06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0010_H01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PST01_0059_C11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0174_B09.b : TAATTTATTCCGGGAAACTGTTGTTGGATCACCA*GTGTCTCAAGGACTTGCTTCCCAAG
LVRM1_0194_C10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCATGGACTTGCTTCCCACG
OVRM1_0036_E08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCA**
LVRM1_0009_D02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTGCCAAG
LVRM1_0194_H10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0081_F04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0085_D09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0172_B06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0045_H04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCTCAAG
LVRM1_0172_F10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0011_E08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0085_D04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0181_D04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0218_E12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0044_D07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0048_D10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0092_D03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0071_D03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0100_D04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0010_G10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0130_H11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVR01_0066_F10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVR01_0081_D01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0198_B08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0082_H07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVR01_0077_E02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCATGGACTTGCTTCCCAAG
ADR01_0062_H07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0026_F10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0075_A03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
ADR01_0026_H11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0158_H03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0028_E06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0114_C08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0076_D10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0134_D12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0010_B07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0003_C01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGAACTTGCTTCCCAAG
LVRM1_0103_H12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0195_B08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0163_D10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0166_C02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0103_E02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0024_E07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0185_C01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0003_B02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0136_F02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0123_C05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0105_E03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0205_B08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0205_D03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0178_E08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0150_E03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0115_C02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0171_F01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
THY01_0018_B02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0161_F09.b : TAATTTATTCCCGGAAGCTGTTGTTGGATCACCA*GTGTCTCAAGGACTTGCTTCCCCAG
LVRM1_0081_F12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0109_F05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PTG01_0038_D05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0039_B10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0122_H09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0099_E10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0196_E11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0091_G06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0053_A10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0091_D10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0181_A05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0035_G07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
THY01_0007_F03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0199_E12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0145_B08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0110_C10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0007_C07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0066_F10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCG*GTGTCTCAGGGACTTGCTTCCCAAG
ADR01_0028_E06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0148_F04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCG*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0170_C05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0104_E09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0025_F11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PTG01_0067_E03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0058_G05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0035_F11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0137_F08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0078_B08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0077_G01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0080_C08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
SMG01_0089_C05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0154_G07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0057_G05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0091_B01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0092_C05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0034_C08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0138_C04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0019_H04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
SPL01_0046_F01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTACTTCCCAAG
OVRM1_0025_F11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0014_D11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0010_F12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0142_F12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0108_E10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0022_E09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0143_C09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAAGGACTTGCTTCCCAAG
LVRM1_0145_G10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0107_F12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0141_F10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0083_C09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0019_C08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0138_C01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0093_A12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
THY01_0068_B10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PTG01_0042_E03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0021_C11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVR01_0090_F06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCATGGACTTGCTTCCCAA*
LVRM1_0002_F09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0129_D11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
UTR01_0009_F11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
SPL01_0084_A09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGG*ACTTGCTTCCCAAG
OVRT1_0143_H08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
PBL01_0007_B09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
SPL01_0010_A03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0144_A09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
SPL01_0012_B01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
ADR01_0011_G03.b : TAATTTATTCCGGGGAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0006_A02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PTG01_0057_H01.b : TAATTTATTCCGGGAAGCTGTTGTCGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0140_H06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVR01_0058_F09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0116_H07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0060_E06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0111_G09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
PTG01_0070_C08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0029_D09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
UTR01_0085_B10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0128_H05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0081_D05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
SPL01_0103_E10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
UTR01_0076_F02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0028_C02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0148_H06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0009_F10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVR01_0069_B03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0022_B12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0130_G06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0136_B02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0146_G05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0012_F11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0130_D09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0065_D09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
TCH01_0021_H09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0135_H10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0132_H05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0013_D03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
PTG01_0035_B03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0058_H03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0138_H06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0100_D01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
PTG01_0047_A06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0029_D07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0125_D02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0076_G10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
PTG01_0105_A09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0136_C07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0053_F03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
SPL01_0059_F05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVR01_0064_D06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0152_B06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0082_G11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0015_F05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0064_A04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
ITT01_0015_B08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0141_G10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0075_D12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0055_G05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0028_H02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0091_D02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0009_E06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
PTG01_0025_G07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
UTR01_0099_E01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0134_H02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAACA*ATGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0063_F09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0146_A02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0151_F11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0028_B09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0117_F09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0111_F08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0115_H02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0045_H10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0047_D11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0076_H04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0072_H03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0004_A11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0006_B04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0126_C01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0065_B05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0135_G05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTCCCCAAG
CLNT1_0151_H04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0030_F11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0130_C12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0044_D08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0124_A10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0033_A07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0150_A07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0056_B08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0057_C07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0013_B03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0102_B10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0082_D08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0115_G03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0142_B04.b : TAATTTATTCCGGGAAGCTGCTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0063_H04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0147_D01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0029_C03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
TCH01_0048_D09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0054_F05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0061_E08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0015_C05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0107_F12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
ITT01_0058_G06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
SPL01_0052_F05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0096_A12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0033_A04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
SPL01_0078_F12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
ADR01_0055_D06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
ADR01_0055_E11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0073_H06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0035_H01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0092_C06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0129_D10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0051_B10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0130_B04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0042_B07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
UTR01_0081_C01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0065_F03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
SPL01_0038_C10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0037_A04.b : TAATTTATTCCGGGAAGCTGTCGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0042_B03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0068_H08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0086_D04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0030_E03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0003_E09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0020_H08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0044_H04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0052_G08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0085_E05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0046_G12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0079_G10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0043_C12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0092_E05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0003_B09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0079_H04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVR01_0040_F11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0056_G09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0019_B03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVR01_0100_F12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0085_D07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGCCTCAGGGACTTGCTTCCCAAG
LVR01_0090_D03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0021_G04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0055_H05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0144_H02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
THY01_0088_G06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
THY01_0074_D01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LNG01_0004_E12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
SPL01_0035_G04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVR01_0006_E01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVR01_0001_H09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCATGTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0071_G09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0061_E07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0023_E06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0058_F10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0048_H07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0021_B03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
PBL01_0011_E05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0038_D09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0091_B02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0080_C09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
ADR01_0064_F08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0102_H08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0125_H02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVR01_0028_D04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
ADR01_0047_C10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0091_C06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
UTR01_0082_A01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LNG01_0006_F02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0081_C12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0010_A11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
PBL01_0032_E08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0061_D08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0050_H10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
ITT01_0074_H10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LNG01_0010_D12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0051_C06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0104_H05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0082_C05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0012_E07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0091_B07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
SPL01_0002_C04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0047_C06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0020_B01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0090_D09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVR01_0059_B05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0066_G09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0013_B01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCCTCCCAAG
CLNT1_0020_F10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0075_F12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
LNG01_0074_E03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
TCH01_0023_G02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LNG01_0025_D02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0043_D05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0087_E11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
LNG01_0071_F01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0032_G02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0087_E04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTCCCCAAG
OVRT1_0095_A12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0081_D10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
LNG01_0056_F12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0083_E04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PBL01_0094_F09.b : TAATTTATCCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0035_H12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
UTR01_0049_H04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0059_E07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
ADR01_0060_D10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0086_B02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0002_G04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0087_F12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0021_F04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
TCH01_0038_H06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0007_E08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0006_G04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0059_G05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0038_G01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
THY01_0090_A11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0073_G11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0035_C11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
MLN01_0063_B11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
TCH01_0020_B10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PBL01_0014_H05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0062_E08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
ITT01_0043_E06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTAAGGGACTTGCTTCCCAAG
PBL01_0107_A01.b : TAATTTATTCCGGGAAGCTGTTGTTGGGTCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0094_D07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
ITT01_0040_A10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0071_B01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0001_F12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
ADR01_0095_B06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
ADR01_0071_C04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0067_B01.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
TCH01_0037_D12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0049_E07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
TCH01_0099_B05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0007_F07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCT*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0069_C11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVR01_0009_F07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
ADR01_0078_F09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PBL01_0077_H04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
ITT01_0034_D10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0081_H12.b : TAATTTATTCCCGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAGG
LVRM1_0034_H10.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCGGGGACTTGCTTCCCAAG
PCT01_0009_E06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0014_G04.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
TES01_0029_H03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGAGACTTGCTTCCCAAG
KDN01_0080_F11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
TCH01_0013_A07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0041_A05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0193_D05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRM1_0049_A03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCACGGACTTGCTTCCCAAG
OVRT1_0131_E09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
CLNT1_0119_F11.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
OVRT1_0063_B06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
KDN01_0037_G08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
LVRM1_0111_F05.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAGG
OVRT1_0064_A06.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
SKNB1_0001_H12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BFLT1_0141_H08.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0018_D09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
TES01_0098_C03.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PCT01_0008_E12.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
BMWN1_0098_H07.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
TCH01_0008_F02.b : TAATTTATTCCAGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
SPL01_0030_D09.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCACCA*GTGTCTCAGGGACTTGCTTCCCAAG
PTG01_0034_D02.b : TAATTTATTCCGGGAAGCTGTTGTTGGATCAGCA*GTGTCTCAGGGACTTGCTTCCCAAG
20110601C-001853 : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
---------+---------+---------+---------+---------+---------+ 457
BFLT1_0039_E12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
KDN01_0080_C07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
TES01_0111_H06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0128_A12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
SPLT1_0062_B09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
ADR01_0045_B12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0010_D11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0010_A09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCGAAAATACCA
PCT01_0017_E02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CBLT1_0036_G09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0010_A12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PST01_0039_E12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
KDN01_0049_H09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PST01_0026_G03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
KDN01_0024_H12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PST01_0081_F11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PST01_0071_A02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0047_B09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0098_H11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0127_F11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PST01_0021_C07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
KDN01_0081_H10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0166_G05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0032_G08.b : CAGGAAAAACGACATGTTTTGCGTCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0091_D07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0149_C03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CBLT1_0039_B01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0114_C01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0088_E07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0004_D11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCCTCAAAAATACCA
KDN01_0023_G06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
SKNB1_0015_E01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
KDN01_0058_F04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
TES01_0017_B10.b : CAGGAAAAACGACATGTTTTGCATCTGGCGTGCAGTGTGAAGAGTCCTTCACAAATACCA
OVRM1_0194_H01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0023_E02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
SPL01_0010_B08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
TCH01_0027_H12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0011_C07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
THY01_0038_G04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LNG01_0084_A12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
ADR01_0097_G07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0062_B09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0027_H04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0027_D06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0016_B10.b : **GGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
TES01_0053_E02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0005_D05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0025_G03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0017_G06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0033_D11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PTG01_0055_E05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PST01_0045_H09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PST01_0090_B12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
SKNB1_0007_B08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PST01_0030_C07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PST01_0056_G05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
TES01_0101_B11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0004_A06.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
KDN01_0022_B09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0077_A04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PST01_0055_G07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0005_E11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGACCTTCAAAAATACCA
PST01_0041_C07.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0033_C04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
KDN01_0056_F04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PST01_0023_G04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PST01_0063_B02.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
KDN01_0009_A02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PST01_0045_A07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PST01_0037_C09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
SPL01_0066_C08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTACAGTGTGAAGAGTCCTTCAAAAATACCA
KDN01_0073_C06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
KDN01_0094_D06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PST01_0026_C09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
KDN01_0069_C10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0006_F12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PST01_0069_G10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PST01_0020_H11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
KDN01_0085_B12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
KDN01_0096_B01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
KDN01_0034_A08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
TCH01_0085_D07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
THY01_0117_E09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATATCA
LVR01_0036_H08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCATTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0005_C03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGCGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0102_G01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PTG01_0069_G11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LNG01_0069_C07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PTG01_0025_G02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0098_H09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0013_B11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0077_C09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0125_F02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
SPL01_0096_C03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0100_F08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0092_B08.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0066_A10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
KDN01_0066_D06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
TCH01_0097_G11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
UTR01_0096_F05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LNG01_0081_D01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
ITT01_0065_C05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
ITT01_0054_H05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
TCH01_0007_H01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
KDN01_0044_D12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0121_A01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0040_E03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0062_B06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0084_B11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0032_F09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0016_C12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0026_D09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0081_G01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0019_G02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
KDN01_0098_C05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
SPL01_0008_B02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PST01_0085_B03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0145_D03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0005_H07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0151_D06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0039_B06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0010_H01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PST01_0059_C11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0174_B09.b : CAGGAAAAACGACCTGTTTTGCATCTGGTGTGCACTGATGAGAGTCCATTCCAAATACCA
LVRM1_0194_C10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGACTCCTTCTAAAATACCA
OVRM1_0036_E08.b : *AGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0009_D02.b : CAGGAAGAACGACATGTTTTGCATCTGGTGGGCAGGGTGAAGAGTCCTTCAAAAATACGA
LVRM1_0194_H10.b : CAGGAAAAACGACGTGTTTTGCATCTGGTGTGCACTGTGAAGAGTCCTTCCAAAATACCA
LVRM1_0081_F04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0085_D09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0172_B06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0045_H04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0172_F10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0011_E08.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0085_D04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0181_D04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0218_E12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTNCAAAATACCA
LVRM1_0044_D07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0048_D10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0092_D03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0071_D03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCTAAAATACCA
LVRM1_0100_D04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0010_G10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0130_H11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVR01_0066_F10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVR01_0081_D01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0198_B08.b : CAGGAAAA*CGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0082_H07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVR01_0077_E02.b : CATGAAAAACGACATGTTTTGCATCTGGCGTGCAGTGTGGAGAGTCCTTCCCAAATACCA
ADR01_0062_H07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0026_F10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0075_A03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
ADR01_0026_H11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0158_H03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0028_E06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0114_C08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0076_D10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0134_D12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0010_B07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0003_C01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0103_H12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0195_B08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0163_D10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0166_C02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0103_E02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0024_E07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0185_C01.b : CAGGAGAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0003_B02.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0136_F02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0123_C05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0105_E03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0205_B08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0205_D03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0178_E08.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0150_E03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0115_C02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0171_F01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
THY01_0018_B02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0161_F09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCCAAAATACCA
LVRM1_0081_F12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0109_F05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PTG01_0038_D05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCCAAAATACCA
LVRM1_0039_B10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0122_H09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0099_E10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0196_E11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0091_G06.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0053_A10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0091_D10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0181_A05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0035_G07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
THY01_0007_F03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGCGCGAAGAGTCCTTCAAAAATACCA
LVRM1_0199_E12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0145_B08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0110_C10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0007_C07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0066_F10.b : CAGGAAAAACGACATGTTTTGCGTCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
ADR01_0028_E06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0148_F04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0170_C05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0104_E09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0025_F11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PTG01_0067_E03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0058_G05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0035_F11.b : CAGGAAAAACGACATGTTTTGCACCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0137_F08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0078_B08.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0077_G01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0080_C08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
SMG01_0089_C05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0154_G07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0057_G05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0091_B01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0092_C05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0034_C08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0138_C04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0019_H04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
SPL01_0046_F01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0025_F11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0014_D11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0010_F12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0142_F12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0108_E10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0022_E09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0143_C09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCGAAAATACCA
LVRM1_0145_G10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0107_F12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0141_F10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0083_C09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0019_C08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0138_C01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0093_A12.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
THY01_0068_B10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PTG01_0042_E03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCCAAAATACCA
OVRM1_0021_C11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVR01_0090_F06.b : **GGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0002_F09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0129_D11.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
UTR01_0009_F11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
SPL01_0084_A09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0143_H08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PBL01_0007_B09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
SPL01_0010_A03.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0144_A09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
SPL01_0012_B01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
ADR01_0011_G03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0006_A02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PTG01_0057_H01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0140_H06.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVR01_0058_F09.b : CAGGAAAAGCGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0116_H07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0060_E06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0111_G09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PTG01_0070_C08.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0029_D09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
UTR01_0085_B10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0128_H05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0081_D05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
SPL01_0103_E10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
UTR01_0076_F02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0028_C02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0148_H06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0009_F10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCTGTGTGAAGAGTCCTTCAAAAATACCA
OVR01_0069_B03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0022_B12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0130_G06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0136_B02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0146_G05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0012_F11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0130_D09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0065_D09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
TCH01_0021_H09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0135_H10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0132_H05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0013_D03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PTG01_0035_B03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0058_H03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAGGAGTCCTTCAAAAATACCA
CLNT1_0138_H06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0100_D01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PTG01_0047_A06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0029_D07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0125_D02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0076_G10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PTG01_0105_A09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0136_C07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0053_F03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
SPL01_0059_F05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVR01_0064_D06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0152_B06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0082_G11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0015_F05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0064_A04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGTAGAGTCCTTCAAAAATACCA
ITT01_0015_B08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0141_G10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0075_D12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0055_G05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0028_H02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0091_D02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0009_E06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PTG01_0025_G07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
UTR01_0099_E01.b : CAGGGAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0134_H02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0063_F09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0146_A02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0151_F11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0028_B09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0117_F09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0111_F08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0115_H02.b : CAAGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0045_H10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0047_D11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0076_H04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0072_H03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0004_A11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0006_B04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0126_C01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0065_B05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0135_G05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0151_H04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0030_F11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0130_C12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0044_D08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0124_A10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0033_A07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0150_A07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0056_B08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0057_C07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0013_B03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0102_B10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0082_D08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0115_G03.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0142_B04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0063_H04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0147_D01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0029_C03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
TCH01_0048_D09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0054_F05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0061_E08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0015_C05.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0107_F12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
ITT01_0058_G06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
SPL01_0052_F05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0096_A12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0033_A04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
SPL01_0078_F12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
ADR01_0055_D06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
ADR01_0055_E11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0073_H06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0035_H01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0092_C06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0129_D10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0051_B10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0130_B04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0042_B07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
UTR01_0081_C01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0065_F03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
SPL01_0038_C10.b : CAGGAAAAACGACATGTTTTGCATCCGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0037_A04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0042_B03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0068_H08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0086_D04.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0030_E03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0003_E09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0020_H08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0044_H04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0052_G08.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATATCA
OVRT1_0085_E05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0046_G12.b : CAGGAAAAACGACGTGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0079_G10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0043_C12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0092_E05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0003_B09.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0079_H04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVR01_0040_F11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0056_G09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0019_B03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVR01_0100_F12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0085_D07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0090_D03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0021_G04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0055_H05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0144_H02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
THY01_0088_G06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
THY01_0074_D01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LNG01_0004_E12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
SPL01_0035_G04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVR01_0006_E01.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVR01_0001_H09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAATAGTCCTTCAAAAATACCA
LVR01_0071_G09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0061_E07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGTGTCCTTCAAAAATACCA
BFLT1_0023_E06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0058_F10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0048_H07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0021_B03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PBL01_0011_E05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0038_D09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0091_B02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0080_C09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
ADR01_0064_F08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0102_H08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0125_H02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVR01_0028_D04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
ADR01_0047_C10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGGAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0091_C06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
UTR01_0082_A01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LNG01_0006_F02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0081_C12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0010_A11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PBL01_0032_E08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0061_D08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0050_H10.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
ITT01_0074_H10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LNG01_0010_D12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0051_C06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0104_H05.b : CAGGAAAAACGACATGTGTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0082_C05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0012_E07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0091_B07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
SPL01_0002_C04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0047_C06.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0020_B01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0090_D09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVR01_0059_B05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0066_G09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0013_B01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0020_F10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0075_F12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LNG01_0074_E03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
TCH01_0023_G02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LNG01_0025_D02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0043_D05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0087_E11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LNG01_0071_F01.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0032_G02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0087_E04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0095_A12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0081_D10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LNG01_0056_F12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0083_E04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PBL01_0094_F09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0035_H12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
UTR01_0049_H04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0059_E07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
ADR01_0060_D10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0086_B02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0002_G04.b : CAGGAAAAACGACATGCTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0087_F12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0021_F04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
TCH01_0038_H06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0007_E08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0006_G04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0059_G05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0038_G01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
THY01_0090_A11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0073_G11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0035_C11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
MLN01_0063_B11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
TCH01_0020_B10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PBL01_0014_H05.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0062_E08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
ITT01_0043_E06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PBL01_0107_A01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0094_D07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
ITT01_0040_A10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0071_B01.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0001_F12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
ADR01_0095_B06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
ADR01_0071_C04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0067_B01.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACTA
TCH01_0037_D12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0049_E07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
TCH01_0099_B05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0007_F07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0069_C11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVR01_0009_F07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
ADR01_0078_F09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PBL01_0077_H04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
ITT01_0034_D10.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0081_H12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0034_H10.b : CAGGAAAAACGACATGTTTTGCATCTGGCGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0009_E06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0014_G04.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
TES01_0029_H03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
KDN01_0080_F11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
TCH01_0013_A07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0041_A05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0193_D05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRM1_0049_A03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCCAAAATACCA
OVRT1_0131_E09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
CLNT1_0119_F11.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0063_B06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
KDN01_0037_G08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
LVRM1_0111_F05.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
OVRT1_0064_A06.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
SKNB1_0001_H12.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BFLT1_0141_H08.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0018_D09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGCGTGAAGAGTCCTTCAAAAATACCA
TES01_0098_C03.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PCT01_0008_E12.b : ***GAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
BMWN1_0098_H07.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
TCH01_0008_F02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
SPL01_0030_D09.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
PTG01_0034_D02.b : CAGGAAAAACGACATGTTTTGCATCTGGTGTGCAGTGTGAAGAGTCCTTCAAAAATACCA
20110601C-001853 : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
---------+---------+---------+---------+---------+---------+ 516
BFLT1_0039_E12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
KDN01_0080_C07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
TES01_0111_H06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0128_A12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
SPLT1_0062_B09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
ADR01_0045_B12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0010_D11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0010_A09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0017_E02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CBLT1_0036_G09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0010_A12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PST01_0039_E12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
KDN01_0049_H09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PST01_0026_G03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
KDN01_0024_H12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PST01_0081_F11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PST01_0071_A02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0047_B09.b : GACGCTAGCACAAAAGTTGCTGAATCCAGAGAAAAGCCCGCCGGTCTTATT*CAGGGACC
OVRM1_0098_H11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0127_F11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PST01_0021_C07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
KDN01_0081_H10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0166_G05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0032_G08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0091_D07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0149_C03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CBLT1_0039_B01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0114_C01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0088_E07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0004_D11.b : GAAGCTAGCACAAAGGTTGCTGAGTCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
KDN01_0023_G06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
SKNB1_0015_E01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
KDN01_0058_F04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
TES01_0017_B10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGATAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0194_H01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0023_E02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
SPL01_0010_B08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
TCH01_0027_H12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0011_C07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
THY01_0038_G04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
LNG01_0084_A12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
ADR01_0097_G07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0062_B09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0027_H04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0027_D06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0016_B10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
TES01_0053_E02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0005_D05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0025_G03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0017_G06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0033_D11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PTG01_0055_E05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PST01_0045_H09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PST01_0090_B12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
SKNB1_0007_B08.b : GAAGCTAGCATTTAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PST01_0030_C07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PST01_0056_G05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
TES01_0101_B11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0004_A06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
KDN01_0022_B09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0077_A04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PST01_0055_G07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0005_E11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PST01_0041_C07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0033_C04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
KDN01_0056_F04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PST01_0023_G04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PST01_0063_B02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
KDN01_0009_A02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PST01_0045_A07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PST01_0037_C09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
SPL01_0066_C08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
KDN01_0073_C06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
KDN01_0094_D06.b : GAAGCTAGCACAAAGGTTGTTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PST01_0026_C09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
KDN01_0069_C10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0006_F12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PST01_0069_G10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PST01_0020_H11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
KDN01_0085_B12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
KDN01_0096_B01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
KDN01_0034_A08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
TCH01_0085_D07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
THY01_0117_E09.b : GAAGCTAGCACAAAGGTTGCTGAATCCACAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0036_H08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0005_C03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0102_G01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PTG01_0069_G11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LNG01_0069_C07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
PTG01_0025_G02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0098_H09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0013_B11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0077_C09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0125_F02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
SPL01_0096_C03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
BFLT1_0100_F08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0092_B08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0066_A10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
KDN01_0066_D06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
TCH01_0097_G11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
UTR01_0096_F05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
LNG01_0081_D01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
ITT01_0065_C05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
ITT01_0054_H05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
TCH01_0007_H01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
KDN01_0044_D12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0121_A01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0040_E03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0062_B06.b : GAAGCTAGCACAGAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0084_B11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0032_F09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAC*CAGGGACC
PCT01_0016_C12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0026_D09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0081_G01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0019_G02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
KDN01_0098_C05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
SPL01_0008_B02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
PST01_0085_B03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0145_D03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0005_H07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0151_D06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0039_B06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0010_H01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PST01_0059_C11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0174_B09.b : GAAGCTAGCTCTAACGTTGCTGAATCCAGggtacgagcccgccgttcctaatcacgcatc
LVRM1_0194_C10.b : GAAGCTAGCACAAAGGTTGCTGAATCCGGAGAACAGCCAGCCGGTCTTAAT*CAGGGACC
OVRM1_0036_E08.b : GAAGCTAGCACATAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0009_D02.b : CAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAATTCAGGGACC
LVRM1_0194_H10.b : GAAGCTAGCACAAATGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CATGGACC
LVRM1_0081_F04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACA
LVRM1_0085_D09.b : AAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0172_B06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0045_H04.b : GAAGCTACCACAAAGGTTGCTGAATCCCTATAAGAGCCCGCCGGTCTTAAT*CACGGACC
LVRM1_0172_F10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0011_E08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CANGGACC
LVRM1_0085_D04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0181_D04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0218_E12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0044_D07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0048_D10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0092_D03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0071_D03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGAGACC
LVRM1_0100_D04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0010_G10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0130_H11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVR01_0066_F10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
OVR01_0081_D01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
LVRM1_0198_B08.b : GAAGCTAGCACAAAGGTTGCTGATTCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0082_H07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVR01_0077_E02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACATGCCACCGGTCTTAAT*CATGGAAC
ADR01_0062_H07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0026_F10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0075_A03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
ADR01_0026_H11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0158_H03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0028_E06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0114_C08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0076_D10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0134_D12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0010_B07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0003_C01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*TAGGGACC
LVRM1_0103_H12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0195_B08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0163_D10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0166_C02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0103_E02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0024_E07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0185_C01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0003_B02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0136_F02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0123_C05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0105_E03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0205_B08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0205_D03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0178_E08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0150_E03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0115_C02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0171_F01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
THY01_0018_B02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
LVRM1_0161_F09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0081_F12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0109_F05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PTG01_0038_D05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0039_B10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0122_H09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0099_E10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0196_E11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0091_G06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0053_A10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0091_D10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0181_A05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0035_G07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
THY01_0007_F03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0199_E12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0145_B08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0110_C10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0007_C07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0066_F10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
ADR01_0028_E06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0148_F04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0170_C05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0104_E09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0025_F11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PTG01_0067_E03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0058_G05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0035_F11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0137_F08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGGACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0078_B08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0077_G01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0080_C08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
SMG01_0089_C05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0154_G07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0057_G05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0091_B01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0092_C05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0034_C08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0138_C04.b : GAAGCTAGCACAAAGGTCGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0019_H04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
SPL01_0046_F01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
OVRM1_0025_F11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0014_D11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0010_F12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0142_F12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0108_E10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0022_E09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0143_C09.b : GAGGCTAGCACAAAGGTTGCTGAATCCGGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0145_G10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAC*CAGGGACC
OVRM1_0107_F12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0141_F10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0083_C09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0019_C08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0138_C01.b : GAAGCTAGCACAAGGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0093_A12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
THY01_0068_B10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
PTG01_0042_E03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0021_C11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVR01_0090_F06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0002_F09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0129_D11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
UTR01_0009_F11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
SPL01_0084_A09.b : GAAGCTAGCACAAAGGTTGCTGGATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0143_H08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PBL01_0007_B09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
SPL01_0010_A03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
OVRT1_0144_A09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
SPL01_0012_B01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
ADR01_0011_G03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0006_A02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PTG01_0057_H01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0140_H06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVR01_0058_F09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0116_H07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0060_E06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0111_G09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PTG01_0070_C08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0029_D09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
UTR01_0085_B10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
CLNT1_0128_H05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0081_D05.b : GAAGCTAGCACAAAGGTTGCTGAATCCACAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
SPL01_0103_E10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
UTR01_0076_F02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
LVR01_0028_C02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0148_H06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0009_F10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVR01_0069_B03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0022_B12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGGACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0130_G06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0136_B02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0146_G05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0012_F11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0130_D09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0065_D09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
TCH01_0021_H09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0135_H10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0132_H05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0013_D03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PTG01_0035_B03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0058_H03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0138_H06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0100_D01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PTG01_0047_A06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0029_D07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0125_D02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0076_G10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PTG01_0105_A09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0136_C07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0053_F03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
SPL01_0059_F05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
OVR01_0064_D06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0152_B06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0082_G11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0015_F05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0064_A04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
ITT01_0015_B08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0141_G10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0075_D12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0055_G05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0028_H02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0091_D02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0009_E06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PTG01_0025_G07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
UTR01_0099_E01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0134_H02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0063_F09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0146_A02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0151_F11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0028_B09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0117_F09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0111_F08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0115_H02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0045_H10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0047_D11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0076_H04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0072_H03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0004_A11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0006_B04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0126_C01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0065_B05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAAAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0135_G05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0151_H04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0030_F11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0130_C12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0044_D08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0124_A10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0033_A07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0150_A07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0056_B08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0057_C07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0013_B03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0102_B10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0082_D08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0115_G03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0142_B04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0063_H04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0147_D01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0029_C03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
TCH01_0048_D09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0054_F05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0061_E08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0015_C05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0107_F12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
ITT01_0058_G06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
SPL01_0052_F05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
BFLT1_0096_A12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0033_A04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
SPL01_0078_F12.b : GAAGCCAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
ADR01_0055_D06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
ADR01_0055_E11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0073_H06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0035_H01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0092_C06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0129_D10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0051_B10.b : GAAGCTAACACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0130_B04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0042_B07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
UTR01_0081_C01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0065_F03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
SPL01_0038_C10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0037_A04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0042_B03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0068_H08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0086_D04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0030_E03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0003_E09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0020_H08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0044_H04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0052_G08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0085_E05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0046_G12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0079_G10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0043_C12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0092_E05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0003_B09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0079_H04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVR01_0040_F11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
BFLT1_0056_G09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0019_B03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVR01_0100_F12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0085_D07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0090_D03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCATAAT*CAGGGACC
LVR01_0021_G04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0055_H05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0144_H02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
THY01_0088_G06.b : GAAGCTAGCACGAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
THY01_0074_D01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CATGGACC
LNG01_0004_E12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
SPL01_0035_G04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
OVR01_0006_E01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVR01_0001_H09.b : CAAGCTAGCACAAAAGTTGCTGAATCCACAGAACAGCCCGCCGGTCTTAAT*CATGGACC
LVR01_0071_G09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0061_E07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0023_E06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0058_F10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0048_H07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0021_B03.b : GAAGCTAGCACAAGGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PBL01_0011_E05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0038_D09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0091_B02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0080_C09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
ADR01_0064_F08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0102_H08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0125_H02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVR01_0028_D04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
ADR01_0047_C10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0091_C06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
UTR01_0082_A01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LNG01_0006_F02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
OVRT1_0081_C12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0010_A11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PBL01_0032_E08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0061_D08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0050_H10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
ITT01_0074_H10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LNG01_0010_D12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
LVR01_0051_C06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0104_H05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0082_C05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0012_E07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0091_B07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
SPL01_0002_C04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0047_C06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0020_B01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0090_D09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVR01_0059_B05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0066_G09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0013_B01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0020_F10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0075_F12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LNG01_0074_E03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
TCH01_0023_G02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
LNG01_0025_D02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
OVRT1_0043_D05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0087_E11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LNG01_0071_F01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0032_G02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0087_E04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0095_A12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0081_D10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LNG01_0056_F12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0083_E04.b : GAAGCTAGCACAAAGGTTGCTGAATCCGGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PBL01_0094_F09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0035_H12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
UTR01_0049_H04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0059_E07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
ADR01_0060_D10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0086_B02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0002_G04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0087_F12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0021_F04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
TCH01_0038_H06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
CLNT1_0007_E08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0006_G04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0059_G05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0038_G01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
THY01_0090_A11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
CLNT1_0073_G11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0035_C11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
MLN01_0063_B11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
TCH01_0020_B10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PBL01_0014_H05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0062_E08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
ITT01_0043_E06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PBL01_0107_A01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0094_D07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
ITT01_0040_A10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0071_B01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BFLT1_0001_F12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
ADR01_0095_B06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
ADR01_0071_C04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0067_B01.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
TCH01_0037_D12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0049_E07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
TCH01_0099_B05.b : GAAGCTAGCACAGAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
CLNT1_0007_F07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0069_C11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVR01_0009_F07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
ADR01_0078_F09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PBL01_0077_H04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
ITT01_0034_D10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0081_H12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGTCGGTCTTAAT*CAGGTACC
LVRM1_0034_H10.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0009_E06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0014_G04.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
TES01_0029_H03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
KDN01_0080_F11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
TCH01_0013_A07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
BFLT1_0041_A05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0193_D05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRM1_0049_A03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGACAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0131_E09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
CLNT1_0119_F11.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0063_B06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
KDN01_0037_G08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
LVRM1_0111_F05.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
OVRT1_0064_A06.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
SKNB1_0001_H12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CACGGACC
BFLT1_0141_H08.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0018_D09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
TES01_0098_C03.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
PCT01_0008_E12.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
BMWN1_0098_H07.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
TCH01_0008_F02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
SPL01_0030_D09.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCACCGGTCTTAAT*CAGGGACC
PTG01_0034_D02.b : GAAGCTAGCACAAAGGTTGCTGAATCCAGAGAACAGCCCGCCGGTCTTAAT*CAGGGACC
20110601C-001853 : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
---------+---------+---------+---------+---------+---------+ 574
BFLT1_0039_E12.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
KDN01_0080_C07.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
TES01_0111_H06.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
OVRM1_0128_A12.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
SPLT1_0062_B09.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
ADR01_0045_B12.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PCT01_0010_D11.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PCT01_0010_A09.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PCT01_0017_E02.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
CBLT1_0036_G09.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PCT01_0010_A12.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PST01_0039_E12.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
KDN01_0049_H09.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PST01_0026_G03.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
KDN01_0024_H12.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PST01_0081_F11.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PST01_0071_A02.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
LVRM1_0047_B09.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGATAAGGGAGGCTGTCCGGACCCCT
OVRM1_0098_H11.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGACAAAGGGAGGTTGTTCGGAACCCT
CLNT1_0127_F11.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PST01_0021_C07.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
KDN01_0081_H10.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
LVRM1_0166_G05.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
LVRM1_0032_G08.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
LVR01_0091_D07.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
BFLT1_0149_C03.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
CBLT1_0039_B01.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
CLNT1_0114_C01.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
OVRT1_0088_E07.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PCT01_0004_D11.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
KDN01_0023_G06.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
SKNB1_0015_E01.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
KDN01_0058_F04.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
TES01_0017_B10.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAATGCAAAGGGAGGTTGTGCGGAACCCT
OVRM1_0194_H01.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
LVRM1_0023_E02.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
SPL01_0010_B08.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
TCH01_0027_H12.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
BFLT1_0011_C07.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
THY01_0038_G04.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
LNG01_0084_A12.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
ADR01_0097_G07.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
OVRT1_0062_B09.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PCT01_0027_H04.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PCT01_0027_D06.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PCT01_0016_B10.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
TES01_0053_E02.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PCT01_0005_D05.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PCT01_0025_G03.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PCT01_0017_G06.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PCT01_0033_D11.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PTG01_0055_E05.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PST01_0045_H09.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PST01_0090_B12.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
SKNB1_0007_B08.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PST01_0030_C07.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PST01_0056_G05.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
TES01_0101_B11.b : GTCTCCT*GGGGATTCCTCAA*GTGGTGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PCT01_0004_A06.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
KDN01_0022_B09.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
CLNT1_0077_A04.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PST01_0055_G07.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PCT01_0005_E11.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PST01_0041_C07.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PCT01_0033_C04.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
KDN01_0056_F04.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PST01_0023_G04.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PST01_0063_B02.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
KDN01_0009_A02.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PST01_0045_A07.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PST01_0037_C09.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
SPL01_0066_C08.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
KDN01_0073_C06.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
KDN01_0094_D06.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PST01_0026_C09.b : GTCTCCT*GGGGATTCCCCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
KDN01_0069_C10.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PCT01_0006_F12.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PST01_0069_G10.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PST01_0020_H11.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
KDN01_0085_B12.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
KDN01_0096_B01.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
KDN01_0034_A08.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
TCH01_0085_D07.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
THY01_0117_E09.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTGGTTCGGAACCCT
LVR01_0036_H08.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
LVRM1_0005_C03.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTGAGGCAAAGGGAGGTTGTTCGGAACCCT
OVRT1_0102_G01.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PTG01_0069_G11.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
LNG01_0069_C07.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PTG01_0025_G02.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
OVRT1_0098_H09.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
OVRT1_0013_B11.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
BFLT1_0077_C09.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
CLNT1_0125_F02.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
SPL01_0096_C03.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
BFLT1_0100_F08.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGCTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
LVR01_0092_B08.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
OVRT1_0066_A10.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
KDN01_0066_D06.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
TCH01_0097_G11.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
UTR01_0096_F05.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
LNG01_0081_D01.b : GTCTCCT*GGGGATTCCTCAA*GTGATGATTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
ITT01_0065_C05.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
ITT01_0054_H05.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
TCH01_0007_H01.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
KDN01_0044_D12.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
LVRM1_0121_A01.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
LVRM1_0040_E03.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
OVRM1_0062_B06.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
OVRM1_0084_B11.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PCT01_0032_F09.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PCT01_0016_C12.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PCT01_0026_D09.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
OVRT1_0081_G01.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PCT01_0019_G02.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
KDN01_0098_C05.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
SPL01_0008_B02.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PST01_0085_B03.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
OVRT1_0145_D03.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
CLNT1_0005_H07.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
CLNT1_0151_D06.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
BFLT1_0039_B06.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PCT01_0010_H01.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
PST01_0059_C11.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
OVRM1_0174_B09.b : gtcttccggggattcttcagatgctggcttaagggacgaggggtttggtctgaagccctt
LVRM1_0194_C10.b : GTCTCCTTGGGGACTCCTCAT*GTGATGGTTTtaaagtacaggaggttgttaggaaaaac
OVRM1_0036_E08.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTCAAGGCATAGGGAGGGTGTACGGAACCCT
LVRM1_0009_D02.b : GGTTCCT*GGGGATTCCTTGA*GTGATGGTTTAAGGGATAGGGAGGCTGGGCGGAACCCT
LVRM1_0194_H10.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAACGCAA*GGGAGGTTGTTCGGAACC*T
LVRM1_0081_F04.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
LVRM1_0085_D09.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGTGAACCT
OVRM1_0172_B06.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAAGGAGGTTGTTTGGAACCCT
LVRM1_0045_H04.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAACGCAAACGGAGGTTGTTCGGAATCCC
LVRM1_0172_F10.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCCGAACCCT
LVRM1_0011_E08.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
LVRM1_0085_D04.b : GTCCCCT*GGGGATTCCTCAG*GTGATGGTTTACGGCAAAGGGAGGTTGTTCGGAGCCCT
LVRM1_0181_D04.b : GTCTCCT*GGGGATTCCTCAG*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
OVRM1_0218_E12.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTTAAGCAAAGGGAAGGTGTTCGGAACCCT
LVRM1_0044_D07.b : GTCTCCT*GGGGATTCCTCGA*GTGATGGTTTAAAGCAAAAGGAGGTTGTTCGGAACCCT
OVRM1_0048_D10.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
LVRM1_0092_D03.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
LVRM1_0071_D03.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCGAACGGAGGTTGTTCGGAACCCT
LVRM1_0100_D04.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
LVRM1_0010_G10.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
LVRM1_0130_H11.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
OVR01_0066_F10.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGGTGTTCGGAACCCT
OVR01_0081_D01.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
LVRM1_0198_B08.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
LVRM1_0082_H07.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAGCCCT
OVR01_0077_E02.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGGTTAAGGCCAAGGGAGGTTGTTCGGAATCCT
ADR01_0062_H07.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
LVRM1_0026_F10.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
OVRM1_0075_A03.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
ADR01_0026_H11.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT
OVRM1_0158_H03.b : GTCTCCT*GGGGATTCCTCAA*GTGATGGTTTAAGGCAAAGGGAGGTTGTTCGGAACCCT