[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-001908

Length: 1,943

Sequence [FASTA format sequence]
GTTTTGTGTG CTGTTTTTCT ATTTACGTAA ATCATGCTGA ACATGTTTGC ATCAACCTCC
TGGTGATGCA CCTTTGATCA ATAGATTTTA GACAAAAGTG GTTTTTGAGT CCAAAGATCA
GGGCTGGGTT GACCTACAGA TTGGATACAG GGTGTATAAA ACAGAGGCAA GGCGCAGGCT
GATAGCAGAG CAATCAGTGC CAAGTCTGAA ATAACTGAGA GGGCGCAGCC GAAGGCTTCC
TGCGGGGCCA GCGAGTGAGG ATGGAGGAGG GAATGAACCT TCTCCATAAC TTTGGGATCC
AATCAACGCG CTACCTCCAG GTGAATTACC AGGACTCCCA GGATTGGTTC ATCTTGGTAT
CTGTGATCGC GGACCTCAGA AATGCCTTTT ATGTCCTCTT CCCCATCTGG TTCCATCTTC
AAGAAGCTGT GGGCATCAAA CTCCTCTGGG TAGCTGTGAT TGGAGACTGG CTCAACCTCG
TCTTTAAGTG GATTCTCTTT GGACAGCGCC CCTACTGGTG GGTCCTGGAC ACTGACTACT
ACAGCAACAC CTCGGTGCCA CTGATAAAGC AGTTCCCAGT CACCTGTGAG ACTGGCCCAG
GGAGTCCCTC TGGCCATGCC ATGGGCACAG CAGGTGTATA CTATGTGATG GTCACATCCG
CCCTCTCTAT CATTCGGGGA AAGAAAAAGC CAACCTACGG CTTTCGGTGC TTGAATGTCA
TTTTGTGGTT GGGATTCTGG ACTGTGCAGC TGAACGTCTG TCTGTCACGA ATCTACCTTG
CTGCTCATTT CCCCCATCAA GTTGTTGCTG GAGTCTTGTC AGGCATTGCA GTTGCTGAGA
CTTTCCGCCA CATTCAGAGT ATCTACAACG CCAGCCTCAA GAAGTATTTT CTCATTACCT
TCTTCCTGTT CAGTTTTGCC ATTGGATTTT ACCTGCTGCT AAAGGGGCTG GGCGTTGACC
TCTCGTGGAC CCTAGAGAAA GCCAAGCGAA GGTGTGAGCG GCCAGAATGG GTCCACATCG
ACACCACGCC CTTTGCCAGC CTCCTCAAGA ACGTGGGGAC CCTCTTCGGC CTGGGTCTGG
CTCTCAACTC CAGCATGTAC AGGCAGGGCT GCAAAGGCAA GCTCAGCAAG TGGTTCCCGT
TCCGCCTCAG CTGCATCGTG GCCTCCCTCG TCCTCCTGCA CTTCTTTGAC TCCTTGAAAC
CCCCATCCCA AATCGAGCTG ATCTTCTACG TCCTGTCCTT CTGCAAGAGC GCGGCAGTGC
CCCTGGCATC TGTCAGCCTC ATCCCCTACT GCCTCTCCCG GGCCCTGGGC CAGCCCGACA
AGAAGACTTT GTAGACAGAT GTGGCGTCCT CAGTATTGAA AGACGATGAC TGTGCCAAGG
ATAGAGGGTG GCTTCTAGGC TTTTCTGCCA GCCCGTTTTG AGGCCAGAGG TGCTAGAATC
AGCTCAGAAC TCCTTCCTCC TTTGCCATTC TGATTGTACT GGGTGACAGT TTTTTGAAAT
GTTAATGAGG CTTCTTGAGA AAGCCTTATT AGAAGCTGGG ACATTCTGGA TTCCTTCCCC
CCACTAAATA TTTACTTATT CTTCTGTTAA ATATACAAAA GCAAGATTCC TTGGTAGGGC
CAGCTCCTAA TCCCAGACTG GGGATCACAA CTGAATTTTC TACTCATTCT CATCCTTACC
CAAAAAAGGC GCAAGGAGCA GTAGTTTTGA TAGGATTGTT TAATATCTTG TATACCATGC
AAATTCTATG TCAAACAATA TCTGAATGGC TTCAATTACA GTAGAATCTT TAGGTAAAGG
ACTCTTAATT GGGGGGGACC AATTTAAAGT ACTATTAATA TGGAGTTCCC ACTATACTGC
AGTGGGTTAG TAATACACCT TGTCTCTGGG TGTTGCCAGG CATGACACCA GCTGTGGTAT
AGGCTGCAAA AGGCCTGGAA CTT


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinG6PCglucose-6-phosphatase [Homo sapiens]. 6770.0O
Contig/Assembly ProteinG6PC2glucose-6-phosphatase 2 isoform 1 [Homo sapiens]. 374e-103O
Contig/Assembly ProteinG6PC3glucose-6-phosphatase 3 [Homo sapiens]. 2195e-57O
Contig/Assembly ProteinG6PC2glucose-6-phosphatase 2 isoform 2 [Homo sapiens]. 1672e-41O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinG6pcglucose-6-phosphatase [Mus musculus]. 6570.0O
Contig/Assembly ProteinG6pc2glucose-6-phosphatase 2 [Mus musculus]. 382e-106O
Contig/Assembly ProteinG6pc3glucose-6-phosphatase 3 [Mus musculus]. 2242e-58O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinG6PCPREDICTED: glucose-6-phosphatase [Canis familiaris]. 6850.0O
Contig/Assembly ProteinG6PCglucose-6-phosphatase [Canis lupus familiaris]. 6840.0O
Contig/Assembly ProteinLOC488389PREDICTED: similar to glucose-6-phosphatase, catalytic, related [Canis familiaris]. 388e-107O
Contig/Assembly ProteinLOC490942PREDICTED: similar to glucose-6-phosphatase catalytic subunit 3 [Canis familiaris]. 2303e-60O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinG6PCglucose-6-phosphatase [Bos taurus]. 6900.0O
Contig/Assembly ProteinG6PC2glucose-6-phosphatase 2 [Bos taurus]. 382e-106O
Contig/Assembly ProteinG6PC2PREDICTED: islet-specific glucose-6-phosphatase-related protein-like [Bos taurus]. 382e-106O
Contig/Assembly ProteinG6PC3glucose-6-phosphatase 3 [Bos taurus]. 2242e-58O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinG6PCglucose-6-phosphatase [Sus scrofa]. 7310.0O
Contig/Assembly ProteinLOC100512070PREDICTED: glucose-6-phosphatase 3-like [Sus scrofa]. 2265e-59O
Contig/Assembly ProteinLOC100518871PREDICTED: glucose-6-phosphatase 2-like [Sus scrofa]. 1694e-42O


Assembly Members: 192      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ITT010021E05ITT01_0021_E05.bBW977898 
ITT010068C02ITT01_0068_C02.bBW982039 
KDN010001E06KDN01_0001_E06.b  
KDN010005B01KDN01_0005_B01.bFS671533 
KDN010005C02KDN01_0005_C02.bFS671541 
KDN010005D11KDN01_0005_D11.bFS671557 
KDN010005G05KDN01_0005_G05.bFS671579 
KDN010006C05KDN01_0006_C05.bFS671621 
KDN010007E10KDN01_0007_E10.bFS671728 
KDN010009C10KDN01_0009_C10.bFS671863 
KDN010009G04KDN01_0009_G04.bFS671887 
KDN010010F12KDN01_0010_F12.bFS671960 
KDN010011B11KDN01_0011_B11.bFS671997 
KDN010012A04KDN01_0012_A04.bFS672062 
KDN010012B07KDN01_0012_B07.bFS672075 
KDN010012D02KDN01_0012_D02.bFS672091 
KDN010013B11KDN01_0013_B11.bFS672155 
KDN010014B11KDN01_0014_B11.bFS672235 
KDN010016H12KDN01_0016_H12.bFS672444 
KDN010019B12KDN01_0019_B12.bFS672606 
KDN010019F07KDN01_0019_F07.b  
KDN010019G10KDN01_0019_G10.b  
KDN010020E10KDN01_0020_E10.b  AK393199
KDN010020F07KDN01_0020_F07.bFS672702 
KDN010021F03KDN01_0021_F03.bFS672778 
KDN010023E08KDN01_0023_E08.bFS672934 
KDN010024A11KDN01_0024_A11.bFS672977 
KDN010024H11KDN01_0024_H11.bFS673049 
KDN010025G06KDN01_0025_G06.bFS673110 
KDN010025G09KDN01_0025_G09.bFS673113 
KDN010028F04KDN01_0028_F04.bFS673332 
KDN010029B05KDN01_0029_B05.bFS673372 
KDN010030A10KDN01_0030_A10.bFS673448 
KDN010030D06KDN01_0030_D06.bFS673474 
KDN010031D01KDN01_0031_D01.bFS673553 
KDN010031E05KDN01_0031_E05.bFS673566 
KDN010032A07KDN01_0032_A07.bFS673610 
KDN010032D09KDN01_0032_D09.bFS673640 
KDN010032G12KDN01_0032_G12.bFS673667 
KDN010033D10KDN01_0033_D10.bFS673716 
KDN010033G03KDN01_0033_G03.bFS673740 
KDN010034D05KDN01_0034_D05.bFS673786 
KDN010034D11KDN01_0034_D11.bFS673790 
KDN010035E06KDN01_0035_E06.bFS673877 
KDN010035E08KDN01_0035_E08.bFS673879 
KDN010038D12KDN01_0038_D12.b  
KDN010039D10KDN01_0039_D10.b  
KDN010041D03KDN01_0041_D03.b  
KDN010043B02KDN01_0043_B02.bFS674170 
KDN010045A10KDN01_0045_A10.bFS674326 
KDN010046A02KDN01_0046_A02.bFS674356 
KDN010046C03KDN01_0046_C03.bFS674371 
KDN010048H05KDN01_0048_H05.bFS674445 
KDN010051C03KDN01_0051_C03.bFS674545 
KDN010051E03KDN01_0051_E03.bFS674557 
KDN010052H11KDN01_0052_H11.bFS674621 
KDN010054D09KDN01_0054_D09.bFS674739 
KDN010056C02KDN01_0056_C02.bFS674883 
KDN010058B12KDN01_0058_B12.bFS675032 
KDN010058E10KDN01_0058_E10.bFS675059 
KDN010059C02KDN01_0059_C02.bFS675115 
KDN010059E07KDN01_0059_E07.bFS675137 
KDN010061A05KDN01_0061_A05.bFS675254 
KDN010062G03KDN01_0062_G03.bFS675399 
KDN010063B09KDN01_0063_B09.bFS675432 
KDN010063F08KDN01_0063_F08.bFS675476 
KDN010064E10KDN01_0064_E10.bFS675550 
KDN010064F12KDN01_0064_F12.b  
KDN010067A11KDN01_0067_A11.bFS675751 
KDN010067B04KDN01_0067_B04.bFS675756 
KDN010067E01KDN01_0067_E01.bFS675781 
KDN010067G04KDN01_0067_G04.bFS675805 
KDN010069H07KDN01_0069_H07.bFS675962 
KDN010070A01KDN01_0070_A01.bFS675967 
KDN010070B11KDN01_0070_B11.bFS675985 
KDN010070B12KDN01_0070_B12.bFS675986 
KDN010070C02KDN01_0070_C02.bFS675988 
KDN010070F07KDN01_0070_F07.bFS676023 
KDN010070H01KDN01_0070_H01.bFS676038 
KDN010070H04KDN01_0070_H04.bFS676041 
KDN010071A09KDN01_0071_A09.bFS676055 
KDN010071C10KDN01_0071_C10.bFS676077 
KDN010073E11KDN01_0073_E11.bFS676258 
KDN010073F09KDN01_0073_F09.bFS676268 
KDN010074A08KDN01_0074_A08.bFS676299 
KDN010074A10KDN01_0074_A10.bFS676301 
KDN010074D07KDN01_0074_D07.bFS676332 
KDN010074H04KDN01_0074_H04.bFS676370 
KDN010076B10KDN01_0076_B10.bFS676471 
KDN010076D08KDN01_0076_D08.b  
KDN010078D11KDN01_0078_D11.bFS676646 
KDN010078D12KDN01_0078_D12.bFS676647 
KDN010079E10KDN01_0079_E10.bFS676730 
KDN010079G02KDN01_0079_G02.bFS676744 
KDN010080A04KDN01_0080_A04.bFS676765 
KDN010080A10KDN01_0080_A10.bFS676769 
KDN010080F12KDN01_0080_F12.bFS676819 
KDN010081D10KDN01_0081_D10.bFS676877 
KDN010082A07KDN01_0082_A07.bFS676922 
KDN010082E05KDN01_0082_E05.bFS676960 
KDN010082F06KDN01_0082_F06.bFS676971 
KDN010083A08KDN01_0083_A08.bFS676997 
KDN010083D04KDN01_0083_D04.bFS677021 
KDN010085C06KDN01_0085_C06.bFS677173 
KDN010088A07KDN01_0088_A07.bFS677389 
KDN010088B10KDN01_0088_B10.bFS677402 
KDN010088F03KDN01_0088_F03.bFS677437 
KDN010090A08KDN01_0090_A08.bFS677554 
KDN010090F07KDN01_0090_F07.bFS677605 
KDN010090H01KDN01_0090_H01.bFS677619 
KDN010093G03KDN01_0093_G03.bFS677857 
KDN010094E01KDN01_0094_E01.bFS677920 
KDN010095A02KDN01_0095_A02.bFS677964 
KDN010095G09KDN01_0095_G09.bFS678032 
KDN010097B02KDN01_0097_B02.bFS678129 
KDN010097H05KDN01_0097_H05.bFS678188 
KDN010098B11KDN01_0098_B11.bFS678210 
KDN010098C10KDN01_0098_C10.bFS678219 
KDN010100E01KDN01_0100_E01.bFS678393 
LVR010026D01LVR01_0026_D01.bBP443694 
LVR010033A07LVR01_0033_A07.bBP441431 
LVR010035C06LVR01_0035_C06.bBP443189 
LVR010038C05LVR01_0038_C05.bBP443114 
LVR010054H01LVR01_0054_H01.bBP447254 
LVR010065A07LVR01_0065_A07.bBP441461 
LVR010073G12LVR01_0073_G12.bBP447191 
LVR010085G03LVR01_0085_G03.bCJ000236 
LVRM10002G07LVRM1_0002_G07.bBP140503 
LVRM10006H02LVRM1_0006_H02.bBP140789 
LVRM10011E03LVRM1_0011_E03.bBP451515 
LVRM10013E10LVRM1_0013_E10.bBP451981 
LVRM10016G12LVRM1_0016_G12.bBP453749 
LVRM10024D05LVRM1_0024_D05.bBP139067 
LVRM10032H06LVRM1_0032_H06.bBP140967 
LVRM10033E07LVRM1_0033_E07.bCJ001255 
LVRM10035G04LVRM1_0035_G04.bCJ001446 
LVRM10037B08LVRM1_0037_B08.bCJ001562 
LVRM10042H01LVRM1_0042_H01.bCJ002032 
LVRM10045E11LVRM1_0045_E11.bBW962896 
LVRM10050G05LVRM1_0050_G05.bBP453249 
LVRM10050H09LVRM1_0050_H09.bBP454373 
LVRM10053C10LVRM1_0053_C10.bBP138794 
LVRM10053H09LVRM1_0053_H09.bBP141091 
LVRM10063F05LVRM1_0063_F05.bBP139992 AK232989
LVRM10065E06LVRM1_0065_E06.bBP139574 
LVRM10066D02LVRM1_0066_D02.b  
LVRM10069E08LVRM1_0069_E08.bBP451858 
LVRM10077F02LVRM1_0077_F02.bBP139880 
LVRM10083H04LVRM1_0083_H04.bCJ002668 
LVRM10086B10LVRM1_0086_B10.bCJ002862 
LVRM10089E07LVRM1_0089_E07.bCJ003141 
LVRM10091B06LVRM1_0091_B06.bCJ003269 
LVRM10091C09LVRM1_0091_C09.bCJ003283 
LVRM10109C06LVRM1_0109_C06.bBP450065 
LVRM10112C05LVRM1_0112_C05.bBP450000 
LVRM10115G05LVRM1_0115_G05.bBP453266 
LVRM10117H05LVRM1_0117_H05.bBP454104 
LVRM10118A12LVRM1_0118_A12.bBP448891 
LVRM10118D01LVRM1_0118_D01.bBP450573 
LVRM10122C07LVRM1_0122_C07.bBP450145 
LVRM10125C04LVRM1_0125_C04.bBP449943 
LVRM10125G05LVRM1_0125_G05.bBP453276 
LVRM10127E08LVRM1_0127_E08.bBP451883 
LVRM10134D10LVRM1_0134_D10.bBP451226 
LVRM10137C07LVRM1_0137_C07.bBP450158 
LVRM10137D05LVRM1_0137_D05.bBP450868 
LVRM10137E07LVRM1_0137_E07.bBP451828 
LVRM10138H10LVRM1_0138_H10.bBP454484 
LVRM10139A11LVRM1_0139_A11.bBP448841 
LVRM10139C08LVRM1_0139_C08.bBP450233 
LVRM10142D07LVRM1_0142_D07.bBP451016 
LVRM10146G11LVRM1_0146_G11.bBP453730 
LVRM10146H08LVRM1_0146_H08.bBP454349 
LVRM10147E05LVRM1_0147_E05.bBP451700 
LVRM10149F08LVRM1_0149_F08.bBP452698 
LVRM10151B09LVRM1_0151_B09.b  
LVRM10156E08LVRM1_0156_E08.bBP451906 
LVRM10156H10LVRM1_0156_H10.bBP454502 
LVRM10157B05LVRM1_0157_B05.bBP449251 
LVRM10159F07LVRM1_0159_F07.bBP452637 
LVRM10170G04LVRM1_0170_G04.bBW963137 
LVRM10175D04LVRM1_0175_D04.bCJ005048 
LVRM10179F11LVRM1_0179_F11.bCJ005388 
LVRM10181G10LVRM1_0181_G10.bCJ005567 
LVRM10185D04LVRM1_0185_D04.bCJ005860 
LVRM10189B09LVRM1_0189_B09.bCJ006183 
LVRM10194G02LVRM1_0194_G02.bCJ006538 
LVRM10198A04LVRM1_0198_A04.bCJ006816 
LVRM10199F06LVRM1_0199_F06.bCJ006957 
LVRM10202F08LVRM1_0202_F08.bCJ007202 
LVRM10205E03LVRM1_0205_E03.bCJ007435 
OVRM10211G03OVRM1_0211_G03.bBP460627 

  

SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
554A0570.320BSTCA/S
G12100.680TCG/S


Alignment:      TOP

20110601C-001908 : ..............................GTTTTGTGTGCTGTTTTTCTATTTACGTAA
---------+---------+---------+---------+---------+---------+ 30
KDN01_0020_E10.b : ngcgtattnnnnnagctgacgtgtgcacggGTTTTGTGTGCTGTTTTTCTATTTACGTAA
KDN01_0059_E07.b : nnncctgcggtggctctgg
KDN01_0079_G02.b : nnnnccagctgtggctctggagt
KDN01_0097_H05.b :
KDN01_0095_G09.b :
KDN01_0071_C10.b :
LVRM1_0063_F05.b :
LVRM1_0156_E08.b :
LVRM1_0146_G11.b :
LVR01_0035_C06.b :
LVRM1_0147_E05.b :
LVRM1_0086_B10.b :
LVRM1_0066_D02.b :
LVRM1_0083_H04.b :
LVRM1_0125_C04.b :
LVRM1_0011_E03.b :
LVRM1_0134_D10.b :
LVRM1_0045_E11.b :
LVRM1_0205_E03.b :
LVRM1_0189_B09.b :
LVRM1_0198_A04.b :
LVRM1_0185_D04.b :
LVRM1_0149_F08.b :
LVRM1_0118_D01.b :
LVRM1_0065_E06.b :
LVRM1_0089_E07.b :
LVRM1_0091_B06.b :
LVRM1_0117_H05.b :
LVRM1_0179_F11.b :
LVRM1_0202_F08.b :
LVRM1_0118_A12.b :
LVRM1_0077_F02.b :
LVRM1_0109_C06.b :
LVRM1_0069_E08.b :
LVRM1_0033_E07.b :
LVRM1_0151_B09.b :
LVRM1_0159_F07.b :
LVRM1_0157_B05.b :
LVRM1_0137_E07.b :
LVRM1_0032_H06.b :
LVRM1_0137_C07.b :
LVRM1_0156_H10.b :
LVRM1_0139_A11.b :
LVRM1_0146_H08.b :
LVRM1_0002_G07.b :
LVR01_0026_D01.b :
LVR01_0038_C05.b :
LVR01_0033_A07.b :
LVR01_0073_G12.b :
LVR01_0065_A07.b :
LVRM1_0175_D04.b :
LVRM1_0024_D05.b :
LVRM1_0199_F06.b :
LVRM1_0115_G05.b :
LVRM1_0050_G05.b :
LVRM1_0091_C09.b :
OVRM1_0211_G03.b :
ITT01_0068_C02.b :
LVRM1_0170_G04.b :
LVRM1_0181_G10.b :
LVRM1_0194_G02.b :
LVRM1_0016_G12.b :
LVRM1_0112_C05.b :
LVRM1_0042_H01.b :
LVRM1_0037_B08.b :
LVRM1_0053_H09.b :
LVRM1_0125_G05.b :
LVRM1_0013_E10.b :
LVRM1_0035_G04.b :
LVRM1_0053_C10.b :
LVRM1_0006_H02.b :
LVRM1_0122_C07.b :
LVRM1_0137_D05.b :
LVRM1_0050_H09.b :
LVR01_0054_H01.b :
LVR01_0085_G03.b :
ITT01_0021_E05.b :
KDN01_0019_B12.b :
KDN01_0031_E05.b :
KDN01_0051_E03.b :
KDN01_0070_H04.b :
KDN01_0030_A10.b :
KDN01_0007_E10.b :
KDN01_0014_B11.b :
KDN01_0010_F12.b :
KDN01_0005_B01.b :
KDN01_0081_D10.b :
KDN01_0073_F09.b :
KDN01_0076_D08.b :
KDN01_0009_G04.b :
KDN01_0012_A04.b :
KDN01_0039_D10.b :
KDN01_0073_E11.b :
KDN01_0100_E01.b :
KDN01_0020_F07.b :
KDN01_0067_G04.b :
KDN01_0088_F03.b :
KDN01_0012_D02.b :
KDN01_0012_B07.b :
KDN01_0074_A08.b :
KDN01_0030_D06.b :
KDN01_0074_D07.b :
KDN01_0021_F03.b :
KDN01_0064_E10.b :
KDN01_0093_G03.b :
KDN01_0032_A07.b :
KDN01_0079_E10.b :
KDN01_0090_H01.b :
KDN01_0024_H11.b :
KDN01_0024_A11.b :
KDN01_0035_E08.b :
KDN01_0069_H07.b :
KDN01_0035_E06.b :
KDN01_0088_A07.b :
KDN01_0059_C02.b :
KDN01_0070_H01.b :
KDN01_0058_E10.b :
KDN01_0095_A02.b :
KDN01_0061_A05.b :
KDN01_0070_C02.b :
KDN01_0043_B02.b :
KDN01_0070_B11.b :
KDN01_0067_B04.b :
KDN01_0033_G03.b :
KDN01_0082_E05.b :
KDN01_0058_B12.b :
KDN01_0074_H04.b :
KDN01_0088_B10.b :
KDN01_0083_A08.b :
KDN01_0085_C06.b :
KDN01_0063_B09.b :
KDN01_0076_B10.b :
KDN01_0094_E01.b :
KDN01_0098_C10.b :
KDN01_0090_A08.b :
KDN01_0038_D12.b :
KDN01_0070_F07.b :
KDN01_0067_E01.b :
KDN01_0082_A07.b :
KDN01_0097_B02.b :
KDN01_0013_B11.b :
KDN01_0098_B11.b :
KDN01_0016_H12.b :
KDN01_0034_D11.b :
KDN01_0025_G09.b :
KDN01_0005_D11.b :
KDN01_0005_G05.b :
KDN01_0032_G12.b :
KDN01_0032_D09.b :
KDN01_0023_E08.b :
KDN01_0034_D05.b :
KDN01_0051_C03.b :
KDN01_0063_F08.b :
KDN01_0019_F07.b :
KDN01_0031_D01.b :
KDN01_0062_G03.b :
KDN01_0080_F12.b :
KDN01_0074_A10.b :
KDN01_0033_D10.b :
KDN01_0080_A04.b :
KDN01_0070_B12.b :
KDN01_0011_B11.b :
KDN01_0071_A09.b :
KDN01_0041_D03.b :
KDN01_0025_G06.b :
KDN01_0001_E06.b :
KDN01_0009_C10.b :
KDN01_0019_G10.b :
KDN01_0090_F07.b :
KDN01_0056_C02.b :
KDN01_0054_D09.b :
KDN01_0078_D11.b :
KDN01_0029_B05.b :
KDN01_0082_F06.b :
KDN01_0067_A11.b :
KDN01_0006_C05.b :
KDN01_0028_F04.b :
KDN01_0070_A01.b :
KDN01_0045_A10.b :
KDN01_0046_C03.b :
KDN01_0048_H05.b :
KDN01_0052_H11.b :
KDN01_0046_A02.b :
KDN01_0080_A10.b :
KDN01_0005_C02.b :
LVRM1_0142_D07.b :
LVRM1_0138_H10.b :
KDN01_0078_D12.b :
KDN01_0064_F12.b :
LVRM1_0139_C08.b :
LVRM1_0127_E08.b :
KDN01_0083_D04.b :
20110601C-001908 : ATCATGCTGAACATGTTTGCATCAACCTCCTGGTGATGCACCTTTGATCAATAGATTTTA
---------+---------+---------+---------+---------+---------+ 90
KDN01_0020_E10.b : ATCATGCTGAACATGTTTGCATCAACCTCCTGGTGATGCACCTTTGATCAATAGATTTTA
KDN01_0059_E07.b : taatctgctgACATGTTTGCATCAACCTCCTGGTGATGCACCTTTGATCAATAGATTTTA
KDN01_0079_G02.b : aatctgctgaACATGTTTGCATCAACCTCCTGGTGATGCACCTTTGATCAATAGATTTTA
KDN01_0097_H05.b : nnnnngctgctgtggctctggatACCTCCTGGTGATGCACCTTTGATCA*TAGATTTTA
KDN01_0095_G09.b :
KDN01_0071_C10.b :
LVRM1_0063_F05.b :
LVRM1_0156_E08.b :
LVRM1_0146_G11.b :
LVR01_0035_C06.b : ctaacccaatctcgaa
LVRM1_0147_E05.b :
LVRM1_0086_B10.b :
LVRM1_0066_D02.b :
LVRM1_0083_H04.b :
LVRM1_0125_C04.b :
LVRM1_0011_E03.b :
LVRM1_0134_D10.b :
LVRM1_0045_E11.b :
LVRM1_0205_E03.b :
LVRM1_0189_B09.b :
LVRM1_0198_A04.b :
LVRM1_0185_D04.b :
LVRM1_0149_F08.b :
LVRM1_0118_D01.b :
LVRM1_0065_E06.b :
LVRM1_0089_E07.b :
LVRM1_0091_B06.b :
LVRM1_0117_H05.b :
LVRM1_0179_F11.b :
LVRM1_0202_F08.b :
LVRM1_0118_A12.b :
LVRM1_0077_F02.b :
LVRM1_0109_C06.b :
LVRM1_0069_E08.b :
LVRM1_0033_E07.b :
LVRM1_0151_B09.b :
LVRM1_0159_F07.b :
LVRM1_0157_B05.b :
LVRM1_0137_E07.b :
LVRM1_0032_H06.b :
LVRM1_0137_C07.b :
LVRM1_0156_H10.b :
LVRM1_0139_A11.b :
LVRM1_0146_H08.b :
LVRM1_0002_G07.b :
LVR01_0026_D01.b :
LVR01_0038_C05.b :
LVR01_0033_A07.b :
LVR01_0073_G12.b : ttt
LVR01_0065_A07.b :
LVRM1_0175_D04.b :
LVRM1_0024_D05.b :
LVRM1_0199_F06.b :
LVRM1_0115_G05.b :
LVRM1_0050_G05.b :
LVRM1_0091_C09.b :
OVRM1_0211_G03.b :
ITT01_0068_C02.b :
LVRM1_0170_G04.b :
LVRM1_0181_G10.b :
LVRM1_0194_G02.b :
LVRM1_0016_G12.b :
LVRM1_0112_C05.b :
LVRM1_0042_H01.b :
LVRM1_0037_B08.b :
LVRM1_0053_H09.b :
LVRM1_0125_G05.b :
LVRM1_0013_E10.b :
LVRM1_0035_G04.b :
LVRM1_0053_C10.b :
LVRM1_0006_H02.b :
LVRM1_0122_C07.b :
LVRM1_0137_D05.b :
LVRM1_0050_H09.b :
LVR01_0054_H01.b : a
LVR01_0085_G03.b :
ITT01_0021_E05.b :
KDN01_0019_B12.b :
KDN01_0031_E05.b :
KDN01_0051_E03.b :
KDN01_0070_H04.b :
KDN01_0030_A10.b :
KDN01_0007_E10.b :
KDN01_0014_B11.b :
KDN01_0010_F12.b :
KDN01_0005_B01.b :
KDN01_0081_D10.b :
KDN01_0073_F09.b :
KDN01_0076_D08.b :
KDN01_0009_G04.b :
KDN01_0012_A04.b :
KDN01_0039_D10.b :
KDN01_0073_E11.b :
KDN01_0100_E01.b :
KDN01_0020_F07.b :
KDN01_0067_G04.b :
KDN01_0088_F03.b :
KDN01_0012_D02.b :
KDN01_0012_B07.b :
KDN01_0074_A08.b :
KDN01_0030_D06.b :
KDN01_0074_D07.b :
KDN01_0021_F03.b :
KDN01_0064_E10.b :
KDN01_0093_G03.b :
KDN01_0032_A07.b :
KDN01_0079_E10.b :
KDN01_0090_H01.b :
KDN01_0024_H11.b :
KDN01_0024_A11.b :
KDN01_0035_E08.b :
KDN01_0069_H07.b :
KDN01_0035_E06.b :
KDN01_0088_A07.b :
KDN01_0059_C02.b :
KDN01_0070_H01.b :
KDN01_0058_E10.b :
KDN01_0095_A02.b :
KDN01_0061_A05.b :
KDN01_0070_C02.b :
KDN01_0043_B02.b :
KDN01_0070_B11.b :
KDN01_0067_B04.b :
KDN01_0033_G03.b :
KDN01_0082_E05.b :
KDN01_0058_B12.b :
KDN01_0074_H04.b :
KDN01_0088_B10.b :
KDN01_0083_A08.b :
KDN01_0085_C06.b :
KDN01_0063_B09.b :
KDN01_0076_B10.b :
KDN01_0094_E01.b :
KDN01_0098_C10.b :
KDN01_0090_A08.b :
KDN01_0038_D12.b :
KDN01_0070_F07.b :
KDN01_0067_E01.b :
KDN01_0082_A07.b :
KDN01_0097_B02.b :
KDN01_0013_B11.b :
KDN01_0098_B11.b :
KDN01_0016_H12.b :
KDN01_0034_D11.b :
KDN01_0025_G09.b :
KDN01_0005_D11.b :
KDN01_0005_G05.b :
KDN01_0032_G12.b :
KDN01_0032_D09.b :
KDN01_0023_E08.b :
KDN01_0034_D05.b :
KDN01_0051_C03.b :
KDN01_0063_F08.b :
KDN01_0019_F07.b :
KDN01_0031_D01.b :
KDN01_0062_G03.b :
KDN01_0080_F12.b :
KDN01_0074_A10.b :
KDN01_0033_D10.b :
KDN01_0080_A04.b :
KDN01_0070_B12.b :
KDN01_0011_B11.b :
KDN01_0071_A09.b :
KDN01_0041_D03.b :
KDN01_0025_G06.b :
KDN01_0001_E06.b :
KDN01_0009_C10.b :
KDN01_0019_G10.b :
KDN01_0090_F07.b :
KDN01_0056_C02.b :
KDN01_0054_D09.b :
KDN01_0078_D11.b :
KDN01_0029_B05.b :
KDN01_0082_F06.b :
KDN01_0067_A11.b :
KDN01_0006_C05.b :
KDN01_0028_F04.b :
KDN01_0070_A01.b :
KDN01_0045_A10.b :
KDN01_0046_C03.b :
KDN01_0048_H05.b :
KDN01_0052_H11.b :
KDN01_0046_A02.b :
KDN01_0080_A10.b :
KDN01_0005_C02.b :
LVRM1_0142_D07.b :
LVRM1_0138_H10.b :
KDN01_0078_D12.b :
KDN01_0064_F12.b :
LVRM1_0139_C08.b :
LVRM1_0127_E08.b :
KDN01_0083_D04.b :
20110601C-001908 : GACAAAAGTGGTTTTTGAGTCCAAAGATCAGGGCTGGGTTGACCTACAGATTGGATACAG
---------+---------+---------+---------+---------+---------+ 150
KDN01_0020_E10.b : GACAAAAGTGGTTTTTGAGTCCAAAGATCAGGGCTGGGTTGACCTACAGATTGGATACAG
KDN01_0059_E07.b : GACAAAAGTGGTTTTTGAGTCCAAAGATCAGGGCTGGGTTGACCTACAGATTGGATACAG
KDN01_0079_G02.b : GACAAAAGTGGTTTTTGAGTCCAAAGATCAGGGCTGGGTTGACCTACAGATTGGATACAG
KDN01_0097_H05.b : GACAAAAGTGGTTTTTGAGTCCAAAGATCAGGGCTGGGTTGACCTACAGATTGGATACAG
KDN01_0095_G09.b : nnnnccggcgttggctctggatc
KDN01_0071_C10.b : nnncctgcggtggct
LVRM1_0063_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0156_E08.b : cagtgacxxxxxxxxxxxxxxxxx
LVRM1_0146_G11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_C06.b : aaaaacactgaatctttggggacctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0147_E05.b : tagttgtcxxxxxxxxxxxxxxxxxx
LVRM1_0086_B10.b : ttgtcxxxxxxxxxxxxxxxxxxx
LVRM1_0066_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0083_H04.b : agttgtcxxxxxxxxxxxxxxxxxxxx
LVRM1_0125_C04.b : cagttgtcxxxxxxxxxxxxxxxxxxxx
LVRM1_0011_E03.b : cgttgtcxxxxxxxxxxxxxxxxxxx
LVRM1_0134_D10.b : ncgtttgtcxxxxxxxxxxxxxxxxxxxx
LVRM1_0045_E11.b : xxxxxxxxxxxxxx
LVRM1_0205_E03.b : xxxxxxxxxxxxxxx
LVRM1_0189_B09.b : cagttgtcxxxxxxxxxxxxxxxxxxx
LVRM1_0198_A04.b : tcxxxxxxxxxxxxxxxxxxx
LVRM1_0185_D04.b : ttgtcxxxxxxxxxxxxxxxxxxx
LVRM1_0149_F08.b : nagttgtcxxxxxxxxxxxxxxxxxxx
LVRM1_0118_D01.b : taatgtcxxxxxxxxxxxxxxxxxxx
LVRM1_0065_E06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0089_E07.b : gtcxxxxxxxxxxxxxxxxxxx
LVRM1_0091_B06.b : ttgtcxxxxxxxxxxxxxxxxxxx
LVRM1_0117_H05.b : agttgtcxxxxxxxxxxxxxxxxxxx
LVRM1_0179_F11.b : cgttgtcxxxxxxxxxxxxxxxxxxx
LVRM1_0202_F08.b : xxxxxxxxxxx
LVRM1_0118_A12.b : agtgtcxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_F02.b : agttgacxxxxxxxxxxxxxxxxxxx
LVRM1_0109_C06.b : cagttgtcxxxxxxxxxxxxxxxxxxxx
LVRM1_0069_E08.b : nagttgtcxxxxxxxxxxxxxxxxxxx
LVRM1_0033_E07.b : gagttgtcxxxxxxxxxxxxxxxxxxx
LVRM1_0151_B09.b : nagttgtcxxxxxxxxxxxxxxxxxxx
LVRM1_0159_F07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_B05.b : tagttgtcxxxxxxxxxxxxxxxxxx
LVRM1_0137_E07.b : agttgtcxxxxxxxxxxxxxxxxxxx
LVRM1_0032_H06.b : nagttgtcxxxxxxxxxxxxxxxxxxxx
LVRM1_0137_C07.b : nagttgtcxxxxxxxxxxxxxxxxxxx
LVRM1_0156_H10.b : ttttaagttgtcxxxxxxxxxxxxxxxxxxx
LVRM1_0139_A11.b : tcagttgtcxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_H08.b : nagttgtcxxxxxxxxxxxxxxxxxxxx
LVRM1_0002_G07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0026_D01.b : ctttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_C05.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_A07.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_G12.b : tttttttttatggcttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_A07.b : atttacagaaacgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0175_D04.b : ncgttgtcxxxxxxxxxxxxxxxxxxx
LVRM1_0024_D05.b : acgttgacxxxxxxxxxx
LVRM1_0199_F06.b : ccgttgtcxxxxxxxxxxxxxxx
LVRM1_0115_G05.b : agtgtcxxxxxxxxxx
LVRM1_0050_G05.b : caattgtcxxxxxxxxxxxxxxx
LVRM1_0091_C09.b : ttgtcxxxxxxxxxxxxxxxxxx
OVRM1_0211_G03.b : gagtttgtcxxxxxxxxxxxxxxx
ITT01_0068_C02.b : nnggatgaacxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0170_G04.b : gtcxxxxxxxxxxxxxxxx
LVRM1_0181_G10.b : ttgtcxxxxxxxxxxxxxxxx
LVRM1_0194_G02.b : xxxxxxxxxxx
LVRM1_0016_G12.b : cgttgtcxxxxxxxxxxxxxxxx
LVRM1_0112_C05.b : tagtttgtcxxxxxxxxxxxxxxxx
LVRM1_0042_H01.b : xxxxxxxxxxx
LVRM1_0037_B08.b : ncgttgtcxxxxxxxxxxxxxxxx
LVRM1_0053_H09.b : nagttgtcxxxxxxxxxxx
LVRM1_0125_G05.b : nagtttgtcatxxxxxxxxxxxxxxx
LVRM1_0013_E10.b : xxxxxxxxxxx
LVRM1_0035_G04.b : gagttgtcxxxxxxxxxxxxxxxx
LVRM1_0053_C10.b : nagttgtcxxxxxxxxxxxxxxxx
LVRM1_0006_H02.b : atxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0122_C07.b : tagtttgtcxxxxxxxxxxxxxxxxx
LVRM1_0137_D05.b : agttgtcxxxxxxxxxxxxxxxx
LVRM1_0050_H09.b : nagtttgtcxxxxxxxxxxxxxxxx
LVR01_0054_H01.b : ttttttatatattttggcttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0085_G03.b : ggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0021_E05.b : nnnggtgaaacxxxxxxxx
KDN01_0019_B12.b :
KDN01_0031_E05.b :
KDN01_0051_E03.b :
KDN01_0070_H04.b :
KDN01_0030_A10.b :
KDN01_0007_E10.b :
KDN01_0014_B11.b :
KDN01_0010_F12.b :
KDN01_0005_B01.b :
KDN01_0081_D10.b :
KDN01_0073_F09.b :
KDN01_0076_D08.b :
KDN01_0009_G04.b :
KDN01_0012_A04.b :
KDN01_0039_D10.b :
KDN01_0073_E11.b :
KDN01_0100_E01.b :
KDN01_0020_F07.b :
KDN01_0067_G04.b :
KDN01_0088_F03.b :
KDN01_0012_D02.b :
KDN01_0012_B07.b :
KDN01_0074_A08.b :
KDN01_0030_D06.b :
KDN01_0074_D07.b :
KDN01_0021_F03.b :
KDN01_0064_E10.b :
KDN01_0093_G03.b :
KDN01_0032_A07.b :
KDN01_0079_E10.b :
KDN01_0090_H01.b :
KDN01_0024_H11.b :
KDN01_0024_A11.b :
KDN01_0035_E08.b :
KDN01_0069_H07.b :
KDN01_0035_E06.b :
KDN01_0088_A07.b :
KDN01_0059_C02.b :
KDN01_0070_H01.b :
KDN01_0058_E10.b :
KDN01_0095_A02.b :
KDN01_0061_A05.b :
KDN01_0070_C02.b :
KDN01_0043_B02.b :
KDN01_0070_B11.b :
KDN01_0067_B04.b :
KDN01_0033_G03.b :
KDN01_0082_E05.b :
KDN01_0058_B12.b :
KDN01_0074_H04.b :
KDN01_0088_B10.b :
KDN01_0083_A08.b :
KDN01_0085_C06.b :
KDN01_0063_B09.b :
KDN01_0076_B10.b :
KDN01_0094_E01.b :
KDN01_0098_C10.b :
KDN01_0090_A08.b :
KDN01_0038_D12.b :
KDN01_0070_F07.b :
KDN01_0067_E01.b :
KDN01_0082_A07.b :
KDN01_0097_B02.b :
KDN01_0013_B11.b :
KDN01_0098_B11.b :
KDN01_0016_H12.b :
KDN01_0034_D11.b :
KDN01_0025_G09.b :
KDN01_0005_D11.b :
KDN01_0005_G05.b :
KDN01_0032_G12.b :
KDN01_0032_D09.b :
KDN01_0023_E08.b :
KDN01_0034_D05.b :
KDN01_0051_C03.b :
KDN01_0063_F08.b :
KDN01_0019_F07.b :
KDN01_0031_D01.b :
KDN01_0062_G03.b :
KDN01_0080_F12.b :
KDN01_0074_A10.b :
KDN01_0033_D10.b :
KDN01_0080_A04.b :
KDN01_0070_B12.b :
KDN01_0011_B11.b :
KDN01_0071_A09.b :
KDN01_0041_D03.b :
KDN01_0025_G06.b :
KDN01_0001_E06.b :
KDN01_0009_C10.b :
KDN01_0019_G10.b :
KDN01_0090_F07.b :
KDN01_0056_C02.b :
KDN01_0054_D09.b :
KDN01_0078_D11.b :
KDN01_0029_B05.b :
KDN01_0082_F06.b :
KDN01_0067_A11.b :
KDN01_0006_C05.b :
KDN01_0028_F04.b :
KDN01_0070_A01.b :
KDN01_0045_A10.b :
KDN01_0046_C03.b :
KDN01_0048_H05.b :
KDN01_0052_H11.b :
KDN01_0046_A02.b :
KDN01_0080_A10.b :
KDN01_0005_C02.b :
LVRM1_0142_D07.b :
LVRM1_0138_H10.b :
KDN01_0078_D12.b :
KDN01_0064_F12.b :
LVRM1_0139_C08.b :
LVRM1_0127_E08.b :
KDN01_0083_D04.b :
20110601C-001908 : GGTGTATAAAACAGAGGCAAGGCGCAGGCTGATAGCAGAGCAAT*CAGTGCCAAGTCTGA
---------+---------+---------+---------+---------+---------+ 209
KDN01_0020_E10.b : GGTGTATAAAACAGAGGCAAGGCGCAGGCTGATAGCAGAGCAAT*CAGTGCCAAGTCTGA
KDN01_0059_E07.b : GGTGTATAAAACAGAGGCAAGGCGCAGGCTGATAGCAGAGCAAT*CAGTGCCAAGTCTGA
KDN01_0079_G02.b : GGTGTATAAAACAGAGGCAAGGCGCAGGCTGATAGCAGAGCAAT*CAGTGCCAAGTCTGA
KDN01_0097_H05.b : GGTGTATAAAACAGAGGCAAGGCGCAGGCTGATAGCAGAGCAAT*CAGTGCCAAGTCTGA
KDN01_0095_G09.b : gggtgtatAAACAGAGGCAAGGCGCAGGCTGATAGCAGAGCAAT*CAGTGCCAAGTCTGA
KDN01_0071_C10.b : agggtgtatAACAGAGGCAAGGCGCAGGCTGATAGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0063_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxtactGGAGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0156_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0146_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAGCAGAGCAAT*CAGTGCCAAGTCTGA
LVR01_0035_C06.b : xxxxxxxxxxxxxxxxxxxxcccggtctactGGAGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0147_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0086_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0066_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAGT*CAGTGCCAAGTCTGA
LVRM1_0083_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGCCTGA
LVRM1_0125_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0011_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0134_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0045_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0205_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0189_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0198_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0185_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0149_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0118_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0065_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0089_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0091_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0117_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0179_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0202_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0118_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0077_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0109_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0069_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0033_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0151_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAATGCAGTGACAAGTCTGG
LVRM1_0159_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0157_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0137_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0032_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0137_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0156_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0139_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0146_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0002_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVR01_0026_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVR01_0038_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVR01_0033_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVR01_0073_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVR01_0065_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0175_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctgAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0024_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0199_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0115_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAGCAAT*CAGTGCCAAGCCTGA
LVRM1_0050_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0091_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggAGAGCAAT*CAGTGCCAAGTCTGA
OVRM1_0211_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAGCAAT*CAGTGCCAAGTCTGA
ITT01_0068_C02.b : xxxxxxxxxxxxxxxxxxxxxttgttggcctactggAGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0170_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0181_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0194_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0016_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0112_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0042_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0037_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0053_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0125_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0013_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0035_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0053_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0006_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0122_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0137_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCAAT*CAGTGCCAAGTCTGA
LVRM1_0050_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCAAT*CAGTACCAAGTCTGA
LVR01_0054_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCAAT*CAGTGCCAAGTCTGA
LVR01_0085_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCAAT*CAGTGCCAAGTCTGA
ITT01_0021_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCAAT*CAGTGCCAAGTCTGA
KDN01_0019_B12.b : nggggtttnnnnnnnncctagcggtggccactggacaaACAT*CAGTGCC*AGTCTGA
KDN01_0031_E05.b : gcgttggctctggagcaACAT*CAGTGCC*AGTCTGA
KDN01_0051_E03.b : tcagcgttggctctggacgACAT*CAGTGCC*AGTCTGA
KDN01_0070_H04.b : ntttctgacgtggctatggacaaACAT*CAGTGCC*AGTCTGA
KDN01_0030_A10.b : gcggtggctcggagcaACAT*CAGTGCC*AGTCTGA
KDN01_0007_E10.b : nctttttnnnnnncctgcgttggctctggacaaACAT*CAGTGCC*AGTCTGA
KDN01_0014_B11.b : tttgtgncctgcgttggctatggagcaACAT*CAGTGCC*AGTCTGA
KDN01_0010_F12.b : ncttttnnnnnncctgcgttggctcggagcaACAT*CAGTGCC*AGTCTGA
KDN01_0005_B01.b : nncctgcagttgccactggacaaACAT*CAGTGCC*AGTCTGA
KDN01_0081_D10.b : ccgcgtggctatggagACAT*CAGTGCCA*GTCTGA
KDN01_0073_F09.b : nnncctgctgtggctctggacaaACAT*CAGTGCC*AGTCTGA
KDN01_0076_D08.b : nctcgcgttggcactggagcaACAT*CAGTGCC*AGTCTGA
KDN01_0009_G04.b : ncccttnnnnnnncctgcattggctcggagACAT*CAGTGCC*AGTCTGA
KDN01_0012_A04.b : nnccttannnnnnncctgcgttggcacggagcaACAT*CAGTGCC*AGTCTGA
KDN01_0039_D10.b : ncctgagttggctatggacagACAT*CAGTGCC*AGTCTGA
KDN01_0073_E11.b : nnncctgctgtggctctggacaaACAT*CAGTGCC*AGTCTGA
KDN01_0100_E01.b : nnnnactgctgtggctctggagACAT*CAGTGCCA*GTCTGA
KDN01_0020_F07.b : nccctttttnnnnnnncctgcggtgtgcacgtgagACAT*CAGTGCC*AGTCTGA
KDN01_0067_G04.b : nnnggctgcggtggctatggacaaACAT*CAGTGCC*AGTCTGA
KDN01_0088_F03.b : nnnncctgcggtggctctggagACAT*CAGTGCC*AGTCTGA
KDN01_0012_D02.b : cctattannnnncctgcgttggctctggagACAT*CAGTGCC*AGTCTGA
KDN01_0012_B07.b : aatcggtnnncctgcgttggctctggacaaACAT*CAGTGCC*AGTCTGA
KDN01_0074_A08.b : nnnncctgctgtggctctggagACAT*CAGTGCC*AGTCTGA
KDN01_0030_D06.b : tcgcgttggctctggagACAT*CAGTGCC*AGTCTGA
KDN01_0074_D07.b : nncctgcggtggctctggagACAT*CAGTGCC*AGTCTGA
KDN01_0021_F03.b : nnnnnnnncctgcgttggctctggagACAT*CAGTGCC*AGTCTGA
KDN01_0064_E10.b : nnnncctgctgtggctctggagACAT*CAGTGCCA*GTCTGA
KDN01_0093_G03.b : nnnncctgcggtggctctggagACAT*CAGTGCCA*GTCTGA
KDN01_0032_A07.b : nnntttcgctgtggctctggagACAT*CAGTGCC*AGTCTGA
KDN01_0079_E10.b : nnncctagcgtggctctggagcaACAT*CAGTGCC*AGTCTGA
KDN01_0090_H01.b : ntttttactgcgttggctatggagcaACAT*CAGTGCC*AGTCTGA
KDN01_0024_H11.b : nnccctgcggtggctctggagACAT*CAGTGCCA*GTCTGA
KDN01_0024_A11.b : gcgttggctctggacaaACAT*CAGTGCC*AGTCTGA
KDN01_0035_E08.b : nnnncctgcggtggctctggagACAT*CAGTGCCA*GTCTGA
KDN01_0069_H07.b : nncctgcgttggctatggacaaACAT*CAGTGCC*AGTCTGA
KDN01_0035_E06.b : nnnnnncctgcgttggctctggacaaACAT*CAGTGCC*AGTCTGA
KDN01_0088_A07.b : nnntttgctgcgttggctctggagcaACAT*CAGTGCCA*GTCTGA
KDN01_0059_C02.b : ttttcctgctgtggctatggagACAT*CAGTGCC*AGTCTGA
KDN01_0070_H01.b : tttttcctgaggtggctctggacaaACAT*CAGTGCC*AGTCTGA
KDN01_0058_E10.b : nncctgcgttggcactggagACAT*CAGTGCC*AGTCTGA
KDN01_0095_A02.b : ncctcgcgtggctatggacaaACAT*CAGTGCC*AGTCTGA
KDN01_0061_A05.b : agcgttggctatggagcaACAT*CAGTGCC*AGTCTGA
KDN01_0070_C02.b : ttctgctgtggctctggacaaACAT*CAGTGCC*AGTCTGA
KDN01_0043_B02.b : attttcctgcgttggctatggacaaACAT*CAGTGCC*AGTCTGA
KDN01_0070_B11.b : nncctgctgtggctctggagcaACAT*CAGTGCC*AGTCTGA
KDN01_0067_B04.b : nnnnncctgcgttggctctggagACAT*CAGTGCC*AGTCTGA
KDN01_0033_G03.b : nnnccctgcgtggctctggagcaACAT*CAGTGCC*AGTCTGA
KDN01_0082_E05.b : nnnnggctgcggttgctctggacaaACAT*CAGTGCC*AGTCTGA
KDN01_0058_B12.b : nttttcctgctgtggctctggagACAT*CAGTGCC*AGTCTGA
KDN01_0074_H04.b : ttttcctgcggtggctctggagACAT*CAGTGCC*AGTCTGA
KDN01_0088_B10.b : tttttgctgctgtggctatggagACAT*CAGTGCCA*GTCTGA
KDN01_0083_A08.b : nnnnncctgcggtggctctggagcaACAT*CAGTGCC*AGTCTGA
KDN01_0085_C06.b : nnnnncctgcgttggctctggagcaACAT*CAGTGCC*AGTCTGA
KDN01_0063_B09.b : ntttcctgcggtggctatggacaaACAT*CAGTGCC*AGTCTGA
KDN01_0076_B10.b : ntttgctgtggctctggagcaACAT*CAGTGCC*AGTCTGA
KDN01_0094_E01.b : nnncctgcgttggctctggagcaACAT*CAGTGCCA*GTCTGA
KDN01_0098_C10.b : nntttcctgctgtggctatggagACAT*CAGTGCCA*GTCTGA
KDN01_0090_A08.b : nnnnggctgcggtggcactggacaaACAT*CAGTGCC*AGTCTGA
KDN01_0038_D12.b : tttgctgaggtggcactggagACAT*CAGTGCCA*GTCTGA
KDN01_0070_F07.b : nncctgcgttggctctggagACAT*CAGTGCC*AGTCTGA
KDN01_0067_E01.b : nnncctgctgtggctctggagACAT*CAGTGCC*AGTCTGA
KDN01_0082_A07.b : nnnnncctgcggtggctatggagACAT*CAGTGCCA*GTCTGA
KDN01_0097_B02.b : nnnncctgctgtggctatggacaaACAT*CAGTGCC*AGTCTGA
KDN01_0013_B11.b : nccttatttnnnncctgcgttggcactggacaaACAT*CAGTGCCA*GTCTGA
KDN01_0098_B11.b : nnnnnactggcgtggctatggagACAT*CAGTGCCA*GTCTGA
KDN01_0016_H12.b : cctannnnnnnnncctgcgttggctctggacaaACAT*CAGTGCC*AGTCTGA
KDN01_0034_D11.b : ttttcctgctgtggctctggacaaACAT*CAGTGCC*AGTCTGA
KDN01_0025_G09.b : nnnnncctgcgttggctatggacaagCAT*CAGTGCC*AGTCTGA
KDN01_0005_D11.b : ncctgcggtggctatggacaagCAT*CAGTGCC*AGTCTGA
KDN01_0005_G05.b : nttactgacgttgctatggacaagCAT*CAGTGCC*AGTCTG*
KDN01_0032_G12.b : ttttttctgcgttggctactggacgagCAT*CAGTGCC*AGTCTGA
KDN01_0032_D09.b : nttttgctgctgtggctactggacgagCAT*CAGTGCCAAGTCTGA
KDN01_0023_E08.b : ncctgctgtggctctggagcgagCAT*CAGTGCC*AGTCTGA
KDN01_0034_D05.b : nnnnncctgaggtggctctggagcaaCAT*CAGTGCCAAGTCTGA
KDN01_0051_C03.b : ttatggctgtggctctggacaagCAT*CAGTGCC*AGTCTGA
KDN01_0063_F08.b : nncctgcgtttgctatggacaagCAT*CAGTGCC*AGTCTGA
KDN01_0019_F07.b : ngggttttnnnnnnncctagcggtgtgcactggagcaaCAT*CAGTGCCAANTCTG*
KDN01_0031_D01.b : nttatcgctgtggctctggacaagCAT*CAGTGCC*AGTCTGA
KDN01_0062_G03.b : nnncctacgtggctatggacgagCAT*CAGTGCC*AGTCTGA
KDN01_0080_F12.b : nnncctgcggtggctatggacaagCAT*CAGTGCC*AGTCTGA
KDN01_0074_A10.b : nnncctgctgtggctatggagcaaCAT*CAGTGCCAAGTCTGA
KDN01_0033_D10.b : tttttcctgaggtggctctggacaagCAT*CAGTGCC*AGTCTGA
KDN01_0080_A04.b : ntttactgcggtggctatggacaaaCAT*CAGTGCCAAGTCTGA
KDN01_0070_B12.b : nnncccgctgtggctctggacaagCAT*CAGTGCCAAGTCTGA
KDN01_0011_B11.b : ctatnnnnnnncctgcgttggctatggacgagCAT*CAGTGCC*AGTCTGA
KDN01_0071_A09.b : nnncctgcggtggctctggacaaaCAT*CAGTGCCAAGTCTGA
KDN01_0041_D03.b : ncctggttnnnnnnncctgcgggtgcactggacaagCAT*CAGTGCC*AGTCTGA
KDN01_0025_G06.b : ttttncctgcgttggctatggacgagCAT*CAGTGCCAAGTCTGA
KDN01_0001_E06.b : nnccgtttnnnnttttggctgcgttgtgcacgtgagcaacAT*CAGTGCCAANTCTGA
KDN01_0009_C10.b : nnnnncctgcgttggctatggacaaacAT*CAGTGCCAAGTCTGA
KDN01_0019_G10.b : ngctatatnnnnnnncctgcgttgtgcactggacaaacAT*CAGTGCCAANTCTGA
KDN01_0090_F07.b : nnnnncctgcggtggctctggacaagcAT*CAGTGCCAAGTCTG*
KDN01_0056_C02.b : gctgtggctctggagacAT*CAGTGCC*AGTCTGA
KDN01_0054_D09.b : gttggctctggagacAT*CAGTGCC*AGTCTGA
KDN01_0078_D11.b : nnnncctgcggtggctctggacaaacAT*CAGTGCCAAGTCTGA
KDN01_0029_B05.b : nnnaaccgctgtggctatggacaagcAT*CAGTGCCAAGTCTGA
KDN01_0082_F06.b : nnnncctgcggtggctatggacaaacAT*CAGTGCCAAGTCTG*
KDN01_0067_A11.b : nnnnttgctgcgttggctatggacaaacAT*CAGTGCCAAGTCTGA
KDN01_0006_C05.b : nncctactgtggctatgnacaaagcatcGTGCCAGTCTGA
KDN01_0028_F04.b : nnnnnncctgcgttggctctggatcGTGCCAGTCTGA
KDN01_0070_A01.b : ttttcctgcggtggctatggagagatcGTGCCAGTCTGA
KDN01_0045_A10.b : TG
KDN01_0046_C03.b :
KDN01_0048_H05.b :
KDN01_0052_H11.b :
KDN01_0046_A02.b :
KDN01_0080_A10.b :
KDN01_0005_C02.b :
LVRM1_0142_D07.b :
LVRM1_0138_H10.b :
KDN01_0078_D12.b :
KDN01_0064_F12.b :
LVRM1_0139_C08.b :
LVRM1_0127_E08.b :
KDN01_0083_D04.b :
20110601C-001908 : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
---------+---------+---------+---------+---------+---------+ 268
KDN01_0020_E10.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0059_E07.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0079_G02.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0097_H05.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0095_G09.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0071_C10.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0063_F05.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0156_E08.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0146_G11.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVR01_0035_C06.b : AATAACTGAAAGGGC*GCAGCCAAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0147_E05.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0086_B10.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0066_D02.b : AATAACTGACAGGGCTGCATCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0083_H04.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0125_C04.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0011_E03.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0134_D10.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0045_E11.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0205_E03.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0189_B09.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0198_A04.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0185_D04.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0149_F08.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0118_D01.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0065_E06.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGGGGATGGAGGA
LVRM1_0089_E07.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0091_B06.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0117_H05.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0179_F11.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0202_F08.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0118_A12.b : AATAGCTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0077_F02.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0109_C06.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0069_E08.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0033_E07.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0151_B09.b : AATAACTGAGAGGGC*GCACCCCAAGGCTTCCTGCGGGGCCAGCGAGTGATGATGGAGGA
LVRM1_0159_F07.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0157_B05.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0137_E07.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0032_H06.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0137_C07.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0156_H10.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0139_A11.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0146_H08.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0002_G07.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVR01_0026_D01.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVR01_0038_C05.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVR01_0033_A07.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVR01_0073_G12.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVR01_0065_A07.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0175_D04.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0024_D05.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0199_F06.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0115_G05.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0050_G05.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0091_C09.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
OVRM1_0211_G03.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
ITT01_0068_C02.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0170_G04.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0181_G10.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0194_G02.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0016_G12.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0112_C05.b : AACAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0042_H01.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0037_B08.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0053_H09.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATAGAGGA
LVRM1_0125_G05.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0013_E10.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0035_G04.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0053_C10.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0006_H02.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0122_C07.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0137_D05.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVRM1_0050_H09.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVR01_0054_H01.b : AGTAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
LVR01_0085_G03.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
ITT01_0021_E05.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0019_B12.b : AATA*CTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0031_E05.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0051_E03.b : A*TAACTGAGAGGGC*GCAGCCGACCTCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0070_H04.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0030_A10.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0007_E10.b : AATA*CTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0014_B11.b : AA*AACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0010_F12.b : AA*AACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0005_B01.b : AAT*ACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0081_D10.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0073_F09.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0076_D08.b : A*TAACTGAGAGGGC*GCAGCCGAACCCTTCAAGCGGGGNCAGNGAGTGAGGATGGAGGA
KDN01_0009_G04.b : AA*AACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0012_A04.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0039_D10.b : A*TAACTGAGAGGGC*GCAGCCGAAGCCTTTAAGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0073_E11.b : A*TAACTGAGAGGGC*GCAGCCGAAGCCTTTATGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0100_E01.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0020_F07.b : AA*AACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0067_G04.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0088_F03.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0012_D02.b : GATA*CTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0012_B07.b : AATA*CTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0074_A08.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0030_D06.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0074_D07.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0021_F03.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0064_E10.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0093_G03.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0032_A07.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0079_E10.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0090_H01.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0024_H11.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0024_A11.b : A*TAACTGAGGGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0035_E08.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0069_H07.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0035_E06.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0088_A07.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0059_C02.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0070_H01.b : *ATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0058_E10.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0095_A02.b : *ATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0061_A05.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0070_C02.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0043_B02.b : *ATAACTGAGAGGGC*GCAGCCGAACGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0070_B11.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0067_B04.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0033_G03.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0082_E05.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0058_B12.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0074_H04.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0088_B10.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0083_A08.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0085_C06.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0063_B09.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0076_B10.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0094_E01.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0098_C10.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0090_A08.b : *ATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0038_D12.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTCCCTTCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0070_F07.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0067_E01.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0082_A07.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0097_B02.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0013_B11.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0098_B11.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0016_H12.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0034_D11.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0025_G09.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0005_D11.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0005_G05.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0032_G12.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0032_D09.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0023_E08.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0034_D05.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0051_C03.b : A*TAACTGAGAGGGC*GCAGCCGACGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0063_F08.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0019_F07.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0031_D01.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0062_G03.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0080_F12.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0074_A10.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0033_D10.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0080_A04.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0070_B12.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0011_B11.b : AA*AACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0071_A09.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0041_D03.b : A*TAACTGAGAGGGC*GCAGCCGACGCTATAAGGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0025_G06.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0001_E06.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0009_C10.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0019_G10.b : AATA*CTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0090_F07.b : AATAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGACCAGCGAGTGAGGATGGAGGA
KDN01_0056_C02.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0054_D09.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0078_D11.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0029_B05.b : A*TAACTGAGAGGGC*GCAGCCGACGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0082_F06.b : AATGACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0067_A11.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0006_C05.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0028_F04.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0070_A01.b : A*TAACTGAGAGGGC*GCAGCCGAAGGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0045_A10.b : AAATACTGAGAGGGC*GCAGCCGATTGCTTCCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0046_C03.b : accctTTTCTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0048_H05.b : acctattaTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0052_H11.b : cccctctttttaaTGCGGGGCCAGCGAGTGAGGATGGAGGA
KDN01_0046_A02.b : GAGGATGGAGGA
KDN01_0080_A10.b :
KDN01_0005_C02.b :
LVRM1_0142_D07.b :
LVRM1_0138_H10.b :
KDN01_0078_D12.b :
KDN01_0064_F12.b :
LVRM1_0139_C08.b :
LVRM1_0127_E08.b :
KDN01_0083_D04.b :
20110601C-001908 : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
---------+---------+---------+---------+---------+---------+ 327
KDN01_0020_E10.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0059_E07.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0079_G02.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0097_H05.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0095_G09.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0071_C10.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0063_F05.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0156_E08.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0146_G11.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVR01_0035_C06.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0147_E05.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0086_B10.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0066_D02.b : GGGAATGAACCTTCTCCATAACTTGGGGATCCAATCATCGCGCGTACCTCCAGGTGAATT
LVRM1_0083_H04.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0125_C04.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0011_E03.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0134_D10.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0045_E11.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0205_E03.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0189_B09.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0198_A04.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0185_D04.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0149_F08.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0118_D01.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0065_E06.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0089_E07.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0091_B06.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0117_H05.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0179_F11.b : GGGAATGGACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0202_F08.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0118_A12.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0077_F02.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0109_C06.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0069_E08.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0033_E07.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0151_B09.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAAGGCGC*TACCTCCAGGTGAATT
LVRM1_0159_F07.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0157_B05.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0137_E07.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0032_H06.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0137_C07.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0156_H10.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0139_A11.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0146_H08.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0002_G07.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVR01_0026_D01.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVR01_0038_C05.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVR01_0033_A07.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVR01_0073_G12.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVR01_0065_A07.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0175_D04.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0024_D05.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0199_F06.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0115_G05.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0050_G05.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0091_C09.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
OVRM1_0211_G03.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
ITT01_0068_C02.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0170_G04.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0181_G10.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0194_G02.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0016_G12.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0112_C05.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0042_H01.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0037_B08.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0053_H09.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGT*TACCTCCAGGTGAATT
LVRM1_0125_G05.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0013_E10.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0035_G04.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0053_C10.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0006_H02.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0122_C07.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0137_D05.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVRM1_0050_H09.b : GGGAATGTACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVR01_0054_H01.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
LVR01_0085_G03.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
ITT01_0021_E05.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0019_B12.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0031_E05.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0051_E03.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0070_H04.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0030_A10.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0007_E10.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0014_B11.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0010_F12.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0005_B01.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0081_D10.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0073_F09.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0076_D08.b : GGGATTCCATTTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0009_G04.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0012_A04.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0039_D10.b : GGGAATGACTCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0073_E11.b : GGGAATGCCTTTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0100_E01.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0020_F07.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0067_G04.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0088_F03.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0012_D02.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0012_B07.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0074_A08.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0030_D06.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0074_D07.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0021_F03.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0064_E10.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0093_G03.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0032_A07.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0079_E10.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0090_H01.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0024_H11.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0024_A11.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0035_E08.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0069_H07.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0035_E06.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0088_A07.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0059_C02.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0070_H01.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0058_E10.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0095_A02.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TATCTCCAGGTGAATT
KDN01_0061_A05.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0070_C02.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0043_B02.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0070_B11.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0067_B04.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0033_G03.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0082_E05.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0058_B12.b : GGGAATGAACCTTCTCCACAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0074_H04.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0088_B10.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0083_A08.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0085_C06.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0063_B09.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0076_B10.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0094_E01.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0098_C10.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0090_A08.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0038_D12.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0070_F07.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0067_E01.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0082_A07.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0097_B02.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0013_B11.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0098_B11.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0016_H12.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0034_D11.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0025_G09.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0005_D11.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0005_G05.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0032_G12.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0032_D09.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0023_E08.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0034_D05.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0051_C03.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0063_F08.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0019_F07.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0031_D01.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0062_G03.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0080_F12.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0074_A10.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0033_D10.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0080_A04.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0070_B12.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0011_B11.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0071_A09.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0041_D03.b : GGGAACGTACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0025_G06.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0001_E06.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0009_C10.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0019_G10.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0090_F07.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0056_C02.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0054_D09.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0078_D11.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0029_B05.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0082_F06.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0067_A11.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0006_C05.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0028_F04.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0070_A01.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0045_A10.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0046_C03.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0048_H05.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0052_H11.b : GGGACTGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0046_A02.b : GGGAATGAACCTTCTCCATAACTTTGGGATCCAATCAACGCGC*TACCTCCAGGTGAATT
KDN01_0080_A10.b :
KDN01_0005_C02.b :
LVRM1_0142_D07.b :
LVRM1_0138_H10.b :
KDN01_0078_D12.b :
KDN01_0064_F12.b :
LVRM1_0139_C08.b :
LVRM1_0127_E08.b :
KDN01_0083_D04.b :
20110601C-001908 : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
---------+---------+---------+---------+---------+---------+ 387
KDN01_0020_E10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0059_E07.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0079_G02.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0097_H05.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0095_G09.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0071_C10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0063_F05.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0156_E08.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0146_G11.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVR01_0035_C06.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0147_E05.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0086_B10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0066_D02.b : ACCATGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0083_H04.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0125_C04.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0011_E03.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0134_D10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0045_E11.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0205_E03.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0189_B09.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0198_A04.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0185_D04.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0149_F08.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0118_D01.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0065_E06.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0089_E07.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0091_B06.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0117_H05.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0179_F11.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0202_F08.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0118_A12.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0077_F02.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0109_C06.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0069_E08.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0033_E07.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0151_B09.b : ACCACGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCACAAATGCCT
LVRM1_0159_F07.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0157_B05.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0137_E07.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0032_H06.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0137_C07.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0156_H10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0139_A11.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0146_H08.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0002_G07.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVR01_0026_D01.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVR01_0038_C05.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVR01_0033_A07.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVR01_0073_G12.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVR01_0065_A07.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0175_D04.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0024_D05.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0199_F06.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0115_G05.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0050_G05.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0091_C09.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
OVRM1_0211_G03.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
ITT01_0068_C02.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0170_G04.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0181_G10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0194_G02.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0016_G12.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0112_C05.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0042_H01.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0037_B08.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0053_H09.b : ACCAGGACTCCCAGGATCGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0125_G05.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0013_E10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0035_G04.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAGTGCCT
LVRM1_0053_C10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0006_H02.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0122_C07.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0137_D05.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVRM1_0050_H09.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVR01_0054_H01.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
LVR01_0085_G03.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
ITT01_0021_E05.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0019_B12.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0031_E05.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0051_E03.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0070_H04.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0030_A10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0007_E10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0014_B11.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0010_F12.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0005_B01.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0081_D10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0073_F09.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0076_D08.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0009_G04.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0012_A04.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0039_D10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0073_E11.b : ACCAGGACTTCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0100_E01.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0020_F07.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0067_G04.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0088_F03.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0012_D02.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0012_B07.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0074_A08.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0030_D06.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0074_D07.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0021_F03.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0064_E10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0093_G03.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0032_A07.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0079_E10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0090_H01.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0024_H11.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0024_A11.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0035_E08.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0069_H07.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0035_E06.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0088_A07.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0059_C02.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0070_H01.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0058_E10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0095_A02.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0061_A05.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0070_C02.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0043_B02.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAGTGCCT
KDN01_0070_B11.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0067_B04.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0033_G03.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0082_E05.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0058_B12.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0074_H04.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0088_B10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0083_A08.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0085_C06.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0063_B09.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0076_B10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0094_E01.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0098_C10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0090_A08.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0038_D12.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0070_F07.b : ACCAGGACTCCCAGGATTGGTTCGTCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0067_E01.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0082_A07.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0097_B02.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0013_B11.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0098_B11.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0016_H12.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0034_D11.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0025_G09.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0005_D11.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0005_G05.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0032_G12.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0032_D09.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0023_E08.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0034_D05.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0051_C03.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0063_F08.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0019_F07.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0031_D01.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0062_G03.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0080_F12.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0074_A10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0033_D10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0080_A04.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0070_B12.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0011_B11.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0071_A09.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0041_D03.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0025_G06.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0001_E06.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0009_C10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0019_G10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0090_F07.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0056_C02.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0054_D09.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0078_D11.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0029_B05.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0082_F06.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0067_A11.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0006_C05.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0028_F04.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0070_A01.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0045_A10.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0046_C03.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0048_H05.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0052_H11.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0046_A02.b : ACCAGGACTCCCAGGATTGGTTCATCTTGGTATCTGTGATCGCGGACCTCAGAAATGCCT
KDN01_0080_A10.b : naactacgtggctnggc
KDN01_0005_C02.b :
LVRM1_0142_D07.b :
LVRM1_0138_H10.b :
KDN01_0078_D12.b :
KDN01_0064_F12.b :
LVRM1_0139_C08.b :
LVRM1_0127_E08.b :
KDN01_0083_D04.b :
20110601C-001908 : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
---------+---------+---------+---------+---------+---------+ 445
KDN01_0020_E10.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0059_E07.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0079_G02.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0097_H05.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0095_G09.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0071_C10.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0063_F05.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0156_E08.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0146_G11.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVR01_0035_C06.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0147_E05.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0086_B10.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0066_D02.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0083_H04.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0125_C04.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0011_E03.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0134_D10.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0045_E11.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0205_E03.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0189_B09.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0198_A04.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0185_D04.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0149_F08.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0118_D01.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0065_E06.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0089_E07.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0091_B06.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0117_H05.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0179_F11.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0202_F08.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0118_A12.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0077_F02.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0109_C06.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0069_E08.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0033_E07.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0151_B09.b : TTTATGTCCTCTTCCCCATCTGGTGTGCCATCTTCCAGAATCTGTGGGCATCAAACTCCT
LVRM1_0159_F07.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0157_B05.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0137_E07.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0032_H06.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0137_C07.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0156_H10.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0139_A11.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0146_H08.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0002_G07.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVR01_0026_D01.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVR01_0038_C05.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVR01_0033_A07.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVR01_0073_G12.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVR01_0065_A07.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0175_D04.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0024_D05.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0199_F06.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0115_G05.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0050_G05.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0091_C09.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
OVRM1_0211_G03.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
ITT01_0068_C02.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0170_G04.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0181_G10.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0194_G02.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0016_G12.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0112_C05.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0042_H01.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0037_B08.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0053_H09.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0125_G05.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0013_E10.b : TTTATGTCCTCTCCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0035_G04.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0053_C10.b : TTTATGTCCTCTTCCCCATCTG**GTTCCGTCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0006_H02.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0122_C07.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0137_D05.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVRM1_0050_H09.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVR01_0054_H01.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
LVR01_0085_G03.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
ITT01_0021_E05.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0019_B12.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0031_E05.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0051_E03.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0070_H04.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0030_A10.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0007_E10.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0014_B11.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0010_F12.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0005_B01.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0081_D10.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0073_F09.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0076_D08.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0009_G04.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0012_A04.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0039_D10.b : TTTATGGCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0073_E11.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0100_E01.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0020_F07.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0067_G04.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0088_F03.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0012_D02.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0012_B07.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0074_A08.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0030_D06.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0074_D07.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0021_F03.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0064_E10.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0093_G03.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0032_A07.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0079_E10.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0090_H01.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0024_H11.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0024_A11.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0035_E08.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0069_H07.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0035_E06.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0088_A07.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0059_C02.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0070_H01.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0058_E10.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGACATCAAACTCCT
KDN01_0095_A02.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0061_A05.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0070_C02.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0043_B02.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0070_B11.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAACTGTGGGCATCAAACTCCT
KDN01_0067_B04.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0033_G03.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0082_E05.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0058_B12.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0074_H04.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0088_B10.b : TTTATGTGCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0083_A08.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0085_C06.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0063_B09.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0076_B10.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0094_E01.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0098_C10.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0090_A08.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTAGGCATCAAACTCCT
KDN01_0038_D12.b : TTTATGTCCGCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0070_F07.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0067_E01.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0082_A07.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0097_B02.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0013_B11.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0098_B11.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0016_H12.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0034_D11.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0025_G09.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0005_D11.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0005_G05.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0032_G12.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0032_D09.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0023_E08.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0034_D05.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0051_C03.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0063_F08.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0019_F07.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0031_D01.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0062_G03.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0080_F12.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0074_A10.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0033_D10.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0080_A04.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0070_B12.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0011_B11.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0071_A09.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0041_D03.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0025_G06.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0001_E06.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTGCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0009_C10.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0019_G10.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0090_F07.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0056_C02.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCGAACTCCT
KDN01_0054_D09.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0078_D11.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0029_B05.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0082_F06.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0067_A11.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0006_C05.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0028_F04.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0070_A01.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0045_A10.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0046_C03.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0048_H05.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0052_H11.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0046_A02.b : TTTATGTCCTCTTCCCCATCTG**GTTCCATCTTCAAGAAGCTGTGGGCATCAAACTCCT
KDN01_0080_A10.b : TTTATGTCCTCTT*CCCATCTG**GTTC*ATCTTCA*GAAGCTGTGGGCATCCA*CTCCT
KDN01_0005_C02.b : nnnccttactgtggctatggatctcaaaaCTGTGGGCATCAAACTCCT
LVRM1_0142_D07.b :
LVRM1_0138_H10.b :
KDN01_0078_D12.b :
KDN01_0064_F12.b :
LVRM1_0139_C08.b :
LVRM1_0127_E08.b :
KDN01_0083_D04.b :
20110601C-001908 : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
---------+---------+---------+---------+---------+---------+ 505
KDN01_0020_E10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCCCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0059_E07.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0079_G02.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACTTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0097_H05.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0095_G09.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0071_C10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0063_F05.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0156_E08.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0146_G11.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVR01_0035_C06.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0147_E05.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0086_B10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0066_D02.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0083_H04.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0125_C04.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0011_E03.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0134_D10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0045_E11.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0205_E03.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0189_B09.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0198_A04.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0185_D04.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0149_F08.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0118_D01.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0065_E06.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0089_E07.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0091_B06.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0117_H05.b : CTGAGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0179_F11.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0202_F08.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0118_A12.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0077_F02.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0109_C06.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0069_E08.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0033_E07.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0151_B09.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGGCTTTAAGTGGAATCTCTTTGGACA
LVRM1_0159_F07.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0157_B05.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0137_E07.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0032_H06.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0137_C07.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0156_H10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0139_A11.b : CTGGGTAGCTGTGATTGGGGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0146_H08.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0002_G07.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVR01_0026_D01.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVR01_0038_C05.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVR01_0033_A07.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVR01_0073_G12.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVR01_0065_A07.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0175_D04.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0024_D05.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0199_F06.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0115_G05.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0050_G05.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0091_C09.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
OVRM1_0211_G03.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
ITT01_0068_C02.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0170_G04.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0181_G10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0194_G02.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0016_G12.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0112_C05.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0042_H01.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0037_B08.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0053_H09.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0125_G05.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0013_E10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0035_G04.b : CTGGGTAGCTGTGATTGGAGACTGGCTTAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0053_C10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0006_H02.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0122_C07.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0137_D05.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0050_H09.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGACTCTCTTTGGACA
LVR01_0054_H01.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVR01_0085_G03.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
ITT01_0021_E05.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0019_B12.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0031_E05.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0051_E03.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0070_H04.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0030_A10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0007_E10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0014_B11.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0010_F12.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0005_B01.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0081_D10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0073_F09.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0076_D08.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0009_G04.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0012_A04.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0039_D10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0073_E11.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0100_E01.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0020_F07.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0067_G04.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0088_F03.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0012_D02.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0012_B07.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0074_A08.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0030_D06.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0074_D07.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0021_F03.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0064_E10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0093_G03.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0032_A07.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0079_E10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0090_H01.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0024_H11.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0024_A11.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0035_E08.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0069_H07.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0035_E06.b : CTGGGTAGCTATGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0088_A07.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0059_C02.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0070_H01.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0058_E10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0095_A02.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0061_A05.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0070_C02.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0043_B02.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0070_B11.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0067_B04.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0033_G03.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0082_E05.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0058_B12.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0074_H04.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0088_B10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0083_A08.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0085_C06.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0063_B09.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0076_B10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0094_E01.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0098_C10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0090_A08.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0038_D12.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0070_F07.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0067_E01.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0082_A07.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0097_B02.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0013_B11.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0098_B11.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0016_H12.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0034_D11.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0025_G09.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0005_D11.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0005_G05.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0032_G12.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0032_D09.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0023_E08.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0034_D05.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0051_C03.b : CTGGGTAGCTGCGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0063_F08.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0019_F07.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0031_D01.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0062_G03.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0080_F12.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0074_A10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0033_D10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0080_A04.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0070_B12.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0011_B11.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0071_A09.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0041_D03.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0025_G06.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0001_E06.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0009_C10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0019_G10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0090_F07.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0056_C02.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0054_D09.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0078_D11.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0029_B05.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0082_F06.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0067_A11.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0006_C05.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0028_F04.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0070_A01.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0045_A10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0046_C03.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0048_H05.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0052_H11.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0046_A02.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0080_A10.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
KDN01_0005_C02.b : CTGGGTAGCTGTGATTGGAGACTGGCTCAACCTCGTCTTTAAGTGGATTCTCTTTGGACA
LVRM1_0142_D07.b :
LVRM1_0138_H10.b :
KDN01_0078_D12.b :
KDN01_0064_F12.b :
LVRM1_0139_C08.b :
LVRM1_0127_E08.b :
KDN01_0083_D04.b :
20110601C-001908 : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
---------+---------+---------+---------+---------+---------+ 564
KDN01_0020_E10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0059_E07.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0079_G02.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0097_H05.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0095_G09.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0071_C10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGCGCCACTGA
LVRM1_0063_F05.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0156_E08.b : GCGCCCCTACTGGTGGGTTCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0146_G11.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVR01_0035_C06.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
LVRM1_0147_E05.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0086_B10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0066_D02.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0083_H04.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0125_C04.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0011_E03.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0134_D10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0045_E11.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0205_E03.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0189_B09.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0198_A04.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0185_D04.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0149_F08.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0118_D01.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0065_E06.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0089_E07.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0091_B06.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0117_H05.b : GCGCCCCTACAGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0179_F11.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0202_F08.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0118_A12.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0077_F02.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0109_C06.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0069_E08.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0033_E07.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0151_B09.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCCCCACTGCCACTGA
LVRM1_0159_F07.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0157_B05.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0137_E07.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0032_H06.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0137_C07.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0156_H10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0139_A11.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0146_H08.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0002_G07.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVR01_0026_D01.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
LVR01_0038_C05.b : GCGCCCCTACTGGTGGGTCCTGGACACCGACTACTACAGCAACACCTC*GGTGCCACTGA
LVR01_0033_A07.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
LVR01_0073_G12.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
LVR01_0065_A07.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
LVRM1_0175_D04.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0024_D05.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0199_F06.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0115_G05.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0050_G05.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0091_C09.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
OVRM1_0211_G03.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
ITT01_0068_C02.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
LVRM1_0170_G04.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0181_G10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0194_G02.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0016_G12.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0112_C05.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0042_H01.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0037_B08.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0053_H09.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0125_G05.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0013_E10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0035_G04.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0053_C10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0006_H02.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0122_C07.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0137_D05.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVRM1_0050_H09.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*AGTGCCACTGA
LVR01_0054_H01.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
LVR01_0085_G03.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
ITT01_0021_E05.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0019_B12.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0031_E05.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0051_E03.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0070_H04.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0030_A10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0007_E10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0014_B11.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0010_F12.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0005_B01.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0081_D10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0073_F09.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0076_D08.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0009_G04.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0012_A04.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0039_D10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0073_E11.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0100_E01.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0020_F07.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0067_G04.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0088_F03.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0012_D02.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0012_B07.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0074_A08.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0030_D06.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0074_D07.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0021_F03.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0064_E10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0093_G03.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0032_A07.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0079_E10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0090_H01.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0024_H11.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0024_A11.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0035_E08.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0069_H07.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0035_E06.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0088_A07.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0059_C02.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0070_H01.b : GCGCCCCTACTGGTGGGTCCTGAACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0058_E10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0095_A02.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0061_A05.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0070_C02.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0043_B02.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0070_B11.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0067_B04.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0033_G03.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0082_E05.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0058_B12.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0074_H04.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0088_B10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0083_A08.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0085_C06.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0063_B09.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0076_B10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0094_E01.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0098_C10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0090_A08.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0038_D12.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0070_F07.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0067_E01.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0082_A07.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0097_B02.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0013_B11.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0098_B11.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0016_H12.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0034_D11.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0025_G09.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0005_D11.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0005_G05.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0032_G12.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0032_D09.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACGCCTC*GGTGCCACTGA
KDN01_0023_E08.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0034_D05.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC**GTGCCACTGA
KDN01_0051_C03.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0063_F08.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0019_F07.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0031_D01.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0062_G03.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0080_F12.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0074_A10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0033_D10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0080_A04.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0070_B12.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0011_B11.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0071_A09.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0041_D03.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0025_G06.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0001_E06.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0009_C10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0019_G10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0090_F07.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTGCTACAGCAACACCTC*GGTGCCACTGA
KDN01_0056_C02.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0054_D09.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0078_D11.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0029_B05.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0082_F06.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAATACCTC*GGTGCCACTGA
KDN01_0067_A11.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0006_C05.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0028_F04.b : GCGCCCCTACTGGTGGGTCCTGGACGCTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0070_A01.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0045_A10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0046_C03.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0048_H05.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0052_H11.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0046_A02.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0080_A10.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
KDN01_0005_C02.b : GCGCCCCTACTGGTGGGTCCTGGACACTGACTACTACAGCAACACCTC*GGTGCCACTGA
LVRM1_0142_D07.b :
LVRM1_0138_H10.b :
KDN01_0078_D12.b :
KDN01_0064_F12.b :
LVRM1_0139_C08.b :
LVRM1_0127_E08.b :
KDN01_0083_D04.b :
20110601C-001908 : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
---------+---------+---------+---------+---------+---------+ 624
KDN01_0020_E10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0059_E07.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0079_G02.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0097_H05.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0095_G09.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0071_C10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0063_F05.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0156_E08.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0146_G11.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVR01_0035_C06.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0147_E05.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0086_B10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGGCCCAGGAGTCCCTCTGGGCATGCCATGG
LVRM1_0066_D02.b : TTTATCAGTTCCCAGTCACCTGTGAGACTGGTCCAGGGAGTCCCTCTGGTCATGCCATGG
LVRM1_0083_H04.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0125_C04.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCACGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0011_E03.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0134_D10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0045_E11.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0205_E03.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0189_B09.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0198_A04.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0185_D04.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0149_F08.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0118_D01.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0065_E06.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0089_E07.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0091_B06.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0117_H05.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0179_F11.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0202_F08.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0118_A12.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0077_F02.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGGCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0109_C06.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0069_E08.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0033_E07.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0151_B09.b : TAAAGCAGTTCCCAGTCTCCTGTGAGACTGGCCCACGGAGTCCCTCTGGTCATGCCATGG
LVRM1_0159_F07.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0157_B05.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0137_E07.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0032_H06.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0137_C07.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0156_H10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0139_A11.b : TAAAGCAGTTCCCAGTCACCTGTGAGACCGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0146_H08.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0002_G07.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVR01_0026_D01.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVR01_0038_C05.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVR01_0033_A07.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVR01_0073_G12.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVR01_0065_A07.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0175_D04.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0024_D05.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0199_F06.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0115_G05.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0050_G05.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0091_C09.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
OVRM1_0211_G03.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
ITT01_0068_C02.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0170_G04.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0181_G10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0194_G02.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0016_G12.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0112_C05.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0042_H01.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0037_B08.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0053_H09.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0125_G05.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0013_E10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0035_G04.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0053_C10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0006_H02.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0122_C07.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0137_D05.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0050_H09.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVR01_0054_H01.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCTTGCCATGG
LVR01_0085_G03.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
ITT01_0021_E05.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCTTGCCATGG
KDN01_0019_B12.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0031_E05.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGCGAGTCCCTCTGGCCATGCCATGG
KDN01_0051_E03.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0070_H04.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0030_A10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0007_E10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0014_B11.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0010_F12.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0005_B01.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0081_D10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0073_F09.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0076_D08.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0009_G04.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0012_A04.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0039_D10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0073_E11.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0100_E01.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0020_F07.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0067_G04.b : TAAAGCAGTTCCCAGTCACCTGTAAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0088_F03.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0012_D02.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0012_B07.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0074_A08.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0030_D06.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0074_D07.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0021_F03.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0064_E10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0093_G03.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0032_A07.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0079_E10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0090_H01.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0024_H11.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0024_A11.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0035_E08.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0069_H07.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0035_E06.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0088_A07.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0059_C02.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0070_H01.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0058_E10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0095_A02.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0061_A05.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0070_C02.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0043_B02.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0070_B11.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0067_B04.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0033_G03.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0082_E05.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0058_B12.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0074_H04.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0088_B10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0083_A08.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0085_C06.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0063_B09.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0076_B10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0094_E01.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0098_C10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0090_A08.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0038_D12.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0070_F07.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0067_E01.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0082_A07.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0097_B02.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0013_B11.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0098_B11.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0016_H12.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0034_D11.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0025_G09.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0005_D11.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0005_G05.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0032_G12.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0032_D09.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0023_E08.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0034_D05.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0051_C03.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0063_F08.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0019_F07.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0031_D01.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0062_G03.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0080_F12.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0074_A10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0033_D10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0080_A04.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0070_B12.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0011_B11.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0071_A09.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0041_D03.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0025_G06.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0001_E06.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCANGGAGTCCCTCTGGGCATGCCATGG
KDN01_0009_C10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0019_G10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0090_F07.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0056_C02.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0054_D09.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0078_D11.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0029_B05.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0082_F06.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0067_A11.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0006_C05.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0028_F04.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0070_A01.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0045_A10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0046_C03.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCTAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0048_H05.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0052_H11.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0046_A02.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0080_A10.b : TAAAGCAGTTCCCAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
KDN01_0005_C02.b : TAAAGCAGTTCCTAGTCACCTGTGAGACTGGCCCAGGGAGTCCCTCTGGCCATGCCATGG
LVRM1_0142_D07.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0138_H10.b : tcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0078_D12.b :
KDN01_0064_F12.b :
LVRM1_0139_C08.b :
LVRM1_0127_E08.b :
KDN01_0083_D04.b :
20110601C-001908 : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
---------+---------+---------+---------+---------+---------+ 683
KDN01_0020_E10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0059_E07.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0079_G02.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0097_H05.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0095_G09.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0071_C10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0063_F05.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0156_E08.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0146_G11.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVR01_0035_C06.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCAGGGAA*AG
LVRM1_0147_E05.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0086_B10.b : GCACAGCAAGTGGATACTATGTGATGGGCACATCCGCCCTCTCTATCATTTCGGGGA*AA
LVRM1_0066_D02.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCTGCCTCTCTAATACTCGGGGAA*AG
LVRM1_0083_H04.b : GCACAGCACGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGTGGA**AG
LVRM1_0125_C04.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAATAG
LVRM1_0011_E03.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0134_D10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAC*AG
LVRM1_0045_E11.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0205_E03.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0189_B09.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0198_A04.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0185_D04.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0149_F08.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0118_D01.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0065_E06.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0089_E07.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0091_B06.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0117_H05.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0179_F11.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0202_F08.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0118_A12.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AT
LVRM1_0077_F02.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0109_C06.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0069_E08.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0033_E07.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0151_B09.b : GCACAGCAGGTGTATACTATGTGATGGACACATCCGCCCTCTCTATCATTCAGGGAA*AG
LVRM1_0159_F07.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0157_B05.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0137_E07.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0032_H06.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0137_C07.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0156_H10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0139_A11.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0146_H08.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0002_G07.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVR01_0026_D01.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVR01_0038_C05.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVR01_0033_A07.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVR01_0073_G12.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVR01_0065_A07.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0175_D04.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0024_D05.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0199_F06.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0115_G05.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0050_G05.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0091_C09.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
OVRM1_0211_G03.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
ITT01_0068_C02.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0170_G04.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCCTTCGGGGAA*AG
LVRM1_0181_G10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0194_G02.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0016_G12.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCCCTATCATTCGGGGAA*AG
LVRM1_0112_C05.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0042_H01.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0037_B08.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0053_H09.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0125_G05.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0013_E10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0035_G04.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0053_C10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0006_H02.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0122_C07.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0137_D05.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0050_H09.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVR01_0054_H01.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVR01_0085_G03.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
ITT01_0021_E05.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0019_B12.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0031_E05.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0051_E03.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0070_H04.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0030_A10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0007_E10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0014_B11.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0010_F12.b : GCACAGCAGGTGTATACTATGTGATGGTCGCATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0005_B01.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0081_D10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0073_F09.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0076_D08.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0009_G04.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0012_A04.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0039_D10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0073_E11.b : GCACAGCAGATGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0100_E01.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0020_F07.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0067_G04.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0088_F03.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0012_D02.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0012_B07.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0074_A08.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0030_D06.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCGTTCGGGGAA*AG
KDN01_0074_D07.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0021_F03.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0064_E10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0093_G03.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0032_A07.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0079_E10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0090_H01.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0024_H11.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0024_A11.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0035_E08.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0069_H07.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0035_E06.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0088_A07.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0059_C02.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0070_H01.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0058_E10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0095_A02.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0061_A05.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0070_C02.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0043_B02.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0070_B11.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0067_B04.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0033_G03.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0082_E05.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0058_B12.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0074_H04.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0088_B10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0083_A08.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0085_C06.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0063_B09.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0076_B10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0094_E01.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0098_C10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0090_A08.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0038_D12.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0070_F07.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0067_E01.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0082_A07.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0097_B02.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0013_B11.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0098_B11.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0016_H12.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0034_D11.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0025_G09.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0005_D11.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0005_G05.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0032_G12.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0032_D09.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0023_E08.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0034_D05.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0051_C03.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0063_F08.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0019_F07.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0031_D01.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0062_G03.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0080_F12.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0074_A10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0033_D10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0080_A04.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0070_B12.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0011_B11.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0071_A09.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0041_D03.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0025_G06.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0001_E06.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0009_C10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0019_G10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0090_F07.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0056_C02.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0054_D09.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0078_D11.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0029_B05.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0082_F06.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0067_A11.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0006_C05.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0028_F04.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0070_A01.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0045_A10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0046_C03.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0048_H05.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0052_H11.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0046_A02.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0080_A10.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0005_C02.b : GCACAGCAGGTGTATACTATGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0142_D07.b : xxxxxxxxxxxxxxxxxxxTGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
LVRM1_0138_H10.b : xxxxxxxxxxxxxxxxxxxTGTGATGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0078_D12.b : nnnnctcacgtttgctacgggtgaGGTCACATCCGCCCTCTCTATCATTCGGGGAA*AG
KDN01_0064_F12.b : nnntttcctacgttggcacggcatcgggga
LVRM1_0139_C08.b : agttgtcxxxxxxxx
LVRM1_0127_E08.b : cagttgt
KDN01_0083_D04.b :
20110601C-001908 : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
---------+---------+---------+---------+---------+---------+ 743
KDN01_0020_E10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0059_E07.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0079_G02.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0097_H05.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0095_G09.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0071_C10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0063_F05.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0156_E08.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0146_G11.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVR01_0035_C06.b : AAAAACCCAACCTACCGCTTTCCGCGCTTGAATATCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0147_E05.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0086_B10.b : AAAAAaaccaactacggccttccgggcctgaagtcattttggggttgggattccggactg
LVRM1_0066_D02.b : AACAAGTCTACCTACcgtttcagagcttgaatcgcattttgtggttgagatgttggacgg
LVRM1_0083_H04.b : AACAAGCCAACCTACGGCTTTCAGTGCCTGAATGTGATTTTGTGGTTGGGATacgacaca
LVRM1_0125_C04.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGCGGTTGGGAATCTGGACT
LVRM1_0011_E03.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0134_D10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0045_E11.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0205_E03.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0189_B09.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0198_A04.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0185_D04.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0149_F08.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0118_D01.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0065_E06.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0089_E07.b : AAAAAGCCAACCTACGGCTTTCGGCGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0091_B06.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0117_H05.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0179_F11.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0202_F08.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0118_A12.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0077_F02.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0109_C06.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTNGATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0069_E08.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0033_E07.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0151_B09.b : AACAAATCAACCTACCGCTTTCTGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0159_F07.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0157_B05.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0137_E07.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0032_H06.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0137_C07.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0156_H10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0139_A11.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0146_H08.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0002_G07.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVR01_0026_D01.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVR01_0038_C05.b : AAAAGGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVR01_0033_A07.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVR01_0073_G12.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVR01_0065_A07.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0175_D04.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0024_D05.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0199_F06.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0115_G05.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0050_G05.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0091_C09.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
OVRM1_0211_G03.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
ITT01_0068_C02.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0170_G04.b : AAATAGCCAACCTACGGCTTTCGGTcgcctgaacgccactttgtggttcgcattccggac
LVRM1_0181_G10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0194_G02.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0016_G12.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0112_C05.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0042_H01.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0037_B08.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0053_H09.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0125_G05.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0013_E10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0035_G04.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0053_C10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0006_H02.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0122_C07.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0137_D05.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0050_H09.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCACTTTGTGGTTGGGATTCTGGACT
LVR01_0054_H01.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVR01_0085_G03.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
ITT01_0021_E05.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0019_B12.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0031_E05.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0051_E03.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0070_H04.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0030_A10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0007_E10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0014_B11.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0010_F12.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0005_B01.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0081_D10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTAGGGATTCTGGACT
KDN01_0073_F09.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0076_D08.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0009_G04.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0012_A04.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0039_D10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0073_E11.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0100_E01.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0020_F07.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0067_G04.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0088_F03.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0012_D02.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0012_B07.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0074_A08.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0030_D06.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0074_D07.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0021_F03.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0064_E10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0093_G03.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0032_A07.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0079_E10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0090_H01.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0024_H11.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0024_A11.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0035_E08.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0069_H07.b : AAACAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0035_E06.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0088_A07.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0059_C02.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0070_H01.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0058_E10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0095_A02.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0061_A05.b : AAAAAGCCAACCTACGGCTTCCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0070_C02.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0043_B02.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0070_B11.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0067_B04.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0033_G03.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0082_E05.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0058_B12.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0074_H04.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0088_B10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0083_A08.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0085_C06.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0063_B09.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0076_B10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0094_E01.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0098_C10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0090_A08.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0038_D12.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0070_F07.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0067_E01.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0082_A07.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0097_B02.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0013_B11.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0098_B11.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0016_H12.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0034_D11.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0025_G09.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0005_D11.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0005_G05.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0032_G12.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0032_D09.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0023_E08.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0034_D05.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0051_C03.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0063_F08.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0019_F07.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0031_D01.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0062_G03.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0080_F12.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0074_A10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAGTGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0033_D10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0080_A04.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0070_B12.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0011_B11.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0071_A09.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0041_D03.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0025_G06.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0001_E06.b : AAAAAGCAAACCTACGGCTTTCGGTGCTGGAATGTCATTTTGTGGT*GGGAATCTGGACT
KDN01_0009_C10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0019_G10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0090_F07.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0056_C02.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0054_D09.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0078_D11.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0029_B05.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0082_F06.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0067_A11.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0006_C05.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0028_F04.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0070_A01.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0045_A10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0046_C03.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0048_H05.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0052_H11.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0046_A02.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0080_A10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0005_C02.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0142_D07.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
LVRM1_0138_H10.b : AAAAAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0078_D12.b : AA*AAGCCAACCTACGGCTTTCGGTGCTTGAATGTCATTTTGTGGTTGGGATTCTGGACT
KDN01_0064_F12.b : agAAAACCAACCTACGGCTTTCGGTGCTTGAATGTCATCTTGTGGTTGGGATTCTGGACT
LVRM1_0139_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTGGGATTCTGGACT
LVRM1_0127_E08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGACT
KDN01_0083_D04.b :
20110601C-001908 : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
---------+---------+---------+---------+---------+---------+ 803
KDN01_0020_E10.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAAGT
KDN01_0059_E07.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0079_G02.b : GTGCAGCTGGACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0097_H05.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0095_G09.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0071_C10.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0063_F05.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTTCCCCATCAAGTT
LVRM1_0156_E08.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0146_G11.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVR01_0035_C06.b : GTGCAACTGAACGTCAGTCTGACACAAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0147_E05.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0086_B10.b : gtggaccaaaaatctgtttgtcacaaaactcaagtggggggcaatttcccccacaagttt
LVRM1_0066_D02.b : gccaccacaacgtatgtctatctgaataaacattgtccctgtttcacctagagttgtatg
LVRM1_0083_H04.b : gtacaggtgacacatctaccgatccggctcgacaacgcacggattcgaccaacaagttta
LVRM1_0125_C04.b : GTTGCGCTGAACGTCCGTCTGTCTACGATCTACCCTGCTGCTCATTTCCCCCATCAAGct
LVRM1_0011_E03.b : GTGCACCTGAGCGTCTGTCTGTCACGAATCGACCTTGCTGCTCATTTCCGCCATCAAGTT
LVRM1_0134_D10.b : GTGCATCCGCACGTCTGTCCGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCACGTT
LVRM1_0045_E11.b : GTGCAACTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCC*ATCAAGTT
LVRM1_0205_E03.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0189_B09.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCTAGTT
LVRM1_0198_A04.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0185_D04.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0149_F08.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCCATCAGTT
LVRM1_0118_D01.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0065_E06.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0089_E07.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0091_B06.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0117_H05.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0179_F11.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0202_F08.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0118_A12.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0077_F02.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0109_C06.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0069_E08.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0033_E07.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0151_B09.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCACATTT*CCCCATCTAGTT
LVRM1_0159_F07.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCCTGCTGCTCATTTCTCCCATCAAGTT
LVRM1_0157_B05.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0137_E07.b : GTGCAGCTGGACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0032_H06.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0137_C07.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0156_H10.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0139_A11.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0146_H08.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0002_G07.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVR01_0026_D01.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVR01_0038_C05.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVR01_0033_A07.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVR01_0073_G12.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVR01_0065_A07.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTC
LVRM1_0175_D04.b : GTGCAGCTGAACGTCTGACTGTCACGAATCTACCATGCTGCTCATTTCCACCACCAGGTT
LVRM1_0024_D05.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0199_F06.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0115_G05.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0050_G05.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0091_C09.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
OVRM1_0211_G03.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
ITT01_0068_C02.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0170_G04.b : tgctcctcttgagcgtcggcctgtcacgaaacacaccgttcccgcctatcccccacacca
LVRM1_0181_G10.b : GTGCAGCTGAACGTCTGACTGTCACGAATCTACCTTGACGCTCATTTCCCCCATCACATT
LVRM1_0194_G02.b : GTGCAGCTGAACGTCTGTCTGTCACGACTCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0016_G12.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCACTTCCCCCATCAAGTT
LVRM1_0112_C05.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCC*CCATCAAGTT
LVRM1_0042_H01.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0037_B08.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0053_H09.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0125_G05.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0013_E10.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0035_G04.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0053_C10.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCTCCCATCNAGAT
LVRM1_0006_H02.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0122_C07.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCCAGTT
LVRM1_0137_D05.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0050_H09.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVR01_0054_H01.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVR01_0085_G03.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
ITT01_0021_E05.b : GTGCAGCTGAACGTCTGTCTATCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0019_B12.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0031_E05.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0051_E03.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0070_H04.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0030_A10.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0007_E10.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0014_B11.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0010_F12.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0005_B01.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0081_D10.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0073_F09.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0076_D08.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0009_G04.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0012_A04.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0039_D10.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0073_E11.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0100_E01.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0020_F07.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0067_G04.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0088_F03.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0012_D02.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0012_B07.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0074_A08.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0030_D06.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0074_D07.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0021_F03.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0064_E10.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0093_G03.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0032_A07.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0079_E10.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0090_H01.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0024_H11.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0024_A11.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0035_E08.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0069_H07.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0035_E06.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0088_A07.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0059_C02.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0070_H01.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0058_E10.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0095_A02.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0061_A05.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0070_C02.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0043_B02.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCTCATCAAGTT
KDN01_0070_B11.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0067_B04.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0033_G03.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0082_E05.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0058_B12.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0074_H04.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0088_B10.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0083_A08.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0085_C06.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0063_B09.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0076_B10.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0094_E01.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0098_C10.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0090_A08.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0038_D12.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0070_F07.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0067_E01.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0082_A07.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0097_B02.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0013_B11.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0098_B11.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0016_H12.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0034_D11.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0025_G09.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0005_D11.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0005_G05.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0032_G12.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0032_D09.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0023_E08.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0034_D05.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTGCCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0051_C03.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0063_F08.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0019_F07.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0031_D01.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0062_G03.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0080_F12.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0074_A10.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0033_D10.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0080_A04.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0070_B12.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0011_B11.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0071_A09.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0041_D03.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0025_G06.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0001_E06.b : GCGCACCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCAATCCCCCCATCAAGTT
KDN01_0009_C10.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0019_G10.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0090_F07.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0056_C02.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0054_D09.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0078_D11.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0029_B05.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0082_F06.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0067_A11.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTCCCCCCATCAAGTT
KDN01_0006_C05.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0028_F04.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0070_A01.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0045_A10.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0046_C03.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0048_H05.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0052_H11.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0046_A02.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0080_A10.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0005_C02.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0142_D07.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0138_H10.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0078_D12.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0064_F12.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0139_C08.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
LVRM1_0127_E08.b : GTGCAGCTGAACGTCTGTCTGTCACGAATCTACCTTGCTGCTCATTTCCCCCATCAAGTT
KDN01_0083_D04.b :
20110601C-001908 : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
---------+---------+---------+---------+---------+---------+ 863
KDN01_0020_E10.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCC*CATTCAGAGTATC
KDN01_0059_E07.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0079_G02.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0097_H05.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0095_G09.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0071_C10.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0063_F05.b : GTTGCTGGAGTCTTGTCAGGCATTGCACCTGCTGAGACTTTCCGCC*CATTCAGAGTATC
LVRM1_0156_E08.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0146_G11.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVR01_0035_C06.b : GTTGCTGGAGTCTTGTCAGGCATTGCACTTGCTGAAACTTTCCGCCCCATTCAAAGAACC
LVRM1_0147_E05.b : GTTGCTGGAGTCTTGTCAAGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0086_B10.b : ttgcggggactttgccgggcttggatttcttaaaaatttccccccatttgagaattacag
LVRM1_0066_D02.b : atggaatctcgatggcgatggttttttgcgccttgcggtccctggctataatagtttgtg
LVRM1_0083_H04.b : cccacgatgctgagcatgagttgcagatgtgaccagttcgagccttccctgtctaacata
LVRM1_0125_C04.b : tgtttgctggagtcctgtctggcttatgcaattggctgacaattttccgcccaatcctaa
LVRM1_0011_E03.b : GTTGCTGGAagtctggcacggattgccgatgtttgagacttggtacgcgttcagagtgtg
LVRM1_0134_D10.b : GTTGCTGGACTCTTGTCATGCATTGCcattgtttaaaacttccgcctcatttgtattttt
LVRM1_0045_E11.b : GTTGCTGGAGTCTTGTCAGGCATTGCAATTGCTGAGACTTTCCGCCACATTCAGAATATC
LVRM1_0205_E03.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTC*GCCACATTCAGAGTATC
LVRM1_0189_B09.b : GTTGCTTGGATCCTGTCAGGAATTGCAGTTGCTGAGACTTCTCCCCAGCTTCAGAATATC
LVRM1_0198_A04.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0185_D04.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0149_F08.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0118_D01.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0065_E06.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0089_E07.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0091_B06.b : GTTGCTGGAGTCTTGTCANGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0117_H05.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0179_F11.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0202_F08.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0118_A12.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0077_F02.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0109_C06.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTT*CCGGCACATTCAGAATATC
LVRM1_0069_E08.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACCTTCCCCCACATTCAGAGTATC
LVRM1_0033_E07.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0151_B09.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTGT*CGCCACATTCAGAGTATC
LVRM1_0159_F07.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0157_B05.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTNCCGCCACATTCAGAGTATC
LVRM1_0137_E07.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0032_H06.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0137_C07.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0156_H10.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0139_A11.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0146_H08.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0002_G07.b : GTTGCTGGAGTCTTGTCANGCATTGCAGTTGCTGAGACTTTCCGNCACATTCAGAGTATC
LVR01_0026_D01.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVR01_0038_C05.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVR01_0033_A07.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVR01_0073_G12.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVR01_0065_A07.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0175_D04.b : GTTGCTGGgatactggtcaagcattagcaattgatngagaattcccgccgccgaccagag
LVRM1_0024_D05.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0199_F06.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0115_G05.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0050_G05.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0091_C09.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
OVRM1_0211_G03.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
ITT01_0068_C02.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0170_G04.b : cattgatgcctgtaatcccgtaatgcattgatcgccactgaaatttgctcctaccctctg
LVRM1_0181_G10.b : GTTGCcggaatcctgaccggcaatgccattgctgaaacttccgcccgattccgagtatct
LVRM1_0194_G02.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTTCGAGTATC
LVRM1_0016_G12.b : GTTGCTGGAGTCTTGTCAAGCATTGCGGTTGCTGAGACTTTCCTCCACGTTCAGAGTTTC
LVRM1_0112_C05.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTT*CGCCACATTCAAAGTATC
LVRM1_0042_H01.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0037_B08.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0053_H09.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0125_G05.b : GTTGCTGGAGTCCTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0013_E10.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAAACTTTCCGCCACATTCAGAGTATC
LVRM1_0035_G04.b : GTTGCTGGAGTCTTGTCAAGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0053_C10.b : GTTGCTGGAGTCTTGTCAAGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0006_H02.b : GTTGCTGGAGTCTTGTCACGCATTGCAGTTGCTGAGACTTTCCGC*ACATTCAGAGTAT*
LVRM1_0122_C07.b : GTTGCTGGAGTCTTGTCAAGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0137_D05.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0050_H09.b : GTTGCTGGAGTCTTGTCAAGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVR01_0054_H01.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVR01_0085_G03.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
ITT01_0021_E05.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0019_B12.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0031_E05.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0051_E03.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0070_H04.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0030_A10.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0007_E10.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0014_B11.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0010_F12.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0005_B01.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0081_D10.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0073_F09.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0076_D08.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0009_G04.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0012_A04.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0039_D10.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0073_E11.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0100_E01.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0020_F07.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0067_G04.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0088_F03.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0012_D02.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0012_B07.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0074_A08.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0030_D06.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0074_D07.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0021_F03.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0064_E10.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0093_G03.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0032_A07.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0079_E10.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0090_H01.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0024_H11.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0024_A11.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0035_E08.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0069_H07.b : GTCGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0035_E06.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0088_A07.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0059_C02.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0070_H01.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0058_E10.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0095_A02.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0061_A05.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0070_C02.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCCGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0043_B02.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0070_B11.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0067_B04.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0033_G03.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGTTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0082_E05.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0058_B12.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0074_H04.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0088_B10.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0083_A08.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0085_C06.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0063_B09.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0076_B10.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0094_E01.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0098_C10.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0090_A08.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0038_D12.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0070_F07.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0067_E01.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0082_A07.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0097_B02.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCGGAGTATC
KDN01_0013_B11.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0098_B11.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0016_H12.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0034_D11.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0025_G09.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0005_D11.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0005_G05.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0032_G12.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0032_D09.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0023_E08.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0034_D05.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0051_C03.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0063_F08.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCTCATTCAGAGTATC
KDN01_0019_F07.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0031_D01.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0062_G03.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0080_F12.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0074_A10.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0033_D10.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0080_A04.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0070_B12.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0011_B11.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0071_A09.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0041_D03.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0025_G06.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0001_E06.b : GTTGCTtgaatccttgtcagggcttgcaattgctgaaaacttccgccccattcaaagatt
KDN01_0009_C10.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0019_G10.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0090_F07.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0056_C02.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0054_D09.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0078_D11.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0029_B05.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0082_F06.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0067_A11.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0006_C05.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0028_F04.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0070_A01.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0045_A10.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0046_C03.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0048_H05.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0052_H11.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0046_A02.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0080_A10.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0005_C02.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0142_D07.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0138_H10.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0078_D12.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0064_F12.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0139_C08.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
LVRM1_0127_E08.b : GTTGCTGGAGTCTTGTCAGGCATTGCAGTTGCTGAGACTTTCCGCCACATTCAGAGTATC
KDN01_0083_D04.b :
20110601C-001908 : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
---------+---------+---------+---------+---------+---------+ 922
KDN01_0020_E10.b : TACAACGCagcctcagaagtattttcccataacctccttccgttcaagtttgccatggga
KDN01_0059_E07.b : TACAACGCCAGCCTNCAGAA*GTATTTTCTCATTACCTTTCTCCTGTTCANGTTTGCCAT
KDN01_0079_G02.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0097_H05.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0095_G09.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0071_C10.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0063_F05.b : TACcatcccttctcagaagtatgttctacttcccttcttcctttacgtgtgccattggat
LVRM1_0156_E08.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0146_G11.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVR01_0035_C06.b : TACCACGCCAACCTCAACAA*ATATTTTCTCATTACCTTCTTCCTGTTCTTTTTTTCCAT
LVRM1_0147_E05.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCAATACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0086_B10.b : acccccccccacaaagatattttccacgacccctttccgggataagttgt
LVRM1_0066_D02.b : gcgtctcttgaattggttgggcagagcgactcgtcgcgacccgtcctg
LVRM1_0083_H04.b : acccacccgcccgtgcttactgttccgatcccccataca
LVRM1_0125_C04.b : agaatcctacaaggccagcctcaaggaagtatgttttcaatacctttctttcctgcgtcg
LVRM1_0011_E03.b : tgccgctttattgtgcccacgtgtagtcgcgataccccccttcagggcggttgtggcggg
LVRM1_0134_D10.b : tcctacctccgcctctcacatcattttctcacttccttcctacttgtttagccttgtccc
LVRM1_0045_E11.b : TAtacgccaccctcaaaaataatttccccttaccatcttaccggtcaattttgccccg
LVRM1_0205_E03.b : TACAACGCCAGCCTCA*GAA*GTATTTTCTCATTACCTcttcc
LVRM1_0189_B09.b : TACACGGTCAGTCTCAGAAA*GTATTTTCTCATTACCTTCctattagttccattgtccat
LVRM1_0198_A04.b : TACNACGCCAGCCTCAAGAA*GTATTTTCTCACTACCTTCTTGCTGTTCA
LVRM1_0185_D04.b : TACAACGCCAGCCTCCAAAA*GTATTTTCTCAGTACCTTCTTCCTGTTCAGTT
LVRM1_0149_F08.b : TACAACGCCAGCCTCAAGAAAGTATTTTCTCATTACCTTCTTCCTGTTCAGTTTg
LVRM1_0118_D01.b : TACAACGCCAGCCTGCAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTT
LVRM1_0065_E06.b : TACTACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGGTCAGT
LVRM1_0089_E07.b : TACNACGCCAGCCTCAAGAG*GTATTTTCTCATTACCTTCTTCCTGTTCAGGTTTGCCAT
LVRM1_0091_B06.b : TACNACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0117_H05.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0179_F11.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0202_F08.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0118_A12.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0077_F02.b : TACTACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0109_C06.b : TACAACGCCAGCCTCAAAGA*ATATTTTCTCAATACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0069_E08.b : CTACACGCCAGCCTCAAGAA*GTATTTTCTCATTACC*TCTTCCTGTTCAG*TTTGCCCT
LVRM1_0033_E07.b : TACAACGCCAGCCCTCAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0151_B09.b : TACAACGGCAGCCTCAATAA*AGGATCTCTCATTACGCTTCTCTTGTTCAGGTTTGCCAT
LVRM1_0159_F07.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0157_B05.b : TACAACGCCAGCCTCAGGAA*GTATTGTCTCATTACCTTCTTCCTGTTCAGTTTTGGCAT
LVRM1_0137_E07.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0032_H06.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0137_C07.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0156_H10.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0139_A11.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0146_H08.b : TACAACGCCAGCCCTCAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0002_G07.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGGTCCAGTTTGCCAT
LVR01_0026_D01.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVR01_0038_C05.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCTT
LVR01_0033_A07.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVR01_0073_G12.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVR01_0065_A07.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0175_D04.b : tatctacaacgtcagcatccaaagcgatcctcaccgtttactccttgcaggcttcgtgt
LVRM1_0024_D05.b : TACAACGCCGGCCTCGAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGATTTGCCAT
LVRM1_0199_F06.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0115_G05.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0050_G05.b : TACAACGCCAGCCTCCAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0091_C09.b : TACAACGCCAGGCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
OVRM1_0211_G03.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCCTCCTGTTCAGTTTTGCCAT
ITT01_0068_C02.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0170_G04.b : agtanccttttatcctatcccccatgcttcacttgtcccatgcctacacnttaccgcaaa
LVRM1_0181_G10.b : aaatggccaccctcaaaagtactatcgcattacgtcttccggagcgttctgaaattgaat
LVRM1_0194_G02.b : TACAACGCCAGCCCTCAGAA*GTATTacccgataaccgtctccctgtcaagttt
LVRM1_0016_G12.b : TAGAACGCCAGCCTCCAaaagcgtcttctccttcatgcctcctgatccactttccatctg
LVRM1_0112_C05.b : TACAACGCCGAGCTCCAAGA*AGATTTTCTCATTACCTTtcttcctgttcagttt
LVRM1_0042_H01.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCCTGTCAGTTTTG
LVRM1_0037_B08.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTT
LVRM1_0053_H09.b : TACAACGGCAGCCTCCAGAA*GTA*TTTCTCATTACCT*CTTCCTGTTCAGTTTTGCCAT
LVRM1_0125_G05.b : TACAACGCCAGCCTCCAGAA*GTATTTTCTCATTACCCTTCTCCTGTTCAGCTTTGCCca
LVRM1_0013_E10.b : TACAACGCCAGCCTCAAGAG*GGTATTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0035_G04.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGT*TTGCCAT
LVRM1_0053_C10.b : TACAACGCCAGCCTCAAGAA*GAAATTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0006_H02.b : TACAACGCCAGCCTTAAGAA*GTATCTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0122_C07.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGATTTGCCAT
LVRM1_0137_D05.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0050_H09.b : TACAACGCCCGCCTCAAGAA*GGTATTTCTCATTACCTTCTTCCTGGTCAGTTTTGCCAT
LVR01_0054_H01.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATAACCTTCTTCCTGTTCAGTTTTGCCAT
LVR01_0085_G03.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
ITT01_0021_E05.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0019_B12.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGNNTCAGTTTGCCAT
KDN01_0031_E05.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0051_E03.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0070_H04.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0030_A10.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0007_E10.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0014_B11.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0010_F12.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0005_B01.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0081_D10.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTCGCCAT
KDN01_0073_F09.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0076_D08.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0009_G04.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0012_A04.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0039_D10.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0073_E11.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0100_E01.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0020_F07.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0067_G04.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0088_F03.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0012_D02.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0012_B07.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0074_A08.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0030_D06.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0074_D07.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0021_F03.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0064_E10.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0093_G03.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0032_A07.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0079_E10.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0090_H01.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0024_H11.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0024_A11.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0035_E08.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0069_H07.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0035_E06.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0088_A07.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0059_C02.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0070_H01.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0058_E10.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0095_A02.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0061_A05.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0070_C02.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0043_B02.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0070_B11.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0067_B04.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0033_G03.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0082_E05.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0058_B12.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0074_H04.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0088_B10.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0083_A08.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0085_C06.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0063_B09.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0076_B10.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0094_E01.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0098_C10.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0090_A08.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0038_D12.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0070_F07.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0067_E01.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0082_A07.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0097_B02.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0013_B11.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0098_B11.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0016_H12.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTACTTCCTGTTCAGTTTTGCCAT
KDN01_0034_D11.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0025_G09.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0005_D11.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0005_G05.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0032_G12.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0032_D09.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0023_E08.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0034_D05.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0051_C03.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0063_F08.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0019_F07.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0031_D01.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0062_G03.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0080_F12.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0074_A10.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0033_D10.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0080_A04.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0070_B12.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0011_B11.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0071_A09.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0041_D03.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0025_G06.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0001_E06.b : ctaaaacgcccgccctaaaaaaaaattttccccataaccttcctcccggttcaattttgc
KDN01_0009_C10.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0019_G10.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCCTGTCAGTTTTGCCAT
KDN01_0090_F07.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0056_C02.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0054_D09.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0078_D11.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0029_B05.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0082_F06.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0067_A11.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0006_C05.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0028_F04.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0070_A01.b : TACAACGCCAGCCTCAAGAA*GTATTCTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0045_A10.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0046_C03.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0048_H05.b : TACAACGCCCGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0052_H11.b : TACCACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0046_A02.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0080_A10.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0005_C02.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0142_D07.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0138_H10.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0078_D12.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0064_F12.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0139_C08.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
LVRM1_0127_E08.b : TACAACGCCAGCCTCAAGAA*GTATTTTCTCATTACCTTCTTCCTGTTCAGTTTTGCCAT
KDN01_0083_D04.b : nnnncctgctgtggc
20110601C-001908 : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
---------+---------+---------+---------+---------+---------+ 979
KDN01_0020_E10.b : ttttactgctgctaaaggggctgggcgttgacttccctggacccctaaaaaagccaaccc
KDN01_0059_E07.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGGCG*TGACCTCTCGTGGACCCTAGAAAA
KDN01_0079_G02.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0097_H05.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGGCG*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0095_G09.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0071_C10.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
LVRM1_0063_F05.b : tctaccgctgctaaggcgctgggcgttatcctccgggccn
LVRM1_0156_E08.b : T*GGATTTTACCTGCTGCGTAAG*G
LVRM1_0146_G11.b : T*TGGATTTACCTGCTGCTAAAG*GGGCT
LVR01_0035_C06.b : T*GGTTTTTCCCTGCTGCTAAAA*Gcggctggccaacgacccctctggcaccctatagaa
LVRM1_0147_E05.b : G*GGATTTac
LVRM1_0086_B10.b :
LVRM1_0066_D02.b :
LVRM1_0083_H04.b :
LVRM1_0125_C04.b : nttttgcccatggaatt
LVRM1_0011_E03.b : gaattacaacga
LVRM1_0134_D10.b : ctggattattctgtagacaaaaggcn
LVRM1_0045_E11.b :
LVRM1_0205_E03.b :
LVRM1_0189_B09.b : tggattttacct
LVRM1_0198_A04.b :
LVRM1_0185_D04.b :
LVRM1_0149_F08.b :
LVRM1_0118_D01.b :
LVRM1_0065_E06.b :
LVRM1_0089_E07.b : g
LVRM1_0091_B06.b : T*GG
LVRM1_0117_H05.b : T*GGATTT
LVRM1_0179_F11.b : T*GGATTTTAC
LVRM1_0202_F08.b : T*GGATTTTAC*TGCTGCTAAAG*GGG
LVRM1_0118_A12.b : T*GGATTTTACCTG
LVRM1_0077_F02.b : T*GGATTTTACCTGCg
LVRM1_0109_C06.b : T*GGATTTTACCTGC
LVRM1_0069_E08.b : T*GGATTTTAC*TGCTgctaaagggctgggccttg
LVRM1_0033_E07.b : T*GGATTTTACCTGCTGn
LVRM1_0151_B09.b : TAGGATTTTACCTGCTGCT
LVRM1_0159_F07.b : T*GGGATTTACCTGCTGCTnaa
LVRM1_0157_B05.b : A*TGGATTTACCTGCTGCTTAAG
LVRM1_0137_E07.b : T*GGATTTTACCTGCTGCTAAAG*GGG
LVRM1_0032_H06.b : T*GGATTTTACCTGCTGCTCAAG*GGGCTGGGn
LVRM1_0137_C07.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGC
LVRM1_0156_H10.b : TTGGATTTTA*CTGCTGCNTAAG*GGGCTGGGCGT*TGAC
LVRM1_0139_A11.b : T*GGATTTTACCTGCTGCNTAAG*GGGCTGGGCGT*TGACCTCT
LVRM1_0146_H08.b : T*GGATTTT*CCTGCTGCTAANG*GGGCTGGGCGT*TGACCTCTCGT
LVRM1_0002_G07.b : T*GGATTCTACCTGCTGCTA*AG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTACAGAA
LVR01_0026_D01.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
LVR01_0038_C05.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
LVR01_0033_A07.b : T*GGATTTTACCTGCTGCTAAAAGGGGCTGGGCGTTTGACCTCTCGTGGACCCTAGAGAA
LVR01_0073_G12.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
LVR01_0065_A07.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
LVRM1_0175_D04.b :
LVRM1_0024_D05.b :
LVRM1_0199_F06.b : T*GGAn
LVRM1_0115_G05.b : T*GGGTTTTACC
LVRM1_0050_G05.b : T*GGATcttcctgctgcttaaggggctggg
LVRM1_0091_C09.b : T*GGATTTTACCTGCTGCT
OVRM1_0211_G03.b : T*GGATTTTACCTGCTGCTAAAG*GGGCT
ITT01_0068_C02.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
LVRM1_0170_G04.b : ctgcg
LVRM1_0181_G10.b : atacatgcagcca
LVRM1_0194_G02.b :
LVRM1_0016_G12.b : attttaccgcgccgagagggctgggcgtgtatgtttacgactc
LVRM1_0112_C05.b :
LVRM1_0042_H01.b :
LVRM1_0037_B08.b :
LVRM1_0053_H09.b : ggattttactgctgctaaagg
LVRM1_0125_G05.b : ttggaatttacctgctgcataagggac
LVRM1_0013_E10.b : T*GGATTTTAC*TGCTGCctaaagggctgggcgttgacttcn
LVRM1_0035_G04.b : T*GGATT
LVRM1_0053_C10.b : T*GGATTTACctgctgct
LVRM1_0006_H02.b : T*GCATTTTACCTGTTGCTAAAC*GGGCTcgcgctcgactccttgtgaccctagacaacc
LVRM1_0122_C07.b : T*GGATTTTACCTGCTGCTTAAG*GGGCGGGGG
LVRM1_0137_D05.b : T*GGATTTTACCTGCTGCTAAAA*GGGCTGGGCGT*TGA
LVRM1_0050_H09.b : TGGNATTTTACCTGCTGCNTAAGAGGGCTGGGCGT*TGACCTCTCGTGGAC
LVR01_0054_H01.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
LVR01_0085_G03.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCCCGTGGACCCTAGAGAA
ITT01_0021_E05.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0019_B12.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGNCGT*TGACCTCTCGTGGACCCTAAAGAA
KDN01_0031_E05.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0051_E03.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0070_H04.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0030_A10.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0007_E10.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAAAA
KDN01_0014_B11.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0010_F12.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0005_B01.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0081_D10.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0073_F09.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0076_D08.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0009_G04.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGCGGACCCTAGAGAA
KDN01_0012_A04.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0039_D10.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0073_E11.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0100_E01.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0020_F07.b : T*GGATTTTACCTGCTGCNTAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAG*A
KDN01_0067_G04.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0088_F03.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0012_D02.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0012_B07.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0074_A08.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0030_D06.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0074_D07.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0021_F03.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0064_E10.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0093_G03.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0032_A07.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0079_E10.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0090_H01.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0024_H11.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0024_A11.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0035_E08.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0069_H07.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0035_E06.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0088_A07.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0059_C02.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0070_H01.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0058_E10.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0095_A02.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0061_A05.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0070_C02.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAAAGAA
KDN01_0043_B02.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0070_B11.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0067_B04.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0033_G03.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0082_E05.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0058_B12.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0074_H04.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0088_B10.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0083_A08.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0085_C06.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0063_B09.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0076_B10.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0094_E01.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0098_C10.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0090_A08.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCCCGTGGACCCTAGAGAA
KDN01_0038_D12.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0070_F07.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0067_E01.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0082_A07.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0097_B02.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0013_B11.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0098_B11.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGGCCTCTCGTGGACCCTAGAGAA
KDN01_0016_H12.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0034_D11.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0025_G09.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0005_D11.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0005_G05.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0032_G12.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0032_D09.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0023_E08.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0034_D05.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0051_C03.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0063_F08.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0019_F07.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0031_D01.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0062_G03.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0080_F12.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0074_A10.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0033_D10.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0080_A04.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0070_B12.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0011_B11.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0071_A09.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0041_D03.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0025_G06.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0001_E06.b : ccatggaattttaaccggcggccaaaagggggctggggggttgcaccccctcggggaacc
KDN01_0009_C10.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0019_G10.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0090_F07.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0056_C02.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0054_D09.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0078_D11.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0029_B05.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0082_F06.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0067_A11.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0006_C05.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0028_F04.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0070_A01.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0045_A10.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAAAGAA
KDN01_0046_C03.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0048_H05.b : TTGGATTTTACCTGCTGCTAAAG*GGCTGGGGCGT*TGACCTCTCTTGGACCCTATAGAA
KDN01_0052_H11.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGGGGACCCTATAAAA
KDN01_0046_A02.b : T*GGATTTTACCTGCTGCTAAAGGGGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0080_A10.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0005_C02.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
LVRM1_0142_D07.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
LVRM1_0138_H10.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0078_D12.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0064_F12.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
LVRM1_0139_C08.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
LVRM1_0127_E08.b : T*GGATTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
KDN01_0083_D04.b : tatggTTTTACCTGCTGCTAAAG*GGGCTGGGCGT*TGACCTCTCGTGGACCCTAGAGAA
20110601C-001908 : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
---------+---------+---------+---------+---------+---------+ 1035
KDN01_0020_E10.b : agggggtgagcggcccaaagggctccaatttaaaccccgccctttgcaacctcccaaaaa
KDN01_0059_E07.b : AGCCA*G*CGAAGGTGTGAGCGGCCAGAA*TGGGTCacatcgaccacgcccttgnnncag
KDN01_0079_G02.b : AGCCAAG*CGGAAGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0097_H05.b : AGCCA*G*CGAAGGTGTGAGCGGGCAGAA*TGGGT*C*ACATCGACACAACGCCC*TTTG
KDN01_0095_G09.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0071_C10.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
LVRM1_0063_F05.b :
LVRM1_0156_E08.b :
LVRM1_0146_G11.b :
LVR01_0035_C06.b : accccaaccaaaggtgtaaccggaccaaataggtcccccatcgaacacaccccctttgcc
LVRM1_0147_E05.b :
LVRM1_0086_B10.b :
LVRM1_0066_D02.b :
LVRM1_0083_H04.b :
LVRM1_0125_C04.b :
LVRM1_0011_E03.b :
LVRM1_0134_D10.b :
LVRM1_0045_E11.b :
LVRM1_0205_E03.b :
LVRM1_0189_B09.b :
LVRM1_0198_A04.b :
LVRM1_0185_D04.b :
LVRM1_0149_F08.b :
LVRM1_0118_D01.b :
LVRM1_0065_E06.b :
LVRM1_0089_E07.b :
LVRM1_0091_B06.b :
LVRM1_0117_H05.b :
LVRM1_0179_F11.b :
LVRM1_0202_F08.b :
LVRM1_0118_A12.b :
LVRM1_0077_F02.b :
LVRM1_0109_C06.b :
LVRM1_0069_E08.b :
LVRM1_0033_E07.b :
LVRM1_0151_B09.b :
LVRM1_0159_F07.b :
LVRM1_0157_B05.b :
LVRM1_0137_E07.b :
LVRM1_0032_H06.b :
LVRM1_0137_C07.b :
LVRM1_0156_H10.b :
LVRM1_0139_A11.b :
LVRM1_0146_H08.b :
LVRM1_0002_G07.b : gccagccgaggggg
LVR01_0026_D01.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
LVR01_0038_C05.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGGCCCCACGCCC*CTTG
LVR01_0033_A07.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAAATGGGTCC*ACATCGACACCACGCCC*TTTG
LVR01_0073_G12.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCT*TTTG
LVR01_0065_A07.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTT
LVRM1_0175_D04.b :
LVRM1_0024_D05.b :
LVRM1_0199_F06.b :
LVRM1_0115_G05.b :
LVRM1_0050_G05.b :
LVRM1_0091_C09.b :
OVRM1_0211_G03.b :
ITT01_0068_C02.b : AGCCAAG*CGAAAGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
LVRM1_0170_G04.b :
LVRM1_0181_G10.b :
LVRM1_0194_G02.b :
LVRM1_0016_G12.b :
LVRM1_0112_C05.b :
LVRM1_0042_H01.b :
LVRM1_0037_B08.b :
LVRM1_0053_H09.b :
LVRM1_0125_G05.b :
LVRM1_0013_E10.b :
LVRM1_0035_G04.b :
LVRM1_0053_C10.b :
LVRM1_0006_H02.b :
LVRM1_0122_C07.b :
LVRM1_0137_D05.b :
LVRM1_0050_H09.b :
LVR01_0054_H01.b : AGCCCAG*CGA*GGTGTGAGCGGCCAGAA*TGGGTC**ACATCGACACACGCCCT*TTTG
LVR01_0085_G03.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
ITT01_0021_E05.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0019_B12.b : AAGCAAG*CGAAAGTGTGAGC*GCCAGAA*TGGGTCC**CATCGACACCACGCCC*TTTG
KDN01_0031_E05.b : AGCCCAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTT
KDN01_0051_E03.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0070_H04.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTT
KDN01_0030_A10.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACAACGCCC*TTTG
KDN01_0007_E10.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0014_B11.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0010_F12.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTT
KDN01_0005_B01.b : AAGCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0081_D10.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0073_F09.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0076_D08.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0009_G04.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0012_A04.b : AGCCAAG*CGGAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0039_D10.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTT
KDN01_0073_E11.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0100_E01.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0020_F07.b : AGCCAAG*CGAAGGTGTGAGCGGGCCAGA*TGGGGTC*ACATCGACACCACGCCC*T*TG
KDN01_0067_G04.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0088_F03.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0012_D02.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0012_B07.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0074_A08.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0030_D06.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0074_D07.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0021_F03.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0064_E10.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0093_G03.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0032_A07.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0079_E10.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0090_H01.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0024_H11.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0024_A11.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0035_E08.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0069_H07.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0035_E06.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0088_A07.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0059_C02.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0070_H01.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0058_E10.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0095_A02.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0061_A05.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0070_C02.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0043_B02.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0070_B11.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0067_B04.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0033_G03.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0082_E05.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0058_B12.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0074_H04.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGGTC*ACATCGACACCACGCCC*TTTG
KDN01_0088_B10.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0083_A08.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0085_C06.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0063_B09.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0076_B10.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0094_E01.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0098_C10.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0090_A08.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0038_D12.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0070_F07.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0067_E01.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0082_A07.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0097_B02.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0013_B11.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0098_B11.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0016_H12.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0034_D11.b : AGCCTAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0025_G09.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTT
KDN01_0005_D11.b : AGCCAAG*CGAAAGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0005_G05.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0032_G12.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*CTTT
KDN01_0032_D09.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0023_E08.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0034_D05.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0051_C03.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0063_F08.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0019_F07.b : AGCCNAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCCCTTTG
KDN01_0031_D01.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCCCTTTG
KDN01_0062_G03.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0080_F12.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*CTTT
KDN01_0074_A10.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0033_D10.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0080_A04.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0070_B12.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0011_B11.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0071_A09.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0041_D03.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0025_G06.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0001_E06.b : cctaaaaaaaccccacccaaagggtgtggccgcccaaaaaggggttcaaattaaacacca
KDN01_0009_C10.b : AGCCAAG*CGAAGGTGTGAGCGGCCAAAA*TGGGTCC*ACATCGACACCACGCCC*CTTT
KDN01_0019_G10.b : AAGCAAG*CGAAGGTGTGAGCGGNCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0090_F07.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0056_C02.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0054_D09.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACCCCC*TTTG
KDN01_0078_D11.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0029_B05.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0082_F06.b : AGCCAAG*CGAAAGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0067_A11.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0006_C05.b : AGCC*AG*CGAAGGTGTGAGCGGCCAAAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0028_F04.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0070_A01.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0045_A10.b : AGCCAAG*CGAAGGTGTGAACGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0046_C03.b : AGCCAAG*CGTAAGTGTGAGCGGGCATAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0048_H05.b : AGCCAAATCGAAGGTGGGACCGGCCAGAA*TGGGTCC*ACATAGACACCACGCCC*TTTT
KDN01_0052_H11.b : AGCCAAC*TAAAAGTGTGAGCGGCCCGAA*TGGGTCCTACATCGACACCACCCCCCTTTG
KDN01_0046_A02.b : AGCCAAG*CGAAGGTGTGAAGCGGCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0080_A10.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0005_C02.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
LVRM1_0142_D07.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
LVRM1_0138_H10.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0078_D12.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0064_F12.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
LVRM1_0139_C08.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
LVRM1_0127_E08.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
KDN01_0083_D04.b : AGCCAAG*CGAAGGTGTGAGCGGCCAGAA*TGGGTCC*ACATCGACACCACGCCC*TTTG
20110601C-001908 : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
---------+---------+---------+---------+---------+---------+ 1092
KDN01_0020_E10.b : atgggggaacctctctggcggggttgggctccaactccacaaggacaggacgggtttcca
KDN01_0059_E07.b : ctctcaagacgtggggaccntctcggctgggtctggtctcactcagcatgtacggcaggc
KDN01_0079_G02.b : CAAGCTTCTCAAA**AACGG*GGGACCC*TCTTCNGCCTGGGTCTGGCT*CCCA*CTTCA
KDN01_0097_H05.b : CAGCCTCCTCAGA**ACGTG*GGGacctcttcggctgggtctgctctcaactcagcatgt
KDN01_0095_G09.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0071_C10.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
LVRM1_0063_F05.b :
LVRM1_0156_E08.b :
LVRM1_0146_G11.b :
LVR01_0035_C06.b : acctccctccaaaaagtggggaacccacttcagcctggagctgggctttcaattcaccac
LVRM1_0147_E05.b :
LVRM1_0086_B10.b :
LVRM1_0066_D02.b :
LVRM1_0083_H04.b :
LVRM1_0125_C04.b :
LVRM1_0011_E03.b :
LVRM1_0134_D10.b :
LVRM1_0045_E11.b :
LVRM1_0205_E03.b :
LVRM1_0189_B09.b :
LVRM1_0198_A04.b :
LVRM1_0185_D04.b :
LVRM1_0149_F08.b :
LVRM1_0118_D01.b :
LVRM1_0065_E06.b :
LVRM1_0089_E07.b :
LVRM1_0091_B06.b :
LVRM1_0117_H05.b :
LVRM1_0179_F11.b :
LVRM1_0202_F08.b :
LVRM1_0118_A12.b :
LVRM1_0077_F02.b :
LVRM1_0109_C06.b :
LVRM1_0069_E08.b :
LVRM1_0033_E07.b :
LVRM1_0151_B09.b :
LVRM1_0159_F07.b :
LVRM1_0157_B05.b :
LVRM1_0137_E07.b :
LVRM1_0032_H06.b :
LVRM1_0137_C07.b :
LVRM1_0156_H10.b :
LVRM1_0139_A11.b :
LVRM1_0146_H08.b :
LVRM1_0002_G07.b :
LVR01_0026_D01.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTTCGCCTGGGTCTGGGT*TCTCACTCCA
LVR01_0038_C05.b : CCAGCCTCCCCAGAAAC*TG*GGGACCC*TCTTCGGCCTGGGTCTGACT*C*CAACTCCA
LVR01_0033_A07.b : CCAGCCTCCTCAAGAACGTGGGGGACCCTTCTTCGGCCTGGGTCTGGCTCCTCAACTCCA
LVR01_0073_G12.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTTGCT*CTCAACTCCA
LVR01_0065_A07.b : GCAGCCTCCCTCAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
LVRM1_0175_D04.b :
LVRM1_0024_D05.b :
LVRM1_0199_F06.b :
LVRM1_0115_G05.b :
LVRM1_0050_G05.b :
LVRM1_0091_C09.b :
OVRM1_0211_G03.b :
ITT01_0068_C02.b : CCAGCCTCCTCA*GAACGTG*GGGGACC*TTCTCGGCCTGGGTCTGGCT*CTCAACTCCA
LVRM1_0170_G04.b :
LVRM1_0181_G10.b :
LVRM1_0194_G02.b :
LVRM1_0016_G12.b :
LVRM1_0112_C05.b :
LVRM1_0042_H01.b :
LVRM1_0037_B08.b :
LVRM1_0053_H09.b :
LVRM1_0125_G05.b :
LVRM1_0013_E10.b :
LVRM1_0035_G04.b :
LVRM1_0053_C10.b :
LVRM1_0006_H02.b :
LVRM1_0122_C07.b :
LVRM1_0137_D05.b :
LVRM1_0050_H09.b :
LVR01_0054_H01.b : CCAG*CTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCCTGGT*CTTCACTCCC
LVR01_0085_G03.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
ITT01_0021_E05.b : CCAGCCCTCTCAAGAACGTG*GGGACCC*CTCTCGGNCTGGGTCTGGCT*CTCNACTCCA
KDN01_0019_B12.b : CCAGCCTCCTCAA**GAcgtggggaccttcctcgggcctgggtctggctctcactccagc
KDN01_0031_E05.b : GCAGCCTCCTCA*GAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCA*CTTCA
KDN01_0051_E03.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0070_H04.b : GCCAGCTCCTCAAGAACGTG*GGGAACC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCAA
KDN01_0030_A10.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGNCTGGGTCTGGCT*CTCAACTCCA
KDN01_0007_E10.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0014_B11.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCC
KDN01_0010_F12.b : GCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0005_B01.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0081_D10.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0073_F09.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0076_D08.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0009_G04.b : CCAGCCTCCCTCAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0012_A04.b : CCAGCCTCCTCAAGGACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0039_D10.b : GCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0073_E11.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0100_E01.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0020_F07.b : CCAGCCTCCTC*AGAACGTG*GGGACCC*TCTTCGGGCTGGGTCTGGCT*CTCAACTCCA
KDN01_0067_G04.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0088_F03.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0012_D02.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0012_B07.b : CCAGCCTCCTCAAGAACGTG*GGGGACC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0074_A08.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCNGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0030_D06.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0074_D07.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0021_F03.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0064_E10.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0093_G03.b : CCAGCCTCCTCAAGAACGTG*GGGAACCNTCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0032_A07.b : CCAGCCTCCNTCAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0079_E10.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0090_H01.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0024_H11.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGNCTGGGTCTGGCT*CTNCACTCCA
KDN01_0024_A11.b : CCAGCCTCCCTCAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0035_E08.b : CCAGCCTCCTTCAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0069_H07.b : CCAGCCTCCTCAAGAACGGG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0035_E06.b : CCAGCCTCCCTCAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0088_A07.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0059_C02.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0070_H01.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0058_E10.b : CCAGCCTCCTCAAGAACGTG*GGGAACC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0095_A02.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0061_A05.b : CCAGCCTCCCTCAGAAACGT*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0070_C02.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0043_B02.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0070_B11.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0067_B04.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0033_G03.b : CCAGCCTCCTNCAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0082_E05.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGGCTGGGTCTGGCT*CTCAACTCCA
KDN01_0058_B12.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0074_H04.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0088_B10.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0083_A08.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0085_C06.b : CCAGCCTCCCTCAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0063_B09.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0076_B10.b : CCAGCCTCCTCAAGAACGTG*GGGAACC*TCTTCGGCCTGGGTCTGGGC*TCTCACTCCA
KDN01_0094_E01.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTC*A
KDN01_0098_C10.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTTCGGCTGGGTCTGGCT*CTCAACTCCA
KDN01_0090_A08.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0038_D12.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0070_F07.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0067_E01.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGNGTCTGGCT*CTCAACTCCA
KDN01_0082_A07.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0097_B02.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTC*A
KDN01_0013_B11.b : CCAGCCTCCTNCAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0098_B11.b : CCAGCCTCCTCCAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0016_H12.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0034_D11.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0025_G09.b : GCAGCCTCCTCAAGAACGTG*GGGAACC*TCTTNCGCCTGGGTCTGGCT*CTCAACTCAA
KDN01_0005_D11.b : CCAGCCTCCTCA*GAACGTG*GGGACCC*TNCTCGGNCTGGGTCTGGCT*CTTCACTCCA
KDN01_0005_G05.b : CCAGCCCTCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAAACTCA
KDN01_0032_G12.b : GCAGCCTCCTNCAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0032_D09.b : CCAGCCTCCCTCAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0023_E08.b : CCAGCCTCCTCAAGAACGTG*GNGGACC*TCTTCGGCCTGGGTCTGGCT*CTC*ACTCCA
KDN01_0034_D05.b : CCAGCCTTTCTCAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0051_C03.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0063_F08.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0019_F07.b : CCAGCCTCCTCA*GAACGTG*GGGAACC*TCTTCCGGCTGGGTCTGGCT*CTCAACTCCC
KDN01_0031_D01.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGNCTGGGTCTGGCT*CTCAGCTCCA
KDN01_0062_G03.b : CCAGCCTCCTNCAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0080_F12.b : GCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0074_A10.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0033_D10.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0080_A04.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0070_B12.b : CCAGCCTCCCTCAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0011_B11.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0071_A09.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0041_D03.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0025_G06.b : CCAGCCTCCTNCAGAACGTG*GGGACCC*TCTTNCGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0001_E06.b : cccccttttgggaacccccccaaaaaaagggggggccccccttcgcgggggggggggggg
KDN01_0009_C10.b : GCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCCGCCTGGGTCTGGCT*CTC*ACTCCA
KDN01_0019_G10.b : GCAGCCT*CTCAAGAACGTG*GGGACCC*TCTTCNGNCTGGGTCTGGCT*CTC*ACTCCA
KDN01_0090_F07.b : CCAGCCTCCNTCAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0056_C02.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0054_D09.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CNTCACTCAA
KDN01_0078_D11.b : CCAGCCTCCCTCAGAACGTG*GGGACCC*TCTTCNGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0029_B05.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0082_F06.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0067_A11.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTC*A
KDN01_0006_C05.b : CCAGCCTCCTCAAGAACGTG*GGGACC**TCTTCGGGCTGGGTCTGGCT*CTCAACTC*A
KDN01_0028_F04.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTNCACTCCA
KDN01_0070_A01.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0045_A10.b : CCAGCCTCATCAAGAACGTG*GGGACCC*TCTTCGGCCCTGGTCTGGCT*CTCAACTCCA
KDN01_0046_C03.b : CCAAGCTTCTTAAATACGTG*GTGACCC*TCTTCGGCCTGGGTCTGGTT*CTCAACTCCA
KDN01_0048_H05.b : GCAATCTCCTCAAGAACGTG*AGGATCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCC
KDN01_0052_H11.b : CCGACCTCCTCAAGAAGTTG*GGGACCC*TCTTCGGCCGGGGTCTGGCT*CTCCATTCCA
KDN01_0046_A02.b : CCAGCCTTCTCTAGAAAGTG*GGGACCC*TCTTCGGCCTGGGctggctctcaattccgca
KDN01_0080_A10.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0005_C02.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
LVRM1_0142_D07.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
LVRM1_0138_H10.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0078_D12.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0064_F12.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
LVRM1_0139_C08.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
LVRM1_0127_E08.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
KDN01_0083_D04.b : CCAGCCTCCTCAAGAACGTG*GGGACCC*TCTTCGGCCTGGGTCTGGCT*CTCAACTCCA
20110601C-001908 : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
---------+---------+---------+---------+---------+---------+ 1150
KDN01_0020_E10.b : aggcaaacccacaaggggtcccgttcccccaaatgtaatggggcccccccgccccccgcg
KDN01_0059_E07.b : tgcaaagcagctcacagtggtccngttcgctcactgatgtggcctcctcgcctctgactt
KDN01_0079_G02.b : GCATGTACAGG*CAGGGCTGCCAA*GGCAGCTCcacaggtggtcccntccgcctcaactg
KDN01_0097_H05.b : aaggcagggcctgcaaggcaactcaacaggtggtccggtccgcctagctgctcggggctc
KDN01_0095_G09.b : GCATGTACAGG*CAGGGCTGCAAAAGGCAGCTCAGCAAAGTGGTTCCGCGTCCGCCTCAG
KDN01_0071_C10.b : GCATGTACAGG*CAGGGCTGCAAAGGGCAGCTCAGCAA*GTGGTTCCCGTTTCAACTCAG
LVRM1_0063_F05.b :
LVRM1_0156_E08.b :
LVRM1_0146_G11.b :
LVR01_0035_C06.b : ttaaaaagacaggggttgcaaaacgaggattcactatatggttcccgttcccacctcaaa
LVRM1_0147_E05.b :
LVRM1_0086_B10.b :
LVRM1_0066_D02.b :
LVRM1_0083_H04.b :
LVRM1_0125_C04.b :
LVRM1_0011_E03.b :
LVRM1_0134_D10.b :
LVRM1_0045_E11.b :
LVRM1_0205_E03.b :
LVRM1_0189_B09.b :
LVRM1_0198_A04.b :
LVRM1_0185_D04.b :
LVRM1_0149_F08.b :
LVRM1_0118_D01.b :
LVRM1_0065_E06.b :
LVRM1_0089_E07.b :
LVRM1_0091_B06.b :
LVRM1_0117_H05.b :
LVRM1_0179_F11.b :
LVRM1_0202_F08.b :
LVRM1_0118_A12.b :
LVRM1_0077_F02.b :
LVRM1_0109_C06.b :
LVRM1_0069_E08.b :
LVRM1_0033_E07.b :
LVRM1_0151_B09.b :
LVRM1_0159_F07.b :
LVRM1_0157_B05.b :
LVRM1_0137_E07.b :
LVRM1_0032_H06.b :
LVRM1_0137_C07.b :
LVRM1_0156_H10.b :
LVRM1_0139_A11.b :
LVRM1_0146_H08.b :
LVRM1_0002_G07.b :
LVR01_0026_D01.b : GCATGTACAGG*CAGGGCTGCCAAGGGCAagctcagcaagtgggttcccgtttccgccct
LVR01_0038_C05.b : GCCTGGACAGG*CAGGGGTGCAAAAGCAACCTCAGCAA*GTGGGTTCCGTTTCCcccccc
LVR01_0033_A07.b : GCATGTACAGGGCAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTTCCccttca
LVR01_0073_G12.b : GCATGTACAAG*CAGGGCTGCAAAAGGCAGCTTAGCAA*GTGGTT
LVR01_0065_A07.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGGTCCCGTTCCCCCTCAG
LVRM1_0175_D04.b :
LVRM1_0024_D05.b :
LVRM1_0199_F06.b :
LVRM1_0115_G05.b :
LVRM1_0050_G05.b :
LVRM1_0091_C09.b :
OVRM1_0211_G03.b :
ITT01_0068_C02.b : GCATGTACAGG*CAGGGCTGCAAAGGCA*GCTCAGCAA*G*GGTTTCCGTTCCGCCTCAG
LVRM1_0170_G04.b :
LVRM1_0181_G10.b :
LVRM1_0194_G02.b :
LVRM1_0016_G12.b :
LVRM1_0112_C05.b :
LVRM1_0042_H01.b :
LVRM1_0037_B08.b :
LVRM1_0053_H09.b :
LVRM1_0125_G05.b :
LVRM1_0013_E10.b :
LVRM1_0035_G04.b :
LVRM1_0053_C10.b :
LVRM1_0006_H02.b :
LVRM1_0122_C07.b :
LVRM1_0137_D05.b :
LVRM1_0050_H09.b :
LVR01_0054_H01.b : GCATGTACAGG*CAGGGCTGCA
LVR01_0085_G03.b : GCATGTACAGG*CAGGGCTGCCAAGGCAAGCTCAACAAGTGGGTTCCCGTTCccccctca
ITT01_0021_E05.b : GCATGTACAGG*CAGGGCTGCA*AGGCAAGCTCAGCAA*GTGG*TCCCGTTNCGNCTCAG
KDN01_0019_B12.b : atgtaaagccaagcctgcaaagccagcctcaccaatgggtccggttccgcctcaactgca
KDN01_0031_E05.b : GCATGTACAGG*CAGGGCTGCAA*GGCCAGCTCAGCAA*GTGGTTCCCGTTCGCCTaact
KDN01_0051_E03.b : GCATGTACAGG*CAGGGCTGCAAAGG*AAGCTCAACAA*GTGGTTCCCGTTC*GCCTCCA
KDN01_0070_H04.b : GCATGTACAGG*CAGGGCTTGCAAAGCAAACTCAACAA**GTGTTCCCGTTCCGCCTCAC
KDN01_0030_A10.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCGGTTC*GGCTCAA
KDN01_0007_E10.b : GCATGTACAGG*CAGGGCTGCAAAGGC*AGCTCAGCAA*GTGGTTCCCGTTTCG*CTCAG
KDN01_0014_B11.b : GCATGTACAGG*CAGGGCTGCAAAG*CAAGCTCAGCAA*GTGG*TCCCGTTCCGCCTCAG
KDN01_0010_F12.b : GCATGTACAGG*CAGGGCTGCAAAG*CAAGCTCAGCAA*GTGGTTCCCGTTC*GCCTCAG
KDN01_0005_B01.b : GCATGTACAGG*CAGGGCTGCAAAGGGCAGCTCAGCAA*GTGGTTCCCCGTTCG*CTCAG
KDN01_0081_D10.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGTTTCCCGTTCCG*CTCAA
KDN01_0073_F09.b : GCATGTACAGG*CAGGGCTGCAAAGGGCAGCTCAGCAA*GTGTTTCCCGTTC*GCCTCAG
KDN01_0076_D08.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCCA*GTGGTTCCCGTTCGCCCTCA*
KDN01_0009_G04.b : GCATGTACAGG*CAGGGCTGCAAGGGC*AGCTCAGCAA*GTGGTT*CCGTTNCCGCTCAG
KDN01_0012_A04.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTT*CCGTTTCCGCTCAG
KDN01_0039_D10.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0073_E11.b : GCATGTACAGG*CAGGGCTGCAA*GGCCAGCTCAGCAA*GTGGTTTCGGTTCCGCCTCAG
KDN01_0100_E01.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAACAA*GTGGTTCCCGTTTCGCCTCAG
KDN01_0020_F07.b : GCATGTACAGG*CAGGGCTGCAAAGGGCAGCTCAGCAA*GTGTTCCCGGTTTCCGCTCAA
KDN01_0067_G04.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCG*CTCAG
KDN01_0088_F03.b : GCATGTACGGG*CAGGGCTGCAAAAGCAAGCTCAGCAA*GTGGTTCCCGT*CCGCCTCAG
KDN01_0012_D02.b : GCATGTACAGG*CAGGGCTGCAAAGGCCAGCTCAACAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0012_B07.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGGTCCGGCTCAG
KDN01_0074_A08.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0030_D06.b : GCATGTACAGG*CAGGGCTGCAAAAGCAAACTCAGCAA*GTGGGTCCCGTTCCGCCTCAG
KDN01_0074_D07.b : GCATGTACAGG*CAGGGCTGCAAGGGC*AGCTCAGCAA*G*GGTTCCCGTTTCGGCTCAG
KDN01_0021_F03.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCCGCTCAG
KDN01_0064_E10.b : GCATGTACAGG*CAGGGCTTGCAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCCGCTCAG
KDN01_0093_G03.b : GCATGTACAGG*CAGGGCTTGCAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAA
KDN01_0032_A07.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTCCCCG*TCCCGCTCAG
KDN01_0079_E10.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCG*CTCAA
KDN01_0090_H01.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGGCTCAG
KDN01_0024_H11.b : GCATGTACAGG*CAGGGCTGCAAAGGGCAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0024_A11.b : GCATGTACAGG*CAGGGGCTGCAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0035_E08.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0069_H07.b : GCATGTACAGG*CAGGGCTGCAAAAGGCAGCTCAGCA**GTGGTTCCCGTTCCGCCTCAG
KDN01_0035_E06.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCCGCTCAG
KDN01_0088_A07.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGGTCCCGTTCCGCCTCAG
KDN01_0059_C02.b : GCATGTACAGG*CAGGGCTGCAAGGGC*AGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0070_H01.b : GCATGTACAGG*CAGGGGCTGCAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0058_E10.b : GCATGTACAGG*CAGGGCTGCAAAGGCCAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0095_A02.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTTCGCCTCAG
KDN01_0061_A05.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTC*GGCTCAA
KDN01_0070_C02.b : GCATGTACAGG*CAGGCCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGGCTCAG
KDN01_0043_B02.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGGTTCCGTTCCGCCTCAG
KDN01_0070_B11.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTT*CCGTTTTCGCTCAG
KDN01_0067_B04.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0033_G03.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAACAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0082_E05.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0058_B12.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTACGCCTCAG
KDN01_0074_H04.b : GCATGTACAGG*CAGGGCTGGCAAGGCCAGCTCAGCAA*GTGGTTCCCGTTCGGCCTCAG
KDN01_0088_B10.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCANCAA*GTGGTTCCCGTCCCG*CTCAG
KDN01_0083_A08.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCCGCTCAG
KDN01_0085_C06.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGGTCCCGTTCCGCCTCAG
KDN01_0063_B09.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTTCCGTTCCGCCTCAG
KDN01_0076_B10.b : GCATGTACAGG*CAGGGGCTGCAAGGGCAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0094_E01.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0098_C10.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAACAA*GTGGTTC*CGTTCCCGCTCAG
KDN01_0090_A08.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGGTCCCGTTTCCGCTCAG
KDN01_0038_D12.b : GCATGTACAGG*CAGGGCTGCAAAGGCCAGCTCAGCAA*GTGGGTCCCGTTTCGCCTCAG
KDN01_0070_F07.b : GCATGTACAGG*CAGGGCTGNCAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCCGCTCAG
KDN01_0067_E01.b : GCATGTACAGG*CAGGGCTGCAAAAGCAAGCTCAGCAA*GTGGTTCCCNGTTTCGCTCAG
KDN01_0082_A07.b : GCATGTACAGG*CAGGGCTGCAAAG*CAAGCTCAGCAA*GTGGTTTCCGTTTCGCCTCAA
KDN01_0097_B02.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCCGCTCAG
KDN01_0013_B11.b : GCATGTACAGG*CAGGGGCTGCAAGGCAAGCTCAGCAA*GTGGTTCCCGTTNCCGCTCAG
KDN01_0098_B11.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0016_H12.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAAGTGGTTNCCCGTTCCCGCTCAG
KDN01_0034_D11.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGGTCCCGTTCCGCCTCAG
KDN01_0025_G09.b : GCATGTACAGG*CAGGGCTGCAAAGGGCAGCTCAGCAA*GTGGTACCCGTTC*GCCTCAG
KDN01_0005_D11.b : GCATGTACAAG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGGTCCCGCTCAG
KDN01_0005_G05.b : GCATGTACAAG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTCCCNG*TCCGGCTCAG
KDN01_0032_G12.b : GCATGTACAGG*CAGGGCTGCNAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCCGCTCAG
KDN01_0032_D09.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCA**GTGGTTCCCGTTCCCGCTCAG
KDN01_0023_E08.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTTCCGTTCCCGCTCAA
KDN01_0034_D05.b : GCATGTACAGG*CAGGGCTGCAAAGGC*AGCTCAGNCA*GTGG*TCCCGTTCCGNCTCAG
KDN01_0051_C03.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGTTTTCCGTTCCCGCTCAG
KDN01_0063_F08.b : GCATGTACAGG*CAGGGCTGGCAAGGGCAGCTCNAGCA*GTGGTTCCCGTTTCCGCTCAG
KDN01_0019_F07.b : GCATGTACAGG*CAGGGCTGNCAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAA
KDN01_0031_D01.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAAGCA*GTGGTTCCCGTTCCGGCTCAG
KDN01_0062_G03.b : GCATGTACAGG*CAGGGCTGCAA*GGCAAGCTCAGCAA*GTGGTTCCCGTTTCGCCTCAG
KDN01_0080_F12.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCCGTTCGCCTCAG
KDN01_0074_A10.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTTCGCCTCAG
KDN01_0033_D10.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTTCCGTTCCGCCTCAG
KDN01_0080_A04.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCCGCTCAG
KDN01_0070_B12.b : GCATGTACAGG*CAGGGGCTGCAAAGCAAGCTCAGCAA*GTGGTTCC*GTTTCGCCTCAA
KDN01_0011_B11.b : GCATGTACAGG*CAGGGCTGCNAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCG*CTCAG
KDN01_0071_A09.b : GCATGTACAGG*CAGGGCTGCAAAGGC*AGCTCAGNCA*GTGGGTTCCGTTCCCGCTCAG
KDN01_0041_D03.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GT*GTTCCCGTTTCCGCTCAG
KDN01_0025_G06.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTTCCGCTCAG
KDN01_0001_E06.b : ccaacaccccccaagttaaaagggggggtttaaaaaaaaaaaccccaaaaggggttcccc
KDN01_0009_C10.b : GCATGTACCGG*CAGGGCTGCCAAAGCAAGCTCAACAA*GTGGTT*CCGTTCCGCCTCAG
KDN01_0019_G10.b : GCATGTACAGG*CAGGGCTGCAAAGGCAACCTCACAAG*TGGGT**CCGTTCCGCCTCAA
KDN01_0090_F07.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA**GTGGTCCCGTTCCCGCTCAG
KDN01_0056_C02.b : GCATGTACAGG*CAGGGGCTGCAAGGGCAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0054_D09.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0078_D11.b : GCATGTACAGG*CAGGGCTGCAAGGGC*AGCTCANCAA*GTGGTTCC*GTTCCCGCTCAG
KDN01_0029_B05.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCCAGCA*GTGGTTCCCGTTTCGCCTCAA
KDN01_0082_F06.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0067_A11.b : GCATGTACAGG*CAGGGCTGCAAAGGCA*GCTCAGCAA*GTGGGTCCCGGTCCGCCTCAG
KDN01_0006_C05.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAACAA*GTGGTTCCCGTTCCCGCTCAG
KDN01_0028_F04.b : GCATGTACAGG*CAGGGCTGCAAAGGC*AGCTCAGCAA*GTGGNTTCCGTTNNCGCTCAG
KDN01_0070_A01.b : GCATGTACAGG*CAGGGCTGCAAAAGGCAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0045_A10.b : CCATGTTCAGG*Ccaggcttgccaaggcaagcttctacaagtggttccggttccgcctca
KDN01_0046_C03.b : GCATGTACAGG*CAGGGCTGCTAAG*CAAGCTCAATAA*GTGGTTCCGGTTCCG*CTCAA
KDN01_0048_H05.b : GCtagtatgagcatggcggcaagggcaacttaaaaagtggttccggttccgcctcagttg
KDN01_0052_H11.b : CCATGgaacgggaggggttgcaaagggaagctcaaccaatggttccccgttccgccctca
KDN01_0046_A02.b : tggtaaaggcagggttcaaaggcagcctcacaagtggtccggtctccgctcaactcatgt
KDN01_0080_A10.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0005_C02.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
LVRM1_0142_D07.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
LVRM1_0138_H10.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0078_D12.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0064_F12.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
LVRM1_0139_C08.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
LVRM1_0127_E08.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
KDN01_0083_D04.b : GCATGTACAGG*CAGGGCTGCAAAGGCAAGCTCAGCAA*GTGGTTCCCGTTCCGCCTCAG
20110601C-001908 : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCATCC
---------+---------+---------+---------+---------+---------+ 1208
KDN01_0020_E10.b : cttttttaaccctggaacccccctcccaaaaggggtaatcttccaccccgccctctcaaa
KDN01_0059_E07.b : cttgatcttgaacccatccaatcaagtatctcaatcggtcttctcaaaacgggaggccct
KDN01_0079_G02.b : gatcggcctccctcgtcctctggacttttttgacccctggaccccccatccaaatcggag
KDN01_0097_H05.b : cctcgtccctggcttcttgactcctgaaaccccatccaatcgagtgatcttcaactccgt
KDN01_0095_G09.b : CTGCATCGTGGCTTCCCCTCGTCCTC*TGCACTTCTTTGA*CTCTTTGAAACCCCCATC*
KDN01_0071_C10.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTGAAAACCCCAT**C
LVRM1_0063_F05.b :
LVRM1_0156_E08.b :
LVRM1_0146_G11.b :
LVR01_0035_C06.b : ctagttagacagcaaccccccgacccaccatgacattcttttgaacctcctgaaagaccc
LVRM1_0147_E05.b :
LVRM1_0086_B10.b :
LVRM1_0066_D02.b :
LVRM1_0083_H04.b :
LVRM1_0125_C04.b :
LVRM1_0011_E03.b :
LVRM1_0134_D10.b :
LVRM1_0045_E11.b :
LVRM1_0205_E03.b :
LVRM1_0189_B09.b :
LVRM1_0198_A04.b :
LVRM1_0185_D04.b :
LVRM1_0149_F08.b :
LVRM1_0118_D01.b :
LVRM1_0065_E06.b :
LVRM1_0089_E07.b :
LVRM1_0091_B06.b :
LVRM1_0117_H05.b :
LVRM1_0179_F11.b :
LVRM1_0202_F08.b :
LVRM1_0118_A12.b :
LVRM1_0077_F02.b :
LVRM1_0109_C06.b :
LVRM1_0069_E08.b :
LVRM1_0033_E07.b :
LVRM1_0151_B09.b :
LVRM1_0159_F07.b :
LVRM1_0157_B05.b :
LVRM1_0137_E07.b :
LVRM1_0032_H06.b :
LVRM1_0137_C07.b :
LVRM1_0156_H10.b :
LVRM1_0139_A11.b :
LVRM1_0146_H08.b :
LVRM1_0002_G07.b :
LVR01_0026_D01.b : cacctgcatcgtgggcctccccctcgtcctccctgccctttcttttaaccccttgaaacc
LVR01_0038_C05.b : ctgcttcggggccctcccccgtcctcctgccctttttttgaccccttgaaacccccctcc
LVR01_0033_A07.b : cctgcattcggggccctccctcgtcctcctggcccttctttaaatcctttaaaacccccc
LVR01_0073_G12.b :
LVR01_0065_A07.b : CTGCATCGTGGCCTC*CCTCGTCCCTCTGCACTTCTTTGA*CTCCCTGAAACCCCCATCC
LVRM1_0175_D04.b :
LVRM1_0024_D05.b :
LVRM1_0199_F06.b :
LVRM1_0115_G05.b :
LVRM1_0050_G05.b :
LVRM1_0091_C09.b :
OVRM1_0211_G03.b :
ITT01_0068_C02.b : CTGCATCGTGcctccctcgttcttctggacttcttgactcctggaaccccccatccaatc
LVRM1_0170_G04.b :
LVRM1_0181_G10.b :
LVRM1_0194_G02.b :
LVRM1_0016_G12.b :
LVRM1_0112_C05.b :
LVRM1_0042_H01.b :
LVRM1_0037_B08.b :
LVRM1_0053_H09.b :
LVRM1_0125_G05.b :
LVRM1_0013_E10.b :
LVRM1_0035_G04.b :
LVRM1_0053_C10.b :
LVRM1_0006_H02.b :
LVRM1_0122_C07.b :
LVRM1_0137_D05.b :
LVRM1_0050_H09.b :
LVR01_0054_H01.b :
LVR01_0085_G03.b : cctgcatcgtggcctcccccctccctcctgcacttcctttgactccctggaaaaccccca
ITT01_0021_E05.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAACCCCCAT**C
KDN01_0019_B12.b : tcggggccttcctccgccccctggaatttcttgaatcctggaacccccatcccaaatcaa
KDN01_0031_E05.b : ggatcggggcctccctcgcctctgcacttcttgactcttgaaaccccctcccaatcgagc
KDN01_0051_E03.b : CTGCATCGGGGCttcctcggccctctgaacttcttgacccttgaaaccccctcccaaacg
KDN01_0070_H04.b : CTGCTTCGGGGCCTC*CCTCGTCtcctggattctttgattcttgaaaccccatcccaaat
KDN01_0030_A10.b : CTGCATCGTGGCCT**CCTCGTCCTCCTGGACTTCTTggattcttgaaaccccatcccaa
KDN01_0007_E10.b : CTGCATCGGGNCCT**CCTCGTCCTCtgcactcttngactccttgaaccccatccnaatc
KDN01_0014_B11.b : CTGCATCGTGGGCTC*CCTCGTCCTC*TGCACTTCTTgactcttggaaccccatcccaat
KDN01_0010_F12.b : CTGCATCGTGGCTC**CCTCGTCCTC*TGCACTTCTTGactcttgaaacccccatccaat
KDN01_0005_B01.b : CTGCATCGTGGCCTC**CTCGTCCTCCTGCACT*CTTTGA*CTCTTGAAACCCCCAtcca
KDN01_0081_D10.b : CTGGATCGTGGCCTC*CCTCGTCCTCCTGCATTTC*TTGA*CTCCTTGAACCCCCCTCCC
KDN01_0073_F09.b : CTGCATCGTGGCCTC*CCTCGTC*TCCTGCACTTCTTTGA*CTCCTTGAACCCCATCCca
KDN01_0076_D08.b : CTGCATCGGGGGCTC*CCTCGTCCTCCTG*ACTTCTTTGA*ATCCTTGAACCCCCATCCA
KDN01_0009_G04.b : CTGCATCGTGGCCT**CCTCGTCCTC*TGCACTTC*TTGA*CTCCTGAANCCCCAtccaa
KDN01_0012_A04.b : CTGCATCGTGGCCT**CCTCGTCCTC*TGCACTTC*TTGA*CTCCNTGAACCCCatccna
KDN01_0039_D10.b : CTGCATCGGGGGCTCCCCTCGTCCTCCTGCACTTCTTGAA*TTCCTTGAAACCCCCATC*
KDN01_0073_E11.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACT*CTTTGA*CTCCTTGAAACCCCCT**C
KDN01_0100_E01.b : CTGCATCGTGGGCTC*CCTCGTCCTCCTGCACTTTCTTGA*CTCCTTGAAACCCCCATCC
KDN01_0020_F07.b : CTGGATCGGGGCCTC*CCTCGGTCTCCTGGAATTCTTGGA*CCCCTTGAACCCCCATCCC
KDN01_0067_G04.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCC*ATCC
KDN01_0088_F03.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGGAACCCCCATCC
KDN01_0012_D02.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGGCACTTCTTGA*CTCCTTGGAACCCCCCATC
KDN01_0012_B07.b : CTGGCTCGTGGGCCTCCCTCGTCCTCCTGCACTTCTTTGA*ACTCCTGAACCCCCAT**C
KDN01_0074_A08.b : CTGCATCGTGGGCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCAT**C
KDN01_0030_D06.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCC*ATCC
KDN01_0074_D07.b : CTGCATCGTGGGCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCC*ATCC
KDN01_0021_F03.b : CTGCATCGTGGNCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTTGAACCCC*ATN*
KDN01_0064_E10.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCAT*C
KDN01_0093_G03.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCATTTCTTTGA*CTCCTGAAACCCCCAT**C
KDN01_0032_A07.b : CTGCATCGTGGGCTCCCCTCGTC*TCCTGCACTTCTTTGA*CTCCTTGAAACCCCCATC*
KDN01_0079_E10.b : CTGCATCGTGGCC*CTCCTCGTCCTCCTGCACTTCTTTGG*GTCTTGGAACCCCCAT**C
KDN01_0090_H01.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAACCCCCATCC*
KDN01_0024_H11.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAACCCCCAT**C
KDN01_0024_A11.b : CTGCATCGTGGCCTT*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCAT*C
KDN01_0035_E08.b : CTGCATCGTGGCCTC*CCTCGTCCTC*TGCACTTCTTTGA*CTCCTTGAAACCCC*ATCC
KDN01_0069_H07.b : CTGGATCGTGGCCTTCCCTCGTCCTCCTGCCCTTTTTTGA*CTCCTTGAAACCCCCATCC
KDN01_0035_E06.b : CTGCATCGTGGGC*CTCCTCGTCCTCCTGCACTTCTTTGA*CTCCTGAANCCCCCAT**C
KDN01_0088_A07.b : CTGCATCGTGGGCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAACCCCC*ATCC
KDN01_0059_C02.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAACCCCCAT**C
KDN01_0070_H01.b : CTGCATCGTGGCC*CTCCTCGTCCTCCTGCACTTCTTTAA*CTTCTTGAAACCCCCATCC
KDN01_0058_E10.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTTCTTGA*CTCCTTGAAACCCCAT*CC
KDN01_0095_A02.b : CTGCATCGTGGGCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCAT*C
KDN01_0061_A05.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCNTGAAACCCC*ATCC
KDN01_0070_C02.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGAACTCCTTGAAACCCCAACCC
KDN01_0043_B02.b : CTGCATCGTGGGCTC*CCTCGTCCTCCTGCACTTCTTTGA*ACTCTTGAAAACCCCATCC
KDN01_0070_B11.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCNTGAAACCCCCATCC
KDN01_0067_B04.b : CTGCATCGTGGCCTC*CCTCGTCNTCCTGCACTTCTTTGA*CTCCCTGAAAACCCCATCC
KDN01_0033_G03.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACT*CTTTGA*CTCCTTGAAACCCCCATTC
KDN01_0082_E05.b : CTGCATCGTGGCCTCCCCTCGTC*TCCTGCACTTCTTTGA*CTCCTTGAAACCCCCNNAT
KDN01_0058_B12.b : CTGCATCGTGGGCTC*CCTCGTCCTCCTGCACTTTCTTGA*CTCCTTGNAAACCCCCATC
KDN01_0074_H04.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCC*ATCC
KDN01_0088_B10.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCCTGAAANCCCCATCC
KDN01_0083_A08.b : CTGCATCGTGGGCTC*CCTCGTCCTCTTGCACTTCTTTGA*CTCCNTGAAACCCCAT*CC
KDN01_0085_C06.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAAACCCCATCC
KDN01_0063_B09.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCATCC
KDN01_0076_B10.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCAT*C
KDN01_0094_E01.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCATCC
KDN01_0098_C10.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTTCTTGA*CTCCCTGAAACCCC*ATCC
KDN01_0090_A08.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCAATCC
KDN01_0038_D12.b : CTGCATCGTGGCCTT*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTTGAACCCCAT*CC
KDN01_0070_F07.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTTCCTGGAACCCCCATCC
KDN01_0067_E01.b : CTGCATCGTGGCC*CTCCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAANCCCCCATCC
KDN01_0082_A07.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCAT*CC
KDN01_0097_B02.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCATCC
KDN01_0013_B11.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCNATC
KDN01_0098_B11.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTNCTTGA*CTCCTTGAAACCCC*ATCC
KDN01_0016_H12.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCAT*C
KDN01_0034_D11.b : CTGCATCGTGGNCTC*CCTCGTCCTCCTGCACTTTCTTGA*CTCCTTGAAACCCCCATCC
KDN01_0025_G09.b : CTGCATCGTGGCCTCCtcgtcctctgcacttcttgactcctgaaaccccatccaaatcga
KDN01_0005_D11.b : CTGCATCGGGGCCTCCCTCGTCCCTNTGGCACTTCTTTGA*ATCCTGAAAACCCCCATCC
KDN01_0005_G05.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTTCTTGA*CTCCTGGAACCCCCAT**C
KDN01_0032_G12.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTGGA*CTCCNTGNAACCCCCATCC
KDN01_0032_D09.b : CTGCATCGTGGCTC**CCTCGTCCTC*TGCACTTC*TTGA*CTCCTTGAACCCCCAT**C
KDN01_0023_E08.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAACCCCCAT**C
KDN01_0034_D05.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCAT**C
KDN01_0051_C03.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCCATC
KDN01_0063_F08.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTT*GA*CTCCTTGAACCCCC*ATCC
KDN01_0019_F07.b : CTGCATCGGGGCCTC*CCTCGTCCTCCTG*ACTTCTTTGA*CTCCCTGAAACCCCCATCC
KDN01_0031_D01.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTTGAACCCCCATCC
KDN01_0062_G03.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCATCC
KDN01_0080_F12.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCATCC
KDN01_0074_A10.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTTCTTGA*CTCCTTGAAACCCCCGGTC
KDN01_0033_D10.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAACCCCCAT**C
KDN01_0080_A04.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCATCC
KDN01_0070_B12.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCAATCC
KDN01_0011_B11.b : CTGCATCGTGGCCTC*CCTCGTCCTCTTGCACTTCTTTGA*CTCCTTGAAACCCCCATCC
KDN01_0071_A09.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTTCTTGA*CTCCTTGAAACCCC*ATCC
KDN01_0041_D03.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCATN*C
KDN01_0025_G06.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCT*GAAACCCCCATCC
KDN01_0001_E06.b : cttccccccccaaggagaaggggggcccccccccccccggggatttttttttcccctaaa
KDN01_0009_C10.b : CTGatcggggcctccctctcctcctgcaatcctttgactccttgaaccccatccaaatcg
KDN01_0019_G10.b : CTGCATCGTGGCCTC*CCTCGTCCTCtggaattcttgaatccctgaaaccccatccaaat
KDN01_0090_F07.b : CTGCATCGTGGCCTC*CCTCGTCCTC*TGCACTTTCTTGA*CTCCTTGAACCCCatccaa
KDN01_0056_C02.b : CTGCATCGTGGCC*CTCCCCGTCCTCCTGCACTTCTTTGA*CTCCTTGANCCCCCAT**C
KDN01_0054_D09.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAACCCCCANT**
KDN01_0078_D11.b : CTGCATCGTGGCC*CTCCTCGTCCTCCTGCACTTCTTGGA*ATCCTGAAACCCCCAT**C
KDN01_0029_B05.b : CTGCATCGTGGCCTCCCTCCGTCTCCTGGCACTTCTTTGA*ATCCTTGAAACCCCCTTCC
KDN01_0082_F06.b : CTGCATCGTGGGCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAAACCCCATCC
KDN01_0067_A11.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTTCTTGA*CTCCTTGAAAACCCCATCC
KDN01_0006_C05.b : CTGCTTCGGGGCCT**CCTCGTCCTC*TGCACTTCTTTGA*CTCCTTGAACCCCCAT**C
KDN01_0028_F04.b : CTGCATCGTGGCCTCCCNNTCGTCTC*TGCACTTCTTTGA*CTCCTTGAAACCCC*ATCC
KDN01_0070_A01.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTTG*ACTCTTGAAAACCCCATCC
KDN01_0045_A10.b : attgctatcgggcttccctcgttctccttgacttctttgaatccttgaacccccctccca
KDN01_0046_C03.b : CTGCATCGGGGCTC**CCTCGTCCTCctgccttcttggatctctgaacccccttccaaat
KDN01_0048_H05.b : gacggggacttccacttcctctggactttattgaatcctggaaccccctcccaaatcggg
KDN01_0052_H11.b : catggatgggggcctccctccgtcttcctgccctttatttaactccttgaaacccccctt
KDN01_0046_A02.b : ggcctcctcttctccggccttctttgatcttgaaaccctctcccaaacaagctgaatttc
KDN01_0080_A10.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCATCC
KDN01_0005_C02.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCATCC
LVRM1_0142_D07.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCATCC
LVRM1_0138_H10.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCATCC
KDN01_0078_D12.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCATCC
KDN01_0064_F12.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCATCC
LVRM1_0139_C08.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCATCC
LVRM1_0127_E08.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCATCC
KDN01_0083_D04.b : CTGCATCGTGGCCTC*CCTCGTCCTCCTGCACTTCTTTGA*CTCCTTGAAACCCCCATCC
20110601C-001908 : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAAG*AGCGCGGCAGTGCCC*CTGG
---------+---------+---------+---------+---------+---------+ 1266
KDN01_0020_E10.b : agagggagagcccccggattttaccctctcccttaagctccccgggcgggggccccaaaa
KDN01_0059_E07.b : gattgtacctttcatatgcctccgggctggncaccaaaaaattttaacatgggtccaaat
KDN01_0079_G02.b : tgatttctacgtcggtcctttggcaaaacgcggaagcccctggatttgttaccctatccc
KDN01_0097_H05.b : cctttgcaaagccggcaggcccgggattgtaacccatccaagggcttccgggcgggccac
KDN01_0095_G09.b : CAAATCGAGCTGATCTTCCCCGTCCTGTCTTTCTGCAAacgcggcagtgcccctgggatt
KDN01_0071_C10.b : CCAATCGAGCTGATCTctacgtcctgtccttctgcagagcgcggcagtgcccgtggatct
LVRM1_0063_F05.b :
LVRM1_0156_E08.b :
LVRM1_0146_G11.b :
LVR01_0035_C06.b : cccccccacaaaaaccacacacaagattctcccacatacacaggcccctatcgtacgaaa
LVRM1_0147_E05.b :
LVRM1_0086_B10.b :
LVRM1_0066_D02.b :
LVRM1_0083_H04.b :
LVRM1_0125_C04.b :
LVRM1_0011_E03.b :
LVRM1_0134_D10.b :
LVRM1_0045_E11.b :
LVRM1_0205_E03.b :
LVRM1_0189_B09.b :
LVRM1_0198_A04.b :
LVRM1_0185_D04.b :
LVRM1_0149_F08.b :
LVRM1_0118_D01.b :
LVRM1_0065_E06.b :
LVRM1_0089_E07.b :
LVRM1_0091_B06.b :
LVRM1_0117_H05.b :
LVRM1_0179_F11.b :
LVRM1_0202_F08.b :
LVRM1_0118_A12.b :
LVRM1_0077_F02.b :
LVRM1_0109_C06.b :
LVRM1_0069_E08.b :
LVRM1_0033_E07.b :
LVRM1_0151_B09.b :
LVRM1_0159_F07.b :
LVRM1_0157_B05.b :
LVRM1_0137_E07.b :
LVRM1_0032_H06.b :
LVRM1_0137_C07.b :
LVRM1_0156_H10.b :
LVRM1_0139_A11.b :
LVRM1_0146_H08.b :
LVRM1_0002_G07.b :
LVR01_0026_D01.b : ccccttcccaaaatcgaagctgattctttcctacgttcctggttcctttttgccaaaaaa
LVR01_0038_C05.b : ccaaatcaaagcttaacttcttacctccccgttcctttccgcaaaaagcgccgggaaggg
LVR01_0033_A07.b : atccccaaattcagcctgaatctttcttccttccctgttcctttctgccaaaaaaccccg
LVR01_0073_G12.b :
LVR01_0065_A07.b : CAAATCAAGCTGATCTTCcaccttcctgtccttctgcaaaaaccccggccatgccccctg
LVRM1_0175_D04.b :
LVRM1_0024_D05.b :
LVRM1_0199_F06.b :
LVRM1_0115_G05.b :
LVRM1_0050_G05.b :
LVRM1_0091_C09.b :
OVRM1_0211_G03.b :
ITT01_0068_C02.b : gagttgatctctagttctgtcttctgcaagacgcggcagtgccctggatttggtaccctc
LVRM1_0170_G04.b :
LVRM1_0181_G10.b :
LVRM1_0194_G02.b :
LVRM1_0016_G12.b :
LVRM1_0112_C05.b :
LVRM1_0042_H01.b :
LVRM1_0037_B08.b :
LVRM1_0053_H09.b :
LVRM1_0125_G05.b :
LVRM1_0013_E10.b :
LVRM1_0035_G04.b :
LVRM1_0053_C10.b :
LVRM1_0006_H02.b :
LVRM1_0122_C07.b :
LVRM1_0137_D05.b :
LVRM1_0050_H09.b :
LVR01_0054_H01.b :
LVR01_0085_G03.b : tccccaaatcgagcctgatctttcaccgtccctggtcctttcggccaaaaagcgcgggcc
ITT01_0021_E05.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTTCTGCAG*AACGCGGCAGTGCCC*CTGG
KDN01_0019_B12.b : actgaactttaagctctgtccttctgaaaagcgcggaatgcccctggaattgttaacttt
KDN01_0031_E05.b : tgatcttcaagtccggcctttgcaaaagggggaaggccctggatctgtacctcatcctta
KDN01_0051_E03.b : agctgacttcatcgtcggtcttttcaaaaacgggaatgccccgggatttgaaaccctcat
KDN01_0070_H04.b : caactgattttttagtctggccttttgcaaaacgggggagggcccgggttttgttaacct
KDN01_0030_A10.b : tcgagctgatttctacgcccggccttcggaaaacgcggcagtgcccgtggatcgtcagct
KDN01_0007_E10.b : gagctgatctctacgtctgtcttctgcagaacgcggagtgccctggatctgtagctcatc
KDN01_0014_B11.b : cgagctgatctctactcctgtcttttgcagaacgcggcagtgccctggatctggagccta
KDN01_0010_F12.b : cgagctgatctctacgtcctgtcttctgcaagacgcggcagtgccctggaatctgtaact
KDN01_0005_B01.b : aatcgagctgatctctacgtcctgtcttctgcaaaacgcgcaatgccctgtggattgtta
KDN01_0081_D10.b : AAATcaacttaatcttctacttccggtcttctgcagaacgcggcagtgcccctgaaattg
KDN01_0073_F09.b : aacgagctgatctctacgtcctgtcttctgcagaacgcgcagtgcccctggaattgtcag
KDN01_0076_D08.b : AAAcgagctgatttctagttctgtcttttgcaagaacggggcagggccctggtattgtaa
KDN01_0009_G04.b : atcgagctgatctctacgtctgtcctctgcagaacgcggcaggcccctggnattgttagc
KDN01_0012_A04.b : atcgagctgatctctacgtctgtcttctggcagacgcggcatgccctggatctgtcacct
KDN01_0039_D10.b : CCAAATCaactgatcttctagttctgtctttcgcaagagcgcggcattgcccctggcatt
KDN01_0073_E11.b : CAAATCGAGgtgatttctacgtccggtcctctgcaaaacggcggaatggccctgggatct
KDN01_0100_E01.b : C*AATCGAGCTGATCTctacgtcctggtcctctgcagaacgcggcagtgccctggaatcg
KDN01_0020_F07.b : AAATcaactgaatcttcaaggtccgggcttctggaaaaaacgggaaggcccctgggaatt
KDN01_0067_G04.b : CAAATCGAGCTGATCTctacgtcctgtcctctgcagagcgccgcatgcccctggntctgt
KDN01_0088_F03.b : C*AATCGAGCTGATCTTCTAggcctgtccttcggaagaacgccgcagtgccctggaatct
KDN01_0012_D02.b : CAAATCGAGCTGAatctctatgtcctgccttctggcagagcgcggcagtgccctggcatc
KDN01_0012_B07.b : CCAATCGAGCTGATCTctacgtcctgtcttctgcagaacgcggcaggcccctggatctgt
KDN01_0074_A08.b : CCAATCGAGCTGATCT*CTACGTCctgtcttcngcaagagcgcggcagtgcccctgggtc
KDN01_0030_D06.b : CAAATCGAGCTGATTTTCTAAGTCCTGTCCTctgcaaaagcggggcagtgccctggcatc
KDN01_0074_D07.b : CAAATCGAGCTGATCTTCTACGTCCTGTCttctgacagagcgcgcaatgcccctggnatc
KDN01_0021_F03.b : CCAATCGAGCTGATCTTCTACGTCtgtcttctgcagaacgcacagtgccctggcatctgt
KDN01_0064_E10.b : CAAATCGAGCTGATCTTCTACGTCCTGTCttctgcagagcgcggcagtgcccctggtatt
KDN01_0093_G03.b : CCAATCGAGCTGATCTTCTACGTCCTGTCttttgcaagagcgcggcatggccctgggatc
KDN01_0032_A07.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTctgcaggagcgcgggatgcccctggaatc
KDN01_0079_E10.b : CCAATCGAGCTGATCTTCTACGTCCTGTCCTctgcaaaagcgcggcatggccctggaatc
KDN01_0090_H01.b : NAAATCAAGCTGATCTTCTACGTCCTGTCCTcttgcaaaacgcggcagtgcccctgggat
KDN01_0024_H11.b : CCAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAgaacggcgcagtgccctggatct
KDN01_0024_A11.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAAG*Acgcggcaatgcccctggaa
KDN01_0035_E08.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAgaacgcggcagtgccctggcatc
KDN01_0069_H07.b : CAAATCGAGTTGATCTTCTACGTCTGGTCCTTCTGCAAaaggggggaatgccccctggat
KDN01_0035_E06.b : CCAATCGAGCTGATCTTCTACGTCCTGGTCTTCTGCAgagcgcggcatgcccctggatct
KDN01_0088_A07.b : CCAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAgaacgcggcagtgccctggaatc
KDN01_0059_C02.b : CAAATCGAGCTGATCTTCTACGTCCTGTTCTTCTGCAAA*AGGGCGGCAtggcccttgga
KDN01_0070_H01.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGGAAG*AGCGCGGCAagggccccggg
KDN01_0058_E10.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGAAAG*AGGGCG*CAGTGCCC*CTGG
KDN01_0095_A02.b : CCAATCGAGCTGATCTTCTACGTTCTGTCCTTCTGC*AG*AACGCGGCAGTGCCC*CTGG
KDN01_0061_A05.b : AAAATCGAGCTGATCTTCTACGTTCTGTCCTTCTGCAAG*AGCGCGGCAGTGCCC*CTGG
KDN01_0070_C02.b : AAAATCGAGCTGATCTTCTACGTCCTGGCCTTCTGCAAG*AGGGCGGAA*TGCCC*CTGG
KDN01_0043_B02.b : CAAATCGAGCTGATCTTCTACNGTCTGTCCTTTCTGCAG*AGCGCGGCAGTGCCC**TGG
KDN01_0070_B11.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTTCTGCAG*AGCGCGGCAGTGCCC*CTGG
KDN01_0067_B04.b : CAAATCGAGCTGATCTTCCTACGTCTGTCCTTCTGCAAG*AGCGCGGCAGTGCCC*CTGG
KDN01_0033_G03.b : CAAATCGAACTGATCTTCTACGTCCTGTTCTTCTGCAAA*AGCGCGGCAGTGCCC*CTGG
KDN01_0082_E05.b : CCAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAAG*AACGCGGCAGTGCCC*CTGG
KDN01_0058_B12.b : CAAATCGAGCTGATCTTCTACGTCCTGTTCCTCTGCAAG*AGCGCGGCAGTGCCCCCTGG
KDN01_0074_H04.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAAG*AGCGCGGCAGTGCCC*CTGG
KDN01_0088_B10.b : CCAATCGAGCTGATCTTCTACGTCCTGT*CTTCTGCAAG*AGCGCGGCATTGCCC*CTGG
KDN01_0083_A08.b : CAAATCGAGCTGATCTTCTACGTCCTGTTCCTCTGCAAG*AGCGCGGCAGTGCCC*CTTG
KDN01_0085_C06.b : CAAATCGAGCTGAATCTCTACGTCCTGTCCTTCTGCAAA*AGCGCGGCAGTGCCC*CTGG
KDN01_0063_B09.b : AAAATCGAGCTGATCTTCTACGTCCTGTCCTTTCTGCAG*AGCGCGGCAATGCCC*CTGG
KDN01_0076_B10.b : CAAATCGAGCTGATCTTCTACCGTCTGTCCTTCTGCAAG*AACGGGGCATTGCCC*CTGG
KDN01_0094_E01.b : CAAATCGAACTGATCTTCCTACGTCTGTCCTTCTGCAAG*AGCCGGGCAGGGCCC*CTGG
KDN01_0098_C10.b : CAAATCGAGCTGATCTTCTACGTCCTGGTCTTCTGCAAG*AGCGCGGCAGTG*CC*CTGG
KDN01_0090_A08.b : C*AATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCA*G*AACGCGGCAGTGCCC*CTGG
KDN01_0038_D12.b : CAAATCGAGCTGATCTTTCTAGTCCTGTCCTTCTGCAAA*AACGCGGAATTGCCC*CTGG
KDN01_0070_F07.b : CCAATCGAGCTGATCTTTCTACGTCTGTCCTTCTGCAGG*AGCGCGGCAGTGCCC*CTGG
KDN01_0067_E01.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCA*G*AACGCGGCAGTGCCC*CTGG
KDN01_0082_A07.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAAG*AGCGCCGCAGTGCCC*CTGG
KDN01_0097_B02.b : CAAATCGAGCTGATCTTCTACGTCTTGGTCTTCTGCAAGGAACGCGGCAGTGGCC*CTGG
KDN01_0013_B11.b : C*AATCGAGCTGATCTTCTACGTCCTGGTCTTCTGCAGA*AAGGCGGCAATGGCC*CTGG
KDN01_0098_B11.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCCGCAAG*AGCGCGGCAGTGGCC*CTGG
KDN01_0016_H12.b : CAAATCGAGCTGATCTTCTACGTCCTGGTCTTCTGCAAG*N*CGCGGCAGTGCCC*CTGG
KDN01_0034_D11.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCCTTCTGCAG*AGCGCGGCAGTGCCC*CTGG
KDN01_0025_G09.b : gctgatcttctacgtctgtcttctgcagaacgcggcagtgccctggaattgtcagctcat
KDN01_0005_D11.b : CAAtcgagctgatcttctagttcttgtccttcgcaaaaacccggcaatgccctgggaatt
KDN01_0005_G05.b : CCAATCGAGCTGATactctaagtcctgtcttctgcaagaaccgggagtggccctggnatt
KDN01_0032_G12.b : CAAATCGAGCTGAatcttctacgtctgttcttcttgcagaacgcggcaatgcccctggga
KDN01_0032_D09.b : CAAATCGAGCTGATCTctacgtcctgtcttctgcagaaggcggcagtgccctgggatcgt
KDN01_0023_E08.b : CCAATCGAGCTGATCT*CTACGTCctgtcttctgcaagagcgcgcagtgccctggcatct
KDN01_0034_D05.b : CCAATCGAGCTGATCTTCTACGTCtgtcctctgcaagacgcggcgtgcccctgcatctgt
KDN01_0051_C03.b : CAAATCGAGCTGATCTTCTACGTCCTGTCttctggaagaacgcgggatggccccgtggat
KDN01_0063_F08.b : CAAATCGAGCTGATCTTCTACTTCCTGTCttctgcaagaacgcggcaggcccctggaatc
KDN01_0019_F07.b : CAAATCGAACTGATCTTtacgtcctgtccttcggcaaaaagccggaatggccccgggatt
KDN01_0031_D01.b : CCAATCGAGCTGATTCTCTACGTCCTGTCCTTCccaagaccgcggaagtgcccctggaat
KDN01_0062_G03.b : CAAATCGAGCTGATCTTCTACGTCCTGTCTTTCTGCAgagcggcgcatgcccctgggatt
KDN01_0080_F12.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAAG*AGCGCGGCAGTGCCC*CTGG
KDN01_0074_A10.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGGAAG*AAGGCGGCAGTGCCC*CTGG
KDN01_0033_D10.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCT*CTGCAAG*AGCGCGGCAGTGCCC*CTGG
KDN01_0080_A04.b : CAAATCGAGCTGAATCTCTAACGTCTGTCCTTCTGCAAG*AGCGCGGCAATGCCC*CTGG
KDN01_0070_B12.b : CAAATCGAGCTGAATCTCTACGTCCTGGCCTTCTTGGAA*AAGGCGGCAGTGCCC*CTGG
KDN01_0011_B11.b : CAAATCGAGCTGATCTTCTACGTCCTGGTNTTTCTGCAG*AACGCGGCAATGCCC*CTGG
KDN01_0071_A09.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAAG*AGCGCGGCAGTGCCC*CTGG
KDN01_0041_D03.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAAG*AGCGCGGCAGTGCCC*CTGG
KDN01_0025_G06.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAAG*AGCGCGGCAGTGCCC*CTGG
KDN01_0001_E06.b : accccccccccaaaaggggggaaatttctacccgcccctcctttaaaaaaaagggggacc
KDN01_0009_C10.b : actggttttctactccggccttctgcaaaacccggcgtgccctggaacctgtaaccctat
KDN01_0019_G10.b : caagctgatcttctacgtctggccctctgaaaaagcggcaatgcccctggaattgtaaac
KDN01_0090_F07.b : atcgagctgatttctacgtctgtcttctgcagaacgcggcagtgccctggatctgtcacc
KDN01_0056_C02.b : CCAATCGAGCTGATCTctacgtcctgtcttctgcagagcgcggcagtgcccctggaactg
KDN01_0054_D09.b : CCAATCGAGCTGATCTCTTACGTCtgtcttctgcaagacgcggcatgcccctgggatctg
KDN01_0078_D11.b : CCAATCGAGCTGATCTctacgtctgtccttctgcagaacgcggaatgccctgggatctgt
KDN01_0029_B05.b : CAAATCGAGCTGATCTTCTACGTCCGGTCCTTTTGCAAA*AGCGggcaagtgcccctgga
KDN01_0082_F06.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAAG*AGCGCGGCAGTGGCC*CTGG
KDN01_0067_A11.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAAA*AGCGCGGCAATGGCC*CTGG
KDN01_0006_C05.b : CCAATCGAGCTGatttccacgtccgggccttctgaaaaacgcgggaatgcccctggaatt
KDN01_0028_F04.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAAG*AGCGCGGCAGTGCCC*CTGG
KDN01_0070_A01.b : CAAATCGAGCTGATCTTCTACGTCCTGGCCCTCTGCAAG*AACGCGGGCATGGCC*CTGG
KDN01_0045_A10.b : aattgagttgatcttctaactctgtgcctctgaaaaacggggcagggcccctggaattgt
KDN01_0046_C03.b : gagctgtcttctactccggtctttagaaaaagcgggagggccctggattctgtacctcac
KDN01_0048_H05.b : cgatcttctacttccgtccttctgtaaaatggggaatgcccctgaatctgtaaactcttc
KDN01_0052_H11.b : cccaaaccgaggtgattttctaccgcccggccctttcgcgaaaacaccggaaagggccca
KDN01_0046_A02.b : acgcctgccttcccaaaacggcggcgtgccctggaattgtaactcatcccttatgcctct
KDN01_0080_A10.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAAG*AGCGCGGCAGTGCCC*CTGG
KDN01_0005_C02.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAAG*AGCGCGGCAGTGCCC*CTGG
LVRM1_0142_D07.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAAG*AGCGCGGCAGTGCCC*CTGG
LVRM1_0138_H10.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAAG*AGCGCGGCAGTGCCC*CTGG
KDN01_0078_D12.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAAG*AGCGCGGCAGTGCCC*CTGG
KDN01_0064_F12.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAAG*AGCGCGGCAGTGCCC*CTGG
LVRM1_0139_C08.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAAG*AGCGCGGCAGTGCCC*CTGG
LVRM1_0127_E08.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAAG*AGCGCGGCAGTGCCC*CTGG
KDN01_0083_D04.b : CAAATCGAGCTGATCTTCTACGTCCTGTCCTTCTGCAAG*AGCGCGGCAGTGCCC*CTGG
20110601C-001908 : CATCTGTCAGCCTCATCCCCTACTGCCTCTCCCG*GGCCCTGGGCCAGCCCGACAAGAAG
---------+---------+---------+---------+---------+---------+ 1325
KDN01_0020_E10.b : aaattttaaaaaatggccccctaataaaaaaacaatccccaaaagaggggtctttttttt
KDN01_0059_E07.b : taaaaatatgccaataagaggcttagttttccactttagcaagaggaacaacaccccctt
KDN01_0079_G02.b : ctatggcctcccggggcctgggcacccaaaaaaaaatttgttaaaaagtggggctccaaa
KDN01_0097_H05.b : ccaaaaaaaattgtaaaaagggcctctcaaattaaaacaaacttccacgaaagggggctt
KDN01_0095_G09.b : ttgtaacctcatcccctatggctttccccggccctgggcagcccgaacaaaaacctggta
KDN01_0071_C10.b : gtcagctcatccctaatgcctctccngccctgggcagccgaaaaaaaatttgtaaacaat
LVRM1_0063_F05.b :
LVRM1_0156_E08.b :
LVRM1_0146_G11.b :
LVR01_0035_C06.b : taacgccggccatagacccccccgtaaaattcgctggtcaccctacccccctccccctag
LVRM1_0147_E05.b :
LVRM1_0086_B10.b :
LVRM1_0066_D02.b :
LVRM1_0083_H04.b :
LVRM1_0125_C04.b :
LVRM1_0011_E03.b :
LVRM1_0134_D10.b :
LVRM1_0045_E11.b :
LVRM1_0205_E03.b :
LVRM1_0189_B09.b :
LVRM1_0198_A04.b :
LVRM1_0185_D04.b :
LVRM1_0149_F08.b :
LVRM1_0118_D01.b :
LVRM1_0065_E06.b :
LVRM1_0089_E07.b :
LVRM1_0091_B06.b :
LVRM1_0117_H05.b :
LVRM1_0179_F11.b :
LVRM1_0202_F08.b :
LVRM1_0118_A12.b :
LVRM1_0077_F02.b :
LVRM1_0109_C06.b :
LVRM1_0069_E08.b :
LVRM1_0033_E07.b :
LVRM1_0151_B09.b :
LVRM1_0159_F07.b :
LVRM1_0157_B05.b :
LVRM1_0137_E07.b :
LVRM1_0032_H06.b :
LVRM1_0137_C07.b :
LVRM1_0156_H10.b :
LVRM1_0139_A11.b :
LVRM1_0146_H08.b :
LVRM1_0002_G07.b :
LVR01_0026_D01.b : gccggggcgcagggcgcccccgtggggatttcttgtttacaccccctccttcccccccct
LVR01_0038_C05.b : ccccccggggaattttgtttcccccccccctcccccccaatggtcccctcccccccgggg
LVR01_0033_A07.b : ggaaatggcccccctggggcttttgttgtcaacccccccattcccccccaacaggccccc
LVR01_0073_G12.b :
LVR01_0065_A07.b : gcat
LVRM1_0175_D04.b :
LVRM1_0024_D05.b :
LVRM1_0199_F06.b :
LVRM1_0115_G05.b :
LVRM1_0050_G05.b :
LVRM1_0091_C09.b :
OVRM1_0211_G03.b :
ITT01_0068_C02.b : tccctaagcctttccaggcttggccaaccaaaagagacttgtaacgatgtgggccccatt
LVRM1_0170_G04.b :
LVRM1_0181_G10.b :
LVRM1_0194_G02.b :
LVRM1_0016_G12.b :
LVRM1_0112_C05.b :
LVRM1_0042_H01.b :
LVRM1_0037_B08.b :
LVRM1_0053_H09.b :
LVRM1_0125_G05.b :
LVRM1_0013_E10.b :
LVRM1_0035_G04.b :
LVRM1_0053_C10.b :
LVRM1_0006_H02.b :
LVRM1_0122_C07.b :
LVRM1_0137_D05.b :
LVRM1_0050_H09.b :
LVR01_0054_H01.b :
LVR01_0085_G03.b : agtgccccctggggattcctgggtaacccccccactccccctttcctggcccccttcccc
ITT01_0021_E05.b : GATCTGTCAGCCTCATCCCCTANTGGCTCTCCaaggcctgggncaaccngaaagaaaaac
KDN01_0019_B12.b : tcccaagggctttccgggccctgggccccccaaaaaaaaattttaaacaaaggtggcccc
KDN01_0031_E05.b : tgccttccgggcctgggcaaccgaaaaaaatttgaaaaaagtgcgcctcatttgaaaaaa
KDN01_0051_E03.b : ccctatgcctctccgggcccggggccgcccaaaaaaaaatttaaaaaaatgggcgcctaa
KDN01_0070_H04.b : atcccaatggctccccgggcctgggcacccaaaaaaaacttttaaacaagggggtcccca
KDN01_0030_A10.b : catccccaatgcctctccgggccctgggcagcccaaaaaaagactttgtaaaaaaggggc
KDN01_0007_E10.b : cctactgctcttcgggcctgggcacccgacagaaacttgtaaaaagtgggtcccctatta
KDN01_0014_B11.b : tccctacggctctccggggcctggggcacccgaaaaaaaattgtaaacaatggggtcctc
KDN01_0010_F12.b : catccctactgctttccgggccctgggcagccgaacaaaaacttggaaacgaattgggtc
KDN01_0005_B01.b : actcatccctaatggcttcccggggcttgggcagcccgaaaaaaactttgaaaaaattgg
KDN01_0081_D10.b : gtaaccttatcccctatggctcttccgggcccttggccaccccaaaaaaaaattgtaaaa
KDN01_0073_F09.b : ctcatccctactgctcttcgggccctgggcagccgacaagagacttgtaaacgatgtggc
KDN01_0076_D08.b : cctcatccctatggctttccgggcccgggcccccccggagaaaacttgaaaacaatgggg
KDN01_0009_G04.b : tcatccctactgctctccgggccttggcaccgaaaaaaaacttgaaacaattggcgtccc
KDN01_0012_A04.b : catccctactgctcttcggggcttgggcaagcgaaaagaaactttgaaaagatttgggtc
KDN01_0039_D10.b : ggtcagcctatcccctaatgcctttcccgggcctgggccagcccgaaaaaaaatttgtaa
KDN01_0073_E11.b : gtcaccctatcccctaatgcttctccgggccttgggcaacccaacaaaaaaactttgaaa
KDN01_0100_E01.b : tcacctcatccctactggctctccggggcctgggcaaccgacaaaaaacttggtaacgaa
KDN01_0020_F07.b : ggaacccttttcccctaaggccttccccggcccgtggccccccccaaaaaaaaatttgaa
KDN01_0067_G04.b : aanctcatccctaatgctcttcggggcctgggcaaccgacaaaaacttgtaaacgatgtg
KDN01_0088_F03.b : gtaactcatccctaatgcctttcggggccgtgggcacccgacaagaaattgtaaacgagt
KDN01_0012_D02.b : tgcaacctcatccctactggctctccgggccttgggcaaccgaacagaaaacttgtaaac
KDN01_0012_B07.b : cagctcatcccctctgcctttccggggcctgggccaccgaacaaagacttttaaaagatt
KDN01_0074_A08.b : tgtcacctcatccntactgccttcccgggcctgggccagccgacaaaagatttgtaaccg
KDN01_0030_D06.b : tgttaactcatccccaatgcctttccgggccctgggcagcccaaaagaaaaattgtaaca
KDN01_0074_D07.b : tgtcagctcacccctactgcttctccgggccctggccagcccgacagaaaacttgtaaac
KDN01_0021_F03.b : caactcatccctactgctctccggggcctgggcagcggaaaaaaaacttgtaaaaatgtg
KDN01_0064_E10.b : gtcagctcatcccctatggctctccgggccctgggcacccgaccaaaaacttgnaaacga
KDN01_0093_G03.b : tgttagctcatccctaatgcctctccgggcccggggcagccgacaaaaaactttaaacaa
KDN01_0032_A07.b : tgtaactcatcccctatgccttccggggcctgggcaacccgaaaaaaatttgaaaccgag
KDN01_0079_E10.b : tgtacctcatccctattgccttcccgggccctgggcagcccgaaaaaaaactttgaaaca
KDN01_0090_H01.b : ctgtaacctcatcccctactgcttttccgggccctgggccaccccaacaaaaaatttgta
KDN01_0024_H11.b : gtcagctcatccctaatggctttccgggcctgggccagccgaaaggaaacttgtaaaaaa
KDN01_0024_A11.b : tctgcagcctcatcccctaatgcctttccgggccctgggccaccccgaaaaaaaactttg
KDN01_0035_E08.b : tgtcagctcatccctactgcntttccgggccttgggcaagcgacaaaagacttgtaaacg
KDN01_0069_H07.b : ttggtcaacttctcccctaatggcttcccgggccctgggccagcccaaaaaaaaattttt
KDN01_0035_E06.b : gtcagctcatccctactggctctcggggcttgggcagaccgacagaaaacttgtaaacga
KDN01_0088_A07.b : tgtacctcatccctaatgctcttccgggcctgggcaaacggacaagaaactttgaaacaa
KDN01_0059_C02.b : tcttgtaacctcatccctaatgcctctccgggccttgggcagcccaaaagagaattgtaa
KDN01_0070_H01.b : attctgtcaccctatcccctaatgcctcttccggggcctggggccgcccggaaagaaaaa
KDN01_0058_E10.b : AATCTGTCAGCttatcccctattgcctctccgggcctgtgggcaccccgacagaaaattt
KDN01_0095_A02.b : CATCTGTCAACCTCATCCCtaatgcttttccgggccttgggcagcccgacagaaaaattg
KDN01_0061_A05.b : AATCTGTCAGCCTCATCCCCTAtgcctttccggggcttggggcaggccgacagaaaaact
KDN01_0070_C02.b : AATCTGTTAGCCTCTTCCCCTAtggcttcttccggggctggggccacccgaaaaaagaac
KDN01_0043_B02.b : CATCTGTCAGCCTCATCCCtactggctctccggggccctgggcaacccgacagaagactt
KDN01_0070_B11.b : AATCTGTCAGCCTCATCCCCTAggcctcctccggggcctgggcagcccgaacaaaagaac
KDN01_0067_B04.b : AATCTGTCAACCTCATCCCCTACTGCttttccggggcctggncagacccgacagaagact
KDN01_0033_G03.b : GATCTGTTCACCTCATCCCTTACTGCCTCTCCgggccctgggccacccgaacaaaaagac
KDN01_0082_E05.b : GATCTGGTCAGCTCATCCCNTACTGCCTCTCCgggncctgggncagcccgaaagaagaat
KDN01_0058_B12.b : GATCTGTCANCTTCATCCCCTAATGGCTCTTCCG*GGgccctgggccagcccaacaaaaa
KDN01_0074_H04.b : GATCTGTCAACCTCATCCCCTACTGCTTCTCCGG*GGCCtgggcaacccgacaaaaactt
KDN01_0088_B10.b : CATCTGTCAACCTCATCCCCTATTGCTTCTCCGG*GGCCtgggcaaccccgaaaaaaaaa
KDN01_0083_A08.b : CATCTGTCACCCTCATCCCCTACTGCCTCTCCGG*GGCCtgggccagtccaacaaaaaac
KDN01_0085_C06.b : CATCTGTCAGCTTCATCCCNTACTGCCTCTCCGG*GGCCtggncagccngacaagaaaaa
KDN01_0063_B09.b : AATCTGTCAGCCTCATCCCCTACTG*CTCTCCCG*GGCCCTGGGgcacccngacagaaaa
KDN01_0076_B10.b : GATCTGTCAATCTCATCCCTTACTGCCCTCTCCG*GGCCCTGGGCCAcccgaacagagaa
KDN01_0094_E01.b : AAT*TGTTAACCTCATCCCCTAATGCCTCTCCGG*GGCCCTGGGCCAcccaacaaaaaaa
KDN01_0098_C10.b : CATCTGTCAACCTCATCCCCTACTGCCTTTCCCG*GGCCCTGGGCCAcccgaacagagac
KDN01_0090_A08.b : GATCTGTCAGCCTCATC*CCTAATGCCTCTCCCG*GGCCCTGGGCCAcccgacaaagaat
KDN01_0038_D12.b : GATCTGGTAGCCTCATCCCCTAATGCCTTTCCCG*GGCCCTGGGCCAACCCcaaaaaaaa
KDN01_0070_F07.b : NATCTGTCAGCCTCATCCCCTACTGGNCTCTCCG*GGCCNNTGGGCAGCCCGACAAaaga
KDN01_0067_E01.b : CATTTGTCAGCTTCATCCCCTACTGCTTCT*CCG*GGCCCTGGGNCAGCCCGACAAaaaa
KDN01_0082_A07.b : AATC*GTCAGCCTCATCCCCTAATGCCTCTCCCG*GGCCCTGGGCCAGCCCGACAAaaaa
KDN01_0097_B02.b : CATCTGTCAGCCTCATCCCCTAATTCCTCTCCCGGGGCCCTGGGCCAGCCCGACAAGAAG
KDN01_0013_B11.b : AATCTGTAAACCTCATCCCCTAATGGCTCTCCGG*GGCCCTGGGCCCGCCCGAaaaaaaa
KDN01_0098_B11.b : GATCTGTCAGCCTCATCCCCTAATGGCTTCCCCG*GGGCCTGGGCCACCCCAACAAGAAA
KDN01_0016_H12.b : NATCTGTCAGCCTCATCCCCT*CTGCCTCTCCCG*GGGCCTGGGCCAACCCGACAAGAAG
KDN01_0034_D11.b : CATCTGTCAGCCTCATCCCCTACTGCCTCTCCGG*GGNCCTGGGNCAGCCCGACAA*AAG
KDN01_0025_G09.b : ccctaatgctctccgggcctgggccacccgaacagagacttgtaaaaaatgggctcctaa
KDN01_0005_D11.b : gtaaacctttttccctatggccttccggggcttggggccacccaaaaaaaaattttgaaa
KDN01_0005_G05.b : gttagcttcatccctattgctccccggggcttgggcaaccgaaaaaaacttttaaaaaat
KDN01_0032_G12.b : tttgttaagctcatcccctaatggtcctcccgggcctgggccaaccggaaaaaaaaactt
KDN01_0032_D09.b : aagctcatcccttatgctctccgggcctgggcacccaacaaaaaacttgtaaaaagggcg
KDN01_0023_E08.b : gtagctcatccctatgcctctccgggcccggggcagccgaaagaagattttaaacgatgt
KDN01_0034_D05.b : cagctcatccctactgcttctccgggcctgggcacccgacaaaaaacttgtaacagatgt
KDN01_0051_C03.b : ctgtaaccctattccttantgcctttccggggcctgggccaccccaaaaaaaactttgaa
KDN01_0063_F08.b : gtcaacctcatccctaatggctctccggggcctggggccgcccgacaagaaactttgtaa
KDN01_0019_F07.b : ggttaacctcttccctaatgccttccgggggcctggggcaccccaaaaaaaaacttggaa
KDN01_0031_D01.b : ctggtaacttattccctactgcctctcccgggccctgggccaacccaaaagaaaactttg
KDN01_0062_G03.b : gtcagctcatccctactggctctccgggcctggggcagcccgaaaaaagatttgtaacaa
KDN01_0080_F12.b : CATCTGTCAGCCTCATCCCCTACTGgcctctcccgggcccgtggncagcccgaacagaaa
KDN01_0074_A10.b : GATCTGTCAACCTCATCCCCTACTGCCTCTCCgggncctgggcacaccgaaaagaagact
KDN01_0033_D10.b : CATCTGTCAGCCTTATCCCCTACTGGCTCTCCgggccctgggccacccgaacagaagact
KDN01_0080_A04.b : AATCTGGCAGCCTCATCCCCTA*TGCCTCTCCCG*GGCCCTGGGCagcccaaaaaaaaaa
KDN01_0070_B12.b : GATCGGTCAGCCTCATCCCCTAATGCNTCTCCCG*GGCCCTGGGGCAGCCgaaaagaaga
KDN01_0011_B11.b : CATCTGTCAGCCCTATCCCCTACGTGCTCTCCGG*GGCCTTGGGGCAACCCGACAAaaaa
KDN01_0071_A09.b : NATCTGTCAAGCTCATCCCCTACTGGCTCTCCCG*GGGCCTGGGGCAGNCCGACAAGAAA
KDN01_0041_D03.b : NATCTGTCAGCCTCATCCCCTACTGGCTCTCCCG*GGCCCTGGGCCAGCCCGACAgagaa
KDN01_0025_G06.b : GATCTGTCAGCCTCATCCCCTACTGCTTCTTCCG*GGGCCTGGGNCAACCCGAACAGAAA
KDN01_0001_E06.b : cccccgttttttttaaacccccccattttgttccccgggggggggggggcccccaaaaaa
KDN01_0009_C10.b : ccccaatggctctcggggcccgggcaacccgaaaaaaaacttgtaaacaaggggctccta
KDN01_0019_G10.b : ctcatccctaatggctttccggggcctgggcaacccaaaaaaaaattttaaaacaattgg
KDN01_0090_F07.b : tcatccctactgctctccggggcctgggcanccgacaaaaacttgttaacaatttgctcc
KDN01_0056_C02.b : tcagctcatccctactgctctcccggccctgggcagcccgacaaaaaatttgtaaaaaag
KDN01_0054_D09.b : tagctcatccctactgctccccgggcctgggcagccgaaaaaagatttgaaacgatgtgc
KDN01_0078_D11.b : cacctcatccctaatgcttctccgggccctgggcaacccgaaaaaaaatttgaaaacgat
KDN01_0029_B05.b : atttgtaagcctatcccctaatggcttcccgggccttgggcaaccgaacagaagaacttg
KDN01_0082_F06.b : NATCTGTCAGCCTCATCCCCTACTGCTTCTCCgggccctggggcagccgacagaagaatt
KDN01_0067_A11.b : CATCTGTCAGCCTCATCCCCTAAGGCTTCTTCCG*GGCCGTGGGCCAGCCCGAacaaaga
KDN01_0006_C05.b : tgtaaccctatccctaatgctttccggggcctgggcaccccaaaaaaaaattttaaaaca
KDN01_0028_F04.b : CATCTGTCAGCCTCATCCCCTACTGCCTCTCCCG*GGCCtggncaaccnngacagaagac
KDN01_0070_A01.b : GATTCTGTAACCTCATCCCCTATGGCCTCTCCGG*GGCCCTGGGCCAcccgaacaaaaaa
KDN01_0045_A10.b : aaacctatccctaatgctttcccggggcgtgggccacccaaaaaaaaatttgaacaaatg
KDN01_0046_C03.b : cctatggcttccgggccttggccgccgacagaaaatttaaaaaatggctccaaatttaaa
KDN01_0048_H05.b : cctatgccttccggtgcctgggcctccaaaaaaaaatttaaaagagtgggccttcctatt
KDN01_0052_H11.b : tgggatatctgtaaccctctccccataatggctcctcagggccctggggccaccctaaaa
KDN01_0046_A02.b : ccgggcctgggcaaccaaacaaaaaattgtaaaaagttggcccaaatttaaaacaaaaag
KDN01_0080_A10.b : CATCTGTCAGCCTCATCCCCTACTGCCTCTCCCG*GGCCCTGGGCCCAGCCGACAAGAAG
KDN01_0005_C02.b : CATCTGTCAGCCTCATCCCCTACTGGCTCTCCCG*GGCCCTGGGCCAGCCCNGACAGA*G
LVRM1_0142_D07.b : CATCTGTCAGCCTCATCCCCTACTGCCTCTCCCG*GGCCCTGGGCCAGCCCGACAAGAAG
LVRM1_0138_H10.b : CATCTGTCAGCCTCATCCCCTACTGCCTCTCCCG*GGCCCTGGGCCAGCCCGACAAGAAG
KDN01_0078_D12.b : CATCTGTCAGCCTCATCCCCTACTGCCTCTCCCG*GGCCCTGGGCCAGCCCGACAAGAAG
KDN01_0064_F12.b : CATCTGTCAGCCTCATCCCCTACTGCCTCTCCCG*GGCCCTGGGCCAGCCCGACAAGAAG
LVRM1_0139_C08.b : CATCTGTCAGCCTCATCCCCTACTGCCTCTCCCG*GGCCCTGGGCCAGCCCGACAAGAAG
LVRM1_0127_E08.b : CATCTGTCAGCCTCATCCCCTACTGCCTCTCCCG*GGCCCTGGGCCAGCCCGACAAGAAG
KDN01_0083_D04.b : CATCTGTCAGCCTCACCCCCTACTGCCTCTCCCG*GGCCCTGGGCCAGCCCGACAAGAAG
20110601C-001908 : ACTTTGTAGACAGATGTGGCGTCCTCAGTATTGAAAGACGATGACTGTGCCAAGGATAGA
---------+---------+---------+---------+---------+---------+ 1385
KDN01_0020_E10.b : cccccttttagaaagagaaaacaaaaaccccc
KDN01_0059_E07.b : ccttatgtgggaatttagaggtttaacttaagggggtgctcccctatatttataaaaaat
KDN01_0079_G02.b : tttaaagacaaaacggtcc
KDN01_0097_H05.b : tgcttttccccccttgggcaaggttaaaaccccaacctccctttcttttgtggggggaat
KDN01_0095_G09.b : aacaaagtggctcctaaatatgaaaaccataatgtcccaggaaaagggggccttaagctt
KDN01_0071_C10.b : ggggttctcaaattgaaaacaataatggccaagaagaagggggttccagcttttctgcac
LVRM1_0063_F05.b :
LVRM1_0156_E08.b :
LVRM1_0146_G11.b :
LVR01_0035_C06.b : ttagcctccctcccccgcggggcccccgctggggggcactacacacccccaaccaacaag
LVRM1_0147_E05.b :
LVRM1_0086_B10.b :
LVRM1_0066_D02.b :
LVRM1_0083_H04.b :
LVRM1_0125_C04.b :
LVRM1_0011_E03.b :
LVRM1_0134_D10.b :
LVRM1_0045_E11.b :
LVRM1_0205_E03.b :
LVRM1_0189_B09.b :
LVRM1_0198_A04.b :
LVRM1_0185_D04.b :
LVRM1_0149_F08.b :
LVRM1_0118_D01.b :
LVRM1_0065_E06.b :
LVRM1_0089_E07.b :
LVRM1_0091_B06.b :
LVRM1_0117_H05.b :
LVRM1_0179_F11.b :
LVRM1_0202_F08.b :
LVRM1_0118_A12.b :
LVRM1_0077_F02.b :
LVRM1_0109_C06.b :
LVRM1_0069_E08.b :
LVRM1_0033_E07.b :
LVRM1_0151_B09.b :
LVRM1_0159_F07.b :
LVRM1_0157_B05.b :
LVRM1_0137_E07.b :
LVRM1_0032_H06.b :
LVRM1_0137_C07.b :
LVRM1_0156_H10.b :
LVRM1_0139_A11.b :
LVRM1_0146_H08.b :
LVRM1_0002_G07.b :
LVR01_0026_D01.b : aacgtgtccccttcccccccgggggcccccccctgggggggcccccacccccccccccaa
LVR01_0038_C05.b : gcccccgtgggggcccccacccccccccaaaaaaaaaaaaaaaaaaaaaaaacttatttt
LVR01_0033_A07.b : cccctcccccggggggcccccctggggggcccccaccccccccccaaaaaaaaaaaaaaa
LVR01_0073_G12.b :
LVR01_0065_A07.b :
LVRM1_0175_D04.b :
LVRM1_0024_D05.b :
LVRM1_0199_F06.b :
LVRM1_0115_G05.b :
LVRM1_0050_G05.b :
LVRM1_0091_C09.b :
OVRM1_0211_G03.b :
ITT01_0068_C02.b : attaaaaaataagtgccaggaaaaggggcttctagtttctccacccttttgaccaaggca
LVRM1_0170_G04.b :
LVRM1_0181_G10.b :
LVRM1_0194_G02.b :
LVRM1_0016_G12.b :
LVRM1_0112_C05.b :
LVRM1_0042_H01.b :
LVRM1_0037_B08.b :
LVRM1_0053_H09.b :
LVRM1_0125_G05.b :
LVRM1_0013_E10.b :
LVRM1_0035_G04.b :
LVRM1_0053_C10.b :
LVRM1_0006_H02.b :
LVRM1_0122_C07.b :
LVRM1_0137_D05.b :
LVRM1_0050_H09.b :
LVR01_0054_H01.b :
LVR01_0085_G03.b : cgggggcccccgggggggccccacaccccccgcaaaaaaaaaaaaaaaaaaaaatttttt
ITT01_0021_E05.b : ttgtaaacgatgtggcgtcctcctatgaaagacaagactgttcaaggaaaaaaggtggct
KDN01_0019_B12.b : aaatatgaaaaaaaaactgtccaagaaaagggggttttaggtttttccaccccttttggg
KDN01_0031_E05.b : gaagggcaagaaaggggggttcagcctttcgccccctttgagcagaggcaaaaaatcaaa
KDN01_0051_E03.b : gatttaaaaaaaaaatggccaggaaaagggtggttcaggtttttgcaccccttttgggcc
KDN01_0070_H04.b : ttttaaacaaataacggccaagaaaagggggtttcagtttttctgcccccttttagccaa
KDN01_0030_A10.b : ggcccaattttgaaaacataaagggccaaggaaaagggtgccttaggctttttgcccccc
KDN01_0007_E10.b : aaacatactggcaggaaaaggggctctagtttcgcccccgtttggcaagggtaaaaatca
KDN01_0014_B11.b : atattgaaaaaaataatgtccaggaaaaaggggcttctaggttttgcccccctttgagcc
KDN01_0010_F12.b : ccctattgaaaacaacactggcaaggaaaaaggggcttttagctttctgccaccttttgg
KDN01_0005_B01.b : gctcctatatttaaaaaaataacggcccagaaaaagggggctccaagtttttgcccccct
KDN01_0081_D10.b : agaggtggggccccaatattaaaaacaataactgggcaagaaataagggggtctctaggt
KDN01_0073_F09.b : gtctaatatgaaaaacaagactggcaaaggaaagggggctttaagcttcctgcaccgttt
KDN01_0076_D08.b : gtcccattttgaaaacatcatgtccaggaaaaagggggttcaggtttttgccaccctttg
KDN01_0009_G04.b : aaatgaaaacaatatggccaggaaaaggggcttcagcttctgcaccgtttgggccagggt
KDN01_0012_A04.b : taatttgaaaacataacgtgcaagaataagggcgcttagcttttcgccaccgtttgagcc
KDN01_0039_D10.b : aaaaatgtggggtcccctttttgaaaaaaaagaggggccaagaaaaagggggctttctag
KDN01_0073_E11.b : caattgtgcctcttaaaatttgaaaaccaaaactgtgccaggaaaaaggggcttcttagc
KDN01_0100_E01.b : gtggggcctaaatttgaaaacaatactggtccaggaaaaagggggctccaggcttttcgc
KDN01_0020_F07.b : aaaaatgggcccctcctattaaaaaacaaacgggcccagaaaaaggggggttcaagcttt
KDN01_0067_G04.b : gctcttcttatgaaaacaagactgtgcagnaaaaagtgcttctaggctttcgcacccgtt
KDN01_0088_F03.b : tgcgtctaatatgaaaaaaatgatgggcaaggaaagggtgcttcaggttttcgccacccg
KDN01_0012_D02.b : aatgtggcttctaatattgaagacaaaacggtgcaagaaaaaggtgcctctagctttctg
KDN01_0012_B07.b : tggcccctaatattaaaaaaatcacggtccaggaaagaggggcttcagctttctgcaccg
KDN01_0074_A08.b : tgggggtcctaatattgaaaaacatactgggcagggaaaagggggctctaggttttctgc
KDN01_0030_D06.b : aaggtgcgtcctcntatttaaaacaagactggcccaggaataaggggctctctagcttcc
KDN01_0074_D07.b : gatgggcgtcctcattatgaagacaagacgggccaggataaagtgggttccagctttctg
KDN01_0021_F03.b : cgtcccccaatgaaaacataatgtgcaggataaagggggttaagctttcttcnanccttt
KDN01_0064_E10.b : attgggctcttcanattgaaaacaatgatgtccaagaataagggggtttcaggcttttgc
KDN01_0093_G03.b : atgggcgcctaatttgaaaaaataactggccaggaaaagggggttcaaggtttttgcccc
KDN01_0032_A07.b : tggcgtccaatttgaaaaacatacgggcaagaaaagggggcttctagctttcgccccccg
KDN01_0079_E10.b : aggggcgtcccaaatatgaaaaacatgactgtccaagaaaagggggctttaaggtttctg
KDN01_0090_H01.b : aaagaagtggccccctcatattaaaaaccaaactgtgccaagaataaagggggtttcaag
KDN01_0024_H11.b : agtgggtcctaatattgaaaacataattggccagataaagggggtttcagctttcttccc
KDN01_0024_A11.b : taacaaaggggcgcctcaaattgaaaaacataatggtcccaggataaagggggcttcaag
KDN01_0035_E08.b : atgtggcgtctaatattgaaaacatacgggccaggaaaaggggntttcagcttttctgca
KDN01_0069_H07.b : aaaaaaaggtggctcctaaattttgaaaacaataacgggtccaagaaaaaagggggcctt
KDN01_0035_E06.b : tgtgcgtctcnaatgaaagacatactgggcaaaataaggtggctctaagctttcgcaccc
KDN01_0088_A07.b : tgggctcctcctattgaaaacaatagggccaagaataaggggccttcaggttttccccac
KDN01_0059_C02.b : aacgaggggctccttcntatggaaaacatgatggccaggaataaggggcttcaggtttct
KDN01_0070_H01.b : tttgttaacaaattgggggcctccaatatgaaaaaaaataactgggccaggataaagggg
KDN01_0058_E10.b : gaaaaagaggggccgctctaaaatttaaaaaaatactgggccaagataaagggggttcta
KDN01_0095_A02.b : gaaacgatgtgccgtcctattttgaaaaaaatgatggtccaaggaaaaaggtggttctag
KDN01_0061_A05.b : tgttaaagatggtgcgtcttaatattgaaaacaatactgggcaggaatgagggggttcta
KDN01_0070_C02.b : tttgaaaacgaatgtggcgtctcaatattgaaagaacattactgtgccaagaataaaggg
KDN01_0043_B02.b : gtagacgatgtggcgtcctaatattgaaaacaagactggccaagataaaggtggctctag
KDN01_0070_B11.b : ttgtaaaccgatgtgccgtcctaattatgaaagaaaatgacgtgcccaagaaaaaggtgg
KDN01_0067_B04.b : ttgtaaaagatgtggcgtcttaattatgaaagacatgactgtgcaggattaaantggctt
KDN01_0033_G03.b : tttgaaacagaaggggcgtcctaattattgaagaaaatgatgtgcccaagaaaaaggtgg
KDN01_0082_E05.b : tgnaaaccaatgtgccgtctaattattgagaacatgactgtgcaagaataagggggctct
KDN01_0058_B12.b : aactttggtaaacgaagttggggtcctcaatattgaaaaacaatacgtgtccaggataaa
KDN01_0074_H04.b : tgtaaacgatgtgccgtctaattatgaaaacaattacgggtcaggataaaggggcttcaa
KDN01_0088_B10.b : cttgtaaacaaagggggtcctaaaaattaaaaaacaaaatgttccaggaaaaagggtgct
KDN01_0083_A08.b : tttgtaaacgatgtgcgtcctccatattgaaaaaaataactggccaaggataagggggct
KDN01_0085_C06.b : ttgtaaacgaatttgcgtctaatattaaaaactataagggccaaggaaaagggtcttcaa
KDN01_0063_B09.b : cttgtaaaaggaggtgcgtcctcatattgaaaaaaattacgtgccaaggataaaggtggt
KDN01_0076_B10.b : tttggtaacaaagggccttcttaattatgaaaaacatgactggccaaggataaagttggc
KDN01_0094_E01.b : ttttgaaaacaatgtggcgtccaaattttaaaaacaataacgggccaaggataaaggggg
KDN01_0098_C10.b : tttgtaaacgatgtggcgtcctcatatttgaaacaatgacggcccaaggaaaagggggct
KDN01_0090_A08.b : ttggtaaacgatgtggcgtcctcattatgaaaacnataatgtgccaggaataaaggtggt
KDN01_0038_D12.b : aaatttgtaaacagatgggcggtccccaaaattgaaaaaacataactgggcccaggaaaa
KDN01_0070_F07.b : cttgttaaacgatgtggcgtcctagtattgaaaacaagactgggccaggaaaaagggtgg
KDN01_0067_E01.b : ctttgtaacagatgtggcgtctaattattaaaaacaagacctggccaggaaagaggggct
KDN01_0082_A07.b : atttgtaaacggatgtggcgtcctcantattgaagaccatgacgggccaaggaaaagggt
KDN01_0097_B02.b : Aactttgtaaacggagtgggcgctcctcctatttnaaaaacaataactgtgccaagaata
KDN01_0013_B11.b : acattgttaaaccgagtgtggcgcctcctaattgaaaaaaaataacgggcccaagaataa
KDN01_0098_B11.b : ATTTTGTAaaagaatggggcgtcttcattattgaaaaacaataccgtgtccaggaaaaaa
KDN01_0016_H12.b : Atttggaaaaggaatggggggtcttcatttattaaaacaaataactgggccaggaaaaaa
KDN01_0034_D11.b : ACTTTGTAGACAAATGTGGCGTCCTCAttatgaaagagatgaacggggcagggaataaan
KDN01_0025_G09.b : aattgaaaacaagactggccaagaataagggggctcaggtttttgcccccgtttgggcca
KDN01_0005_D11.b : acaatgtgggccctcctttttaaaaacaatacggcccaggaaaaagggggtctctagctt
KDN01_0005_G05.b : gtgcctcccaatataaaaaaataacggccaagtaaaaaggggcttctagttctcgccccg
KDN01_0032_G12.b : gtaaacaaattgggggccctcaaattaaaaaacaaaaatgggccaagaataaggggggct
KDN01_0032_D09.b : tcctaatatgaaaacaagatgggccaggataaaggggctccaagctcctggccccgtttt
KDN01_0023_E08.b : ggctcctantatgaaaaagaagatgtccaggaataagggggtctaggtttctgcgctaaa
KDN01_0034_D05.b : gcgtctcatattgaagaaaaaactgtgcaaggataaggtggctcaagctttctgcaccgt
KDN01_0051_C03.b : acgaagtggcgtccccatattgaaaacaataactgggcaagaaaaaggggcttctaggct
KDN01_0063_F08.b : agaattggcttctaataatgaaaacaatgatgggcaaagaataaggtggcttctagcttt
KDN01_0019_F07.b : acaaaggggccccctaatttgaaaaaaaaaaagggccaaggaaaagggggtttcaggttt
KDN01_0031_D01.b : aaaaaaatgtgcggcctcctattgtaaaacaaaaatgtgccaggaaaagagggggtttct
KDN01_0062_G03.b : atgggcgtcctatattgaaaacaatactgtgccaggaaagggggttctagcttcctgcga
KDN01_0080_F12.b : aatttgtagaacaaagtggggttcctaaatatttaaaaaacaatactgtgcccaggaaaa
KDN01_0074_A10.b : ttgtaaacgatgtggcgtcctcatattgaaaaacaataacgtggcaaggaaaaagggggc
KDN01_0033_D10.b : tgtaaacggatgtggcgtcctantattgaaagacaaggatgggcccaggataaaggtggc
KDN01_0080_A04.b : ctttgttaaacgatgtgccctctcattattgaagacaaataagggccaaggataaagggg
KDN01_0070_B12.b : acttggtaaacaaatgttgccccctaaatattgaaaacaatgaatggtccaaagaataaa
KDN01_0011_B11.b : atttgtaaaccaagtggcggtcctaatattgaaaacaataacggtccaggaaaaaggggg
KDN01_0071_A09.b : ACTTTGaaacgaatgtggcgtcttaatattgaaaaaacatgactgtcccaggaaagaggt
KDN01_0041_D03.b : ctttgaaaangaatgtgcgtcttaatatgaaagaccatgatgtgccaaggaataaagggg
KDN01_0025_G06.b : AACTTGTAAACAGATGTGGCGgtctaatttattgaaaaacnatgattgtgcaagggataa
KDN01_0001_E06.b : aatttttttaagggggggcgccccctccattaaaaaaaaaaccccccccccaaaaggggg
KDN01_0009_C10.b : ttttaaaaaaagaatggccagaaaaaggggctcagctttttccccccgtttagcccaagt
KDN01_0019_G10.b : gctccaaatattaaaaacaaaacttgccaggaaaaggggggtttaaggttcttgccaccc
KDN01_0090_F07.b : tcataatgaaaacaacatggccaaggaaaaggggcttctagcttctgcaacccttttagc
KDN01_0056_C02.b : tgcgtcctcaaattgaaacaagatgtgcaagaaaaggtgcttaagcttttcgcaccgttt
KDN01_0054_D09.b : gtctaatatgaaaacatgatggcccagaaaaggtgcttctagtttttgccaccctttgag
KDN01_0078_D11.b : gtgcgtctcaatatgaaaaacatcatgggccagaaaaaggtggtttcagcctttccgcca
KDN01_0029_B05.b : taaacaaccggcggtcctaattttgaagaccaatattgtgccaggaaaaggggggcttca
KDN01_0082_F06.b : gtagacagatgtgccgtcctaataattaaagaaataactgtgcaagaataaggtggcttc
KDN01_0067_A11.b : ctttggaaaaagatgtggcgtcctcaatattaaaaaacaataactgtcccaggaataaga
KDN01_0006_C05.b : agtgggccccaaattttaaaaaaaaactggcccagaaaaagggggcttaggttttcgccc
KDN01_0028_F04.b : ttggaaaaggagtggcgtcctaagtatgaaaacaatgatgtgcaaggataaagggggctc
KDN01_0070_A01.b : actttgtaaacgaatgggggtccctaattttgtaaaccattacggtgccaaggattaagg
KDN01_0045_A10.b : gggcccctaatattaaaacaatactgccaagaaaaagggggtttctagtttctgcccctt
KDN01_0046_C03.b : aaaatatgttcagagaaaggggtcttagttttcccccctttgacaaagggtaaacatcaa
KDN01_0048_H05.b : aaaaaatactgggcaggataaggtggtttaagttattcccccctttgggacaaggagtaa
KDN01_0052_H11.b : aaataaatttttagaaaaatggggcgtccccaaatttaaatagaaaaaaatatgtgtcca
KDN01_0046_A02.b : tgcaagaaaagggggtttaagtttttgcaccctttagacaaaggcataaaactaaacctc
KDN01_0080_A10.b : ACTTTGTAGACAGAAGTGGCGTCCTCAGTATTGAAAGACGATGACTGTGCCAAGGATAGA
KDN01_0005_C02.b : ACTTTGTAGACAGATGTGGCGTCCTAAGTATTGAAgacgatgactgtgccnagatagaag
LVRM1_0142_D07.b : ACTTTGTAGACAGATGTGGCGTCCTCAGTATTGAAAGACGATGACTGTGCCAAGGATAGA
LVRM1_0138_H10.b : ACTTTGTAGACAGATGTGGCGTCCTCAGTATTGAAAGACGATGACTGTGCCCAGGATAGA
KDN01_0078_D12.b : ACTTTGTAGACAGATGTGGCGTCCTCAGTATTGAAAGACGATGACTGTGCCAAGGATAGA
KDN01_0064_F12.b : ACTTTGTAGACAGATGTGGCGTCCTCAGTATTGAAAGACGATGACTGTGCCAAGGATAGA
LVRM1_0139_C08.b : ACTTTGTAGACAGATGTGGCGTCCTCAGTATTGAAAGACGATGACTGTGCCAAGGATAGA
LVRM1_0127_E08.b : ACTTTGTAGACAGATGTGGCGTCCTCAGTATTGAAAGACGATGACTGTGCCAAGGATAGA
KDN01_0083_D04.b : ACTTTGTAGACAGATGTGGCGTCCTAAGTATTGAAAGACGATGACTGTGCCAAGGATAGA
20110601C-001908 : GGGTGGCTTCTAGGCTTTTCTGCCAGCCCGTTTTGAGGCCAGAGGTGCTAGAATCAGCTC
---------+---------+---------+---------+---------+---------+ 1445
KDN01_0020_E10.b :
KDN01_0059_E07.b : gggggccaagagagatttctccacggaga
KDN01_0079_G02.b :
KDN01_0097_H05.b : tttgagatggatt
KDN01_0095_G09.b : tctgcccccgctttagagccaagggtaaaacacccaaaaccctcccccttcatttgaagg
KDN01_0071_C10.b : cgtttggggcaaaggctaaaacatctaacccttcctcttgtcatctatggagggggagat
LVRM1_0063_F05.b :
LVRM1_0156_E08.b :
LVRM1_0146_G11.b :
LVR01_0035_C06.b : gaaaaaatcaaaacacacttaatcatgataacaa
LVRM1_0147_E05.b :
LVRM1_0086_B10.b :
LVRM1_0066_D02.b :
LVRM1_0083_H04.b :
LVRM1_0125_C04.b :
LVRM1_0011_E03.b :
LVRM1_0134_D10.b :
LVRM1_0045_E11.b :
LVRM1_0205_E03.b :
LVRM1_0189_B09.b :
LVRM1_0198_A04.b :
LVRM1_0185_D04.b :
LVRM1_0149_F08.b :
LVRM1_0118_D01.b :
LVRM1_0065_E06.b :
LVRM1_0089_E07.b :
LVRM1_0091_B06.b :
LVRM1_0117_H05.b :
LVRM1_0179_F11.b :
LVRM1_0202_F08.b :
LVRM1_0118_A12.b :
LVRM1_0077_F02.b :
LVRM1_0109_C06.b :
LVRM1_0069_E08.b :
LVRM1_0033_E07.b :
LVRM1_0151_B09.b :
LVRM1_0159_F07.b :
LVRM1_0157_B05.b :
LVRM1_0137_E07.b :
LVRM1_0032_H06.b :
LVRM1_0137_C07.b :
LVRM1_0156_H10.b :
LVRM1_0139_A11.b :
LVRM1_0146_H08.b :
LVRM1_0002_G07.b :
LVR01_0026_D01.b : aaacaaaaaaaaaaaaaaaaaatattttttttttgtta
LVR01_0038_C05.b : ttg
LVR01_0033_A07.b : aaaaaaaaatatttttgttg
LVR01_0073_G12.b :
LVR01_0065_A07.b :
LVRM1_0175_D04.b :
LVRM1_0024_D05.b :
LVRM1_0199_F06.b :
LVRM1_0115_G05.b :
LVRM1_0050_G05.b :
LVRM1_0091_C09.b :
OVRM1_0211_G03.b :
ITT01_0068_C02.b : aaaccccaaaaccccccttcctttggagaaggggaaattttaagttaaggttctgaaact
LVRM1_0170_G04.b :
LVRM1_0181_G10.b :
LVRM1_0194_G02.b :
LVRM1_0016_G12.b :
LVRM1_0112_C05.b :
LVRM1_0042_H01.b :
LVRM1_0037_B08.b :
LVRM1_0053_H09.b :
LVRM1_0125_G05.b :
LVRM1_0013_E10.b :
LVRM1_0035_G04.b :
LVRM1_0053_C10.b :
LVRM1_0006_H02.b :
LVRM1_0122_C07.b :
LVRM1_0137_D05.b :
LVRM1_0050_H09.b :
LVR01_0054_H01.b :
LVR01_0085_G03.b : ttttttaaaaaaac
ITT01_0021_E05.b : tcaggctttctgcaacccgttttgggccnaggggtaaaatcacctaaaatccttcccctg
KDN01_0019_B12.b : caaagggaaaaaacccaaacctttcccctttacttgatttggggggaaattttttaagat
KDN01_0031_E05.b : cctccctttcttcgagtgagggaaattttaatataggcctttgaaaccttaaagagattg
KDN01_0051_E03.b : gaggtgtaaatacctaaaaaccctccccttgccctcggagtggcggggaaattttgaagt
KDN01_0070_H04.b : ggggaaaacctcaaaacctcccctttccttagtggaggggagaatttgaaattttgaggt
KDN01_0030_A10.b : gttttgggcccaggggttaaatcctctaaacccctcccttggctctgaaggaggggggaa
KDN01_0007_E10.b : atcttccttgccttatgatgggagatttaaggagaggtttaaacataaagggagtgatct
KDN01_0014_B11.b : aggggctaaaacaccaaaaccctccctttccattaatgagagggaaaattttgaagttag
KDN01_0010_F12.b : gcgaagggttaaaactcaaaaccctcccctgccattgaaaaacggggaatttttaaaagt
KDN01_0005_B01.b : tttgggccaaggggtaaaccccaaaaacttccccttgccttgaaggagggggaaattttt
KDN01_0081_D10.b : ttttgcccaccctttttaggcacagggttaaaataactcaaaacccctccccttgcctct
KDN01_0073_F09.b : tggccaagggctaaacacccaaatcctcccctttgcttcgatggcgggggaaatttttaa
KDN01_0076_D08.b : ggcaaaggggaaaaaaatcaaaaccctccctttgcatggagtgacgggaaaattttgaag
KDN01_0009_G04.b : aaaaatccaatctctcctgcntctataaggggaaattttaaattaaggttgtaaacttaa
KDN01_0012_A04.b : gaagggtaaacaccaaactctttcccttcctttattgaggggaaattttaaggttaaggg
KDN01_0039_D10.b : gtttctggcccccgtttgtgggccgagggcttaaatagctaaaacccccctctttgcatt
KDN01_0073_E11.b : tttcgccaaccgttttgaggcaaaggggtaaacaccccaaaacctctccccttgccattg
KDN01_0100_E01.b : caccctttttaggcaaagggctaaatcccctaaaaccctcccctttgcattggaaggagg
KDN01_0020_F07.b : ctcccaccctttttgggccaggggtaaaaaacccaaacccctccccttccatttaatgta
KDN01_0067_G04.b : ttagcaaagggttaaacgccaacctcttcccttgcattgagtgaggggaacttttgaagt
KDN01_0088_F03.b : tttgggccaaagggctaaacactcaaaaccttcccttgcctctaagtgagggggaatttt
KDN01_0012_D02.b : gcacccgtttgagccaagggttaaacactccaaccctctcccttgcattaatggaagggg
KDN01_0012_B07.b : tttgagccaaggctaaataataaaacctcccttggctttagatgggggggacttttaaag
KDN01_0074_A08.b : cccccgttttaggccaagggtaaaaacccaaaaccctccccttgcctttgaagacggggg
KDN01_0030_D06.b : tgcccccgttttgggccaagggttaaaacacccaaacccctcccttggatttaaatgaag
KDN01_0074_D07.b : caacccgttgaggccaaggcctaaacaccaaaaccctccccttccatcgatggaggggga
KDN01_0021_F03.b : taggcaaagggctaatcactaaatcttccccttccttttatgatcggggaatttttaagt
KDN01_0064_E10.b : caccccttttggccagagggcaaaacactcaaactttctccttgcttcgagtgacgggga
KDN01_0093_G03.b : ccgtttagggcaagggtaaaatcccagacccttccccttgctttgatgacggggaaattt
KDN01_0032_A07.b : tttgggccaaggggtaaaaaccccaaaccttccctttgcatttaatgaggggggaaattt
KDN01_0079_E10.b : ccacccttttgaggccagaggccaaaaccctcaaacccctcccctttcntttgattgaag
KDN01_0090_H01.b : ctttctgcaaccccttttaacccaaaggcctaaaacacccaaaacccttccccttgcctt
KDN01_0024_H11.b : ccgctttggcccaggggtaaaaacctaaaaccttccctttcctttgatggagggggaaat
KDN01_0024_A11.b : tttttggcccccctttttaggcaaagggctaaaacacctaaaaacctcccccttgccttg
KDN01_0035_E08.b : ccgtttgaggcaaagtgtaaaacaccaacccttcctcttgcttcgatggagggggagatt
KDN01_0069_H07.b : ctaagcttttcgccccctgttttgggcccaagaggcataataaactcaaaaacccttccc
KDN01_0035_E06.b : gtttaggcacaggctaatcactcaaattttctccttgccttcgatgacgggggacatttt
KDN01_0088_A07.b : ccttttgaggccaagtgcaaaaaactcaaaccttccccttggcttgaaggacggggaaat
KDN01_0059_C02.b : gcacccgtttgggcaagggtaaaaccccaaaccctccccttgcttcgaatgacgggaaat
KDN01_0070_H01.b : gctttcaggtttttcgcccacccgttttgagcccaaaggtgtaaaatccgcccaaaaccc
KDN01_0058_E10.b : agcttttctgcaccccttttgggccaaggggttaaaacactcaaacccttcccccttgcc
KDN01_0095_A02.b : cttttcggcaccccttttgagcccaagggctaaaacaccccaaaccctctccccttgtca
KDN01_0061_A05.b : gctttttgccacccgttgaggccaagggctgattacnctaaaccctcctcttgcattaag
KDN01_0070_C02.b : ggcttctaggcttttctgccccccgctttgagggcaaagggctaaaacaccccaaactcc
KDN01_0043_B02.b : ctttnctgcacccgtttgaggcaaagggctaaatcactcaaactcctccccttgtcatcg
KDN01_0070_B11.b : gctctaggctttctgccaccccgtttggagcccaggggctaaatcnctaaaaaccctccc
KDN01_0067_B04.b : ctagctttctgccccccgctttagccaaagtgtagatcattcaaactctcctctttgctt
KDN01_0033_G03.b : cttctaggctttctgcaccccgctttgaggcaaaggtcttaaatcacctcaaaaccctcc
KDN01_0082_E05.b : cagccttccgcccaccctttgaggcagagtgcttaaatcacccaaaccctccccctgcct
KDN01_0058_B12.b : ggggggcttctaggttttctcccccccgctttgaggccaagaggttaaaacacctccaaa
KDN01_0074_H04.b : gctttctgcacccgtttgggcacaagggtaaaacacccaaaccctcccctttgctttgat
KDN01_0088_B10.b : tcgggctttccgcaacccgttttgagccaaggggctaaaccacccaaacccctccccctg
KDN01_0083_A08.b : cctagctttttgccacccttttgagccaagggtcaaataacctcaacccttccccttgct
KDN01_0085_C06.b : gcttctgccacccttttaggcaaagggctaatcacctaaatccttccctgccttttgatg
KDN01_0063_B09.b : tctagctttctggcaccgtttgaggccaagggttaaacgccaaaaccttctcttgccttc
KDN01_0076_B10.b : tctaggctttctgccacccggtttgaagcaaagggctaaatcactcaaaaccctcccctt
KDN01_0094_E01.b : cctccaggctttttgccccccctttttaggcagagggctaaaatcactcaaaccctcccc
KDN01_0098_C10.b : tcaggctttttgccccccttttagggcaaaggctaaaatcctcaaaacccctcccttggc
KDN01_0090_A08.b : tcaaggctttccgccaccccttttgaggccaggtggtaaaacacccaaatcttccccttg
KDN01_0038_D12.b : agggtggtcttctaggttttttctcccacccccttttgaggcccagagggcgctaaaacc
KDN01_0070_F07.b : ttctagctttctgccgcccgtttaggccaagggctaaaaactcaaccccttccctttgca
KDN01_0067_E01.b : tcaagcttttctgcaaccgtttgaggcaaggggctaaacagctcaaaatcttctccgggc
KDN01_0082_A07.b : ggttctaggtttttcgcaacccttttgaggncaaagggctaaaacagttaaacccctcct
KDN01_0097_B02.b : agggtggcttctagcttttctgcaacccggtttaaaggccagggtctaaaatccccacaa
KDN01_0013_B11.b : aggggggctttcagccttttctgcacccgcttttgaggccaaaggggtaaaaacccccaa
KDN01_0098_B11.b : gggggccttcaaggcctttccgccacccccttttgaggccgaaggtgtaaaataacctca
KDN01_0016_H12.b : gggggcttctaagcttttcttgcaccccgtttttggcccaaggggctaaaatccgtctaa
KDN01_0034_D11.b : gtggcttctaggctttcttgcacccgtttgtagagccaaggggctaaatcacccaaaaac
KDN01_0025_G09.b : agggctaataacccaaatcctcccctggctttgaatgtagggggaatttttaagtttagg
KDN01_0005_D11.b : ttgccacccctttgaggccaaggtgaaaaacctcaaaaccctcctcttgtctttaatgag
KDN01_0005_G05.b : ttgtggccaagagctaaaccccaaaccctccccttgccttaatgtcggggaaattttaaa
KDN01_0032_G12.b : tctaaggttttcgtccaccccttttagggcaagaggcgtaaactcc
KDN01_0032_D09.b : ggccagggtaaaaaatctaaaccttccctgcctttgaggggggggaatttttaaagatgg
KDN01_0023_E08.b : acctccccctgcatcgaatgagggggaaattttaaggtaagagttttgaaaccttataac
KDN01_0034_D05.b : ttgaagcaaaggcaaatcaatccactcttctctttgcttcgatgacgggggagtttttta
KDN01_0051_C03.b : ttcggcccccgttttgggccaaggggctaaaacactcaaaccccttccccttgcattcaa
KDN01_0063_F08.b : tcgccancccttttgagccgagggctaaatcacccaaaccttcctttgtgcttcgaatga
KDN01_0019_F07.b : ttgccccacccttttggccaaggggtaaaaaccctaaaaccctcccctttgcaattagag
KDN01_0031_D01.b : ggcttctctgcaccccgttttgaggcgaagggcttaatcccccaaaacccttcccctttg
KDN01_0062_G03.b : cccttttaggccaaggctaaaacacctcaaacctccccttgccattgatgaaggggaaat
KDN01_0080_F12.b : agggggcttctagggttttttgccacccctttttgaggccaaaggtggtaaaacaactaa
KDN01_0074_A10.b : ttctaggctttttgcaacccgttttggggcaaaggtgcaaattaacccaaaacccctcct
KDN01_0033_D10.b : ctctaggctttctgccancccgttttaggccgaggggctaaataactcaaacccttcccc
KDN01_0080_A04.b : gcttttaagcttttcgcccccccnttttgagccgaagggccaaataacccaaaaccctcc
KDN01_0070_B12.b : gggtggtttaaagcttttttgccccccgttttagagccaaaagggctaaacacctcaaaa
KDN01_0011_B11.b : gttttagctttttgccacccgttttaggcaaagggtaaaaaccccaaaccctccccctgc
KDN01_0071_A09.b : gccttctaggctttctgcanccctttggaggcnaagggcttaaatcactcaaatccttcc
KDN01_0041_D03.b : gcttctagcttttctgcacccgtttgaggccaaggggtaaatcnctcgaacccttcccct
KDN01_0025_G06.b : aggtggcttctaagctttctgccccccngttttgagcaaagagctaaaatcactcacaaa
KDN01_0001_E06.b : gttttttttttttttccccccccttgggggggggggggggaagaaaaaaaccccctccct
KDN01_0009_C10.b : taaaacaccaaacctcccttgggttgaagtaggggcatttttaagttgaccttttaaaaa
KDN01_0019_G10.b : ttttgggccaaggggtaaaaaactcaaaaccttcccctttgctttgaatggcggggaaaa
KDN01_0090_F07.b : caaggctaaaacactcaaacctccctttgcattaatggaggggaacttttgaagttagag
KDN01_0056_C02.b : gagcaaaggctaatcatcaaactctcccctgcatcgagtgagggaatttttaagtagagg
KDN01_0054_D09.b : ccaagggtaaacatctaaccctcctcttgcatcgaggccggggacattttaaagtagggt
KDN01_0078_D11.b : ccgttttgagccaagggctaaaaaccccaaaacccttccccttgcattggatgaacgggg
KDN01_0029_B05.b : ggttttttgcaccccgtttggggcagagggttaaacacctaaaaccctcccctgtccttt
KDN01_0082_F06.b : aagcctttctgcaacccgttttaggccaaagtgctaaaacactcaaaaccctcccccttg
KDN01_0067_A11.b : gggggtttttagccttttcgcccccccgtttgagggcaaagggctaaaaaaactccaaac
KDN01_0006_C05.b : cccttttgggccaaggggtaaacctcaaaaccttcccctgccattatatgaggggaaatt
KDN01_0028_F04.b : taggttttcgccacccttttgagcaaagggctaaatcatctaaactctttcctttgcntt
KDN01_0070_A01.b : ggtggctctaggctttttcgccacccgttttgaggcccaagggcttaaaacccttaaaac
KDN01_0045_A10.b : tttgagccaagggtcaaatcccaaaactctccctttcctttgtatgaggggaacttttaa
KDN01_0046_C03.b : accctctttttctctatgcggggaattttaagttagggcttgaaacctataatggctttg
KDN01_0048_H05.b : accgaaattctccttttgctataaggagggacattttgaaggaaggtcttgaaaccttta
KDN01_0052_H11.b : aggaaaagggaggctttcaagatattttctccacgcctgtttgagagcgaagggtgaaaa
KDN01_0046_A02.b : cccttcctctgagtggggaaattttaagttgagctgtgaaaaccttaagggaatcgttcc
KDN01_0080_A10.b : GGGTGGCTTCTTAGCTTTTCTGC*CACCCGTTTTTGAGGCAGAGGTGCTAGAATCAACTC
KDN01_0005_C02.b : gtggctttctagcttttctgcagccccgtttgaggccagagtgctagaatcacctcaaaa
LVRM1_0142_D07.b : GGGTGGCTTCTAGGCTTTTCTGC
LVRM1_0138_H10.b : GGGTGGCTTCTAGGCTTTTCTGCCCAGCCGTTTTGAGGCCAGAGGTGCTAGAA
KDN01_0078_D12.b : GGGTGGCTTCTAGGCTTTTCTGCCAGCCCGTTTTGAGGCCAGAGGTGCTAGAATCAGCTC
KDN01_0064_F12.b : GGGTGGCTTCTAGGCTTTTCTGCCAGCCCGTTTTGAGGCCAGAGGTGCTAGAATCAGCTC
LVRM1_0139_C08.b : GGGTGGCTTCTAGGCTTTTCTGCCAGCCCGTTTTGAGGCCAGAAGTGCTAGAATCAGCTC
LVRM1_0127_E08.b : GGGTGGCTTTCTAGCTTTTCTGCCAGCCCGTTTTGAAGCCAGAGGTGCTAGAATCAGCTC
KDN01_0083_D04.b : GGGTGGCTTCTAGGCTTTTCTGCCAGCCCGTTTTGAGGCCAGAGGTGCTAGAATCAGCTC
20110601C-001908 : AGAACTCCTTCCTCCTTTGCCATTCTGATTGTACTGGGTGACAGTTTTTTGAAATGTTAA
---------+---------+---------+---------+---------+---------+ 1505
KDN01_0020_E10.b :
KDN01_0059_E07.b :
KDN01_0079_G02.b :
KDN01_0097_H05.b :
KDN01_0095_G09.b : acgggggaatttttaaaatttaggggcctttaaacaccttaaaagtgggaatttggatcc
KDN01_0071_C10.b : tttgaagttaaaggttttgaaaactttaaaagggaattggatcctccccaaaatttttct
LVRM1_0063_F05.b :
LVRM1_0156_E08.b :
LVRM1_0146_G11.b :
LVR01_0035_C06.b :
LVRM1_0147_E05.b :
LVRM1_0086_B10.b :
LVRM1_0066_D02.b :
LVRM1_0083_H04.b :
LVRM1_0125_C04.b :
LVRM1_0011_E03.b :
LVRM1_0134_D10.b :
LVRM1_0045_E11.b :
LVRM1_0205_E03.b :
LVRM1_0189_B09.b :
LVRM1_0198_A04.b :
LVRM1_0185_D04.b :
LVRM1_0149_F08.b :
LVRM1_0118_D01.b :
LVRM1_0065_E06.b :
LVRM1_0089_E07.b :
LVRM1_0091_B06.b :
LVRM1_0117_H05.b :
LVRM1_0179_F11.b :
LVRM1_0202_F08.b :
LVRM1_0118_A12.b :
LVRM1_0077_F02.b :
LVRM1_0109_C06.b :
LVRM1_0069_E08.b :
LVRM1_0033_E07.b :
LVRM1_0151_B09.b :
LVRM1_0159_F07.b :
LVRM1_0157_B05.b :
LVRM1_0137_E07.b :
LVRM1_0032_H06.b :
LVRM1_0137_C07.b :
LVRM1_0156_H10.b :
LVRM1_0139_A11.b :
LVRM1_0146_H08.b :
LVRM1_0002_G07.b :
LVR01_0026_D01.b :
LVR01_0038_C05.b :
LVR01_0033_A07.b :
LVR01_0073_G12.b :
LVR01_0065_A07.b :
LVRM1_0175_D04.b :
LVRM1_0024_D05.b :
LVRM1_0199_F06.b :
LVRM1_0115_G05.b :
LVRM1_0050_G05.b :
LVRM1_0091_C09.b :
OVRM1_0211_G03.b :
ITT01_0068_C02.b : ttaacgggatttgattcccccaaattttttcttgaaaaaaaaaaaatgtgggtggggccc
LVRM1_0170_G04.b :
LVRM1_0181_G10.b :
LVRM1_0194_G02.b :
LVRM1_0016_G12.b :
LVRM1_0112_C05.b :
LVRM1_0042_H01.b :
LVRM1_0037_B08.b :
LVRM1_0053_H09.b :
LVRM1_0125_G05.b :
LVRM1_0013_E10.b :
LVRM1_0035_G04.b :
LVRM1_0053_C10.b :
LVRM1_0006_H02.b :
LVRM1_0122_C07.b :
LVRM1_0137_D05.b :
LVRM1_0050_H09.b :
LVR01_0054_H01.b :
LVR01_0085_G03.b :
ITT01_0021_E05.b : cctttggaggtacgggggaacatttttaaagtagggggctcttgagaactttaaaaacgg
KDN01_0019_B12.b : aaaggttttggaaaacttttaaagagggatcgtggttctcccccaaaaat
KDN01_0031_E05.b : gtcttcccacaaattttttgtaataaaagatttggggcgcctccgggaacgttttctttc
KDN01_0051_E03.b : gaaaggctcttgaagccttttaaaggggaatttgtgttcctccccaaatttttatttttt
KDN01_0070_H04.b : ttgaacccttaaaagggaattggatcctccccaaatttatttttgaaataaaaattttgg
KDN01_0030_A10.b : atttttaaagttaagggcctttgaaacattttaaaggggaatttgggttctctccccaaa
KDN01_0007_E10.b : cccacattatttttaaaaaaaaattgggcctccaggacgtttttcctctccgggnggggt
KDN01_0014_B11.b : aggctttgaaaactttaaaaggggaatcggatttcccccaaaatattta
KDN01_0010_F12.b : aaaaggtttt
KDN01_0005_B01.b : aaagttagaggttctgaaccttttaaaggggatttgattctccccccaattatttttttg
KDN01_0081_D10.b : gaatggcgggagaacatttttaaattaaaggagttcttaagacccttataaag
KDN01_0073_F09.b : gtaaagggttttgaaaacctttaaacgggatttggtcctcccccaaaattttttccttgt
KDN01_0076_D08.b : gtatgaggcttgtaaaacttataaaggggaattggatcctcccaaaaattattatttgta
KDN01_0009_G04.b : agggaatgatttcccaaatttttttttaaaaaattgggggctcccgggcgttttttccag
KDN01_0012_A04.b : tttgaaactttaaaagggattggacttcccccaaatattctcttaaaaaaaaattggggg
KDN01_0039_D10.b : cgaaggacggggacaattttaaaattagaggctctttaaaaccttttaaaggggatatcg
KDN01_0073_E11.b : aaatgacgggggaaattttttaaagtaaagaggttctagaaacctttatagaagggaatt
KDN01_0100_E01.b : ggggaaatttttaaagttaaaggcttttgaaaacttataaacggggattgggatcccccc
KDN01_0020_F07.b : gggggaaaatttttaagttaagggctttgaaacactttaaaggggatttgggtctccccc
KDN01_0067_G04.b : aaggcttctgaacacttaaaggggattggatcttccccaaattatattctgaaaaaaaag
KDN01_0088_F03.b : taagagagaggctctgaaacctttaaaacggaattggatcctccccaaaatttttttctt
KDN01_0012_D02.b : gaattttataagttagaaggttcttgaaacttattaacgggaattggatcttcccaacaa
KDN01_0012_B07.b : taagccttcgaaactttaaaggggattggattctcccaaatttatttttatataaaaaat
KDN01_0074_A08.b : aatttttaaagtaagaggttctgaaaacttttaaggggaattgggtctcctcccaaaatt
KDN01_0030_D06.b : ggaaaattttgaaggtaagagcttggaaacctatataacgggattggatcttcccacaaa
KDN01_0074_D07.b : attttgaaaggaagaggttctgaaaacctttaaacgggaattggatctttcccaaaattt
KDN01_0021_F03.b : aagagctctgaaactttaaagggaattgatctcccccaattattctcttaaaaaagaatt
KDN01_0064_E10.b : cattttaatgtaaggcctctgaaacctttaaacggaattcgatcttccccaaatatattc
KDN01_0093_G03.b : taaagtaagggttttgaaacctttaaggggaattgattcctcccaaaattttttttgtta
KDN01_0032_A07.b : taagttagagggttttgaaaactttaaaagggaattcggtcctccccaaatttatatttt
KDN01_0079_E10.b : ggggacattttgaatgtaaggagttttgagaccctataaacgggaattggatccctccca
KDN01_0090_H01.b : tgatgaaggggggaaatttttaaagttagaggtttttaaaaacctttaaag
KDN01_0024_H11.b : ttttaaggtaaggcttcttaaacctattaacggggaatgggtctttcccccaatattttt
KDN01_0024_A11.b : aagggaggggggaacttttttaaagttaagaggtcttgaaaaccttataaaacgga
KDN01_0035_E08.b : gtaaggtaagggctttgaaaccttaaaaggggattggatctcccccaatatttttctcgt
KDN01_0069_H07.b : ctgtggcctttaatatgccggggcacaattttttaaagtttagagagttcctttgaaacc
KDN01_0035_E06.b : aaagtataggctcttgaaacttattaagggaattggatcttcccaaaatgctttctcgta
KDN01_0088_A07.b : tttgaaagttaaaggtttgaaaccataaaacggaattggacctcccccaaatatatttct
KDN01_0059_C02.b : tttaaagtaaaggttttaaacccttaaaaggaattcggtcttccccaaatttattttttg
KDN01_0070_H01.b : c
KDN01_0058_E10.b : attgatggacgggagaaattttttaaagttaaagggtctttgaaaccttttaaacgggga
KDN01_0095_A02.b : ttcaagggacgggggaaatttttgaaaggtaggggctcttgaaaaccttttaaacgggaa
KDN01_0061_A05.b : tgagggggaaattttgatgtagggctcttagaactttaaaagggaattggtctcccccca
KDN01_0070_C02.b : tcctcctttgcattcgaatgacgggggacaaattttgaaggtatgaggcttgtgaaaacc
KDN01_0043_B02.b : gaggacgggggaaattttgaaggtaaggaggtcttggaaccttataaacgggaatctgaa
KDN01_0070_B11.b : ccctggcattcgaagggcgggggaaagtttttgaaggtaaaaggctttgtgaaaccttta
KDN01_0067_B04.b : tgatgaacggggaaaattttgaagttaagagttttgaaagcttttgaacggaatttgaac
KDN01_0033_G03.b : tccttggcattcgaatgaccgggggaacattttgaaagttaagagctctctgaagacctt
KDN01_0082_E05.b : tcgattgacggggaaatttttgaggttaagggtcttgaaaccttataagacggaactcgg
KDN01_0058_B12.b : cccttccccttgtgcatcggatgtccgggggaaaatttttgaaagtaaagagtcttt
KDN01_0074_H04.b : gaagggggaacttttgaagttaagggctttgaacacttttaaagggaatttggtattccc
KDN01_0088_B10.b : gcatttagatgacggggaaaattttttaagttaagaggccttgaaaaccttttaaaaggg
KDN01_0083_A08.b : tccaatgacggggaaaatttttaagtgtagggttcttaaagcttattaacggaatttgga
KDN01_0085_C06.b : gaggggaaatttttaatgtaaagagcttggaaacctttaaacggggattggtcctccccc
KDN01_0063_B09.b : aatgaacggggaatttttaagtagagggttctgaagctattaaacggaattggaactccc
KDN01_0076_B10.b : ggcctttggatgagcggggaaattttttaagttatggggttcctgaaaaccttttaagcg
KDN01_0094_E01.b : ctttgcatttggatggccgggggaacattttggatgttaaagagctttttaaaaaccctt
KDN01_0098_C10.b : tttaaaggagggggaaattttagaggtaaggggctttgaaaccttataaaggggaattgg
KDN01_0090_A08.b : gcatttaattgacggggaaattttttagtgtaggagctctggaaaacctttaaacgggga
KDN01_0038_D12.b : ccctcaaaacccttcccccctttgcattcagaatggacggggggagaaattttttaaaag
KDN01_0070_F07.b : ttgaatggcggggaactttttgaagttaggggctctgaaacctattaagggaatctggat
KDN01_0067_E01.b : atttgattgacggggaaagtttttaagtttagagggtcttgaaacctttataaagggaat
KDN01_0082_A07.b : ccttggcattgaaggaccggggaacttttttaaagttaagagcttcttaaaactttataa
KDN01_0097_B02.b : ctcttctccttggcattcgaatggacggggaacatttttaaagtaaagggttcttgaaaa
KDN01_0013_B11.b : aaccttccccctgtgcttttaagtgacggggggaatttttaaatgtaaggaggtttgtgg
KDN01_0098_B11.b : aaaccctcccccttggtccttccgaatggagggggggaaatttttttaaaggaaaaaagc
KDN01_0016_H12.b : aa
KDN01_0034_D11.b : cctcccccttgcacttgaagtaacggggaacatttttaaaatgtaagaggcttttgaaaa
KDN01_0025_G09.b : tctttgaaacttttaaagggaatctggtctcccccaaatttatttcttataaaaaaaatt
KDN01_0005_D11.b : cggggaaatttttaaaggtaagggtcttgaaaaacctttaaaaggggaattgtgttcccc
KDN01_0005_G05.b : gtaaaggtctctgaaacttttaaaggggaattggatccccccaatttattttcctatatt
KDN01_0032_G12.b :
KDN01_0032_D09.b : gtcttaaaaccttaaaagggttggtcctccccaaattaattttgtaataaaaaattgggg
KDN01_0023_E08.b : gggatttggatcttccccaaattttactctgtaataaagaatctgtgggcgtcacccagg
KDN01_0034_D05.b : gttagaggctctgaaccttataacaggaatcggatcctccccaaaattattttctggaaa
KDN01_0051_C03.b : gtgagggggacatttttaaggtaagaggcctttgaaaacctattaaagggggatttgtga
KDN01_0063_F08.b : cggggagaattttgaaggtaagaggtttggaaacctttaaaggggaaatcggtcctcccc
KDN01_0019_F07.b : ggcgggggaaatttttaaaggtaaagagtcttggaacctttaaaaggggggtttgggttc
KDN01_0031_D01.b : ccattggaatgaacggggagaattttttaaggttagagggtcttgaaaacctcttaaaag
KDN01_0062_G03.b : tttaaagttagggtttctgaaaactttaaacgggaattgaatcttcccaaattatttttt
KDN01_0080_F12.b : aaaacctctccccgcgggacttaaagagaggggggagaatttttaaaatgtaagag
KDN01_0074_A10.b : cttgtccattagatggaccggggaaaatttttataagttatagaggtcttgaaaaccttt
KDN01_0033_D10.b : tttgccatcgaatgaacggggagattttttataagtgtaagggctcttgaaaacctttta
KDN01_0080_A04.b : cctttgccttttgatgacgggggaaattttttgaagttaagagagttctgaaaaaccttt
KDN01_0070_B12.b : cccttccccctttgcatttgaagtgcagggggcaaattttttaaaggaaaga
KDN01_0011_B11.b : cttaaaggaaggggaaaattttgaattaagaggctcttgaaacctttaaaaagggaactg
KDN01_0071_A09.b : ccttggcatcgagatgacggggaaatttttaaggttaagaggttcttgaaaacttattaa
KDN01_0041_D03.b : tgtctttgaaggaagggggacttttttgaagtaaggagttctgaaaaccttttaaatggg
KDN01_0025_G06.b : tccttccccttgccttctattggatgggggaaatttttgaagtaaggaggttcttgaaaa
KDN01_0001_E06.b : ccttcttttttttggggggggggggttttttttttaaaagaggggggaaaaaaaaaaaaa
KDN01_0009_C10.b : ttaaaggggatgatttcccctaatttatttcttaaaaaaattgtgggccnccggggaggt
KDN01_0019_G10.b : tttttaaatgaaaaggctttgaaaacctttaaagggggattgtgtttccccccaaaatta
KDN01_0090_F07.b : gttctgaacctttaaaagggaattggatcctccccaaaatctttttgttaaaaaaaaatc
KDN01_0056_C02.b : tctggaactttaagaggattggatctcccacatataattctgttaataaaaacctggggc
KDN01_0054_D09.b : tcttaaactttagaaggaattggatccccccaaatttatttctgtaattaagaatttggg
KDN01_0078_D11.b : aaatttttgaagttaaaggcttttgaaaacctatataagggggatttgat
KDN01_0029_B05.b : gatgtccgggggaaattttaaggttagaggctcttaaaaccttataaggggatttggatt
KDN01_0082_F06.b : caattgaatgacggggaacatttttaaagttaaaaggctccttgaaaacttataaagcgg
KDN01_0067_A11.b : ccttctcccttgccattttaaatgaccggggggagatttttta
KDN01_0006_C05.b : tttaaagttaagggttctaaaaacttataaaggaattttgatcccccccaaatttttttt
KDN01_0028_F04.b : taatggacggggaaanttttgaagttaggagtcttgaaacacttataaagggaattcggt
KDN01_0070_A01.b : ccttcccctttgccttcgagatgccgggagaaatttttatagtgtaaggagcctctggaa
KDN01_0045_A10.b : attagagctcttaaacctttaagcggaatcggcttctccccaattttatttttgataaaa
KDN01_0046_C03.b : tctccacatatttttctttttataaccccctttacttatggggaccacaggggtggagat
KDN01_0048_H05.b : aggggatctgatctcccaatattttttttaataaaaaatctgtggggctcctccgtggat
KDN01_0052_H11.b : aagctgagaaaacccctcccctgtgtcaattgaagaggaggtggagaaattt
KDN01_0046_A02.b : tcccaaatttattttaaataaaaattggggccttcacgaggacaaatttcttcttcaaac
KDN01_0080_A10.b : AAAACTCCTTCTCCTTTTGCCA*TCTGATTGTACTGGGTGACAGTTTTTTGGAATGGTAA
KDN01_0005_C02.b : ctcctcctctttgcaatctgatgaactgggtgacgttttttaaaggtaatgaggctcttg
LVRM1_0142_D07.b :
LVRM1_0138_H10.b :
KDN01_0078_D12.b : AGAACTCCTTCCTCCTTTGCCATTCTGATTGTACTGGGTGACAGTTTTTTGAAATGTTAA
KDN01_0064_F12.b : AGAACTCCTTCCTCCTTTGCCATTCTGATTGTACTGGGTGACAGTTTTTTGAAATGTTAA
LVRM1_0139_C08.b : AGAACTCCTTCCTCCTTTGCCGTTCTGATTGTATTGGGTGACAGTTTTTTGAAATGTTAA
LVRM1_0127_E08.b : AGAACTCCTTCCTCCTTGCCCCGTCTGAT*GTATTGGGTGACAGTTTTTTGGAATGGTTA
KDN01_0083_D04.b : AGAACTCCTTCCTCCTTTGCCATTCTGATTGTACTGGGTGACAGTTTTTTGAAATGTTAA
20110601C-001908 : TGAGGCTTCTTGAGAAAGCCTTATTAGAAGCTGGGACATTCTGGATTCCTTCCCCCCACT
---------+---------+---------+---------+---------+---------+ 1565
KDN01_0020_E10.b :
KDN01_0059_E07.b :
KDN01_0079_G02.b :
KDN01_0097_H05.b :
KDN01_0095_G09.b : tcccccaaattttatttctttgaaaaaaagaagatttggag
KDN01_0071_C10.b : ctttgaataaagatattgtgggcctccaccacggggaacaa
LVRM1_0063_F05.b :
LVRM1_0156_E08.b :
LVRM1_0146_G11.b :
LVR01_0035_C06.b :
LVRM1_0147_E05.b :
LVRM1_0086_B10.b :
LVRM1_0066_D02.b :
LVRM1_0083_H04.b :
LVRM1_0125_C04.b :
LVRM1_0011_E03.b :
LVRM1_0134_D10.b :
LVRM1_0045_E11.b :
LVRM1_0205_E03.b :
LVRM1_0189_B09.b :
LVRM1_0198_A04.b :
LVRM1_0185_D04.b :
LVRM1_0149_F08.b :
LVRM1_0118_D01.b :
LVRM1_0065_E06.b :
LVRM1_0089_E07.b :
LVRM1_0091_B06.b :
LVRM1_0117_H05.b :
LVRM1_0179_F11.b :
LVRM1_0202_F08.b :
LVRM1_0118_A12.b :
LVRM1_0077_F02.b :
LVRM1_0109_C06.b :
LVRM1_0069_E08.b :
LVRM1_0033_E07.b :
LVRM1_0151_B09.b :
LVRM1_0159_F07.b :
LVRM1_0157_B05.b :
LVRM1_0137_E07.b :
LVRM1_0032_H06.b :
LVRM1_0137_C07.b :
LVRM1_0156_H10.b :
LVRM1_0139_A11.b :
LVRM1_0146_H08.b :
LVRM1_0002_G07.b :
LVR01_0026_D01.b :
LVR01_0038_C05.b :
LVR01_0033_A07.b :
LVR01_0073_G12.b :
LVR01_0065_A07.b :
LVRM1_0175_D04.b :
LVRM1_0024_D05.b :
LVRM1_0199_F06.b :
LVRM1_0115_G05.b :
LVRM1_0050_G05.b :
LVRM1_0091_C09.b :
OVRM1_0211_G03.b :
ITT01_0068_C02.b : taatccgggcaccccccttttgagtctgttataaggccttttccgagaagtgttgatttg
LVRM1_0170_G04.b :
LVRM1_0181_G10.b :
LVRM1_0194_G02.b :
LVRM1_0016_G12.b :
LVRM1_0112_C05.b :
LVRM1_0042_H01.b :
LVRM1_0037_B08.b :
LVRM1_0053_H09.b :
LVRM1_0125_G05.b :
LVRM1_0013_E10.b :
LVRM1_0035_G04.b :
LVRM1_0053_C10.b :
LVRM1_0006_H02.b :
LVRM1_0122_C07.b :
LVRM1_0137_D05.b :
LVRM1_0050_H09.b :
LVR01_0054_H01.b :
LVR01_0085_G03.b :
ITT01_0021_E05.b : gaattgggaccctccccccaatattaattctcgttgaaaaaaaaaaaaaaaaaaaaacat
KDN01_0019_B12.b :
KDN01_0031_E05.b : ccaaggggggtttggtatttccccataaaggcgtaaatagactg
KDN01_0051_E03.b : gttaaataaaaaattcgtggggcccccn
KDN01_0070_H04.b : gggcccccccagggaaagtatttcttc
KDN01_0030_A10.b :
KDN01_0007_E10.b : ttgcttcaanntcnttnnnaaataacaaanttccaaaagaacttaaatagagaaaannnn
KDN01_0014_B11.b :
KDN01_0010_F12.b :
KDN01_0005_B01.b : taaaaaaaagaattttggggcccccccccgagggacacaatctccctctcccccaagggg
KDN01_0081_D10.b :
KDN01_0073_F09.b : ataaaaaaattttgggggccccttccgggggacaagttttctctcctccaa
KDN01_0076_D08.b : tataaaaatattgggggccccctccccggggaacgtgtttcattctcctcaaagg
KDN01_0009_G04.b : cgccggggggttggnnnnnnntcnntncnnnnccacaancccccaacaaacgtttnnnnn
KDN01_0012_A04.b : gcctcccgggagagttttctcttctcggcgggggggggtttcggttaaaaantcaaatnn
KDN01_0039_D10.b : gaaccttccccaaatatttatttctttaaataaaacaaatcttggggcgctcctcccagg
KDN01_0073_E11.b : tggaatcctcccccaaaattaattactttta
KDN01_0100_E01.b : ccacaaattatattctctttaaataaaaaaaattt
KDN01_0020_F07.b : caaattttttttctttaaaaaaagaaactggggggcgcctccacagggtacaattttttt
KDN01_0067_G04.b : atttggggcccctccacagggaacaattttttctccaacgggggntttggtgttttgacc
KDN01_0088_F03.b : aaaataaaaaaattgtgggccccctcccaagggaacatatttccttcctc
KDN01_0012_D02.b : attatattctgttaaaaaaaaagactggggggcgcctccgagggaaggatttctttctct
KDN01_0012_B07.b : tgtgcgcccccaagggaaaatttttttctctaaggggagttttgttattcccctccaagg
KDN01_0074_A08.b : tttttcttagaataaaaaagtcggtgggcgccc
KDN01_0030_D06.b : atatttcttcgtaaaaaagaagattcgtgggccccttccacagggtacaagattcttctc
KDN01_0074_D07.b : atttttgttaaaaaaaagattcggggggccccttccagggggaacagtttccttctcctc
KDN01_0021_F03.b : tgggggcctcccagggaaaatatttcttctcccagcggggggtgtgtatttcccttccaa
KDN01_0064_E10.b : tttgaataaagaaattggggggccctcccaggggacaaatttccttccctcaaagggggg
KDN01_0093_G03.b : taaaaaattttggggcgcctaccaggggcaaaattttcttcttc
KDN01_0032_A07.b : gaaaataaaaaaatcttgggggccccaccagga
KDN01_0079_E10.b : aaaattatatcctgtatataa
KDN01_0090_H01.b :
KDN01_0024_H11.b : ttgtaataaaaaa
KDN01_0024_A11.b :
KDN01_0035_E08.b : aataaaaagattttggggccccccccaggggaacgtttcctctctctccaagcggggttt
KDN01_0069_H07.b : cttataaaggagggg
KDN01_0035_E06.b : ataaaggattctggggcccctaccaggggaaagatttctttctcaaaggggggtttgagt
KDN01_0088_A07.b : ttaataaaaagaatctt
KDN01_0059_C02.b : aaataaaaaaattgggggcctctccaaaggacacgatttccttctttccaagggggattt
KDN01_0070_H01.b :
KDN01_0058_E10.b : atctgatcccccccccgaaatttatattctggtaaataaagaaattctggtgggcccctc
KDN01_0095_A02.b : attggatctctccccctaaattatttttctggaaaataaaaagattcggtg
KDN01_0061_A05.b : atatttttctgtaataaaagaactgtggggcccttcccaaggaaccaattctttctctcc
KDN01_0070_C02.b : tttttaaacgggagattgggtcctctccccaaaattttatttctctgtaaataaaaaaat
KDN01_0043_B02.b : tcttcccaaaatatttattttttatatacaagaaatctggggcgctcccccaaagagaat
KDN01_0070_B11.b : taaaggggaattttgattcctccccccaattt
KDN01_0067_B04.b : cttccccaattttttattcgtaaataaaagaatctggggcccccctcccggggacaaagt
KDN01_0033_G03.b : attaagaggggattctgaatcctcccccaaaaattaattttttggatatataaaaaagtt
KDN01_0082_E05.b : atcttcccccaaattacttttcgttaaacaaaaaatttgggggccccctacacagggaca
KDN01_0058_B12.b :
KDN01_0074_H04.b : ccaaatatatttttctgtaattaaaaaattctgggggccctcccagagaaacata
KDN01_0088_B10.b : agatttggtctctccccccaaattttatttttctttaaataaaaaa
KDN01_0083_A08.b : tttctcccccaatttcattttccgtataaaagaaaacttggggccccctacccaagggaa
KDN01_0085_C06.b : aaattctacttgttaataaaaaaatctgtagcccccccccagggtaaatatttctcttct
KDN01_0063_B09.b : ccataatttatttctttaaaaaaagatctgggggcccttccaggggaagatttccttctc
KDN01_0076_B10.b : agaatctgaatcttccccccaaatttatttctctggaaataaaaagattcttggggcgcc
KDN01_0094_E01.b : taaaagggggcatttggaatccttcccccaatattattatttct
KDN01_0098_C10.b : gctctcccccaatattttattctgttaaataaaagattttgtggggccctcttccccggg
KDN01_0090_A08.b : ttcggatcttcccccaaattatttttctgataataaaagaatttgggggccccctcccca
KDN01_0038_D12.b : gtaaagaagacttc
KDN01_0070_F07.b : cttccccaaattttattttgttattaaaaaaatctgtgggccctctccagggacaggatt
KDN01_0067_E01.b : tgggatctccccccacaatatttttctttaaaacaacaatatcttggggc
KDN01_0082_A07.b : acgggacattgggatctctcccccaaatt
KDN01_0097_B02.b : cctttataaacgggattgggatcctcccccaaaattattttctcggaaataaaaaaaatt
KDN01_0013_B11.b : aagcttataaaaagggggatgggattcttccccacaaattaaatttttgttaaataaaaa
KDN01_0098_B11.b : cttctaa
KDN01_0016_H12.b :
KDN01_0034_D11.b : ccttttaaaaggt
KDN01_0025_G09.b : ggtgggcccctcccagggaagatattcttctctaacagggggggttggtgtttttccctc
KDN01_0005_D11.b : cccaaaaatttttttctttaaaataaaagatttggtggggcctttcccaggggaacaaaa
KDN01_0005_G05.b : aaaaaaacttggggcgccctcccaggggaactattttctcccctccaagggggattttgg
KDN01_0032_G12.b :
KDN01_0032_D09.b : gcgccccggggaaagatttttttcctcaagggggggttgtgtt
KDN01_0023_E08.b : gaaaggttttcttccctccaaggggaggttgggttatttccacttacaaggtttaaataa
KDN01_0034_D05.b : taaagaattctggggcgccctccacggggacgatttctcttccttccaagcggggttgtg
KDN01_0051_C03.b : tcttcccccaaatatttattttttggattaaaaagaatctgttgggcccctctccccggg
KDN01_0063_F08.b : ccaaattttttctttgaaattaagaaatcttgggcgccctccccaggggacataatttct
KDN01_0019_F07.b : ccccccaaattttttttcctcttaaaaaaaagaaatttgggggggccctccccaggggga
KDN01_0031_D01.b : gggaatctggatctctcccc
KDN01_0062_G03.b : gatataaaaaaatcgtggggccctacccagggacagtatttctttcctctaaggggggtt
KDN01_0080_F12.b :
KDN01_0074_A10.b : ataaaggggggaatttcggatccttccccaccaatatttattt
KDN01_0033_D10.b : agctgacaattggaattcctcccccaaaatatttatcttggtaaaaacaacaaatctgtt
KDN01_0080_A04.b : taaagcggaaatttggatcctccccc
KDN01_0070_B12.b :
KDN01_0011_B11.b : tatcttccccccaaatattttttctgaaataaaaaaatttggtgcggtctt
KDN01_0071_A09.b : cgggaattggatccttcccccaaaatttattcttgtaaataaaagaaatcttgtgggcct
KDN01_0041_D03.b : attcgatcttcccccaaaatattttatttgtaaataaaaaaatctgggggcccttatcaa
KDN01_0025_G06.b : cttataaaagcgggaattgggactctcccccaaatattatattctgttatataaaaaaat
KDN01_0001_E06.b : agagggaggggtccccccccccccccaattttt
KDN01_0009_C10.b : tttttctcccccgcngnnnntactctcaacccacacagatnnnnnnccnnnnnnnnncct
KDN01_0019_G10.b : tttttttgtataaaaaaaaatttgggggcccctccccgggggacagattttctttctcct
KDN01_0090_F07.b : tggggcccctaccaggggaaattttctttcctcaaagcggggnttgggttttttcccatc
KDN01_0056_C02.b : cctcccgggaacattttcttttctcaagggggcttagttttttccccttcaacggtctaa
KDN01_0054_D09.b : cgcccttccgagggacagtttttcttcccctcaagggggatttgtgtttattctgccttt
KDN01_0078_D11.b :
KDN01_0029_B05.b : tcccacaattatattttctttgtatataaaaaatcctgtgggccccttcaaggggaaaat
KDN01_0082_F06.b : aatttcggatcctcccccaaattatattattcttttaaatataacaaattcgggggggcc
KDN01_0067_A11.b :
KDN01_0006_C05.b : ttgtaaataaaaaattggggggcgcccccacagggtacaattttttttcctctcaagggg
KDN01_0028_F04.b : tcttcccacatatattttctgtaataaaagaaatcttggggccccttccagggaaaagat
KDN01_0070_A01.b : accttataaacggggaaattgggatctcccccca
KDN01_0045_A10.b : aaaaactttgggccctcctccagggn
KDN01_0046_C03.b : cttcaaactctaccttctttattccctcataaattgttttnccanaggggtagtttctat
KDN01_0048_H05.b : cgtatttcttcttcaagaggggctattgttttttgcatctcaagtgtcccttgattgtgg
KDN01_0052_H11.b :
KDN01_0046_A02.b : ggattttgtttg
KDN01_0080_A10.b : TGAAGCTTCCTGAAAAAGCCcttataagagctnggaacattcggaatccttccccccaca
KDN01_0005_C02.b : aaaagcctattaaaactggaaattcggattcctcccccccaaaattactaaccttcgtaa
LVRM1_0142_D07.b :
LVRM1_0138_H10.b :
KDN01_0078_D12.b : TGAGGCTTCTTGAGAAAGCCTTATTAGAAGCTGGGACATTCTGGATTCCCTCCCCCCAC*
KDN01_0064_F12.b : TGAGGCTTCTTGAGAAAGCCTTATTAGAAGCTGGGACATTCTGGATTCCTTCCCCCCACT
LVRM1_0139_C08.b : TGAGGtt
LVRM1_0127_E08.b : TGAGGTTTCTTGAGAAAGCtctataga
KDN01_0083_D04.b : TGAGGCTTCTTGAGAAAGCCTTATTAGAAGCTGGGACATTCTGGATTCCTTCCCCCCACT
20110601C-001908 : AAATATTTACTTATTCTTCTGTTAAATATACAAAAGCAAGATTCCTTGGTAGGGCCAGCT
---------+---------+---------+---------+---------+---------+ 1625
KDN01_0020_E10.b :
KDN01_0059_E07.b :
KDN01_0079_G02.b :
KDN01_0097_H05.b :
KDN01_0095_G09.b :
KDN01_0071_C10.b :
LVRM1_0063_F05.b :
LVRM1_0156_E08.b :
LVRM1_0146_G11.b :
LVR01_0035_C06.b :
LVRM1_0147_E05.b :
LVRM1_0086_B10.b :
LVRM1_0066_D02.b :
LVRM1_0083_H04.b :
LVRM1_0125_C04.b :
LVRM1_0011_E03.b :
LVRM1_0134_D10.b :
LVRM1_0045_E11.b :
LVRM1_0205_E03.b :
LVRM1_0189_B09.b :
LVRM1_0198_A04.b :
LVRM1_0185_D04.b :
LVRM1_0149_F08.b :
LVRM1_0118_D01.b :
LVRM1_0065_E06.b :
LVRM1_0089_E07.b :
LVRM1_0091_B06.b :
LVRM1_0117_H05.b :
LVRM1_0179_F11.b :
LVRM1_0202_F08.b :
LVRM1_0118_A12.b :
LVRM1_0077_F02.b :
LVRM1_0109_C06.b :
LVRM1_0069_E08.b :
LVRM1_0033_E07.b :
LVRM1_0151_B09.b :
LVRM1_0159_F07.b :
LVRM1_0157_B05.b :
LVRM1_0137_E07.b :
LVRM1_0032_H06.b :
LVRM1_0137_C07.b :
LVRM1_0156_H10.b :
LVRM1_0139_A11.b :
LVRM1_0146_H08.b :
LVRM1_0002_G07.b :
LVR01_0026_D01.b :
LVR01_0038_C05.b :
LVR01_0033_A07.b :
LVR01_0073_G12.b :
LVR01_0065_A07.b :
LVRM1_0175_D04.b :
LVRM1_0024_D05.b :
LVRM1_0199_F06.b :
LVRM1_0115_G05.b :
LVRM1_0050_G05.b :
LVRM1_0091_C09.b :
OVRM1_0211_G03.b :
ITT01_0068_C02.b : gaaaaaaa
LVRM1_0170_G04.b :
LVRM1_0181_G10.b :
LVRM1_0194_G02.b :
LVRM1_0016_G12.b :
LVRM1_0112_C05.b :
LVRM1_0042_H01.b :
LVRM1_0037_B08.b :
LVRM1_0053_H09.b :
LVRM1_0125_G05.b :
LVRM1_0013_E10.b :
LVRM1_0035_G04.b :
LVRM1_0053_C10.b :
LVRM1_0006_H02.b :
LVRM1_0122_C07.b :
LVRM1_0137_D05.b :
LVRM1_0050_H09.b :
LVR01_0054_H01.b :
LVR01_0085_G03.b :
ITT01_0021_E05.b : gtttgggggggggcgccttaaactcgggggatattctcctt
KDN01_0019_B12.b :
KDN01_0031_E05.b :
KDN01_0051_E03.b :
KDN01_0070_H04.b :
KDN01_0030_A10.b :
KDN01_0007_E10.b : nnnnnnnnnnnnnnnnnnnnnnnnnt
KDN01_0014_B11.b :
KDN01_0010_F12.b :
KDN01_0005_B01.b : gatttttatgtttttttctcctctccaaaagagttccaattaaaaaaggccgcggcccca
KDN01_0081_D10.b :
KDN01_0073_F09.b :
KDN01_0076_D08.b :
KDN01_0009_G04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
KDN01_0012_A04.b : ncggggnnnttataatagcgtgctcccaactc
KDN01_0039_D10.b : ggaacaatatctttctctttca
KDN01_0073_E11.b :
KDN01_0100_E01.b :
KDN01_0020_F07.b : tcccccacaagggggaggttgggtgtttttcccactctaaaaagggcttaaaat
KDN01_0067_G04.b : tctccggggtcnnnnnctcttgaaataacttttctcttnncncggagaatctataaataa
KDN01_0088_F03.b :
KDN01_0012_D02.b : ctaaggcgggttttgggtattctacgcattacaaaacttataanaaacggggaaaaatta
KDN01_0012_B07.b : gtcnnnnnnnnggctaaaaacnnnaaattcgccggcactgaggtatcatagtaannnnnn
KDN01_0074_A08.b :
KDN01_0030_D06.b : tctcaaggagagattttgagtttttgtaccatttcaaaagggtctacatggacttgggaa
KDN01_0074_D07.b : tcaagggcgggtttttgtgtttttccccccttcca
KDN01_0021_F03.b : agggttntttgagtggggaatagtctgttctgtctccgg
KDN01_0064_E10.b : tttggagttcttcccattcaaaaggcttaaatagggatgga
KDN01_0093_G03.b :
KDN01_0032_A07.b :
KDN01_0079_E10.b :
KDN01_0090_H01.b :
KDN01_0024_H11.b :
KDN01_0024_A11.b :
KDN01_0035_E08.b : gagtatttccgcttacaatggctctaattggacttggcaaaatgactcggtatc
KDN01_0069_H07.b :
KDN01_0035_E06.b : tttttaccttcaaaaggggtcaattaagannnnnnaaaacaactcgaaaatgggcgcgag
KDN01_0088_A07.b :
KDN01_0059_C02.b : g
KDN01_0070_H01.b :
KDN01_0058_E10.b : c
KDN01_0095_A02.b :
KDN01_0061_A05.b : aagggggagttttggtttattaccttt
KDN01_0070_C02.b : atctgtgggcgccctatcccagagggacaagagatttcttctcctctcacaaggggagga
KDN01_0043_B02.b : agtttcctttctttcagagg
KDN01_0070_B11.b :
KDN01_0067_B04.b : tctttctctccaaagcggattttggtttttttatctctcta
KDN01_0033_G03.b : ctgtgggcctccctcccgaggggaaccagatttttcttctcttccaa
KDN01_0082_E05.b : caatttctttccctctcagggggagattgtgtgtt
KDN01_0058_B12.b :
KDN01_0074_H04.b :
KDN01_0088_B10.b :
KDN01_0083_A08.b : cgatatctcttcctctcaagcgggatttttattgtttta
KDN01_0085_C06.b : ctcaaggggggcttgggtttacttcccatttaaagggtctaaattgaattggggaaaata
KDN01_0063_B09.b : tcaagggggcctttgagttttgtcccttcaaaaggttnaattaaanngggaaaaaatccg
KDN01_0076_B10.b : cttcca
KDN01_0094_E01.b :
KDN01_0098_C10.b : ggtactattttctttt
KDN01_0090_A08.b : ggggaccagaatttcttttcttccaaaggcggactttttttgtttatttccattt
KDN01_0038_D12.b :
KDN01_0070_F07.b : tccttctctcaagagggggtttgtagttttctctcgatttcaaaagggttaaaatagaga
KDN01_0067_E01.b :
KDN01_0082_A07.b :
KDN01_0097_B02.b : tgtgtgggcgccctaccaa
KDN01_0013_B11.b : gaacttgggggct
KDN01_0098_B11.b :
KDN01_0016_H12.b :
KDN01_0034_D11.b :
KDN01_0025_G09.b : cacaccggccaac
KDN01_0005_D11.b : ttttctttcctctccaagggggggttttttgttttttctttccttt
KDN01_0005_G05.b : gttttttccccttaaaaggggctaaatgaaatggggaaaaaacccggaaangggacataa
KDN01_0032_G12.b :
KDN01_0032_D09.b :
KDN01_0023_E08.b : gatgggcaaaaaacccntaatcttcctccccccctngagagggatccttcattacactct
KDN01_0034_D05.b : ggttctttcgcctttaaaaggtttaatattgattggggaaaaaatatntattccgtcttc
KDN01_0051_C03.b : ggcaaggatttttcc
KDN01_0063_F08.b : tttctctcaaggggaatttttagtttattttctc
KDN01_0019_F07.b : aaaaatttttttcctttcccaagagaggagattttggggttatttcccccttccaaaaaa
KDN01_0031_D01.b :
KDN01_0062_G03.b : ttttgttttttctctt
KDN01_0080_F12.b :
KDN01_0074_A10.b :
KDN01_0033_D10.b : gtggcccctcaaccagtgtga
KDN01_0080_A04.b :
KDN01_0070_B12.b :
KDN01_0011_B11.b :
KDN01_0071_A09.b : ctcccaagggagacaagttttcttcttctccacaagaggggattttttgtgttatttttc
KDN01_0041_D03.b : gggacacggattttcttcttccacgcgggggttttgggttattcctccttctcagggcgc
KDN01_0025_G06.b : attgtgtgcgcgccctctcagagtacaagtatttcctttctctctacaggcgggttgttt
KDN01_0001_E06.b :
KDN01_0009_C10.b : agacaaaagctactannnt
KDN01_0019_G10.b : ccaaagggg
KDN01_0090_F07.b : aacaggctcaa
KDN01_0056_C02.b : c
KDN01_0054_D09.b : caa
KDN01_0078_D11.b :
KDN01_0029_B05.b : attctttctcctccaagggcgggttttagtgttatctctccctcccacaaggcctcccca
KDN01_0082_F06.b : ccctaccacgagggaaacaaatttctccttctcctccaaaggcgagaganttagagtgtt
KDN01_0067_A11.b :
KDN01_0006_C05.b : ggtttttgggtacttcccccttcacaagggttaaattggaatggggaaataacccggaaa
KDN01_0028_F04.b : ttctttctcctcaaggggggtttgaggtttattccgattcaaagagggtcaaatagactt
KDN01_0070_A01.b :
KDN01_0045_A10.b :
KDN01_0046_C03.b : caacactcacaaatcnnnn
KDN01_0048_H05.b : taaatacctccctcctg
KDN01_0052_H11.b :
KDN01_0046_A02.b :
KDN01_0080_A10.b : taaaattaacataatccttcgttaaataaccaaaccaaaattcctggagagggcagctcc
KDN01_0005_C02.b : atacaagacaaatcctggaaggcagtcctatccaacgggatcaacgaattcccccttccc
LVRM1_0142_D07.b :
LVRM1_0138_H10.b :
KDN01_0078_D12.b : AAATATTTACTTAATCTTctngtaatatacaaaacaagatttcttggtagggccagctcc
KDN01_0064_F12.b : AAATATTTACTTATTCTTTCTGTAAATATACAAAAGCAAGATTCCTTGGTAGGGCCAGCT
LVRM1_0139_C08.b :
LVRM1_0127_E08.b :
KDN01_0083_D04.b : AAATATTTACTTATTCTTCTGTTAAATATACAAAAGCAAGATTCCTTGGTAGGGCCAGCT
20110601C-001908 : CCTAATCCCAGACTGGGGATCACAACTGAATTTTCTACTCATTCTCATCCTTACCCAAAA
---------+---------+---------+---------+---------+---------+ 1685
KDN01_0020_E10.b :
KDN01_0059_E07.b :
KDN01_0079_G02.b :
KDN01_0097_H05.b :
KDN01_0095_G09.b :
KDN01_0071_C10.b :
LVRM1_0063_F05.b :
LVRM1_0156_E08.b :
LVRM1_0146_G11.b :
LVR01_0035_C06.b :
LVRM1_0147_E05.b :
LVRM1_0086_B10.b :
LVRM1_0066_D02.b :
LVRM1_0083_H04.b :
LVRM1_0125_C04.b :
LVRM1_0011_E03.b :
LVRM1_0134_D10.b :
LVRM1_0045_E11.b :
LVRM1_0205_E03.b :
LVRM1_0189_B09.b :
LVRM1_0198_A04.b :
LVRM1_0185_D04.b :
LVRM1_0149_F08.b :
LVRM1_0118_D01.b :
LVRM1_0065_E06.b :
LVRM1_0089_E07.b :
LVRM1_0091_B06.b :
LVRM1_0117_H05.b :
LVRM1_0179_F11.b :
LVRM1_0202_F08.b :
LVRM1_0118_A12.b :
LVRM1_0077_F02.b :
LVRM1_0109_C06.b :
LVRM1_0069_E08.b :
LVRM1_0033_E07.b :
LVRM1_0151_B09.b :
LVRM1_0159_F07.b :
LVRM1_0157_B05.b :
LVRM1_0137_E07.b :
LVRM1_0032_H06.b :
LVRM1_0137_C07.b :
LVRM1_0156_H10.b :
LVRM1_0139_A11.b :
LVRM1_0146_H08.b :
LVRM1_0002_G07.b :
LVR01_0026_D01.b :
LVR01_0038_C05.b :
LVR01_0033_A07.b :
LVR01_0073_G12.b :
LVR01_0065_A07.b :
LVRM1_0175_D04.b :
LVRM1_0024_D05.b :
LVRM1_0199_F06.b :
LVRM1_0115_G05.b :
LVRM1_0050_G05.b :
LVRM1_0091_C09.b :
OVRM1_0211_G03.b :
ITT01_0068_C02.b :
LVRM1_0170_G04.b :
LVRM1_0181_G10.b :
LVRM1_0194_G02.b :
LVRM1_0016_G12.b :
LVRM1_0112_C05.b :
LVRM1_0042_H01.b :
LVRM1_0037_B08.b :
LVRM1_0053_H09.b :
LVRM1_0125_G05.b :
LVRM1_0013_E10.b :
LVRM1_0035_G04.b :
LVRM1_0053_C10.b :
LVRM1_0006_H02.b :
LVRM1_0122_C07.b :
LVRM1_0137_D05.b :
LVRM1_0050_H09.b :
LVR01_0054_H01.b :
LVR01_0085_G03.b :
ITT01_0021_E05.b :
KDN01_0019_B12.b :
KDN01_0031_E05.b :
KDN01_0051_E03.b :
KDN01_0070_H04.b :
KDN01_0030_A10.b :
KDN01_0007_E10.b :
KDN01_0014_B11.b :
KDN01_0010_F12.b :
KDN01_0005_B01.b :
KDN01_0081_D10.b :
KDN01_0073_F09.b :
KDN01_0076_D08.b :
KDN01_0009_G04.b :
KDN01_0012_A04.b :
KDN01_0039_D10.b :
KDN01_0073_E11.b :
KDN01_0100_E01.b :
KDN01_0020_F07.b :
KDN01_0067_G04.b : at
KDN01_0088_F03.b :
KDN01_0012_D02.b : gtaaaacgcgccaccgtaagctcaagc
KDN01_0012_B07.b : nnnnnnnnnnnnn
KDN01_0074_A08.b :
KDN01_0030_D06.b : t
KDN01_0074_D07.b :
KDN01_0021_F03.b :
KDN01_0064_E10.b :
KDN01_0093_G03.b :
KDN01_0032_A07.b :
KDN01_0079_E10.b :
KDN01_0090_H01.b :
KDN01_0024_H11.b :
KDN01_0024_A11.b :
KDN01_0035_E08.b :
KDN01_0069_H07.b :
KDN01_0035_E06.b : agagggagaa
KDN01_0088_A07.b :
KDN01_0059_C02.b :
KDN01_0070_H01.b :
KDN01_0058_E10.b :
KDN01_0095_A02.b :
KDN01_0061_A05.b :
KDN01_0070_C02.b : gtg
KDN01_0043_B02.b :
KDN01_0070_B11.b :
KDN01_0067_B04.b :
KDN01_0033_G03.b :
KDN01_0082_E05.b :
KDN01_0058_B12.b :
KDN01_0074_H04.b :
KDN01_0088_B10.b :
KDN01_0083_A08.b :
KDN01_0085_C06.b : tccnggaaccgtcgaaacagaaaataaaagagca
KDN01_0063_B09.b : tactctcccanncccaaagaagggtgtattaactcgcct
KDN01_0076_B10.b :
KDN01_0094_E01.b :
KDN01_0098_C10.b :
KDN01_0090_A08.b :
KDN01_0038_D12.b :
KDN01_0070_F07.b : ctggacatatagctcgga
KDN01_0067_E01.b :
KDN01_0082_A07.b :
KDN01_0097_B02.b :
KDN01_0013_B11.b :
KDN01_0098_B11.b :
KDN01_0016_H12.b :
KDN01_0034_D11.b :
KDN01_0025_G09.b :
KDN01_0005_D11.b :
KDN01_0005_G05.b : aaaaaagataaaaa
KDN01_0032_G12.b :
KDN01_0032_D09.b :
KDN01_0023_E08.b : cacnnnnnnnnnnnnnnnnnnnnn
KDN01_0034_D05.b : cnanannttggaagggctcttatatttaggactgtatannnnnn
KDN01_0051_C03.b :
KDN01_0063_F08.b :
KDN01_0019_F07.b : ggggaaaaatagagg
KDN01_0031_D01.b :
KDN01_0062_G03.b :
KDN01_0080_F12.b :
KDN01_0074_A10.b :
KDN01_0033_D10.b :
KDN01_0080_A04.b :
KDN01_0070_B12.b :
KDN01_0011_B11.b :
KDN01_0071_A09.b : tccttttta
KDN01_0041_D03.b : taaattaaaattggggtatagcacggt
KDN01_0025_G06.b : gagggttctctgccccttcaacaaggggtctaaatataacatgggattaataacactgta
KDN01_0001_E06.b :
KDN01_0009_C10.b :
KDN01_0019_G10.b :
KDN01_0090_F07.b :
KDN01_0056_C02.b :
KDN01_0054_D09.b :
KDN01_0078_D11.b :
KDN01_0029_B05.b :
KDN01_0082_F06.b : tctctcccactttcacaa
KDN01_0067_A11.b :
KDN01_0006_C05.b : nnggacaacaaaaagaaaaacaaaaa
KDN01_0028_F04.b : ggcaaatgctcgtattg
KDN01_0070_A01.b :
KDN01_0045_A10.b :
KDN01_0046_C03.b :
KDN01_0048_H05.b :
KDN01_0052_H11.b :
KDN01_0046_A02.b :
KDN01_0080_A10.b : caacccgaacggggaatcccacggaaatttcacacccttccctccctacccaaaaaggcc
KDN01_0005_C02.b : cctaccaaaggccaagacaaggttaaaatgttatttgttaccgaatttttaaaaattgaa
LVRM1_0142_D07.b :
LVRM1_0138_H10.b :
KDN01_0078_D12.b : tatccccgactggggatcacaactgaattttcactcattctcatccttacccaaaaaggc
KDN01_0064_F12.b : CCTAATCCAGACTGGGGGATCAC*ACTGAATTTTCTACTCATTCTCATCCTTTACCAAAA
LVRM1_0139_C08.b :
LVRM1_0127_E08.b :
KDN01_0083_D04.b : CCTAATCCCAGACTGGGGATCACAACTGAATTTTCTACTCATTCTCATCCTTACCCAAAA
20110601C-001908 : AAGGCGCAAGGAGCAGTAGTTTTGATAGGATTGTTTAATATCTTGTATACCATGCAAATT
---------+---------+---------+---------+---------+---------+ 1745
KDN01_0020_E10.b :
KDN01_0059_E07.b :
KDN01_0079_G02.b :
KDN01_0097_H05.b :
KDN01_0095_G09.b :
KDN01_0071_C10.b :
LVRM1_0063_F05.b :
LVRM1_0156_E08.b :
LVRM1_0146_G11.b :
LVR01_0035_C06.b :
LVRM1_0147_E05.b :
LVRM1_0086_B10.b :
LVRM1_0066_D02.b :
LVRM1_0083_H04.b :
LVRM1_0125_C04.b :
LVRM1_0011_E03.b :
LVRM1_0134_D10.b :
LVRM1_0045_E11.b :
LVRM1_0205_E03.b :
LVRM1_0189_B09.b :
LVRM1_0198_A04.b :
LVRM1_0185_D04.b :
LVRM1_0149_F08.b :
LVRM1_0118_D01.b :
LVRM1_0065_E06.b :
LVRM1_0089_E07.b :
LVRM1_0091_B06.b :
LVRM1_0117_H05.b :
LVRM1_0179_F11.b :
LVRM1_0202_F08.b :
LVRM1_0118_A12.b :
LVRM1_0077_F02.b :
LVRM1_0109_C06.b :
LVRM1_0069_E08.b :
LVRM1_0033_E07.b :
LVRM1_0151_B09.b :
LVRM1_0159_F07.b :
LVRM1_0157_B05.b :
LVRM1_0137_E07.b :
LVRM1_0032_H06.b :
LVRM1_0137_C07.b :
LVRM1_0156_H10.b :
LVRM1_0139_A11.b :
LVRM1_0146_H08.b :
LVRM1_0002_G07.b :
LVR01_0026_D01.b :
LVR01_0038_C05.b :
LVR01_0033_A07.b :
LVR01_0073_G12.b :
LVR01_0065_A07.b :
LVRM1_0175_D04.b :
LVRM1_0024_D05.b :
LVRM1_0199_F06.b :
LVRM1_0115_G05.b :
LVRM1_0050_G05.b :
LVRM1_0091_C09.b :
OVRM1_0211_G03.b :
ITT01_0068_C02.b :
LVRM1_0170_G04.b :
LVRM1_0181_G10.b :
LVRM1_0194_G02.b :
LVRM1_0016_G12.b :
LVRM1_0112_C05.b :
LVRM1_0042_H01.b :
LVRM1_0037_B08.b :
LVRM1_0053_H09.b :
LVRM1_0125_G05.b :
LVRM1_0013_E10.b :
LVRM1_0035_G04.b :
LVRM1_0053_C10.b :
LVRM1_0006_H02.b :
LVRM1_0122_C07.b :
LVRM1_0137_D05.b :
LVRM1_0050_H09.b :
LVR01_0054_H01.b :
LVR01_0085_G03.b :
ITT01_0021_E05.b :
KDN01_0019_B12.b :
KDN01_0031_E05.b :
KDN01_0051_E03.b :
KDN01_0070_H04.b :
KDN01_0030_A10.b :
KDN01_0007_E10.b :
KDN01_0014_B11.b :
KDN01_0010_F12.b :
KDN01_0005_B01.b :
KDN01_0081_D10.b :
KDN01_0073_F09.b :
KDN01_0076_D08.b :
KDN01_0009_G04.b :
KDN01_0012_A04.b :
KDN01_0039_D10.b :
KDN01_0073_E11.b :
KDN01_0100_E01.b :
KDN01_0020_F07.b :
KDN01_0067_G04.b :
KDN01_0088_F03.b :
KDN01_0012_D02.b :
KDN01_0012_B07.b :
KDN01_0074_A08.b :
KDN01_0030_D06.b :
KDN01_0074_D07.b :
KDN01_0021_F03.b :
KDN01_0064_E10.b :
KDN01_0093_G03.b :
KDN01_0032_A07.b :
KDN01_0079_E10.b :
KDN01_0090_H01.b :
KDN01_0024_H11.b :
KDN01_0024_A11.b :
KDN01_0035_E08.b :
KDN01_0069_H07.b :
KDN01_0035_E06.b :
KDN01_0088_A07.b :
KDN01_0059_C02.b :
KDN01_0070_H01.b :
KDN01_0058_E10.b :
KDN01_0095_A02.b :
KDN01_0061_A05.b :
KDN01_0070_C02.b :
KDN01_0043_B02.b :
KDN01_0070_B11.b :
KDN01_0067_B04.b :
KDN01_0033_G03.b :
KDN01_0082_E05.b :
KDN01_0058_B12.b :
KDN01_0074_H04.b :
KDN01_0088_B10.b :
KDN01_0083_A08.b :
KDN01_0085_C06.b :
KDN01_0063_B09.b :
KDN01_0076_B10.b :
KDN01_0094_E01.b :
KDN01_0098_C10.b :
KDN01_0090_A08.b :
KDN01_0038_D12.b :
KDN01_0070_F07.b :
KDN01_0067_E01.b :
KDN01_0082_A07.b :
KDN01_0097_B02.b :
KDN01_0013_B11.b :
KDN01_0098_B11.b :
KDN01_0016_H12.b :
KDN01_0034_D11.b :
KDN01_0025_G09.b :
KDN01_0005_D11.b :
KDN01_0005_G05.b :
KDN01_0032_G12.b :
KDN01_0032_D09.b :
KDN01_0023_E08.b :
KDN01_0034_D05.b :
KDN01_0051_C03.b :
KDN01_0063_F08.b :
KDN01_0019_F07.b :
KDN01_0031_D01.b :
KDN01_0062_G03.b :
KDN01_0080_F12.b :
KDN01_0074_A10.b :
KDN01_0033_D10.b :
KDN01_0080_A04.b :
KDN01_0070_B12.b :
KDN01_0011_B11.b :
KDN01_0071_A09.b :
KDN01_0041_D03.b :
KDN01_0025_G06.b : ctcgcgcgcagcgcga
KDN01_0001_E06.b :
KDN01_0009_C10.b :
KDN01_0019_G10.b :
KDN01_0090_F07.b :
KDN01_0056_C02.b :
KDN01_0054_D09.b :
KDN01_0078_D11.b :
KDN01_0029_B05.b :
KDN01_0082_F06.b :
KDN01_0067_A11.b :
KDN01_0006_C05.b :
KDN01_0028_F04.b :
KDN01_0070_A01.b :
KDN01_0045_A10.b :
KDN01_0046_C03.b :
KDN01_0048_H05.b :
KDN01_0052_H11.b :
KDN01_0046_A02.b :
KDN01_0080_A10.b : aggagcacaatttttagaagattgtttaattctggaaaccgggaattcttggt
KDN01_0005_C02.b : gttttaagaaatttgaaagacttggggcacttaaattaaaggccccacgcgggaaaacct
LVRM1_0142_D07.b :
LVRM1_0138_H10.b :
KDN01_0078_D12.b : gcaaggaccaatattttggatagaatgttaaatatctgtaaccatgcaaatctatgtcaa
KDN01_0064_F12.b : AAGGCGCAAGGAGCAGTAGTTTTGATAGGGATTGTTAATATCNTGTATACCATGCNAATT
LVRM1_0139_C08.b :
LVRM1_0127_E08.b :
KDN01_0083_D04.b : AAGGCGCAAGGAGCAGTAGTTTTGATAGGATTGTTTAATATCTTGTATACCATGCAAATT
20110601C-001908 : CTATGTCAAACAATATCTGAATGGCTTCAATTACAGTAGAATCTTTAGGTAAAGGACTCT
---------+---------+---------+---------+---------+---------+ 1805
KDN01_0020_E10.b :
KDN01_0059_E07.b :
KDN01_0079_G02.b :
KDN01_0097_H05.b :
KDN01_0095_G09.b :
KDN01_0071_C10.b :
LVRM1_0063_F05.b :
LVRM1_0156_E08.b :
LVRM1_0146_G11.b :
LVR01_0035_C06.b :
LVRM1_0147_E05.b :
LVRM1_0086_B10.b :
LVRM1_0066_D02.b :
LVRM1_0083_H04.b :
LVRM1_0125_C04.b :
LVRM1_0011_E03.b :
LVRM1_0134_D10.b :
LVRM1_0045_E11.b :
LVRM1_0205_E03.b :
LVRM1_0189_B09.b :
LVRM1_0198_A04.b :
LVRM1_0185_D04.b :
LVRM1_0149_F08.b :
LVRM1_0118_D01.b :
LVRM1_0065_E06.b :
LVRM1_0089_E07.b :
LVRM1_0091_B06.b :
LVRM1_0117_H05.b :
LVRM1_0179_F11.b :
LVRM1_0202_F08.b :
LVRM1_0118_A12.b :
LVRM1_0077_F02.b :
LVRM1_0109_C06.b :
LVRM1_0069_E08.b :
LVRM1_0033_E07.b :
LVRM1_0151_B09.b :
LVRM1_0159_F07.b :
LVRM1_0157_B05.b :
LVRM1_0137_E07.b :
LVRM1_0032_H06.b :
LVRM1_0137_C07.b :
LVRM1_0156_H10.b :
LVRM1_0139_A11.b :
LVRM1_0146_H08.b :
LVRM1_0002_G07.b :
LVR01_0026_D01.b :
LVR01_0038_C05.b :
LVR01_0033_A07.b :
LVR01_0073_G12.b :
LVR01_0065_A07.b :
LVRM1_0175_D04.b :
LVRM1_0024_D05.b :
LVRM1_0199_F06.b :
LVRM1_0115_G05.b :
LVRM1_0050_G05.b :
LVRM1_0091_C09.b :
OVRM1_0211_G03.b :
ITT01_0068_C02.b :
LVRM1_0170_G04.b :
LVRM1_0181_G10.b :
LVRM1_0194_G02.b :
LVRM1_0016_G12.b :
LVRM1_0112_C05.b :
LVRM1_0042_H01.b :
LVRM1_0037_B08.b :
LVRM1_0053_H09.b :
LVRM1_0125_G05.b :
LVRM1_0013_E10.b :
LVRM1_0035_G04.b :
LVRM1_0053_C10.b :
LVRM1_0006_H02.b :
LVRM1_0122_C07.b :
LVRM1_0137_D05.b :
LVRM1_0050_H09.b :
LVR01_0054_H01.b :
LVR01_0085_G03.b :
ITT01_0021_E05.b :
KDN01_0019_B12.b :
KDN01_0031_E05.b :
KDN01_0051_E03.b :
KDN01_0070_H04.b :
KDN01_0030_A10.b :
KDN01_0007_E10.b :
KDN01_0014_B11.b :
KDN01_0010_F12.b :
KDN01_0005_B01.b :
KDN01_0081_D10.b :
KDN01_0073_F09.b :
KDN01_0076_D08.b :
KDN01_0009_G04.b :
KDN01_0012_A04.b :
KDN01_0039_D10.b :
KDN01_0073_E11.b :
KDN01_0100_E01.b :
KDN01_0020_F07.b :
KDN01_0067_G04.b :
KDN01_0088_F03.b :
KDN01_0012_D02.b :
KDN01_0012_B07.b :
KDN01_0074_A08.b :
KDN01_0030_D06.b :
KDN01_0074_D07.b :
KDN01_0021_F03.b :
KDN01_0064_E10.b :
KDN01_0093_G03.b :
KDN01_0032_A07.b :
KDN01_0079_E10.b :
KDN01_0090_H01.b :
KDN01_0024_H11.b :
KDN01_0024_A11.b :
KDN01_0035_E08.b :
KDN01_0069_H07.b :
KDN01_0035_E06.b :
KDN01_0088_A07.b :
KDN01_0059_C02.b :
KDN01_0070_H01.b :
KDN01_0058_E10.b :
KDN01_0095_A02.b :
KDN01_0061_A05.b :
KDN01_0070_C02.b :
KDN01_0043_B02.b :
KDN01_0070_B11.b :
KDN01_0067_B04.b :
KDN01_0033_G03.b :
KDN01_0082_E05.b :
KDN01_0058_B12.b :
KDN01_0074_H04.b :
KDN01_0088_B10.b :
KDN01_0083_A08.b :
KDN01_0085_C06.b :
KDN01_0063_B09.b :
KDN01_0076_B10.b :
KDN01_0094_E01.b :
KDN01_0098_C10.b :
KDN01_0090_A08.b :
KDN01_0038_D12.b :
KDN01_0070_F07.b :
KDN01_0067_E01.b :
KDN01_0082_A07.b :
KDN01_0097_B02.b :
KDN01_0013_B11.b :
KDN01_0098_B11.b :
KDN01_0016_H12.b :
KDN01_0034_D11.b :
KDN01_0025_G09.b :
KDN01_0005_D11.b :
KDN01_0005_G05.b :
KDN01_0032_G12.b :
KDN01_0032_D09.b :
KDN01_0023_E08.b :
KDN01_0034_D05.b :
KDN01_0051_C03.b :
KDN01_0063_F08.b :
KDN01_0019_F07.b :
KDN01_0031_D01.b :
KDN01_0062_G03.b :
KDN01_0080_F12.b :
KDN01_0074_A10.b :
KDN01_0033_D10.b :
KDN01_0080_A04.b :
KDN01_0070_B12.b :
KDN01_0011_B11.b :
KDN01_0071_A09.b :
KDN01_0041_D03.b :
KDN01_0025_G06.b :
KDN01_0001_E06.b :
KDN01_0009_C10.b :
KDN01_0019_G10.b :
KDN01_0090_F07.b :
KDN01_0056_C02.b :
KDN01_0054_D09.b :
KDN01_0078_D11.b :
KDN01_0029_B05.b :
KDN01_0082_F06.b :
KDN01_0067_A11.b :
KDN01_0006_C05.b :
KDN01_0028_F04.b :
KDN01_0070_A01.b :
KDN01_0045_A10.b :
KDN01_0046_C03.b :
KDN01_0048_H05.b :
KDN01_0052_H11.b :
KDN01_0046_A02.b :
KDN01_0080_A10.b :
KDN01_0005_C02.b : ccggggtcgccccgttttgaacccactttagggggaaaaggggggaatttgcaaaaaaaa
LVRM1_0142_D07.b :
LVRM1_0138_H10.b :
KDN01_0078_D12.b : aaataatctgaaggcttcaattacgtaaaaattttaggtaaaggatcttaattggggggg
KDN01_0064_F12.b : CTATGTCAAACAtatctgaatggcttcattacagtagaatcttangtaaaggactctaan
LVRM1_0139_C08.b :
LVRM1_0127_E08.b :
KDN01_0083_D04.b : CTATGTCAAACAATATCTGAATGGCTTCAATTACAGTAGAATCTTTAGGTAAAGGACTCT
20110601C-001908 : TAATTGGGGGGGACCAATTTAAAGTACTATTAATATGGAGTTCCCACTATACTGCAGTGG
---------+---------+---------+---------+---------+---------+ 1865
KDN01_0020_E10.b :
KDN01_0059_E07.b :
KDN01_0079_G02.b :
KDN01_0097_H05.b :
KDN01_0095_G09.b :
KDN01_0071_C10.b :
LVRM1_0063_F05.b :
LVRM1_0156_E08.b :
LVRM1_0146_G11.b :
LVR01_0035_C06.b :
LVRM1_0147_E05.b :
LVRM1_0086_B10.b :
LVRM1_0066_D02.b :
LVRM1_0083_H04.b :
LVRM1_0125_C04.b :
LVRM1_0011_E03.b :
LVRM1_0134_D10.b :
LVRM1_0045_E11.b :
LVRM1_0205_E03.b :
LVRM1_0189_B09.b :
LVRM1_0198_A04.b :
LVRM1_0185_D04.b :
LVRM1_0149_F08.b :
LVRM1_0118_D01.b :
LVRM1_0065_E06.b :
LVRM1_0089_E07.b :
LVRM1_0091_B06.b :
LVRM1_0117_H05.b :
LVRM1_0179_F11.b :
LVRM1_0202_F08.b :
LVRM1_0118_A12.b :
LVRM1_0077_F02.b :
LVRM1_0109_C06.b :
LVRM1_0069_E08.b :
LVRM1_0033_E07.b :
LVRM1_0151_B09.b :
LVRM1_0159_F07.b :
LVRM1_0157_B05.b :
LVRM1_0137_E07.b :
LVRM1_0032_H06.b :
LVRM1_0137_C07.b :
LVRM1_0156_H10.b :
LVRM1_0139_A11.b :
LVRM1_0146_H08.b :
LVRM1_0002_G07.b :
LVR01_0026_D01.b :
LVR01_0038_C05.b :
LVR01_0033_A07.b :
LVR01_0073_G12.b :
LVR01_0065_A07.b :
LVRM1_0175_D04.b :
LVRM1_0024_D05.b :
LVRM1_0199_F06.b :
LVRM1_0115_G05.b :
LVRM1_0050_G05.b :
LVRM1_0091_C09.b :
OVRM1_0211_G03.b :
ITT01_0068_C02.b :
LVRM1_0170_G04.b :
LVRM1_0181_G10.b :
LVRM1_0194_G02.b :
LVRM1_0016_G12.b :
LVRM1_0112_C05.b :
LVRM1_0042_H01.b :
LVRM1_0037_B08.b :
LVRM1_0053_H09.b :
LVRM1_0125_G05.b :
LVRM1_0013_E10.b :
LVRM1_0035_G04.b :
LVRM1_0053_C10.b :
LVRM1_0006_H02.b :
LVRM1_0122_C07.b :
LVRM1_0137_D05.b :
LVRM1_0050_H09.b :
LVR01_0054_H01.b :
LVR01_0085_G03.b :
ITT01_0021_E05.b :
KDN01_0019_B12.b :
KDN01_0031_E05.b :
KDN01_0051_E03.b :
KDN01_0070_H04.b :
KDN01_0030_A10.b :
KDN01_0007_E10.b :
KDN01_0014_B11.b :
KDN01_0010_F12.b :
KDN01_0005_B01.b :
KDN01_0081_D10.b :
KDN01_0073_F09.b :
KDN01_0076_D08.b :
KDN01_0009_G04.b :
KDN01_0012_A04.b :
KDN01_0039_D10.b :
KDN01_0073_E11.b :
KDN01_0100_E01.b :
KDN01_0020_F07.b :
KDN01_0067_G04.b :
KDN01_0088_F03.b :
KDN01_0012_D02.b :
KDN01_0012_B07.b :
KDN01_0074_A08.b :
KDN01_0030_D06.b :
KDN01_0074_D07.b :
KDN01_0021_F03.b :
KDN01_0064_E10.b :
KDN01_0093_G03.b :
KDN01_0032_A07.b :
KDN01_0079_E10.b :
KDN01_0090_H01.b :
KDN01_0024_H11.b :
KDN01_0024_A11.b :
KDN01_0035_E08.b :
KDN01_0069_H07.b :
KDN01_0035_E06.b :
KDN01_0088_A07.b :
KDN01_0059_C02.b :
KDN01_0070_H01.b :
KDN01_0058_E10.b :
KDN01_0095_A02.b :
KDN01_0061_A05.b :
KDN01_0070_C02.b :
KDN01_0043_B02.b :
KDN01_0070_B11.b :
KDN01_0067_B04.b :
KDN01_0033_G03.b :
KDN01_0082_E05.b :
KDN01_0058_B12.b :
KDN01_0074_H04.b :
KDN01_0088_B10.b :
KDN01_0083_A08.b :
KDN01_0085_C06.b :
KDN01_0063_B09.b :
KDN01_0076_B10.b :
KDN01_0094_E01.b :
KDN01_0098_C10.b :
KDN01_0090_A08.b :
KDN01_0038_D12.b :
KDN01_0070_F07.b :
KDN01_0067_E01.b :
KDN01_0082_A07.b :
KDN01_0097_B02.b :
KDN01_0013_B11.b :
KDN01_0098_B11.b :
KDN01_0016_H12.b :
KDN01_0034_D11.b :
KDN01_0025_G09.b :
KDN01_0005_D11.b :
KDN01_0005_G05.b :
KDN01_0032_G12.b :
KDN01_0032_D09.b :
KDN01_0023_E08.b :
KDN01_0034_D05.b :
KDN01_0051_C03.b :
KDN01_0063_F08.b :
KDN01_0019_F07.b :
KDN01_0031_D01.b :
KDN01_0062_G03.b :
KDN01_0080_F12.b :
KDN01_0074_A10.b :
KDN01_0033_D10.b :
KDN01_0080_A04.b :
KDN01_0070_B12.b :
KDN01_0011_B11.b :
KDN01_0071_A09.b :
KDN01_0041_D03.b :
KDN01_0025_G06.b :
KDN01_0001_E06.b :
KDN01_0009_C10.b :
KDN01_0019_G10.b :
KDN01_0090_F07.b :
KDN01_0056_C02.b :
KDN01_0054_D09.b :
KDN01_0078_D11.b :
KDN01_0029_B05.b :
KDN01_0082_F06.b :
KDN01_0067_A11.b :
KDN01_0006_C05.b :
KDN01_0028_F04.b :
KDN01_0070_A01.b :
KDN01_0045_A10.b :
KDN01_0046_C03.b :
KDN01_0048_H05.b :
KDN01_0052_H11.b :
KDN01_0046_A02.b :
KDN01_0080_A10.b :
KDN01_0005_C02.b : atttcctttttatttgttt
LVRM1_0142_D07.b :
LVRM1_0138_H10.b :
KDN01_0078_D12.b : accattaaagtcttttaattggggttccccataacggcagggggtataaaaacctttgcc
KDN01_0064_F12.b : ttgggggggacaatttaangtacttttnatatggaggtccacttaactgcgtggggttaa
LVRM1_0139_C08.b :
LVRM1_0127_E08.b :
KDN01_0083_D04.b : TAATTGGGGGGGACCAATTTAAAGTACTATTAATATGGAGTTCCCACTATACTGCAGTGG
20110601C-001908 : GTTAGTAATACACCTTGTCTCTGGGTGTTGCCAGGCATGACACCAGCTGTGGTATAGGCT
---------+---------+---------+---------+---------+---------+ 1925
KDN01_0020_E10.b :
KDN01_0059_E07.b :
KDN01_0079_G02.b :
KDN01_0097_H05.b :
KDN01_0095_G09.b :
KDN01_0071_C10.b :
LVRM1_0063_F05.b :
LVRM1_0156_E08.b :
LVRM1_0146_G11.b :
LVR01_0035_C06.b :
LVRM1_0147_E05.b :
LVRM1_0086_B10.b :
LVRM1_0066_D02.b :
LVRM1_0083_H04.b :
LVRM1_0125_C04.b :
LVRM1_0011_E03.b :
LVRM1_0134_D10.b :
LVRM1_0045_E11.b :
LVRM1_0205_E03.b :
LVRM1_0189_B09.b :
LVRM1_0198_A04.b :
LVRM1_0185_D04.b :
LVRM1_0149_F08.b :
LVRM1_0118_D01.b :
LVRM1_0065_E06.b :
LVRM1_0089_E07.b :
LVRM1_0091_B06.b :
LVRM1_0117_H05.b :
LVRM1_0179_F11.b :
LVRM1_0202_F08.b :
LVRM1_0118_A12.b :
LVRM1_0077_F02.b :
LVRM1_0109_C06.b :
LVRM1_0069_E08.b :
LVRM1_0033_E07.b :
LVRM1_0151_B09.b :
LVRM1_0159_F07.b :
LVRM1_0157_B05.b :
LVRM1_0137_E07.b :
LVRM1_0032_H06.b :
LVRM1_0137_C07.b :
LVRM1_0156_H10.b :
LVRM1_0139_A11.b :
LVRM1_0146_H08.b :
LVRM1_0002_G07.b :
LVR01_0026_D01.b :
LVR01_0038_C05.b :
LVR01_0033_A07.b :
LVR01_0073_G12.b :
LVR01_0065_A07.b :
LVRM1_0175_D04.b :
LVRM1_0024_D05.b :
LVRM1_0199_F06.b :
LVRM1_0115_G05.b :
LVRM1_0050_G05.b :
LVRM1_0091_C09.b :
OVRM1_0211_G03.b :
ITT01_0068_C02.b :
LVRM1_0170_G04.b :
LVRM1_0181_G10.b :
LVRM1_0194_G02.b :
LVRM1_0016_G12.b :
LVRM1_0112_C05.b :
LVRM1_0042_H01.b :
LVRM1_0037_B08.b :
LVRM1_0053_H09.b :
LVRM1_0125_G05.b :
LVRM1_0013_E10.b :
LVRM1_0035_G04.b :
LVRM1_0053_C10.b :
LVRM1_0006_H02.b :
LVRM1_0122_C07.b :
LVRM1_0137_D05.b :
LVRM1_0050_H09.b :
LVR01_0054_H01.b :
LVR01_0085_G03.b :
ITT01_0021_E05.b :
KDN01_0019_B12.b :
KDN01_0031_E05.b :
KDN01_0051_E03.b :
KDN01_0070_H04.b :
KDN01_0030_A10.b :
KDN01_0007_E10.b :
KDN01_0014_B11.b :
KDN01_0010_F12.b :
KDN01_0005_B01.b :
KDN01_0081_D10.b :
KDN01_0073_F09.b :
KDN01_0076_D08.b :
KDN01_0009_G04.b :
KDN01_0012_A04.b :
KDN01_0039_D10.b :
KDN01_0073_E11.b :
KDN01_0100_E01.b :
KDN01_0020_F07.b :
KDN01_0067_G04.b :
KDN01_0088_F03.b :
KDN01_0012_D02.b :
KDN01_0012_B07.b :
KDN01_0074_A08.b :
KDN01_0030_D06.b :
KDN01_0074_D07.b :
KDN01_0021_F03.b :
KDN01_0064_E10.b :
KDN01_0093_G03.b :
KDN01_0032_A07.b :
KDN01_0079_E10.b :
KDN01_0090_H01.b :
KDN01_0024_H11.b :
KDN01_0024_A11.b :
KDN01_0035_E08.b :
KDN01_0069_H07.b :
KDN01_0035_E06.b :
KDN01_0088_A07.b :
KDN01_0059_C02.b :
KDN01_0070_H01.b :
KDN01_0058_E10.b :
KDN01_0095_A02.b :
KDN01_0061_A05.b :
KDN01_0070_C02.b :
KDN01_0043_B02.b :
KDN01_0070_B11.b :
KDN01_0067_B04.b :
KDN01_0033_G03.b :
KDN01_0082_E05.b :
KDN01_0058_B12.b :
KDN01_0074_H04.b :
KDN01_0088_B10.b :
KDN01_0083_A08.b :
KDN01_0085_C06.b :
KDN01_0063_B09.b :
KDN01_0076_B10.b :
KDN01_0094_E01.b :
KDN01_0098_C10.b :
KDN01_0090_A08.b :
KDN01_0038_D12.b :
KDN01_0070_F07.b :
KDN01_0067_E01.b :
KDN01_0082_A07.b :
KDN01_0097_B02.b :
KDN01_0013_B11.b :
KDN01_0098_B11.b :
KDN01_0016_H12.b :
KDN01_0034_D11.b :
KDN01_0025_G09.b :
KDN01_0005_D11.b :
KDN01_0005_G05.b :
KDN01_0032_G12.b :
KDN01_0032_D09.b :
KDN01_0023_E08.b :
KDN01_0034_D05.b :
KDN01_0051_C03.b :
KDN01_0063_F08.b :
KDN01_0019_F07.b :
KDN01_0031_D01.b :
KDN01_0062_G03.b :
KDN01_0080_F12.b :
KDN01_0074_A10.b :
KDN01_0033_D10.b :
KDN01_0080_A04.b :
KDN01_0070_B12.b :
KDN01_0011_B11.b :
KDN01_0071_A09.b :
KDN01_0041_D03.b :
KDN01_0025_G06.b :
KDN01_0001_E06.b :
KDN01_0009_C10.b :
KDN01_0019_G10.b :
KDN01_0090_F07.b :
KDN01_0056_C02.b :
KDN01_0054_D09.b :
KDN01_0078_D11.b :
KDN01_0029_B05.b :
KDN01_0082_F06.b :
KDN01_0067_A11.b :
KDN01_0006_C05.b :
KDN01_0028_F04.b :
KDN01_0070_A01.b :
KDN01_0045_A10.b :
KDN01_0046_C03.b :
KDN01_0048_H05.b :
KDN01_0052_H11.b :
KDN01_0046_A02.b :
KDN01_0080_A10.b :
KDN01_0005_C02.b :
LVRM1_0142_D07.b :
LVRM1_0138_H10.b :
KDN01_0078_D12.b : tggggtttcccgaataaacaccctgggaataggtcaaaggcctggacattattggacagg
KDN01_0064_F12.b : aaaaaccttgtctcctggggttgcagnaataaaccacttgtggaaagctgccaaagccct
LVRM1_0139_C08.b :
LVRM1_0127_E08.b :
KDN01_0083_D04.b : GTTAGTAATACACCTTGTCTCTGGGTGTTGCCAGGCATGACACCAGCTGTGGTATAGGCT
20110601C-001908 : GCAAAAGGCCTGGAACTT..........................................
---------+---------+---------+---------+---------+---------+ 1943
KDN01_0020_E10.b :
KDN01_0059_E07.b :
KDN01_0079_G02.b :
KDN01_0097_H05.b :
KDN01_0095_G09.b :
KDN01_0071_C10.b :
LVRM1_0063_F05.b :
LVRM1_0156_E08.b :
LVRM1_0146_G11.b :
LVR01_0035_C06.b :
LVRM1_0147_E05.b :
LVRM1_0086_B10.b :
LVRM1_0066_D02.b :
LVRM1_0083_H04.b :
LVRM1_0125_C04.b :
LVRM1_0011_E03.b :
LVRM1_0134_D10.b :
LVRM1_0045_E11.b :
LVRM1_0205_E03.b :
LVRM1_0189_B09.b :
LVRM1_0198_A04.b :
LVRM1_0185_D04.b :
LVRM1_0149_F08.b :
LVRM1_0118_D01.b :
LVRM1_0065_E06.b :
LVRM1_0089_E07.b :
LVRM1_0091_B06.b :
LVRM1_0117_H05.b :
LVRM1_0179_F11.b :
LVRM1_0202_F08.b :
LVRM1_0118_A12.b :
LVRM1_0077_F02.b :
LVRM1_0109_C06.b :
LVRM1_0069_E08.b :
LVRM1_0033_E07.b :
LVRM1_0151_B09.b :
LVRM1_0159_F07.b :
LVRM1_0157_B05.b :
LVRM1_0137_E07.b :
LVRM1_0032_H06.b :
LVRM1_0137_C07.b :
LVRM1_0156_H10.b :
LVRM1_0139_A11.b :
LVRM1_0146_H08.b :
LVRM1_0002_G07.b :
LVR01_0026_D01.b :
LVR01_0038_C05.b :
LVR01_0033_A07.b :
LVR01_0073_G12.b :
LVR01_0065_A07.b :
LVRM1_0175_D04.b :
LVRM1_0024_D05.b :
LVRM1_0199_F06.b :
LVRM1_0115_G05.b :
LVRM1_0050_G05.b :
LVRM1_0091_C09.b :
OVRM1_0211_G03.b :
ITT01_0068_C02.b :
LVRM1_0170_G04.b :
LVRM1_0181_G10.b :
LVRM1_0194_G02.b :
LVRM1_0016_G12.b :
LVRM1_0112_C05.b :
LVRM1_0042_H01.b :
LVRM1_0037_B08.b :
LVRM1_0053_H09.b :
LVRM1_0125_G05.b :
LVRM1_0013_E10.b :
LVRM1_0035_G04.b :
LVRM1_0053_C10.b :
LVRM1_0006_H02.b :
LVRM1_0122_C07.b :
LVRM1_0137_D05.b :
LVRM1_0050_H09.b :
LVR01_0054_H01.b :
LVR01_0085_G03.b :
ITT01_0021_E05.b :
KDN01_0019_B12.b :
KDN01_0031_E05.b :
KDN01_0051_E03.b :
KDN01_0070_H04.b :
KDN01_0030_A10.b :
KDN01_0007_E10.b :
KDN01_0014_B11.b :
KDN01_0010_F12.b :
KDN01_0005_B01.b :
KDN01_0081_D10.b :
KDN01_0073_F09.b :
KDN01_0076_D08.b :
KDN01_0009_G04.b :
KDN01_0012_A04.b :
KDN01_0039_D10.b :
KDN01_0073_E11.b :
KDN01_0100_E01.b :
KDN01_0020_F07.b :
KDN01_0067_G04.b :
KDN01_0088_F03.b :
KDN01_0012_D02.b :
KDN01_0012_B07.b :
KDN01_0074_A08.b :
KDN01_0030_D06.b :
KDN01_0074_D07.b :
KDN01_0021_F03.b :
KDN01_0064_E10.b :
KDN01_0093_G03.b :
KDN01_0032_A07.b :
KDN01_0079_E10.b :
KDN01_0090_H01.b :
KDN01_0024_H11.b :
KDN01_0024_A11.b :
KDN01_0035_E08.b :
KDN01_0069_H07.b :
KDN01_0035_E06.b :
KDN01_0088_A07.b :
KDN01_0059_C02.b :
KDN01_0070_H01.b :
KDN01_0058_E10.b :
KDN01_0095_A02.b :
KDN01_0061_A05.b :
KDN01_0070_C02.b :
KDN01_0043_B02.b :
KDN01_0070_B11.b :
KDN01_0067_B04.b :
KDN01_0033_G03.b :
KDN01_0082_E05.b :
KDN01_0058_B12.b :
KDN01_0074_H04.b :
KDN01_0088_B10.b :
KDN01_0083_A08.b :
KDN01_0085_C06.b :
KDN01_0063_B09.b :
KDN01_0076_B10.b :
KDN01_0094_E01.b :
KDN01_0098_C10.b :
KDN01_0090_A08.b :
KDN01_0038_D12.b :
KDN01_0070_F07.b :
KDN01_0067_E01.b :
KDN01_0082_A07.b :
KDN01_0097_B02.b :
KDN01_0013_B11.b :
KDN01_0098_B11.b :
KDN01_0016_H12.b :
KDN01_0034_D11.b :
KDN01_0025_G09.b :
KDN01_0005_D11.b :
KDN01_0005_G05.b :
KDN01_0032_G12.b :
KDN01_0032_D09.b :
KDN01_0023_E08.b :
KDN01_0034_D05.b :
KDN01_0051_C03.b :
KDN01_0063_F08.b :
KDN01_0019_F07.b :
KDN01_0031_D01.b :
KDN01_0062_G03.b :
KDN01_0080_F12.b :
KDN01_0074_A10.b :
KDN01_0033_D10.b :
KDN01_0080_A04.b :
KDN01_0070_B12.b :
KDN01_0011_B11.b :
KDN01_0071_A09.b :
KDN01_0041_D03.b :
KDN01_0025_G06.b :
KDN01_0001_E06.b :
KDN01_0009_C10.b :
KDN01_0019_G10.b :
KDN01_0090_F07.b :
KDN01_0056_C02.b :
KDN01_0054_D09.b :
KDN01_0078_D11.b :
KDN01_0029_B05.b :
KDN01_0082_F06.b :
KDN01_0067_A11.b :
KDN01_0006_C05.b :
KDN01_0028_F04.b :
KDN01_0070_A01.b :
KDN01_0045_A10.b :
KDN01_0046_C03.b :
KDN01_0048_H05.b :
KDN01_0052_H11.b :
KDN01_0046_A02.b :
KDN01_0080_A10.b :
KDN01_0005_C02.b :
LVRM1_0142_D07.b :
LVRM1_0138_H10.b :
KDN01_0078_D12.b : gttgggcga
KDN01_0064_F12.b : gaacttattggtaaaggttggcggaaaaaatgtgtggggggggggggaaattcttttggg
LVRM1_0139_C08.b :
LVRM1_0127_E08.b :
KDN01_0083_D04.b : GCAAAAGGCCTGGAACTTacatgtgaccaaggtatgggcaggaaaaaatattggttgaag
20110601C-001908 : ............................................................
---------+---------+---------+---------+---------+---------+ 1943
KDN01_0020_E10.b :
KDN01_0059_E07.b :
KDN01_0079_G02.b :
KDN01_0097_H05.b :
KDN01_0095_G09.b :
KDN01_0071_C10.b :
LVRM1_0063_F05.b :
LVRM1_0156_E08.b :
LVRM1_0146_G11.b :
LVR01_0035_C06.b :
LVRM1_0147_E05.b :
LVRM1_0086_B10.b :
LVRM1_0066_D02.b :
LVRM1_0083_H04.b :
LVRM1_0125_C04.b :
LVRM1_0011_E03.b :
LVRM1_0134_D10.b :
LVRM1_0045_E11.b :
LVRM1_0205_E03.b :
LVRM1_0189_B09.b :
LVRM1_0198_A04.b :
LVRM1_0185_D04.b :
LVRM1_0149_F08.b :
LVRM1_0118_D01.b :
LVRM1_0065_E06.b :
LVRM1_0089_E07.b :
LVRM1_0091_B06.b :
LVRM1_0117_H05.b :
LVRM1_0179_F11.b :
LVRM1_0202_F08.b :
LVRM1_0118_A12.b :
LVRM1_0077_F02.b :
LVRM1_0109_C06.b :
LVRM1_0069_E08.b :
LVRM1_0033_E07.b :
LVRM1_0151_B09.b :
LVRM1_0159_F07.b :
LVRM1_0157_B05.b :
LVRM1_0137_E07.b :
LVRM1_0032_H06.b :
LVRM1_0137_C07.b :
LVRM1_0156_H10.b :
LVRM1_0139_A11.b :
LVRM1_0146_H08.b :
LVRM1_0002_G07.b :
LVR01_0026_D01.b :
LVR01_0038_C05.b :
LVR01_0033_A07.b :
LVR01_0073_G12.b :
LVR01_0065_A07.b :
LVRM1_0175_D04.b :
LVRM1_0024_D05.b :
LVRM1_0199_F06.b :
LVRM1_0115_G05.b :
LVRM1_0050_G05.b :
LVRM1_0091_C09.b :
OVRM1_0211_G03.b :
ITT01_0068_C02.b :
LVRM1_0170_G04.b :
LVRM1_0181_G10.b :
LVRM1_0194_G02.b :
LVRM1_0016_G12.b :
LVRM1_0112_C05.b :
LVRM1_0042_H01.b :
LVRM1_0037_B08.b :
LVRM1_0053_H09.b :
LVRM1_0125_G05.b :
LVRM1_0013_E10.b :
LVRM1_0035_G04.b :
LVRM1_0053_C10.b :
LVRM1_0006_H02.b :
LVRM1_0122_C07.b :
LVRM1_0137_D05.b :
LVRM1_0050_H09.b :
LVR01_0054_H01.b :
LVR01_0085_G03.b :
ITT01_0021_E05.b :
KDN01_0019_B12.b :
KDN01_0031_E05.b :
KDN01_0051_E03.b :
KDN01_0070_H04.b :
KDN01_0030_A10.b :
KDN01_0007_E10.b :
KDN01_0014_B11.b :
KDN01_0010_F12.b :
KDN01_0005_B01.b :
KDN01_0081_D10.b :
KDN01_0073_F09.b :
KDN01_0076_D08.b :
KDN01_0009_G04.b :
KDN01_0012_A04.b :
KDN01_0039_D10.b :
KDN01_0073_E11.b :
KDN01_0100_E01.b :
KDN01_0020_F07.b :
KDN01_0067_G04.b :
KDN01_0088_F03.b :
KDN01_0012_D02.b :
KDN01_0012_B07.b :
KDN01_0074_A08.b :
KDN01_0030_D06.b :
KDN01_0074_D07.b :
KDN01_0021_F03.b :
KDN01_0064_E10.b :
KDN01_0093_G03.b :
KDN01_0032_A07.b :
KDN01_0079_E10.b :
KDN01_0090_H01.b :
KDN01_0024_H11.b :
KDN01_0024_A11.b :
KDN01_0035_E08.b :
KDN01_0069_H07.b :
KDN01_0035_E06.b :
KDN01_0088_A07.b :
KDN01_0059_C02.b :
KDN01_0070_H01.b :
KDN01_0058_E10.b :
KDN01_0095_A02.b :
KDN01_0061_A05.b :
KDN01_0070_C02.b :
KDN01_0043_B02.b :
KDN01_0070_B11.b :
KDN01_0067_B04.b :
KDN01_0033_G03.b :
KDN01_0082_E05.b :
KDN01_0058_B12.b :
KDN01_0074_H04.b :
KDN01_0088_B10.b :
KDN01_0083_A08.b :
KDN01_0085_C06.b :
KDN01_0063_B09.b :
KDN01_0076_B10.b :
KDN01_0094_E01.b :
KDN01_0098_C10.b :
KDN01_0090_A08.b :
KDN01_0038_D12.b :
KDN01_0070_F07.b :
KDN01_0067_E01.b :
KDN01_0082_A07.b :
KDN01_0097_B02.b :
KDN01_0013_B11.b :
KDN01_0098_B11.b :
KDN01_0016_H12.b :
KDN01_0034_D11.b :
KDN01_0025_G09.b :
KDN01_0005_D11.b :
KDN01_0005_G05.b :
KDN01_0032_G12.b :
KDN01_0032_D09.b :
KDN01_0023_E08.b :
KDN01_0034_D05.b :
KDN01_0051_C03.b :
KDN01_0063_F08.b :
KDN01_0019_F07.b :
KDN01_0031_D01.b :
KDN01_0062_G03.b :
KDN01_0080_F12.b :
KDN01_0074_A10.b :
KDN01_0033_D10.b :
KDN01_0080_A04.b :
KDN01_0070_B12.b :
KDN01_0011_B11.b :
KDN01_0071_A09.b :
KDN01_0041_D03.b :
KDN01_0025_G06.b :
KDN01_0001_E06.b :
KDN01_0009_C10.b :
KDN01_0019_G10.b :
KDN01_0090_F07.b :
KDN01_0056_C02.b :
KDN01_0054_D09.b :
KDN01_0078_D11.b :
KDN01_0029_B05.b :
KDN01_0082_F06.b :
KDN01_0067_A11.b :
KDN01_0006_C05.b :
KDN01_0028_F04.b :
KDN01_0070_A01.b :
KDN01_0045_A10.b :
KDN01_0046_C03.b :
KDN01_0048_H05.b :
KDN01_0052_H11.b :
KDN01_0046_A02.b :
KDN01_0080_A10.b :
KDN01_0005_C02.b :
LVRM1_0142_D07.b :
LVRM1_0138_H10.b :
KDN01_0078_D12.b :
KDN01_0064_F12.b : cccaaaaaaatcaaaaa
LVRM1_0139_C08.b :
LVRM1_0127_E08.b :
KDN01_0083_D04.b : gggtgggagaatccctgttgtggcccacaaaaacgaatccactattaacctgaaattttg
20110601C-001908 : ............................................................
---------+---------+---------+---------+---------+---------+ 1943
KDN01_0020_E10.b :
KDN01_0059_E07.b :
KDN01_0079_G02.b :
KDN01_0097_H05.b :
KDN01_0095_G09.b :
KDN01_0071_C10.b :
LVRM1_0063_F05.b :
LVRM1_0156_E08.b :
LVRM1_0146_G11.b :
LVR01_0035_C06.b :
LVRM1_0147_E05.b :
LVRM1_0086_B10.b :
LVRM1_0066_D02.b :
LVRM1_0083_H04.b :
LVRM1_0125_C04.b :
LVRM1_0011_E03.b :
LVRM1_0134_D10.b :
LVRM1_0045_E11.b :
LVRM1_0205_E03.b :
LVRM1_0189_B09.b :
LVRM1_0198_A04.b :
LVRM1_0185_D04.b :
LVRM1_0149_F08.b :
LVRM1_0118_D01.b :
LVRM1_0065_E06.b :
LVRM1_0089_E07.b :
LVRM1_0091_B06.b :
LVRM1_0117_H05.b :
LVRM1_0179_F11.b :
LVRM1_0202_F08.b :
LVRM1_0118_A12.b :
LVRM1_0077_F02.b :
LVRM1_0109_C06.b :
LVRM1_0069_E08.b :
LVRM1_0033_E07.b :
LVRM1_0151_B09.b :
LVRM1_0159_F07.b :
LVRM1_0157_B05.b :
LVRM1_0137_E07.b :
LVRM1_0032_H06.b :
LVRM1_0137_C07.b :
LVRM1_0156_H10.b :
LVRM1_0139_A11.b :
LVRM1_0146_H08.b :
LVRM1_0002_G07.b :
LVR01_0026_D01.b :
LVR01_0038_C05.b :
LVR01_0033_A07.b :
LVR01_0073_G12.b :
LVR01_0065_A07.b :
LVRM1_0175_D04.b :
LVRM1_0024_D05.b :
LVRM1_0199_F06.b :
LVRM1_0115_G05.b :
LVRM1_0050_G05.b :
LVRM1_0091_C09.b :
OVRM1_0211_G03.b :
ITT01_0068_C02.b :
LVRM1_0170_G04.b :
LVRM1_0181_G10.b :
LVRM1_0194_G02.b :
LVRM1_0016_G12.b :
LVRM1_0112_C05.b :
LVRM1_0042_H01.b :
LVRM1_0037_B08.b :
LVRM1_0053_H09.b :
LVRM1_0125_G05.b :
LVRM1_0013_E10.b :
LVRM1_0035_G04.b :
LVRM1_0053_C10.b :
LVRM1_0006_H02.b :
LVRM1_0122_C07.b :
LVRM1_0137_D05.b :
LVRM1_0050_H09.b :
LVR01_0054_H01.b :
LVR01_0085_G03.b :
ITT01_0021_E05.b :
KDN01_0019_B12.b :
KDN01_0031_E05.b :
KDN01_0051_E03.b :
KDN01_0070_H04.b :
KDN01_0030_A10.b :
KDN01_0007_E10.b :
KDN01_0014_B11.b :
KDN01_0010_F12.b :
KDN01_0005_B01.b :
KDN01_0081_D10.b :
KDN01_0073_F09.b :
KDN01_0076_D08.b :
KDN01_0009_G04.b :
KDN01_0012_A04.b :
KDN01_0039_D10.b