[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-002188

Length: 1,356

Sequence [FASTA format sequence]
TGGACTTCCG GTGGCGGCCG TGAGCGTCTT CCGGCCACGC GCGAGTTTGT TCCGGTCGGC
CTCCGGGACA TGAAGCCCCC CGGACCCCGA GCTTGGACCC TGCCGTGACA GGCCCGCACC
ATGCGAAGCC TCCTCGGCGC GCTCTGGCTC GCTCTGGCTT GCGGCTCTGC TCACGGCACC
CTGTCGAAGT CCGATGCCAA AAAGGCTGCC TCCAAGACAC TGCCGGAGAA GACTCAGGTT
GCGGGCGTGC CCGTCCAGGA GCGGGGTCTG GTGGTGACAG ACCTCAGAGC CGAGGACGTG
GTTCTTGAGC ATCGCAGCTA CTGCTCCGCG AAGGCCCTCA GGAAACACTT TGCCGGGGAC
GTCCTGGGCT ACGTCACTCC ATGGAACAGC CACGGCTACG ACATCGCCAA GATCTTTGCG
GGCAAGTTCA CCCACGTGGC GCCCGTGTGG CTGCAGCTGA GGCGGCATGG CCGCGAGATG
TTCGAGGTCA CAGGCCTCGA CGACGTGGAC CAAGGGTGGA TGCGAGCAGT CAGGAAGCAG
ACCAAGGGCC TCCGCATAGT GCCCCGGCTC CGGTTTGAGG ACTGGACGTA CGAGGACTTC
CGGAACGTCC TGGACAGTGA GGACGAGATA GAGGAGCTGA GCAGGACTGT GGTCCAGGTG
GCCAAGAGCC AGCGCTTCGA CGGCTTCGTG GTGGAGGTCT GGAACCAGCT GCTGATCCAG
AAGCACGTGG GCCTCATTCA CATGCTCACC CACGTGGTCG AGGCGCTGCA CCAGGCCCGG
CTGCTGGCCA TCCTGGTCAT CCCCCCCGCC GTCGCCCCCG GGACCAACAA GCTGGGCGTG
TTCACGCACA AGGAGTTTGA GCAGCTGGCG CCCCTGCTGG ACGGCTTCAG CCTCATGACC
TACGACTACT CCACGGCGCA GCAGCCTGGC CCCAACGCAC CGCTGTCCTG GGTGCGGGCC
TGTGTCCAGG TCCTGGACCC CAAGTCCCGG TGGCGGAGCA AGATCCTGCT GGGGCTCAAC
TTCTACGGCA TGGACTACGC AGCCTCCAAG GATGCCCGCG AGCCCATCAT TGGGGCCAGG
TACATCCAGA CGCTGAAGGA CCACAGGCCC CGGATCACGT GGGACAGCCA AGCCGCAGAG
CACGTCTTCG AGTACAAGAA GAACCGCGGT GGGAGGCACA TCGTCTTCTA CCCGACGCTG
AAGTCCTTGC AGGTGCGGCT TGAGCTGGCC AGGGAGTTGG GCGTCGGGCT GTCCATCTTG
GGAGCTGGGC CAGGGCCTGG ACTAACTTCT ACGACCCTGC TGTAGGCTGG GCCTGGACTG
GCCTGCACAA TAAAGAACTT CTTCTCCGCC CTTCTT


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCHID1chitinase domain-containing protein 1 isoform a [Homo sapiens]. 619e-177O
Contig/Assembly ProteinCHID1chitinase domain-containing protein 1 isoform a [Homo sapiens]. 619e-177O
Contig/Assembly ProteinCHID1chitinase domain-containing protein 1 isoform a [Homo sapiens]. 619e-177O
Contig/Assembly ProteinCHID1chitinase domain-containing protein 1 isoform b [Homo sapiens]. 612e-175O
Contig/Assembly ProteinCHID1chitinase domain-containing protein 1 isoform c [Homo sapiens]. 548e-156O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinChid1chitinase domain-containing protein 1 isoform 1 [Mus musculus]. 622e-178O
Contig/Assembly ProteinChid1chitinase domain-containing protein 1 isoform 2 [Mus musculus]. 3402e-93O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC475993PREDICTED: similar to CG8460-PA isoform 1 [Canis familiaris]. 627e-179O
Contig/Assembly ProteinLOC475993PREDICTED: similar to CG8460-PA isoform 3 [Canis familiaris]. 617e-176O
Contig/Assembly ProteinLOC475993PREDICTED: similar to CG8460-PA isoform 2 [Canis familiaris]. 555e-158O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCHID1chitinase domain-containing protein 1 precursor [Bos taurus]. 6430.0O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCHID1chitinase domain containing 1 [Sus scrofa]. 7110.0O


Assembly Members: 86      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
BFLT10006H07BFLT1_0006_H07.bFS640489 
BFLT10101C03BFLT1_0101_C03.bHX201799 
CLNT10018F10CLNT1_0018_F10.bFS658499 
ITT010012B04ITT01_0012_B04.bBW977062 
ITT010064C08ITT01_0064_C08.bBW981680 
LNG010087D10LNG01_0087_D10.bBP436727 
LVR010030B10LVR01_0030_B10.bBP442570 
LVRM10036H12LVRM1_0036_H12.bCJ001544 
MLN010023B06MLN01_0023_B06.bCJ009375 
MLN010050C06MLN01_0050_C06.bCJ011517 
OVR010013E08OVR01_0013_E08.b  
OVR010055F06OVR01_0055_F06.bBW964538 
OVR010066D12OVR01_0066_D12.bBW965500 
OVR010086F08OVR01_0086_F08.bBW967105 
OVR010094C11OVR01_0094_C11.bBW967683 
OVR010104G10OVR01_0104_G10.bBW968527 
OVRM10022G05OVRM1_0022_G05.bBP152791 
OVRM10067H09OVRM1_0067_H09.bBP154597 
OVRM10068D09OVRM1_0068_D09.bBP149528 
OVRM10213H07OVRM1_0213_H07.bBP461887 
OVRT10012G12OVRT1_0012_G12.bFS687407 
OVRT10116B03OVRT1_0116_B03.bHX236085 
PCT010012H04PCT01_0012_H04.bFS695482 
PTG010019B07PTG01_0019_B07.bFS706062 
PTG010032G07PTG01_0032_G07.bFS707253 
PTG010047G03PTG01_0047_G03.bFS708592 
PTG010053B07PTG01_0053_B07.bFS709068 
PTG010056E05PTG01_0056_E05.bFS709339 
PTG010074G02PTG01_0074_G02.bFS710724 
PTG010099D06PTG01_0099_D06.b  
SKNB10024G04SKNB1_0024_G04.b  
SKNB10058F04SKNB1_0058_F04.bDB803487 
SKNB10059H06SKNB1_0059_H06.bDB803569 
SMG010001C02SMG01_0001_C02.bFS713494 
SMG010019F07SMG01_0019_F07.bFS714934 
SMG010044A12SMG01_0044_A12.bFS717078 
SMG010044G08SMG01_0044_G08.bFS717142 
SMG010067G02SMG01_0067_G02.bFS719088 
SMG010091E12SMG01_0091_E12.bFS721148 
SPLT10039G07SPLT1_0039_G07.bHX242253 
SPLT10095C11SPLT1_0095_C11.bHX246602 
TCH010043D08TCH01_0043_D08.bCJ025659 AK399325
TCH010064E12TCH01_0064_E12.bCJ027022 
TCH010066A01TCH01_0066_A01.bCJ027132 
TCH010071G06TCH01_0071_G06.bCJ027557 
TCH010100F02TCH01_0100_F02.bCJ029763 
TES010001A10TES01_0001_A10.bCJ030028 
TES010003D05TES01_0003_D05.bCJ030186 
TES010003G10TES01_0003_G10.bCJ030210 
TES010005B06TES01_0005_B06.bCJ030303 
TES010005F04TES01_0005_F04.bCJ030338 
TES010006E11TES01_0006_E11.bCJ030407 
TES010009B08TES01_0009_B08.bCJ030579 
TES010010G05TES01_0010_G05.b  
TES010020F06TES01_0020_F06.bCJ031360 
TES010024H02TES01_0024_H02.bCJ031644 
TES010031H01TES01_0031_H01.bCJ032080 
TES010036B02TES01_0036_B02.bCJ032356 
TES010053C10TES01_0053_C10.bCJ033386 
TES010055H03TES01_0055_H03.bCJ033524 
TES010056F03TES01_0056_F03.bCJ033581 
TES010061G05TES01_0061_G05.b  
TES010063E12TES01_0063_E12.bCJ034072 AK238545
TES010064B08TES01_0064_B08.b  
TES010065E03TES01_0065_E03.bCJ034189 
TES010069E05TES01_0069_E05.bCJ034462 
TES010071H03TES01_0071_H03.bCJ034615 
TES010076H01TES01_0076_H01.bCJ034925 
TES010078B06TES01_0078_B06.bCJ034997 
TES010081H08TES01_0081_H08.bCJ035255 
TES010082G01TES01_0082_G01.bCJ035310 
TES010084C04TES01_0084_C04.bCJ035416 
TES010084F04TES01_0084_F04.bCJ035441 
TES010091F07TES01_0091_F07.bCJ035907 
TES010099D01TES01_0099_D01.bCJ036476 
TES010100E01TES01_0100_E01.bCJ036563 
TES010102C04TES01_0102_C04.bCJ036690 
TES010104A07TES01_0104_A07.bCJ036822 
TES010105B07TES01_0105_B07.bCJ036908 
TES010105D10TES01_0105_D10.b  
TES010106C01TES01_0106_C01.bCJ036986 
THY010101B08THY01_0101_B08.b  AK239405
UTR010056B07UTR01_0056_B07.bBP463111 
UTR010066B10UTR01_0066_B10.bBP463190 
UTR010088F11UTR01_0088_F11.bCJ038148 
UTR010102E10UTR01_0102_E10.bCJ039337 

  

SNPs: 4      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
86C7410.949M-
T040.051
603C430.101OSCGC/R
G6110.899CGG/R
754A1410.366ONATG/M
G2420.634GTG/V
765A1300.342WSGCA/A
G2320.658GCG/A


Alignment:      TOP

20110601C-002188 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
TCH01_0043_D08.b : nnnnggcatggactatgacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0071_H03.b : tttt
TCH01_0064_E12.b : ttttgggatgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0087_D10.b : cgggggagatggacttanaagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0100_F02.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0012_G12.b : nttttccgttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0061_G05.b :
TES01_0024_H02.b :
TES01_0053_C10.b :
TES01_0006_E11.b :
TES01_0069_E05.b :
OVR01_0094_C11.b : ngggcatggactataacxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0084_C04.b :
SPLT1_0095_C11.b : nnnccgcgattagaggccgtaxxxxxxx
BFLT1_0006_H07.b : nntttcgtctgcgnacgxxxxxxxxxx
TES01_0102_C04.b :
SPLT1_0039_G07.b : nnnccgcgagtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0067_G02.b : attttt
OVRT1_0116_B03.b : nncctcgtcagcgnag
UTR01_0102_E10.b : nnggctaggactatgacxxxxxx
OVR01_0066_D12.b : ntttgataggactatnacxxxx
PCT01_0012_H04.b :
TES01_0003_G10.b :
THY01_0101_B08.b :
TES01_0078_B06.b :
LVRM1_0036_H12.b : cgtt
TES01_0009_B08.b :
TES01_0036_B02.b :
TES01_0031_H01.b :
SMG01_0044_A12.b :
ITT01_0012_B04.b :
TES01_0063_E12.b :
OVR01_0086_F08.b : tagtgxxxxxxxxxxx
TES01_0105_D10.b :
LVR01_0030_B10.b : ttttxxxxxxxxxxxxxxxxx
PTG01_0053_B07.b :
TES01_0020_F06.b :
TES01_0003_D05.b :
OVR01_0055_F06.b : nnnggcttggactatgacx
SMG01_0044_G08.b : ct
SKNB1_0059_H06.b :
MLN01_0050_C06.b : nnntttgttgtgacttgac
OVRM1_0213_H07.b :
OVRM1_0068_D09.b :
PTG01_0032_G07.b :
TES01_0105_B07.b :
UTR01_0088_F11.b : nnnggcttggactataa
SMG01_0001_C02.b : nnnn
PTG01_0019_B07.b : nng
MLN01_0023_B06.b : nttcgggctaggactt
UTR01_0066_B10.b : gcxxxxxxxxxxxxxxxxxxx
TES01_0005_F04.b :
TES01_0001_A10.b :
PTG01_0074_G02.b : nnnn
OVRM1_0067_H09.b :
SMG01_0091_E12.b :
TCH01_0066_A01.b : nnnttgcatg
TES01_0082_G01.b :
TES01_0106_C01.b :
TES01_0084_F04.b :
OVRM1_0022_G05.b :
OVR01_0104_G10.b : ngctaggacta
TES01_0055_H03.b :
TES01_0104_A07.b :
SMG01_0019_F07.b : n
PTG01_0047_G03.b :
PTG01_0056_E05.b : nnnnnn
TES01_0091_F07.b :
TES01_0100_E01.b :
TES01_0076_H01.b :
TES01_0064_B08.b :
TES01_0056_F03.b :
TES01_0065_E03.b :
TES01_0005_B06.b :
TES01_0010_G05.b :
BFLT1_0101_C03.b : nnn
TES01_0081_H08.b :
TES01_0099_D01.b :
CLNT1_0018_F10.b :
PTG01_0099_D06.b : nnnnnnnnnnnnnnnnnnnnn
OVR01_0013_E08.b : agggaatttggtgtxxxxxxxxxxxxxx
SKNB1_0058_F04.b :
ITT01_0064_C08.b :
TCH01_0071_G06.b :
SKNB1_0024_G04.b :
UTR01_0056_B07.b :
20110601C-002188 : ...................TGGACTTCCGGTGGCGGCCGTGAGCGTCTTCCGGCCACGCG
---------+---------+---------+---------+---------+---------+ 41
TCH01_0043_D08.b : xxxxxxxxxxxxxxxxxxxTGGACTTCCGGTGGCGGCCGTGAGCGTCTTCCGGCCACGCG
TES01_0071_H03.b : tcctactgttgctatgggtgGGACTTCCGGTGGCGGCCGTGAGCGTCTTCCGGCC*CGCG
TCH01_0064_E12.b : xxxxxxxxxxxxxxxxxxxtGGACTTCCGGTGGCGGCCGTGAGCGTCTTCCGGCCACGCG
LNG01_0087_D10.b : xxxxxxxxxxxxxxxxxxxxxgtCTTCCGGTGGCGGCCGTGAGCGTCTTCCGGCCACGCG
TCH01_0100_F02.b : xxxxxxxxxxxxxxxxxxxxxxxCTTCCGGTGGCGGCCGTGAGCGTCTTCCGGCCACGCG
OVRT1_0012_G12.b : xxxxxxxxxxxxxxxxxxxxxxxCTTCCGGTGGCGGCCGTGAGCGTCTTCCGGCCACGCG
TES01_0061_G05.b : cactgtggctctgggtgggaTTCCGGTGGCGGCCGTGAGCGTCTTCCGGCC*CGCG
TES01_0024_H02.b : tcgcgttggctctgggtgggacttCGGTGGCGGCCGTGAGCGTCTTCCGGCC*CGCG
TES01_0053_C10.b : GTGGCGGCCGTGAGCGTCTTCCGGCC*CGCG
TES01_0006_E11.b : cgcgttggctctggggtggGGCCGTGAGCGTCTTCCGGCC*CGCG
TES01_0069_E05.b : nccgcgttggctctggGTGAGCGTCTTCCGGCC*CGCG
OVR01_0094_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGAGCGTCTTCCGGCCACGCG
TES01_0084_C04.b : ttttcctgctgttgctctgggtgaCGTCTTCCGGCC*CGCG
SPLT1_0095_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGTCTTCCGGCCACGCG
BFLT1_0006_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTCCGGCCACGCG
TES01_0102_C04.b : ttcctgcggtggctatggCCGGCCCGCG
SPLT1_0039_G07.b : xxxxxgaggcgtcctgggtgggacttccggtggcggccgtgagcgtcttcCGGCCACGCG
SMG01_0067_G02.b : tgatatacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCCACGCG
OVRT1_0116_B03.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGCG
UTR01_0102_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGCG
OVR01_0066_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCG
PCT01_0012_H04.b : nnnncgccaaattnnnnnggctacgtttggcactggaGCG
TES01_0003_G10.b : tcgcgttggctctggaGCG
THY01_0101_B08.b : tgggtcaaacaggctggtacggtccggaatcctcagcatgtggcctatggcggccaCG
TES01_0078_B06.b : nttccgactgtggctatggacCG
LVRM1_0036_H12.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctCG
TES01_0009_B08.b : tttttttcactgtggctctggacCG
TES01_0036_B02.b : ttggctC
TES01_0031_H01.b : gcgttggctC
SMG01_0044_A12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxtc
ITT01_0012_B04.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0063_E12.b : tacgctacacgagcggccttgttgacctact
OVR01_0086_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0105_D10.b : nttcgctgtggctct
LVR01_0030_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0053_B07.b : attttaggataaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0020_F06.b : tggctct
TES01_0003_D05.b : actgttggctat
OVR01_0055_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0044_G08.b : gtcatnnnnggataaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0059_H06.b : nnnnccgagtnnnnnnnccacacgttgtgcac
MLN01_0050_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0213_H07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0068_D09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0032_G07.b : nntttgataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0105_B07.b : tttcctgcagtggctt
UTR01_0088_F11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0001_C02.b : ccgtatnnnnnggacactacagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0019_B07.b : ggatttnnnnnggataaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0023_B06.b : gacagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0066_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0005_F04.b : ctcgcgttggc
TES01_0001_A10.b : ttttactgcgttggctat
PTG01_0074_G02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxx
OVRM1_0067_H09.b : tcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0091_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxx
TCH01_0066_A01.b : tctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0082_G01.b : ttactactgttgctc
TES01_0106_C01.b : ttttncctactgtggcta
TES01_0084_F04.b : ttttcctgcggtggctc
OVRM1_0022_G05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0104_G10.b : tnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0055_H03.b : ntttttactgcgttggcta
TES01_0104_A07.b : nttttactgctgtggctt
SMG01_0019_F07.b : nccgttatnnnnggataaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0047_G03.b : tatattttgagtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0056_E05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0091_F07.b : nnnnncctactgtggctct
TES01_0100_E01.b : tttttacgactgtggctct
TES01_0076_H01.b : ttttttcgctgtggcta
TES01_0064_B08.b : tttaccgctgtggct
TES01_0056_F03.b : ttttcctgcggtg
TES01_0065_E03.b : ttcctcgcgttggc
TES01_0005_B06.b : nttcgctgtgg
TES01_0010_G05.b : nttcgcgttggctc
BFLT1_0101_C03.b : nccgtctgctgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0081_H08.b :
TES01_0099_D01.b : ntttccgacgt
CLNT1_0018_F10.b : nctttcagcgtacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0099_D06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngacgcgc
OVR01_0013_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0058_F04.b :
ITT01_0064_C08.b :
TCH01_0071_G06.b :
SKNB1_0024_G04.b :
UTR01_0056_B07.b :
20110601C-002188 : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
---------+---------+---------+---------+---------+---------+ 95
TCH01_0043_D08.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0071_H03.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TCH01_0064_E12.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
LNG01_0087_D10.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TCH01_0100_F02.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
OVRT1_0012_G12.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0061_G05.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0024_H02.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0053_C10.b : CGAG*TTTGTTCCCGCCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0006_E11.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0069_E05.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
OVR01_0094_C11.b : CGAGCTTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0084_C04.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
SPLT1_0095_C11.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
BFLT1_0006_H07.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0102_C04.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
SPLT1_0039_G07.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
SMG01_0067_G02.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
OVRT1_0116_B03.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
UTR01_0102_E10.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
OVR01_0066_D12.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
PCT01_0012_H04.b : CGAN*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0003_G10.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
THY01_0101_B08.b : CGCGAGTTGTTCCGGTCGGCC*TCCGGG*ACATGAA*CCCCCCG**GACCCCGAGCT*TG
TES01_0078_B06.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
LVRM1_0036_H12.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACTCCGAGCT*TG
TES01_0009_B08.b : CGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0036_B02.b : TGGG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0031_H01.b : TGGG*TTTGTTCCGGTCGGCCNTCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
SMG01_0044_A12.b : CTGGGTTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
ITT01_0012_B04.b : CTGGGTTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0063_E12.b : gGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
OVR01_0086_F08.b : xGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0105_D10.b : gGAG*TTTGTNCCGGTCGGCC*NTCCGG*GAATGAAGCCCCCCG**GACCCCGAGCTCTG
LVR01_0030_B10.b : xGAG*TTTGTTCCGGTCGGCC*TCCGGG*AGATGAAGCCCCCCG**GACCCCGAGCT*TG
PTG01_0053_B07.b : xGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0020_F06.b : gGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0003_D05.b : gGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
OVR01_0055_F06.b : xGAG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
SMG01_0044_G08.b : xGAG*TTTGTTCCCGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
SKNB1_0059_H06.b : ggGAGTTTGTTCCGGTCGGCC*TCCGGG*AAATGAAGCCCCCCG**GACCCCGAGCT*TG
MLN01_0050_C06.b : xxxG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
OVRM1_0213_H07.b : xxxG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACTCCGAGCT*TG
OVRM1_0068_D09.b : xxxG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACTCCGAGCT*TG
PTG01_0032_G07.b : xxxG*TTTGTTCCGGTCGGCC*TCCGGG*TCATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0105_B07.b : cggGGGTTTGTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
UTR01_0088_F11.b : xxxG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
SMG01_0001_C02.b : xxxG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
PTG01_0019_B07.b : xxxG*TTTGTTCCCGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
MLN01_0023_B06.b : xxxG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
UTR01_0066_B10.b : xxxG*TTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0005_F04.b : tctGGGTTTGTCCGGTCGGCCTNCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0001_A10.b : gaaAGTTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
PTG01_0074_G02.b : xxxxGTTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
OVRM1_0067_H09.b : xxxxGTTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACTCCGAGCT*TG
SMG01_0091_E12.b : xxtcGTTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TCH01_0066_A01.b : xxxxGTTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0082_G01.b : tgggaGTTGTNCCGGTCGGCCNTCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0106_C01.b : tgggaGTTGTNCCGGTCGGCC*TCCGGG*AAATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0084_F04.b : tgggaGTTTGTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
OVRM1_0022_G05.b : xxxgtTTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
OVR01_0104_G10.b : xxxxxTTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0055_H03.b : tgggaGTTTGTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0104_A07.b : cggggGTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
SMG01_0019_F07.b : xxxxtTTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
PTG01_0047_G03.b : xxxgtTTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
PTG01_0056_E05.b : nnnngnTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0091_F07.b : ggagagTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0100_E01.b : ggggagTTGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0076_H01.b : tgggagTTGTTCCGGTCGGCC*NTCCGG*GAATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0064_B08.b : ctgggagTTGTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0056_F03.b : gctctggTTGTTCGGTCGGCCTCCTGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0065_E03.b : tctggggTTGTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0005_B06.b : ctctgggTTGTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0010_G05.b : tgggagtTTGTCCGGTCGGCC*TCCGCG*GAATGAAGCCCCCCG**GACCCCGAGCT*TG
BFLT1_0101_C03.b : xxxxxxxxGTTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0081_H08.b : aGTCCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
TES01_0099_D01.b : ttgctacggGTTCGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
CLNT1_0018_F10.b : xxxxxxxxxxxxxGGTCGGCC*TCCGGG*ACATGAAGCCCCCCG**GACCCCGAGCT*TG
PTG01_0099_D06.b : caggttggttccggcTCGGCC*TCCGGGTACATGAATCCCCCCGAGACCCCGGAGCT*TG
OVR01_0013_E08.b : xcgccccagggtgccccggccggcctcccgacacgagatccccgccggacggctagctcg
SKNB1_0058_F04.b : nngg
ITT01_0064_C08.b : nnnnggt
TCH01_0071_G06.b : nnnnggctagtgacttnacxxxxxxxx
SKNB1_0024_G04.b :
UTR01_0056_B07.b :
20110601C-002188 : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
---------+---------+---------+---------+---------+---------+ 154
TCH01_0043_D08.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0071_H03.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TCH01_0064_E12.b : GACCCTGCCG*TGACGGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
LNG01_0087_D10.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TCH01_0100_F02.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
OVRT1_0012_G12.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0061_G05.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0024_H02.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0053_C10.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0006_E11.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0069_E05.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
OVR01_0094_C11.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0084_C04.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
SPLT1_0095_C11.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
BFLT1_0006_H07.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0102_C04.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
SPLT1_0039_G07.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
SMG01_0067_G02.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
OVRT1_0116_B03.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
UTR01_0102_E10.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
OVR01_0066_D12.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
PCT01_0012_H04.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0003_G10.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
THY01_0101_B08.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0078_B06.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
LVRM1_0036_H12.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0009_B08.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0036_B02.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0031_H01.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
SMG01_0044_A12.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
ITT01_0012_B04.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCCCTGGCTCGCTC
TES01_0063_E12.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
OVR01_0086_F08.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0105_D10.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
LVR01_0030_B10.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
PTG01_0053_B07.b : GACCCTGCCCCTGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0020_F06.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0003_D05.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
OVR01_0055_F06.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
SMG01_0044_G08.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
SKNB1_0059_H06.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
MLN01_0050_C06.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
OVRM1_0213_H07.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
OVRM1_0068_D09.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
PTG01_0032_G07.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0105_B07.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
UTR01_0088_F11.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
SMG01_0001_C02.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
PTG01_0019_B07.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
MLN01_0023_B06.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
UTR01_0066_B10.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0005_F04.b : GACCCTCCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0001_A10.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
PTG01_0074_G02.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
OVRM1_0067_H09.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
SMG01_0091_E12.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TCH01_0066_A01.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0082_G01.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0106_C01.b : TACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0084_F04.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
OVRM1_0022_G05.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
OVR01_0104_G10.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0055_H03.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0104_A07.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
SMG01_0019_F07.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
PTG01_0047_G03.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
PTG01_0056_E05.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0091_F07.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0100_E01.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0076_H01.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0064_B08.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0056_F03.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0065_E03.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0005_B06.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0010_G05.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
BFLT1_0101_C03.b : GACTCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0081_H08.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
TES01_0099_D01.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
CLNT1_0018_F10.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
PTG01_0099_D06.b : GACCCTGCCG*TGACAGGCCCGCACCATGCGAAGCCTCCTCGGCGCGCTCTGGCTCGCTC
OVR01_0013_E08.b : taccctggctggcagacGCCCGCACCGTGGGAAGCCTCGTCCGCCGACTCTGGTTCGCTC
SKNB1_0058_F04.b : gttnnnnnnncctgcgttgtgctcggcctgcgAGCCTCCTCGGCGCGCTCTGGCTCGCTC
ITT01_0064_C08.b : gaagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGCTCGCTC
TCH01_0071_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCGCTC
SKNB1_0024_G04.b :
UTR01_0056_B07.b :
20110601C-002188 : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
---------+---------+---------+---------+---------+---------+ 214
TCH01_0043_D08.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0071_H03.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TCH01_0064_E12.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
LNG01_0087_D10.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TCH01_0100_F02.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
OVRT1_0012_G12.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0061_G05.b : CGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0024_H02.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0053_C10.b : TGGCTTGCGGCTCTGCTCGCGGCACCCTGTCTAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0006_E11.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0069_E05.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
OVR01_0094_C11.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0084_C04.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
SPLT1_0095_C11.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
BFLT1_0006_H07.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0102_C04.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
SPLT1_0039_G07.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
SMG01_0067_G02.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
OVRT1_0116_B03.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
UTR01_0102_E10.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
OVR01_0066_D12.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
PCT01_0012_H04.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0003_G10.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
THY01_0101_B08.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0078_B06.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
LVRM1_0036_H12.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0009_B08.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0036_B02.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0031_H01.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
SMG01_0044_A12.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
ITT01_0012_B04.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0063_E12.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
OVR01_0086_F08.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0105_D10.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
LVR01_0030_B10.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
PTG01_0053_B07.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0020_F06.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0003_D05.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
OVR01_0055_F06.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
SMG01_0044_G08.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
SKNB1_0059_H06.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
MLN01_0050_C06.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
OVRM1_0213_H07.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
OVRM1_0068_D09.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
PTG01_0032_G07.b : TG*CTTGCGGCTCTGCTCACGGCACCCTGCCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0105_B07.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
UTR01_0088_F11.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
SMG01_0001_C02.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
PTG01_0019_B07.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGCCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
MLN01_0023_B06.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
UTR01_0066_B10.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0005_F04.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0001_A10.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
PTG01_0074_G02.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCCGCCTCCA
OVRM1_0067_H09.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
SMG01_0091_E12.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TCH01_0066_A01.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0082_G01.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0106_C01.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0084_F04.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
OVRM1_0022_G05.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
OVR01_0104_G10.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGGAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0055_H03.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0104_A07.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
SMG01_0019_F07.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
PTG01_0047_G03.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
PTG01_0056_E05.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0091_F07.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0100_E01.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0076_H01.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0064_B08.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0056_F03.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0065_E03.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0005_B06.b : TGGCTTGCGGCCCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0010_G05.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
BFLT1_0101_C03.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0081_H08.b : TGGCTTGCGGCTCTGCTCACAGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TES01_0099_D01.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
CLNT1_0018_F10.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
PTG01_0099_D06.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
OVR01_0013_E08.b : TGGGTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
SKNB1_0058_F04.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
ITT01_0064_C08.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
TCH01_0071_G06.b : TGGCTTGCGGCTCTGCTCACGGCACCCTGTCGAAGTCCGATGCCAAAAAGGCTGCCTCCA
SKNB1_0024_G04.b : nnnngggttnnnnnnnaatacgttggctcggataggctgcct
UTR01_0056_B07.b :
20110601C-002188 : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
---------+---------+---------+---------+---------+---------+ 274
TCH01_0043_D08.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0071_H03.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TCH01_0064_E12.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
LNG01_0087_D10.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TCH01_0100_F02.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
OVRT1_0012_G12.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0061_G05.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0024_H02.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0053_C10.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0006_E11.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGA
TES01_0069_E05.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
OVR01_0094_C11.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0084_C04.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
SPLT1_0095_C11.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
BFLT1_0006_H07.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0102_C04.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
SPLT1_0039_G07.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
SMG01_0067_G02.b : AGACATTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
OVRT1_0116_B03.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
UTR01_0102_E10.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
OVR01_0066_D12.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
PCT01_0012_H04.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0003_G10.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
THY01_0101_B08.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0078_B06.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
LVRM1_0036_H12.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0009_B08.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0036_B02.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0031_H01.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
SMG01_0044_A12.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
ITT01_0012_B04.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0063_E12.b : AGACACTGCCGGAGAAGGCTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
OVR01_0086_F08.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0105_D10.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
LVR01_0030_B10.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
PTG01_0053_B07.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0020_F06.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGAGGTCTGGTGG
TES01_0003_D05.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
OVR01_0055_F06.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
SMG01_0044_G08.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
SKNB1_0059_H06.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
MLN01_0050_C06.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
OVRM1_0213_H07.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
OVRM1_0068_D09.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
PTG01_0032_G07.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0105_B07.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
UTR01_0088_F11.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
SMG01_0001_C02.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
PTG01_0019_B07.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
MLN01_0023_B06.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
UTR01_0066_B10.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0005_F04.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0001_A10.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
PTG01_0074_G02.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
OVRM1_0067_H09.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
SMG01_0091_E12.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TCH01_0066_A01.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0082_G01.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0106_C01.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGGGCGGGGTCTGGTGG
TES01_0084_F04.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
OVRM1_0022_G05.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
OVR01_0104_G10.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0055_H03.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0104_A07.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
SMG01_0019_F07.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
PTG01_0047_G03.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
PTG01_0056_E05.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0091_F07.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0100_E01.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0076_H01.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0064_B08.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0056_F03.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0065_E03.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0005_B06.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0010_G05.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
BFLT1_0101_C03.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0081_H08.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TES01_0099_D01.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
CLNT1_0018_F10.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
PTG01_0099_D06.b : AGACACTGCCGGAGAAGACTCAGGTTGCAGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
OVR01_0013_E08.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
SKNB1_0058_F04.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
ITT01_0064_C08.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
TCH01_0071_G06.b : AGACACTGCCGGAGAAGACTCAGGTTGCGGGCGTGCCCGTCCAGGAGCGGGGTCTGGTGG
SKNB1_0024_G04.b : ccggacctgccggagaagatcaaGTTGCGGGCGTGTTCGTCCAGGAGCGGGGTCTGGTGG
UTR01_0056_B07.b :
20110601C-002188 : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
---------+---------+---------+---------+---------+---------+ 333
TCH01_0043_D08.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0071_H03.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TCH01_0064_E12.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
LNG01_0087_D10.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TCH01_0100_F02.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
OVRT1_0012_G12.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0061_G05.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0024_H02.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0053_C10.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0006_E11.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0069_E05.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
OVR01_0094_C11.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0084_C04.b : TGACAGACCTCAG*AGCCGAGGACGTGATTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
SPLT1_0095_C11.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
BFLT1_0006_H07.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGTAGCTACTGCTCCGCGAAG
TES01_0102_C04.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
SPLT1_0039_G07.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
SMG01_0067_G02.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
OVRT1_0116_B03.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
UTR01_0102_E10.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
OVR01_0066_D12.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
PCT01_0012_H04.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0003_G10.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
THY01_0101_B08.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0078_B06.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
LVRM1_0036_H12.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0009_B08.b : TGACAGACCTCAG*AGCCGAGGATGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0036_B02.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0031_H01.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
SMG01_0044_A12.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
ITT01_0012_B04.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0063_E12.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
OVR01_0086_F08.b : TGACAGACCTCAA*AGCCGAGGACGTGGTTCTTGAACATCGCAGCTACTGCTCCGCGAAG
TES01_0105_D10.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
LVR01_0030_B10.b : TGACAGACCTCGG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
PTG01_0053_B07.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0020_F06.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0003_D05.b : TGACAGACCTCAG*AGCCGAGGACGTGATTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
OVR01_0055_F06.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
SMG01_0044_G08.b : TGACAGACATCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
SKNB1_0059_H06.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
MLN01_0050_C06.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
OVRM1_0213_H07.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
OVRM1_0068_D09.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
PTG01_0032_G07.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0105_B07.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
UTR01_0088_F11.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
SMG01_0001_C02.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
PTG01_0019_B07.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
MLN01_0023_B06.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
UTR01_0066_B10.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0005_F04.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0001_A10.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
PTG01_0074_G02.b : GGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
OVRM1_0067_H09.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
SMG01_0091_E12.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TCH01_0066_A01.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0082_G01.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0106_C01.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0084_F04.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
OVRM1_0022_G05.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
OVR01_0104_G10.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0055_H03.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0104_A07.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
SMG01_0019_F07.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
PTG01_0047_G03.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
PTG01_0056_E05.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0091_F07.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0100_E01.b : TGACAGACCCCAG*AGCCGAGGACGTGGTTCTTGAGCACCGCAGCTACTGCTCCGCGAAG
TES01_0076_H01.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0064_B08.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0056_F03.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0065_E03.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0005_B06.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0010_G05.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
BFLT1_0101_C03.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0081_H08.b : TGACAGACCTCAT*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TES01_0099_D01.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
CLNT1_0018_F10.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
PTG01_0099_D06.b : TGACAGACCTCAC*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
OVR01_0013_E08.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
SKNB1_0058_F04.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
ITT01_0064_C08.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
TCH01_0071_G06.b : TGACAGACCTCAG*AGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
SKNB1_0024_G04.b : TGACAGACCTCAGGAGCCGAGGACGTGGTTCTTGAGCATCGCAGCTACTGCTCCGCGAAG
UTR01_0056_B07.b :
20110601C-002188 : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
---------+---------+---------+---------+---------+---------+ 393
TCH01_0043_D08.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0071_H03.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TCH01_0064_E12.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
LNG01_0087_D10.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TCH01_0100_F02.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
OVRT1_0012_G12.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0061_G05.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0024_H02.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0053_C10.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0006_E11.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0069_E05.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
OVR01_0094_C11.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0084_C04.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
SPLT1_0095_C11.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
BFLT1_0006_H07.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0102_C04.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
SPLT1_0039_G07.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
SMG01_0067_G02.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
OVRT1_0116_B03.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
UTR01_0102_E10.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
OVR01_0066_D12.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
PCT01_0012_H04.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0003_G10.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
THY01_0101_B08.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0078_B06.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
LVRM1_0036_H12.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0009_B08.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0036_B02.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0031_H01.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
SMG01_0044_A12.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
ITT01_0012_B04.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0063_E12.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
OVR01_0086_F08.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0105_D10.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
LVR01_0030_B10.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
PTG01_0053_B07.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0020_F06.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0003_D05.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
OVR01_0055_F06.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
SMG01_0044_G08.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
SKNB1_0059_H06.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
MLN01_0050_C06.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
OVRM1_0213_H07.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
OVRM1_0068_D09.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
PTG01_0032_G07.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0105_B07.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
UTR01_0088_F11.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
SMG01_0001_C02.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
PTG01_0019_B07.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
MLN01_0023_B06.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
UTR01_0066_B10.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0005_F04.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0001_A10.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
PTG01_0074_G02.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGNGCTACGTCACTCCATGGAACAGCCAC
OVRM1_0067_H09.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
SMG01_0091_E12.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TCH01_0066_A01.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0082_G01.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCCACGTCACTCCATGGAACAGCCAC
TES01_0106_C01.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0084_F04.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
OVRM1_0022_G05.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
OVR01_0104_G10.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0055_H03.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0104_A07.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
SMG01_0019_F07.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
PTG01_0047_G03.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
PTG01_0056_E05.b : GCCCTCANGAAACACTTTTGCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0091_F07.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0100_E01.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0076_H01.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0064_B08.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0056_F03.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0065_E03.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0005_B06.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0010_G05.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
BFLT1_0101_C03.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0081_H08.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TES01_0099_D01.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
CLNT1_0018_F10.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
PTG01_0099_D06.b : GCCCTCAAGAAACACTTTGCCGGGGACGTCCTGTGCTACGTCACTCCATGGAACAGCCAC
OVR01_0013_E08.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
SKNB1_0058_F04.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
ITT01_0064_C08.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
TCH01_0071_G06.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCAC
SKNB1_0024_G04.b : GCCCTCAGGAAACACTTTGCCGGGGACGTCCTGAGCTACGTCACTCCATGGAACAGCCAC
UTR01_0056_B07.b :
20110601C-002188 : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
---------+---------+---------+---------+---------+---------+ 453
TCH01_0043_D08.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0071_H03.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGCGGCTG
TCH01_0064_E12.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
LNG01_0087_D10.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TCH01_0100_F02.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
OVRT1_0012_G12.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0061_G05.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0024_H02.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0053_C10.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACTTGGCGCCCGTGTGGCTG
TES01_0006_E11.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0069_E05.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
OVR01_0094_C11.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0084_C04.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
SPLT1_0095_C11.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
BFLT1_0006_H07.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0102_C04.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
SPLT1_0039_G07.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
SMG01_0067_G02.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
OVRT1_0116_B03.b : GGCTACGACATCGCCAAGATCTTTGCGGGTAAGTTCACCCACGTGGCGCCCGTGTGGCTG
UTR01_0102_E10.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
OVR01_0066_D12.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
PCT01_0012_H04.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0003_G10.b : GGCTACGACATCGCCAAAATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
THY01_0101_B08.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0078_B06.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCGCGTGGCGCCCGTGTGGCTG
LVRM1_0036_H12.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0009_B08.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0036_B02.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0031_H01.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
SMG01_0044_A12.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
ITT01_0012_B04.b : GGCTACGACATCGCCAAGATCTTTGCAGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0063_E12.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
OVR01_0086_F08.b : GGGTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0105_D10.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
LVR01_0030_B10.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
PTG01_0053_B07.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0020_F06.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0003_D05.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
OVR01_0055_F06.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
SMG01_0044_G08.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
SKNB1_0059_H06.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
MLN01_0050_C06.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
OVRM1_0213_H07.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
OVRM1_0068_D09.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
PTG01_0032_G07.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0105_B07.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
UTR01_0088_F11.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
SMG01_0001_C02.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
PTG01_0019_B07.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
MLN01_0023_B06.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
UTR01_0066_B10.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0005_F04.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0001_A10.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
PTG01_0074_G02.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
OVRM1_0067_H09.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
SMG01_0091_E12.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TCH01_0066_A01.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0082_G01.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0106_C01.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0084_F04.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
OVRM1_0022_G05.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
OVR01_0104_G10.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0055_H03.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0104_A07.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
SMG01_0019_F07.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
PTG01_0047_G03.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
PTG01_0056_E05.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAATTTCACCCACGTGGCGCCCGggggggct
TES01_0091_F07.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0100_E01.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0076_H01.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0064_B08.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0056_F03.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0065_E03.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0005_B06.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0010_G05.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTCCACCCACGTGGCGCCCGTGTGGCTG
BFLT1_0101_C03.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0081_H08.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TES01_0099_D01.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
CLNT1_0018_F10.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
PTG01_0099_D06.b : GGCTACGACATCGCCGAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
OVR01_0013_E08.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
SKNB1_0058_F04.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
ITT01_0064_C08.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
TCH01_0071_G06.b : GGCTACGACATCGCCAAGATCTTTGCGGGCAAGTTCACCCACGTGGCGCCCGTGTGGCTG
SKNB1_0024_G04.b : GGCTACGACGTCGCCAAGATCTTTGCGGACAAGTTCACCCACGTGGCGCCCGTGTGGCTG
UTR01_0056_B07.b : ctttttggttgccxxxxxxxxxxxxxxxxxxxx
20110601C-002188 : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
---------+---------+---------+---------+---------+---------+ 512
TCH01_0043_D08.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0071_H03.b : CAGCTGAAGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TCH01_0064_E12.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
LNG01_0087_D10.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TCH01_0100_F02.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
OVRT1_0012_G12.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0061_G05.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0024_H02.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0053_C10.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACATGCCTCGACGACG*TGGACCA
TES01_0006_E11.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0069_E05.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
OVR01_0094_C11.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0084_C04.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
SPLT1_0095_C11.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
BFLT1_0006_H07.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0102_C04.b : CAGCTGAGGCGGCATAGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
SPLT1_0039_G07.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
SMG01_0067_G02.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGGCGACG*TGGACCA
OVRT1_0116_B03.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
UTR01_0102_E10.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
OVR01_0066_D12.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
PCT01_0012_H04.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0003_G10.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
THY01_0101_B08.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACCACGCTGGACCA
TES01_0078_B06.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
LVRM1_0036_H12.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0009_B08.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0036_B02.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0031_H01.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
SMG01_0044_A12.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
ITT01_0012_B04.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0063_E12.b : CAGCTGAGGCGGCATGGCCCCGAGATGTTCGAGGTCACAGGCCTCGACCACG*TGGACCA
OVR01_0086_F08.b : CAGCTGAAGCGGCATGGCCGCCAGATGTTCGAGGTCACAGGCCTCCACCACA*TGGACCA
TES01_0105_D10.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
LVR01_0030_B10.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
PTG01_0053_B07.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0020_F06.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0003_D05.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
OVR01_0055_F06.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
SMG01_0044_G08.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
SKNB1_0059_H06.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
MLN01_0050_C06.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
OVRM1_0213_H07.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
OVRM1_0068_D09.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
PTG01_0032_G07.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0105_B07.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
UTR01_0088_F11.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
SMG01_0001_C02.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
PTG01_0019_B07.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
MLN01_0023_B06.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
UTR01_0066_B10.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0005_F04.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0001_A10.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
PTG01_0074_G02.b : CAGCTGAAGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
OVRM1_0067_H09.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
SMG01_0091_E12.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TCH01_0066_A01.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0082_G01.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0106_C01.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0084_F04.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
OVRM1_0022_G05.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
OVR01_0104_G10.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0055_H03.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0104_A07.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
SMG01_0019_F07.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
PTG01_0047_G03.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
PTG01_0056_E05.b : gccacctaaggcggcatgggccccaaaagttcaaaggtcccaggccccaaccacttggaa
TES01_0091_F07.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0100_E01.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0076_H01.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0064_B08.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0056_F03.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0065_E03.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0005_B06.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0010_G05.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
BFLT1_0101_C03.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0081_H08.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TES01_0099_D01.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
CLNT1_0018_F10.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
PTG01_0099_D06.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
OVR01_0013_E08.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
SKNB1_0058_F04.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
ITT01_0064_C08.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
TCH01_0071_G06.b : CAGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACG*TGGACCA
SKNB1_0024_G04.b : CTGCTGAGGCGGCATGGCCGCGAGATGTTCGAGGTCACAGGCCTCGACGACC*TGTACCA
UTR01_0056_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG*TGGACCA
20110601C-002188 : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
---------+---------+---------+---------+---------+---------+ 571
TCH01_0043_D08.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0071_H03.b : AAGGTGGATGCGAGCAGTCAGGAAGCAGACC*AGGGGCTCCACATAGTGCCCCGGC**TC
TCH01_0064_E12.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
LNG01_0087_D10.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TCH01_0100_F02.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
OVRT1_0012_G12.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0061_G05.b : AGGGTGGATGCGAGCAGTCAGGAAGCAAACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0024_H02.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCACATAGTGCCCCGGC*TCC
TES01_0053_C10.b : AGGGTGGATGCTAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0006_E11.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0069_E05.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
OVR01_0094_C11.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0084_C04.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
SPLT1_0095_C11.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
BFLT1_0006_H07.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0102_C04.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
SPLT1_0039_G07.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
SMG01_0067_G02.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
OVRT1_0116_B03.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
UTR01_0102_E10.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
OVR01_0066_D12.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
PCT01_0012_H04.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0003_G10.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
THY01_0101_B08.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCA*GGGCCCCCGCATACTGCCCCGGC*TCg
TES01_0078_B06.b : AGGGTGGATGCGAGCAGTCTGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
LVRM1_0036_H12.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0009_B08.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0036_B02.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0031_H01.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
SMG01_0044_A12.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
ITT01_0012_B04.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0063_E12.b : AAGGTGGATGCGAGCAGTCAGGAAGCATACCAAGGGCCTCCCCATATTGCCCCGGCCTCC
OVR01_0086_F08.b : AGGGTGGATGCGAGCAGTCTTGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCCGC*TCC
TES01_0105_D10.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
LVR01_0030_B10.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
PTG01_0053_B07.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0020_F06.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0003_D05.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
OVR01_0055_F06.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
SMG01_0044_G08.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
SKNB1_0059_H06.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
MLN01_0050_C06.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
OVRM1_0213_H07.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
OVRM1_0068_D09.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
PTG01_0032_G07.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0105_B07.b : AGGGCGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
UTR01_0088_F11.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
SMG01_0001_C02.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
PTG01_0019_B07.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
MLN01_0023_B06.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
UTR01_0066_B10.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0005_F04.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0001_A10.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
PTG01_0074_G02.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAGGGGC*TCCACATAGTGCCCCGGC*TCC
OVRM1_0067_H09.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
SMG01_0091_E12.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TCH01_0066_A01.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0082_G01.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0106_C01.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0084_F04.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
OVRM1_0022_G05.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
OVR01_0104_G10.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0055_H03.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0104_A07.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
SMG01_0019_F07.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
PTG01_0047_G03.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
PTG01_0056_E05.b : ccagggggaatccaccatcctggaaaacaaacaagggcccccccaaaaaggccccggccc
TES01_0091_F07.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0100_E01.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0076_H01.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0064_B08.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0056_F03.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0065_E03.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0005_B06.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0010_G05.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
BFLT1_0101_C03.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0081_H08.b : AGGGTGGATGTGAGCAGTCAGGAATCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TES01_0099_D01.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
CLNT1_0018_F10.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
PTG01_0099_D06.b : AGGGTGGATGCGAGCAGTCATGAAGCAGACCAAGGGCTTCCGCATAGTGCCCCGGC*TCC
OVR01_0013_E08.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
SKNB1_0058_F04.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
ITT01_0064_C08.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
TCH01_0071_G06.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
SKNB1_0024_G04.b : AGGGTGGATGCGAGCAGTCCGGAAACATACCAAGGGCCTCCGCATATTGTCCCGGC*TCC
UTR01_0056_B07.b : AGGGTGGATGCGAGCAGTCAGGAAGCAGACCAAGGGCCTCCGCATAGTGCCCCGGC*TCC
20110601C-002188 : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
---------+---------+---------+---------+---------+---------+ 630
TCH01_0043_D08.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0071_H03.b : CGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TCH01_0064_E12.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
LNG01_0087_D10.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TCH01_0100_F02.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
OVRT1_0012_G12.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0061_G05.b : CGTTTGAGGACTGGACGTACGAAGACTTCCCGGAACGTCCTGTACCGTGAGGACAAGATA
TES01_0024_H02.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0053_C10.b : GGTTTGAGGACTGGACGTACGATGACTTC*CGGAACGTCCTGGACAGTGAGGACGATATA
TES01_0006_E11.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0069_E05.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACGGTGAGGACGAAATA
OVR01_0094_C11.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0084_C04.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
SPLT1_0095_C11.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
BFLT1_0006_H07.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0102_C04.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
SPLT1_0039_G07.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGNACAGTGAGGACGAGATA
SMG01_0067_G02.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
OVRT1_0116_B03.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
UTR01_0102_E10.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
OVR01_0066_D12.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
PCT01_0012_H04.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGCAACGTCCTGGACAGTGAGGACGAGATA
TES01_0003_G10.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
THY01_0101_B08.b : gcttgaggactggcccttccagaacttcggacgtctggaacgtagggacaaaaaagcact
TES01_0078_B06.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CCGAACGTCCTGGACAGTGAGGACGAGATA
LVRM1_0036_H12.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGCAACGTCCTGGACAGTGAGGACGAGATA
TES01_0009_B08.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0036_B02.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0031_H01.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
SMG01_0044_A12.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
ITT01_0012_B04.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0063_E12.b : GGTTTGAGGACTGGACcttacaagaacttcccgaaactccctggaaagtgagggaacaaa
OVR01_0086_F08.b : GGTTTGAGGACTGGACCTACTAGGACTTC*CCGAACGTCCTGGACAGTGAGGACCAGATA
TES01_0105_D10.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
LVR01_0030_B10.b : GGTTTGAGGACTGGACGTACGAAGACTTC*CGCAACGTCCTGGACAGTGAGGACGAGATA
PTG01_0053_B07.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGCAACGTCCTGGACAGTGAGGACGAGATA
TES01_0020_F06.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0003_D05.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
OVR01_0055_F06.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
SMG01_0044_G08.b : GGTTTGAGGACTGGACGTACGAGGGCTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
SKNB1_0059_H06.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
MLN01_0050_C06.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGNACAGTGAGGACGAGATA
OVRM1_0213_H07.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGCAACGTCCTGGACAGTGAGGACGAGATA
OVRM1_0068_D09.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGCAACGTCCTGGACAGTGAGGACGAGATA
PTG01_0032_G07.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGCAACGTCCTGGACAGTGAGGACGAGATA
TES01_0105_B07.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
UTR01_0088_F11.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
SMG01_0001_C02.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
PTG01_0019_B07.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGCAACGTCCTGGACAGTGAGGACGAGATA
MLN01_0023_B06.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
UTR01_0066_B10.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0005_F04.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0001_A10.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
PTG01_0074_G02.b : GGTTTGAGGACTGGACGTACGAAGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
OVRM1_0067_H09.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGCAACGTCCTGGACAGTGAGGACGAGATA
SMG01_0091_E12.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TCH01_0066_A01.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0082_G01.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0106_C01.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0084_F04.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
OVRM1_0022_G05.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
OVR01_0104_G10.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0055_H03.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCCGGACAGTGAGGACGAGATA
TES01_0104_A07.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
SMG01_0019_F07.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
PTG01_0047_G03.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
PTG01_0056_E05.b : ccgtttgggaatgggacttaaaaaaaattccggaaaaccctggaaagggggggaaaaata
TES01_0091_F07.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0100_E01.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0076_H01.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGNACAGTGAGGACGAGATA
TES01_0064_B08.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0056_F03.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0065_E03.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0005_B06.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0010_G05.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
BFLT1_0101_C03.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TES01_0081_H08.b : GGTTTGAGGACTGGACTTACTATGACTTC*CGGAACGTCCTGGACTGTGAGGACCATATT
TES01_0099_D01.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
CLNT1_0018_F10.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
PTG01_0099_D06.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGTACAGTGAGGACGAGATA
OVR01_0013_E08.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
SKNB1_0058_F04.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
ITT01_0064_C08.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
TCH01_0071_G06.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
SKNB1_0024_G04.b : GGTTTGAGGACTGGACGTACTAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
UTR01_0056_B07.b : GGTTTGAGGACTGGACGTACGAGGACTTC*CGGAACGTCCTGGACAGTGAGGACGAGATA
20110601C-002188 : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
---------+---------+---------+---------+---------+---------+ 689
TCH01_0043_D08.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0071_H03.b : AAGGACCTGAGCAGGACTGTGGTCCAGTTGGCCAAaaccagcgcttcgaccgcttctggt
TCH01_0064_E12.b : GAGGAGCTGAGCANGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
LNG01_0087_D10.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TCH01_0100_F02.b : GAGGAGCTGAGCAGGACTGCGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
OVRT1_0012_G12.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0061_G05.b : AAGGAGCTGAACCGGACTGTGGTCCAGGggggccaaagcccagcgcttcaacgggttctt
TES01_0024_H02.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCTT
TES01_0053_C10.b : GATGATCTGATCAGGACTGTGGTCCAAGTGGCCAAGATCCAGCGCTTTCAACGGCTTTCT
TES01_0006_E11.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0069_E05.b : GAAGAACTGAGCAGGACTGTGGTCCAGGGGGCCAAaaccaccgcttcaaacggttcctgg
OVR01_0094_C11.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0084_C04.b : GAGGAGCTGAGCANGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
SPLT1_0095_C11.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
BFLT1_0006_H07.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0102_C04.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
SPLT1_0039_G07.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
SMG01_0067_G02.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
OVRT1_0116_B03.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
UTR01_0102_E10.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
OVR01_0066_D12.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
PCT01_0012_H04.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0003_G10.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
THY01_0101_B08.b : cgcacgctggtctcacttggcgccan
TES01_0078_B06.b : GAGGAGCTGAGCAGGACTGTGGTCCAAGTGGCCAAGAGCCAACGCT*TCGACTGCTTCGT
LVRM1_0036_H12.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCTAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0009_B08.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0036_B02.b : GAGGAGCTGAGCAGGACTGTGGTCCAAGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCCT
TES01_0031_H01.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
SMG01_0044_A12.b : GAGGAGCTGAGCANGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
ITT01_0012_B04.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0063_E12.b : taaaggaacgaaccaggattgtggttccaggggggccaaaaaccaccccttccaaagggt
OVR01_0086_F08.b : GAGGAGCTGAGCCCGACTGTGGTCCCAGTGGCCAAAAACCAGCGCT*TCCACGGCTTTTT
TES01_0105_D10.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
LVR01_0030_B10.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCCACGGCTTCGT
PTG01_0053_B07.b : GAGGAGCTGAGCAAGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0020_F06.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0003_D05.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
OVR01_0055_F06.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
SMG01_0044_G08.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
SKNB1_0059_H06.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
MLN01_0050_C06.b : GAGGAACTGAGCAGGACTGTGGTCCAGGTGGCCAAGAACCAGCGCT*TCGACGGCTTCGT
OVRM1_0213_H07.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
OVRM1_0068_D09.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
PTG01_0032_G07.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0105_B07.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
UTR01_0088_F11.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
SMG01_0001_C02.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TTGACGGCTTCGT
PTG01_0019_B07.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
MLN01_0023_B06.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
UTR01_0066_B10.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0005_F04.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0001_A10.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
PTG01_0074_G02.b : AAGGAGCTGAACAGGACTGGGGTCCAAGTGccaaaaancagcgcctcgaccggttcgtgg
OVRM1_0067_H09.b : GAGGAGCTGAACAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
SMG01_0091_E12.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TCH01_0066_A01.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0082_G01.b : GAGGAGCTGAGCATGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACTGCTTCTT
TES01_0106_C01.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0084_F04.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
OVRM1_0022_G05.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
OVR01_0104_G10.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCTT
TES01_0055_H03.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0104_A07.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
SMG01_0019_F07.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
PTG01_0047_G03.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
PTG01_0056_E05.b : taagggacttaaaaaggggtggggggcccaggggggcaaaaaaccaccccctttcacagg
TES01_0091_F07.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0100_E01.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0076_H01.b : GAGGAGCTGAGCANGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0064_B08.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0056_F03.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0065_E03.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0005_B06.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0010_G05.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
BFLT1_0101_C03.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TES01_0081_H08.b : CAAGAGCTGATCAGGACTGTGGTCCAGGTGGCCAAaaacccaccccttctaacggtttct
TES01_0099_D01.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAATAGCCAGCGCT*TCGACGGCTTCGT
CLNT1_0018_F10.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
PTG01_0099_D06.b : CAGGATCTGAGCACGACTGTGGTCCAGGTGGGCAAGAGCCAGCGCT*TCGACGGCTTCGT
OVR01_0013_E08.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
SKNB1_0058_F04.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
ITT01_0064_C08.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
TCH01_0071_G06.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
SKNB1_0024_G04.b : GAGGAGCTGAGCTTGACTGAGGTCCAGGTGGCCGAGAGCCAGCGCT*TCGACGGCTTCGT
UTR01_0056_B07.b : GAGGAGCTGAGCAGGACTGTGGTCCAGGTGGCCAAGAGCCAGCGCT*TCGACGGCTTCGT
20110601C-002188 : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
---------+---------+---------+---------+---------+---------+ 746
TCH01_0043_D08.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0071_H03.b : tggaagtccggaaccaactgcctaatcaaaaacccgtgggccctattcaatggcccaccc
TCH01_0064_E12.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
LNG01_0087_D10.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TCH01_0100_F02.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
OVRT1_0012_G12.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0061_G05.b : ggtggaaggtctggaaaccacttgctgatccaaaaccccgtggggcccctttccattgtt
TES01_0024_H02.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAAC*ACGTGGGCCTCATTCACATGCT
TES01_0053_C10.b : GGGGGAGGTCT**GGAACCATCTGCTGATCTCGAAGC*ACTTGGGCCTCATTCACATGCT
TES01_0006_E11.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0069_E05.b : tgaaggccgggaccagctgccgaatccaaaaacacgtgggccctcattccattgcccacc
OVR01_0094_C11.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCCCATGGC
TES01_0084_C04.b : GGTGGAAGTCT**GGAANCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
SPLT1_0095_C11.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
BFLT1_0006_H07.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0102_C04.b : GGTGGAGGTCT**GGAGCCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
SPLT1_0039_G07.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
SMG01_0067_G02.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
OVRT1_0116_B03.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
UTR01_0102_E10.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
OVR01_0066_D12.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
PCT01_0012_H04.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0003_G10.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
THY01_0101_B08.b :
TES01_0078_B06.b : GGTGGAAGTCT**GGAAACAGCTGCTGATCCAAAAGCCACGTGGGCCTCATTCACAatgc
LVRM1_0036_H12.b : GGTGGAGGTCT**GGGACCANCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0009_B08.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0036_B02.b : TGTGGAGGTCT**GGAACCAGCTGCTGATCCCAAAAC*ACGTGGGCCTCATTTCCATGCT
TES01_0031_H01.b : GGGGGAGGTCT**GGAAACAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
SMG01_0044_A12.b : GGTGGAAGTCT**GGAACCAGCTGCTGATCCAGAA*C*ACGTGGGCCTCATTCACATGCT
ITT01_0012_B04.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0063_E12.b : tttttggtggaaggactgggaaccaccctgcgattcaaaaaaaactgggggccctattca
OVR01_0086_F08.b : GGgggaaagtttggaaccaccctgtttatcctaaaacacgtggggcccatttctctgcct
TES01_0105_D10.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGTGCCTCATTCACATGCT
LVR01_0030_B10.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
PTG01_0053_B07.b : GGTGGAGGTCT**GGAAACAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0020_F06.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0003_D05.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
OVR01_0055_F06.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGNGCCTCATTCACATGCT
SMG01_0044_G08.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
SKNB1_0059_H06.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
MLN01_0050_C06.b : GGgtggaagtctgggaaccacctgctgattcagaaaccacgtggggcctcatttccatgg
OVRM1_0213_H07.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
OVRM1_0068_D09.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
PTG01_0032_G07.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0105_B07.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCGGAAGC*ACGTGGGCCTCATTCACATGCT
UTR01_0088_F11.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
SMG01_0001_C02.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
PTG01_0019_B07.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
MLN01_0023_B06.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
UTR01_0066_B10.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0005_F04.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0001_A10.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAA*******GGGCCTCATTCACATGCT
PTG01_0074_G02.b : tggaagtctgaaaccgctgctgaatccaaaccagtgggccctcattccatggttcccccg
OVRM1_0067_H09.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCCCATGCT
SMG01_0091_E12.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TCH01_0066_A01.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0082_G01.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAAC*ACGTGGGCCTCATTCACATGCT
TES01_0106_C01.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCGAAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0084_F04.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
OVRM1_0022_G05.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
OVR01_0104_G10.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCCGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0055_H03.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0104_A07.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
SMG01_0019_F07.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
PTG01_0047_G03.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
PTG01_0056_E05.b : tttttggggggggggggtggaaaaccctttgtgtataaaaaaaaaggggggggttttttt
TES01_0091_F07.b : GGTGGAAGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0100_E01.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0076_H01.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0064_B08.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0056_F03.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0065_E03.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0005_B06.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0010_G05.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
BFLT1_0101_C03.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TES01_0081_H08.b : tggtggaaggtctgaaccagcctgcctgaatccagaaacacgtggggcctcatttccatg
TES01_0099_D01.b : GGGGGAGGTCT**GGAACCAGCTGCTGATCCAAAAGC*ACGTGGGCCTCATTCCCATGCT
CLNT1_0018_F10.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
PTG01_0099_D06.b : GGTGGAGGTCT**GGAACCATCTGCTGATCCAGATGC*ACGTGCGCCTCATTCACATGCT
OVR01_0013_E08.b : GGTGGAGGTCTCGGAACCCAGCTGCTGATCCACAAGC*ACGTGGGCCTTATTCACATGCT
SKNB1_0058_F04.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
ITT01_0064_C08.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
TCH01_0071_G06.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
SKNB1_0024_G04.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCAGTCACATGCT
UTR01_0056_B07.b : GGTGGAGGTCT**GGAACCAGCTGCTGATCCAGAAGC*ACGTGGGCCTCATTCACATGCT
20110601C-002188 : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
---------+---------+---------+---------+---------+---------+ 803
TCH01_0043_D08.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
TES01_0071_H03.b : acctggctaaagccttcaacaagcccggctgttggccatcttggtattccccccccccgt
TCH01_0064_E12.b : CACCCACGTG*GTCGAAGCGCT*GCACCAGGCCCCGCTGCTGGGCATCCTGGTCATCCCC
LNG01_0087_D10.b : CACCCACATG*GTCGAGGCACT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
TCH01_0100_F02.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
OVRT1_0012_G12.b : CACCCACATG*GTCGAGGCACT*GCACCAGGCCCGGCTGCTGGGCATCCTGGTCAT*CCC
TES01_0061_G05.b : cccccccgtgggtcaagggccttgacccagggccgggttgctggcattctggggtattcc
TES01_0024_H02.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGGCATCCTGGTCAT**cc
TES01_0053_C10.b : tcaccctcctgggtcaagcgcttcaccaggccctgctgctggcctccctggtcatctcct
TES01_0006_E11.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
TES01_0069_E05.b : ccactgggccaaggcgcttcccccaggcccggtttgtgggcattcctggttaatcccccc
OVR01_0094_C11.b : TCCCCACATG*GCCGAGGCACT*GCACCAGGCCCGGCTGCTGGGCcttcctggccatccc
TES01_0084_C04.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
SPLT1_0095_C11.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
BFLT1_0006_H07.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
TES01_0102_C04.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCATCCCC
SPLT1_0039_G07.b : CACCCACATG*GTCGAAGCACT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
SMG01_0067_G02.b : CACCCACATG*GTCGAGGCACT*GCACCAGGCCCGGCTGCTGGGCATCCTGGTCAT*CCC
OVRT1_0116_B03.b : CACCCACATG*GTCGAGGCACT*GCACCAGGCCCGGCTGCTGGGCATCCTGGTCAT*CCC
UTR01_0102_E10.b : CACCCACATG*GTCGAGGCACT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
OVR01_0066_D12.b : CACCCACATG*GTCGAGGCACT*GCACCCAGCCCGGCTGCTGGCCATCCTGGTCATCCCC
PCT01_0012_H04.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGNCATCCTGGTCAT**CC
TES01_0003_G10.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
THY01_0101_B08.b :
TES01_0078_B06.b : tcaccccccgtggtcaaagcgcttcaccaaggccccggttgctgggccatcttggttaat
LVRM1_0036_H12.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCTCGGCTGCTGGCCATCCTGGTCATCCCC
TES01_0009_B08.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
TES01_0036_B02.b : CACCCACGTG*GGCCAGGCGCT*GCACCAGGCCCGGCTGGCTGGCATTCTTGTTATCCCC
TES01_0031_H01.b : CACCCACGTGGGTCCAAGCGCT*TGCCCAGGCCCCGCTGCTGGCCATCCTGGTCAT*CCC
SMG01_0044_A12.b : CACCCACATG*GTCGAGGCACT*GCACCAAGCCCGGCTGCTGGCCATCCTGGTCAT**CC
ITT01_0012_B04.b : CACCCACATG*GTCGAGGCACT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
TES01_0063_E12.b : tatgtcccccccccttggtctaagaagcttacaacaggccccggtggttgtgcattcttg
OVR01_0086_F08.b : cccccccatttgtcaagggcctgcatcagggcccggctgctggccctctctggtaatccc
TES01_0105_D10.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCCGGTGCTGGCCATCCTGGTCAT*CCC
LVR01_0030_B10.b : CACCCACGTG*GTCCAGGCGCT*GCACCACGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
PTG01_0053_B07.b : CACCCACGTG*GTCAAGGCGCT*GCACCACCCCCGGCTGCTGGCCATCCTGGTCATCCCC
TES01_0020_F06.b : CACCCACGTG*GTCGAGGCGCT*GCACCAAGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
TES01_0003_D05.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT**CC
OVR01_0055_F06.b : CACCCACATG*GTCGAGGCACT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
SMG01_0044_G08.b : CACCCACATG*GTCGAGGCACT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
SKNB1_0059_H06.b : CACCCACATG*GTCGAGGCACT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*NCC
MLN01_0050_C06.b : ctcccccacttgggccgaagcccctgccaccaagccccggcttgctgggccaatcctggg
OVRM1_0213_H07.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCC*GGCTGCTGGCCATCCTGGTCATCCCC
OVRM1_0068_D09.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT**CC
PTG01_0032_G07.b : CACCCACGTG*GTCGAGGCGCT*GCACCACGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
TES01_0105_B07.b : CACCCACGTG*GTCGAGGCACT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT**CC
UTR01_0088_F11.b : CACCCACATG*GTCGAGGCACT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
SMG01_0001_C02.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGGCATCCTGGTCAT*CCC
PTG01_0019_B07.b : CACCCACGTG*GTCGAGGCGCT*GCACCACGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
MLN01_0023_B06.b : CACCCACATG*GTCGAGGCACT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
UTR01_0066_B10.b : CACCCACATG*GTCGAGGCACT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
TES01_0005_F04.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGACTGCTGGCCATCCTGGTCAT*CCC
TES01_0001_A10.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
PTG01_0074_G02.b : ggggtcaaggctttacccaggcccgggtgctggccatactgggtatccccccgccggttc
OVRM1_0067_H09.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCTGGCTGCTGGCCACCCTGGTTCA*TCC
SMG01_0091_E12.b : CACCCACATG*GTCGAGGCACT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
TCH01_0066_A01.b : CACCCACATG*GTCGAGGCACT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
TES01_0082_G01.b : CACCCACGTG*GTCGAGGCGCC*GCACCAGGCCCGGCTGCTTGGCATCCTGGTCAT*CCC
TES01_0106_C01.b : CACCCACGTG*GTCAAGGCGCT*GCACCAGGCCTGGCTGCTGGCAATCCTGGGCAT*CCC
TES01_0084_F04.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGGCATCCTGGTCAT**CC
OVRM1_0022_G05.b : CACCCACATG*GTCGAGGCACT*GCACCANGCCCGGCTGCTGGCCATCCTGGTCAT**CC
OVR01_0104_G10.b : CACCCACATG*GTCGAGGCACT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
TES01_0055_H03.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
TES01_0104_A07.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
SMG01_0019_F07.b : CACCCACGTG*GTCGTGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
PTG01_0047_G03.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT**CC
PTG01_0056_E05.b : tataggtccccccccgggggggaggggggcccccaaacgcgggggggggggggaaattgt
TES01_0091_F07.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCCGCTGCTGGGCATCCTGGTCAT*CCC
TES01_0100_E01.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
TES01_0076_H01.b : CACCCACGTG*GTCGAAGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT**CC
TES01_0064_B08.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCCGCTGCTGGCCAT*CTGGTCAT*CCC
TES01_0056_F03.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
TES01_0065_E03.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
TES01_0005_B06.b : CACCCACGTG*GTCGAGGCGCT*GTACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
TES01_0010_G05.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
BFLT1_0101_C03.b : CACCCACATG*GTCGAGGCACT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
TES01_0081_H08.b : gttcaccccacttgttcaaggtgctgcaccaaggcccggcttcctggccttcctggttat
TES01_0099_D01.b : CACCCACTTG*GGCCAGGCGCTTGCACCAGGCCCGGCTGCTGGGCCTCCTGGTTATCCCC
CLNT1_0018_F10.b : CACCCACATG*GTCGAGGCACT*GCACCANGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
PTG01_0099_D06.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
OVR01_0013_E08.b : CACCCcacatgcctcaggcactgcaccatgtcccccctgctttccccctgctcatccccc
SKNB1_0058_F04.b : CACCCACATG*GTCGAGGCACT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
ITT01_0064_C08.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
TCH01_0071_G06.b : CACCCACGTG*GTCGAGGCGCT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
SKNB1_0024_G04.b : CACCCACATG*GTCAAGGCACT*GCACCAGGCCCGGCTGCTGGCCGTCCTGGTCAT*CCC
UTR01_0056_B07.b : CACCCACATG*GTCGAGGCACT*GCACCAGGCCCGGCTGCTGGCCATCCTGGTCAT*CCC
20110601C-002188 : CCCCGCCGTCGCCCCCGGGACCAACAAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
---------+---------+---------+---------+---------+---------+ 861
TCH01_0043_D08.b : CCCCGCCGTCGCCCCCGGGGACCACAAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
TES01_0071_H03.b : ccccccggggacaaaaaagctgggggttttccccccaaagaattttgaaaactgtggggc
TCH01_0064_E12.b : CCCGCGTCGCCCCCGGACCAACAgcttggcgtgttccccccaaggaatttgacaactggc
LNG01_0087_D10.b : CCC*GCCGTCGCCCCCCG*GACCACAAGCTGGN*CGTGTTCACGCACA**GGAGTTTGAG
TCH01_0100_F02.b : CCCCGCCGTCGCCCCCGGGA*CCACAAGCTGGG*CGTGGTCACGCACAN*GGAGTTTGAG
OVRT1_0012_G12.b : CCCCGCCGTCGCCCCCGGGACCNAACAGCTGGG*CGTGTTCACGCANCA*GGAGTTTGAG
TES01_0061_G05.b : ccccccgcgtttccccccgggaaaaaaaaagtttgggggggtttctccccaagggagttt
TES01_0024_H02.b : ccccggccgcgcccccggggACAACAGCTGGG**CGTGTTCACGCCCCA*GGAGTTTGAC
TES01_0053_C10.b : ccgccatctcccccaggtactataaactgggcgtgttcctccccatgaattttgaactct
TES01_0006_E11.b : CCCCGCCGTCGCCCCCGGGACCAACAAGCTGGG*CGTGTTCCCGCACAA*GGAGTTTGAG
TES01_0069_E05.b : ccgcctttccccccgggaccaaaaaactgggggtgtttccccaaaagaaattttaaaaac
OVR01_0094_C11.b : cccccgccgtctgccctcggggaccaacaagctagggggggtttaccccccaaggaattt
TES01_0084_C04.b : CCCCGC*GTCGCCCCCCGGGACAACAAGCTGGG*CGTGTTCACGCACAA*AGAGTTTGAC
SPLT1_0095_C11.b : CCCCGCCGTCGCCCCCGGGACCAACAAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
BFLT1_0006_H07.b : CCCCGCCGTCGCCCCCGGGGACCAACAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
TES01_0102_C04.b : CCCGCCGTTCCCCCCCGGGACCAACAagactgggcgtgttcccgccaaaggaattttgaa
SPLT1_0039_G07.b : CCCCCCCGTCGCCCCC*GGAACCACAAGCTGGG*CGTGTTCccccaaaggattttgagca
SMG01_0067_G02.b : CCCCGCCGTCGCCCCCGGGAACAACAAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
OVRT1_0116_B03.b : CCCCGCCGTCGCCCCCGGGAACCAACAGCTGGG*CGTGTTCACGCACAA**GAGTTTGAG
UTR01_0102_E10.b : CCCCGCCGTCGGCCCCCGGGACAACAAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
OVR01_0066_D12.b : CCCGCCCTTCGCCCCCGGGACCCACAAGCTGGGGCGTGTTCcacgcacaaggaagtttga
PCT01_0012_H04.b : CCCCCGCGTCGCCCCGGGAACCA**CAGCTGGG*CGTGTTCACGCACAA**GAGTTTGAG
TES01_0003_G10.b : CCCCGCCGTCGCCCCCGGGACCAAC*AGCTGGG*CGTGTTCACGCACAA*TGAGTTTGAG
THY01_0101_B08.b :
TES01_0078_B06.b : ccccccccgccggcgccccctgggaaccaaaaacctggggcttgtttcacccacagggag
LVRM1_0036_H12.b :
TES01_0009_B08.b : CCCCGCCGTCGCCCCCGGGACCAACAAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
TES01_0036_B02.b : CCCcgccgttgccccccgggaacaaaaaactgggggtgtttcacgcccaaggaagtttaa
TES01_0031_H01.b : CCCCGCCGTCGCCCCCGGGACCAAAAGCTTGG**CGTGTTCACCCACAA*GGAGTTTGAG
SMG01_0044_A12.b : CCCCGCCGTCGCCCCGGGGACAAACAActgggcgtgtttccccacaaagaattttgagca
ITT01_0012_B04.b : CCCCGCCGTCGCCCCCGGGACCCAACAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
TES01_0063_E12.b : gttaaatcccccctgcctttccccccggggaaaaaaaaattgggggggggttctccccca
OVR01_0086_F08.b : cccccgccgtccccccccggaaataaaaaaattgggggggtttctccccccagggaattt
TES01_0105_D10.b : CCCCGCCGTCGCCCCCCGGACCAACAAGCTGGGCGTGTTCCCTCCCAAG*GAAGTTTGAG
LVR01_0030_B10.b : CCCCGCCGTCGCCCCCGGGAACAACAAACTGGGgcgtgtttcacgcacaaaggagtttga
PTG01_0053_B07.b : CCCCGCCGTCCCCCCCGGGAACAACAAACTGGG*CGTGTTCACGCACAC*GGAATTTGAA
TES01_0020_F06.b : CCCCCGCGTCGCCCCCGGGACCAATAAGCTGGG*CGTGTTCACGCACAA*AGAGTTTGAG
TES01_0003_D05.b : CCCCCGCGTCGCCCCCGGGACCAACAAGCTGGGGCGTGTTCACGCACAA*GGAGTTTGAG
OVR01_0055_F06.b : CCCCGCCGTCGCCCCCGGGACCAACAAGCTGGGGCGTGTTCACGCACAA*GGAGTTTGAG
SMG01_0044_G08.b : CCCCGCCGTCGCCCCCCGGGACCAACAACTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
SKNB1_0059_H06.b : CCCCGCCGTCGCCCCCGGGACCAACAAGCTGGG*CGTGTTCACGCACAA*AGAGTTTGAG
MLN01_0050_C06.b : ttattccccccccgccgttcccccccccggggaacaaaaaaaccttgggccgtgtttcca
OVRM1_0213_H07.b : CCCGC
OVRM1_0068_D09.b : CCCCGCCGTCGCCCCC**GGACCAACAGCTGGG*CGTG
PTG01_0032_G07.b : CCCCGCCGTCGCCCCCGGGACCAACAAGCTGGGGCGTGTTCACGCACAAAGGATTTTGAG
TES01_0105_B07.b : CCCCCGCGTCGCCCCCGGGACCAACAAGCTGGG*CGTGTTCACGCACAA**GAGTTTGAG
UTR01_0088_F11.b : CCCCGCCGTCGCCCCCGGGAACAACAAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
SMG01_0001_C02.b : CCCCGCCGTCGCCCCCGGGGACAAAAAGCTGGG*CGTGTTCACGCACAA*GGAAGTTGAG
PTG01_0019_B07.b : CCCCGCCGTCGCCCCCGGGGACAACAAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
MLN01_0023_B06.b : CCCCGCCGTCGCCCCCGGGACCAACAAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
UTR01_0066_B10.b : CCCCGCCGTCGCCCCCGGGACCAACAAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
TES01_0005_F04.b : CCCCGCCGTCGCCCCCGGGACCAACAAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
TES01_0001_A10.b : CCCCGCCGTCGCCCCCGGGACCAACAAGCTGGG*CGTGTTCACGCACAA*AGAGTTTGAG
PTG01_0074_G02.b : ccccgggaacaaaaaatggggcggtttcccccaaagagattttaaaccttgggcccccgg
OVRM1_0067_H09.b : CCCCGCCGTCCCCCCCCGGAACAAAAAGCTGAGCGT
SMG01_0091_E12.b : CCCCGGCGTCGCCCCCGGGAACA*CAAGCTGGG*CGTGTTCACcccaaggatttgaacaa
TCH01_0066_A01.b : CCCCGCCGTCGCCCCCGGGACCAACAAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
TES01_0082_G01.b : CCCCGCCGTCTCCTCCCGGGACCcaacaactgggcgtgtttactctccaaggatttggaa
TES01_0106_C01.b : CCCCGCCGTCCCCCCCGGGGACCAACAACTGGGgcctgttcacccccaagaattttgaac
TES01_0084_F04.b : CCCCGCCGTCGCCCCCGGGAACAACAAGCTGGG*CGTGTTCccccccaagaatttgagcc
OVRM1_0022_G05.b : CCCCGCCGTCGNCCCCGGACCAACAgctgggn
OVR01_0104_G10.b : CCCCGCCGTCGCCCCCTGGACCAACAAGCTTGGGCGTGTTccccccaccaagagttttta
TES01_0055_H03.b : CCCCGCCGTCGCCCCCGGGGACAACAAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
TES01_0104_A07.b : CCCCGCTGTCGCCCCCGGGACC*ACAAGCTGGG*CGTGTTCACGCACAA**GAGTTTGAG
SMG01_0019_F07.b : CCCCGCCGTCGCCCCCGGGAACCAACAGCTGGG*CGTGGTCACGCACAA**GAGTTTGAG
PTG01_0047_G03.b : CCCCGCCGTCGCCCC*GGGAACAACAAGCTGGG*CGTGGTCACGCACAA*GGAGTTTGAG
PTG01_0056_E05.b : gttttaaccccccccgggtctccccgggggaaaaaaaaaagggggggggttgcctccccc
TES01_0091_F07.b : CCCCGCCGTCGCCCCCGGGACCAACAAGCTGGG*Ccgggtcccccacaaggaatttggac
TES01_0100_E01.b : CCCCGCCGTTCGCCCCGGGACCAACAAGCTGGG*CGTGTTCACGCACAA*GGAATTTGAA
TES01_0076_H01.b : CCCCGCCGTCGCCCCCGGGACCCACAAGCTGGGGCGTGTTCACCCCCCA*GGAGTTTGAC
TES01_0064_B08.b : CCCCGCCGTCGCCCCCGGGACCAACA*GCTGGG*CGTGTTCACGCCCAA*GGAGTTTGAA
TES01_0056_F03.b : CCCCGCCGTCGCCCCCGGGACCAACAAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
TES01_0065_E03.b : CCCCGCCGTCGCCCCCGGGACCAACAAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
TES01_0005_B06.b : CCCCGCCGTCGCCCCCGGGAC***CAAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
TES01_0010_G05.b : CCCCGCCGTCGCCCCCGGGACCAACAAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
BFLT1_0101_C03.b : CCCCGCCGTCGCCCCCGGGACCAACAAGCTGGG*CGTGTTCACGCACNA*GGAGTTTGAG
TES01_0081_H08.b : ccccccccgcctttcccccccgggaccaaaaaaactgggcgtttttcccccaccaggagt
TES01_0099_D01.b : CCCGCCGTCCCCCCCCGGGAACAATAAGCTGGG*CGTGTTtcccccaaagggatttgagc
CLNT1_0018_F10.b : CCCCGCCGTCGCCCCCGGGACCAACAAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
PTG01_0099_D06.b : CCCCGCCGTCACCCCGGGGACCGAACAACTGGGGCGTGTTCACGCACAA*AGAGTTTGAG
OVR01_0013_E08.b : cctcccaccccccccggcaaccaacaacttcgcctgttcccccaccacgacttcaattcc
SKNB1_0058_F04.b : CCCCGCCGTCGCCCCCGGGACCAACAAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
ITT01_0064_C08.b : CCCCGCCGTCGCCCCCGGGACCAACAAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
TCH01_0071_G06.b : CCCCGCCGTCGCCCCCGGGACCAACAAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
SKNB1_0024_G04.b : CCCCGCCGTCGCCTCCGGGACCAACTAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
UTR01_0056_B07.b : CCCCGCCGTCGCCCCCGGGACCAACAAGCTGGG*CGTGTTCACGCACAA*GGAGTTTGAG
20110601C-002188 : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAG
---------+---------+---------+---------+---------+---------+ 921
TCH01_0043_D08.b : CAGCTGGCGCCCCTGCTGGACGG*CTTCAGCTCATGACCTACGACTACTCCACGGCGCAA
TES01_0071_H03.b : cccttgtggaaagttttctccctattaacttataaaattctcccgggggaaaaaaccggg
TCH01_0064_E12.b : gcccctgctggaaggttcagcctaataactagaaaactcacggggcaacaccctgcccca
LNG01_0087_D10.b : CAGCTGGCGCCCtgctggacggcttcgcctcatgacctaaactactccacgcgcancagc
TCH01_0100_F02.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAA
OVRT1_0012_G12.b : CAGCTGGCGCCCCTGCTGGACNGCTTCAGCCTCATNGACTACGACTACTCCAACGCGCAA
TES01_0061_G05.b : tagaactttggcccccccgtggggaaggttttacacctcggtaccataaaaattcccccg
TES01_0024_H02.b : CA*CTGGCGCCCCTGCTGGAAGGCTTTAGCCTCATGACCTAgaatactcccggcgcagca
TES01_0053_C10.b : tgtcccccctgctggacagcttctacctcatgaactctcaaattattctatgtcgctcca
TES01_0006_E11.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAG
TES01_0069_E05.b : ttgggcccccttgttgaaaggttttaacccctgaaacctaaaaataatccccggggccaa
OVR01_0094_C11.b : tgaagccccttggcgccccttgtctggacggttttcagcctccattaccctacgaactac
TES01_0084_C04.b : CAACTGGCGCCCCTGCTGGAAGGCTTCACCCTCTTGACCTACGAATACTCCACGGGGCAA
SPLT1_0095_C11.b : CAGCTGGCGCCCCTGCTGGACGGGCTCAGCCTCATGACCTACGACTACTCCACGGCGCAG
BFLT1_0006_H07.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAA
TES01_0102_C04.b : cagcttggcgcccctgttggaagggcttcgccctctggaactacaaattctccccggggg
SPLT1_0039_G07.b : cctggcgcccctgcttggaggcttcacctcatgacttcgaacaatccagggccaacacct
SMG01_0067_G02.b : CACCTGGCGCCCCTGCTGGACGGGCTCCACCTCATGACCTAAGACTACTCCAGGGGGCAA
OVRT1_0116_B03.b : CAGCTGGCGCCCCTGCTGGAACGCTTCAGCCTCATGAACTACGACTACTCCACGGCGCAG
UTR01_0102_E10.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGGGCAA
OVR01_0066_D12.b : acaagctggcgccccctggctggaagggtttcagccctcatgaaccttacgaactactcc
PCT01_0012_H04.b : CAGCTGGCGCCCCTGCTAGACGN*TTCAGCCTCATGACCTACGACTACTCCACGG*GCAA
TES01_0003_G10.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCCG
THY01_0101_B08.b :
TES01_0078_B06.b : tttgaaccatcttggcgcccctgtttgaaaggctttaccctcatagacctattaatattc
LVRM1_0036_H12.b :
TES01_0009_B08.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAG
TES01_0036_B02.b : acaactggggccccctgcttgaagggtttcagccccttgaaccaagaattctccccgggg
TES01_0031_H01.b : CAGCTGGGGCCCCTGCTGGAagggtttcgcctcttgaactaagattacttcccggggcaa
SMG01_0044_A12.b : actggggcccctgctgaaaggtttcgcctcttgacctaaaaataatcacggggaaacaac
ITT01_0012_B04.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAG
TES01_0063_E12.b : aaaagttttaaaacctttgtgcccctatctggaaggtttttcccctctgtatataaaaaa
OVR01_0086_F08.b : taacaccttggcgccccctcccgggacgggttcccccccccttgaccatataaaaatctc
TES01_0105_D10.b : CAACTGGCGCCCCTGCTGGAagggtttcgccttcatgacctacgactactcccacggggc
LVR01_0030_B10.b : acagcttggcgcccctgccagggcggctttcacctcatgaactacgcactactcccacgg
PTG01_0053_B07.b : CAGCTGGCGCCCCTGCTAAACGGGTTCAGCCTCATGAacctaaaaatactccacggggca
TES01_0020_F06.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAACCTTCTGACCTACGACTACTCCACAGCGCAG
TES01_0003_D05.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCCCATGACCTACGACTACTCCACGGCGCAG
OVR01_0055_F06.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGGCGCA
SMG01_0044_G08.b : CAACTGGCGCCCCTGCGGAACGGCTTCAGCCTCATGAACCACGACTACTCCACGGCGCAA
SKNB1_0059_H06.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAG
MLN01_0050_C06.b : cccaaaaaggaaatttttaaaacaacttggggcccccccttttttggaaagggtttttac
OVRM1_0213_H07.b :
OVRM1_0068_D09.b :
PTG01_0032_G07.b : CAGCTGGCGCCCCTGCTAAACCGCTTCAGCCctcatgacctacgaataactcccggggca
TES01_0105_B07.b : CAGCTGGCGCCCCTGCTGGACGGCTTC*GCCTTCTGACCTACGACTACTCCACGGCGCAA
UTR01_0088_F11.b : CAGCTGGCGCCCCCTGCTGAACGCTTCAGCCCCATGAACCTCGACTACTCCCCGGGGCAA
SMG01_0001_C02.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGAACTACGACTACTCCACGGCGCAG
PTG01_0019_B07.b : CAGCTGGCGCCCCTGCTAGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAG
MLN01_0023_B06.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAG
UTR01_0066_B10.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAG
TES01_0005_F04.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAG
TES01_0001_A10.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAG
PTG01_0074_G02.b : tggaaggttcccccctaggaactaaaaatacccccggggaaaacctgggcccaaaaaaac
OVRM1_0067_H09.b :
SMG01_0091_E12.b : ctggcgcccctgctggacggcttcgcctcatgacctacgaatactccacgggccaacaac
TCH01_0066_A01.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAG
TES01_0082_G01.b : caactggcccccctgcttggaagggtttcagccctcatgacttacgattaactcacgggg
TES01_0106_C01.b : aactgggccccccgctggaacggtttcacccccttgaactaaaattaattccgggggcaa
TES01_0084_F04.b : actggcgcccctgctggaaggtttcaccctcttgacctacaaatactcccaggggccaca
OVRM1_0022_G05.b :
OVR01_0104_G10.b : acaactgggcgcccctggttggaagggcttccgccctcctggacctatcaacttacttcc
TES01_0055_H03.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAG
TES01_0104_A07.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAG
SMG01_0019_F07.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGAACTACGAATACTCCACGGCGCAG
PTG01_0047_G03.b : CAGCTGGCGCCCCTGCTGGACGGCTTCA*CCTCATGACTTACGACTACTCCACGGCGCAA
PTG01_0056_E05.b : aaaattttttttttgtggggcccccccccgcgggggggttttcccccctaaaaaaaaaaa
TES01_0091_F07.b : acctgggcccccggctggacggttcagccccctgaacttagaatactcccacgggccaaa
TES01_0100_E01.b : CAGCTGGGCGCCCTGCGGGAC*GCTTCAGCCTCATGAACCTAGACTACTCCAAGGCGCAC
TES01_0076_H01.b : CAACTGGCGCCCCTGCTGGACGGCTTCCGCCTCATGAACCTAGAATACTCCAAGGGGCAA
TES01_0064_B08.b : CAGCTTGCCCCCTTGCTtgaagggtttcgcctcttgaccttagactactcacggggcaac
TES01_0056_F03.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAG
TES01_0065_E03.b : CAGCTGGCGCCCCTGCTGGACGGCTTCCGCCTCTTGACCTAAGACTACTC*ACGGCGCAG
TES01_0005_B06.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAG
TES01_0010_G05.b : CAGCTGGGCGCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAG
BFLT1_0101_C03.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACTTACGACTACTCCACGGCGCAA
TES01_0081_H08.b : tttggaacatttgggtccccctggtggataggtttttccctcattgacctactaattact
TES01_0099_D01.b : acttggcccccctgctgaagggttccacctcttgacttactactattccagggtccaaaa
CLNT1_0018_F10.b : CAGCTGGCGCCCCTGCTGAACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAG
PTG01_0099_D06.b : CAGCTGGCGCCCCTGCTGTACGGCTTCCACCTCATGACCTACGACTACTCCACGG*GCAA
OVR01_0013_E08.b : accatccttgccttgtcctgtttctaccttatttctcaccatctcttctcatccgtaacc
SKNB1_0058_F04.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAG
ITT01_0064_C08.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAG
TCH01_0071_G06.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAG
SKNB1_0024_G04.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACGCCATGGCGCAT
UTR01_0056_B07.b : CAGCTGGCGCCCCTGCTGGACGGCTTCAGCCTCATGACCTACGACTACTCCACGGCGCAG
20110601C-002188 : CAGCCTGGC*CCCAACGCACCGCTGT*CCTGGGTGCGGGCCTGTGTCCAGGTCCTGGACC
---------+---------+---------+---------+---------+---------+ 979
TCH01_0043_D08.b : CAGCCTGGC*CCCAACGCACCGTTGC*CCTGGGG*CGGGCCTGTGTCCAGGT*CCTGGAC
TES01_0071_H03.b : ggcccaaaaaccccccttttcttgggggggggcccttttccacgttcccggaaacccaat
TCH01_0064_E12.b : agcaaccgtttccgggtgcgggcgtgttcaggtccggaccccagtcccggggcggaacaa
LNG01_0087_D10.b : ctggccccaagcacgctgtcctgggtgcggccgtgtccggtcctggacccaattcccgtg
TCH01_0100_F02.b : CAGCCTGGC*CCCCACGCACCGCTtgtctggggtgcggccctgtgtccagtccttgaacc
OVRT1_0012_G12.b : CAGCCTGG**CCCAACGCNACGCTGT*CCTGGGTGCGGGCCTGTGTCAAGNT*CCTGGAC
TES01_0061_G05.b : ggggcaattaacctggggccccaagcacacctttttttgggggggggggctttttccaga
TES01_0024_H02.b : acctggccccaacccaccctgtcctgggtgggggccttgttccagttccggaacccagtt
TES01_0053_C10.b : acttggccccacaaaacgcttttctgggtgctggcctgagatcaagtcctggaacccaaa
TES01_0006_E11.b : CAACCTGGC*CCCAACGCACCGCTGC*CCTGGGTGCGGGGCTGTGTCCAAGT*CCctgaa
TES01_0069_E05.b : aacccttgtgcccaaaaaaccccttttccggggggggggcccggtttccggatcctggaa
OVR01_0094_C11.b : tttcacggtctcattcatccttgtgcccctaactcactccccttttccttggggggccgg
TES01_0084_C04.b : CAACCTTGCCCCCAAAGCACCCCTGT*CCTGGGGGCGGGCCTGGTTCCAGGT*CCcggaa
SPLT1_0095_C11.b : CAGtacatccagacgctgaaggaccacggcccccggatcacgtgggacacccagccccag
BFLT1_0006_H07.b : CAGCCTGGC*CCCAACGCAC*GCTGT*CCTGGGTGCGGGCCTGTGTCCAGGT*CGTGAAC
TES01_0102_C04.b : aacacacctggcccctaacccaccgttgtcctgggggggcgggcctgtgtcccaggtcct
SPLT1_0039_G07.b : ggccccaagcaccctttcctgggtgcgggccgttttccgttccggaacccaatttcggtg
SMG01_0067_G02.b : CAACCTGGC*CCCAAAGCACGCTTGT*CCTGGGGGCGGGCTGGTGTCCAGGT*CCTGAAC
OVRT1_0116_B03.b : CAGCCTGCC**CCAACGCACCctgtcccgggggccgggctgtgtccagtcctggacccca
UTR01_0102_E10.b : CAACCTGGGCCCCAACGCACCCCTGT*CCCGGGGGCCGGCCTGTGTCCCGGTCCcgggac
OVR01_0066_D12.b : cacggggccaaccagcctgggcccccaacgccaccgctgttccggggtggcggggcccgg
PCT01_0012_H04.b : CAGCCTGC**CCCCAAGCAACGCTGT*CCTGGGTGCGGGCtgtgtccagttcctgaaccc
TES01_0003_G10.b : CACCCTGGC*CCCTACGCACCCCTGT*CCTGGGTGCGGGCCTGTGTCCAGGTCCTGAACC
THY01_0101_B08.b :
TES01_0078_B06.b : ccctggtcaaaaaaacttgaccccatattacaccctttcttggtgtggggacctgtgttc
LVRM1_0036_H12.b :
TES01_0009_B08.b : CAGCCTGG**CCCCACGCACCGCTGT*CCTGGGTGCGGGCCTGTGTCCAGGTCCTGGACC
TES01_0036_B02.b : caaaaaccctggcccccaaacaccccttttcttgggggggggccggtgtcccagtctctg
TES01_0031_H01.b : aaaccctgggcccaaacgcaccgttgttctggggggcgggcctgggtcccggtcctggaa
SMG01_0044_A12.b : tgggccccaagcaaccttttctgggggggggcctgtttccaggtccggaacccaatcccg
ITT01_0012_B04.b : CAGCCTGGC*CCCCACGCACCGCTGT*CCTGGGTGCGGGCCTGTGTCCAGGTCCTGGACC
TES01_0063_E12.b : tattcccagggtgaatgatatcttgtccccattaaacacatttctttggggggggggggt
OVR01_0086_F08.b : tccatgcggccactaaatttgttcccctacattcacccctttttcctgggtggtcgggcc
TES01_0105_D10.b : aacagcctgggcccaatgcaccgttgtcccggggggcgggcctgttgcccaggtccggga
LVR01_0030_B10.b : gccagcaacctggccccaaacccacccgcttgtccttgggtgggggccctgttttccagt
PTG01_0053_B07.b : acaagctggcccccaagaaccgctggtccggggggcgggcctgtttccaaggccctggac
TES01_0020_F06.b : CAGCTTGG**CCCCACGCACCTGTTGTCCTGGGGGCGGGGCTGTGTCCAGtccttgaacc
TES01_0003_D05.b : CAGCCTGG**CCCCACGCACCGCTGTTCCTGGGTGCGGGCCTGTGTCCAGGTTCCTGGAC
OVR01_0055_F06.b : ACACCCTGGCCCCCACGCACCGCTtgtcctgggtgcgggcctggggtccaggttcctgga
SMG01_0044_G08.b : CAACCTGGC*CCCAAGGCACCGCTTT*CTGGGGTGCGGGCCTGTGTCAGGGC*CCTGAAC
SKNB1_0059_H06.b : CAGCCTGG**CCCANCGCACCGCTGT*CCTGGGTGCGGGCCTGTGTCCAGGTC**TGGAC
MLN01_0050_C06.b : ccccctttgaaaccataaaaaaaacttcccccgggggggaaaaaaaaactttgggccccc
OVRM1_0213_H07.b :
OVRM1_0068_D09.b :
PTG01_0032_G07.b : acaagctggccccacggcacccgtgtcctgggggggggcctggggccaagtcccggaacc
TES01_0105_B07.b : CAGCCGGC**CCCAACGCACCCCTGTCtgggtgcgggcctggtgtcaggtcctgaacccc
UTR01_0088_F11.b : CACCCGGGC*CCCAAAGCACCCCTGTCCTGGGggggggccctgtgtcccggtccctggac
SMG01_0001_C02.b : CACCTTGGC*CCCAACCCACCGCTGT*CCTGGGTGCGGGCCTGTGTCCAGtcctggaacc
PTG01_0019_B07.b : CAGCCTGG**CCCCACGCAACGCTGT**CCTGGTGCGGGCCTGTGTCCAGGTCCTGGACC
MLN01_0023_B06.b : CAGCCTGG**CCCCACGCACCGCTGT*CCTGGGTGCGGGCCTGTGTCCAGGTCCTGGACC
UTR01_0066_B10.b : CAGCCTGGC*CCCAACGCACCGCTGT*CCTGGGTGCGGGCCTGTGTCCAGGTCCTGGACC
TES01_0005_F04.b : CAGCCTGGC*CCCCACGCACCGCTGT*CTTGGGTGCGGGCCTGTTGTCCAGTCCTGGACC
TES01_0001_A10.b : CAGCCTGGC*CCCAACGCACCGCTGT*CCTGGGTGCGGGCCTGTGTCCAGGTCCTGGACC
PTG01_0074_G02.b : cttttttggggggggggcgtgtttcaattctggaacccaaattccgtgggggaaaaaaaa
OVRM1_0067_H09.b :
SMG01_0091_E12.b : ttggcccaaagcaccgttttcttgggggcgggcttgtgtccagtccctgaacccaattcc
TCH01_0066_A01.b : CAGCCTGGCCCCACGCACGCTGT****CCTGGGTGCGGGCCTGTGTCCAGGTTCTGGACC
TES01_0082_G01.b : gcaacaacctggacccaaaaccacctgtttccttgggggggggcctgtggtccaggtccc
TES01_0106_C01.b : caacctggcccccaacccacccttttccttggggggggccctgtttccaggttccgggaa
TES01_0084_F04.b : acctggccccaaataacgcttgtcctggtggcggcccgtgtccaggcccggaaccccaat
OVRM1_0022_G05.b :
OVR01_0104_G10.b : ccgggcgcaaacaaacctgggccccaaacgcaacccccttttccctgggggtgcggggcc
TES01_0055_H03.b : CAACCTGGG*CCCCACGCACCGCTGT*CCTGGGTGCGGGGCTGTGTCCAGGTCCTGGACC
TES01_0104_A07.b : CAGCCTGG**CCCCACGCAACGCTGT*CCTGGGTGCGGGCCTGTGTCCA*GT*CCTGGAC
SMG01_0019_F07.b : CAACCTGGC*CCCCACGCACCGCTGT*CCTGGTTGCGGGCCTGTGGTCCAGTCCTGGACC
PTG01_0047_G03.b : CAGCCTGGC*CCCAACGCACCGCTGT*CCTGGGTGGCGGCCTGTGTTCCAGGTCCGGACC
PTG01_0056_E05.b : aaaaacccccccggggaaacctttggcccccccaacaaacctttttgttggggggggggg
TES01_0091_F07.b : agccgggccccaagcacccctgtcctgggggcgggccgggtcccggtcctggaccccaat
TES01_0100_E01.b : CAGCCTGGCCCCCAagccccgcttgcccgggtggcgggcctgtgtccaggttcgggaacc
TES01_0076_H01.b : CAACCTGGC*CCCAAAGCACCccttttcctgggtgggggccggggttccagttccggaac
TES01_0064_B08.b : aaccttgcccccaagcacccgttgtcttggggcggggcctgtttccaggtcctggaaccc
TES01_0056_F03.b : CAGCCTGGC*CCCAACGGCACGCTGT*CCTGGGTGCGGGCCTGGGTCCAGGTCCTGGACC
TES01_0065_E03.b : CAGCCCTGGCCCCAACGCACCGCTGT*TCTGGGTGCGGGCCTGTGTCCCGGTCCTGGACC
TES01_0005_B06.b : CAGCCTGGC*CCCAACGCACCGCTGT*CCTGGGTGCGGGCCTGTGTCCAGGTCCTGGACC
TES01_0010_G05.b : CAGCCTGG**CCCAACGCACCGCTGT*CCTGGGTGCGGGCCTGTGTCCAGGTCCTGGACC
BFLT1_0101_C03.b : CAGCCTGGC*CCCAAAGCAACGCTGT*CCTGGGTGCGGGCtgtgtccagtcctggacccc
TES01_0081_H08.b : ccaagggggatagaagtctgggccccaaagactctttttctcttgggggggggcctatgt
TES01_0099_D01.b : acctggccccataacccctttttcctgggtgggggccctggtccctgtcctgaaacccaa
CLNT1_0018_F10.b : CAGCCTGGC*CCCAACGCACCGCTGT*CCTGGGTGCGGGCCTGTGTCCAGGTCCTGAAAC
PTG01_0099_D06.b : CATCCTGGC*CCCAACGCACggttgtctgggtgcgggcctgtgtccaggttctgacccaa
OVR01_0013_E08.b : atctgccctccttcacccctcccctcccttctaattcacctattctctcccccccaccct
SKNB1_0058_F04.b : CAGCCTGGC*CCCAACGCACCGCTGT*CCTGGGTGCGGGCCTGTGTCCAGGTCCTGGNAC
ITT01_0064_C08.b : CAGCCTGGC*CCCAACGCACCGCTGT*CCTGGGTGCGGGCCTGTGTCCAGGTCCTGGACC
TCH01_0071_G06.b : CAGCCTGGC*CCCAACGCACCCCTGT*CCTGGGTGCGGGCCTGTGTCCAGGTCCTGGACC
SKNB1_0024_G04.b : CAGCCTGGC*CTCAACGCACCGCTGT*CCTGGGTGCGGGCCTGTGTCCAGGTCCTGGACC
UTR01_0056_B07.b : CAGCCTGGC*CCCAACGCACCGCTGT*CCTGGGTGCGGGCCTGTGTCCAGGTCCTGGACC
20110601C-002188 : CCAAGTCCCGGTGG*CGGAGCAAGAT*CCTGCTGGGGCTCAACTTCTACGGCATGGACTA
---------+---------+---------+---------+---------+---------+ 1037
TCH01_0043_D08.b : CCCAAGTCCCGGTG*Ggggaaccaaaatccggctggggctcaacttctacggcatgggac
TES01_0071_H03.b : acccggtttggggaacaaaaatttttagggggtccccaattttttagggctgtgatataa
TCH01_0064_E12.b : aacccctggggcccacttccagggtggaaacccccccccat
LNG01_0087_D10.b : gcgaacagatctgctggggctcactcaacgcatggatacccacctcaggatgcccgagcc
TCH01_0100_F02.b : ccagtccggtgggcggacaagatcctgcttgggctcaacttcaacgcatgaactacccac
OVRT1_0012_G12.b : CCNAGTCCgggtggcgagcagatcctgctggggctcactctacgcatggactaccaccct
TES01_0061_G05.b : tcccgggacccctattccggggggggaaaaaaaaaccccgggggggcccaattttttagc
TES01_0024_H02.b : ccggggggggaaaaaatctggctgggggtcaatttttagggttggaatataccaccctcc
TES01_0053_C10.b : ctccggggtgcttaacacaatcccgttgtgagctaatctttaacggttggtctaaccttc
TES01_0006_E11.b : ccccagtccccggtggcgggagcaagaatctgctggggctcaaacttccacgggatggga
TES01_0069_E05.b : ccccatccccggggggaaaaaaaaaacccgggggggctacttttccggggggggaacaaa
OVR01_0094_C11.b : gcccttttgttcccaagtcccctgggccccccaagtttcccggttggggggaaataaaat
TES01_0084_C04.b : cccacattcccggtggcggaaaccaaaatctgcgcggggccccaaattcttaggggtggg
SPLT1_0095_C11.b : agcacgtctttaattaaagagaaaccgcggtgggaggcaatcgtcttctaccgaacctaa
BFLT1_0006_H07.b : CCAAGTCCCGGTGG*GCGAACAAGAT*CCTGCTGGGGCTC*Acttctacggaaggaacta
TES01_0102_C04.b : ggaaccccaattccccgggggggaaaaaaaaacctggcggggggcccaacttctctggga
SPLT1_0039_G07.b : gcgaacaaatcccgtggggccaacttccaggcatggctaccacctcccagatcccccacc
SMG01_0067_G02.b : CCCAAGTCCCGGggggggagcaaaatccggcgggggcccaacttttaaggatggaccaac
OVRT1_0116_B03.b : attccgttggcgaacaaaatctgctggggctcactttacgggaggaatacccccccccag
UTR01_0102_E10.b : cccaagtcccgggtgggcgaaccaggatcctggtgggggctcactttctagggagtggac
OVR01_0066_D12.b : ggttccgggttcccgggaacccccaaatccccggggggggggaaaaccaagaaatccttg
PCT01_0012_H04.b : aatccccggtggcggaacaaatcttgctggggctcactttcacgggatggaataaccacc
TES01_0003_G10.b : CCAAGTCCCcgggggcggaacagaaccctggtgggggctcacactttctccggatgggaa
THY01_0101_B08.b :
TES01_0078_B06.b : ctgtttcctggaaccctaattcccttggggggaaacaaaaatccttttgggggtctatat
LVRM1_0036_H12.b :
TES01_0009_B08.b : CCAAGTCCCGGTGGCNNGAGCA*GAT*CCTGCTGGGGCTC*ACTTCTACGGCATGGACTA
TES01_0036_B02.b : ggaccccaattcccggggggggaacaaaattcctctgggggcccaccttttctcggggtg
TES01_0031_H01.b : ccccaattcccgtggggggaaaaagaatccggtggggggccaacttcttagggagtggaa
SMG01_0044_A12.b : gtggggaaaaagaacctgccgggggtcaccttttaccggatggaaaaaccaccccccaag
ITT01_0012_B04.b : C**AAGTCCCGGTGGGCGAGCA*GAT*CCTGCTGGGGCTC*NACTCTACGGCATGGACTA
TES01_0063_E12.b : cggtgttaaaatatcattaacaccaacaactccctgggtgggataaataatacattggtg
OVR01_0086_F08.b : ctgttttttctaattactctgcaatcccaaattcccccgcgtggcttgtatcatgaatat
TES01_0105_D10.b : ccccatgtccccggtggggggaacaaaatcctggctggggctcactttctacggaatgga
LVR01_0030_B10.b : tcctggaccccaaatccccggggggcgaaaccaaaaacccggcggggggctccaactttc
PTG01_0053_B07.b : cccaatccccgggggcggaaaaaaatctgctgggggctaaatttctaggggaggaaaaac
TES01_0020_F06.b : ccaatccccggtggggaacaagatcctgttggggatcaactcttctggttggactaagcc
TES01_0003_D05.b : CCCAAGTCCCGGTG*GCtgaacaagatcctggctggggttcaacttttacgggatgtgat
OVR01_0055_F06.b : acccaagttcccggtgggggaaccaagaacctgcttggggccttcaacttcttacgggaa
SMG01_0044_G08.b : CCCCAATCCCGGgggggaaacaagatcctgctggggcccaacttctacggaatggaaaac
SKNB1_0059_H06.b : CCCAAGTCCCGGTGGCGGAGCANGAT*CCTGCTGGGGCTC*ACTTCTACGGCATGGACTA
MLN01_0050_C06.b : aaaaaaaccaccgtgttttttttttgggggggggcggccccctttttttttcccaaattc
OVRM1_0213_H07.b :
OVRM1_0068_D09.b :
PTG01_0032_G07.b : ccaattcccggtggcggaacaaatcctggctggggtccaatttcaacggatggaaaaccc
TES01_0105_B07.b : agtcccggggggcgaacaagaaccgggcggggctcaacttttacggtatggaattaccac
UTR01_0088_F11.b : cccaatccccgggggcggaacaaagatcctgccgggggctccaacttcttagggaatgga
SMG01_0001_C02.b : caatcccggtggcggaacaaatcctgctgggctaaattctacggatgaataaccaacctc
PTG01_0019_B07.b : Caagtccccgtgcggaacagatctgctggggctcaactccacggatggactacccgcctc
MLN01_0023_B06.b : CCAAGTCCggtggcgagcaagatctgctggggctcaacttctacgcatggactagcagcc
UTR01_0066_B10.b : CCAAGTTCCCGtgggcgaccaagatcctggttggggctcaactttctcgggatggaatta
TES01_0005_F04.b : CCAA*TCCCGGGTGGCGGAGCAAGAT*CCTGCTGGGGCTCAACTTCTACGGCATGGACTA
TES01_0001_A10.b : CCAAGTTCCCGGTGCCGGAGCAAGATCCCTGCTGGGGCTCAACTTCTACGGCATGGACTA
PTG01_0074_G02.b : acctggggggccccctctttgcggggagaaacccccccccccagggagccccgcggcccc
OVRM1_0067_H09.b :
SMG01_0091_E12.b : cgggggggaaaaaaatccgggtgggggctcaattccccggcagggaaaaaccacccccca
TCH01_0066_A01.b : CCAAGTCCCGGTGG*GCGAGCAAGAT*CCTGCTGGGGCTC*Acttctacggaatgactac
TES01_0082_G01.b : tggaaccccaaatccctggggggcgaaaacaaatcttgtcgggggttcaatttctggcgg
TES01_0106_C01.b : ccccaatcccggggggggaaaaaaaaatccggcgggggccccactttccagggagggaac
TES01_0084_F04.b : tcccggggcggaaacaaaatcggctgggggctcatttcttcggagggaaaaacccccccc
OVRM1_0022_G05.b :
OVR01_0104_G10.b : ttgttgtcccagggtcctgtggaaccccccagattccccggggggggggaaaacaaaaaa
TES01_0055_H03.b : CCAAGTCCCGGTGG*CCGAGCAAGAA*TCTGCTGGGGCTcaacttctacggcatggacta
TES01_0104_A07.b : CCCAGTCCCGGTGG*GCGAGCA*GAT*CCTGCTGGGGCTC*Acttctacgcatggatacg
SMG01_0019_F07.b : CCAAATCCCGtggccaaacaagaatctgctgggcctcaacttcacggaatggactaccag
PTG01_0047_G03.b : CCAAGTCCCGGGGG*GGGAGCAaaatcccgctggggctcaaattctacgggatggacata
PTG01_0056_E05.b : gggtgttttttttttaaccccaccccccccgggggggggaggaaaaaaaaaagggggggg
TES01_0091_F07.b : tccgggggggggaacaaatcccgctggggcccaacttcccgggtgggacaaccccccccc
TES01_0100_E01.b : ccaattcccggggggggaacaaaaatctggctggggcctcaactttcacgggaagggaat
TES01_0076_H01.b : ccccaatccccggggggggaacaagaacccgccggggccccaaacttctccgggcgggga
TES01_0064_B08.b : caattcccgggggcggaaacaaaatccccgggggggccaacttttccggggggggatacc
TES01_0056_F03.b : CCAAGTCCggtggcgaagcagaatcctggtggggctcaacttctacggaatggaatacgc
TES01_0065_E03.b : CCAAGTCCCGtgggcgaacaaaaatccgctggggctcaacttctacggaatggactaacc
TES01_0005_B06.b : CCA**GTCCCGGTGGCGGAGCAAGAT*CCTGCTGGGGCTC*ACTTCTACGGgaggaacta
TES01_0010_G05.b : CCAAGTCCCGGTGGCGGGAGCAGATC*CTGCTGGGGGCTCAACTTCTACGCCATGGACTA
BFLT1_0101_C03.b : agtcccgggggcgagacaggatcgggcggggctaacttcaacggaatggaaaacccacct
TES01_0081_H08.b : tcccattctcggcaacccaattccccgggggtgaaataaataaacttttgggggactcaa
TES01_0099_D01.b : tttccgggtggggaaaaaaaaatctggggggtcctcacttttcagggtttggaaaaccca
CLNT1_0018_F10.b : CCAAGGTCCCGGTGCGGGAGCAAGAT*CCggctggggctcaactctacgggatggactac
PTG01_0099_D06.b : ttcccggttggggaaacagatcctgctggggttcattttctagggctggaataacctgcc
OVR01_0013_E08.b : ttttcccactcccacactaccacccacttcccaaacctccccctcctccctccttcccac
SKNB1_0058_F04.b : CCCAGTCCCGGTGGCGGGAGCA*GAT*CCTGCTGGGGGCTCACTTCTACGGCATGGACTA
ITT01_0064_C08.b : CCAAGTCCCGGTGG**CGGAGCAGAT*CCTGCTGGGGGCTCACTTCTACGGCATGGACTA
TCH01_0071_G06.b : CCA**GTCCCGGTGGGCGGAGCAGAT*CCTGCTGGGGCTCAACTTCTACGGCATGGACTA
SKNB1_0024_G04.b : CCAAGTCCCGGTGG*CGGAGCAAGAT*CCTGCTGGGGCTCAACCTCTACGGCATGGACTA
UTR01_0056_B07.b : CCAAGTCCCGGTGG*CGGAGCAAGAT*CCTGCTGGGGCTCAACTTCTACGGCATGGACTA
20110601C-002188 : CGCAGCCTCCAAGGATGCCCGCGAGCCCATCATTGGGGCCAGGTACATCCAGACGCTGAA
---------+---------+---------+---------+---------+---------+ 1097
TCH01_0043_D08.b : taaccaccccccagggaggcccgcggacccttcttgtgggcccggttactccaaaacctt
TES01_0071_H03.b : acacccttcaagagattccctcgaacccttcttttgggcgccttctatctctaacccctt
TCH01_0064_E12.b :
LNG01_0087_D10.b : ctcatggggcagtactccgacgctgagacccggcccgatcgggggacaccaccccaaacc
TCH01_0100_F02.b : ctccaaggatgcccgcgagcccatcatggggccggttcatcccaaccctgaggaccacgg
OVRT1_0012_G12.b : ccagatgccggcagncttcctggggcaggtcatccagacctgaagacccangccccgatc
TES01_0061_G05.b : gggggagtacttcccccccccaaggatgccccgtggcccatttttgtggggcgggttttc
TES01_0024_H02.b : agggatgccgcaagccattctttgggggccggtcatttcaaaccctgaaggaaccaaggc
TES01_0053_C10.b : cttcaaaaatttcccttacccctctatgtggcatggatactcctctatctttcatgatct
TES01_0006_E11.b : ctaccccagcctccaaggaagccccgccaagcccatcattggaggccaggtaactcccaa
TES01_0069_E05.b : ccccccccagggacccccggacccccttttggggcccggaatctcccctctataagaaac
OVR01_0094_C11.b : cccttgcttgtgggctctcaactctctccacgggtcttgtgtaattaattcagatccttt
TES01_0084_C04.b : actaagccaacccccaagggaatgccccggaacccctcttttggggccgggaaaatttca
SPLT1_0095_C11.b : attcttgccggtgcggcttacttgccagggattggggcgtcgggcttcaatcgggaactg
BFLT1_0006_H07.b : ccaaccttcaaggatggccgggagccctcattggggccagggaactccgaccctgaagac
TES01_0102_C04.b : gggatatacccaccccctgggatgccccgagaccctttattgggggcccggtaatcccaa
SPLT1_0039_G07.b : ccctatgggccaggtaatccaaccctaaaaacccagcccgaatcttggaaaccaacccca
SMG01_0067_G02.b : cacccccaaggaagccccaaacccctcttgtgggcccggtcattccaacactaaagacca
OVRT1_0116_B03.b : gatgccgcaacccattattggggcggtaatccaaactgaagaaccaggccggaaactggg
UTR01_0102_E10.b : taaccaaccccccaggaaggccccgcagccccatccttggggccagggtacatcccaaac
OVR01_0066_D12.b : gctggggggctttaaacttttcttccgggggattggaaaataacccccagccccctccca
PCT01_0012_H04.b : ccccaggaagcccgggagctttctttgggggcaggaaatcccaaacttaaagaccccggc
TES01_0003_G10.b : ttacccacccccccaaggaatgcccccgaacccactcatttggggccaaggacctttcca
THY01_0101_B08.b :
TES01_0078_B06.b : ttttctaggaagtgataataccaaccccccagatattcccccctaacccctcttttgggt
LVRM1_0036_H12.b :
TES01_0009_B08.b : CGCAGCCTCCAAGatgcccgcgagcccatcattggggccagtacatcagacgctgaagga
TES01_0036_B02.b : gagtatcctccccccaagggaggcccgccagcccctttttggggcccggaatttcctcca
TES01_0031_H01.b : tatcaccaccccccaaggatgcccgcaagccctcttttggggcccggttcatcccaaatc
SMG01_0044_A12.b : aagcccccgagcccatttttggggccgggtaattccaaacctgaaaggaccaaggccccg
ITT01_0012_B04.b : CGCAGCCTCaaggatgccgcgagccatcattgggccaggtacatccagagctgaagacca
TES01_0063_E12.b : gggtacttctttcttcgttagggaaaaaaatccccccccactaggaaagcccgtaacccc
OVR01_0086_F08.b : cttcctgtgtggccctcaccttttactgcagggggaatttatcacatctcctcctcggtt
TES01_0105_D10.b : ttatccaccccccagggatgccccggagcccttcattggggccggttatctcctaatcct
LVR01_0030_B10.b : taagggtatggaaaataaccaccccctcaaagaatgcccccccaaacccccttacattgg
PTG01_0053_B07.b : cacccccaagaatcccggaagccaattttggggccggtaaatccaaaccttaaaaccacg
TES01_0020_F06.b : gccccccaggaggccctctagctcctctttgggggccggtaatttccgaactcttataga
TES01_0003_D05.b : acgccaccccccaaggatgcccgccaagccccttctttggggcccgggtacatcccaacg
OVR01_0055_F06.b : tggaactacgccaacccttcaaaggaaggcccccaagccccttcatttgtgggcccgggt
SMG01_0044_G08.b : caacctccaaagatgcccccaaggccatacatggggccaggtctttccaaaccctaaaga
SKNB1_0059_H06.b : CGCAGCCTCCCAGGAgcccgccagcccatcattggggccggtactcccaacgctgaagga
MLN01_0050_C06.b : ctcggaaaaaccccacaaaatttcccccggggtggggggagaaaaaaaaaatttctcttc
OVRM1_0213_H07.b :
OVRM1_0068_D09.b :
PTG01_0032_G07.b : acccccaaggatgccgcaagcccatcatggggccaggtaattccaaacctaaaggaccaa
TES01_0105_B07.b : ccccagggagcccgccaacccccttttgggggccggtaatttccaaacctaaagaaccaa
UTR01_0088_F11.b : aaaaccccacccctccaagagtgccccccgaaccccatctattggggcccgggtaactcc
SMG01_0001_C02.b : aagaagcccccaacccctattggggccggtactccaaacctgaagaacaaagcccgaatt
PTG01_0019_B07.b : caggaagccgcgaggccatcttggggccgtaaatcagacccttaagacaacagccccgat
MLN01_0023_B06.b : ccaaggatgcccgcaacccatcattgggccagtacatcagagctaaagacacagccccgg
UTR01_0066_B10.b : cgccgccccccaagggagccccccaagccccctctttgggggccagggtacatcccaaac
TES01_0005_F04.b : CGCCACCTCCAAAGATGCCCGCcaagccctcattggggccggtacttccagaccctgaag
TES01_0001_A10.b : AGCAGCCTCCAAGGATGCCCGCGAGcccatcattggggccaggtacatccagaccctaaa
PTG01_0074_G02.b : cttttgggggggggtctcccccccttaaagaacccccggcccccttttttggggaaaacc
OVRM1_0067_H09.b :
SMG01_0091_E12.b : aggaagccccaaacccctctttggggcccggtactcccaaacttaaagaaaaagggcccc
TCH01_0066_A01.b : ccagcctccaaggatcccgcgaacccatcattggggcccgttacatccaacccttaaaga
TES01_0082_G01.b : attggaaatcccaatctcccagggtagcccccagacccccttatgtggtcccagttccct
TES01_0106_C01.b : taccccacccccagggagagccccgagagcccccctttggggccaggtaatctccaaaac
TES01_0084_F04.b : ccagggaagccccgaacccctcttttggggcccggaactcccaaacctttaaggaaccag
OVRM1_0022_G05.b :
OVR01_0104_G10.b : aatccctgctgggggggtgtctaaaactttctcatcgcggggtgtgtgaaatattacccc
TES01_0055_H03.b : cgcgcctccaaagatgcccgcgagcccttaatggggccaggtactccaaacgctgaggaa
TES01_0104_A07.b : cagcctccaggatgccgcgagcccatcatggggcaggtacatccagagctgaagacacag
SMG01_0019_F07.b : cctccaagatgccccaagccctccatggggccggtaattccaaccttaaggacccaggcc
PTG01_0047_G03.b : ccacccccaaggaatgccgcgagcccatctttggggcaggttcatccaaccctaaaagac
PTG01_0056_E05.b : ggggcttcttttctggggggggggaggaaaaaacacccccacgggggggggggcgcccgc
TES01_0091_F07.b : aaggattcccccaacccctctatggggcccggacaccccaaccctaaagaacacgggccc
TES01_0100_E01.b : ccccccccccccaaggagggcccccgagccccttattgggggccgggtttactccaaaac
TES01_0076_H01.b : aaaaccccccccccaaggggtgcccccccagcccccctttggggggcccgggaaactccc
TES01_0064_B08.b : caccccccccagagaagccccgcgaacccccctttgggggccgggttattccaaacccta
TES01_0056_F03.b : agcctccaaggagccccccagcccttcttggggcccagtaactccagaacctaaaggacc
TES01_0065_E03.b : accccccaggatgccccgaagcccttattggggccagttaattcagaccctaaaggaaca
TES01_0005_B06.b : cccagcctccaggaatgcccgcgagccctcattgggggcagggtcatccaaaccctgaag
TES01_0010_G05.b : TGCAGCCTCCCAAGAAGCCCGCcaagcccctcatttgggcccggtacatcccgaccctga
BFLT1_0101_C03.b : caaggatgccccgaacccttcttggggccaggtaatccaaaacctaaggaacaagggccc
TES01_0081_H08.b : tttctaaggggaagatacatcctgcccttctaggaattcccccgtaacccttttattttt
TES01_0099_D01.b : accttctaaaggtgtccccgaaccccctattgggggccggttctcttctacatctaaaga
CLNT1_0018_F10.b : gcagcctccaaggatgccgggaagcccctcttggggcccggtactcccaaacctgaagga
PTG01_0099_D06.b : tccagggatcccggcaagcccttttgggggccggttatcccaaagcttaagaccccaggc
OVR01_0013_E08.b : cttcccacaccccctacccatgctccccctacccccacatcccctacccctctacactcc
SKNB1_0058_F04.b : CGCAGCCTCCNAGGATGCCCGCGAGCCCATCATTGGGGCCAGGTACATCCAGACGCTGAA
ITT01_0064_C08.b : CGCAGCCTCCAAGGATGCCCGCGAGCCCATCATTGGGGCCAGGTACATCcagacgctgaa
TCH01_0071_G06.b : CGCAGCCTCCAAGGATGCCCGCGAGcccatcattgggggccagtacatccagacgctgaa
SKNB1_0024_G04.b : CGCAGCCTCCTAGGATGCCTGCGAGgccatcattggggccaggtacatccggacgctgaa
UTR01_0056_B07.b : CGCAGCCTCCAAGGATGCCCGCGAGCCCATCATTGGGGCCAGGTACATCCAGACGCTGAA
20110601C-002188 : GGACCACAGGCCCCGGATCACGTGGGACAGCCAAGCCGCAGAGCACGTCTTCGAGTACAA
---------+---------+---------+---------+---------+---------+ 1157
TCH01_0043_D08.b : aaagacccagggcccggatacctgggaaacccaaccccaaaaacccttttccaataaaaa
TES01_0071_H03.b : aaaaaccccaccccctcgttattgtggaatataacaaccccccaatattctttttattta
TCH01_0064_E12.b :
LNG01_0087_D10.b : gtctccatacaaaaaaccggggggggccttccctccaaccaccaaatcttcggcggctta
TCH01_0100_F02.b : ccccgaatccgtgggaacaccaaccccaaaccctcttcaattacaaaaaaccggggggag
OVRT1_0012_G12.b : ctgggaaaccaaccccaaacagttctccatataaaaaaccgggggggggcattcccttac
TES01_0061_G05.b : ctaaaccttaaaagaccctcgcccccatttatatgggtagaatatacaccataaaataat
TES01_0024_H02.b : cccggatttttggggaaaacccaaaccgccaaaacacctctctatataaaaaataacccg
TES01_0053_C10.b : cggtctctttttatctggttaatcataatcctaaaatttttttttatatataataaaccc
TES01_0006_E11.b : aaccctaaaaggaccaaaggcccccgaattcactggggaacaccccaacccccaaaaccc
TES01_0069_E05.b : ctcgccctcaaatttgggaaaacaaaccccaaaaaatctttttaaaaaaaaaaaaccggg
OVR01_0094_C11.b : ttataagtgatttccccctgcttgaccctcctcccttttgtgggtcccgggtatacactc
TES01_0084_C04.b : aacacttaaaggacccaggggccccggaataacgtggaacaaaccaaacccgcaaaaacc
SPLT1_0095_C11.b : ggcccggcctggaatatttctaaaactccgtagggtggccttgaatggcctgacaaaaga
BFLT1_0006_H07.b : ccaggccccggttcctgggaaaaccaaaccccaaacccttttcagaaaaaaaaacccggg
TES01_0102_C04.b : acctctaagaaactaaggcccccaataacttgggaaaaccaaatccccaaaaaacttttt
SPLT1_0039_G07.b : aacatttttattaaaaaaacccgtggaagactctcttccccacccaaattttcagtccgt
SMG01_0067_G02.b : aggccccgaattcctgggaaacccaaccccaaaacaatcttctaataaaaaaaaccccgg
OVRT1_0116_B03.b : aaaccaacccaaacctttttcataaaaaaaacccgggggaggaatttcttacccaactaa
UTR01_0102_E10.b : ccttaaagaacccaggcccccgaatacctgtgggaaaccccaaccccccaaaaacctttt
OVR01_0066_D12.b : ggggaatgtccc
PCT01_0012_H04.b : cccggatacctgggaaccaaacccccagacatcttcaataaaaaaaacccggggggagca
TES01_0003_G10.b : aacaccttaaaggaacccacgggcccccggaattccggtggggaaagcccacacccctca
THY01_0101_B08.b :
TES01_0078_B06.b : ccctatatattatcattaccctaatgaaccccagtgccccgttattttggggaaatccaa
LVRM1_0036_H12.b :
TES01_0009_B08.b : ccacaggcccggatcagtgggacagcagccgcagagcactcttcagtacagaagaacccc
TES01_0036_B02.b : cccttaaagaaaccaggccccccaattcttgggaaaacccaacccccaaaaaactttttt
TES01_0031_H01.b : cctaaaggaccacgggcccccgaattacatggggaaaacccaaaccccaagaaacctttt
SMG01_0044_A12.b : aaaactggggaaaacccaacccccaaaaacttttttaaaaaaaaaaaaacccggggggga
ITT01_0012_B04.b : cngccccgatcagtgggacaccagccccaagcagtcttcatacaaagaacgcgggggagc
TES01_0063_E12.b : ccttattgtgggggatggatttattactatcataaaagaaataatcacccctatactatt
OVR01_0086_F08.b : tagacccacctcaacccctttcattcttgtgctctcgatacacttttcctctctactcta
TES01_0105_D10.b : taagggaccccggcccccgtattaattggggataccccaaccccaaaaacactttttcaa
LVR01_0030_B10.b : ggggcccagggtaaaatctcaaaaccccctaaaaaggaaccccacaggggccccccccga
PTG01_0053_B07.b : accccgaaacgtgggaaaccaaccccaaaaactcttaaataaaaaaggggccccctttgt
TES01_0020_F06.b : cctcaggccccggatctttggaaaaacaaactcctaaaaaactttttcaatataaaataa
TES01_0003_D05.b : cttaaaggaccccaggcccccggatctcttggggaacacccaacccccaaaaacacgttc
OVR01_0055_F06.b : acattctcaaacccctgaaaggaacaccn
SMG01_0044_G08.b : aaccaggcccggaatcacgtggaaaaaccaaccccaaaacactttttcataaaaaaaaaa
SKNB1_0059_H06.b : cacaggcccgggattaattggaaagccaaccccaaacaagtcttcagtaaaaaaaacacg
MLN01_0050_C06.b : ttgtgtgt
OVRM1_0213_H07.b :
OVRM1_0068_D09.b :
PTG01_0032_G07.b : ggccccgaaacgttggaaaacccaccccaaaaaccttttaaaaaaaaaaaacccgggggg
TES01_0105_B07.b : ggcccggaaataatgggaaaaccaaacccaaaaacccccttttagtaaaagaataaaccc
UTR01_0088_F11.b : tcgacatcctaaagcaccc
SMG01_0001_C02.b : ctttgaaacccacccccaacagttttaattaaaaaaacccggggagccatcctttaccaa
PTG01_0019_B07.b : cactggaaaccaaccgcaaccattcttcaaaaaaaaaacccggggaggcaatccctcacc
MLN01_0023_B06.b : atcagtgggaaccaagcgcaaacacgtctcgatacagaaaaccgcgtggagcacatctct
UTR01_0066_B10.b : ccctaaaggggaccacagggcccg
TES01_0005_F04.b : gaccccaggccccggatcccttgggaaaaccaaaccgcaaaaccgtcttcaattaaaaaa
TES01_0001_A10.b : ggaccaacaggcccggatcacttgggaaagcccaaccccaaacaagtcttccaataaaaa
PTG01_0074_G02.b : ccccccacaaaattttttttaaaaaaaaaaaaccggggggggggagactcttttcccccc
OVRM1_0067_H09.b :
SMG01_0091_E12.b : gattcgggggaaacccaccccaaaaaccttttctaaaaaaaaaacccggggggggaacac
TCH01_0066_A01.b : cacagggccccgattcttgggaaacccaaccccaaaaacttcttcaataaaaaaaaacac
TES01_0082_G01.b : caataaccttaaagaacacctggcccccgatatcctggggaaaaccccaacccctaatat
TES01_0106_C01.b : ccaaaaggaacaccggcccccgtaatattggggaaacacacaacccccaaaaaacttttt
TES01_0084_F04.b : ggcccccgaatatggggaaaaaccaaaccctaaaaacccttttttaaaaaaaaaaaaaca
OVRM1_0022_G05.b :
OVR01_0104_G10.b : atagccttcc
TES01_0055_H03.b : ccacaggcccggatcacgtggacacccaaccgaaagcagtcttgagtacaagagaacccc
TES01_0104_A07.b : gcccggatcacntggacagccagcgcaaacacgtctcaatacagagaacccggtggagca
SMG01_0019_F07.b : cgaatccgtggaacaccaaccccgaaccctcttcaaaaaaaaaaccccgggggaggaatc
PTG01_0047_G03.b : caaggccccgaatccgtggaaaacccaaccccaaaaacgtttctaaaaaaaaaaaaaccc
PTG01_0056_E05.b : ccccattgggtgtgggggggggacacaccacaaaaaaaaaaaaaaacacccccccctttt
TES01_0091_F07.b : cgtatccggggaaaaccaacccccaaacctctttcaaataaaaaaaacccgggggagagg
TES01_0100_E01.b : ccataaagaaaccaggccccccggatccctggtggaaacccaaacccccaaaacaccttt
TES01_0076_H01.b : caacccctaaaaggacccacagggcccccggaaatttgggggaaaaccccaaccccccaa
TES01_0064_B08.b : aaagaccccaggccccggatatttgggggaaacccacaccgcaaaaactttttttatata
TES01_0056_F03.b : caggccccggatcctggggaaacccaacccccaaaccttctttcataaaaaaaaacccgg
TES01_0065_E03.b : agggccccgattaacgtgggaaacccaaccgcaaaaccctttttcaataaaaaagacccg
TES01_0005_B06.b : accccagggcccgggatacctgggaacaccaaccgccagagcacctcttcgaatcaaaga
TES01_0010_G05.b : tggaacaccagcccccgaacacgttgggacaccccagccgcagacaccttcttccattac
BFLT1_0101_C03.b : ggattccggggaacccaaaccccaaaccttctttcaataaaaaaaccccgtgggggacat
TES01_0081_H08.b : gggccgtgttttttctttatctctttaaggaaatactggcccctggtattcgttgtgaaa
TES01_0099_D01.b : tacctgtgtccctgttacttgtgaaaatcctaaccctaaaacttctttctaatttctaaa
CLNT1_0018_F10.b : ccccgggccccgaatcactggggaaacccaaccccaaaacacgtcttcagaaacaaagaa
PTG01_0099_D06.b : ccctatccctgggaaacccaacgcaaagacttttccaaaaaaaaaaaaccgggggaagga
OVR01_0013_E08.b : ccttctaattatcacactatccacactttacactccc
SKNB1_0058_F04.b : GGAC*ACAGGCCCCGGATCACGTGGGACAGCaagccgcaaagcacgtcttcagtacagaa
ITT01_0064_C08.b : ggacacaggccccggatcacgtgggacagcaagccgcagacacgtctccagttacagaaa
TCH01_0071_G06.b : agaccacggcccccgatcacgtgggacagccaagccgcgaacacgtcttcagtacagaag
SKNB1_0024_G04.b : ggaacacaggccccggatcacgtgggacgccaagccgcagaccacggcttcaagtacaag
UTR01_0056_B07.b : GGACCACAGGCCCCGGATCACGTGGGACAGCCAAGCCGCAGAGCACGTCTTCGAGTACAA
20110601C-002188 : GAAGAACCGCGGTGGGAGGCACATCGTCTTCTACCCGACGCTGAAGTCCTTGCAGGTGCG
---------+---------+---------+---------+---------+---------+ 1217
TCH01_0043_D08.b : aaaaccccgggggagggacatttcctttcccaaacttaattccttcggtgtcgcttgttc
TES01_0071_H03.b : ataaataaattcgcgtggaatacattatctttttttcaatcgacatatcattctaaagct
TCH01_0064_E12.b :
LNG01_0087_D10.b : tggccggatggcccggtttccttgaatggcaggcgaaatctcaacgtgggggggcggggg
TCH01_0100_F02.b : gcacctccttctcccaacctaaatccttcagtcccttgactgcgcgaatttggcctcggg
OVRT1_0012_G12.b : ccaacctaaatctttaggggcttaactgccagaatgggctcgttttcttggaatggcggg
TES01_0061_G05.b : ttttttgtaaaaataaaacccccgggggaggagaaatttttcttctcccacaaaaaactt
TES01_0024_H02.b : gtgtggagagcaattatcttttatccaaagttaaaattctctccggggcgcctgtaattg
TES01_0053_C10.b : aggggcggttaaatatctttgtcctcatctgtaaacactttgtggtgcgtaacttctcta
TES01_0006_E11.b : agtttttccaaataaaaa
TES01_0069_E05.b : ggggagacacatttattcccacaaaaaaaatttatggagggcatttttactcccaaaatt
OVR01_0094_C11.b : tccac
TES01_0084_C04.b : cttcttcaaataaaaagaaaaccccggggggaggagaatcttccttttccccccaactaa
SPLT1_0095_C11.b : accttctccgcaaaaaaannaaaaaaaaaaaaanaaaannaaaaaganannannngannn
BFLT1_0006_H07.b : gggagggcaatccttcaacccaactaaatctttaaggtggttgtactgccacagattggg
TES01_0102_C04.b : tgtataaaaaaaaacaccggtgggaggaaatatttttttcccacaatgaaaaatctttta
SPLT1_0039_G07.b : taccccacgaattgcctggtttctttggggggggggcggaaaattcacagtgtaggggcg
SMG01_0067_G02.b : ggggagaacacctctcccccaaacagaattcttttaggggcttttaaaccaacaaaattt
OVRT1_0116_B03.b : atcttcaggggtttaccgcaaaatttggccgcctttcgtggggggggggggagaaattaa
UTR01_0102_E10.b : tctaa
OVR01_0066_D12.b :
PCT01_0012_H04.b : accttcttcaccaacacaaaaactcttaagggcgtttaacttccaaaaaattggcccggg
TES01_0003_G10.b : aagacacctttcttctcatataaaaaaaaataaccccgcggtgggaaggggaaatatggt
THY01_0101_B08.b :
TES01_0078_B06.b : accccttaataaatcttttataataaaaaaataaacactcgagagggagaaaattttttt
LVRM1_0036_H12.b :
TES01_0009_B08.b : gtgggagcacatcgctctaccaaccctaatccttcagtgcgctgactggccgggatttgg
TES01_0036_B02.b : aatataaaaaaaaaccccgtgggggagaaaattttttttccccacccttaaaacttcttc
TES01_0031_H01.b : tttaataaaatataaaacccggggggggaggaaatattttttttctcaaaccttaaaaac
SMG01_0044_A12.b : gaaactccctttctcccaccctaaaattctttgagggcgcctttaatctcccaaaaaatt
ITT01_0012_B04.b : actctcttcaccgacctaattctgcagggcgcttgacctgccggattggcgttggtttca
TES01_0063_E12.b : tagggaaaactaccactctgataatatattttttatttatataataaaatccagtgggag
OVR01_0086_F08.b : atgtgaccaattgcggcctcctggtactattatgtgaacataataacacaatcaccttca
TES01_0105_D10.b : atataaaataaacaccgggtggagaggaatactcttttctcaccaaatttaaactctttc
LVR01_0030_B10.b : aataaacacggggggtgttcaacccacaaaaccccctccaaaaaaaaaacaaacttttct
PTG01_0053_B07.b : aaacacgggggagggcaatttctttaccccacctaaaccttggaggggcttacacccaaa
TES01_0020_F06.b : acccgggggggaggtaattctcttttccccacactaaaatcttgtcgggtgcgttattac
TES01_0003_D05.b : tcttatataaaaaaaaaaccccggtgggtgagagaaattgtctattttccctaaacttga
OVR01_0055_F06.b :
SMG01_0044_G08.b : accggggggaaggcaaattctctttctcccaacttaaaactttgcaggggcgctttaact
SKNB1_0059_H06.b : cggggagggaacgccttctcccaacccaaaaggcgcttactgtccccgaatttggcccgg
MLN01_0050_C06.b :
OVRM1_0213_H07.b :
OVRM1_0068_D09.b :
PTG01_0032_G07.b : agggcaatttttttacacaacccaaaaccttcaagggccttttattgcacagaatatggc
TES01_0105_B07.b : cggggggggagaatctccttctcccccaaccataaacctttcagggcggtttgtacctgc
UTR01_0088_F11.b :
SMG01_0001_C02.b : cctaaatcttcaatgcgttaaacgccaaaattggcccggtttccttgaaatgggcaggcg
PTG01_0019_B07.b : cactaattctttaagtcgtttactgccaaaatttggcccgttttcattggatgggcgggc
MLN01_0023_B06.b : tcaccacctaattcttgcaggccgttgacttgcagnatttggctccgtttcattgggacg
UTR01_0066_B10.b :
TES01_0005_F04.b : aaaccccggtgggaagaaatttttttttacccaaacctaaaatctttcaggtgcggcttg
TES01_0001_A10.b : aaaaaccccgggggaaggaaaatttcttctacccaaactgaattcctgcagggggcggtt
PTG01_0074_G02.b : aaaaaaaaatttttggggggggtgtttttaccaaaaaaaattgtggggccgctcctcctt
OVRM1_0067_H09.b :
SMG01_0091_E12.b : ctctcttcaccacgaaaatctttaagaggcgtttaaccccccaaaatatgggcccgtgtc
TCH01_0066_A01.b : cgggggaggccaatgtcttttaccccccct
TES01_0082_G01.b : accttcctctctataataaaaaaaaacctggggggggaggaaaattcttcttttacccca
TES01_0106_C01.b : ttataaataaaaaaaaaaccccggtgtggggggaatattttctttcacccacacaaataa
TES01_0084_F04.b : cgtgggagaggaaattatttttctcccaaagtaaaaatttttcaggggcgtcttgtactc
OVRM1_0022_G05.b :
OVR01_0104_G10.b :
TES01_0055_H03.b : gtggggagccatctcctctcccaagcctaaatcttgcagtgcgcttgactggccgggaat
TES01_0104_A07.b : catcccttcaccacacctaatccttcaggtcgctgactgccaggaattgggccggtgtcc
SMG01_0019_F07.b : cctttcaccaccctaaatcttcagggcctcttaccgccacgaatgggctcgggttctctt
PTG01_0047_G03.b : gggggagggcataccctttacccaaccttaaacctttaagggcgttttcctgccagagat
PTG01_0056_E05.b : ttgttttttttttaccccaccccccccccctttttttttttataaaaaaaaaaaaggggg
TES01_0091_F07.b : cctccctttttacccacctaaacctttcagggcggctttaccgccccaaattggcccccg
TES01_0100_E01.b : ccccaatataaaaaaaaaccgcggtgggggagggccattttttttttcatccaaactaat
TES01_0076_H01.b : aaacaccttcttttaatataaaaaaaaacacccccgcgtggggggaagcaaatttttttt
TES01_0064_B08.b : aaaaaaaaacccgggggggaggcctcttttttctccccacctaaattcttttcggggccc
TES01_0056_F03.b : ggggaggccaccccttctccccaaccttgaatccttgcagggccgcttaccggccagaat
TES01_0065_E03.b : gggggaaggaatttgttttttcccagacttaaactctttaggggtccttttaacttccca
TES01_0005_B06.b : aaaaccgcggggggaaggaaaatctttttctttcccaaacttaaaggggcggcttgaact
TES01_0010_G05.b : aaaaaaaccccgtgggagggaaatctttctttaccgaaccgtaattccttgcggggccgc
BFLT1_0101_C03.b : cttcttccccacactaatccttgaggggggcttacttgcagagatggcctcggtctcttt
TES01_0081_H08.b : atcccaatctctcaaaaacactttcttatattaaataaaaaactccctgggtgtggaatt
TES01_0099_D01.b : aaaattgctggggggaggaatctcccttttcctaatctttattttcttcttgtctgcttg
CLNT1_0018_F10.b : accccgtgggagggcatcccccttcacccacacctaaacctttaaggggcctttaacctg
PTG01_0099_D06.b : atttctttacccaccctaatccttgagggcctttattggcaaaaattgggccgggtttcc
OVR01_0013_E08.b :
SKNB1_0058_F04.b : gaaatcgccggtgggagcacatcgtctctacccgagctgaattcctgccagtggcgctga
ITT01_0064_C08.b : accgcgtggaaggcaatcgtctctaccggagcctaatccttgcaggtgcgctgacctggc
TCH01_0071_G06.b : aaccccgggggaagcaattgtcttctaccgacctgaatcttgcagtgcgcttgaactgcc
SKNB1_0024_G04.b : aaaaaccgcgttgggagggaaatcgtcttcacccaacgctgagttcttgcaagtgccggc
UTR01_0056_B07.b : GAAGAACCGCGGTGGGAGGCACATCGTCTTCTACCCGACGCTGAAGTCCTTGCAGGTGCG
20110601C-002188 : GCTTGAGCTGGCCAGGGAGTTGGGCGTCGGGCTGTCCATCTTGGGAGCTGGGCCAGGGCC
---------+---------+---------+---------+---------+---------+ 1277
TCH01_0043_D08.b : tgtcagga
TES01_0071_H03.b : ctggtttataatgacaacgtttatataatggctatcataccatattgattagattcgaat
TCH01_0064_E12.b :
LNG01_0087_D10.b : ggcaaaaactccccaaaaannnnnnannnnnaannanaaaangggctgttggggggccta
TCH01_0100_F02.b : ttctcttggaactggcgggccggacatttccaccgtgtgggggggcgagggcgcaa
OVRT1_0012_G12.b : ccgaaatcttcaacgttggggggggggggggcccaaaaaattttccaaaaaaaaaaagcg
TES01_0061_G05.b : tcttagaggggttaattatcccagagaaaatgtggcgcgcgttcttcttgaggagtagcg
TES01_0024_H02.b : tcccggaatttgggctctcgggttctcttatggaaaattgggcgggccctaaaaattttt
TES01_0053_C10.b : ttaattgatacccaatatccatttgaaactagtttcaacacaactacttctatcactttg
TES01_0006_E11.b :
TES01_0069_E05.b : gttgctggtgttctctttgggagggagagggagaggatatatttaatatattattgtggg
OVR01_0094_C11.b :
TES01_0084_C04.b : aaatctttttggggggcggcttatccaccaacagaaaattgtggctctcgggttctcatc
SPLT1_0095_C11.b : nnganngnnnngnnnaagaancanannannncacgccgccgccgccctctcttggggtat
BFLT1_0006_H07.b : ctcggcttcccttgaatcgggcgggccggaatttctaaccgtgatggggcggagggcggc
TES01_0102_C04.b : tgatacccttatatactctctctagaatattggacccgcgctttcctctaagaagaaggt
SPLT1_0039_G07.b : ggggccaaaaaatctctccnaanannnnnnannnaaananannnnnnnncccccccctct
SMG01_0067_G02.b : ggctcggtctctcttggggaagggcggggggtgaaatattcaactgggtgggggggggga
OVRT1_0116_B03.b : acggggggggggggggcggccaaaactttcccaaaaaaaaaaaatgttccagggcgccaa
UTR01_0102_E10.b :
OVR01_0066_D12.b :
PCT01_0012_H04.b : ttcccttggaggggggcgggggggaatcttaaacacggggggggggggaagggcgccaaa
TES01_0003_G10.b : tttttttaacctcgaaagtg
THY01_0101_B08.b :
TES01_0078_B06.b : ttccccctcataaattaattcttatgaaaagtcttattttcctcctgaattatttagctg
LVRM1_0036_H12.b :
TES01_0009_B08.b : ctccgcgccctccggaactgccagggcggaatacttccaccgtgtaggtggctggaggcc
TES01_0036_B02.b : gggtgcggttattcttttccagaaattgtggtcccggctttctctcttgggagggtgggg
TES01_0031_H01.b : ctttttagtggcggctctaattttccccagaatttgtgccctcggtttctctatttggtg
SMG01_0044_A12.b : ggcctctgggttttctctggaaaatgggcccggccct
ITT01_0012_B04.b : tcggactggccagccggaaaatcaaacggtgaggggggccggagccggaaaaaacctttc
TES01_0063_E12.b : agcataatctatttttttatcaaacattattttaatcttgtttactataatactatacca
OVR01_0086_F08.b : taaaatatcctttctctatttacactaaatataactc
TES01_0105_D10.b : agggggcgctttatccttccatataatgtggccttggcctctcctcttgtgagtgtggct
LVR01_0030_B10.b : tttttcacaaaaaaaaaaaaaaaaaaaaaaaaaaaacccacccgccgcggggg
PTG01_0053_B07.b : aaatgggcacggtttcatcgagaggggcagagggaatatttaacatgttaaggggcgtga
TES01_0020_F06.b : cgcaaagaaatttgcttctggtctctctttgggaactgggccggcccgaatattttcaac
TES01_0003_D05.b : aatcccttgtcaggtgccggcttttacccgtgccaggaattttg
OVR01_0055_F06.b :
SMG01_0044_G08.b : gccaggaaattgggccttggttttccatttgaaagagggcggagcgggaaatttttaaca
SKNB1_0059_H06.b : ggcccccttagaaagggcgggcggaacatctaacactttaggggggcgggggcgggaaaa
MLN01_0050_C06.b :
OVRM1_0213_H07.b :
OVRM1_0068_D09.b :
PTG01_0032_G07.b : cccgttctcctcggaaagggcgagggcggaaattttaaacggtgaagggggcgggaggcg
TES01_0105_B07.b : ccgaaaatgtggccttggtgttcccttggggaaatggccaggggctggaaatttataaac
UTR01_0088_F11.b :
SMG01_0001_C02.b : aaatttaaaagtttgagggcgagggccaaaaaaatttcccaaaaaaaaaaaaaaaaaaca
PTG01_0019_B07.b : ggaaaattaaacgggtgagggggcggaggggcaaaaaaacctcccccaaaaaaaaaaaaa
MLN01_0023_B06.b : ggcaggccggaaattttaaactgtaggtgcctggaggccgcaaaaaatcttcccccaaaa
UTR01_0066_B10.b :
TES01_0005_F04.b : actcgcccaggaatt
TES01_0001_A10.b : g
PTG01_0074_G02.b : cggggggggggggggagggggaaattaaaaaagagggggggggggggggggggcgcggaa
OVRM1_0067_H09.b :
SMG01_0091_E12.b : tccttgagagggggggggggggagaatctaaaccgctggtgggggggggaggggcgccaa
TCH01_0066_A01.b :
TES01_0082_G01.b : atcgataaaatttctcagagggtggtttttcatttctcaaaaattgatgtccttatgtct
TES01_0106_C01.b : aatcttctcgggtcgcctatcacactcaccaagatatgttgggcctctgttttctccatt
TES01_0084_F04.b : ccccgtaaattggcgccctcgtgtttccctctggaaactggacaagccctaataattttt
OVRM1_0022_G05.b :
OVR01_0104_G10.b :
TES01_0055_H03.b : tggctccggcttccactgggaactgcccgggccggaaattttcaaccccctaagcgggcc
TES01_0104_A07.b : tcggaatgggcgggcgggaaattctacccggtagggggcgggaggggcccaaaaattc
SMG01_0019_F07.b : ggaagggggcgggcgaaaatttacaaccggtgggggggggagggcccgaaaaaaacctct
PTG01_0047_G03.b : tggcccggggtccacttgggaaggggcgggcgggatatttctaacactgagggggggcgg
PTG01_0056_E05.b : ggggggggggggccccccccccccccccacacccacatttatataatttttttggaggga
TES01_0091_F07.b : ggtttccttgggaaggggccgggcggaaaattttcaacctctttaatgggccctaaaggc
TES01_0100_E01.b : aattcttttaaggggcggctttttaacctgccagaaatattggggcccccggttttttct
TES01_0076_H01.b : ttataaccaagagttaaaaatcctttctcgggggccgcccttttaacctcctcccagaga
TES01_0064_B08.b : ttttattcgacggaaaagggcgctcgggtgtccctggggggggggggggggccggataat
TES01_0056_F03.b : tgggccttgctttcctttgggaacggccagggccggacatttccaaacctccttagtggg
TES01_0065_E03.b : gaaaagtggcctcggcgttccttccgggaaggggcggggctgtgaattttcaaaaccttt
TES01_0005_B06.b : tgcc
TES01_0010_G05.b : ttgaccggccagggaattggcctcggctttccatctggaactggcccaggcctggactat
BFLT1_0101_C03.b : ggaagtggcggcggtatattaaacagggagggggggggagggggcaaaaaacttcccaaa
TES01_0081_H08.b : aagttctttttaaccaagctaaaaaaattttttagagtgcattattaatttttactctct
TES01_0099_D01.b : tttctcttcatacaaattgttattgtacttatccatgtgcatggtctcagcgttttattt
CLNT1_0018_F10.b : ccaggaattgtggcctcggttttccctggaaaggtggccgggccggaaaatcttcaacac
PTG01_0099_D06.b : ttggaattgccagggcggaaaatttaaaacggtagtggggggagggctaaaaaaaaactc
OVR01_0013_E08.b :
SKNB1_0058_F04.b : ctgggccagggaattgggcttcgggttgccattttgaaactggccagggcctgaatactc
ITT01_0064_C08.b : caggaattggcctccgctgtcactctggactgggccggccggacacttctacactgctta
TCH01_0071_G06.b : caggaattgggttcggctgcccttgggactgggccgggccggacactctacaactgtcga
SKNB1_0024_G04.b : tgaactggccaggagtttggcgtccggctgtccatctggggactgggccaggcccgaact
UTR01_0056_B07.b : GCTTGAGCTGGCCAGGGAGTTGGGCGTCGGGCTGTCCATCTTGGGAGCTGGGCCAGGGCC
20110601C-002188 : TGGACTAACTTCTACGACCCTGCTGTAGGCTGGGCCTGGACTGGCCTGCACAATAAAGAA
---------+---------+---------+---------+---------+---------+ 1337
TCH01_0043_D08.b :
TES01_0071_H03.b : gcccatactctcgtctttctgtaggtcttattaatttgaattt
TCH01_0064_E12.b :
LNG01_0087_D10.b : tcccggcccacccctttaagcctagaaaaacncctttccaacggttgacgggacaaaaaa
TCH01_0100_F02.b :
OVRT1_0012_G12.b :
TES01_0061_G05.b : ggcggtggatttatatatag
TES01_0024_H02.b : aacacgtggt
TES01_0053_C10.b : tatcgattatacctgttcctcatataaaatctatctcctacatatataataataaatcaa
TES01_0006_E11.b :
TES01_0069_E05.b : aggtgaggttcaccaaaaaataaccctcctccaaaaaaaaaaaaaaagactg
OVR01_0094_C11.b :
TES01_0084_C04.b : tgggaaattgggcccaggcgcgaaatatctttaaaacattttaagttgggccccaatagc
SPLT1_0095_C11.b : gtatcaacacaaaaattattttgggggcaccccgaagggatggaaaagtcttttttaatg
BFLT1_0006_H07.b : aaaaaaacttcccccaaaaaaaaaaaagggcgtgtgctttggtgtggcgcaaatttaaaa
TES01_0102_C04.b : gagggttcttatatttacataaccctttgttaggcgcactatatcctccctcatataaaa
SPLT1_0039_G07.b : ttttgtttttcaaaaaatttccccaaanaaatttttttttttttataaacacactttttt
SMG01_0067_G02.b : gggcgccaaaaaaaaatttctcctctaaaaaaaaaagaaacggttttatgtgggggcgcc
OVRT1_0116_B03.b : ataaaaaacaccccccccaaaaaaaaatttgttttattaaaaaaaacaacaacaatttt
UTR01_0102_E10.b :
OVR01_0066_D12.b :
PCT01_0012_H04.b : aaaaatcttcccaaaaaaaaaaaaaaaaaaaaaaaatgttttattgggcggccattaata
TES01_0003_G10.b :
THY01_0101_B08.b :
TES01_0078_B06.b : caatttttccatgtgatagtaggcgtgcgctagataatttttctaatctattttatagta
LVRM1_0036_H12.b :
TES01_0009_B08.b : ccaaaaaaacttccccaaaaaaaaaaaaaaaaaaaaaaagcctttgctactgtccgccct
TES01_0036_B02.b : gagaggtggaattatttttaacaccttttgatggtgcccctatggcccccacaaaaaaat
TES01_0031_H01.b : ataggggtcaaggcccgtgaatatttttcaacacaccttaatagtgggcgctgcaatgtc
SMG01_0044_A12.b :
ITT01_0012_B04.b : ccaaaaaaaaaaaaaaaaaaaaaaagctttgtttggggcggccctaatcccgggcaccac
TES01_0063_E12.b : tatattggattgatcatttactcatcaatctgtggctacgatatgaaatttactcatatc
OVR01_0086_F08.b :
TES01_0105_D10.b : cggcccctctaatttctaccaaactctatttagtgtgtcactaaaatcctcaataaaaaa
LVR01_0030_B10.b :
PTG01_0053_B07.b : gggtcaaaaaaaaatttcccacaaaaaaaaaaaaaacagttgtagacggtggcgcctcaa
TES01_0020_F06.b : cacttcttatggtggcctgaatgacctcaaacaaaaccttctctataataataaataaaa
TES01_0003_D05.b :
OVR01_0055_F06.b :
SMG01_0044_G08.b : ccttttaaagtggcctaaaggcccccaataaaaatctccctctccccaaanaaataaaat
SKNB1_0059_H06.b : aaacctc
MLN01_0050_C06.b :
OVRM1_0213_H07.b :
OVRM1_0068_D09.b :
PTG01_0032_G07.b : gcgcaaaaaattccccccacaaaaaaaaaaagacctgtttttctggaggcgggcccctat
TES01_0105_B07.b : acttttatagtgggccttaattccccccaatataaaacttcctccccaaaaaataaaaaa
UTR01_0088_F11.b :
SMG01_0001_C02.b : tttctgttggccgccctaatcttgggcaaaacccctttaaagccttaagaataaaaacgc
PTG01_0019_B07.b : aaggaattttaggtgggcgcctaaatctgggccacaccaaccttttaaggcctagggtaa
MLN01_0023_B06.b : aaaaaaaaaaaaaaaaaaaagcctttttacatgggcgccctaaattctgggcca
UTR01_0066_B10.b :
TES01_0005_F04.b :
TES01_0001_A10.b :
PTG01_0074_G02.b : gaaaaaaaatctcttcccaacaaaaaaaaaaaaaaaaaaaagaagaacccgtcgcgtggc
OVRM1_0067_H09.b :
SMG01_0091_E12.b : aaaaatttcccccaaaaaaaaaaaaaaaaccactgtttttttggggggcccttatatccc
TCH01_0066_A01.b :
TES01_0082_G01.b : ccccactttgaaaatgtagacactgcctattttacacttctcccacacgcatttgagg
TES01_0106_C01.b : ggagagaggtgtgggaggtctgaaaatttcttatacacacgctttataggggtgccctaa
TES01_0084_F04.b : ctaacactttaaagtggcgccctacattgctccctacaaaaaactttctcccccaaaaat
OVRM1_0022_G05.b :
OVR01_0104_G10.b :
TES01_0055_H03.b : ggaacgcccccaaaaaacctctcctccaaaaaaaaaaaaaggcacattttctactggggg
TES01_0104_A07.b :
SMG01_0019_F07.b : ccccaaaaaaaaaaaaaaaaacattgtttcttgtgggcgctctaatatccgggggcatca
PTG01_0047_G03.b : aggggccccaaaaaactttccccaaaaaaaaaaaaaaaaaaaaaaaaaaaagggttggtg
PTG01_0056_E05.b : agagaagaagaggaagaccctcctccccc
TES01_0091_F07.b : tcccaaaaaaaccttccccaaaaaaaaaaaaaaaaagagccttgttccactttgtgc
TES01_0100_E01.b : cttggaaatttgggcacggcctttatattaatttcaa
TES01_0076_H01.b : ag
TES01_0064_B08.b : tttaacaccgttgagggggggcgagaggtcccacaaaaaaaccttccccccaaaaaaaaa
TES01_0056_F03.b : ccgaaatgccgccaaaaaaattctcccccaaaaaaaaaagggccttgtgtttttttggtc
TES01_0065_E03.b : ataaggtggcccaaaccccccacaaaaaacctctcccccaaaaaaaaaataaggcacttt
TES01_0005_B06.b :
TES01_0010_G05.b : ttctaaccctcttagcttggcccgaaagcctcccaaataaaaccttcccccaaaaaaaaa
BFLT1_0101_C03.b : aaaaaaaaacgctgtgcgccggcgccctaaaaaaaaactcccccaaaaaaaaaagtgtgt
TES01_0081_H08.b : attttgtgacttatctgtactaccactttagatattgtggcattgtgccacatta
TES01_0099_D01.b : cttattaccctctttactcgtttgctgtgttgtctgatcacataaac
CLNT1_0018_F10.b : ctttaggggggccaaagggcctcacaaaaaaacttctccccaaaaaa
PTG01_0099_D06.b : cccaaaaaaaaaaacaaggcctcgtggggcggcccttttaatccgggggcttaccaccct
OVR01_0013_E08.b :
SKNB1_0058_F04.b : tccaacctccttatacggggcccgaatggcctgcccaaaaaaacttttccccaaaaaaaa
ITT01_0064_C08.b : ggcgggctggacgcctgaaaaaaatcttcccccaaaaaaaaaaaaaaaagccttggctag
TCH01_0071_G06.b : agctgccctgagggccgcaataaaatctttccccaaaaaaaaaaaaaaaaaaaa
SKNB1_0024_G04.b : acttctcaaccggctgtagctgggcccggaatggctgcaca
UTR01_0056_B07.b : TGGACTAACTTCTACGACCCTGCTGTAGGCTGGGCCTGGACTGGCCTGCACAATAAAGAA
20110601C-002188 : CTTCTTCTCCGCCCTTCTT.........................................
---------+---------+---------+---------+---------+---------+ 1356
TCH01_0043_D08.b :
TES01_0071_H03.b :
TCH01_0064_E12.b :
LNG01_0087_D10.b : aannnnnnnnnnnnnnncgcccccccccgctcaggctccgctagccaggggggggnnnnn
TCH01_0100_F02.b :
OVRT1_0012_G12.b :
TES01_0061_G05.b :
TES01_0024_H02.b :
TES01_0053_C10.b : tgtctcctcagaccgcgctctatcaccatagataactcactcctcg
TES01_0006_E11.b :
TES01_0069_E05.b :
OVR01_0094_C11.b :
TES01_0084_C04.b : cctcctcaaataaactctc
SPLT1_0095_C11.b : cacgcccct
BFLT1_0006_H07.b : aaacccccccccggcaaaaaaaaagtgttgtttgttgttcctagaaaaaacacaataaaa
TES01_0102_C04.b : acttctcccatcaaaagaa
SPLT1_0039_G07.b : ggggtttnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SMG01_0067_G02.b : cctaattcttcgggggcacaagcacccttttgtagagccataaaattataaaagcgcct
OVRT1_0116_B03.b :
UTR01_0102_E10.b :
OVR01_0066_D12.b :
PCT01_0012_H04.b : aaaaaaccaccccccccccaaaaaaaaaatttttttttttttttttaaaaaaaaaaaaaa
TES01_0003_G10.b :
THY01_0101_B08.b :
TES01_0078_B06.b : ggtctttcttacctccacaataaaacacctcctcccctaaaaaataattaatataaatat
LVRM1_0036_H12.b :
TES01_0009_B08.b : aaattaaaaaccaccc
TES01_0036_B02.b : ccctccccaacaaaataaaaaaagacaacaatttcttcttctggtgc
TES01_0031_H01.b : cgtcgacaataaaaacactttcg
SMG01_0044_A12.b :
ITT01_0012_B04.b : ccctttgaagggctaggtttaaaacggcgctttcccgggaaactgtttttaaatt
TES01_0063_E12.b : tcttttattcttgaatctagaatctttcaaataataaa
OVR01_0086_F08.b :
TES01_0105_D10.b : tctcttcccctctatacataatatactattcatatggctgctg
LVR01_0030_B10.b :
PTG01_0053_B07.b : atcctagaggcataaaactccttttaaagagctaagaaaataaaagacggctcttatctc
TES01_0020_F06.b : tatatgcgcacttctccatttgatccccgtcctaaaatcttaaataaaccctcccctccc
TES01_0003_D05.b :
OVR01_0055_F06.b :
SMG01_0044_G08.b : ataaanaaaggccctttgttcaaatagagggcgccc
SKNB1_0059_H06.b :
MLN01_0050_C06.b :
OVRM1_0213_H07.b :
OVRM1_0068_D09.b :
PTG01_0032_G07.b : aatccggggcgcaaataaccgcctttgttaaagccctaaggatataaaaggaggggtctt
TES01_0105_B07.b : ataaaagccctcgg
UTR01_0088_F11.b :
SMG01_0001_C02.b : tcttaccgt
PTG01_0019_B07.b : aaggcccttacgggggagaagg
MLN01_0023_B06.b :
UTR01_0066_B10.b :
TES01_0005_F04.b :
TES01_0001_A10.b :
PTG01_0074_G02.b : gg
OVRM1_0067_H09.b :
SMG01_0091_E12.b : gggggcgaaaacacccctttttaagagaccaaagaaaataaaaaggcggcttttccctcg
TCH01_0066_A01.b :
TES01_0082_G01.b :
TES01_0106_C01.b : cattccctcaataaaataaact
TES01_0084_F04.b : aaacaaaaan
OVRM1_0022_G05.b :
OVR01_0104_G10.b :
TES01_0055_H03.b : ggccccaatttttaaaaacccccccccccccaccaaaaaaaagagattt
TES01_0104_A07.b :
SMG01_0019_F07.b : cacccttttgaaacgccaaggaataaaaggt
PTG01_0047_G03.b : gtgggggggcccttatatcgggggccgcacacccctttttagaaggcctaagtaaaataa
PTG01_0056_E05.b :
TES01_0091_F07.b :
TES01_0100_E01.b :
TES01_0076_H01.b :
TES01_0064_B08.b : aaaaaaaaggcttgttttcttagggtgcgccccaaatt
TES01_0056_F03.b : ggcctaaaattttaaaaaaactccccccccccacaaaacaaaaagcagttgtgttttttt
TES01_0065_E03.b : ttcctatgtgggtcgcgcctatatatttaaaaaacactccccctcccctcaacaaaataa
TES01_0005_B06.b :
TES01_0010_G05.b : aaaaaaaggccatgttttctcactctgggcggcctttaaattctaaaaacaccccacccc
BFLT1_0101_C03.b : tttttttatagaaaaaaaacaaaaatatttttgttaataattgtgggggggttttttcca
TES01_0081_H08.b :
TES01_0099_D01.b :
CLNT1_0018_F10.b :
PTG01_0099_D06.b : tttataagccctaagggaaaaaaaacggggttttacgcagaaaaactttttttaaaatcc
OVR01_0013_E08.b :
SKNB1_0058_F04.b : aaaaaaagcacggttttcttctttggtggggccccccatattttaaaaaaacccccccct
ITT01_0064_C08.b : tgggtcgccctcagatcccagggccattaccacccttttgaaaggtcataggctttaaac
TCH01_0071_G06.b :
SKNB1_0024_G04.b :
UTR01_0056_B07.b : CTTCTTCTCCGCCCTTCTTatctataattaaaacattacatttaaattccataaaaaaaa
20110601C-002188 : ............................................................
---------+---------+---------+---------+---------+---------+ 1356
TCH01_0043_D08.b :
TES01_0071_H03.b :
TCH01_0064_E12.b :
LNG01_0087_D10.b : nnnnnnnnnnnng
TCH01_0100_F02.b :
OVRT1_0012_G12.b :
TES01_0061_G05.b :
TES01_0024_H02.b :
TES01_0053_C10.b :
TES01_0006_E11.b :
TES01_0069_E05.b :
OVR01_0094_C11.b :
TES01_0084_C04.b :
SPLT1_0095_C11.b :
BFLT1_0006_H07.b : attttt
TES01_0102_C04.b :
SPLT1_0039_G07.b :
SMG01_0067_G02.b :
OVRT1_0116_B03.b :
UTR01_0102_E10.b :
OVR01_0066_D12.b :
PCT01_0012_H04.b : acaaaatatttttggggggaaaataattggggaggaattcttccctccccaaaaaactat
TES01_0003_G10.b :
THY01_0101_B08.b :
TES01_0078_B06.b : ttcgtctatattcagctgaccgc
LVRM1_0036_H12.b :
TES01_0009_B08.b :
TES01_0036_B02.b :
TES01_0031_H01.b :
SMG01_0044_A12.b :
ITT01_0012_B04.b :
TES01_0063_E12.b :
OVR01_0086_F08.b :
TES01_0105_D10.b :
LVR01_0030_B10.b :
PTG01_0053_B07.b : gggagaaatgttttgttaacaatttggagacgaacaccatataaagaaatatttataact
TES01_0020_F06.b : tcatataaataagagtgtttg
TES01_0003_D05.b :
OVR01_0055_F06.b :
SMG01_0044_G08.b :
SKNB1_0059_H06.b :
MLN01_0050_C06.b :
OVRM1_0213_H07.b :
OVRM1_0068_D09.b :
PTG01_0032_G07.b : tcacgggagaaaattattttttaa
TES01_0105_B07.b :
UTR01_0088_F11.b :
SMG01_0001_C02.b :
PTG01_0019_B07.b :
MLN01_0023_B06.b :
UTR01_0066_B10.b :
TES01_0005_F04.b :
TES01_0001_A10.b :
PTG01_0074_G02.b :
OVRM1_0067_H09.b :
SMG01_0091_E12.b : gaaaaaaccgttttataaaaacttttggtggcaacccaaatttccaaatattttttt
TCH01_0066_A01.b :
TES01_0082_G01.b :
TES01_0106_C01.b :
TES01_0084_F04.b :
OVRM1_0022_G05.b :
OVR01_0104_G10.b :
TES01_0055_H03.b :
TES01_0104_A07.b :
SMG01_0019_F07.b :
PTG01_0047_G03.b : gaggcctttaacggaggaaaggtt
PTG01_0056_E05.b :
TES01_0091_F07.b :
TES01_0100_E01.b :
TES01_0076_H01.b :
TES01_0064_B08.b :
TES01_0056_F03.b : tcccttaggtaaaaaacacc
TES01_0065_E03.b : taaaattgtgttttaattttatgcccttagtcgataatctcacccttn
TES01_0005_B06.b :
TES01_0010_G05.b : c
BFLT1_0101_C03.b : catttgtggtaaaaaaaaagtagagaaaacatttannnnnnnnngnttncctcatgtata
TES01_0081_H08.b :
TES01_0099_D01.b :
CLNT1_0018_F10.b :
PTG01_0099_D06.b : ttgggttggaacccaaaaacggaaatatttgggaccccgtgcggtctaaa
OVR01_0013_E08.b :
SKNB1_0058_F04.b : ccccgcccga
ITT01_0064_C08.b : acggccttttactcggaaacctggttggactctcggggtggacccaaaaccgaaaatttt
TCH01_0071_G06.b :
SKNB1_0024_G04.b :
UTR01_0056_B07.b : aaaattcaaattatttttaaaaaaaaaaaaacaaaacaaatacaaatataatggggcccc
20110601C-002188 : ............................................................
---------+---------+---------+---------+---------+---------+ 1356
TCH01_0043_D08.b :
TES01_0071_H03.b :
TCH01_0064_E12.b :
LNG01_0087_D10.b :
TCH01_0100_F02.b :
OVRT1_0012_G12.b :
TES01_0061_G05.b :
TES01_0024_H02.b :
TES01_0053_C10.b :
TES01_0006_E11.b :
TES01_0069_E05.b :
OVR01_0094_C11.b :
TES01_0084_C04.b :
SPLT1_0095_C11.b :
BFLT1_0006_H07.b :
TES01_0102_C04.b :
SPLT1_0039_G07.b :
SMG01_0067_G02.b :
OVRT1_0116_B03.b :
UTR01_0102_E10.b :
OVR01_0066_D12.b :
PCT01_0012_H04.b : ataa
TES01_0003_G10.b :
THY01_0101_B08.b :
TES01_0078_B06.b :
LVRM1_0036_H12.b :
TES01_0009_B08.b :
TES01_0036_B02.b :
TES01_0031_H01.b :
SMG01_0044_A12.b :
ITT01_0012_B04.b :
TES01_0063_E12.b :
OVR01_0086_F08.b :
TES01_0105_D10.b :
LVR01_0030_B10.b :
PTG01_0053_B07.b : cccgtcttctattaataataaactgttgtccctccccc
TES01_0020_F06.b :
TES01_0003_D05.b :
OVR01_0055_F06.b :
SMG01_0044_G08.b :
SKNB1_0059_H06.b :
MLN01_0050_C06.b :
OVRM1_0213_H07.b :
OVRM1_0068_D09.b :
PTG01_0032_G07.b :
TES01_0105_B07.b :
UTR01_0088_F11.b :
SMG01_0001_C02.b :
PTG01_0019_B07.b :
MLN01_0023_B06.b :
UTR01_0066_B10.b :
TES01_0005_F04.b :
TES01_0001_A10.b :
PTG01_0074_G02.b :
OVRM1_0067_H09.b :
SMG01_0091_E12.b :
TCH01_0066_A01.b :
TES01_0082_G01.b :
TES01_0106_C01.b :
TES01_0084_F04.b :
OVRM1_0022_G05.b :
OVR01_0104_G10.b :
TES01_0055_H03.b :
TES01_0104_A07.b :
SMG01_0019_F07.b :
PTG01_0047_G03.b :
PTG01_0056_E05.b :
TES01_0091_F07.b :
TES01_0100_E01.b :
TES01_0076_H01.b :
TES01_0064_B08.b :
TES01_0056_F03.b :
TES01_0065_E03.b :
TES01_0005_B06.b :
TES01_0010_G05.b :
BFLT1_0101_C03.b : tgtactttt
TES01_0081_H08.b :
TES01_0099_D01.b :
CLNT1_0018_F10.b :
PTG01_0099_D06.b :
OVR01_0013_E08.b :
SKNB1_0058_F04.b :
ITT01_0064_C08.b : gaccctccggttgaaaaaaaaattttttngccccttccttcccattttatcttggtgtcc
TCH01_0071_G06.b :
SKNB1_0024_G04.b :
UTR01_0056_B07.b : tgttgccccacccgcggggcgcggccccccctagaaatcccccctggagggccccaacct
20110601C-002188 : ............................................................
---------+---------+---------+---------+---------+---------+ 1356
TCH01_0043_D08.b :
TES01_0071_H03.b :
TCH01_0064_E12.b :
LNG01_0087_D10.b :
TCH01_0100_F02.b :
OVRT1_0012_G12.b :
TES01_0061_G05.b :
TES01_0024_H02.b :
TES01_0053_C10.b :
TES01_0006_E11.b :
TES01_0069_E05.b :
OVR01_0094_C11.b :
TES01_0084_C04.b :
SPLT1_0095_C11.b :
BFLT1_0006_H07.b :
TES01_0102_C04.b :
SPLT1_0039_G07.b :
SMG01_0067_G02.b :
OVRT1_0116_B03.b :
UTR01_0102_E10.b :
OVR01_0066_D12.b :
PCT01_0012_H04.b :
TES01_0003_G10.b :
THY01_0101_B08.b :
TES01_0078_B06.b :
LVRM1_0036_H12.b :
TES01_0009_B08.b :
TES01_0036_B02.b :
TES01_0031_H01.b :
SMG01_0044_A12.b :
ITT01_0012_B04.b :
TES01_0063_E12.b :
OVR01_0086_F08.b :
TES01_0105_D10.b :
LVR01_0030_B10.b :
PTG01_0053_B07.b :
TES01_0020_F06.b :
TES01_0003_D05.b :
OVR01_0055_F06.b :
SMG01_0044_G08.b :
SKNB1_0059_H06.b :
MLN01_0050_C06.b :
OVRM1_0213_H07.b :
OVRM1_0068_D09.b :
PTG01_0032_G07.b :
TES01_0105_B07.b :
UTR01_0088_F11.b :
SMG01_0001_C02.b :
PTG01_0019_B07.b :
MLN01_0023_B06.b :
UTR01_0066_B10.b :
TES01_0005_F04.b :
TES01_0001_A10.b :
PTG01_0074_G02.b :
OVRM1_0067_H09.b :
SMG01_0091_E12.b :
TCH01_0066_A01.b :
TES01_0082_G01.b :
TES01_0106_C01.b :
TES01_0084_F04.b :
OVRM1_0022_G05.b :
OVR01_0104_G10.b :
TES01_0055_H03.b :
TES01_0104_A07.b :
SMG01_0019_F07.b :
PTG01_0047_G03.b :
PTG01_0056_E05.b :
TES01_0091_F07.b :
TES01_0100_E01.b :
TES01_0076_H01.b :
TES01_0064_B08.b :
TES01_0056_F03.b :
TES01_0065_E03.b :
TES01_0005_B06.b :
TES01_0010_G05.b :
BFLT1_0101_C03.b :
TES01_0081_H08.b :
TES01_0099_D01.b :
CLNT1_0018_F10.b :
PTG01_0099_D06.b :
OVR01_0013_E08.b :
SKNB1_0058_F04.b :
ITT01_0064_C08.b : gggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TCH01_0071_G06.b :
SKNB1_0024_G04.b :
UTR01_0056_B07.b : tttccctctccccacttttttttttaaaaagggggtcccttttttgtggggcccatttat
20110601C-002188 : ............................................................
---------+---------+---------+---------+---------+---------+ 1356
TCH01_0043_D08.b :
TES01_0071_H03.b :
TCH01_0064_E12.b :
LNG01_0087_D10.b :
TCH01_0100_F02.b :
OVRT1_0012_G12.b :
TES01_0061_G05.b :
TES01_0024_H02.b :
TES01_0053_C10.b :
TES01_0006_E11.b :
TES01_0069_E05.b :
OVR01_0094_C11.b :
TES01_0084_C04.b :
SPLT1_0095_C11.b :
BFLT1_0006_H07.b :
TES01_0102_C04.b :
SPLT1_0039_G07.b :
SMG01_0067_G02.b :
OVRT1_0116_B03.b :
UTR01_0102_E10.b :
OVR01_0066_D12.b :
PCT01_0012_H04.b :
TES01_0003_G10.b :
THY01_0101_B08.b :
TES01_0078_B06.b :
LVRM1_0036_H12.b :
TES01_0009_B08.b :
TES01_0036_B02.b :
TES01_0031_H01.b :
SMG01_0044_A12.b :
ITT01_0012_B04.b :
TES01_0063_E12.b :
OVR01_0086_F08.b :
TES01_0105_D10.b :
LVR01_0030_B10.b :
PTG01_0053_B07.b :
TES01_0020_F06.b :
TES01_0003_D05.b :
OVR01_0055_F06.b :
SMG01_0044_G08.b :
SKNB1_0059_H06.b :
MLN01_0050_C06.b :
OVRM1_0213_H07.b :
OVRM1_0068_D09.b :
PTG01_0032_G07.b :
TES01_0105_B07.b :
UTR01_0088_F11.b :
SMG01_0001_C02.b :
PTG01_0019_B07.b :
MLN01_0023_B06.b :
UTR01_0066_B10.b :
TES01_0005_F04.b :
TES01_0001_A10.b :
PTG01_0074_G02.b :
OVRM1_0067_H09.b :
SMG01_0091_E12.b :
TCH01_0066_A01.b :
TES01_0082_G01.b :
TES01_0106_C01.b :
TES01_0084_F04.b :
OVRM1_0022_G05.b :
OVR01_0104_G10.b :
TES01_0055_H03.b :
TES01_0104_A07.b :
SMG01_0019_F07.b :
PTG01_0047_G03.b :
PTG01_0056_E05.b :
TES01_0091_F07.b :
TES01_0100_E01.b :
TES01_0076_H01.b :
TES01_0064_B08.b :
TES01_0056_F03.b :
TES01_0065_E03.b :
TES01_0005_B06.b :
TES01_0010_G05.b :
BFLT1_0101_C03.b :
TES01_0081_H08.b :
TES01_0099_D01.b :
CLNT1_0018_F10.b :
PTG01_0099_D06.b :
OVR01_0013_E08.b :
SKNB1_0058_F04.b :
ITT01_0064_C08.b : nnnnnnnnn
TCH01_0071_G06.b :
SKNB1_0024_G04.b :
UTR01_0056_B07.b : aaaccttaggctctgggcccccctcttttttttcccactccgtggtcgggggaaaaaacc
20110601C-002188 : ............................................................
---------+---------+---------+---------+---------+---------+ 1356
TCH01_0043_D08.b :
TES01_0071_H03.b :
TCH01_0064_E12.b :
LNG01_0087_D10.b :
TCH01_0100_F02.b :
OVRT1_0012_G12.b :
TES01_0061_G05.b :
TES01_0024_H02.b :
TES01_0053_C10.b :
TES01_0006_E11.b :
TES01_0069_E05.b :
OVR01_0094_C11.b :
TES01_0084_C04.b :
SPLT1_0095_C11.b :
BFLT1_0006_H07.b :
TES01_0102_C04.b :
SPLT1_0039_G07.b :
SMG01_0067_G02.b :
OVRT1_0116_B03.b :
UTR01_0102_E10.b :
OVR01_0066_D12.b :
PCT01_0012_H04.b :
TES01_0003_G10.b :
THY01_0101_B08.b :
TES01_0078_B06.b :
LVRM1_0036_H12.b :
TES01_0009_B08.b :
TES01_0036_B02.b :
TES01_0031_H01.b :
SMG01_0044_A12.b :
ITT01_0012_B04.b :
TES01_0063_E12.b :
OVR01_0086_F08.b :
TES01_0105_D10.b :
LVR01_0030_B10.b :
PTG01_0053_B07.b :
TES01_0020_F06.b :
TES01_0003_D05.b :
OVR01_0055_F06.b :
SMG01_0044_G08.b :
SKNB1_0059_H06.b :
MLN01_0050_C06.b :
OVRM1_0213_H07.b :
OVRM1_0068_D09.b :
PTG01_0032_G07.b :
TES01_0105_B07.b :
UTR01_0088_F11.b :
SMG01_0001_C02.b :
PTG01_0019_B07.b :
MLN01_0023_B06.b :
UTR01_0066_B10.b :
TES01_0005_F04.b :
TES01_0001_A10.b :
PTG01_0074_G02.b :
OVRM1_0067_H09.b :
SMG01_0091_E12.b :
TCH01_0066_A01.b :
TES01_0082_G01.b :
TES01_0106_C01.b :
TES01_0084_F04.b :
OVRM1_0022_G05.b :
OVR01_0104_G10.b :
TES01_0055_H03.b :
TES01_0104_A07.b :
SMG01_0019_F07.b :
PTG01_0047_G03.b :
PTG01_0056_E05.b :
TES01_0091_F07.b :
TES01_0100_E01.b :
TES01_0076_H01.b :
TES01_0064_B08.b :
TES01_0056_F03.b :
TES01_0065_E03.b :
TES01_0005_B06.b :
TES01_0010_G05.b :
BFLT1_0101_C03.b :
TES01_0081_H08.b :
TES01_0099_D01.b :
CLNT1_0018_F10.b :
PTG01_0099_D06.b :
OVR01_0013_E08.b :
SKNB1_0058_F04.b :
ITT01_0064_C08.b :
TCH01_0071_G06.b :
SKNB1_0024_G04.b :
UTR01_0056_B07.b : cgcgctttttggggagtatttttttttgaaagggaaacctttttttttttttg