[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-002277

Length: 972

Sequence [FASTA format sequence]
CATGCGCGGT ATGTGTGGCT GGGGAATTCA TGTGGAGGTC AGAGTGGAAG CAGGTGTGAG
TGGGTCCAGC AGAAGGAGAC ATGGCTGCCA AGGTGTTTGA GTCCATCGGC AAGTTTGGCC
TGGCCTTAGC CGTTGCAGGA GGCGTGGTGA ACTCTGCCTT GTATAATGTG GATGCTGGGC
ACAGAGCTGT CATCTTTGAC CGGTTCCGTG GTGTGCAGGA CATTGTTGTA GGGGAAGGGA
CGCACTTTCT CATCCCTTGG GTACAGAAGC CAATTATCTT TGACTGCCGC TCTCGACCAC
GTAACGTGCC AGTGATCACT GGTAGCAAAG ATTTACAGAA TGTCAACATC ACCCTGCGTA
TCCTCTTTCG GCCGGTCGCC AGCCAGCTCC CCCGCATCTT CACCAGCATC GGGGAGGACT
ACGACGAGCG TGTGCTGCCC TCCATCACCA CAGAGATCCT CAAGTCCGTG GTGGCTCGCT
TTGACGCTGG AGAACTGATC ACCCAGAGAG AGCTGGTCTC CAGACAGGTG AGCGATGACC
TCACGGAGCG AGCAGCCACC TTTGGGCTCA TCCTGGATGA CGTGTCTCTG GTAAGAGCCT
TGGCAAGCCT GTGGGGGAGG GCGCATGGCT CCATGGCTGG GTAGACACCG TGAGGTCCTC
CCTACGATTT GCCTCGACGA AGACTTGAAA ACGTGGAACC TTCCTGATGG TATGAGGCGC
TCCTCCTTGG GTTCGTTGGA CCTCCCATGT GCCACAGACA TTTTTCTTTT GATTTTTGGT
TCCACTCAGA GGGTCCCCAA CCACTGGACT TTTCACCTTC CCCCAAACTG TGAGTGTTCT
CCCGCGCTCC CCAGGGAGTG ATGTCTCGCT TAACCCCGTT TGACACCGGC AGACACTGCC
CGGTAGAGAC TAGAGAACAG CTTGGAGAGT CTTTCTCCCT AGCACGGGAC CTCCAGCCTG
ACCCCTGAAA AT


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinPHBprohibitin [Homo sapiens]. 3317e-91O
Contig/Assembly ProteinPHB2prohibitin-2 isoform 2 [Homo sapiens]. 1693e-42O
Contig/Assembly ProteinPHB2prohibitin-2 isoform 1 [Homo sapiens]. 1693e-42O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinPhbprohibitin [Mus musculus]. 3301e-90O
Contig/Assembly Protein1700071K01Rikprohibitin-like [Mus musculus]. 3185e-87O
Contig/Assembly ProteinPhb2prohibitin-2 [Mus musculus]. 1692e-42O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinPHBprohibitin [Canis lupus familiaris]. 3317e-91O
Contig/Assembly ProteinLOC484431PREDICTED: similar to prohibitin [Canis familiaris]. 3049e-83O
Contig/Assembly ProteinLOC609045PREDICTED: similar to prohibitin [Canis familiaris]. 2671e-71O
Contig/Assembly ProteinLOC486716PREDICTED: similar to B-cell receptor-associated protein 37 [Canis familiaris]. 1694e-42O
Contig/Assembly ProteinLOC490527PREDICTED: similar to B-cell receptor-associated protein 37 [Canis familiaris]. 65.57e-11O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinPHBprohibitin [Bos taurus]. 3317e-91O
Contig/Assembly ProteinPHB2prohibitin-2 [Bos taurus]. 1694e-42O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100524170PREDICTED: prohibitin-like [Sus scrofa]. 3314e-91O
Contig/Assembly ProteinLOC100524707PREDICTED: prohibitin-like [Sus scrofa]. 3314e-91O
Contig/Assembly ProteinPHB2prohibitin 2 [Sus scrofa]. 1693e-42O


Assembly Members: 6      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
BFLT10059F04BFLT1_0059_F04.bFS644697 AK390342
LVRM10036C10LVRM1_0036_C10.bCJ001490 
OVRM10166H09OVRM1_0166_H09.bBP462012 
PST010066A09PST01_0066_A09.bFS702021 
PST010075E06PST01_0075_E06.bFS702758 
THY010007E08THY01_0007_E08.bBP165065 

  

SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
212C020.333BSGGC/G
T400.667GGT/G
227A020.333BSGTA/V
T400.667GTT/V
431C020.400BSCGC/R
T300.600CGT/R


Alignment:      TOP

20110601C-002277 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
BFLT1_0059_F04.b : gganccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0075_E06.b : t
OVRM1_0166_H09.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0007_E08.b : gaxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0066_A09.b :
LVRM1_0036_C10.b : gcgtttgtcxxxxxxxxxxxxxxxx
20110601C-002277 : ............CATGCGCGGTATGTGTGGCTGGGGAATTCATGTGGAGGTCAGAGTGGA
---------+---------+---------+---------+---------+---------+ 48
BFLT1_0059_F04.b : xxxxxxxxxxxgCATGCGCGGTATGTGTGGCTGGGGAATTCATGTGGAGGTCAGAGTGGA
PST01_0075_E06.b : ttttcctgcgttggctatgGGTATGTGTGGCTGGGGAATTC*TGTGGAGGTCAGAGTGGA
OVRM1_0166_H09.b : xxxxxxxxxxxxxxxxxxxxxxxTGTGTGGCTGGGGAATTCATGTGGAGGTCAGAGTGGA
THY01_0007_E08.b : xxxxxxxxxxxxxxxxxxxxxxxTGTGTGGCTGGGGAATTCATGTGGAGGTCAGAGTGGA
PST01_0066_A09.b : tttttttcgcgttggctctggatgGTGGCTGGGGAAT*CATGTGGAGGTCAGAGTGGA
LVRM1_0036_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCATGTGGAGGTCAGAGTGGA
20110601C-002277 : AGCAGGTGTGAGTGGGTCCAGCAGAAGGAGACATGGCTGCCAAGGTGTTTGAGTCCATCG
---------+---------+---------+---------+---------+---------+ 108
BFLT1_0059_F04.b : AGCAGGTGTGAGTGGGTCCAGCAGAAGGAGACATGGCTGCCAAGGTGTTTGAGTCCATCG
PST01_0075_E06.b : AGCAGGTGTGAGTGGGTCCAGCAGAAGGAGACATGGCTGCCAAGGTGTTTGAGTCCATCG
OVRM1_0166_H09.b : AGCAGGTGTGAGTGGGTCCAGCAGAAGGAGACATGGCTGCCAAGGTGTTTGAGTCCATCG
THY01_0007_E08.b : AGCAGGTGTGAGTGGGTCCAGCAGAAGGAGACATGGCTGCCAAGGTGTTTGAGTCCATCG
PST01_0066_A09.b : AGCAGGTGTGCGTGGGTCCAGCAGAAGGAGACATGGCTGCCAAGGTGTTTGAGTCCATCG
LVRM1_0036_C10.b : AGCAGGTGTGAGTGGGTCCAGCAGAAGGAGACATGGCTGCCAAGGTGTTTGAGTCCATCG
20110601C-002277 : GCAAGTTTGGCCTGGCCTTAGCCGTTGCAGGAGGCGTGGTGAACTCTGCCTTGTATAATG
---------+---------+---------+---------+---------+---------+ 168
BFLT1_0059_F04.b : GCAAGTTTGGCCTGGCCTTAGCCGTTGCAGGAGGCGTGGTGAACTCTGCCTTGTATAATG
PST01_0075_E06.b : GCAAGTTTGGCCTGGCCTTAGCCGTTGCAGGAGGCGTGGTGAACTCTGCCTTGTATAATG
OVRM1_0166_H09.b : GCAAGTTTGGCCTGGCCTTAGCCGTTGCAGGAGGCGTGGTGAACTCTGCCTTGTATAATG
THY01_0007_E08.b : GCAAGTTTGGCCTGGCCTTAGCCGTTGCAGGAGGCGTGGTGAACTCTGCCTTGTATAATG
PST01_0066_A09.b : GCAAGTTTGGCCTGGCCTTAGCCGTTGCAGGAGGCGTGGTGAACTCTGCCTTGTATAATG
LVRM1_0036_C10.b : GCAAGTTTGGCCTGGCCTTAGCCGTTGCAGGAGGCGTGGTGAACTCTGCCTTGTATAATG
20110601C-002277 : TGGATGCTGGGCACAGAGCTGTCATCTTTGACCGGTTCCGTGGTGTGCAGGACATTGTTG
---------+---------+---------+---------+---------+---------+ 228
BFLT1_0059_F04.b : TGGATGCTGGGCACAGAGCTGTCATCTTTGACCGGTTCCGTGGTGTGCAGGACATTGTTG
PST01_0075_E06.b : TGGATGCTGGGCACAGAGCTGTCATCTTTGACCGGTTCCGTGGTGTGCAGGACATTGTTG
OVRM1_0166_H09.b : TGGATGCTGGGCACAGAGCTGTCATCTTTGACCGGTTCCGTGGCGTGCAGGACATTGTAG
THY01_0007_E08.b : TGGATGCTGGGCACAGAGCTGTCATCTTTGACCGGTTCCGTGGTGTGCAGGACATTGTTG
PST01_0066_A09.b : TGGATGCTGGGCACAGAGCTGTCATCTTTGACCGGTTCCGTGGTGTGCAGGACATTGTTG
LVRM1_0036_C10.b : TGGATGCTGGGCACAGAGCTGTCATCTTTGACCGGTTCCGTGGCGTGTAGGACATTGTAG
20110601C-002277 : TAGGGGAAGGGACGCACTTTCTCATCCCTTGGGTACAGAAGCCAATTATCTTTGACTGCC
---------+---------+---------+---------+---------+---------+ 288
BFLT1_0059_F04.b : TAGGGGAAGGGACGCACTTTCTCATCCCTTGGGTACAGAAGCCAATTATCTTTGACTGCC
PST01_0075_E06.b : TAGGGGAAGGGACGCACTTTCTCATCCCTTGGGTACAGAAGCCAATTATCTTTGACTGCC
OVRM1_0166_H09.b : TAGGGGAAGGGACGCACTTTCTCATCCCTTGGGTACAGAAGCCAATTATCTTTGACTGCC
THY01_0007_E08.b : TAGGGGAAGGGACGCACTTTCTCATCCCTTGGGTACAGAAGCCAATTATCTTTGACTGCC
PST01_0066_A09.b : TAGGGGAAGGGACGCACTTTCTCATCCCTTGGGTACAGAAGCCAATTATCTTTGACTGCC
LVRM1_0036_C10.b : TAGGGGAAGGGACGCACTTTCTCATCCCTTGGGTACAGAAGCCAATTATCTTTGACTGCC
20110601C-002277 : GCTCTCGACCACGTAACGTGCCAGTGATCACTGGTAGCAAAGATTTACAGAATGTCAACA
---------+---------+---------+---------+---------+---------+ 348
BFLT1_0059_F04.b : GCTCTCGACCACGTAACGTGCCAGTGATCACTGGTAGCAAAGATTTACAGAATGTCAACA
PST01_0075_E06.b : GCTCTCGACCACGTAACGTGCCAGTGATCACTGGTAGCAAAGATTTACAGAATGTCAACA
OVRM1_0166_H09.b : GCTCTCGACCACGTAACGTGCCAGTGATCACTGGTAGCAAAGATTTACAGAATGTCAACA
THY01_0007_E08.b : GCTCTCGACCACGTAACGTGCCAGTGATCACTGGTAGCAAAGATTTACAGAATGTCAACA
PST01_0066_A09.b : GCTCTCGACCACGTAACGTGCCAGTGATCACTGGTAGCAAAGATTTACAGAATGTCAACA
LVRM1_0036_C10.b : GCTCTCGACCACGTAACGTGCCAGTGATCACTGGTAGCAAAGATTTACAGAATGTCAACA
20110601C-002277 : TCACCCTGCGTATCCTCTTTCGGCCGGTCGCCAGCCAGCTCCCCCGCATCTTCACCAGCA
---------+---------+---------+---------+---------+---------+ 408
BFLT1_0059_F04.b : TCACCCTGCGTATCCTCTTTCGGCCGGTCGCCAGCCAGCTCCCCCGCATCTTCACCAGCA
PST01_0075_E06.b : TCACCCTGCGTATCCTCTTTCGGCCGGTCGCCAGCCAGCTCCCCCGCATCTTCACCAGCA
OVRM1_0166_H09.b : TCACCCTGCGTATCCTCTTTCGGCCGGTCGCCAGCCAGCTCCCCCGCATCTTCACCAGCA
THY01_0007_E08.b : TCACCCTGCGTATCCTCTTTCGGTCGGTCGCCAGCCAGCTCCCCCGCATCTTCACCAGCA
PST01_0066_A09.b : TCACCCTGCGTATCCTCTTTCGGCCGGTCGCCAGCCAGCTCCCCCGCATCTTCACCAGCA
LVRM1_0036_C10.b : TCACCCTGCGTATCCTCTTTCGGCCGGTCGCCAGCCAGCTCCCCCGCATCTTCACCAGCA
20110601C-002277 : TCGGGGAGGACTACGACGAGCGTGTGCTGCCCTCCATCACCACAGAGATCCTCAAGTCCG
---------+---------+---------+---------+---------+---------+ 468
BFLT1_0059_F04.b : TCGGGGAGGACTACGACGAGCGTGTGCTGCCCTCCATCACCACAGAGATCCTCAAGTCCG
PST01_0075_E06.b : TCGGGGAGGACTACGACGAGCGTGTGCTGCCCTCCATCACCACAGAGATCCTCAAGTCCG
OVRM1_0166_H09.b : TCGGGGAGGACTACGACGAGCGCGTGCTGCCCTCCATCACCACAGAGATCCTCAAGTCCG
THY01_0007_E08.b : TCGGGGAGGACTACGACGAGCGTGTGCTGCCCTCCATCACCACAGAGATCCTCAAGTCCG
PST01_0066_A09.b : TCGGGGAGGACTACGACGAGCGTGTGCTGCCCTCCATCACCACAGAGATCCTCAAGTCCG
LVRM1_0036_C10.b : TCGGGGAGGACTACGACGAGCGCGTGCTGCCCTCCATCACCACAGAGATCCTCAAGTCCG
20110601C-002277 : TGGTGGCTCGCTTTGACGCTGGAGAACTGATCACCCAGAGAGAGCTGGTCTCCAGACAGG
---------+---------+---------+---------+---------+---------+ 528
BFLT1_0059_F04.b : TGGTGGCTCGCTTTGACGCTGGAGAACTGATCACCCAGAGAGAGCTGGTCTCCAGACAGG
PST01_0075_E06.b : TGGTGGCTCGCTTTGACGCTGGAGAACTGATCACCCAGAGAGAGCTGGTCTCCAGACAGG
OVRM1_0166_H09.b : TGGTGGCTCGCTTTGACGCTGGAGAACTGATCACCCAGAGAGAGCTGGTCTCCAGACAGG
THY01_0007_E08.b : TGGTGGCTCGCTTTGACGCTGGAGAACTGATCACCCACAGAGAGCTGGCCTCCAGACAGG
PST01_0066_A09.b : TGGTGGCTCGCTTTGACGCTGGAGAACTGATCACCCAGAGAGAGCTGGTCTCCAGACAGG
LVRM1_0036_C10.b : TGGTGGCTCGCTTTGACGCTGGAGAACTGATCACCCAGAGAGAGCTGGTCTCCAGACAGG
20110601C-002277 : TGAGCGATGACCTCACGGAGCGAGCAGCCACCTTTGGGCTCATCCTGGATGACGTGTC*T
---------+---------+---------+---------+---------+---------+ 587
BFLT1_0059_F04.b : TGAGCGATGACCTCACGGAGCGAGCAGCCACCTTTGGGCTCATCCTGGATGACGTGTC*T
PST01_0075_E06.b : TGAGCGATGACCTCACGGAGCGAGCAGCCACCTTTGGGCTCATCCTGGATGACGTGTC*T
OVRM1_0166_H09.b : TGAGCGATGACCTCACGGAGCGAGCAGCCACCTTTGGGCTCATCCTGGATGACGTGTC*T
THY01_0007_E08.b : TGAGCGATGACCTCACGGAGCGAGCAGTCACCTTTGGGCTCATCCTGGATGACGTGTCCT
PST01_0066_A09.b : TGAGCGATGACCTCACGGAGCGAGCAGCCACCTTTGGGCTCATCCTGGATGACGTGTC*T
LVRM1_0036_C10.b : TGAGCGATGACCTCACGGAGCGAGCAGCCACCTTTGGGCTCATCCTGGATGACGTGTC*T
20110601C-002277 : CTGGTAAGAGCCTTGGCAAGCCTGTGGGGGAGGGCGCATGGCTCCATGGCTGGGTAGACA
---------+---------+---------+---------+---------+---------+ 647
BFLT1_0059_F04.b : CTGGTAAGAGCCTTGGCAAGCCTGTGGGGGAGGGCGCATGGCTCCATGGCTGGGTAGACA
PST01_0075_E06.b : CTGGTAAGAGCCTTGGCAAGCCTGTGGGGGAGGGCGCATGGCTCCATGGCTGGGTAGACA
OVRM1_0166_H09.b : CTGGTAAGAGCCTTGGCAAGCCTGTGGGGGAGGGCGCATGGCTCCATGGCTGGGTAGACA
THY01_0007_E08.b : CTGGTAAGAGCCTTGGCAAGCCTGTGGGGGAGGGCGCATGGCTCCATGGCTTGGTAGACA
PST01_0066_A09.b : CTGGTAAGAGCCTTGGCAAGCCTGTGGGGGAGGGCGCATGGCTCCATGGCTGGGTAGACA
LVRM1_0036_C10.b : CTGGTAAGAGCCTTGGCAAGCCTGTGGGGGAGGGCGCATGGCTCCATGGCTGGGTAGACA
20110601C-002277 : CCGTGAGGTCC*TCCCTACGATTTGCCTCGACGAAGACTTGAAAACGTGGAACCTTCCTG
---------+---------+---------+---------+---------+---------+ 706
BFLT1_0059_F04.b : CCGTGAGGTCC*TCCCTACGATTTGCCTCGACGAAGACTTGAAAACGTGGAACCTTCCTG
PST01_0075_E06.b : CCGTGAGGTCC*TCCCTACGATTTGCCTCGACGAAGACTTGAAAACGTGGAACCTTCCTG
OVRM1_0166_H09.b : CCGTGAGGTCC*TCCCTACGATTTGCCTCGACGAAGACTTTGAAACGTGGAACCTTCCTG
THY01_0007_E08.b : TCCTGAGGTCCCTCCCTACGATTTGCCTCGACGAAGACTTGAAAACGTGGAACCTTCCTG
PST01_0066_A09.b : CCGTGAGGTCC*TCCCTACGATTTGCCTCGACGAAGACTTGAAAACGTGGAACCTTCCTG
LVRM1_0036_C10.b : CCGTGAGGTCC*TCCCTACGATTTGCCTCGACGAAGACTTGAAAACGTNGGAACTTCCTG
20110601C-002277 : ATGGTATGAGGCGCTCCTCCTTGGGTTCGTTGGACCTCCCATGTGCCACAGACATTTT*T
---------+---------+---------+---------+---------+---------+ 765
BFLT1_0059_F04.b : ATGGTATGAGGCGCTCCTCCTTGGGTTCGTTGGACCTCCCATGTGCCACAGACATTTT*T
PST01_0075_E06.b : ATGGTATGAGGCGCTCCTCCTTGGGTTCGTTGGACCTCCCATGTGCCACAGACATTTT*T
OVRM1_0166_H09.b : ATGGTATGAGGCGCTCCTCCTTGGGTTCGTTG
THY01_0007_E08.b : ATGGTATGACGCGCTCCTCCTTGAGTTCGCTGGACCTCCCCAGTGCCACAGACATTTTCT
PST01_0066_A09.b : ATGGTATGAGGCGCTCCTCCTTGGGTTCGTTGGACCTCCCATGTGCCACAGACATTTT*T
LVRM1_0036_C10.b : ATGGTATGAGGCGCTCCTCCTTGGGTTCGTTGGACCTCCCATGTGCCACAGACATTTT*T
20110601C-002277 : CTTTTGATTTTTGGTTCCACTCAGAGGGTCCCCAACCACTGGACTTTTCACCTTCCCCCA
---------+---------+---------+---------+---------+---------+ 825
BFLT1_0059_F04.b : CTTTTGATTTTTGGTTCCACTCAGAAGGTCCCCAACCACTGGACTTTTCACCTTCCCCCA
PST01_0075_E06.b : CTTTTGATTTTTGGTTCCACTCAGAGGGTCCCCAACCACTGGACTTTTCACCCTCCCCCA
OVRM1_0166_H09.b :
THY01_0007_E08.b : CTTTTGAATTTTGGTTCCACTCACAGGGTCCCCAACCACctgtacttttcaccttccccc
PST01_0066_A09.b : CTTTTGATTTTTGGTTCCACTCAGAGGGTCCCCAACCACTGGACTTTTCACCTTCCCCCA
LVRM1_0036_C10.b : CTTTTGATTTTTGGTTCCACTCAGA
20110601C-002277 : AACTGTGAGTGTTCTCCCGCGCTCCCCAGGGAGTGATGTCTCGCTTAACCCCGTTTGACA
---------+---------+---------+---------+---------+---------+ 885
BFLT1_0059_F04.b : A*CTGTGAATGTTCTCCCGCGCTCCCCAGG*AGTGATGTCTCGCTTAACCCCGTTgacac
PST01_0075_E06.b : AACTGTGAGTGTTCTCCCGCGCTCCCCAGGGAGTGATGTCTCGCTTAACCCCGTTTGACA
OVRM1_0166_H09.b :
THY01_0007_E08.b : cacctgtganctgtctccccgcgctcctttaggcattgatgcctctcttaacccctttg
PST01_0066_A09.b : AACTGTGAGTGTTCTCCCGCGCTCCCCAGGGAGTGATGTCTCGCTTAACCCCGTTTGACA
LVRM1_0036_C10.b :
20110601C-002277 : CCGGCAGACACTGCCCGGTAGAGACTAGAGAACAGCTTGGAGAGTCTTTCTCCCTAGCAC
---------+---------+---------+---------+---------+---------+ 945
BFLT1_0059_F04.b : cggcgacactgcccggtaaaaactaaaaacaccttggaaagtctttctcctaacacggac
PST01_0075_E06.b : CCGGCAGACACTGCCCGGTAGAGACTAGAGAACAGCTTGGAGAGTCTTTCTCCCTAGCAC
OVRM1_0166_H09.b :
THY01_0007_E08.b :
PST01_0066_A09.b : CCGGCAGACACTGCCCGGTAGAGACTAGAGAACAGCTTGGAGAGTCTTTCTCCCTAGCAC
LVRM1_0036_C10.b :
20110601C-002277 : GGGACCTCCAGCCTGACCCCTGAAAAT.................................
---------+---------+---------+---------+---------+---------+ 972
BFLT1_0059_F04.b : ctccaacctgaaccctgaaattttctgaactccgggcctcaaccaatcaggcaggccggg
PST01_0075_E06.b : GGGACCTCCAGCCTGACCCCTGAGAATtttctgacactcagggtctgcagcacagtcagg
OVRM1_0166_H09.b :
THY01_0007_E08.b :
PST01_0066_A09.b : GGACCCTCCAGCCTGACCCCTGAAAATccctgacgctcagggtctgcagcacagtcaggc
LVRM1_0036_C10.b :
20110601C-002277 : ............................................................
---------+---------+---------+---------+---------+---------+ 972
BFLT1_0059_F04.b : aactccccgtaaagggataaaggaaacaaggtttttttgccaaacccggcaaggggtggg
PST01_0075_E06.b : cgaagcctggggactccccgtggaaggtgatagaatgtaaacgaatggttctgttgccca
OVRM1_0166_H09.b :
THY01_0007_E08.b :
PST01_0066_A09.b : gaggcctgggaaactcccgtgaaggtgatagagtgtaaacgagtggttctggtgcccaag
LVRM1_0036_C10.b :
20110601C-002277 : ............................................................
---------+---------+---------+---------+---------+---------+ 972
BFLT1_0059_F04.b : ggggggaatcttaagaaaacccccccttgaacatggggcggggggtgtttcttgaaacaa
PST01_0075_E06.b : gagcctgncactgggggtgggggggtggggcatctctgaagcaatagccatccttctgaa
OVRM1_0166_H09.b :
THY01_0007_E08.b :
PST01_0066_A09.b : cctgccactggggggggggggtggggcatctctgaagcatagccatctcttgaaaccatg
LVRM1_0036_C10.b :
20110601C-002277 : ............................................................
---------+---------+---------+---------+---------+---------+ 972
BFLT1_0059_F04.b : ggcctaaccaaaaaaaaaatgggcggtagtttttatacccagaagaggggagggccgttc
PST01_0075_E06.b : gacatgtggtctgtggggctgtattcttatgacatcaatgcctttaacccgacgaaaagc
OVRM1_0166_H09.b :
THY01_0007_E08.b :
PST01_0066_A09.b : tgtctgggtgcctgttttctatgaatcgaagccctaacacaacagaaagcattcgggcag
LVRM1_0036_C10.b :
20110601C-002277 : ............................................................
---------+---------+---------+---------+---------+---------+ 972
BFLT1_0059_F04.b : taatctgaaaaacctgttagtttttcggggaaaaaatttttttcttctcggcgccgggaa
PST01_0075_E06.b : aattcgggccggatacctttcaattcccgaagaagaagggaaggggtcccgtttccaatt
OVRM1_0166_H09.b :
THY01_0007_E08.b :
PST01_0066_A09.b : aaacactttaaattccgaagataaaggaaagggctctgtttcaattccctggaaaaacct
LVRM1_0036_C10.b :
20110601C-002277 : ............................................................
---------+---------+---------+---------+---------+---------+ 972
BFLT1_0059_F04.b : gccattccctttccctgtggtttaacacgggagtactccctcccggggtccttgacctcc
PST01_0075_E06.b : ccttgaaaaatccttggcggaatttttcggggggagacaaggttccggtcaatccccggg
OVRM1_0166_H09.b :
THY01_0007_E08.b :
PST01_0066_A09.b : tggcggatttgtccgggggaaatagtttccgtcatttcccggggccgggagaagccactt
LVRM1_0036_C10.b :
20110601C-002277 : ............................................................
---------+---------+---------+---------+---------+---------+ 972
BFLT1_0059_F04.b : tcgaggttgtttttggaacggctcccttcaaa
PST01_0075_E06.b : cgccccgggaagaacccttccccttttgcccggtgctgtttaaaccccctgatattccac
OVRM1_0166_H09.b :
THY01_0007_E08.b :
PST01_0066_A09.b : cccttttcccgtgccgtgttaaaagccccgagaattccccccatctcccggggtgtcctc
LVRM1_0036_C10.b :
20110601C-002277 : ............................................................
---------+---------+---------+---------+---------+---------+ 972
BFLT1_0059_F04.b :
PST01_0075_E06.b : ccacctccccggggttccctttggaccctttccgggagaggtgctcctctgggag
OVRM1_0166_H09.b :
THY01_0007_E08.b :
PST01_0066_A09.b : ttagaacctttcgtgaaagttgtcctctctttacaccctccctccccca
LVRM1_0036_C10.b :