[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-002318

Length: 1,128

Sequence [FASTA format sequence]
GAGTCTCGGT TATATAGCCC GGCGACGGAG CACGCGTGTG TGCGGACGCA GTTGCGTGAA
GGGTATTTGC CTTTTGCCTT GCGGTGGAGC AGAGCTTGTT CCTCTCCCGT TCAGCCGTGC
AGGTTGAATT GACCAAAGCA ATGGTTATGG AGAAGCCTAG TCCCCTGCTG GTCGGGCGGG
AATTTGTGAG ACAGTATTAC ACGCTGCTGA ACCAGGCCCC AGACATGCTA CACAGATTTT
ATGGAAAGAA CTCTTCTTAT GTCCATGGGG GATTGGATTC AAATGGAAAG CCAGCAGATG
CAGTCTATGG ACAAAAAGAA ATCCATAGGA AAGTGATGGC TCAGAACTTC ACCAACTGCC
ACACCAAGAT CCGCCATGTC GACGCTCACG CCACCCTGAA TGACGGCGTG GTGGTCCAGG
TGATGGGCTT GCTCTCGAAC AACAACCAGG CTTTGAGGAG ATTCATGCAG ACTTTTGTCC
TTGCTCCTGA GGGCTCTGTT GCAAATAAAT TCTATGTTCA CAATGATATC TTCAGATACC
AAGATGAGGT CTTTGGTGGC TTTGTCACGG AGCCTCAGGA GGAATCTGAA GAAGAAGTAG
AGGAACCTGA AGAAAGACAG CAGACACCTG AGGTGGTGCC TGATGATTCT GGAACTTTCT
ATGATCAAAC TGTCAGCAAT GACTTAGAAG AGCATTTAGA AGAACCTGTT GCTGAACCAG
AGCCTGATCC TGAACCAGAA CCAGAGCAAG AACCTGTATC TGAAGTCCAG GAGGAAAAGT
CTGAGCCAGT ATTGGAAGAA GCTGCTCCTG AGGATGTTCA GAAGAGTTCT TCTCCAGCGC
CTGCAGACAT AGCACAGACA GTACAGGAGG ATTTGAGAAC CTTTTCCTGG GCGTCTGTGA
CCAGTAAGAA CCTTCCTCCC AGTGGAGCTG TTCCGGTTAC CGGGATACCA CCTCATGTTG
TTAAAGTGCC AGCTTCACAG CCTCGTCCAG AGACTAAACC TGAATCTCAG ATTCCACCGC
AGAGGCCTCA AAGGGATCAA AGGGTTCGGG AACAGCGAAT AAATGTTCCT CCCCAAAGGG
GTCCTAAAAC ANTCCGAGAG GCTGGTGAGC AAGGGGATGT TGAGCCTC


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinG3BP1ras GTPase-activating protein-binding protein 1 [Homo sapiens]. 464e-131O
Contig/Assembly ProteinG3BP1ras GTPase-activating protein-binding protein 1 [Homo sapiens]. 464e-131O
Contig/Assembly ProteinG3BP2ras GTPase-activating protein-binding protein 2 isoform a [Homo sapiens]. 2954e-80O
Contig/Assembly ProteinG3BP2ras GTPase-activating protein-binding protein 2 isoform a [Homo sapiens]. 2954e-80O
Contig/Assembly ProteinG3BP2ras GTPase-activating protein-binding protein 2 isoform b [Homo sapiens]. 2432e-64O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinG3bp1ras GTPase-activating protein-binding protein 1 [Mus musculus]. 454e-128O
Contig/Assembly ProteinG3bp2ras GTPase-activating protein-binding protein 2 isoform a [Mus musculus]. 2953e-80O
Contig/Assembly ProteinG3bp2ras GTPase-activating protein-binding protein 2 isoform a [Mus musculus]. 2953e-80O
Contig/Assembly ProteinG3bp2ras GTPase-activating protein-binding protein 2 isoform a [Mus musculus]. 2953e-80O
Contig/Assembly ProteinG3bp2ras GTPase-activating protein-binding protein 2 isoform b [Mus musculus]. 2432e-64O
Contig/Assembly ProteinG3bp2ras GTPase-activating protein-binding protein 2 isoform b [Mus musculus]. 2432e-64O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC479322PREDICTED: similar to Ras-GTPase-activating protein binding protein 1 (GAP SH3-domain binding protein 1) (G3BP-1) (DNA helicase VIII) (HDH-VIII) isoform 1 [Canis familiaris]. 468e-132O
Contig/Assembly ProteinLOC479322PREDICTED: similar to Ras-GTPase-activating protein binding protein 1 (GAP SH3-domain binding protein 1) (G3BP-1) (DNA helicase VIII) (HDH-VIII) isoform 4 [Canis familiaris]. 468e-132O
Contig/Assembly ProteinLOC479322PREDICTED: similar to Ras-GTPase-activating protein binding protein 1 (GAP SH3-domain binding protein 1) (G3BP-1) (DNA helicase VIII) (HDH-VIII) isoform 3 [Canis familiaris]. 382e-106O
Contig/Assembly ProteinLOC478429PREDICTED: similar to Ras-GTPase activating protein SH3 domain-binding protein 2 isoform a isoform 1 [Canis familiaris]. 2962e-80O
Contig/Assembly ProteinLOC478429PREDICTED: similar to Ras-GTPase activating protein SH3 domain-binding protein 2 isoform a isoform 9 [Canis familiaris]. 2962e-80O
Contig/Assembly ProteinLOC478429PREDICTED: similar to Ras-GTPase activating protein SH3 domain-binding protein 2 isoform a isoform 8 [Canis familiaris]. 2962e-80O
Contig/Assembly ProteinLOC478429PREDICTED: similar to Ras-GTPase activating protein SH3 domain-binding protein 2 isoform a isoform 7 [Canis familiaris]. 2962e-80O
Contig/Assembly ProteinLOC478429PREDICTED: similar to Ras-GTPase activating protein SH3 domain-binding protein 2 isoform a isoform 2 [Canis familiaris]. 2962e-80O
Contig/Assembly ProteinLOC478429PREDICTED: similar to Ras-GTPase activating protein SH3 domain-binding protein 2 isoform b isoform 4 [Canis familiaris]. 2432e-64O
Contig/Assembly ProteinLOC479322PREDICTED: similar to Ras-GTPase-activating protein binding protein 1 (GAP SH3-domain binding protein 1) (G3BP-1) (DNA helicase VIII) (HDH-VIII) isoform 2 [Canis familiaris]. 1271e-29O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinG3BP1ras GTPase-activating protein-binding protein 1 [Bos taurus]. 473e-133O
Contig/Assembly ProteinG3BP2ras GTPase-activating protein-binding protein 2 [Bos taurus]. 2432e-64O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinG3BP1ras GTPase-activating protein-binding protein 1 [Sus scrofa]. 478e-135O
Contig/Assembly ProteinG3BP2PREDICTED: ras GTPase-activating protein-binding protein 2 isoform 3 [Sus scrofa]. 2978e-81O
Contig/Assembly ProteinG3BP2PREDICTED: ras GTPase-activating protein-binding protein 2 isoform 2 [Sus scrofa]. 2978e-81O
Contig/Assembly ProteinG3BP2PREDICTED: ras GTPase-activating protein-binding protein 2 isoform 1 [Sus scrofa]. 2431e-64O


Assembly Members: 39      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
BFLT10029D04BFLT1_0029_D04.bFS642361 
BFLT10052G11BFLT1_0052_G11.bFS644143 
BFLT10055D04BFLT1_0055_D04.bFS644349 
BFLT10110E11BFLT1_0110_E11.bHX202579 
BMWN10054C04BMWN1_0054_C04.bHX208842 
CBLT10072G10CBLT1_0072_G10.bHX216932 
CLNT10027F08CLNT1_0027_F08.bFS659198 
CLNT10035C11CLNT1_0035_C11.bFS659784 
CLNT10116B08CLNT1_0116_B08.bHX220372 
ILNT10054E09ILNT1_0054_E09.b  
ITT010017H04ITT01_0017_H04.bBW977572 
ITT010023A07ITT01_0023_A07.bBW978041 
ITT010030A08ITT01_0030_A08.bBW978665 
ITT010068H06ITT01_0068_H06.bBW982099 
KDN010066F08KDN01_0066_F08.bFS675719 
KDN010071G08KDN01_0071_G08.bFS676112 
KDN010083B12KDN01_0083_B12.b  
LVR010054B08LVR01_0054_B08.bBP442442 
MLN010028C11MLN01_0028_C11.bCJ009801 AK394420
OVR010019G06OVR01_0019_G06.bBP144144 
OVR010047C11OVR01_0047_C11.bBP142546 
OVR010089B10OVR01_0089_B10.bBW967287 
OVRM10039A10OVRM1_0039_A10.bBP455331 
OVRM10048F11OVRM1_0048_F11.bBP460255 
OVRM10080H09OVRM1_0080_H09.bBP154610 AK395133
OVRM10122F01OVRM1_0122_F01.bBP151222 
OVRT10142H09OVRT1_0142_H09.bHX238231 
PST010065H06PST01_0065_H06.bFS702009 
PST010073B09PST01_0073_B09.bFS702559 AK400859
PST010087G11PST01_0087_G11.bFS703764 
PTG010079F04PTG01_0079_F04.bFS711129 
SPL010033B03SPL01_0033_B03.bCJ016577 
SPL010051B01SPL01_0051_B01.bCJ017574 
THY010001F11THY01_0001_F11.bBP166612 
THY010002A08THY01_0002_A08.bBP160073 
THY010041E05THY01_0041_E05.bBP164782 
THY010056D05THY01_0056_D05.bBP163538 
THY010069G12THY01_0069_G12.bBP168046 
THY010206D12THY01_0206_D12.bBP462569 AK239805

  

SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
359C3340.949WSTGC/C
T200.051TGT/C
569A800.216WSACA/T
G2540.784ACG/T
664A3130.944WNGAT/D
G200.056GGT/G


Alignment:      TOP

20110601C-002318 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
MLN01_0028_C11.b : ctaggnnngggctggacttgacagtttgtcxxxxxxxxxxxxxx
THY01_0056_D05.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0017_H04.b :
PST01_0073_B09.b :
THY01_0002_A08.b : ctcttcccccctcctctctttcctctccctccttttttttctcatcccccctagctattt
THY01_0206_D12.b : gcxxxxxxx
ITT01_0030_A08.b :
CBLT1_0072_G10.b :
OVRM1_0048_F11.b :
OVRM1_0039_A10.b :
OVRM1_0080_H09.b :
THY01_0041_E05.b : gg
THY01_0069_G12.b : gcxxxxxx
CLNT1_0116_B08.b :
PTG01_0079_F04.b :
BFLT1_0055_D04.b :
OVR01_0089_B10.b :
OVR01_0047_C11.b : aagcctcttg
OVR01_0019_G06.b : tgggxxx
CLNT1_0035_C11.b :
LVR01_0054_B08.b : gxxxxxxx
BFLT1_0029_D04.b :
ITT01_0023_A07.b :
BMWN1_0054_C04.b :
BFLT1_0110_E11.b :
BFLT1_0052_G11.b :
CLNT1_0027_F08.b :
SPL01_0051_B01.b : nnnaa
KDN01_0066_F08.b :
ITT01_0068_H06.b :
ILNT1_0054_E09.b :
OVRM1_0122_F01.b :
OVRT1_0142_H09.b : nnna
KDN01_0071_G08.b :
PST01_0065_H06.b :
KDN01_0083_B12.b :
PST01_0087_G11.b :
SPL01_0033_B03.b :
THY01_0001_F11.b :
20110601C-002318 : ......................................GAGTCTCGGTTATATAGCCCGG
---------+---------+---------+---------+---------+---------+ 22
MLN01_0028_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGTCTCGGTTATATAGCCCGG
THY01_0056_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTCTCGGTTATATAGCCCGG
ITT01_0017_H04.b : nnggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCGG
PST01_0073_B09.b : aacgttgctctggattgccc
THY01_0002_A08.b : agtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0206_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0030_A08.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0072_G10.b : nttttagcaggagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0048_F11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0039_A10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0080_H09.b : cgttgacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0041_E05.b : gggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0069_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0116_B08.b : nnnccgtttgcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0079_F04.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BFLT1_0055_D04.b : nggaaccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0089_B10.b : tgcttggacttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0047_C11.b : ggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0019_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0035_C11.b : gaatccgtttgcngtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0029_D04.b : ggaatccgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0023_A07.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0054_C04.b : ttttagcaggtagaggxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0110_E11.b : nnnccccgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0052_G11.b : tttccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0027_F08.b : actcgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0051_B01.b : agcttggacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0066_F08.b : nn
ITT01_0068_H06.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0054_E09.b : nnnggacggtagacgxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0122_F01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0142_H09.b : cattttnnnnnnnnccgttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0071_G08.b :
PST01_0065_H06.b :
KDN01_0083_B12.b : nt
PST01_0087_G11.b : nnnn
SPL01_0033_B03.b :
THY01_0001_F11.b :
20110601C-002318 : CGACGGAGCACGCGTGTGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
---------+---------+---------+---------+---------+---------+ 82
MLN01_0028_C11.b : CGACGGAGCATGCGTGTGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
THY01_0056_D05.b : CGACGGAGCACGCGTGTGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
ITT01_0017_H04.b : CGACGGAGCACGCGTGTGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
PST01_0073_B09.b : ggcgacgagcCGCGTGTGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
THY01_0002_A08.b : xxxxxxxxxxxxxxxGTGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
THY01_0206_D12.b : xxxxxxxxxxxxxxxGTGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
ITT01_0030_A08.b : xxxxxxxxxxxxxxxGTGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
CBLT1_0072_G10.b : xxxxxxxxxxxxxxgGTGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
OVRM1_0048_F11.b : xxxxxxxxxxxxxxxxxGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
OVRM1_0039_A10.b : xxxxxxxxxxxxxxxxxGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
OVRM1_0080_H09.b : xxxxxxxxxxxxxxxxxGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
THY01_0041_E05.b : xxxxxxxxxxxxxxxxxGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
THY01_0069_G12.b : xxxxxxxxxxxxxxxxxGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
CLNT1_0116_B08.b : xxxxxxxxxxxxxxxxxGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
PTG01_0079_F04.b : nnnnnnnxxxxxxxxxxGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
BFLT1_0055_D04.b : xxxxxxxxxxxxxxxxxGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
OVR01_0089_B10.b : xxxxxxxxxxxxxxxxxGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
OVR01_0047_C11.b : xxxxxxxxxxxxxxxxxGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
OVR01_0019_G06.b : xxxxxxxxxxxxxxxxxGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
CLNT1_0035_C11.b : xxxxxxxxxxxxxxxxxGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
LVR01_0054_B08.b : xxxxxxxxxxxxxxxxxGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
BFLT1_0029_D04.b : xxxxxxxxxxxxxxxxxGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
ITT01_0023_A07.b : xxxxxxxxxxxxxxxxxGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
BMWN1_0054_C04.b : xxxxxxxxxxxxxxxxgGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
BFLT1_0110_E11.b : xxxxxxxxxxxxxxxxxGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
BFLT1_0052_G11.b : xxxxxxxxxxxxxxxxxGTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
CLNT1_0027_F08.b : xxxxxxxxxxxxxxcgttTGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
SPL01_0051_B01.b : xxxxxxxxxxxxxxxxxgcGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
KDN01_0066_F08.b : nnncctgctgtggctatggGCGGA*GCAGTTGCGTGA*GGGTATTTGCCTTTTGCCTTGC
ITT01_0068_H06.b : xxxxxxxxxxxxxxxxxxxGCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
ILNT1_0054_E09.b : xxxxxxxxxxxxxxxxxxgGCGGACGCCCTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
OVRM1_0122_F01.b : xxxxxxxxxxxxxxxxxxxxCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
OVRT1_0142_H09.b : xxxxxxxxxxxxxxxxxxxxCGGACGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
KDN01_0071_G08.b : ncctgctgtggctctgggtGCGGAGCAGTTGCGTGAA*GGTATTTGCCTTTTGCCTTGC
PST01_0065_H06.b : ntcgcgttggctctgggtgCGGAGCAGTTGCGTGAAG*GTATTTGCCTTTTGCCTTGC
KDN01_0083_B12.b : tttcctgacgttgctctggggCGGAGCAGTTGCGTGAA*GGTATTTGCCTTTTGCCTTGC
PST01_0087_G11.b : ncctgcgttggctctgggtgtgGGAGCAGTTGCGTGAAGGGTATTTGCCTTTTGCCTTGC
SPL01_0033_B03.b :
THY01_0001_F11.b :
20110601C-002318 : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
---------+---------+---------+---------+---------+---------+ 142
MLN01_0028_C11.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
THY01_0056_D05.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCGAAGCAAT
ITT01_0017_H04.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
PST01_0073_B09.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
THY01_0002_A08.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
THY01_0206_D12.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
ITT01_0030_A08.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
CBLT1_0072_G10.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
OVRM1_0048_F11.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
OVRM1_0039_A10.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
OVRM1_0080_H09.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
THY01_0041_E05.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
THY01_0069_G12.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
CLNT1_0116_B08.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
PTG01_0079_F04.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
BFLT1_0055_D04.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
OVR01_0089_B10.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
OVR01_0047_C11.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
OVR01_0019_G06.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
CLNT1_0035_C11.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
LVR01_0054_B08.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
BFLT1_0029_D04.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
ITT01_0023_A07.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAGGCAAT
BMWN1_0054_C04.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
BFLT1_0110_E11.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
BFLT1_0052_G11.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
CLNT1_0027_F08.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
SPL01_0051_B01.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
KDN01_0066_F08.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
ITT01_0068_H06.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
ILNT1_0054_E09.b : GGTGGAGCACAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
OVRM1_0122_F01.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
OVRT1_0142_H09.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
KDN01_0071_G08.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
PST01_0065_H06.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
KDN01_0083_B12.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
PST01_0087_G11.b : GGTGGAGCAGAGCTTGTTCCTCTCCCGTTCAGCCGTGCAGGTTGAATTGACCAAAGCAAT
SPL01_0033_B03.b : ttttagcttggactat
THY01_0001_F11.b : ttgcttttttgcctggtcgacggtttgtttctatcttcctacaacc
20110601C-002318 : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
---------+---------+---------+---------+---------+---------+ 202
MLN01_0028_C11.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
THY01_0056_D05.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
ITT01_0017_H04.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
PST01_0073_B09.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
THY01_0002_A08.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
THY01_0206_D12.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
ITT01_0030_A08.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
CBLT1_0072_G10.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
OVRM1_0048_F11.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
OVRM1_0039_A10.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
OVRM1_0080_H09.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
THY01_0041_E05.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
THY01_0069_G12.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
CLNT1_0116_B08.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
PTG01_0079_F04.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
BFLT1_0055_D04.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
OVR01_0089_B10.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
OVR01_0047_C11.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
OVR01_0019_G06.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
CLNT1_0035_C11.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
LVR01_0054_B08.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
BFLT1_0029_D04.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
ITT01_0023_A07.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
BMWN1_0054_C04.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
BFLT1_0110_E11.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
BFLT1_0052_G11.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
CLNT1_0027_F08.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
SPL01_0051_B01.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
KDN01_0066_F08.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
ITT01_0068_H06.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
ILNT1_0054_E09.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
OVRM1_0122_F01.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
OVRT1_0142_H09.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
KDN01_0071_G08.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
PST01_0065_H06.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
KDN01_0083_B12.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
PST01_0087_G11.b : GGTTATGGAGAAGCCTAGTCCCCTGCTGGTCGGGCGGGAATTTGTGAGACAGTATTACAC
SPL01_0033_B03.b : nacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0001_F11.b : ccctccccctagctattaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-002318 : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
---------+---------+---------+---------+---------+---------+ 262
MLN01_0028_C11.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
THY01_0056_D05.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
ITT01_0017_H04.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
PST01_0073_B09.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
THY01_0002_A08.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
THY01_0206_D12.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
ITT01_0030_A08.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
CBLT1_0072_G10.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
OVRM1_0048_F11.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
OVRM1_0039_A10.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
OVRM1_0080_H09.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
THY01_0041_E05.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
THY01_0069_G12.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
CLNT1_0116_B08.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
PTG01_0079_F04.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
BFLT1_0055_D04.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
OVR01_0089_B10.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
OVR01_0047_C11.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
OVR01_0019_G06.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
CLNT1_0035_C11.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
LVR01_0054_B08.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
BFLT1_0029_D04.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
ITT01_0023_A07.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
BMWN1_0054_C04.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
BFLT1_0110_E11.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
BFLT1_0052_G11.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
CLNT1_0027_F08.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
SPL01_0051_B01.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
KDN01_0066_F08.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
ITT01_0068_H06.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
ILNT1_0054_E09.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
OVRM1_0122_F01.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
OVRT1_0142_H09.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
KDN01_0071_G08.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
PST01_0065_H06.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
KDN01_0083_B12.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
PST01_0087_G11.b : GCTGCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
SPL01_0033_B03.b : xxxxCTGAACCAGGCCCCAGACATGCTACACAGATTTTATGGAAAGAACTCTTCTTATGT
THY01_0001_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTATGGAAAGAACTCTTCTTATGT
20110601C-002318 : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
---------+---------+---------+---------+---------+---------+ 322
MLN01_0028_C11.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
THY01_0056_D05.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
ITT01_0017_H04.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
PST01_0073_B09.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
THY01_0002_A08.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
THY01_0206_D12.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
ITT01_0030_A08.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
CBLT1_0072_G10.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
OVRM1_0048_F11.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
OVRM1_0039_A10.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
OVRM1_0080_H09.b : CCATGGGGGATTGGATTCGAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
THY01_0041_E05.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
THY01_0069_G12.b : CCATGGGGGATTGGATCCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
CLNT1_0116_B08.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
PTG01_0079_F04.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
BFLT1_0055_D04.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
OVR01_0089_B10.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
OVR01_0047_C11.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
OVR01_0019_G06.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
CLNT1_0035_C11.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
LVR01_0054_B08.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
BFLT1_0029_D04.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
ITT01_0023_A07.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
BMWN1_0054_C04.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
BFLT1_0110_E11.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
BFLT1_0052_G11.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
CLNT1_0027_F08.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
SPL01_0051_B01.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
KDN01_0066_F08.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
ITT01_0068_H06.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
ILNT1_0054_E09.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
OVRM1_0122_F01.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
OVRT1_0142_H09.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
KDN01_0071_G08.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
PST01_0065_H06.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
KDN01_0083_B12.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
PST01_0087_G11.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
SPL01_0033_B03.b : CCATGGGGGATTGGATTCAAATGGAAAGCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
THY01_0001_F11.b : CCATGGGGGATTGGATTCAAATGGAAATCCAGCAGATGCAGTCTATGGACAAAAAGAAAT
20110601C-002318 : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
---------+---------+---------+---------+---------+---------+ 382
MLN01_0028_C11.b : CCATAGGAAAGTGATGGCTCAGAGCTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
THY01_0056_D05.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
ITT01_0017_H04.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
PST01_0073_B09.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
THY01_0002_A08.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
THY01_0206_D12.b : CCGTAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
ITT01_0030_A08.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
CBLT1_0072_G10.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
OVRM1_0048_F11.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
OVRM1_0039_A10.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
OVRM1_0080_H09.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
THY01_0041_E05.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
THY01_0069_G12.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
CLNT1_0116_B08.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
PTG01_0079_F04.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
BFLT1_0055_D04.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
OVR01_0089_B10.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
OVR01_0047_C11.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
OVR01_0019_G06.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
CLNT1_0035_C11.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGTCACACCAAGATCCGCCATGTCGA
LVR01_0054_B08.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
BFLT1_0029_D04.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
ITT01_0023_A07.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
BMWN1_0054_C04.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
BFLT1_0110_E11.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
BFLT1_0052_G11.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTTGA
CLNT1_0027_F08.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGTCACACCAAGATCCGCCATGTCGA
SPL01_0051_B01.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
KDN01_0066_F08.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
ITT01_0068_H06.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
ILNT1_0054_E09.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
OVRM1_0122_F01.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
OVRT1_0142_H09.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
KDN01_0071_G08.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
PST01_0065_H06.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
KDN01_0083_B12.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
PST01_0087_G11.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
SPL01_0033_B03.b : CCATAGGAAAGTGATGGCTCAGAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
THY01_0001_F11.b : CCATAGGAAAGTGATGGCTCACAACTTCACCAACTGCCACACCAAGATCCGCCATGTCGA
20110601C-002318 : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
---------+---------+---------+---------+---------+---------+ 442
MLN01_0028_C11.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
THY01_0056_D05.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
ITT01_0017_H04.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
PST01_0073_B09.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
THY01_0002_A08.b : CGCTCACGCCACCCTGAATGACGGCGTGGCGGTCCAGGTGATGGGCTTGCTCTCGAACAA
THY01_0206_D12.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
ITT01_0030_A08.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
CBLT1_0072_G10.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
OVRM1_0048_F11.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
OVRM1_0039_A10.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
OVRM1_0080_H09.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
THY01_0041_E05.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
THY01_0069_G12.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
CLNT1_0116_B08.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
PTG01_0079_F04.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
BFLT1_0055_D04.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
OVR01_0089_B10.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
OVR01_0047_C11.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
OVR01_0019_G06.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
CLNT1_0035_C11.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
LVR01_0054_B08.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
BFLT1_0029_D04.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
ITT01_0023_A07.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
BMWN1_0054_C04.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
BFLT1_0110_E11.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
BFLT1_0052_G11.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
CLNT1_0027_F08.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
SPL01_0051_B01.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
KDN01_0066_F08.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
ITT01_0068_H06.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
ILNT1_0054_E09.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
OVRM1_0122_F01.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
OVRT1_0142_H09.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
KDN01_0071_G08.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
PST01_0065_H06.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
KDN01_0083_B12.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
PST01_0087_G11.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
SPL01_0033_B03.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
THY01_0001_F11.b : CGCTCACGCCACCCTGAATGACGGCGTGGTGGTCCAGGTGATGGGCTTGCTCTCGAACAA
20110601C-002318 : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
---------+---------+---------+---------+---------+---------+ 502
MLN01_0028_C11.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
THY01_0056_D05.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
ITT01_0017_H04.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
PST01_0073_B09.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
THY01_0002_A08.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
THY01_0206_D12.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
ITT01_0030_A08.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
CBLT1_0072_G10.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
OVRM1_0048_F11.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
OVRM1_0039_A10.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
OVRM1_0080_H09.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
THY01_0041_E05.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
THY01_0069_G12.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
CLNT1_0116_B08.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
PTG01_0079_F04.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
BFLT1_0055_D04.b : CAGCCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
OVR01_0089_B10.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
OVR01_0047_C11.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
OVR01_0019_G06.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
CLNT1_0035_C11.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
LVR01_0054_B08.b : CAACCAGGCTTTGAGGAGATCCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
BFLT1_0029_D04.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
ITT01_0023_A07.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
BMWN1_0054_C04.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
BFLT1_0110_E11.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
BFLT1_0052_G11.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
CLNT1_0027_F08.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
SPL01_0051_B01.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
KDN01_0066_F08.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
ITT01_0068_H06.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
ILNT1_0054_E09.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
OVRM1_0122_F01.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
OVRT1_0142_H09.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
KDN01_0071_G08.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
PST01_0065_H06.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
KDN01_0083_B12.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
PST01_0087_G11.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
SPL01_0033_B03.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
THY01_0001_F11.b : CAACCAGGCTTTGAGGAGATTCATGCAGACTTTTGTCCTTGCTCCTGAGGGCTCTGTTGC
20110601C-002318 : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
---------+---------+---------+---------+---------+---------+ 562
MLN01_0028_C11.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
THY01_0056_D05.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
ITT01_0017_H04.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
PST01_0073_B09.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
THY01_0002_A08.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
THY01_0206_D12.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
ITT01_0030_A08.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
CBLT1_0072_G10.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
OVRM1_0048_F11.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
OVRM1_0039_A10.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAAGTCTTTGGTGGCTT
OVRM1_0080_H09.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
THY01_0041_E05.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
THY01_0069_G12.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
CLNT1_0116_B08.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
PTG01_0079_F04.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
BFLT1_0055_D04.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
OVR01_0089_B10.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
OVR01_0047_C11.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
OVR01_0019_G06.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
CLNT1_0035_C11.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
LVR01_0054_B08.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
BFLT1_0029_D04.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
ITT01_0023_A07.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
BMWN1_0054_C04.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
BFLT1_0110_E11.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
BFLT1_0052_G11.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
CLNT1_0027_F08.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
SPL01_0051_B01.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
KDN01_0066_F08.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
ITT01_0068_H06.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
ILNT1_0054_E09.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
OVRM1_0122_F01.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
OVRT1_0142_H09.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
KDN01_0071_G08.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
PST01_0065_H06.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
KDN01_0083_B12.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
PST01_0087_G11.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
SPL01_0033_B03.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
THY01_0001_F11.b : AAATAAATTCTATGTTCACAATGATATCTTCAGATACCAAGATGAGGTCTTTGGTGGCTT
20110601C-002318 : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
---------+---------+---------+---------+---------+---------+ 620
MLN01_0028_C11.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
THY01_0056_D05.b : TGTCACAGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
ITT01_0017_H04.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
PST01_0073_B09.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
THY01_0002_A08.b : TGTCACGGAGCCTCAGGAGGAATCTGAAAGAAGAAGTAGAGGAACCTTGAAGAAAAACAG
THY01_0206_D12.b : TGTCACGGGGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
ITT01_0030_A08.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
CBLT1_0072_G10.b : TGTCACAGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
OVRM1_0048_F11.b : TGTCACGGAGCCTCANGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
OVRM1_0039_A10.b : TGTCACGGAGCCTCANGAGGAATCTGAA*GAAGAAGTATAGGAACC*TGAAGAAAGACAG
OVRM1_0080_H09.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
THY01_0041_E05.b : TGTCACGGAGCCTCACGAGGAATCTGAA*GAAGAAATAGAGGAACC*TGAAGAAAGACAG
THY01_0069_G12.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
CLNT1_0116_B08.b : TGTCACAGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
PTG01_0079_F04.b : TGTCACAGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
BFLT1_0055_D04.b : TGTCACAGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
OVR01_0089_B10.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
OVR01_0047_C11.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
OVR01_0019_G06.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
CLNT1_0035_C11.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
LVR01_0054_B08.b : TGTCACAGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
BFLT1_0029_D04.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
ITT01_0023_A07.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
BMWN1_0054_C04.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
BFLT1_0110_E11.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
BFLT1_0052_G11.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
CLNT1_0027_F08.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
SPL01_0051_B01.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
KDN01_0066_F08.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
ITT01_0068_H06.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
ILNT1_0054_E09.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
OVRM1_0122_F01.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
OVRT1_0142_H09.b : TGTCACAGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
KDN01_0071_G08.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
PST01_0065_H06.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
KDN01_0083_B12.b : TGTCACAGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
PST01_0087_G11.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
SPL01_0033_B03.b : TGTCACGGAGCCTCAGGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
THY01_0001_F11.b : TGTCACAGAGTCTCACGAGGAATCTGAA*GAAGAAGTAGAGGAACC*TGAAGAAAGACAG
20110601C-002318 : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
---------+---------+---------+---------+---------+---------+ 680
MLN01_0028_C11.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
THY01_0056_D05.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
ITT01_0017_H04.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
PST01_0073_B09.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
THY01_0002_A08.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACCTTCTATGATCAAACTGCCAGCAAT
THY01_0206_D12.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
ITT01_0030_A08.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
CBLT1_0072_G10.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
OVRM1_0048_F11.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCCAT
OVRM1_0039_A10.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATNCAACTGTCAGCAAT
OVRM1_0080_H09.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
THY01_0041_E05.b : CAGACACCTGAGGTGGTGCCTGATGATTTCTGGACTTTCTATGATCCAACTGTCAGCAAT
THY01_0069_G12.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
CLNT1_0116_B08.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
PTG01_0079_F04.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
BFLT1_0055_D04.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
OVR01_0089_B10.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
OVR01_0047_C11.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
OVR01_0019_G06.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
CLNT1_0035_C11.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGGTCAAACTGTCAGCAAT
LVR01_0054_B08.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
BFLT1_0029_D04.b : CAGACACCTGAGGGGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
ITT01_0023_A07.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
BMWN1_0054_C04.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
BFLT1_0110_E11.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
BFLT1_0052_G11.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
CLNT1_0027_F08.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGGTCAAACTGTCAGCAAT
SPL01_0051_B01.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
KDN01_0066_F08.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
ITT01_0068_H06.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
ILNT1_0054_E09.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
OVRM1_0122_F01.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
OVRT1_0142_H09.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
KDN01_0071_G08.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
PST01_0065_H06.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
KDN01_0083_B12.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
PST01_0087_G11.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
SPL01_0033_B03.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTCAGCAAT
THY01_0001_F11.b : CAGACACCTGAGGTGGTGCCTGATGATTCTGGAACTTTCTATGATCAAACTGTTAGCAAT
20110601C-002318 : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
---------+---------+---------+---------+---------+---------+ 738
MLN01_0028_C11.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
THY01_0056_D05.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
ITT01_0017_H04.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
PST01_0073_B09.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
THY01_0002_A08.b : GACTTATAAGAGCATTTATAA*GAACCTGTTGCTTGAACAAGAGCTTGACCCTGAACCAG
THY01_0206_D12.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
ITT01_0030_A08.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
CBLT1_0072_G10.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
OVRM1_0048_F11.b : GACTTAAAAGAGCTTTTAAAA*AAACCTGTTGCT*GAACCAGAGCCTGATCCTGAAacaa
OVRM1_0039_A10.b : GACTTANAAGAGCATTTAGAA*AAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
OVRM1_0080_H09.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
THY01_0041_E05.b : GACTTAAAAAAGCATTTAAAAAGAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACC*G
THY01_0069_G12.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
CLNT1_0116_B08.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
PTG01_0079_F04.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
BFLT1_0055_D04.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
OVR01_0089_B10.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAAACCGAGCCTGATCCTGAACCAG
OVR01_0047_C11.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
OVR01_0019_G06.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
CLNT1_0035_C11.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
LVR01_0054_B08.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
BFLT1_0029_D04.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
ITT01_0023_A07.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
BMWN1_0054_C04.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAANCAG
BFLT1_0110_E11.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
BFLT1_0052_G11.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
CLNT1_0027_F08.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
SPL01_0051_B01.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
KDN01_0066_F08.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
ITT01_0068_H06.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
ILNT1_0054_E09.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
OVRM1_0122_F01.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCA*
OVRT1_0142_H09.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
KDN01_0071_G08.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
PST01_0065_H06.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
KDN01_0083_B12.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
PST01_0087_G11.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
SPL01_0033_B03.b : GACTTAGAGGAGCATTTAGAA*GAACCTGTTGCT*GAACCAGAGCCTGATCCTGAACCAG
THY01_0001_F11.b : GACTTAGAAGAGCATTTAGAA*GAACCTGTTGCT*GAAACAGAGCCTGATCCTGAACCAG
20110601C-002318 : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
---------+---------+---------+---------+---------+---------+ 797
MLN01_0028_C11.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
THY01_0056_D05.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
ITT01_0017_H04.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
PST01_0073_B09.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
THY01_0002_A08.b : AACCCGAGCATTAACCTGTATCTGAAGTTCAGGAAGGAAAAGCCTGAGCCAGCATTGGAA
THY01_0206_D12.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
ITT01_0030_A08.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
CBLT1_0072_G10.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
OVRM1_0048_F11.b : aacanagcaagaacccgtatccgaattccggaagaaaatctgaacctttaatggaaaacc
OVRM1_0039_A10.b : AAACACAGCAAGAACCTGTATCTGAAGTCCAGGAAGGAAAA*TCCGAGCCAGTATTGcaa
OVRM1_0080_H09.b : AACCAGAGCAAGTACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
THY01_0041_E05.b : AACCAGAACAAAAAACTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAacccatatttgga
THY01_0069_G12.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
CLNT1_0116_B08.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
PTG01_0079_F04.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
BFLT1_0055_D04.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
OVR01_0089_B10.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
OVR01_0047_C11.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
OVR01_0019_G06.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
CLNT1_0035_C11.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
LVR01_0054_B08.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
BFLT1_0029_D04.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
ITT01_0023_A07.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
BMWN1_0054_C04.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*G*AAAAGTCTGAGCCAGTATTGGAA
BFLT1_0110_E11.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
BFLT1_0052_G11.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
CLNT1_0027_F08.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
SPL01_0051_B01.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAATCTGAGCCAGTATTGGAA
KDN01_0066_F08.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
ITT01_0068_H06.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
ILNT1_0054_E09.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
OVRM1_0122_F01.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGG
OVRT1_0142_H09.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
KDN01_0071_G08.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
PST01_0065_H06.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
KDN01_0083_B12.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
PST01_0087_G11.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
SPL01_0033_B03.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
THY01_0001_F11.b : AACCAGAGCAAGAACCTGTATCTGAAGTCCAGGA*GGAAAAGTCTGAGCCAGTATTGGAA
20110601C-002318 : GAAGCTGCTCCTGAGGATGTTCAGAAGAGTTC*TTCTCCAGCGCCTGCAGACATAGC*AC
---------+---------+---------+---------+---------+---------+ 855
MLN01_0028_C11.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAGTTC*TTCTCCAGCGCCTGCAGACATAGC*AC
THY01_0056_D05.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAGTTC*TTCTCCAGCGCCTGCAGACATAGC*AC
ITT01_0017_H04.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAGTTC*TTCTCCAGCGCCTGCAGACATAGC*AC
PST01_0073_B09.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAGTTC*TTCTCCAACGCCTGCAGACATAGC*AC
THY01_0002_A08.b : AAAACTGTTCCTGAGGATGTTCAAAATAGTTC*TTCTCCAGCGCCTGCcgaattatccca
THY01_0206_D12.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAGTTC*TTCTCCAGCGCCTGCAGACATAGC*AC
ITT01_0030_A08.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAGTTC*TTCTCCAGCGCCTGCAGACATAGC*AC
CBLT1_0072_G10.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAGTTC*TTCTCCAGCGCCTGCAGACATAGC*AC
OVRM1_0048_F11.b : tgctcctgaagatatgcaaata
OVRM1_0039_A10.b : aaactgctcctgcagatgtca
OVRM1_0080_H09.b : GAgctgctccctgaggatgtcagaagagttctct
THY01_0041_E05.b : aaaagctgctcctgaggttgtttcaaaaaaattctttccccaccccctgccaaacttaaa
THY01_0069_G12.b : GAAGCTGCTC
CLNT1_0116_B08.b : GAAGCTGCTCCTGANGATGTTCAGAAGAGT*C*TTCTCCAGCGCCTGCAGACATAGC*AC
PTG01_0079_F04.b : GAAGCTGCTCCTGAGGATGTTCAAAAGAATTC*TTCTCCAGCGCCTGCAGACATAGC*AC
BFLT1_0055_D04.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAAGTC*TTCTCCAGCGCCTGCAGACATAGC*AC
OVR01_0089_B10.b : AAAGCTGCTCCTGAAGATGTTCAGAAGAATTC*CTCTCCCGCGCCTGCAGACTTACC*AC
OVR01_0047_C11.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAGTTC*TTCTCCAGCGCCTGCAGACATAGC*AC
OVR01_0019_G06.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAGTTC*TTCTCCAGCGCCTGCAGACATAGC*AC
CLNT1_0035_C11.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAAGTC*TTCTCCAGCGCCTGCAGACATAGC*AC
LVR01_0054_B08.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAGTTC*TTCTCCAGCGCCTGCAGACATAGC*AC
BFLT1_0029_D04.b : GAAGCTGCTCCTGAGGATGTTCAAAAGAGT*C*TTCTCCAGCGCCTGCAGACATAGC*AC
ITT01_0023_A07.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAGTTC*TTCTCCAGCGCCTGCAGACATAGC*AC
BMWN1_0054_C04.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAATTT*TCTCTCAGCGCCTGCAGACATAGC*AC
BFLT1_0110_E11.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAGTTC*TTCTCCAGCGCCTGCAGACATAGC*AC
BFLT1_0052_G11.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAGT*C*TTCTCCAGCGCCTGCAGACATAGC*AC
CLNT1_0027_F08.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAGTTC*TTCTCCAGCGCCTGCAGACATAGC*AC
SPL01_0051_B01.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAGTTC*TTCTCCAGCGCCTGCAGACTTAGC*AC
KDN01_0066_F08.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAGTTC*TTCTCCAGCGCCTGCAGACATAGC*AC
ITT01_0068_H06.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAGTTC*TTCTCCAGCGCCTGCAGACATAGC*AC
ILNT1_0054_E09.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAGTTC*TTCTCCAGCGCCTGCAGACATAGC*AC
OVRM1_0122_F01.b :
OVRT1_0142_H09.b : GAAGCTGCCTCTGAAGATGTTCAGAAGAGTTCNTCCTCCAGCGCCTGCAGACATAGC*AC
KDN01_0071_G08.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAGTTC*TTCTCCAGCGCCTGCAGACATAGC*AC
PST01_0065_H06.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAGTTC*TTCTCCAGCGCCTGCAGACATAGC*AC
KDN01_0083_B12.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAGTTC*TTCTCCAGCGCCTGCAGACATAGC*AC
PST01_0087_G11.b : GAAGCTGCTCCTGAGGATGTTCAGAAGAGTTC*TTCTCCAGCGCCTGCAGACATAGC*AC
SPL01_0033_B03.b : GAAGCTGCTCCTGAAGATGTTCAGAAGAGTTC*TTCTCCAGCGCCTGCAGACATAGC*AC
THY01_0001_F11.b : GAAGCTGCTCCTGACGATGTTCACAAGAGTTC*TTCTCCAGCTGCTGCCGACCTAGCTAC
20110601C-002318 : AGACAGTAC*AGGAGGATTTGA*GAACCTTTTCCTGGGCGTCTGTGACCAGTAAGAA*CC
---------+---------+---------+---------+---------+---------+ 912
MLN01_0028_C11.b : AGACAGTAC*AGGAGGATTTGA*GAACCTTTTCCCTGGCGTCTGTGACCAGTAAGA**CC
THY01_0056_D05.b : AGACAGTAC*AGGAGGATTTGA*GAACCTTTTCCTGGGCGTCTGTGACCAGTAAGAA*CC
ITT01_0017_H04.b : AGACAGTAC*AGGAGGATTTGA*GAACCTTTTCCTGGGCGTCTGTGACCAGTAAGAA*AC
PST01_0073_B09.b : AGACCATAC*AGGAGGATTTGA*GAACCTTTTCCTGGGCGTCTGTGACCAGTAAAAA*CC
THY01_0002_A08.b : gaacgtattggcggatttgggacctttttcttgggcgcctgtgaccgtatgaactttccc
THY01_0206_D12.b : AGACAGTAC*AGGAGGATTTGA*GAACCTTTTCCTGGGCGTCTGTGACCAGTAAGAA**C
ITT01_0030_A08.b : AGACAGTAC*AGGAGGATTTGA*GAACCTTTTTCTGGGCGTCTGTGACCAGTAAGAA**C
CBLT1_0072_G10.b : AGACAGTAC*AGGAGGATTTGA*GAACCTTTTCCTGGGCGTCTGTGACCAGTAAGAA*CT
OVRM1_0048_F11.b :
OVRM1_0039_A10.b :
OVRM1_0080_H09.b :
THY01_0041_E05.b : ccagaaacgtacaaggaggattttaaaaacctttttcccgggcgttcgttaaccccaaaa
THY01_0069_G12.b :
CLNT1_0116_B08.b : AGACAGTAC*AGGAAGATTTGA*GAACCTTTTC*TGGGCGTCTGTGACCAGTAAAAA*CT
PTG01_0079_F04.b : AGACAGTAC*AGGAAGATTTGA*GAACTTTTTCCTGGGCGTCTGGTGACAGTTAGAA*CC
BFLT1_0055_D04.b : AGACAGTAC*AGGAGGATTTGA*GAACCTTTTTCTGGGCGTCTGTGACCAGTAAGAA*CC
OVR01_0089_B10.b : A*ACCGTAC*AGGAGGATTTGA*GAACCTTTTCCTGGGCCGTTGTGACCCATAAGAA*CC
OVR01_0047_C11.b : AGACAGTAC*AGGAGGATTTGA*GAACCTTTTCCTGGGCGTCTGTGACCAGTAAGAA*CC
OVR01_0019_G06.b : AGACAGTAC*AGGAGGATTTGA*GAACCTTTTCCTGGGCGTCTGTGACCAGTAAGAACCC
CLNT1_0035_C11.b : AGACAGTAC*AGGAGGATTTGAAGAACTTTTNCTTGGGCGTCTGTGACCAGTAGGAA*CC
LVR01_0054_B08.b : AGACAGTAC*AGGAGGATTTGA*GAACCTTTTCCTGGGCGTCTGTGACCAGTAAGAA*CC
BFLT1_0029_D04.b : AGACAGTAC*AGGAGGATTTTG*AGACCTTTTCCTGGGCGTCTGTGACCAGTAAGAA*CT
ITT01_0023_A07.b : AGACAGTAC*AGGAGGATTTGA*GAACCTTTTCCTGGGCGTCTGTGACCAGTAAGAA**C
BMWN1_0054_C04.b : AGACAGTAC*AGGAGGATTTGA*GAACCTTTTCCTGGGCGTCTGTGACCAGTAAGAA*CT
BFLT1_0110_E11.b : AGACAGTAC*AGGAGGATTTGA*GAACCTTTTTCTGGGCGTCTGTGACCATTAAGAA**C
BFLT1_0052_G11.b : AGACAGTAC*AGGANGATTTGA*GAACCTTTTTCTGGGCGTCTGTGAACAGTAAGAA**C
CLNT1_0027_F08.b : AGACAGTAC*AGGAGGATTTGA*GAACTTTTTCCTTGGCGTCTGTGACCCATAAGAA*C*
SPL01_0051_B01.b : AGACAGTAC*AGGAGGATTTGA*GAACCTTTTCCTGGGCGTCTGGGACCAGTAAGAA*CC
KDN01_0066_F08.b : AGACAGTAC*AGGAGGATTTGA*GAACCTTTTCCTGGGCGTCTGTGACCAGTAAGAA*CC
ITT01_0068_H06.b : AGACAGTAC*AGGAGGATTTGA*GAACCTTTTCCTGGGCGTCTGTGACCAGTAAGAACCT
ILNT1_0054_E09.b : AGACAGTAC*AGGAGGATTTGA*GAACCTTTTCCTGGGCGTCTGTGACCAGTAAGAA*CC
OVRM1_0122_F01.b :
OVRT1_0142_H09.b : AGACGGTAC*AGGAGGATTTGA*GAACCTTTTTCGTGGCGTCTGTGACCgtaagaaccct
KDN01_0071_G08.b : AGACAGTAC*AGGAGGATTTGA*GAACCTTTTCCTGGGCGTCTGTGACCAGTAAGAA*CC
PST01_0065_H06.b : AGACAGTAC*AGGAGGATTTGA*GAACCTTTTCCTGGGCGTCTGTGACCAGTAAGAA*CC
KDN01_0083_B12.b : AGACAGTAC*AGGAGGATTTGA*GAGCCTTTTCCTGGGCGTCTGTGACCAGTAAGAA*CC
PST01_0087_G11.b : AGACAGTAC*AGGAGGATTTGA*GAACCTTTTCCTGGGCGTCTGTGACCAGTAAGAA*CC
SPL01_0033_B03.b : AGACAGTAC*AGGAGGATTTGA*GAACCTTTTCCTGGGCGTCTGTGACCAGTAAGAACCT
THY01_0001_F11.b : AGAAGGTACCACGAGGATCTGA*GAACCTTTTCCTGCGCGTCTGTGACCAGCAAGAA*CC
20110601C-002318 : TTCCTCCCAGTGGAGCTGTTCCGGTT*ACCGGGATACCACCTCATGTT*GTTAAAGTGCC
---------+---------+---------+---------+---------+---------+ 970
MLN01_0028_C11.b : CTCCTCCCAGTGGAGCTGTTCCGTTT*ACGGGGATA*Cacctcatgctgtttaagtgcca
THY01_0056_D05.b : TTCCTCCCAGTGGAGCTGTTCCGGTT*ACTGGGATA*CACCTCATGTT*GTTAAAGTGCC
ITT01_0017_H04.b : TTTCCTCCAGTGGAGCTGTTCCGGTT*ACCGGGATACCACCTCATGTT*GTTAAgtgcca
PST01_0073_B09.b : TTCCTCCCAGTGGAGCTGTTCCGGTTTACCGGGATACCACCTCATGGT*GTTTAAAGTGC
THY01_0002_A08.b : tcccatggaattgttctcggtaccgggataccccctatgttgcaaagggcn
THY01_0206_D12.b : CTTCTCCCAGTGGAGCTGTTCCGGGT*ACCGGGATACCACCTCATGTTTGTTAAAGTGGC
ITT01_0030_A08.b : CTCCCTCCAGTGGAGCTGTTCCGGT**ACCGGGATACCACCTCATGTT*GTTAAAGTNGC
CBLT1_0072_G10.b : TTCCT*CCAGTGGAGCTGTTCGGGTTTAC*GGGATACCAC*TCATGTT*GTTAAAGTGCC
OVRM1_0048_F11.b :
OVRM1_0039_A10.b :
OVRM1_0080_H09.b :
THY01_0041_E05.b : aaaaccctttccccccccggggagcttgtttccggttaaccgggaatcccccctcttttt
THY01_0069_G12.b :
CLNT1_0116_B08.b : TTCTT*CCAGTGGAGCTGTTCggttaccgggaaacacctcatgttgttaagtgccagctt
PTG01_0079_F04.b : TTTCTCCCAGTGGAGCTGTCCCGGTT*CCCGGGATACCACtcatgttgtaaaatggcnac
BFLT1_0055_D04.b : TTCCT*CCAGTGGAGCTGTTCCGGTT*ACGGGGATACCACtcatgttgttaaagtgcagc
OVR01_0089_B10.b : TCCCTCCCAGTGGAGCTGTTCCGGTTT*CCGGGATACCACCTCtggtttttaaaggggcc
OVR01_0047_C11.b : CTCCCTCCCGTGGAGCTGGTCCGGTT*ACCGGGATACCACCTCATGgttgtttaagtggc
OVR01_0019_G06.b : TTCCTCCCCGTGGAGCTGTTCCGGTTACCGGGGATACCACCTCATGTT*GTTAAAGTGCC
CLNT1_0035_C11.b : TTCCTCCCAGTGGAGCTGTTCCCGTT*ACCGGGATACCACCTCATGTT*GNTAAAGTGCC
LVR01_0054_B08.b : TTCCTCCC*GTGGAGCTGTTTCCGTT*ACCGGGATACCACCTCATGTT*GTTAAAGTGCC
BFLT1_0029_D04.b : TTCCTCCCAGTGGAGCTGTTCCNGTT*ACCGGGATACCACCTCATGTT*GGTTAAAATGC
ITT01_0023_A07.b : CTCCCTCCAGTGGAGCTGTTCCGGTT*ACCGGGATACCACCTCATGNT*TGTAAAGTG*C
BMWN1_0054_C04.b : TTCCTCCCAGTGGAGCTGGCCCGGTT**ACGGGGATACACCTCATGTT*GGTAAGGTGGC
BFLT1_0110_E11.b : TTTCCTCCAGTGGAGCTGTTCGGGTTTAC*GGGATACCACCTCATGTT*GTTAAAGTTGC
BFLT1_0052_G11.b : CTTCTCCCAGTGGAGCTGTTCCGGTTTCCCGGATTAC*ACCTCATGGT*GTTAAAAGTGC
CLNT1_0027_F08.b : TTTCTCCCAGTGGAGCTGTTCGG**TTACCGGAATACCACTTCATGTT*GTTAAAtgtca
SPL01_0051_B01.b : TTCCTCCCAtgggagcttgttcgggttccgggaatacccctcatgtttgttaaagtgcca
KDN01_0066_F08.b : TTCCTCCCAGTGGAGCTGTTCCGGTT*ACCGGGATACCACCTCATGTT*GTTAAAGTGCC
ITT01_0068_H06.b : TTCCT*CCAGTGGAGCTGTTCCGGTT*ACCGGGATACCACCTCATGTT*GTTTTAAGCGC
ILNT1_0054_E09.b : TTCCTCCCATTGGAGCTGTTCCGGTT*AACGGGATACCACCTCATGTT*GTTAA*GTGGC
OVRM1_0122_F01.b :
OVRT1_0142_H09.b : tcctcccagggagctgtcccggtaacgggataccactctctgttgtaaggtgccgcttcc
KDN01_0071_G08.b : TTCCNTCCAGTGGAGCTGTTCCGGTT*ACCGGGATACCACCTCATGTT*GTTTAAGTGCC
PST01_0065_H06.b : TTCCTCCCAGTGGAGCTGTTCCGGTT*ACCGGGATACCACCTCATGTT*GTTAAAGTGCC
KDN01_0083_B12.b : TTCCTCCCAGTGGAGCTGTTCCGGTT*ACCGGGATACCACCTCATGTT*GTTAAAGTGCC
PST01_0087_G11.b : TTCCTCCCAGTGGAGCTGTTCCGGTT*ACCNGGATACCACCTCATGTT*GTTTAAAGTGC
SPL01_0033_B03.b : TCCCTCCCAGTGGAGCTGTTCCCGGTTACGGGAATACCACCTCATGTT*GTTAAAGTTGC
THY01_0001_F11.b : TTCCTCCCACCGGACTTGTTCCGGGTAACGGGATACCcccctctgttgttaaacgccctc
20110601C-002318 : AGCTTCACAGCCTCGTCCAGAGA*CTAAACCTGAATCTCAGATTCCACCGCAGAGGCCTC
---------+---------+---------+---------+---------+---------+ 1029
MLN01_0028_C11.b : gcttcccacctcgtccagagactaacctgaatctcagatcaccgcaaaggcctcaaggat
THY01_0056_D05.b : AGCTTTCCACCCTCGTCCAAAGA*CTAAACCTGAATCTCAAATTCCACCGCcaaagccct
ITT01_0017_H04.b : gcttcacagctccgtcagagactaacctgaatctcaaattcaccggcagaagctccnaag
PST01_0073_B09.b : AGCTTCACAGCCTCGTCCAGAGA*CTAAACCTGAATCTCAAATTCCACCGCAAAAGCCTC
THY01_0002_A08.b :
THY01_0206_D12.b : AGCTTCACAGCCTCcgtccagagactaaaacctgaatctcagattccaccgccaaaggct
ITT01_0030_A08.b : AGCTTCACAGCCTCGTCCAGAGA*CTAAA*CTGAATCTCAGATTCCACgcaaaagcctca
CBLT1_0072_G10.b : AGCTTCACACCCTCGTCCAGAGA*CTAAACCTGAATCTCAGATTCCACCGCAGAGGCCTC
OVRM1_0048_F11.b :
OVRM1_0039_A10.b :
OVRM1_0080_H09.b :
THY01_0041_E05.b : gttataaagggccccctttcccccccctcctctccaaaataaaaacttcgattttttcaa
THY01_0069_G12.b :
CLNT1_0116_B08.b : cacagcctctccaaaaataaacctggatctcaaatcccccgcaaaggccctcaagggata
PTG01_0079_F04.b : ttcacaccctctccaaaaactaacctggattctcaattccacccaaagcctcaaaggaat
BFLT1_0055_D04.b : ttcaagcctcgtcaggagataaacctgatctcgaattcacgcaaaagcctcaaaggatca
OVR01_0089_B10.b : acttttacagcctcctccagaaactaaacctgaatctccaaatccccccccaaaaggcct
OVR01_0047_C11.b : caccttccccgccctcgtccagagactaaaccttgaatttcaaattcccccgcaaaaggc
OVR01_0019_G06.b : AGCctccacagcctcgttcagaggcttaaacctgaaatctcagaattccaccgcagaggc
CLNT1_0035_C11.b : AGCTTCACAGCCTCGTtccaaaaactaaacctgaatcttangattccacgccagaagccc
LVR01_0054_B08.b : AGCTTCACAGCCctcgtccaaaaactaaaacctgaattctcaaattccccccgcaaaaag
BFLT1_0029_D04.b : AGCTTCACAGCCTCGTCCAGAGA*CTAAACCTGAATCTCAGATTCacccgcaaagcccca
ITT01_0023_A07.b : AGCTTCACAGCCTCGTCCAGAGA*CTA*ACCTGAATCTCAGATTC*ACCGCAGAAGCCTC
BMWN1_0054_C04.b : AGCTTCACAGCCTCGTTCAGAAG*ATAAACCTGAATCTTCGAATTCACCGCAGAGGCCTC
BFLT1_0110_E11.b : AGCTTCAAAGCCTCGTTCAGAAAACTAAACCTGAATCTCAAATTCCACCGCAAAGGCCTC
BFLT1_0052_G11.b : AGCTTCAAAGCCTCGTCCAGAAA*CTA*ACCTGAATCTCAGAATCCACCGCAAAGGCCTC
CLNT1_0027_F08.b : gcttcaagcctcgtccaaaactaaccctgatctccaatccacccccaaggctcaaaggaa
SPL01_0051_B01.b : gctttccagccttgttccgaggaaaaaacctgaaatcttaaaattccccccccaaagggc
KDN01_0066_F08.b : AGCTTCACAGCCTCGTCCAGAGA*CTAAACCTGAATCTCAGATTC*ACCGCAGAAGCCTC
ITT01_0068_H06.b : AGCTTCACAGCCTCGTCCAGAGA*CTAAACCTGA*TCTCAGATTTCACCGCAAAGGCCTC
ILNT1_0054_E09.b : AACTTCCCAGCTTCGTCCAAAGA*CTAAACCTGAAATCCAAATTCCCCCGCAAAGGCCTC
OVRM1_0122_F01.b :
OVRT1_0142_H09.b : cgcctcctccaaaactaaacctgaatccaaatcccccgccaaggcctcaaggattcaagg
KDN01_0071_G08.b : AGCTTCACAGCCTTCGTCAGAGA*CTAAACCTGAATCTCAGATTCaccgcagaagcctca
PST01_0065_H06.b : AGCTTCACAGCCTCGGTCAGAGA*CTAAACCTGAATCTCAGATTCCACCGCAGAAGCCTC
KDN01_0083_B12.b : AGCTTCACAGCCTCGTCCAGAGA*CTAAACCTGAATCTCAAAATCCACCGCAGAAGGCTC
PST01_0087_G11.b : AGCTTCACAGCCTCGTCCAGAGA*ACTAACCTGAATCTCAGATTC*ACCGCAGAGGCCTC
SPL01_0033_B03.b : AGCTTTCCAGCCTCGTCCAaaagactaaaccctgaatctcaaaatccccccgcaaaggcc
THY01_0001_F11.b : ttcccagcctcgctccaagactaactccgaaactcaaattcccccgaaaagtctcagagg
20110601C-002318 : AAAGGGATCAAAGGGTTCGGGAACAGCGAATAAATGTTCCTCCCCAAAGGGGTCCTAAAA
---------+---------+---------+---------+---------+---------+ 1089
MLN01_0028_C11.b : caagggttcggaacagcaattaatgttctcccacaagggtctagaccgtccaaaggctgt
THY01_0056_D05.b : caaagggattcaaaggggtcggggaaaagcgaaataaaggttccctcccccaaaggggtt
ITT01_0017_H04.b : gatcaaggggttcgggaacgcgaataatgttcctcccagagggtcctaaacaatccgaaa
PST01_0073_B09.b : AAAGGAATCAAgggttcgggaaacacgaataatgttctcccccaaggggcctaaaaccaa
THY01_0002_A08.b :
THY01_0206_D12.b : tcagaggggatcaaaggggtcgggaaacagccaaataattgttccctcccccaaaggggg
ITT01_0030_A08.b : gaggnatcaaaggtttcgggacagcgaataaatgtcctcccagagggtcctagacagtcc
CBLT1_0072_G10.b : AGAGGGATCAAAGGGGTTCGGGACCAGCGATAAATGTTCCTCCCCAAAGGGtcctaaacc
OVRM1_0048_F11.b :
OVRM1_0039_A10.b :
OVRM1_0080_H09.b :
THY01_0041_E05.b : tctccccccccaaaaagcccccacagagggtataaagggggtttcgggaaaaaaaagaaa
THY01_0069_G12.b :
CLNT1_0116_B08.b : aagggttcgggaacacgaataaatgttccccccaaaggggcccaacacattccaaagctg
PTG01_0079_F04.b : aagggttcgggacaccaaaaattttcctccccaagggtgccaaaccttccaaaggtgggg
BFLT1_0055_D04.b : aagggtcgggaacgcgaataatgttctcccaaagggtctaaaccatccaaaaggtgtgac
OVR01_0089_B10.b : tcaagggatcaaaggctttggggaacacccaatatatgttccctccccacagggggtccc
OVR01_0047_C11.b : ctcagaagggaatcaaaaggggtttcggggaaccagcgaaaaaaaattgtttcctttccc
OVR01_0019_G06.b : ctccaaagggatccaaggggtttcgggaaacggcgaaataaatggttccttccccaaagg
CLNT1_0035_C11.b : tcaaagggatccaaagggttcgggaacaagcgaataaatgtcctccccaaagaggttcta
LVR01_0054_B08.b : cctccaaaagggatcaaaaagttttcggggaa
BFLT1_0029_D04.b : aaaggaatcaagggttcgggacaccgaaataatgttccctcccaaagggtcctaaaccat
ITT01_0023_A07.b : AAAGGGATCAAAGGttcgggacagcgaataatgttcctcccaaaggggtcctagacagtc
BMWN1_0054_C04.b : NAAAGGATCAAAGGttcggggaacgcaaataattgtccttcccagaggggtctaaacant
BFLT1_0110_E11.b : Aaaggatcaaggttccggaacaacaaataatgttctcccaaaggggtccaaaacattcca
BFLT1_0052_G11.b : CAAAGGATCAAAGGGTTCGGGAACA*CGAATAAATGTTCCCCCCCAGAGGGGTCtaaaac
CLNT1_0027_F08.b : caaggggtccggaacaccaaaaatgttccccccaaagggtctaaacatcccaaagctggg
SPL01_0051_B01.b : ccccaaggggatcaaagggggttgg
KDN01_0066_F08.b : AGAGGGATCAAAGGGTTCGGGAACAGCGAtaaatgttcctcccagaagggtctagacagt
ITT01_0068_H06.b : AAAGGGAcaaagggttcggaacagcgaataaatgttcctccccgaagggtcctaaacaat
ILNT1_0054_E09.b : AAAAGGATCAAAGGGTTCGGGAACCGCGAATAAAGGTTCCTCCCaaaggggtcctaaaca
OVRM1_0122_F01.b :
OVRT1_0142_H09.b : gtcgggaaaaccaaaaattttccccccaaggggtccaaaccatccaaaagggggtaaaaa
KDN01_0071_G08.b : aaggatcaaagggttcgggacagcgaataaatgttcctccccgaggggtcctagacaatc
PST01_0065_H06.b : AGAGGGATCAAAGGG*TTCGGAACAGCGAATAATTGTTCCTCCCaaaggggtctagacca
KDN01_0083_B12.b : AGAGGGATCAAAGGNTTCGGGGACAAGCAAATAAATGTTCCTCCCAAAGGGGTCCTAGAA
PST01_0087_G11.b : AGAAGGGATCAAGGGTTCGGGAACAGCGAATAAAGGTTCCTCCCCAAAGGGGTCCTAAAC
SPL01_0033_B03.b : tcccaagggattcaaaggttccggaaaacagcgaataaatgttcctcccccaaaggggtc
THY01_0001_F11.b : catcaaaggttccggaacacccacaaatgttctcccccaaagggtcctataccaccccac
20110601C-002318 : CANTCCGAGAGGCTGGTGAGCAAGGGGATGTTGAGCCTC.....................
---------+---------+---------+---------+---------+---------+ 1128
MLN01_0028_C11.b : gacaagggatgtgagctcaaaatcgtgaaacctgacgccaccactctctggaactgcccg
THY01_0056_D05.b : cctaaaacccatcccaaaaaggctgggggaaacaaaggggggaatgtttaaaccccccca
ITT01_0017_H04.b : gctgttgaacaagggagttaaactccaaaaacgggaaaccctgaagccccgctcttttgg
PST01_0073_B09.b : tccgaaaggcgtgtaaacaaggggattttaaccttcaaaaaccttgagacaccctgacgc
THY01_0002_A08.b :
THY01_0206_D12.b : ttcctaaacccagtcccaaa
ITT01_0030_A08.b : gaaagctggtgaacaggggatgttgacctcnaagatctggagaaacctgacagcaccact
CBLT1_0072_G10.b : antccgagaaggctggtgaacaaggggagttgaacctccaaaaatcttgagacacctgga
OVRM1_0048_F11.b :
OVRM1_0039_A10.b :
OVRM1_0080_H09.b :
THY01_0041_E05.b : aataaaatgtcttcccccccccccaaaagggggctctcaaacaccacccccccgcagaaa
THY01_0069_G12.b :
CLNT1_0116_B08.b : gggaacaaggaattttacccctaaaaattggaaaccctgaaccccccctctttatgggaa
PTG01_0079_F04.b : aaaagggaattttaaccccaaaatcggaaaaccctgaaacccccatctttttggaacctg
BFLT1_0055_D04.b : agggatttaacctccaaatctgaaacctgaagccccactttcttggaaccgtccctgggg
OVR01_0089_B10.b : taaaccatcctcgaaagttttgggtatcaaggggaatgtttaaccctccaaaatatcttt
OVR01_0047_C11.b : ccagaaggggggtcccttaaaaacccacttccccaaaaaaggggctttgggggggaaaca
OVR01_0019_G06.b : gggtcctagaacccagtcccaagaagggttggtggaacaaggggggaatgtttaagcccc
CLNT1_0035_C11.b : aaaccattccaaaagttgggtaaccagggaaatgttaaaccccaaaaatttgggaaaacc
LVR01_0054_B08.b :
BFLT1_0029_D04.b : ccagaaggctggggaccaggggaatttaaccccaaaaatttgggaaccctggagcccaca
ITT01_0023_A07.b : caaaagctggtgaacangggatgttgacctnnaaatcgtgaaaacctgacgccacagtcc
BMWN1_0054_C04.b : cccaaaagctgtaaccaaggggatgttaaccccaaaaattctgaaacccctggacgccac
BFLT1_0110_E11.b : aaagctggtaaccagggaatttaccccaaaaatcgtgaacacctgaagccccaccttttt
BFLT1_0052_G11.b : attccaaaaggttggtaaacaagggaattttaaaccccaaaaaatcgtgggaaccctgga
CLNT1_0027_F08.b : gacaagggaagttaacctcaaaattcggaaaccctgaaccccactttctttggaactgcc
SPL01_0051_B01.b :
KDN01_0066_F08.b : ccgagagctggtgagcaagggatgttgacctcaagatcgtgagaacctgacagccacagc
ITT01_0068_H06.b : ccaagagctgggaacaggggatgtgacctccaagatcctgaaacccctgacagccacact
ILNT1_0054_E09.b : ttccaagagcctgttgaaacagggaaatttaacccccaaaatccgggaaaccccttaagc
OVRM1_0122_F01.b :
OVRT1_0142_H09.b : gggaattttaccccccaaaatgtggaaccccgaaccccccttttttttggaaaccgcccc
KDN01_0071_G08.b : cgaaaggctgtggacaagggatgtgaactcgaaaatcgtgaaaaccctgaagccaccact
PST01_0065_H06.b : gtcgaaaggctggtgagcaggggaagttgagctccaagaacctgaaaaccctggaagcac
KDN01_0083_B12.b : CANTCCGAGAGGCTGGTGAGCAAGGGGATGTTGAcctccnagaatcgtgaaaaacctgac
PST01_0087_G11.b : CANTCCGAGAGGCTGGTGAGCAAAGGGATGTTGAGCCTCnaaaatcntgaaacacctgaa
SPL01_0033_B03.b : ctaaaaccaatccaaaaaggttggtaaacaagggaaattttaaaccctccaaaaaatcct
THY01_0001_F11.b : aagtcgtgaccaagggaagtttaccctccaaaatccccggaaccccggccgcacagtttt
20110601C-002318 : ............................................................
---------+---------+---------+---------+---------+---------+ 1128
MLN01_0028_C11.b : gagggacaataaactaaaatttccaattggaaagggggaacgccttacaggggaaatccc
THY01_0056_D05.b : aaaaaaaaccgcgggaaaaaccccccccctggcaca
ITT01_0017_H04.b : aaaccgcccgtgaggggacatttaaactaaaaatttttcaaattgggaagggggggactc
PST01_0073_B09.b : ccccagctctttcttgcaaccgtgcccctgagggggaacattaaagcttaagattttttt
THY01_0002_A08.b :
THY01_0206_D12.b :
ITT01_0030_A08.b : tctcatggcaactgcccaatgagtggaaaattaaaccttaagattttttcaaaatatggg
CBLT1_0072_G10.b : agccccagctcttcattggcacctgccccatgaggtggaaaatttaagcttaaaaatttt
OVRM1_0048_F11.b :
OVRM1_0039_A10.b :
OVRM1_0080_H09.b :
THY01_0041_E05.b : agggtggtgtggacaaaaagaggggggaagtggttgtctccccccccctcaaaaaataaa
THY01_0069_G12.b :
CLNT1_0116_B08.b : cgccccctggggggaaatttaacctaaaatttttctaaaggggttttattttaaaccaac
PTG01_0079_F04.b : cccggggggaaaataagactaaatttttttaaaattgggaagggggaacggcctaacagg
BFLT1_0055_D04.b : acaattaaactaaaattttccaatttggaatggggggacccctaacggggggaatacaat
OVR01_0089_B10.b : ggaaaccccttgaaagcccccccacct
OVR01_0047_C11.b : aagggggggggaaaatgtttgtgaaagcccc
OVR01_0019_G06.b : ttcaaaaaaaattcgggaaaaaaccccccctgaacaaccccccccccaactttttttttt
CLNT1_0035_C11.b : ctgaaggccccaatttttttttgtgaaaccggcccctgagggggaaaatttaaacttaaa
LVR01_0054_B08.b :
BFLT1_0029_D04.b : cctttcttggaactgccccggggggaaaattaacctcaaaatttttcaatttgggagggg
ITT01_0023_A07.b : tcatggcaccgcccatgagtgacaagtaaactaaaattttttcaattatgggaggggggg
BMWN1_0054_C04.b : cccctttcttggaacctgccccggggggggaaatttaaccttaaaaatttttcaaattgg
BFLT1_0110_E11.b : tgaaacggccccgggggggacaataaacctaaatttttttaaattgggaatggggagcgg
BFLT1_0052_G11.b : aaccccaacctttttttggcaactgcccattagggtgaaaatttaagacttaaaattttt
CLNT1_0027_F08.b : ctgagggaaaaataatttaaatttttcaaattggaagtggggaatggccttaagggggaa
SPL01_0051_B01.b :
KDN01_0066_F08.b : tctcatggcaactgcccatgaggtggaaagtaaagcttaagatttttcaaatatggaaag
ITT01_0068_H06.b : cttcttggcactgcccatgaggggaaaagtaaacttagaatttttcaattagggaagtgg
ILNT1_0054_E09.b : ccccccctctttttggaacccgcgcccaggagggaaaatttaaccttaaaaatttttcaa
OVRM1_0122_F01.b :
OVRT1_0142_H09.b : gggggggaaattaaccttaaatttttttaaatgggggggggggggcgcccacaggggggg
KDN01_0071_G08.b : cttcttggcaactgcccatgaggggacagttaaactaaaattttttcaatatgggagtgg
PST01_0065_H06.b : aactcttcattggacctgcccctgaggggaacattaaagctaagaattttttcaattagg
KDN01_0083_B12.b : agccaccagttctcaatggaaactggcccctgagggggaaaattaaaccttaaatttttt
PST01_0087_G11.b : cagccacagttcttcatggaaactggccatgaagtggacagtaaagctaaagatttttca
SPL01_0033_B03.b : gaaaaacccctgaaacgcccccagtttctttattgggaaaactggcccctggagggggga
THY01_0001_F11.b : tcattggtaccg
20110601C-002318 : ............................................................
---------+---------+---------+---------+---------+---------+ 1128
MLN01_0028_C11.b : atttggtgtttgttaaattaaacttcaag
THY01_0056_D05.b :
ITT01_0017_H04.b : gcttaaaagtggggaaattcccattgggttttgggttgagaatcaaccggttaaaaggct
PST01_0073_B09.b : caaatatatggaatgtgggggaacgcgccattaacgggggggagattacccaatttgggt
THY01_0002_A08.b :
THY01_0206_D12.b :
ITT01_0030_A08.b : gatggggggaacctgccattaaaagggtggaattacccaattgggttgttggtttgagat
CBLT1_0072_G10.b : ttcaaatttggggaagtgtggggacccgcccttaaacggggggagaaatccccaaatttg
OVRM1_0048_F11.b :
OVRM1_0039_A10.b :
OVRM1_0080_H09.b :
THY01_0041_E05.b : aatctttcacgaaaaaaaaccccccccccctcaactcaacaccccccccccacccccccc
THY01_0069_G12.b :
CLNT1_0116_B08.b : cctttaaccgggtggtaaaaaaaaaagagggctccctcgtggggggaaaaataaacaaca
PTG01_0079_F04.b : gggaaaaccccatttgggttgtgggtgaaaatcaaacctaaaagggttaaaagccccctt
BFLT1_0055_D04.b : tggttgtggttaaaatcaaacgcttaagggttaacagcctttttcaaggggcccttatta
OVR01_0089_B10.b :
OVR01_0047_C11.b :
OVR01_0019_G06.b : attttggggggccaaacccctgttgcccccccccccgtgttgaaa
CLNT1_0035_C11.b : aaattttttccaatttgggaaagggtgggagccgcccttaaacgggggggaaatccccac
LVR01_0054_B08.b :
BFLT1_0029_D04.b : ggaccgccataacagggggaaaaccaatttggttgtgtgttgaaaatcaacctttaaagg
ITT01_0023_A07.b : actcccctaaagggggggaatacccaatttggttggtgggtgaaatccaaaccgtcaaag
BMWN1_0054_C04.b : gaaggggggggagcccctcaacaggggggggaaaccacattggggtttttggttagaaat
BFLT1_0110_E11.b : ccataaggggggaattccacattgggtgttgtttaaaacaaaacttataagggtccacac
BFLT1_0052_G11.b : ttcaaattatgggaaggggggggacccgcccttaacaggtggggaaaatacccaatttgg
CLNT1_0027_F08.b : atacaattgggtttgggtgaaaataaccgtcaaaggttacacgcccttttaaagagaccc
SPL01_0051_B01.b :
KDN01_0066_F08.b : gggggactcccataacgtggtgggaattaccattggggttgggggttgaaatccgaccgt
ITT01_0068_H06.b : ggaactgcctaacaggtgggaatcacatttgggttgtgggttaaaattcaaccttccaaa
ILNT1_0054_E09.b : aattggggaaggtggggaacggccctaacaggggggagaaaaccaaatttgggttgtggg
OVRM1_0122_F01.b :
OVRT1_0142_H09.b : aacaacctttggtgtgtgtgttgtattacccgtccgggggcaacccccccccttaagggg
KDN01_0071_G08.b : gggactgccataacggtggggaaattaccaattgggttgttgggtggaaatccgacggtt
PST01_0065_H06.b : ggaagggggggactgccataaagggtgggaaatcccaatttgggttgtggggtttaagat
KDN01_0083_B12.b : caaatttgggaatgggtgaacctgcctttaaagtgggggaattaccaaatttgggttggt
PST01_0087_G11.b : aattatgggagtgggggactgcccttaacgtggtgggaattaccaattggggttgtgggt
SPL01_0033_B03.b : caattttaaagtttaaaaattttttttcaaaattatgggaaaagtggttgggaacctccc
THY01_0001_F11.b :
20110601C-002318 : ............................................................
---------+---------+---------+---------+---------+---------+ 1128
MLN01_0028_C11.b :
THY01_0056_D05.b :
ITT01_0017_H04.b : ttcaaggccctctttaaagggggcccccaaagggaaaaaaaaccc
PST01_0073_B09.b : ttgtggggttgaaaactcaaacgcgttaaaagggctttaacaggcccccattttcaaagg
THY01_0002_A08.b :
THY01_0206_D12.b :
ITT01_0030_A08.b : tcaaccggtaaagggctttacaaggcccccgtttaaagggggccctctaagggaaaaaaa
CBLT1_0072_G10.b : ggtttttggtggtttagaaatccaaacacgtttaagaggggtttaacacaggcccctctt
OVRM1_0048_F11.b :
OVRM1_0039_A10.b :
OVRM1_0080_H09.b :
THY01_0041_E05.b : tacc
THY01_0069_G12.b :
CLNT1_0116_B08.b : caaatggggtcaccctccccccgggataagaaccgcgtttaagtggggagaaacaacgcc
PTG01_0079_F04.b : ttaaggggagccctaaggaaaaaaaaaacctccccggaggaaccaaaaaacccgggaaag
BFLT1_0055_D04.b : aaaaaaacattccgggggacttaaacccgggaaagcctcgggggggggggagcccggggg
OVR01_0089_B10.b :
OVR01_0047_C11.b :
OVR01_0019_G06.b :
CLNT1_0035_C11.b : attggggtttgggggtgaagatttcaaccgttcaaaggg
LVR01_0054_B08.b :
BFLT1_0029_D04.b : gttaacacccccttttaaagagccccctaagggaaaaaaactctccgaaggaacaaaaac
ITT01_0023_A07.b : ggctaacacgcccattttttgggggggccctcaaggtgaaaaaaaacccgccccggggag
BMWN1_0054_C04.b : caaacctttaagaggttaacccgcccctttttttggagggtcttcaatgaaaaaaaaaac
BFLT1_0110_E11.b : cccttttttaagggagccttt
BFLT1_0052_G11.b : ggttgggggtttgagaactaaaccctttcaaagggctt
CLNT1_0027_F08.b : tataggaaaaaaacattccggaggactaaaaccgcggaaagccctcgggtgggggaaacc
SPL01_0051_B01.b :
KDN01_0066_F08.b : tcaagggctaacacaggccttgttcaagtgagtccttaatggaaaaaaaacacatgtccg
ITT01_0068_H06.b : gggttacaccgcctctctttagggaggcccctgatgtgaaaaaaaacaacgtccgaagag
ILNT1_0054_E09.b : tgtagaattcaacacgttcagagggtttcaaaccgccctcttttcaagaggagcctctaa
OVRM1_0122_F01.b :
OVRT1_0142_H09.b : gcccgcaggaaaaaaaaaaccgcggggggaaaaaacccgggggggggcgg
KDN01_0071_G08.b : caagagggtaaacaggccttttttaagggggccccttattgtgaaaaaacacacttccgg
PST01_0065_H06.b : cgaaccgttcaagggcttaacacaggcctctgttcaagggaagcctcttagggggaaaaa
KDN01_0083_B12.b : gggttgaaaatccaaccgttca
PST01_0087_G11.b : tgagatccgaccgtgtaaagggctaacaaaggcccttgtttaaaggaggcctttga
SPL01_0033_B03.b : ctataaacaggggggggaatttaaccaaattttgggtttgtttgtggttttaagaatccg
THY01_0001_F11.b :
20110601C-002318 : ............................................................
---------+---------+---------+---------+---------+---------+ 1128
MLN01_0028_C11.b :
THY01_0056_D05.b :
ITT01_0017_H04.b :
PST01_0073_B09.b : agagccctcttaatgtgaaaaaaaaaccccactcccggg
THY01_0002_A08.b :
THY01_0206_D12.b :
ITT01_0030_A08.b : aaccaactcccggagggaactctaaaacccgggggaagga
CBLT1_0072_G10.b : tttaaagggaaggcccctcaattgtgaaaaaaaaaaaccaaagccccggagggggagcct
OVRM1_0048_F11.b :
OVRM1_0039_A10.b :
OVRM1_0080_H09.b :
THY01_0041_E05.b :
THY01_0069_G12.b :
CLNT1_0116_B08.b : cacggtctggtggtggatatttttccaataatcacccggcgctccggggtataaaaaaaa
PTG01_0079_F04.b : aacccagagggggggggaaaaccccccgggaggtgaaaaattggtgggggcctccgggtg
BFLT1_0055_D04.b : ggaaaatgtgggagtccagatttcccaaacctcggatattgtgt
OVR01_0089_B10.b :
OVR01_0047_C11.b :
OVR01_0019_G06.b :
CLNT1_0035_C11.b :
LVR01_0054_B08.b :
BFLT1_0029_D04.b : ccgggacagacctaggggggggaagaccctcggggtgacaaatag
ITT01_0023_A07.b : acctaaaatacg
BMWN1_0054_C04.b : cccc
BFLT1_0110_E11.b :
BFLT1_0052_G11.b :
CLNT1_0027_F08.b : cctgggggaacaatttggaggctctcctttct
SPL01_0051_B01.b :
KDN01_0066_F08.b : aaggacccaaaaccctcgggactgagcccgagggtggggggtaaagcctctgggaggggc
ITT01_0068_H06.b : acataaaaccgcgggaaaaagcccagggtggggggggagagcccttggggggaaacaatt
ILNT1_0054_E09.b : gggaaaaaaaaacacaacctccgagagggcacttaataacctgggagatagagccccaga
OVRM1_0122_F01.b :
OVRT1_0142_H09.b :
KDN01_0071_G08.b : agggacccaaatacccggggactggacccggggttgggggaaaagccccctgggggggaa
PST01_0065_H06.b : aaacccagtcccggaagaacccaaataaccctgcggactgagcctcagggngggggggtt
KDN01_0083_B12.b :
PST01_0087_G11.b :
SPL01_0033_B03.b : aaacgggttccaaaaggtgctattcaacagggcccatatggtttaagaggtagggccccc
THY01_0001_F11.b :
20110601C-002318 : ............................................................
---------+---------+---------+---------+---------+---------+ 1128
MLN01_0028_C11.b :
THY01_0056_D05.b :
ITT01_0017_H04.b :
PST01_0073_B09.b :
THY01_0002_A08.b :
THY01_0206_D12.b :
ITT01_0030_A08.b :
CBLT1_0072_G10.b : aaaataaccctcggggg
OVRM1_0048_F11.b :
OVRM1_0039_A10.b :
OVRM1_0080_H09.b :
THY01_0041_E05.b :
THY01_0069_G12.b :
CLNT1_0116_B08.b : agggggggcgcccgtaaaacccccaagaaattttttttctaacaaaaatatctgcgt
PTG01_0079_F04.b : tttcccaaaaaacaccaaga
BFLT1_0055_D04.b :
OVR01_0089_B10.b :
OVR01_0047_C11.b :
OVR01_0019_G06.b :
CLNT1_0035_C11.b :
LVR01_0054_B08.b :
BFLT1_0029_D04.b :
ITT01_0023_A07.b :
BMWN1_0054_C04.b :
BFLT1_0110_E11.b :
BFLT1_0052_G11.b :
CLNT1_0027_F08.b :
SPL01_0051_B01.b :
KDN01_0066_F08.b : aaccttttgtggggcttcggaggttctcc
ITT01_0068_H06.b : ggggaggctccccggttttcccacac
ILNT1_0054_E09.b : ggggggggggagaatacg
OVRM1_0122_F01.b :
OVRT1_0142_H09.b :
KDN01_0071_G08.b : ccattggtggggctctcctgatttc
PST01_0065_H06.b : aagan
KDN01_0083_B12.b :
PST01_0087_G11.b :
SPL01_0033_B03.b : cttaatgtgggaaaaaaaaaaaaaaccaatcttccccggaaaagggaacctctaa
THY01_0001_F11.b :