[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-003007

Length: 1,419

Sequence [FASTA format sequence]
ACGTTTCCGA GGGAACCCGG TCTCCACAAG CCCGTCGAAG GGCAGGAAGA ATGGACTGAA
AGTCTCTGGA GCAGGCGCGG ATCCCACCGG CCCAGGCTCC TAGGGAACCA GCCTCACTTA
GCTTGAGCTT GTTTTATTTT TGTCGTCTTT TCTTTTTATC TCGTATGTTT TAAAAACCTC
TTGGAATTTC TGGGCGATTT TGCAGTCATG GAGGTAGCTC AGCCCAAGGA CCTGGAGGAG
GACTTTGGCC AGGCCAAGAA GAGACATGCA GAGCTGTGCA GGCAGAAACG GATCTTCAAT
GCCAGGAACA GGATCTTTGG GGGAGACATA GACGCCTGGA ACGTACAGGT TTGTGACCAG
AAGATAAGAG AAGCAACGGA AAAAGCTAGA CAGGAAACAT TTGCTGCTGA AATGAGGCAG
AATGACAAAA TCACATGCAT ATTAGAAGAC CGGGCAAGGA GAGACAGGAA AAATCTCTGT
AAAGCTATCA ATGACTTCCA GCAGAGCTTT CAGAAGCCAG AAACTCGCCG TGAATTTGAC
CTCTCTGACC CCCTTGCCCT TAAGAAAGAT CTTCCAGCCC GGCAGTCCGA TAATGATGCT
CGGAATACGG TGTCAGGAAT GCAGAAATTC ATGGGAGAGG ATTTAAACAT CCATCAGAGG
AGGAAATTCC AAGAGGAACA AAACAGAGAA TGGTCCTTGC AACAGCAGAG GGAGTGGAAG
ATTGCCCGTG AGGACCAAAA ACACGCCGAG GATCTCTACT TGGAGACCAG GCTGCAGTTT
GATGAAACAG CCAAGCATTT ACAGAATCTG GAAGGCACCA CCAGAAAGGC GGTTTGTGCA
GCTGTGAAAG AATTCAACAA GAACCAGGCC TTGGAGTCAG CGGAAAAGAA ACGTCAAGAG
AGAAAACAGG AACAAGAGGA CAACTTGGCC GAGATCACCA ACCTGCTGCG TGGGGACCTG
CTGTCAGAGG ACCCGCAGCA GGCAGCCAGT TCCTTCGGGC CCCATCGCGT GGTCCCCGAC
CGCTGGAAGG GCATGACCCA GGAGCAGCTG GAGCAGATCC GCCTGGTTCA GAAACAGCAA
GTCCAGGAGA AGCTGAGGCT CCAGGAAGAG GAGCGCCAGC GAGACATGGA CTGGGACCGG
CAGAGGGTTC AGAAGGCTCG CGCCACCTTG CTGTCGGAGC GGCAGCTGCA GCGCCAGCAG
CGTGCGCTGC GCAGAGCCCT GGACGGCAGC AACCTCAGCC TGGCCAAGGA GCAGCTTTTG
CAGAAAAATA TATGAAAGAA ATCTATACAA ATCAGCCCAC TGAAGATTAT TTCACACAAT
TTAATACCAG AAGTCGATAA TGAAAAGGCC ACCTGCCCTC CTGCTGAATT GTATAAAGTG
CTGTACCCTT AAAGAGTCCC ATGTGTTAAA AAAAAAAAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRIBC2RIB43A-like with coiled-coils protein 2 [Homo sapiens]. 507e-151O
Contig/Assembly ProteinRIBC1RIB43A-like with coiled-coils protein 1 isoform 1 [Homo sapiens]. 1663e-44O
Contig/Assembly ProteinRIBC1RIB43A-like with coiled-coils protein 1 isoform 2 [Homo sapiens]. 96.36e-20O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRibc2RIB43A-like with coiled-coils protein 2 [Mus musculus]. 403e-117O
Contig/Assembly ProteinRibc1RIB43A-like with coiled-coils protein 1 [Mus musculus]. 1473e-39O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC474469PREDICTED: similar to RIB43A domain with coiled-coils 2 [Canis familiaris]. 388e-108O
Contig/Assembly ProteinLOC480929PREDICTED: similar to RIB43A domain with coiled-coils 1 isoform 1 [Canis familiaris]. 1662e-44O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRIBC2RIB43A-like with coiled-coils protein 2 [Bos taurus]. 504e-148O
Contig/Assembly ProteinRIBC1RIB43A-like with coiled-coils protein 1 [Bos taurus]. 1561e-41O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100519482PREDICTED: RIB43A-like with coiled-coils protein 2-like [Sus scrofa]. 592e-179O
Contig/Assembly ProteinLOC100518968PREDICTED: RIB43A-like with coiled-coils protein 2-like [Sus scrofa]. 570e-172O


Assembly Members: 21      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
LNG010047B06LNG01_0047_B06.bBP434423 
OVR010058E01OVR01_0058_E01.bBW964791 AK234418
OVR010071C10OVR01_0071_C10.bBW965937 
OVR010092D04OVR01_0092_D04.bBW967535 
TCH010002G02TCH01_0002_G02.bCJ022612 
TCH010016F12TCH01_0016_F12.bCJ023639 
TCH010043E11TCH01_0043_E11.bCJ025671 
TCH010048A02TCH01_0048_A02.bCJ025985 
TCH010049G03TCH01_0049_G03.bCJ026122 
TCH010062C08TCH01_0062_C08.bCJ026846 
TCH010071C12TCH01_0071_C12.bCJ027521 
TCH010079C08TCH01_0079_C08.bCJ028133 
TCH010083B09TCH01_0083_B09.bCJ028438 
TCH010083B11TCH01_0083_B11.bCJ028439 
TCH010083D09TCH01_0083_D09.bCJ028457 
TCH010099E12TCH01_0099_E12.bCJ029692 
TCH010099G05TCH01_0099_G05.bCJ029705 
UTR010010C06UTR01_0010_C06.bBP170652 
UTR010032A11UTR01_0032_A11.bBP169826 
UTR010084C08UTR01_0084_C08.bCJ037737 
UTR010089D02UTR01_0089_D02.bCJ038209 

  

SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
806A1400.875WNAAT/N
G200.125AGT/S


Alignment:      TOP

20110601C-003007 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
TCH01_0071_C12.b : nnnngggctggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0099_E12.b : nnnggctaggactataacxxxxxxxxxxxxxxxxxxxx
TCH01_0083_D09.b : nnnggctaggactatgacxxxxxxxxxxxxxxxxxxxxxx
TCH01_0048_A02.b : tagttnggctaggactatgacxxxxxxxxxxxxxxxx
OVR01_0071_C10.b : nnggctaggactatgacagtttgtaacxxxxxxxx
TCH01_0099_G05.b : nnnggctaggactatgacxxxxxxxxxxxxxx
OVR01_0058_E01.b : nnnnggctagtgacttgacxxxxxxxxxxxxxxxx
TCH01_0016_F12.b : nnaacctgattgacagtttgtcxxxxxxxxx
TCH01_0062_C08.b : ngctaggacttaaacxxxxxxxxxxxxxxxx
TCH01_0043_E11.b : ttttaaattggacttgacagtttgtacxxxxxx
TCH01_0049_G03.b : nnttgctaggactatnacagtttgtacxxxxxx
UTR01_0010_C06.b : gggggxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0032_A11.b : attttgggtgaaxxxxxxxxxxxx
UTR01_0089_D02.b : nnnnggcttggacttanacxx
TCH01_0002_G02.b : nnnngggtaggactatnacx
OVR01_0092_D04.b : nnnnggctagtgacttgac
TCH01_0079_C08.b : nnnnggattggact
LNG01_0047_B06.b : tggggtcccccttgcttagtgxxxxxxxxxxxx
TCH01_0083_B11.b :
TCH01_0083_B09.b :
UTR01_0084_C08.b :
20110601C-003007 : ..................ACGTTTCCGAGGGAACCCGGTCTCCACAAGCCCGTCGAAGGG
---------+---------+---------+---------+---------+---------+ 42
TCH01_0071_C12.b : xxxxxxxxxxxxxxxxxxACGTTTCCGAGGGAACCCGGTCTCCACAAGCCCGTCGAAGGG
TCH01_0099_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxaggtctccACAAGCCCGTCGAAGGG
TCH01_0083_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggtctccACAAGCCCGTCGAAGGG
TCH01_0048_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggACAAGCCCGTCGAAGGG
OVR01_0071_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAAGCCCGTCGAAGGG
TCH01_0099_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAAGCCCGTCGAAGGG
OVR01_0058_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCCGTCGAAGGG
TCH01_0016_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggggGCCCGTCGAAGGG
TCH01_0062_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCCGTCGAAGGG
TCH01_0043_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCCGTCGAAGGG
TCH01_0049_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCCCGTCGAAGGG
UTR01_0010_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCGAAGGG
UTR01_0032_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0089_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxg
TCH01_0002_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0092_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0079_C08.b : aaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0047_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0083_B11.b :
TCH01_0083_B09.b :
UTR01_0084_C08.b :
20110601C-003007 : CAGGAAGAATGGACTGAAAGTCTCTGGAGCAGGCGCGGATCCCACCGGCCCAGGCTCCTA
---------+---------+---------+---------+---------+---------+ 102
TCH01_0071_C12.b : CAGGAAGAATGGACTGAAAGTCTCTGGAGCAGGCGCGGATCCCACCGGCCCAGGCTCCTA
TCH01_0099_E12.b : CAGGAAGAATGGACTGAAAGTCTCTGGAGCAGGCGCGGATCCCACCGGCCCAGGCTCCTA
TCH01_0083_D09.b : CAGGAAGAATGGACTGAAAGTCTCTGGAGCAGGCGCGGATCCCACCGGCCCAGGCTCCTA
TCH01_0048_A02.b : CAGGAAGAATGGACTGAAAGTCTCTGGAGCAGGCGCGGATCCCACCGGCCCAGGCTCCTA
OVR01_0071_C10.b : CAGGAAGAATGGACTGAAAGTCTCTGGAGCAGGCGCGGATCCCACCGGCCCAGGCTCCTA
TCH01_0099_G05.b : CAGGAAGAATGGACTGAAAGTCTCTGGAGCAGGCGCGGATCCCACCGGCCCAGGCTCCTA
OVR01_0058_E01.b : CAGGAAGAATGGACTGAAAGTCTCTGGAGCAGGCGCGGATCCCACCGGCCCAGGCTCCTA
TCH01_0016_F12.b : CAGGAAGAATGGACTGAAAGTCTCTGGAGCAGGCGCGGATCCCACCGGCCCAGGCTCCTA
TCH01_0062_C08.b : CAGGAAGAATGGACTGAAAGTCTCTGGAGCAGGCGCGGATCCCACCGGCCCAGGCTCCTA
TCH01_0043_E11.b : CAGGAAGAATGGACTGAAAGTCTCTGGAGCAGGCGCGGATCCCACCGGCCCAGGCTCCTA
TCH01_0049_G03.b : CAGGAAGAATGGACTGAAAGTCTCTGGAGCAGGCGCGGATCCCACCGGCCCAGGCTCCTA
UTR01_0010_C06.b : CAGGAAGAATGGACTGAAAGTCTCTGGAGCAGGCGCGGATCCCACCGGCCCAGGCTCCTA
UTR01_0032_A11.b : gAGGAAGAATGGACTGAAAGTCTCTGGAGCAGGCGCGGATCCCACCGGCCCAGGCTCCTA
UTR01_0089_D02.b : gAGGAAGAATGGACTGAAAGTCTCTGGAGCAGGCGCGGATCCCACCGGCCCAGGCTCCTA
TCH01_0002_G02.b : tAGGAAGAATGGACTGAAAGTCTCTGGAGCAGGCGCGGATCCCACCGGCCCAGGCTCCTA
OVR01_0092_D04.b : xxGGAAGAATGGACTGAAAGTCTCTGGAGCAGGCGCGGATCCCACCGGCCCAGGCTCCTA
TCH01_0079_C08.b : xxGGAAGAATGGACTGAAAGTCTCTGGAGCAGGCGCGGATCCCACCGGCCCAGGCTCCTA
LNG01_0047_B06.b : xxGGAAGAATGGACTGAAAGTCTCTGGAGCAGGCGCGGATCCCACCGGCCCAGGCTCCTA
TCH01_0083_B11.b :
TCH01_0083_B09.b :
UTR01_0084_C08.b :
20110601C-003007 : GGGAACCAGCCTCACTTAGCTTGAGCTTGTTTTATTTTTGTCGTCTTTTCTTTTTATCTC
---------+---------+---------+---------+---------+---------+ 162
TCH01_0071_C12.b : GGGAACCAGCCTCACTTAGCTTGAGCTTGTTTTATTTTTGTCGTCTTTTCTTTTTATCTC
TCH01_0099_E12.b : GGGAACCAGCCTCACTTAGCTTGAGCTTGTTTTATTTTTGTCGTCTTTTCTTTTTATCTC
TCH01_0083_D09.b : GGGAACCAGCCTCACTTAGCTTGAGCTTGTTTTATTTTTGTCGTCTTTTCTTTTTATCTC
TCH01_0048_A02.b : GGGAACCAGCCTCACTTAGCTTGAGCTTGTTTTATTTTTGTCGTCTTTTCTTTTTATCTC
OVR01_0071_C10.b : GGGAACCAGCCTCACTTAGCTTGAGCTTGTTTTATTTTTGTCGTCTTTTCTTTTTATCTC
TCH01_0099_G05.b : GGGAACCAGCCTCACTTAGCTTGAGCTTGTTTTATTTTTGTCGTCTTTTCTTTTTATCTC
OVR01_0058_E01.b : GGGAACCAGCCTCACTTAGCTTGAGCTTGTTTTATTTTTGTCGTCTTTTCTTTTTATCTC
TCH01_0016_F12.b : GGGAACCAGCCTCACTTAGCTTGAGCTTGTTTTATTTTTGTCGTCTTTTCTTTTTATCTC
TCH01_0062_C08.b : GGGAACCAGCCTCACTTAGCTTGAGCTTGTTTTATTTTTGTCGTCTTTTCTTTTTATCTC
TCH01_0043_E11.b : GGGAACCAGCCTCACTTAGCTTGAGCTTGTTTTATTTTTGTCGTCTTTTCTTTTTATCTC
TCH01_0049_G03.b : GGGAACCAGCCTCACTTAGCTTGAGCTTGTTTTATTTTTGTCGTCTTTTCTTTTTATCTC
UTR01_0010_C06.b : GGGAACCAGCCTCACTTAGCTTGAGCTTGTTTTATTTTTGTCGTCTTTTCTTTTTATCTC
UTR01_0032_A11.b : GGGAACCAGCCTCACTTAGCTTGAGCTTGTTTTATTTTTGTCGTCTTTTCTTTTTATCTC
UTR01_0089_D02.b : GGGAACCAGCCTCACTTAGCTTGAGCTTGTTTTATTTTTGTCGTCTTTTCTTTTTATCTC
TCH01_0002_G02.b : GGGAACCAGCCTCACTTAGCTTGAGCTTGTTTTATTTTTGTCGTCTTTTCTTTTTATCTC
OVR01_0092_D04.b : GGGAACCAGCCTCACTTAGCTTGAGCTTGTTTTATTTTTGTCGTCTTTTCTTTTTATCTC
TCH01_0079_C08.b : GGGAACCAGCCTCACTTAGCTTGAGCTTGTTTTATTTTTGTCGTCTTTTCTTTTTATCTC
LNG01_0047_B06.b : GGGAACCAGCCTCACTTAGCTTGAGCTTGTTTTATTTTTGTCGTCTTTTCTTTTTATCTC
TCH01_0083_B11.b :
TCH01_0083_B09.b :
UTR01_0084_C08.b :
20110601C-003007 : GTATGTTTTAAAAACCTCTTGGAATTTCTGGGCGATTTTGCAGTCATGGAGGTAGCTCAG
---------+---------+---------+---------+---------+---------+ 222
TCH01_0071_C12.b : GTATGTTTTAAAAACCTCTTGGAATTTCTGGGCGATTTTGCAGTCATGGAGGTAGCTCAG
TCH01_0099_E12.b : GTATGTTTTAAAAACCTCTTGGAATTTCTGGGCGATTTTGCAGTCATGGAGGTAGCTCAG
TCH01_0083_D09.b : GTATGTTTTAAAAACCTCTTGGAATTTCTGGGCGATTTTGCAGTCATGGAGGTAGCTCAG
TCH01_0048_A02.b : GTATGTTTTAAAAACCTCTTGGAATTTCTGGGCGATTTTGCAGTCATGGAGGTAGCTCAG
OVR01_0071_C10.b : GTATGTTTTAAAAACCTCTTGGAATTTCTGGGCGATTTTGCAGTCATGGAGGTAGCTCAG
TCH01_0099_G05.b : GTATGTTTTAAAAACCTCTTGGAATTTCTGGGCGATTTTGCAGTCATGGAGGTAGCTCAG
OVR01_0058_E01.b : GTATGTTTTAAAAACCTCTTGGAATTTCTGGGCGATTTTGCAGTCATGGAGGTAGCTCAG
TCH01_0016_F12.b : GTATGTTTTAAAAACCTCTTGGAATTTCTGGGCGATTTTGCAGTCATGGAGGTAGCTCAG
TCH01_0062_C08.b : GTATGTTTTAAAAACCTCTTGGAATTTCTGGGCGATTTTGCAGTCATGGAGGTAGCTCAG
TCH01_0043_E11.b : GTATGTTTTAAAAACCTCTTGGAATTTCTGGGCGATTTTGCAGTCATGGAGGTAGCTCAG
TCH01_0049_G03.b : GTATGTTTTAAAAACCTCTTGGAATTTCTGGGCGATTTTGCAGTCATGGAGGTAGCTCAG
UTR01_0010_C06.b : GTATGTTTTAAAAACCTCTTGGAATTTCTGGGCGATTTTGCAGTCATGGAGGTAGCTCAG
UTR01_0032_A11.b : GTATGTTTTAAAAACCTCTTGGAATTTCTGGGCGATTTTGCAGTCATGGAGGTAGCTCAG
UTR01_0089_D02.b : GTATGTTTTAAAAACCTCTTGGAATTTCTGGGCGATTTTGCAGTCATGGAGGTAGCTCAG
TCH01_0002_G02.b : GTATGTTTTAAAAACCTCTTGGAATTTCTGGGCGATTTTGCAGTCATGGAGGTAGCTCAG
OVR01_0092_D04.b : GTATGTTTTAAAAACCTCTTGGAATTTCTGGGCGATTTTGCAGTCATGGAGGTAGCTCAG
TCH01_0079_C08.b : GTATGTTTTAAAAACCTCTTGGAATTTCTGGGCGATTTTGCAGTCATGGAGGTAGCTCAG
LNG01_0047_B06.b : GTATGTTTTAAAAACCTCTTGGAATTTCTGGGCGATTTTGCAGTCATGGAGGTAGCTCAG
TCH01_0083_B11.b :
TCH01_0083_B09.b :
UTR01_0084_C08.b :
20110601C-003007 : CCCAAGGACCTGGAGGAGGACTTTGGCCAGGCCAAGAAGAGACATGCAGAGCTGTGCAGG
---------+---------+---------+---------+---------+---------+ 282
TCH01_0071_C12.b : CCCAAGGACCTGGAGGAGGACTTTGGCCAGGCCAAGAAGAGACATGCAGAGCTGTGCAGG
TCH01_0099_E12.b : CCCAAGGACCTGGAGGAGGACTTTGGCCAGGCCAAGAAGAGACATGCAGAGCTGTGCAGG
TCH01_0083_D09.b : CCCAAGGACCTGGAGGAGGACTTTGGCCAGGCCAAGAAGAGACATGCAGAGCTGTGCAGG
TCH01_0048_A02.b : CCCAAGGACCTGGAGGAGGACTTTGGCCAGGCCAAGAAGAGACATGCAGAGCTGTGCAGG
OVR01_0071_C10.b : CCCAAGGACCTGGAGGAGGACTTTGGCCAGGCCAAGAAGAGACATGCAGAGCTGTGCAGG
TCH01_0099_G05.b : CCCAAGGACCTGGAGGAGGACTTTGGCCAGGCCAAGAAGAGACATGCAGAGCTGTGCAGG
OVR01_0058_E01.b : CCCAAGGACCTGGAGGAGGACTTTGGCCAGGCCAAGAAGAGACATGCAGAGCTGTGCAGG
TCH01_0016_F12.b : CCCAAGGACCTGGAGGAGGACTTTGGCCAGGCCAAGAAGAGACATGCAGAGCTGTGCAGG
TCH01_0062_C08.b : CCCAAGGACCTGGAGGAGGACTTTGGCCAGGCCAAGAAGAGACATGCAGAGCTGTGCAGG
TCH01_0043_E11.b : CCCAAGGACCTGGAGGAGGACTTTGGCCAGGCCAAGAAGAGACATGCAGAGCTGTGCAGG
TCH01_0049_G03.b : CCCAAGGACCTGGAGGAGGACTTTGGCCAGGCCAAGAAGAGACATGCAGAGCTGTGCAGG
UTR01_0010_C06.b : CCCAAGGACCTGGAGGAGGACTTTGGCCAGGCCAAGAAGAGACATGCAGAGCTGTGCAGG
UTR01_0032_A11.b : CCCAAGGACCTGGAGGAGGACTTTGGCCAGGCCAAGAAGAGACATGCAGAGCTGTGCAGG
UTR01_0089_D02.b : CCCAAGGACCTGGAGGAGGACTTTGGCCAGGCCAAGAAGAGACATGCAGAGCTGTGCAGG
TCH01_0002_G02.b : CCCAAGGACCTGGAGGAGGACTTTGGCCAGGCCAAGAAGAGACATGCAGAGCTGTGCAGG
OVR01_0092_D04.b : CCCAAGGACCTGGAGGAGGACTTTGGCCAGGCCAAGAAGAGACATGCAGAGCTGTGCAGG
TCH01_0079_C08.b : CCCAAGGACCTGGAGGAGGACTTTGGCCAGGCCAAGAAGAGACATGCGGAGCTGTGCAGG
LNG01_0047_B06.b : CCCAAGGACCTGGAGGAGGACTTTGGCCAGGCCAAGAAGAGACATGCAGAGCTGTGCAGG
TCH01_0083_B11.b :
TCH01_0083_B09.b :
UTR01_0084_C08.b :
20110601C-003007 : CAGAAACGGATCTTCAATGCCAGGAACAGGATCTTTGGGGGAGACATAGACGCCTGGAAC
---------+---------+---------+---------+---------+---------+ 342
TCH01_0071_C12.b : CAGAAACGGATCTTCAATGCCAGGAACAGGATCTTTGGGGGAGACATAGACGCCTGGAAC
TCH01_0099_E12.b : CAGAAACGGATCTTCAATGCCAGGAACAGGATCTTTGGGGGAGACGTAGACGCCTGGAAC
TCH01_0083_D09.b : CAGAAACGGATCTTCAATGCCAGGAACAGGATCTTTGGGGGAGACATAGACGCCTGGAAC
TCH01_0048_A02.b : CAGAAACGGATCTTCAATGCCAGGAACAGGATCTTTGGGGGAGACATAGACGCCTGGAAC
OVR01_0071_C10.b : CAGAAACGGATCTTCAATGCCAGGAACAGGATCTTTGGGGGAGACATAGACGCCTGGAAC
TCH01_0099_G05.b : CAGAAACGGATCTTCAATGCCAGGAACAGGATCTTTGGGGGAGACATAGACGCCTGGAAC
OVR01_0058_E01.b : CAGAAACGGATCTTCAATGCCAGGAACAGGATCTTTGGGGGAGACATAGACGCCTGGAAC
TCH01_0016_F12.b : CAGAAACGGATCTTCAATGCCAGGAACAGGATCTTTGGGGGAGACATAGACGCCTGGAAC
TCH01_0062_C08.b : CAGAAACGGATCTTCAATGCCAGGAACAGGATCTTTGGGGGAGACATAGACGCCTGGAAC
TCH01_0043_E11.b : CAGAAACGGATCTTCAATGCCAGGAACAGGATCTTTGGGGGAGACATAGACGCCTGGAAC
TCH01_0049_G03.b : CAGAAACGGATCTTCAATGCCAGGAACAGGATCTTTGGGGGAGACATAGACGCCTGGAAC
UTR01_0010_C06.b : CAGAAACGGATCTTCAATGCCAGGAACAGGATCTTTGGGGGAGACATAGACGCCTGGAAC
UTR01_0032_A11.b : CAGAAACGGATCTTCAATGCCAGGAACAGGATCTTTGGGGGAGACATAGACGCCTGGAAC
UTR01_0089_D02.b : CAGAAACGGATCTTCAATGCCAGGAACAGGATCTTTGGGGGAGACATAGACGCCTGGAAC
TCH01_0002_G02.b : CAGAAACGGATCTTCAATGCCAGGAACAGGATCTTTGGGGGAGACATAGACGCCTGGAAC
OVR01_0092_D04.b : CAGAAACGGATCTTCAATGCCAGGAACAGGATCTTTGGGGGAGACATAGACGCCTGGAAC
TCH01_0079_C08.b : CAGAAACGGATCTTCAATGCCAGGAACAGGATCTTTGGGGGAGACATAGACGCCTGGAAC
LNG01_0047_B06.b : CAGAAACGGATCTTCAATGCCAGGAACAGGATCTTTGGGGGAGACATAGACGCCTGGAAC
TCH01_0083_B11.b :
TCH01_0083_B09.b :
UTR01_0084_C08.b :
20110601C-003007 : GTACAGGTTTGTGACCAGAAGATAAGAGAAGCAACGGAAAAAGCTAGACAGGAAACATTT
---------+---------+---------+---------+---------+---------+ 402
TCH01_0071_C12.b : GTACAGGTTTGTGACCAGAAGATAAGAGAAGCAACGGAAAAAGCTAGACAGGAAACATTT
TCH01_0099_E12.b : GTACAGGTTTGTGACCAGAAGATAAGAGAAGCAACGGAAAAAGCTAGACAGGAAACATTT
TCH01_0083_D09.b : GTACAGGTTTGTGACCAGAAGATAAGAGAAGCAACGGAAAAAGCTAGACAGGAAACATTT
TCH01_0048_A02.b : GTACAGGTTTGTGACCAGAAGATAAGAGAAGCAACGGAAAAAGCTAGACAGGAAACATTT
OVR01_0071_C10.b : GTACAGGTTTGTGACCAGAAGATAAGAGAAGCAACGGAAAAAGCCAGACAGGAAACATTT
TCH01_0099_G05.b : GTACAGGTTTGTGACCAGAAGATAAGAGAAGCAACGGAAAAAGCTAGACAGGAAACATTT
OVR01_0058_E01.b : GTACAGGTTTGTGACCAGAAGATAAGAGAAGCAACGGAAAAAGCTAGACAGGAAACATTT
TCH01_0016_F12.b : GTACAGGTTTGTGACCAGAAGATAAGAGAAGCAACGGAAAAAGCTAGACAGGAAACATTT
TCH01_0062_C08.b : GTACAGGTTTGTGACCAGAAGATAAGAGAAGCAACGGAAAAAGCTAGACAGGAAACATTT
TCH01_0043_E11.b : GTACAGGTTTGTGACCAGAAGATAAGAGAAGTAACGGAAAAAGCTAGACAGGAAACATTT
TCH01_0049_G03.b : GTACAGGTTTGTGACCAGAAGATAAGAGAAGCAACGGAAAAAGCTAGACAGGAAACATTT
UTR01_0010_C06.b : GTACAGGTTTGTGACCAGAAGATAAGAGAAGCAACGGAAAAAGCTAGACAGGAAACATTT
UTR01_0032_A11.b : GTACAGGTTTGTGACCAGAAGATAAGAGAAGCAACGGAAAAAGCTAGACAGGAAACATTT
UTR01_0089_D02.b : GTACAGGTTTGTGACCAGAAGATAAGAGAAGCAACGGAAAAAGCTAGACAGGAAACATTT
TCH01_0002_G02.b : GTACAGGTTTGTGACCAGAAGATAAGAGAAGCAACGGAAAAAGCTAGACAGGAAACATTT
OVR01_0092_D04.b : GTACAGGTTTGTGACCAGAAGATAAGAGAAGCAACGGAAAAAGCTAGACAGGAAACATTT
TCH01_0079_C08.b : GTACAGGTTTGTGACCAGAAGATAAGAGAAGCAACGGAAAAAGCTAGACAGGAAACATTT
LNG01_0047_B06.b : GTACAGGTTTGTGACCAGAAGATAAGAGAAGCAACGGAAAAAGCTAGACAGGAAACATTT
TCH01_0083_B11.b : nnnggcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0083_B09.b : nnggctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0084_C08.b :
20110601C-003007 : GCTGCTGAAATGAGGCAGAATGACAAAATCACATGCATATTAGAAGACCGGGCAAGGAGA
---------+---------+---------+---------+---------+---------+ 462
TCH01_0071_C12.b : GCTGCTGAAATGAGGCAGAATGACAAAATCACATGCATATTAGAAGACCGGGCAAGGAGA
TCH01_0099_E12.b : GCTGCTGAAATGAGGCAGAATGACAAAATCACATGCATATTAGAAGACCGGGCAAGGAGA
TCH01_0083_D09.b : GCTGCTGAAATGAGGCAGAATGACAAAATCACATGCATATTAGAAGACCGGGCAAGGAGA
TCH01_0048_A02.b : GCTGCTGAAATGAGGCAGAATGACAAAATCACATGCATATTAGAAGACCGGGCAAGGAGA
OVR01_0071_C10.b : GCTGCTGAAATGAGGCAGAATGACAAAATCACATGCATATTAGAAGACCGGGCAAGGAGA
TCH01_0099_G05.b : GCTGCTGAAATGAGGCAGAATGACAAAATCACATGCATATTAGAAGACCGGGCAAGGAGA
OVR01_0058_E01.b : GCTGCTGAAATGAGGCAGAATGACAAAATCACATGCATATTAGAAGACCGGGCAAGGAGA
TCH01_0016_F12.b : GCTGCTGAAATGAGGCAGAATGACAAAATCACATGCATATTAGAAGACCGGGCAAGGAGA
TCH01_0062_C08.b : GCTGCTGAAATGAGGCAGAATGACAAAATCACATGCATATTAGAAGACCGGGCAAGGAGA
TCH01_0043_E11.b : GCTGCTGAAATGAGGCAGAATGACAAAATCACATGCATATTAGAAGACCGGGCAAGGAGA
TCH01_0049_G03.b : GCTGCTGAAATGAGGCAGAATGACAAAATCACATGCATATTAGAAGACCGGGCAAGGAGA
UTR01_0010_C06.b : GCTGCTGAAATGAGGCAGAATGACAAAATCACATGCATATTAGAAGACCGGGCAAGGAGA
UTR01_0032_A11.b : GCTGCTGAAATGAGGCAGAATGACAAAATCACATGCATATTAGAAGACCGGGCAAGGAGA
UTR01_0089_D02.b : GCTGCTGAAATGAGGCAGAATGACAAAAGCACATGCATATTAGAAGACCGGGCAAGGAGA
TCH01_0002_G02.b : GCTGCTGAAATGAGGCAGAATGACAAAATCACATGCATATTAGAAGACCGGGCAAGGAGA
OVR01_0092_D04.b : GCTGCTGAAATGAGGCAGAATGACAAAATCACATGCATATTAGAAGACCGGGCAAGGAGA
TCH01_0079_C08.b : GCTGCTGAAATGAGGCAGAATGACAAAATCACATGCATATTAGAAGACCGGGCAAGGAGA
LNG01_0047_B06.b : GCTGCTGAAATGAGGCAGAATGACAAAATCACATGCATATTAGAAGACCGGGCAAGGAGA
TCH01_0083_B11.b : xxxxxxxxxxxxxxxxxctagGACAAAATCACATGCATATTAGAAGACCGGGCAAGGAGA
TCH01_0083_B09.b : xxxxxxxxxxxxxxxxxctagGACAAAATCACATGCATATTAGAAGACCGGGCAAGGAGA
UTR01_0084_C08.b : nnnggc
20110601C-003007 : GACAGGAAAAATCTCTGTAAAGCTATCAATGACTTCCAGCAGAGCTTTCAGAAGCCAGAA
---------+---------+---------+---------+---------+---------+ 522
TCH01_0071_C12.b : GACAGGAAAAATCTCTGTAAAGCTATCAATGACTTCCAGCAGAGCTTTCAGAAGCCAGAA
TCH01_0099_E12.b : GACAGGAAAAATCTCTGTAAAGCTATCAATGACCTCCAGCAGAGCTTTCAGAAGCCAGAA
TCH01_0083_D09.b : GACAGGAAAAATCTCTGTAAAGCTATCAATGACTTCCAGCAGAGCTTTCAGAAGCCAGAA
TCH01_0048_A02.b : GACAGGAAAAATCTCTGTAAAGCTATCAATGACTTCCAGCAGAGCTTTCAGAAGCCAGAA
OVR01_0071_C10.b : GACAGGAAAAATCTCTGTAAAGCTATCAATGACTTCCAGCAGAGCTTTCAGAAGCCAGAA
TCH01_0099_G05.b : GACAGGAAAAATCTCTGTAAAGCTATCAATGACTTCCAGCAGAGCTTTCAGAAGCCAGAA
OVR01_0058_E01.b : GACAGGAAAAATCTCTGTAAAGCTATCAATGACTTCCAGCAGAGCTTTCAGAAGCCAGAA
TCH01_0016_F12.b : GACAGGAAAAATCTCTGTAAAGCTATCAATGACTTCCAGCAGAGCTTTCAGAAGCCAGAA
TCH01_0062_C08.b : GACAGGAAAAATCTCTGTAAAGCTATCAATGACTTCCAGCAGAGCTTTCAGAAGCCAGAA
TCH01_0043_E11.b : GACAGGAAAAATCTCTGTAAAGCTATCAATGACTTCCAGCAGAGCTTTCAGAAGCCAGAA
TCH01_0049_G03.b : GACAGGAAAAATCTCTGTAAAGCTATCAATGACTTCCAGCAGAGCTTTCAGAAGCCAGAA
UTR01_0010_C06.b : GACAGGAAAAATCTCTGTAAAGCTATCAATGACTTCCAGCAGAGCTTTCAGAAGCCAGAA
UTR01_0032_A11.b : GACAGGAAAAATCTCTGTAAAGCTATCAATGACTTCCAGCAGAGCTTTCAGAAGCCAGAA
UTR01_0089_D02.b : GACAGGAAAAATCTCTGTAAAGCTATCAATGACTTCCAGCAGAGCTTTCAGAAGCCAGAA
TCH01_0002_G02.b : GACAGGAAAAATCTCTGTAAAGCTATCAATGACTTCCAGCAGAGCTTTCAGAAGCCAGAA
OVR01_0092_D04.b : GACAGGAAAAATCTCTGTAAAGCTATCAATGACTTCCAGCAGAGCTTTCAGAAGCCAGAA
TCH01_0079_C08.b : GACAGGAAAAATCTCTGTAAAGCTATCAATGACTTCCAGCAGAGCTTTCAGAAGCCAGAA
LNG01_0047_B06.b : GACAGGAAAAATCTCTGTAAAGCTATCAATGACTTCCAGCAGAGCTTTCAGAAGCCAGAA
TCH01_0083_B11.b : GACAGGAAAAATCTCTGTAAAGCTATCAATGACTTCCAGCAGAGCTTTCAGAAGCCAGAA
TCH01_0083_B09.b : GACAGGAAAAATCTCTGTAAAGCTATCAATGACTTCCAGCAGAGCTTTCAGAAGCCAGAA
UTR01_0084_C08.b : tagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-003007 : ACTCGCCGTGAATTTGACCTCTCTGACCCCCTTGCCCTTAAGAAAGATCTTCCAGCCCGG
---------+---------+---------+---------+---------+---------+ 582
TCH01_0071_C12.b : ACTCGCCGTGAATTTGACCTCTCTGACCCCCTTGCCCTTAAGAAAGATCTTCCAGCCCGG
TCH01_0099_E12.b : ACTCGCCGTGAATTTGACCTCTCTGACCCCCTTGCCCTTAAGAAAGATCTTCCAGCCCGG
TCH01_0083_D09.b : ACTCGCCGTGAATTTGACCTCTCTGACCCCCTTGCCCTTAAGAAAGATCTTCCAGCCCGG
TCH01_0048_A02.b : ACTCGCCGTGAATTTGACCTCTCTGACCCCCTTGCCCTTAAGAAAGATCTTCCAGCCCGG
OVR01_0071_C10.b : ACTCGCCGTGAATTTGACCTCTCTGACCCCCTTGCCCTTAAGAAAGATCTTCCAGCCCGG
TCH01_0099_G05.b : ACTCGCCGTGAATTTGACCTCTCTGACCCCCTTGCCCTTAAGAAAGATCTTCCAGCCCGG
OVR01_0058_E01.b : ACTCGCCGTGAATTTGACCTCTCTGACCCCCTTGCCCTTAAGAAAGATCTTCCAGCCCGG
TCH01_0016_F12.b : ACTCGCCGTGAATTTGACCTCTCTGACCCCCTTGCCCTTAAGAAAGATCTTCCAGCCCGG
TCH01_0062_C08.b : ACTCGCCGTGAATTTGACCTCTCTGACCCCCTTGCCCTTAAGAAAGATCTTCCAGCCCGG
TCH01_0043_E11.b : ACTCGCCGTGAATTTGACCTCTCTGACCCCCTTGCCCTTAAGAAAGATCTTCCAGCCCGG
TCH01_0049_G03.b : ACTCGCCGTGAATTTGACCTCTCTGACCCCCTTGCCCTTAAGAAAGATCTTCCAGCCCGG
UTR01_0010_C06.b : ACTCGCCGTGAATTTGACCTCTCTGACCCCCTTGCCCTTAAGAAAGATCTTCCAGCCCGG
UTR01_0032_A11.b : ACTCGCCGTGAATTTGACCTCTCTGACCCCCTTGCCCTTAAGAAAGATCTTCCAGCCCGG
UTR01_0089_D02.b : ACTCGCCGTGAATTTGACCTCTCTGACCCCCTTGCCCTTAAGAAAGATCTTCCAGCCCGG
TCH01_0002_G02.b : ACTCGCCGTGAATTTGACCTCTCTGACCCCCTTGCCCTTAAGAAAGATCTTCCAGCCCGG
OVR01_0092_D04.b : ACTCGCCGTGAATTTGACCTCTCTGACCCCCTTGCCCTTAAGAAAGATCTTCCAGCCCGG
TCH01_0079_C08.b : ACTCGCCGTGAATTTGACCTCTCTGACCCCCTTGCCCTTAAGAAAGATCTTCCAGCCCGG
LNG01_0047_B06.b : ACTCGCCGTGAATTTGACCTCTCTGACCCCCTTGCCCTTAAGAAAGATCTTCCAGCCCGG
TCH01_0083_B11.b : ACTCGCCGTGAATTTGACCTCTCTGACCCCCTTGCCCTTAAGAAAGATCTTCCAGCCCGG
TCH01_0083_B09.b : ACTCGCCGTGAATTTGACCTCTCTGACCCCCTTGCCCTTAAGAAAGATCTTCCAGCCCGG
UTR01_0084_C08.b : xxxxxxxxxxxxxctggctggaCTGACCCCCTTGCCCTTAAGAAAGATCTTCCAGCCCGG
20110601C-003007 : CAGTCCGATAATGATGCTCGGAATACGGTGTCAGGAATGCAGAAATTCATGGGAGAGGAT
---------+---------+---------+---------+---------+---------+ 642
TCH01_0071_C12.b : CAGTCCGATAATGATGCTCGGAATACGGTGTCAGGAATGCAGAAATTCATGGGAGAGGAT
TCH01_0099_E12.b : CAGTCCGATAATGATGCTCGGAATACGGTGTCAGGAATGCAGAAATTCATGGGAGAGGAT
TCH01_0083_D09.b : CAGTCCGATAATGATGCTCGGAATACGGTGTCAGGAATGCAGAAATTCATGGGAGAGGAT
TCH01_0048_A02.b : CAGTCCGATAATGATGCTCGGAATACGGTGTCAGGAATGCAGAAATTCATGGGAGAGGAT
OVR01_0071_C10.b : CAGTCCGATAATGATGCTCGGAATACGGTGTCAGGAATGCAGAAATTCATGGGAGAGGAT
TCH01_0099_G05.b : CAGTCCGATAATGATGCTCGGAATACGGTGTCAGGAATGCAGAAATTCATGGGAGAGGAT
OVR01_0058_E01.b : CAGTCCGATAATGATGCTCGGAATACGGTGTCAGGAATGCAGAAATTCATGGGAGAGGAT
TCH01_0016_F12.b : CAGTCCGATAATGATGCTCGGAATACGGTGTCAGGAATGCAGAAATTCATGGGAGAGGAT
TCH01_0062_C08.b : CAGTCCGATAATGATGCTCGGAATACGGTGTCAGGAATGCAGAAATTCATGGGAGAGGAT
TCH01_0043_E11.b : CAGTCCGATAATGATGCTCGGAATACGGTGTCAGGAATGCAGAAAATGTTGGGAGAGGAT
TCH01_0049_G03.b : CAGTCCGATAATGATGCTCGGAATACGGTGTCAGGAATGCAGAAATTCATGGGAGAGGAT
UTR01_0010_C06.b : CAGTCCGATAATGATGCTCGGAATACGGTGTCAGGAATGCAGAAATTCATGGGAGAGGAT
UTR01_0032_A11.b : CAGTCCGATAATGATGCTCGGAATACGGTGTCAGGAATGCAGAAATTCATGGGAGAGGAT
UTR01_0089_D02.b : CAGTCCGATAATGATGCTCGGAATACGGTGTCAGGAATGCAAAAATTCATGGGAGAGGAT
TCH01_0002_G02.b : CAGTCCGATAATGATGCTCGGAATACGGTGTCAGGAATGCAGAAATTCATGGGAGAGGAT
OVR01_0092_D04.b : CAGTCCGATAATGATGCTCGGAATACGGTGTCAGGAATGCAGAAATTCATGGGAGAGGAT
TCH01_0079_C08.b : CAGTCCGATAATGATGCTCGGAATACGGTGTCAGGAATGCAGAAATTCATGGGAGAGGAT
LNG01_0047_B06.b : CAGTCCGATAATGATGCTCGGAATACGGTGTCAGGAATGCAGAAATTCATGGGAGAGGAT
TCH01_0083_B11.b : CAGTCCGATAATGATGCTCGGAATACGGTGTCAGGAATGCAGAAATTCATGGGAGAGGAT
TCH01_0083_B09.b : CAGTCCGATAATGATGCTCGGAATACGGTGTCAGGAATGCAGAAATTCATGGGAGAGGAT
UTR01_0084_C08.b : CAGTCCGATAATGATGCTCGGAATACGGTGTCAGGAATGCAGAAATTCATGGGAGAGGAT
20110601C-003007 : TTAAACATCCATCAGAGGAGGAAATTCCAAGAGGAACAAAACAGAGAATGGTCCTTGCAA
---------+---------+---------+---------+---------+---------+ 702
TCH01_0071_C12.b : TTAAACATCCATCAGAGGAGGAAATTCCAAGAGGAACAAAACAGAGAATGGTCCTTGCAA
TCH01_0099_E12.b : TTAAACATCCATCAGAGGAGGAAATTCCAAGAGGAACAAAACAGAGAATGGTCCTTGCAA
TCH01_0083_D09.b : TTAAACATCCATCAGAGGAGGAAATTCCAAGAGGAACAAAACAGAGAATGGTCCTTGCAA
TCH01_0048_A02.b : TTAAACATCCATCAGAGGAGGAAATTCCAAGAGGAACAAAACAGAGAATGGTCCTTGCAA
OVR01_0071_C10.b : TTAAACATCCATCAGAGGAGGAAATTCCAAGAGGAACAAAACAGAGAATGGTCCTTGCAA
TCH01_0099_G05.b : TTAAACATCCATCAGAGGAGGAAATTCCAAGAGGAACAAAACAGAGAATGGTCCTTGCAA
OVR01_0058_E01.b : TTAAACATCCATCAGAGGAGGAAATTCCAAGAGGAACAAAACAGAGAATGGTCCTTGCAA
TCH01_0016_F12.b : TTAAACATCCATCAGAGGAGGAAATTCCAAGAGGAACAAAACAGAGAATGGTCCTTGGCA
TCH01_0062_C08.b : TTAAACATCCATCAGAGGAGGAAATTCCAAGAGGAACAAAACAGAGAATGGTCCTTGCAA
TCH01_0043_E11.b : TTAAACATCCATCAGAGGAGGAAATTCCAAGAGGAACAAAACAGAGAATGGTCCTTGCAA
TCH01_0049_G03.b : TTAAACATCCATCAGAGGAGGAAATTCCAAGAGGAACAAAACAGAGAATGGTCCTTGCAA
UTR01_0010_C06.b : TTAAACATCCATCAGAGGAGGAAATTCCAAGAGGAACAAAACAGAGAATGGTCCTTGCAA
UTR01_0032_A11.b : TTAAACATCCATCAGAGGAGGAAATTCCAAGAGGAACAAAACAGAGAATGGTCCTTGCAA
UTR01_0089_D02.b : TTAAACATCCATCAGAGGAGGAAATTCCAAGAGGAACAAAACAGAGAATGGTCCTTGCAA
TCH01_0002_G02.b : TTAAACATCCATCAGAGGAGGAAATTCCAAGAGGAACAAAACAGAGAATGGTCCTTGCAA
OVR01_0092_D04.b : TTAAACATCCATCAGAGGAGGAAATTCCAAGAGGAACAAAGCAGAGAATGGTCCTTGCAA
TCH01_0079_C08.b : TTAAACATCCATCAGAGGAGGAAATTCCAAGAGGAACAAAACAGAGAATGGTCCTTGCAA
LNG01_0047_B06.b : TTAAACATCCATCAGAGGAGGAAATTCCAAGAGGAACAAAACAGAGAATGGTCCTTGCAA
TCH01_0083_B11.b : TTAAACATCCATCAGAGGAGGAAATTCCAAGAGGAACAAAACAGAGAATGGTCCTTGCAA
TCH01_0083_B09.b : TTAAACATCCATCAGAGGAGGAAATTCCAAGAGGAACAAAACAGAGAATGGTCCTTGCAA
UTR01_0084_C08.b : TTAAACATCCATCAGAGGAGGAAATTCCAAGAGGAACAAAACAGAGAATGGTCCTTGCAA
20110601C-003007 : CAGCAGAGGGAGTGGAAGATTGCCCGTGAGGACCAAAAACACGCCGAGGATCTCTACTTG
---------+---------+---------+---------+---------+---------+ 762
TCH01_0071_C12.b : CAGCAGAGGGAGTGGAAGATTGCCCGTGAGGACCAAAAACACGCCGAGGATCTCTACTTG
TCH01_0099_E12.b : CAGCAGAGGGAGTGGAAGATTGCCCGTGAGGACCAAAAACACGCCGAGGATCTCTACTTG
TCH01_0083_D09.b : CAGCAGAGGGAGTGGAAGATTGCCCGTGAGGACCAAAAACACGCCGAGGATCTCTACTTG
TCH01_0048_A02.b : CAGCAGAGGGAGTGGAAGATTGCCCGTGAGGACCAAAAACACGCCGAGGATCTCTACTTG
OVR01_0071_C10.b : CAGCAGAGGGAGTGGAAGATTGCCCGTGAGGACCAAAAACACGCCGAGGATCTCTACTTG
TCH01_0099_G05.b : CAGCAGAGGGAGTGGAAGATTGCCCGTGAGGACCAAAAACACGCCGAGGATCTCTACTTG
OVR01_0058_E01.b : CAGCAGAGGGAGTGGAAGATTGCCCGTGAGGACCAAAAACACGCCGAGGATCTCTACTTG
TCH01_0016_F12.b : CAGCAGAGGGAGTGGAAGATTGCCCGTGAGGACAAAAAACACGCCGAGGATCTCCACTTG
TCH01_0062_C08.b : CAGCAGAGGGAGTGGAAGATTGCCCGTGAGGACCAAAAACACGCCGAGGATCTCTACTTG
TCH01_0043_E11.b : CAGCAGAGGGAGTGGAAGATTGCCCGTGAGGACCAAAAACACGCCGAGGATCTCTACTTG
TCH01_0049_G03.b : CAGCAGAGGGAGTGGAAGATTGCCCGTGAGGACCAAAAACACGCCGAGGATCTCTACTTG
UTR01_0010_C06.b : CAGCAGAGGGAGTGGAAGATTGCCCGTGAGGACCAAAAACACGCCGAGGATCTCTACTTG
UTR01_0032_A11.b : CAGCAGAGGGAGTGGAAGATTGCCCGTGAGGACCAAAAACACGCCGAGGATCTCTACTTG
UTR01_0089_D02.b : CAGCAGAGGGAGTGGAAGATTGCCCGTGAGGACCAAAAACACGCCGAGGATCTCTACTTG
TCH01_0002_G02.b : CAGCAGAGGGAGTGGAAGATTGCCCGTGAGGACCAAAAACACGCCGAGGATCTCTACTTG
OVR01_0092_D04.b : CAGCAGAGGGAGTGGAAGATTGCCCGTGAGGACCAAAAACACGCCGAGGATCTCTACTTG
TCH01_0079_C08.b : CAGCAGAGGGAGTGGAAGATTGCCCGTGAGGACCAAAAACACGCCGAGGATCTCTACTTG
LNG01_0047_B06.b : CAGCAGAGGGAGTGGAAGATTGCCCGTGAGGACCAAAAACACGCCGAGGATCTCTACTTG
TCH01_0083_B11.b : CAGCAGAGGGAGTGGAAGATTGCCCGTGAGGACCAAAAACACGCCGAGGATCTCTACTTG
TCH01_0083_B09.b : CAGCAGAGGGAGTGGAAGATTGCCCGTGAGGACCAAAAACACGCCGAGGATCTCTACTTG
UTR01_0084_C08.b : CAGCAGAGGGAGTGGAAGATTGCCCGTGAGGACCAAAAACACGCCGAGGATCTCTACTTG
20110601C-003007 : GAGACCAGGCTGCAGTTTGATGAAACAGCCAAGCATTTACAGAATCTGGAAGGCACCACC
---------+---------+---------+---------+---------+---------+ 822
TCH01_0071_C12.b : GAGACCAGGCTGCAGTTTGATGAAACAGCCAAGCATTTACAGAATCTGGAAGGCACCACC
TCH01_0099_E12.b : GAGACCAGGCTGCAGTTTGATGAAACAGCCAAGCATTTACAGAATCTGGAAGGCACCACC
TCH01_0083_D09.b : GAGACCAGGCTGCAGTTTGATGAAACAGCCAAGCATTTACAGAATCTGGAAGGCACCACC
TCH01_0048_A02.b : GAGACCAGGCTGCAGTTTGATGAAACAGCCAAGCATTTACAGAATCTGGAAGGCACCACC
OVR01_0071_C10.b : GAGACCAGGCTGCAGTTTGATGAAACAGCCAAGCATTTACAGAATCTGGGAGGCACCACC
TCH01_0099_G05.b : GAGACCAGGCTGCAGTTTGATGAAACAGCCAAGCATTTACAGAATCTGGAAGGCACCACC
OVR01_0058_E01.b : GAGACCAGGCTGCAGTTTGATGAAACAGCCAAGCATTTACAGAATCTGGAAGGgcatgac
TCH01_0016_F12.b : GAGACCAGGCTGCAGTTTGATGAAACAGCCAAGCATTTACAGAATCTGGAAGGCACCCAC
TCH01_0062_C08.b : GAGACCAGGCTGCAGTTTGATGAAACAGCCAAGCATTTACAGAATCTGGAAGGCACCACC
TCH01_0043_E11.b : GAGACCAGGCTGCAGTTTGATGAAACAGCCAAGCATTTACAGAATCTGGAAGGCACCACC
TCH01_0049_G03.b : GAGACCAGGCTGCAGTTTGATGAAACAGCCAAGCATTTACAGAATCTGGAAGGCACCACC
UTR01_0010_C06.b : GAGACCAGGCTGCAGTTTGATGAAACAGCCAAGCATTTACAGAATCTGGAAGGCCCCACC
UTR01_0032_A11.b : GAGACCAGGCTGCAGTTTGATGAAACAGCCAAGCATTTACAGAATCTGGAAGGCACCACC
UTR01_0089_D02.b : GAGAACAGGCTGCAGTTTGATGAAACAGCCAAGCATTTACAGAATCTGGAAAGGCACACC
TCH01_0002_G02.b : GAGACCAGGCTGCAGTTTGATGAAACAGCCAAGCATTTACAGAATCTGGAAGGCACCACC
OVR01_0092_D04.b : GAGACCAGGCTGCAGTTTGATGAAACAGCCAAGCATTTACAGAATCTGGAAGGCACCACC
TCH01_0079_C08.b : GAGACCAGGCTGCAGTTTGATGAAACAGCCAAGCATTTACAGAATCTGGAAGGCACCACC
LNG01_0047_B06.b : GAGACCAGGCTGCAGTTTGATGAAACAGCCAAGCATTTACAGAATCTGGAAGGCACCACC
TCH01_0083_B11.b : GAGACCAGGCTGCAGTTTGATGAAACAGCCAAGCATTTACAGAGTCTGGAAGGCACCACC
TCH01_0083_B09.b : GAGACCAGGCTGCAGTTTGATGAAACAGCCAAGCATTTACAGAGTCTGGAAGGCACCACC
UTR01_0084_C08.b : GAGACCAGGCTGCAGTTTGATGAAACAGCCAAGCATTTACAGAATCTGGAAGGCACCACC
20110601C-003007 : AGAAAGGCGGT*TTGTGCAGCTGTGAAAGAATTCAACAAGAACCAGGCC*TTGGAGTCAG
---------+---------+---------+---------+---------+---------+ 880
TCH01_0071_C12.b : AGAAAGGCGGT*TTGTGCAGCTGTGAAAGAATTCA*ACAGAACCAGGCC*CTGGAGTCAG
TCH01_0099_E12.b : AGAAAGGCGGT*TTGTGCAGCTGTGAAAGAATTCA*CAAGAACCA*GCC*TTGGAGTCAG
TCH01_0083_D09.b : AGAAAGGCGGT*TTGTGCAGCTGTGAAAGAATTCA*CAAAGACCAGGCC*TTGGAGTCAG
TCH01_0048_A02.b : AGAAAGGCGGT*TTGTGCAGCTGTGAAAGAATTCA*CAAGAACCAGGCC*TTGGAGTCAG
OVR01_0071_C10.b : AGAAAGGCGGT*TTGTGCAGCTGTGAAAGAATTCAACAAGAACCAAGCC*TTGGAGTCAG
TCH01_0099_G05.b : AGAAAGGCGGT*TTGTGCAGCTGTGAAAGAATTTCAC*AGAACCAGGCC*TTGGAGTCAG
OVR01_0058_E01.b : ccaggagcagctggagcagatccgcctggttcaaaaacagcaagttcaggagaagctgaa
TCH01_0016_F12.b : AGAAAG*CGGT*TTGTGCAGCTGTGAAAGAATTTCACAAGAAACCAGCC*TTGGAGTCAG
TCH01_0062_C08.b : CAGAAGGCGGT*TTGTGCAGCTGTGAAAGAATTCCACAAGACCCAGGCC*TTGGAGTCAG
TCH01_0043_E11.b : AGAAAGGCGGT*TTGTGCAGCTGTGAAAGAATTCAACAAGAACCCAGCC*TTGGAGTCAG
TCH01_0049_G03.b : AGAAAGGCGGTTTTGTGCAGCTGTGAAAGAAATTCACAAGAACCAGGCCCTTGGAGTCAG
UTR01_0010_C06.b : AGAAAGGCGGT*TTGTGCAGCTGTGAAAGAATTCAACAAGAACCAG
UTR01_0032_A11.b : AGAAAGGCGGT*TTGTGCAGCTGTGAAAGAATTCAACAAGAACCAGGCC*TTGGAGTCAG
UTR01_0089_D02.b : AGAAAAGCGGT*TTGTGCAGCTGTGAAAGATTTCA*CAGAAACCGGGC**TTGGAGTCAG
TCH01_0002_G02.b : AGAAAGGCGGT*TTGTGCAGCTGTGAAAGAA*TCAACAAGAACCAGGCC*TTGGAGTCAG
OVR01_0092_D04.b : AGAAAGGCGGT*TTGTGCAGCTGTGAAAGAATTTCAACAGAACCAGGCC*TTGGAGTCAG
TCH01_0079_C08.b : AGAAAGGCGGT*TTGTGCAGCTGTGAAAGAA*TCAACAAGAAC*AGGCC*TTGNAGTCAG
LNG01_0047_B06.b : AGAAAGGCGGT*TTGTGCAGCTGTGAAAGAATTCAACAAGAACCAGGCC*TTGGAGTCAG
TCH01_0083_B11.b : AGAAAGGCGGT*TTGTGCAGCTGTGAAAGAATTCAACAAGAACCAGGCC*TTGGAGTCAG
TCH01_0083_B09.b : AGAAAGGCGGT*TTGTGCAGCTGTGAAAGAATTCAACAAGAACCAGGCC*TTGGAGTCAG
UTR01_0084_C08.b : AGAAAGGCGGT*TTGTGCAGCTGTGAAAGAATTCAACAAGAACCAGGCC*TTGGAGTCAG
20110601C-003007 : CGGAAAAGAAACGTCAAGAGAGAAAACAGGAACAAGAGGACAACTTGGCCGAGATCACCA
---------+---------+---------+---------+---------+---------+ 940
TCH01_0071_C12.b : CGGAAA*GAAACGTCAGGAGAGAAACAGG**AACAAGAGGACACTTGGCCGAGATCA*CA
TCH01_0099_E12.b : CGGAAA*AGAACGTNCAGAGAGAAAcaggaacagaggacacttggccggatcaccacctg
TCH01_0083_D09.b : CGGAAA*GGAACGTNCAGAGAGAAAACGG**AACA*GAGGACACTTGGCCGAGATCA*CC
TCH01_0048_A02.b : CGGAAAAGAAACGGTCAGAGAGAAAACAGGAAACAGAGGACNACTTGGNCGAGATCACCA
OVR01_0071_C10.b : CGGAAAAGAAACGTCCAGAGAGAAAACGCGGACCAGAGGACAACTTGGCCAAAATTACCA
TCH01_0099_G05.b : CGGAAA*GAAACGTNCAGAGAGAAAACGGG*AACAGAGGACNACTTGGCCGAGATCA*CC
OVR01_0058_E01.b : gctccaggaagaggaacgcccgccaagacatggactgggaacggcaaagggtttcaaaag
TCH01_0016_F12.b : CGGAAAAGAAACGTCCAGAGAGAAAccagaacaagaggacacttggccgaagatcacaac
TCH01_0062_C08.b : CGGAAAAGAAACGTCCAGAGAGAAAACCGGGACCAGAGGACAACTTGGCCGAGATCACCA
TCH01_0043_E11.b : CGGAAAAGAAACGTCAAGAGAGAAAACAGGAACAAGAGGACACCTTGGCCGAGATCACCA
TCH01_0049_G03.b : CGGAAAAGAAACGTCAAGAAGAGAAACCGGGACAAGAGGGACACTTGGCCGAGATCACCA
UTR01_0010_C06.b :
UTR01_0032_A11.b : CGGAAAAGAAACGT
UTR01_0089_D02.b : CGAAAAAG*AACGTCCAGAGAGAAAacaggaacaagaggacaactgggcgagatcaccac
TCH01_0002_G02.b : CGGAAGAGAAACGTCAAGAGAGAAAACAGGAAACAGAGGACAACTTTGGCGAGATCACCA
OVR01_0092_D04.b : CGGAAAAGAAAACGTCAGAGAGAAAACAGG*AACAGAGGACAACTTGGCCGAGATCA*CA
TCH01_0079_C08.b : CGGAAAAG*AACGTNCAGAGAGAAACAGG**AACAGAAGAA*ACTTGGCCGAGATCACAN
LNG01_0047_B06.b : CGGAAAAGAAACGTCAAGAGAGAAAACAGGAAACAGAGGGACACTTGGGCGAGATCACCA
TCH01_0083_B11.b : CGGAAAAGAAACGTCAAGAGAGAAAACAGGAACAAGAGGACAACTTGGCCGAGATCACCA
TCH01_0083_B09.b : CGGAAAAGAAACGTCAAGAGAGAAAACAGGAACAAGAGGACAACTTGGCCGAGATCACCA
UTR01_0084_C08.b : CGGAAAAGAAACGTCAAGAGAGAAAACAGGAACAAGAGGACAACTTGGCCGAGATCACCA
20110601C-003007 : ACCTGCTGCGTGG*GGACCTGCTGTCAGAGGACCCGCAGCAGGCAGCCAGTTCCTT*CGG
---------+---------+---------+---------+---------+---------+ 998
TCH01_0071_C12.b : ACTTGCTGCGGGG*GGAC*TGCTGTCAaagacccgcaccagcacccatttcttcgggcca
TCH01_0099_E12.b : ctgcgtggggactgctgtcagagacccgcagcagcagcagttcttcgggcccatcgcgtg
TCH01_0083_D09.b : ACCTGCTGCGTGG*GGACctgctgtcaaaggaccgcaacaggcagccgtttcttcgggcc
TCH01_0048_A02.b : ACCTGCTGCGTGG*GGACNTGCTGTCAAAAGACCCGCAGCAGGCAACCAGTTTCTTTCGG
OVR01_0071_C10.b : ACCTGCTGCGTGG*GGACCTTCTGTCAaaagaacccccaacagggcgcccagttccttcg
TCH01_0099_G05.b : ACCTGCTGCGTGG*GGAC*TGCTGTCAGAGGACC*GCAGCAGgcagccagttcttcggcc
OVR01_0058_E01.b : gctcccgccacccttgctgtccggaacggcaactttcaaccgccagcaacggtggcgctg
TCH01_0016_F12.b : tgctgcttggggactgctgtcaaaggaccgcaacagcacccgttccttcggccccatccg
TCH01_0062_C08.b : ACCTGCTGCGTGG*GGgacctgcttgtcaaggaaccgcaccangaagccagttttttcgg
TCH01_0043_E11.b : ACCTGCTGCGTGG*GGACCTGCTGTCcaagaaccgcaacaggccaccagttcctttcggc
TCH01_0049_G03.b : ACCTGCTGCGTGGGGGACCTGCTGTCAGAGGACCCGCAGCCAGCAGNCAGTTTCTT*CGG
UTR01_0010_C06.b :
UTR01_0032_A11.b :
UTR01_0089_D02.b : ctgctgcgtggggactgctgtcaaaggaccgcaacaggcagcaagttcttcgggcccatc
TCH01_0002_G02.b : ACTTGCTGCGTGG*GGACCTGCTGTCAGAGGACCCGCAGCAGGCAGCCAGTTTCCT*CGG
OVR01_0092_D04.b : ACCTGCTGCGTGG*GGACtgctgtcaaaggaccgcagcaggcagccagttcttcgggccc
TCH01_0079_C08.b : **CTGCTGCGTGG*GGAC*TGCTGTCAGA*GACCCGCAGCAGcagcagttcctcggcccc
LNG01_0047_B06.b : ACCTGCTGCGTGG*GGACCTGCTGTCAGAGGTCCCGCAGCAGGGAGCCAGTTCCCT*CGG
TCH01_0083_B11.b : ACCTGCTGCGTGG*GGACCTGCTGTCAGAGGACCCGCAGCAGGCAGCCAGTTCCTT*CGG
TCH01_0083_B09.b : ACCTGCTGCGTGG*GGACCTGCTGTCAGAGGACCCGCAGCAGGCAGCCAGTTCCTT*CGG
UTR01_0084_C08.b : ACCTGCTGCGTGG*GGACCTGCTGTCAGGGGACCCGCAGCAGGCAGCCAGTTCCTT*CGG
20110601C-003007 : GCCCCATCGCGTGGTCCCCGACCGCTGG*AAGGGCATGACCCAGGAGCAGCTGGAGCAGA
---------+---------+---------+---------+---------+---------+ 1057
TCH01_0071_C12.b : tcgcgggtcccaacgctggaaggctgacccagaacactggacaaatccctgtttaaaacg
TCH01_0099_E12.b : tccccgacgctggaggncagaccnagagcagctgagcaatccgctggtcaaaacgcagtc
TCH01_0083_D09.b : ccatccggtgttcccgaccgctggaagggcatgacccaggaacactgaagcaaatccccc
TCH01_0048_A02.b : CCCCCATCGCGTGGTCCCCGACGGCTGG*AAAGGCTTGACCCAAGAACACCTGGAGCAAA
OVR01_0071_C10.b : ggccccctcccggggtccccccaccccttggaagggcttgaacccagaaacaactggagc
TCH01_0099_G05.b : ccatcgcgtggtccccgacgctgaagggcatgaccaaggacaactggacagatcgcctgg
OVR01_0058_E01.b : cgccaaaacccttggaaagggcaaccaacctttagacctgtggcca
TCH01_0016_F12.b : gggccccgaccgttggaaggattacccaagacacctggaccaattccctggttcaaaacc
TCH01_0062_C08.b : gcccccatcgcggggtccccgaccgctggaagggcatgacccacggaccaactgaaacca
TCH01_0043_E11.b : ccatcgcgtggtccccaaccgctggaagggcttgacccagaaccactgaaccaaaccgcc
TCH01_0049_G03.b : GCCCCATCGCGTGGTCCCCcaaccgctggaaggcatgacccaggaacaactgggacaaat
UTR01_0010_C06.b :
UTR01_0032_A11.b :
UTR01_0089_D02.b : gcgtgctccgaacgctggaagggcatgaccacgaacacctggacaaaatccccgtggttc
TCH01_0002_G02.b : GCCCCATCGCGTGGTCCCCGACgcctggagggcatgaccangaacagctggagcaaatcg
OVR01_0092_D04.b : atcgcgtggtccccgaccgctgaaaggcatgacccagagcaactgaancaaatcgcctgg
TCH01_0079_C08.b : atcgcgggtccccgacgctggaggcatgaccnagagcactggacaaatcgctggtcaaaa
LNG01_0047_B06.b : GCCCCATCGCGTGGTCCCCGACCGCTGGGAAGGGCATGACCCAAGAACAGCTGGAGCAAA
TCH01_0083_B11.b : GCCCCATCGCGTGGTCCCCGACCGCTGG*AAGGGCATGACCCAGGAGCAGCTGGAGCAGA
TCH01_0083_B09.b : GCCCCATCGCGTGGTCCCCGACCGCTGG*AAGGGCATGACCCAGGAGCAGCTGGAGCAGA
UTR01_0084_C08.b : GCCCCATCGCGTGGTCCCCGACCGCTGG*AAGGGCATGACCCAGGAGCAGCTGGAGCAGA
20110601C-003007 : TCCGCCTGGTTCAGAAACAGCAAGTCCAGGAGAAGCTGAGGCTCCAGGAAGAGGAGCGCC
---------+---------+---------+---------+---------+---------+ 1117
TCH01_0071_C12.b : cagtcaggaaaactaagccccgaaaaaaaccccccggaagtgctggaccgcaaaggttca
TCH01_0099_E12.b : aggagagctgagctccggagaagacgcaccaacatgactggaccgcaaaggtcaaagctc
TCH01_0083_D09.b : tgttccaaaccgccagtccaggaaaagctgaggctccggaaaaagaccgcaccaagactg
TCH01_0048_A02.b : TCCcccgggtttaaaacagcaagtcccgggaaaactaagggtccccgaaaaaaaaccccc
OVR01_0071_C10.b : caaatcccccggggttcaaaaaaccgccaattccgggaaaaaacctaaggcccccggaaa
TCH01_0099_G05.b : tcaaaacgcaagtcaagaaagctgagctccagaaagaacgcagcagactgactggacggc
OVR01_0058_E01.b :
TCH01_0016_F12.b : ccagttcagaaaactaaggtcccgaaaagaacccccggaactggatgggacggggaaggg
TCH01_0062_C08.b : atccgcctggtttcaaaaccgccaagtccaggaaaaactgaggctcccagaaaaggaacg
TCH01_0043_E11.b : ggtttcaaaaacaccagtccggaaaaacttaagccccggaaaaagaaccgccccgggcat
TCH01_0049_G03.b : ccccctgttcaaaaacagcaggtccggaaaaactgaagctcgggaaaaggaacccccgca
UTR01_0010_C06.b :
UTR01_0032_A11.b :
UTR01_0089_D02.b : aaacagcaagtcagaaaaactaagctccagaaaaggaaccctgcaaaaatggaatgggac
TCH01_0002_G02.b : ccttggtcaaaacagcagtccagaaaagctgaagctcccgaaaaggacgcccaccaaaat
OVR01_0092_D04.b : gtcaaaacagcagtccagagagctgagctccagagaagaacgcagcaaacttactggacc
TCH01_0079_C08.b : cgcagtccagagactgaggctcaggaaagacgccacagaatgactggacgcaaaaggtca
LNG01_0047_B06.b : TCCGCCctggttcaaaaacagcaaggtccaggaaaaacctgaggctcccgggaaaaaagg
TCH01_0083_B11.b : TCCGCCTGGTTCAGAAACAGCAAGTCCAGGAGAAGCTGAGGCTCCAGGAAGAGGAGCGCC
TCH01_0083_B09.b : TCCGCCTGGTTCAGAAACAGCAAGTCCAGGAGAAGCTGAGGCTCCAGGAAGAGGAGCGCC
UTR01_0084_C08.b : TCCGCCTGGTTCAGAAACAGCAAGTCCAGGAGAAGCTGAGGCTCCAGGAAGAGGAGCGCC
20110601C-003007 : AGCGAGACATGGACTGGGACCGGCAGAGGGTTCAGAAGGCTCGCGCCACCTTGCTGTCGG
---------+---------+---------+---------+---------+---------+ 1177
TCH01_0071_C12.b : aagtccct
TCH01_0099_E12.b : cgcccttgctgtgaacgcattcacccaacaatggcttccaacctgaaggaaacctacctg
TCH01_0083_D09.b : aattgggacgggaaaaggttccaaaaggctccgcccctttttttgagaagaatttcaagc
TCH01_0048_A02.b : ccaaaaaatgtatgtggaccggcaaaaggttcaaaagggtcccc
OVR01_0071_C10.b : aaggaacgccc
TCH01_0099_G05.b : aaggttaaaggtccgcaccttgcttcgacgcactcacccaccactgcctgccaaactgga
OVR01_0058_E01.b :
TCH01_0016_F12.b : tcaaaggcccgccctttgtttcgacggaacttcccccacagtggtctccaaacctgtagg
TCH01_0062_C08.b : cccccaaaaactggactgggaaccgccaaaaggttcaaagggtctcccccccttgctttt
TCH01_0043_E11.b : tgaaaggggacgggccaaagtttcaaaagctcccccccctttttgttgaacggaacttta
TCH01_0049_G03.b : aaaatggactgggaccgccaagggttaaaagggtcggccactttctgttgaaagggatct
UTR01_0010_C06.b :
UTR01_0032_A11.b :
UTR01_0089_D02.b : c
TCH01_0002_G02.b : ggactggaccggcaaagggtccaaagcttcgcccccttgctgtcgaagggaattgaaccc
OVR01_0092_D04.b : ggcaaagttcaaagggtccgcacctgctttcaaagcaactaaacccgaacgtgcctgcaa
TCH01_0079_C08.b : aaggtccgcacttcgttcgacgcactgcacccacacttgctgccaacctgtaggacactc
LNG01_0047_B06.b : aacggccgcgcgaaaaaattggaacctggggaaccgggcaaaaaagggggtttcaaaaaa
TCH01_0083_B11.b : AGCGGGACATGGACTGGGACCGGCAGAGGGTTCAGAAAGCTCGCGCCACCTTGCTGTCGG
TCH01_0083_B09.b : AGCGGGACATGGACTGGGACCGGCAGAGGGTTCAGAAGGCTCGCGCCACCTTGCTGTCGG
UTR01_0084_C08.b : AGCGAGACATGGACTGGGACCGGCAGAGGGTTCAGAAGGCTCGCGCCACCTTGCTGTCGG
20110601C-003007 : AGCGGCAGCTGCAGCGCCAGCAGCGTGCGCTGCGCAGAGCCCTGGACGGCAGCAACCTCA
---------+---------+---------+---------+---------+---------+ 1237
TCH01_0071_C12.b :
TCH01_0099_E12.b : gcagggactttgcaaaaaatt
TCH01_0083_D09.b : ccaaaatgggcctgccaaaacctggagggaaacacctcaccgtgccaagaat
TCH01_0048_A02.b :
OVR01_0071_C10.b :
TCH01_0099_G05.b : gaacaccaccggcagagcctttgaaaaattgagaacttcatccccggattttcccttttc
OVR01_0058_E01.b :
TCH01_0016_F12.b : gcacttcccgggcaagacgctttcaaaaatttaagaaattaaaatccccgaaatttccca
TCH01_0062_C08.b : tgaagaggaattgcacccccacaaagggggcttg
TCH01_0043_E11.b : accccaaatgtggtccgtcccaaacc
TCH01_0049_G03.b : gtaacc
UTR01_0010_C06.b :
UTR01_0032_A11.b :
UTR01_0089_D02.b :
TCH01_0002_G02.b : caaaagtgggctggcaaaacccgaaagcaaaa
OVR01_0092_D04.b : aactgag
TCH01_0079_C08.b : ccgggcaaggaacttgtcaaaaatgaaggaactcaaacccccggaaatttcccttataaa
LNG01_0047_B06.b : ggggctcccgggggcccccccccccctttgtggctttgtgttc
TCH01_0083_B11.b : AGCGGCAGCTGCAGCGCCAGCAGCGTGCGCTGCGCAGAGCCCTGGACGGCAGCAACCTCA
TCH01_0083_B09.b : AGCGGCAGCTGCAGCGCCAGCAGCGTGCGCTGCGCAGAGCCCTGGACGGCAGCAACCTCA
UTR01_0084_C08.b : AGCGGCAGCTGCAGCGCCAGCAGCGTGCGCTGCGCAGAGCCCTGGACGGCAGCAACCTCA
20110601C-003007 : GCCTGGCCAAGGAGCAGCTTTTGCAGAA*AAATATATGAAAGAAATCTATACAAATCAGC
---------+---------+---------+---------+---------+---------+ 1296
TCH01_0071_C12.b :
TCH01_0099_E12.b :
TCH01_0083_D09.b :
TCH01_0048_A02.b :
OVR01_0071_C10.b :
TCH01_0099_G05.b : aaagcataaacccgcctcgaattaaggggcctaacc
OVR01_0058_E01.b :
TCH01_0016_F12.b : ttataaaagtaaaaaagccccccccctatattaaagttccccaaaccctgtaaaaaaaaa
TCH01_0062_C08.b :
TCH01_0043_E11.b :
TCH01_0049_G03.b :
UTR01_0010_C06.b :
UTR01_0032_A11.b :
UTR01_0089_D02.b :
TCH01_0002_G02.b :
OVR01_0092_D04.b :
TCH01_0079_C08.b : ggaatgat
LNG01_0047_B06.b :
TCH01_0083_B11.b : GCCTGGCCAAGGAGCAGCTTTTGCAGAA*AAATATATGAAGGAAATCTATACAAATCAGC
TCH01_0083_B09.b : GCCTGGCCAAGGAGCAGCTTTTGCAGAANAAATATATGAAGGGAATCTATACAAATCAGC
UTR01_0084_C08.b : GCCTGGCCAAGGAGCAGCTTTTGCAGAAAAAATATATGAAAGAAATCTATACAAATCAGC
20110601C-003007 : CCACTGAAGATTATTTCACACAATTTAATACCAGAAGTCGATAATGAAAAGGCCACCTGC
---------+---------+---------+---------+---------+---------+ 1356
TCH01_0071_C12.b :
TCH01_0099_E12.b :
TCH01_0083_D09.b :
TCH01_0048_A02.b :
OVR01_0071_C10.b :
TCH01_0099_G05.b :
OVR01_0058_E01.b :
TCH01_0016_F12.b : agattgtcaagaccctatttgcggtaaatgaaacccgttgtgaaaaaaaagatgtttagg
TCH01_0062_C08.b :
TCH01_0043_E11.b :
TCH01_0049_G03.b :
UTR01_0010_C06.b :
UTR01_0032_A11.b :
UTR01_0089_D02.b :
TCH01_0002_G02.b :
OVR01_0092_D04.b :
TCH01_0079_C08.b :
LNG01_0047_B06.b :
TCH01_0083_B11.b : CCACTGAAGATATT*TCACACAATTTATACA*AGAAGTCGAT**ATGAAAAGGCCACCTG
TCH01_0083_B09.b : CCACTGAAGATTAT*TCACACAATTTAAATACAGAAGTCGATNATGAAAAGGGCCACCTG
UTR01_0084_C08.b : CCACTGAAGATTATTTCACACAATTTAATACAAGAAGTCGATAATGAAAAGGCCACCTGC
20110601C-003007 : CCTCCTGCTGAATTGTATAAAGTGCTGTACCCTTAAAGAGTCCCATGTGTTAAAAAAAAA
---------+---------+---------+---------+---------+---------+ 1416
TCH01_0071_C12.b :
TCH01_0099_E12.b :
TCH01_0083_D09.b :
TCH01_0048_A02.b :
OVR01_0071_C10.b :
TCH01_0099_G05.b :
OVR01_0058_E01.b :
TCH01_0016_F12.b : gcgcttaacggggcacatctttggtgattaaatagggttcttggaaagtttgaactggtt
TCH01_0062_C08.b :
TCH01_0043_E11.b :
TCH01_0049_G03.b :
UTR01_0010_C06.b :
UTR01_0032_A11.b :
UTR01_0089_D02.b :
TCH01_0002_G02.b :
OVR01_0092_D04.b :
TCH01_0079_C08.b :
LNG01_0047_B06.b :
TCH01_0083_B11.b : CCTCCTGCTAA*TTGTATAAAGTGCTGTACCCTTTA*GAGTCCCATGGGTTAAAAAAAAA
TCH01_0083_B09.b : CCTCCTGCTAAATTGTATAAAGTGCTGTACCCTTAAAGAGTCCCATGTGTTAAAAAAAAA
UTR01_0084_C08.b : CTTCCTGCTGAATTGTATAAAGTGCTGTACCCTTAAAGAGTCCCATGTGttaaaaaaaaa
20110601C-003007 : AAA.........................................................
---------+---------+---------+---------+---------+---------+ 1419
TCH01_0071_C12.b :
TCH01_0099_E12.b :
TCH01_0083_D09.b :
TCH01_0048_A02.b :
OVR01_0071_C10.b :
TCH01_0099_G05.b :
OVR01_0058_E01.b :
TCH01_0016_F12.b : aacacaaaataatatgactctccttaaaaaagttttactccccctctctcaatatatttt
TCH01_0062_C08.b :
TCH01_0043_E11.b :
TCH01_0049_G03.b :
UTR01_0010_C06.b :
UTR01_0032_A11.b :
UTR01_0089_D02.b :
TCH01_0002_G02.b :
OVR01_0092_D04.b :
TCH01_0079_C08.b :
LNG01_0047_B06.b :
TCH01_0083_B11.b : AAggactttggtccagaagaacttcaacttatttctcacgtcgtcaaactgataaacctt
TCH01_0083_B09.b : AAAtgcactttgttcccagaggacccttcaacttanttnccccctgtcgtcaaaactgga
UTR01_0084_C08.b : aaaaaaaaaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-003007 : ............................................................
---------+---------+---------+---------+---------+---------+ 1419
TCH01_0071_C12.b :
TCH01_0099_E12.b :
TCH01_0083_D09.b :
TCH01_0048_A02.b :
OVR01_0071_C10.b :
TCH01_0099_G05.b :
OVR01_0058_E01.b :
TCH01_0016_F12.b : tgtgtccnaataagctagataagtcaggaaattatttntntaanannntnnantgacaat
TCH01_0062_C08.b :
TCH01_0043_E11.b :
TCH01_0049_G03.b :
UTR01_0010_C06.b :
UTR01_0032_A11.b :
UTR01_0089_D02.b :
TCH01_0002_G02.b :
OVR01_0092_D04.b :
TCH01_0079_C08.b :
LNG01_0047_B06.b :
TCH01_0083_B11.b : cctgcatttcgggaggaaaaaaaaaaaaaaaaggcactgggttcaagctgcgtcgggccc
TCH01_0083_B09.b : taaaacctttcctgcatttcggtgaggaaaaaaaaaaaaaaaaaaagccccatgggctca
UTR01_0084_C08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-003007 : ............................................................
---------+---------+---------+---------+---------+---------+ 1419
TCH01_0071_C12.b :
TCH01_0099_E12.b :
TCH01_0083_D09.b :
TCH01_0048_A02.b :
OVR01_0071_C10.b :
TCH01_0099_G05.b :
OVR01_0058_E01.b :
TCH01_0016_F12.b : acgcgctgcaccgtcggttttttcatttctatatttactctggccgttatagcatcgtat
TCH01_0062_C08.b :
TCH01_0043_E11.b :
TCH01_0049_G03.b :
UTR01_0010_C06.b :
UTR01_0032_A11.b :
UTR01_0089_D02.b :
TCH01_0002_G02.b :
OVR01_0092_D04.b :
TCH01_0079_C08.b :
LNG01_0047_B06.b :
TCH01_0083_B11.b : cttaaaattcctggggggccagtttaggtaccagtttttggaaaagggcc
TCH01_0083_B09.b : actgcggtccgggccgcttaaggattcttcgggggccaaagctaccgaaccagcttctgt
UTR01_0084_C08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-003007 : ............................................................
---------+---------+---------+---------+---------+---------+ 1419
TCH01_0071_C12.b :
TCH01_0099_E12.b :
TCH01_0083_D09.b :
TCH01_0048_A02.b :
OVR01_0071_C10.b :
TCH01_0099_G05.b :
OVR01_0058_E01.b :
TCH01_0016_F12.b : ttaaaatctattacatttttttattcataaacngctttactttatctttcacgctcaatt
TCH01_0062_C08.b :
TCH01_0043_E11.b :
TCH01_0049_G03.b :
UTR01_0010_C06.b :
UTR01_0032_A11.b :
UTR01_0089_D02.b :
TCH01_0002_G02.b :
OVR01_0092_D04.b :
TCH01_0079_C08.b :
LNG01_0047_B06.b :
TCH01_0083_B11.b :
TCH01_0083_B09.b : gaaaagggtcctaaagggagccattttagccgggc
UTR01_0084_C08.b : nnnn
20110601C-003007 : ............................................................
---------+---------+---------+---------+---------+---------+ 1419
TCH01_0071_C12.b :
TCH01_0099_E12.b :
TCH01_0083_D09.b :
TCH01_0048_A02.b :
OVR01_0071_C10.b :
TCH01_0099_G05.b :
OVR01_0058_E01.b :
TCH01_0016_F12.b : agcgtactctataaattcatattcctactcta
TCH01_0062_C08.b :
TCH01_0043_E11.b :
TCH01_0049_G03.b :
UTR01_0010_C06.b :
UTR01_0032_A11.b :
UTR01_0089_D02.b :
TCH01_0002_G02.b :
OVR01_0092_D04.b :
TCH01_0079_C08.b :
LNG01_0047_B06.b :
TCH01_0083_B11.b :
TCH01_0083_B09.b :
UTR01_0084_C08.b :