[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-003094

Length: 1,612

Sequence [FASTA format sequence]
CATTCAGGGG AGGGCGTGGC TTCTCCGAGC CTCTGGGAAC CGGCCTCCCT TTCCCTTCAG
TCGTCTCCGG TCCCGCATTG CATCGGATCG CGAGGTGGTG GGGCGCGTCA GAGAGGCGCC
TGCTGCCCAA CAGCTCGCGT TCGTGTAAGC TTCGGGCTCA CCAAAAACGG AGGAAGCCCC
GGGCCTCCCG GCTGCGAGAA CCCCGGGCCG AGAGCATCCG CCTGCCGAGG ACGGGCGGGG
CCTCGAGAGA GCGCTCTCCG AACTGACCTC GGAAACCGAC GTGCCCGTTG TGTTTGTGAA
GCGGCGAAAG ATAGGCGGCC ATGGTCAAAC CCTGAAGGCT TATCAGGAGG GCAGACTTCA
AAAGCTACTG AAAATGAATG GTGCTGAGGA GCTTCCCGAG ATGTATGACT ATGACCTCAT
CATCATTGGA GGGGGCTCAG GAGGCCTGGC GGCTGCTAAG GAAGCAGCCA GATTTAACAA
GCGGGTCATG GTCCTGGATT TTGTCACTCC AACCCCTCTC GGAACTAGAT GGGGTCTCGG
AGGAACGTGT GTGAATGTAG GTTGCATACC TAAAAAACTG ATGCACCAAG CAGCTTTGTT
AGGACAAGCC CTACGAGACT CTCGAAACTA TGGGTGGAAC GTCGAGGAGA CGATTAAACA
CGACTGGGAA AGAATGACAG AAGCTGTGCA GAATCACATT GGCTCTCTGA ACTGGGGCTA
CCGCGTGGCT CTGCGGGAGA AAAAAGTCAC TTATGAGAAT GCCTATGGGC AGTTTGTTGG
GCCTCACAGA ATTAAGGCAA CAAATAACAA AGGCAAAGAA AAAATTTATT CAGCAGAGAA
ATTTCTCATT GCCACTGGTG AAAGGCCACG CTATTTGGGT ATCCCTGGTG ACAAAGAGTA
CTGCATCAGC AGTGATGATC TTTTCTCTTT ACCTTATTGC CCGGGTAAGA CCCTGGTGGT
CGGAGCATCC TATGTCGCTT TGGAATGTGC TGGATTTCTT GCCGGCATCG GTTTAGATGT
CACTGTTATG GTACGGTCCA TTCTCCTGAG AGGATTTGAC CAGGACATGG CCAACAAAAT
CGGTGAACAT ATGGAAGAAC ACGGTGTCAA GTTTATAAGA CAGTTTGTAC CAATAAAAGT
TGAACAAATC GAAGCAGGGA TGCCAGGCCG ACTCAGGGTG ACAGCTAAGG CCACTAACAG
TGACGAAACC ATCGAAGGAG AGTATAATAC GGTATTGCTG GCAATAGGAA GAGATGCTTG
CACAAGGAAC ATTGGCTTAG AAACTGTGGG GGTAGAGATA AACGAAAAGA CTGGAAAAAT
ACCTGTGACG GATGAAGAGC AGACTAATGT GCCTTATGTC TATGCCATTG GTGATATATT
GGAGGGGAAG CCAGAGCTCA CCCCCGGTAG CATCCAGGCA GGAAGGTTGC TGGCACANAG
GCTGTATGGT GGCTCCCACT GTCAGTATGA CTATGAAAAC GTTCCAACGA CCGTTTTTAC
TCCTTTGGAA TATGGTGCTT GTGGTNCTTC CGAAGAGNAN GCTGTGGAGA AATTGGGGGA
AGAAAAATAT GAGATTACCA TAGTTTACTT TGGCCGTTGG AATGGACGAT TC


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTXNRD1thioredoxin reductase 1, cytoplasmic isoform 3 [Homo sapiens]. 7880.0
Contig/Assembly ProteinTXNRD1thioredoxin reductase 1, cytoplasmic isoform 1 [Homo sapiens]. 7880.0O
Contig/Assembly ProteinTXNRD1thioredoxin reductase 1, cytoplasmic isoform 2 [Homo sapiens]. 7080.0O
Contig/Assembly ProteinTXNRD1thioredoxin reductase 1, cytoplasmic isoform 2 [Homo sapiens]. 7080.0O
Contig/Assembly ProteinTXNRD1thioredoxin reductase 1, cytoplasmic isoform 2 [Homo sapiens]. 7080.0O
Contig/Assembly ProteinTXNRD3thioredoxin reductase 3 isoform 1 [Homo sapiens]. 617e-179
Contig/Assembly ProteinTXNRD3thioredoxin reductase 3 isoform 2 [Homo sapiens]. 580e-165
Contig/Assembly ProteinTXNRD2thioredoxin reductase 2, mitochondrial precursor [Homo sapiens]. 417e-116O
Contig/Assembly ProteinGSRglutathione reductase, mitochondrial isoform 1 precursor [Homo sapiens]. 1697e-42O
Contig/Assembly ProteinGSRglutathione reductase, mitochondrial isoform 2 precursor [Homo sapiens]. 1543e-37O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTxnrd1thioredoxin reductase 1, cytoplasmic isoform 1 [Mus musculus]. 7070.0O
Contig/Assembly ProteinTxnrd1thioredoxin reductase 1, cytoplasmic isoform 2 [Mus musculus]. 6980.0O
Contig/Assembly ProteinTxnrd1thioredoxin reductase 1, cytoplasmic isoform 2 [Mus musculus]. 6980.0O
Contig/Assembly ProteinTxnrd1thioredoxin reductase 1, cytoplasmic isoform 2 [Mus musculus]. 6980.0O
Contig/Assembly ProteinTxnrd3thioredoxin reductase 3 isoform 2 [Mus musculus]. 606e-175O
Contig/Assembly ProteinTxnrd3thioredoxin reductase 3 isoform 1 [Mus musculus]. 606e-175
Contig/Assembly ProteinTxnrd2thioredoxin reductase 2, mitochondrial precursor [Mus musculus]. 411e-115O
Contig/Assembly ProteinTxnrd3thioredoxin reductase 3 isoform 3 [Mus musculus]. 2195e-57
Contig/Assembly ProteinTxnrd3thioredoxin reductase 3 isoform 4 [Mus musculus]. 2195e-57O
Contig/Assembly ProteinGsrglutathione reductase, mitochondrial precursor [Mus musculus]. 1789e-45O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTXNRD1thioredoxin reductase 1, cytoplasmic [Canis lupus familiaris]. 7970.0
Contig/Assembly ProteinTXNRD3thioredoxin reductase 3 [Canis lupus familiaris]. 617e-179O
Contig/Assembly ProteinLOC608155PREDICTED: similar to thioredoxin reductase 2 isoform 1 precursor [Canis familiaris]. 412e-115O
Contig/Assembly ProteinLOC475596PREDICTED: similar to Glutathione reductase, mitochondrial precursor (GR) (GRase) [Canis familiaris]. 1795e-45O
Contig/Assembly ProteinDLDdihydrolipoyl dehydrogenase, mitochondrial precursor [Canis lupus familiaris]. 1435e-34O
Contig/Assembly ProteinDLDPREDICTED: dihydrolipoamide: NAD+ oxidoreductase [Canis familiaris]. 1429e-34O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTXNRD1thioredoxin reductase 1, cytoplasmic [Bos taurus]. 7190.0O
Contig/Assembly ProteinTXNRD3PREDICTED: thioredoxin reductase 3 [Bos taurus]. 600e-173
Contig/Assembly ProteinTXNRD2thioredoxin reductase 2, mitochondrial precursor [Bos taurus]. 401e-112O
Contig/Assembly ProteinGSRglutathione reductase, mitochondrial [Bos taurus]. 1742e-43O
Contig/Assembly ProteinDLDdihydrolipoyl dehydrogenase, mitochondrial [Bos taurus]. 1497e-36O
Contig/Assembly ProteinDLDPREDICTED: dihydrolipoamide dehydrogenase [Bos taurus]. 1497e-36O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTXNRD1thioredoxin reductase 1, cytoplasmic [Sus scrofa]. 7560.0O
Contig/Assembly ProteinTXNRD3PREDICTED: thioredoxin reductase 3 [Sus scrofa]. 612e-175
Contig/Assembly ProteinTXNRD2thioredoxin reductase 2, mitochondrial [Sus scrofa]. 405e-113O
Contig/Assembly ProteinLOC100520493PREDICTED: hypothetical protein LOC100520493 [Sus scrofa]. 1771e-44O
Contig/Assembly ProteinLOC100621661PREDICTED: glutathione reductase, mitochondrial-like isoform 1 [Sus scrofa]. 1726e-43O
Contig/Assembly ProteinGSRPREDICTED: glutathione reductase, mitochondrial [Sus scrofa]. 1602e-39O
Contig/Assembly ProteinLOC100621661PREDICTED: glutathione reductase, mitochondrial-like isoform 2 [Sus scrofa]. 1519e-37O
Contig/Assembly ProteinDLDdihydrolipoyl dehydrogenase, mitochondrial precursor [Sus scrofa]. 1472e-35O
Contig/Assembly ProteinLOC100622918PREDICTED: dihydrolipoyl dehydrogenase, mitochondrial-like [Sus scrofa]. 1472e-35O
Contig/Assembly ProteinLOC100621661PREDICTED: glutathione reductase, mitochondrial-like isoform 3 [Sus scrofa]. 1364e-32O


Assembly Members: 13      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
AMP010078F02AMP01_0078_F02.bBW960637 
AMP010078G07AMP01_0078_G07.bBW960650 
BFLT10032C05BFLT1_0032_C05.bFS642606 
DCI010083D10DCI01_0083_D10.bDB796933 
HTMT10071F06HTMT1_0071_F06.b  
ITT010086F04ITT01_0086_F04.bBW983647 
KDN010073D07KDN01_0073_D07.bFS676242 
OVR010012B08OVR01_0012_B08.bBP141951 
OVRM10098A03OVRM1_0098_A03.bBP145110 AK348221
OVRT10063F03OVRT1_0063_F03.bFS691570 
OVRT10148D08OVRT1_0148_D08.bHX238692 
PST010050F07PST01_0050_F07.bFS700797 
SPL010041C09SPL01_0041_C09.bBP157581 

  

SNPs: 4      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
143C200.333WNCCT/P
G310.667CGT/R
191C210.500WNGCC/A
G300.500GGC/G
340C200.182WSCTA/L
T810.818TTA/L
611C900.818WSCTA/L
T200.182TTA/L


Alignment:      TOP

20110601C-003094 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRM1_0098_A03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0032_C05.b : nggatccgttcagc
OVR01_0012_B08.b : cgaaaatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0148_D08.b :
OVRT1_0063_F03.b : nnaaggttt
KDN01_0073_D07.b :
ITT01_0086_F04.b :
AMP01_0078_F02.b :
AMP01_0078_G07.b :
HTMT1_0071_F06.b :
PST01_0050_F07.b :
SPL01_0041_C09.b :
DCI01_0083_D10.b :
20110601C-003094 : .CATTCAGGGGAGGGCGTGGCTTCTCCGAGCCTCTGGGAACCGGCCTCCCTTTCCCTTCA
---------+---------+---------+---------+---------+---------+ 59
OVRM1_0098_A03.b : xCATTCAGGGGAGGGCGTGGCTTCTCCGAGCCTCTGGGAACCGGCCTCCCTTTCCCTTCA
BFLT1_0032_C05.b : gtaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0012_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0148_D08.b : nnnnncctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0063_F03.b : tnnnnnnnnccctcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0073_D07.b : nt
ITT01_0086_F04.b :
AMP01_0078_F02.b : nn
AMP01_0078_G07.b : nnc
HTMT1_0071_F06.b :
PST01_0050_F07.b :
SPL01_0041_C09.b :
DCI01_0083_D10.b :
20110601C-003094 : GTCGTCTCCGGTCCCGCATTGCATCGGATCGCGAGGTGGTGGGGCGCGTCAGAGAGGCGC
---------+---------+---------+---------+---------+---------+ 119
OVRM1_0098_A03.b : GTCGTCTCCGGTCCCGCATTGCATCGGATCGCGAGGTGGTGGGGCGCGTCAGAGAGGCGC
BFLT1_0032_C05.b : GTCGTCTCCGGTCCCGCATTGCATCGGATCGCGAGGTGGTGGGGCGCGTCAGAGAGGCGC
OVR01_0012_B08.b : GTCGTCTCCGGTCCCGCATTGCATCGGATCGCGAGGTGGTGGGGCGCGTCAGAGAGGCGC
OVRT1_0148_D08.b : xxxxxxxxxxxxxxxxxxTTGCATCGGATCGCGAGGTGGTGGGGCGCGTCAGAGAGGCGC
OVRT1_0063_F03.b : xxxxxxxxxxxxxxxxxtTTGCATCGGATCGCGAGGTGGTGGGGCGCGTCAGAGAGGCGC
KDN01_0073_D07.b : tttcctgctgtggctctggttgcTCGGATCGCGAGGTGGTGGGGCGCGTCAGAGAGGCGC
ITT01_0086_F04.b :
AMP01_0078_F02.b : cctgtacatatagccgaatcttggcgctgctcccacgccgxxxxxxxxxxxxxxxxxxxx
AMP01_0078_G07.b : cgatatcttatggcgatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_F06.b : ntaacagt
PST01_0050_F07.b :
SPL01_0041_C09.b :
DCI01_0083_D10.b :
20110601C-003094 : CTGCTGCCCAACAGCTCGCGTTCGTGTAAGCTTCGGGCTCACCAAAAACGGAGGAAGCCC
---------+---------+---------+---------+---------+---------+ 179
OVRM1_0098_A03.b : CTGCTGCCCAACAGCTCGCGTTCGTGTAAGCTTCGGGCTCACCAAAAACGGAGGAAGCCC
BFLT1_0032_C05.b : CTGCTGCCCAACAGCTCGCGTTCGTGTAAGCTTCGGGCTCACCAAAAACGGAGGAAGCCC
OVR01_0012_B08.b : CTGCTGCCCAACAGCTCGCGTTCGTGTAAGCTTCGGGCTCACCAAAAACGGAGGAAGCCC
OVRT1_0148_D08.b : CTGCTGCCCAACAGCTCGCGTTCCTGTAAGCTTCGGGCTCACCAAAAACGGAGGAAGCCC
OVRT1_0063_F03.b : CTGCTGCCCAACAGCTCGCGTTCCTGTAAGCTTCGGGCTCACCAAAAACGGAGGAAGCCC
KDN01_0073_D07.b : CTGCTGCCCAT*AGCTCGCGTTCGTGTAAGCTTCGGGCTCACCAAAAACGGAGGAAGCCC
ITT01_0086_F04.b : ttttggatgaa
AMP01_0078_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0078_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0071_F06.b : acgacgccgtagtatttatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgacttccccctt
PST01_0050_F07.b :
SPL01_0041_C09.b :
DCI01_0083_D10.b :
20110601C-003094 : CGGGCCTCCCGGCTGCGAGAACCCCGGGCCGAGAGCATCCGCCTGCCGAGGACGGGCGGG
---------+---------+---------+---------+---------+---------+ 239
OVRM1_0098_A03.b : CGGGCCTCCCGCCTGCGAGAACCCCGGGCCGAGAGCATCCGCCTGCCGAGGACGGGCGGG
BFLT1_0032_C05.b : CGGGCCTCCCGGCTGCGAGAACCCCGGGCCGAGAGCATCCGCCTGCCGAGGACGGGCGGG
OVR01_0012_B08.b : CGGGCCTCCCGGCTGCGAGAACCCCGGGCCGAGAGCATCCGCCTGCCGAGGACGGGCGGG
OVRT1_0148_D08.b : CGGGCCTCCCGCCTGCGAGAACCCCGGGCCGAGAGCATCCGCCTGCCGAGGACGGGCGGG
OVRT1_0063_F03.b : CGGGCCTCCCGCCTGCGAGAACCCCGGGCCGAGAGCATCCGCCTGCCGAGGACGGGCGGG
KDN01_0073_D07.b : CGGGCCTCCCGGCTGCGAGAACCCCGGGCCGAGAGCATCCGCCTGCCGAGGACGGGCGGG
ITT01_0086_F04.b : caxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcAGAGGACGGGCGGG
AMP01_0078_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAGGACGGGCGGG
AMP01_0078_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGAGGACGGGCGGG
HTMT1_0071_F06.b : cgcgcggggcggaaagactgaccggcttcgctctgcccttgtgcccaGAGGACGGGCGGG
PST01_0050_F07.b : nttcgcgttggctatgagaggaGGGCGGG
SPL01_0041_C09.b :
DCI01_0083_D10.b :
20110601C-003094 : GCCTCGAGAGAGCGCTCTCCGAACTGACCTCGGAAACCGACGTGCCCGTTGTGTTTGTGA
---------+---------+---------+---------+---------+---------+ 299
OVRM1_0098_A03.b : GCCTCGAGAGAGCGCTCTCCGAACTGACCTCGGAAACCGACGTGCCCGTTGTGTTTGTGA
BFLT1_0032_C05.b : GCCTCGAGAGAGCGCTCTCCGAACTGACCTCGGAAACCGACGTGCCCGTTGTGTTTGTGA
OVR01_0012_B08.b : GCCTCGAGAGAGCGCTCTCCGAACTGACCTCGGAAACCGACGTGCCCGTTGTGTTTGTGA
OVRT1_0148_D08.b : GCCTCGAGAGAGCGCTCTCCGAACTGACCTCGGAAACCGACGTGCCCGTTGTGTTTGTGA
OVRT1_0063_F03.b : GCCTCGAGAGAGCGCTCTCCGAACTGACCTCGGAAACCGACGTGCCCGTTGTGTTTGTGA
KDN01_0073_D07.b : GCCTCGAGAGAGCGCTCTCCGAACTGACCTCGGAAACCGACGTGCCCGTTGTGTTTGTGA
ITT01_0086_F04.b : GCCTCGAGAGAGCGCTCTCCGAACTGACCTCGGAAACCGACGTGCCCGTTGTGTTTGTGA
AMP01_0078_F02.b : GCCTCGAGAGAGCGCTCTCCGAACTGACCTCGGAAACCGACGTGCCCGTTGTGTTTGTGA
AMP01_0078_G07.b : GCCTCGAGAGAGCGCTCTCCGAACTGACCTCGGAAACCGACGTGCCCGTTGTGTTTGTGA
HTMT1_0071_F06.b : GCCTCGAGAGAGCGCTCTCCGAACTGACCTCGGAAACCGACGTGCCCGTTGTGTTTGTGA
PST01_0050_F07.b : GCCTCGAGAGAGCGCTCTCCGAACTGACCTCGGACACCTACGTGCCCGTTGTGTTTGTGA
SPL01_0041_C09.b : ggggctxxxxxx
DCI01_0083_D10.b :
20110601C-003094 : AGCGGCGAAAGATAGGCGGCCATGGTCAAACCCTGAAGGCTTATCAGGAGGGCAGACTTC
---------+---------+---------+---------+---------+---------+ 359
OVRM1_0098_A03.b : AGCGGCGAAAGATAGGCGGCCATGGTCAAACCCTGAAGGCTTATCAGGAGGGCAGACTTC
BFLT1_0032_C05.b : AGCGGCGAAAGATAGGCGGCCATGGTCAAACCCTGAAGGCTTATCAGGAGGGCAGACTTC
OVR01_0012_B08.b : AGCGGCGAAAGATAGGCGGCCATGGTCAAACCCTGAAGGCTTATCAGGAGGGCAGACTTC
OVRT1_0148_D08.b : AGCGGCGAAAGATAGGCGGCCATGGTCAAACCCTGAAGGCTTATCAGGAGGGCAGACTTC
OVRT1_0063_F03.b : AGCGGCGAAAGATAGGCGGCCATGGTCAAACCCTGAAGGCTTATCAGGAGGGCAGACTTC
KDN01_0073_D07.b : AGCGGCGAAAGATAGGCGGCCATGGTCAAACCCTGAAGGCTTATCAGGAGGGCAGACTTC
ITT01_0086_F04.b : AGCGGCGAAAGATAGGCGGCCATGGTCAAACCCTGAAGGCTTATCAGGAGGGCAGACTTC
AMP01_0078_F02.b : AGCGGCGAAAGATAGGCGGCCATGGTCAAACCCTGAAGGCCTATCAGGAGGGCAGACTTC
AMP01_0078_G07.b : AGCGGCGAAAGATAGGCGGCCATGGTCAAACCCTGAAGGCCTATCAGGAGGGCAGACTTC
HTMT1_0071_F06.b : AGCGGCGAAAGATAGGCGGCCATGGTCAAACCCTGAAGGCTTATCAGGAGGGCAGACTTC
PST01_0050_F07.b : AGCGGCGAAAGATAGGCGGCCATGGTCAAACCCTGAAGGCTTATCAGGAGGGCAGACTTC
SPL01_0041_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0083_D10.b :
20110601C-003094 : AAAAGCTACTGAAAATGAATGGTGCTGAGGAGCTTCCCGAGATGTATGACTATGACCTCA
---------+---------+---------+---------+---------+---------+ 419
OVRM1_0098_A03.b : AAAAGCTACTGAAAATGAATGGTGCTGAGGAGCTTCCCGAGATGTATGACTATGACCTCA
BFLT1_0032_C05.b : AAAAGCTACTGAAAATGAATGGTGCTGAGGAGCTTCCCGAGATGTATGACTATGACCTCA
OVR01_0012_B08.b : AAAAGCTACTGAAAATGAATGGTGCTGAGGAGCTTCCCGAGATGTATGACTATGACCTCA
OVRT1_0148_D08.b : AAAAGCTACTGAAAATGAATGGTGCTGAGGAGCTTCCCGAGATGTATGACTATGACCTCA
OVRT1_0063_F03.b : AAAAGCTACTGAAAATGAATGGTGCTGAGGAGCTTCCCGAGATGTATGACTATGACCTCA
KDN01_0073_D07.b : AAAAGCTACTGAAAATGAATGGTGCTGAGGAGCTTCCCGAGATGTATGACTATGACCTCA
ITT01_0086_F04.b : AAAAGCTACTGAAAATGAATGGTGCTGAGGAGCTTCCCGAGATGTATGACTATGACCTCA
AMP01_0078_F02.b : AAAAGCTACTGAAAATGAATGGTGCTGAGGAGCTTCCCGAGATGTATGACTATGACCTCA
AMP01_0078_G07.b : AAAAGCTACTGAAAATGAATGGTGCTGAGGAGCTTCCCGAGATGTATGACTATGACCTCA
HTMT1_0071_F06.b : AAAAGCTACTGAAAATGAATGGTGCTGAGGAGCTTCCCGAGATGTATGACTATGACCTCA
PST01_0050_F07.b : AAAAGCTACTGAAAATGAATGGTGCTGAGGAGCTTCCCGAGATGTATGACTATGACCTCA
SPL01_0041_C09.b : xxxxxxxxxxxxxxATGAATGGTGCTGAGGAGCTTCCCGAGATGTATGACTATGACCTCA
DCI01_0083_D10.b :
20110601C-003094 : TCATCATTGGAGGGGGCTCAGGAGGCCTGGCGGCTGCTAAGGAAGCAGCCAGATTTAACA
---------+---------+---------+---------+---------+---------+ 479
OVRM1_0098_A03.b : TCATCATTGGAGGGGGCTCAGGAGGCCTGGCGGCTGCTAAGGAAGCAGCCAGATTTAACA
BFLT1_0032_C05.b : TCATCATTGGAGGGGGCTCAGGAGGCCTGGTGGCTGCTAAGGAAGCAGCCAGATTTAACA
OVR01_0012_B08.b : TCATCATTGGAGGGGGCTCAGGAGGCCTGGCGGCTGCTAAGGAAGCAGCCAGATTTAACA
OVRT1_0148_D08.b : TCATCATTGGAGGGGGCTCAGGAGGCCTGGCGGCTGCTAAGGAAGCAGCCAGATTTAACA
OVRT1_0063_F03.b : TCATCATTGGAGGGGGCTCAGGAGGCCTGGCGGCTGCTAAGGAAGCAGCCAGATTTAACA
KDN01_0073_D07.b : TCATCATTGGAGGGGGCTCAGGAGGCCTGGCGGCTGCTAAGGAAGCAGCCAGATTTAACA
ITT01_0086_F04.b : TCATCATTGGAGGGGGCTCAGGAGGCCTGGCGGCTGCTAAGGAAGCAGCCAGATTTAACA
AMP01_0078_F02.b : TCATCATTGGAGGGGGCTCAGGAGGCCTGGCGGCTGCTAAGGAAGCAGCCAGATTTAACA
AMP01_0078_G07.b : TCATCATTGGAGGGGGCTCAGGAGGCCTGGCGGCTGCTAAGGAAGCAGCCAGATTTAACA
HTMT1_0071_F06.b : TCATCATTGGAGGGGGCTCAGGAGGCCTGGCGGCTGCTAAGGAAGCAGCCAGATTTAACA
PST01_0050_F07.b : TCATCATTGGAGGGGGCTCAGGAGGCCTGGCGGCTGCTAAGGAAGCAGCCAGATTTAACA
SPL01_0041_C09.b : TCATCATTGGAGGGGGCTCAGGAGGCCTGGCGGCTGCTAAGGAAGCAGCCAGATTTAACA
DCI01_0083_D10.b :
20110601C-003094 : AGCGGGTCATGGTCCTGGATTTTGTCACTCCAACCCCTCTCGGAACTAGATGGGGTCTCG
---------+---------+---------+---------+---------+---------+ 539
OVRM1_0098_A03.b : AGCGGGTCATGGTCCTGGATTTTGTCACTCCAACCCCTCTCGGAACTAGATGGGGTCTCG
BFLT1_0032_C05.b : AGCGGGTCATGGTCCTGGATTTTGTCACTCCAACCCCTCTCGGAACTAGATGGGGTCTCC
OVR01_0012_B08.b : AGCGGGTCATGGTCCTGGATTTTGTCACTCCAACCCCTCTCGGAACTAGATGGGGTCTCG
OVRT1_0148_D08.b : AGCGGGTCATGGTCCTGGATTTTGTCACTCCAACCCCTCTCGGAACTAGATGGGGTCTCG
OVRT1_0063_F03.b : AGCGGGTCATGGTCCTGGATTTTGTCACTCCAACCCCTCTCGGAACTAGATGGGGTCTCG
KDN01_0073_D07.b : AGCGGGTCATGGTCCTGGATTTTGTCACTCCAACCCCTCTCGGAACTAGATGGGGTCTCG
ITT01_0086_F04.b : AGCGGGTCATGGTCCTGGATTTTGTCACTCCAACCCCTCTCGGAACTAGATGGGGTCTCG
AMP01_0078_F02.b : AGCGGGTCATGGTCCTGGATTTTGTCACTCCAACCCCTCTCGGAACTAGATGGGGTCTCG
AMP01_0078_G07.b : AGCGGGTCATGGTCCTGGATTTTGTCACTCCAACCCCTCTCGGAACTAGATGGGGTCTCG
HTMT1_0071_F06.b : AGCGGGTCATGGTCCTGGATTTTGTCACTCCAACCCCTCTCGGAACTAGATGGGGTCTCG
PST01_0050_F07.b : AGCGGGTCATGGTCCTGGATTTTGTCACTCCAACCCCTCTCGGAACTAGATGGGGTCTCG
SPL01_0041_C09.b : AGCGGGTCATGGTCCTGGATTTTGTCACTCCAACCCCTCTCGGAACTAGATGGGGTCTCG
DCI01_0083_D10.b : nntttacgtaatctaagggctgctcgcgcgccgxxx
20110601C-003094 : GAGGAACGTGTGTGAATGTAGGTTGCATACCTAAAAAACTGATGCACCAAGCAGCTTTGT
---------+---------+---------+---------+---------+---------+ 599
OVRM1_0098_A03.b : GAGGAACGTGTGTGAATGTAGGTTGCATACCTACAAAACTGATGCACCAAGCAGCTTTGT
BFLT1_0032_C05.b : GAGGAACGTGTGTGAATGTAGGTTGCATACCTAAAAAACTGATGCACCAAGCAGCTTTGT
OVR01_0012_B08.b : GAGGAACGTGTGTGAATGTAGGTTGCATACCTAAAAAACTGATGCACCAAGCAGCTTTGT
OVRT1_0148_D08.b : GAGGAACGTGTGTGAATGTAGGTTGCATACCTAAAAAACTGATGCACCAAGCAGCTTTGT
OVRT1_0063_F03.b : GAGGAACGTGTGTGAATGTAGGTTGCATACCTAAAAAACTGATGCACCAAGCAGCTTTGT
KDN01_0073_D07.b : GAGGAACGTGTGTGAATGTAGGTTGCATACCTAAAAAACTGATGCACCAAGCAGCTTTGT
ITT01_0086_F04.b : GAGGAACGTGTGTGAATGTAGGTTGCATACCTAAAAAACTGATGCACCAAGCAGCTTTGT
AMP01_0078_F02.b : GAGGAACGTGTGTGAATGTAGGTTGCATACCTAAAAAACTGATGCACCAAGCAGCTTTGT
AMP01_0078_G07.b : GAGGAACGTGTGTGAATGTAGGTTGCATACCTAAAAAACTGATGCACCAAGCAGCTTTGT
HTMT1_0071_F06.b : GAGGAACGTGTGTGAATGTAGGTTGCATACCTAAAAAACTGATGCACCAAGCAGCTTTGT
PST01_0050_F07.b : GAGGAACGTGTGTGAATGTAGGTTGCATACCTAAAAAACTGATGCACCAAGCAGCTTTGT
SPL01_0041_C09.b : GAGGAACGTGTGTGAATGTAGGTTGCATACCTAAAAAACTGATGCACCAAGCAGCTTTGT
DCI01_0083_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-003094 : TAGGACAAGCCCTACGAGACTCTCGAAACTATGGGTGGAACGTCGAGGAGACGATTAAAC
---------+---------+---------+---------+---------+---------+ 659
OVRM1_0098_A03.b : TAGGACAAGCCCTACGAGACTCTCGAAACTATGGGTGGAACGTCGAGGAGACGATTTAAC
BFLT1_0032_C05.b : TAGGACAAGCCCTACGAGACTCTCGAAACTATGGGTGGAACGTCGAGGAGACGATTAAAC
OVR01_0012_B08.b : TAGGACAAGCCCTACGAGACTCTCGAAACTATGGGTGGAACGTCGAGGAGACGATTAAAC
OVRT1_0148_D08.b : TAGGACAAGCCCTACGAGACTCTCGAAACTATGGGTGGAACGTCGAGGAGACGATTAAAC
OVRT1_0063_F03.b : TAGGACAAGCCCTACGAGACTCTCGAAACTATGGGTGGAACGTCGAGGAGACGATTAAAC
KDN01_0073_D07.b : TAGGACAAGCCCTACGAGACTCTCGAAACTATGGGTGGAACGTCGAGGAGACGATTAAAC
ITT01_0086_F04.b : TAGGACAAGCCCTACGAGACTCTCGAAACTATGGGTGGAACGTCGAGGAGACGATTAAAC
AMP01_0078_F02.b : TAGGACAAGCCTTACGAGACTCTCGAAACTATGGGTGGAACGTCGAGGAGACGATTAAAC
AMP01_0078_G07.b : TAGGACAAGCCTTACGAGACTCTCGAAACTATGGGTGGAACGTCGAGGAGACGATTAAAC
HTMT1_0071_F06.b : TAGGACAAGCCCTACGAGACTCTCGAAACTATGGGTGGAACGTCGAGGAGACGATTAAAC
PST01_0050_F07.b : TAGGACAAGCCCTACGAGACTCTCGAAACTATGGGTGGAACGTCGAGGAGACGATTAAAC
SPL01_0041_C09.b : TAGGACAAGCCCTACGAGACTCTCGAAACTATGGGTGGAACGTCGAGGAGACGATTAAAC
DCI01_0083_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-003094 : ACGACTGGGAAAGAATGACAGAAGCTGTGCAGAATCACATTGGCTCTCTGAACTGGGGCT
---------+---------+---------+---------+---------+---------+ 719
OVRM1_0098_A03.b : ACGACTGGTGAAGAACGACANAGGCTGTGCAGAATCACATTGGCTCTCTGAACTGGGGCT
BFLT1_0032_C05.b : ACGACTGGGAAAGAATGACAGAAGCTGTGCAGAATCACATTGGCTCTCTGAACTGGGGTT
OVR01_0012_B08.b : ACGACTGGGAAAGAATGACAGAAGCTGTGCAGAATCACATTGGCTCTCTGAACTGGGGCT
OVRT1_0148_D08.b : ACGACTGGGAAAGAATGACAGAAGCTGTGCAGAATCACATTGGCTCTCTGAACTGGGGCT
OVRT1_0063_F03.b : ACGACTGGGAAAGAATGACAGAAGCTGTGCAGAATCACATTGGCTCTCTGAACTGGGGCT
KDN01_0073_D07.b : ACGACTGGGAAAGAATGACAGAAGCTGTGCAGAATCACATTGGCTCTCTGAACTGGGGCT
ITT01_0086_F04.b : ACGACTGGGAAAGAATGACAGAAGCTGTGCAGAATCACATTGGCTCTCTGAACTGGGGCT
AMP01_0078_F02.b : ACGACTGGGAAAGAATGACAGAAGCTGTGCAGAATCACATTGGCTCTCTGAACTGGGGCT
AMP01_0078_G07.b : ACGACTGGGAAAGAATGACAGAAGCTGTGCAGAATCACATTGGCTCTCTGAACTGGGGCT
HTMT1_0071_F06.b : ACGACTGGGAAAGAATGACAGAAGCTGTGCAGAATCACATTGGCTCTCTGAACTGGGGCT
PST01_0050_F07.b : ACGACTGGGAAAGAATGACAGAAGCTGTGCAGAATCACATTGGCTCTCTGAACTGGGGCT
SPL01_0041_C09.b : ACGACTGGGAAAGAATGACAGAAGCTGTGCAGAATCACATTGGCTCTCTGAACTGGGGCT
DCI01_0083_D10.b : xxxACTGGGAAAGAATGACAGAAGCTGTGCAGAATCACATTGGCTCTCTGAACTGGGGCT
20110601C-003094 : ACCGCGTGGCTCTGCGGGAGAAAAAAG*TCACTTATGAGAATGCCTATGGGCAGTTTGTT
---------+---------+---------+---------+---------+---------+ 778
OVRM1_0098_A03.b : ACCGCGTGGCTCTGCcggtataaaagtcgcctatgagatggctat
BFLT1_0032_C05.b : ACCGCGTGGCTCTGCGGGAGAAAAAAG*TCACTTATGAGAATGCCTATGGGCAGTTTGTT
OVR01_0012_B08.b : ACCGCGTGGCTCTGCGGGAGAAAAAAG*TCACTTATGAGAATGCCTATGGGCAGTTTGTT
OVRT1_0148_D08.b : ACCGCGTGGCTCTGCGGGAGAAAAAAG*TCACTTATGAGAATGCCTATGGGCAGTTTGTT
OVRT1_0063_F03.b : ACCGCGTGGCTCTGCGGGAGAAAAAAG*TCACTTATGAGAATGCCTATGGGCAGTTTGTT
KDN01_0073_D07.b : ACCGCGTGGCTCTGCGGGAGAAAAAAG*TCACTTATGAGAATGCCTATGGGCAGTTTGTT
ITT01_0086_F04.b : ACCGCGTGGCTCTGCGGGAGAAAAAAG*TCACTTATGAGAATGCCTATGGGCAGTTTGTT
AMP01_0078_F02.b : ACCGCGTGGCTCTGCGGGAGAAAAAAG*TCACTTATGAGAATGCCTATGGGCAGTTTGTT
AMP01_0078_G07.b : ACCGCGTGGCTCTGCGGGAGAAAAAAG*TCACTTATGAGAATGCCTATGGGCAGTTTGTT
HTMT1_0071_F06.b : ACCGCGTGGCTCTGCGGGAGAAAAAAGTTCACTTATGAGAATGCCTATGGGCAGTTTGTT
PST01_0050_F07.b : ACCGCGTGGCTCTGCGGGAGAAAAAAG*TCACTTATGAGAATGCCTATGGGCAGTTTGTT
SPL01_0041_C09.b : ACCGCGTGGCTCTGCGGGAGAAAAAAG*TCACTTATGAGAATGCCTATGGGCAGTTTGTC
DCI01_0083_D10.b : ACCGCGTGGCTCTGCGGGAGAAAAAAG*TCACTTATGAGAATGCCTATGGGCAGTTTGTT
20110601C-003094 : GGGCCTCACAGAATTAAGGCAACAAATAACAAAGGCAAAGA*AAAAATTTATTCAGCAGA
---------+---------+---------+---------+---------+---------+ 837
OVRM1_0098_A03.b :
BFLT1_0032_C05.b : GGGCCTCACAGAATTAAGGCAANNCAATACAAAGGCAAAGAAAAAAATTTATTCAGCAGA
OVR01_0012_B08.b : GGGCCTCACAGAATTAAGGCAACAAATAACAAAGGCAAAGA*AAAAATTTATTCAGCAGA
OVRT1_0148_D08.b : GGGCCTCACAGAATTAAGGCAACAAATAACAA*GGCAAAGA**AAAATTTATTCAGCAGA
OVRT1_0063_F03.b : GGGCCTCACAGAATTAAGGCAACAAATAACAAAGGCAAAGA*AAAAATTTATTCAGCAGA
KDN01_0073_D07.b : GGGCCTCACAGAATTAAGGCAACAAATAACAAAGGCAAAGA*AAAAATTTATTCAGCAGA
ITT01_0086_F04.b : GGGCCTCACAGAATTAAGGCAACAAATAACAAAGGCAAAGA*AAAAATTTATTCAGCAGA
AMP01_0078_F02.b : GGGCCTCACAGAATTAAGGCAACAAATAACAAAGGCAAAGA*AAAAATTTATTCAGCAGA
AMP01_0078_G07.b : GGGCCTCACAGAATTAAGGCAACAAATAACAAAGGCAAAGA*AAAAATTTATTCAGCAGA
HTMT1_0071_F06.b : GGGCCTCACAGAATTAAGGCAACAAATAACAAAGGCAAAGA*AAAAATTTATTCAGCAGA
PST01_0050_F07.b : GGGCCTCACAGAATTAAGGCGACAAATAACAAAGGCAAAGA*AAAAATTTATTCAGCAGA
SPL01_0041_C09.b : GGGCCTCACAGAATTAAGGCAACAAATAACAAAGGCAAAGA*AAAAATTTATTCAGCAGA
DCI01_0083_D10.b : GGGCCTCACAGAATTAAGGCAACAAATAACAAAGGCAAAGA*AAAAATTTATTCAGCAGA
20110601C-003094 : GAAATTTCTCATTGCCACTGGTGAAAGGCCACGCTATTTGGGTATCCCTGGTGACAAAGA
---------+---------+---------+---------+---------+---------+ 897
OVRM1_0098_A03.b :
BFLT1_0032_C05.b : GAAATTTCTCATTGCCACTGGTGAAAAGCCACGCTATTTGGGTATCCCTGGTGNACAAGA
OVR01_0012_B08.b : GAAATTTCTCATTGCCACTGGTGAAAGGCCACGCTATTTGGGTATCCCTGGTGACAAAGA
OVRT1_0148_D08.b : GAAATTTCTTATTTGCACTGGTGAAAGGCCACGCTATTTGGGTATCCCTGGTGACAAGGA
OVRT1_0063_F03.b : GAAATTTCTTATTGCCACTGGTGAAAGGGCACGCTATTTGGGTATCCCTGGTGACNAGGA
KDN01_0073_D07.b : GAAATTTCTCATTGCCACTGGTGAAAGGCCACGCTATTTGGGTATCCCTGGTGACAAAGA
ITT01_0086_F04.b : GAAATTTCTCATTGCCACTGGTGAAAGGCCACGCTATTTGGGTATCCCTGGTGACAAAGA
AMP01_0078_F02.b : GAAATTTCTCATTGCCACTGGTGAAGGGCCACGCTATTTGGGTATCCCTGGTGACAAAGA
AMP01_0078_G07.b : GAAATTTCTCATTGCCACTGGTGAAGGGCCACGCTATTTGGGTATCCCTGGTGACAAAGA
HTMT1_0071_F06.b : GAAATTTCTCATTGCCACTGGTGAAAGGCCACGCTATTTGGGTATCCCTGGTGACCAAGA
PST01_0050_F07.b : GAAATTTCTCATTGCCACTGGTGAAAGGCCACGCTATTTGGGTATCCCTGGTGACAAAGA
SPL01_0041_C09.b : GAAATTTCTCATTGCCACTGGTGAAAGGCCACGCTATTTGGGTATCCCTGGTGACAAAGA
DCI01_0083_D10.b : GAAATTTCTCATTGCCACTGGTGAAAGGCCACGCTATTTGGGTATCCCTGGTGACAAAGA
20110601C-003094 : GTACTGCATCAGCAGTGATGATCTTTTCTCTTTACCTTATTGCCCGGGTAAGACCCTGGT
---------+---------+---------+---------+---------+---------+ 957
OVRM1_0098_A03.b :
BFLT1_0032_C05.b : GTACTGCATCAGCAGTGATGATCTTTTCTCTTTACCT*ATTGCCCGGGNTAGAACCTGGT
OVR01_0012_B08.b : GTACTGCATCAGCAGTGATGATCTTTTCTCTTTACCTTATTGCCCGGGTAAGACCCTGGT
OVRT1_0148_D08.b : GTACTGCATCACCAGTGATGATCTTTTCTCTTTACCCTATgcccgggtagaaccctggtg
OVRT1_0063_F03.b : GTACTGCATCAGCAGTGATGATCTTTTCTCTTTACCTTAATGCCCGGGTAAGACCCTGGT
KDN01_0073_D07.b : GTACTGCATCAGCAGTGATGATCTTTTCTCTTTACCTTATTGCCCGGGTAAGACCCTGGT
ITT01_0086_F04.b : GTACTGCATCAGCAGTGATGATCTTTTCTCTTTACCTTATTGCCCGGGTAAGACCCTGGT
AMP01_0078_F02.b : GTACTGCATCAGCAGTGATGATCTTTTCTCTTTACCTTATTGCCCGGGTAAGACCCTGGT
AMP01_0078_G07.b : GTACTGCATCAGCAGTGATGATCTTTTCTCTTTACCTTATTGCCCGGGTAAGACCCTGGT
HTMT1_0071_F06.b : GTACTGCATCAGCAGTGATGATCTTTTCTCTTTACCTTATTGCCCGGGTAAGACCCTGGT
PST01_0050_F07.b : GTACTGCATCAGCAGTGATGATCTTTTCTCTTTACCTTATTGCCCGGGTAAGACCCTGGT
SPL01_0041_C09.b : GTACTGCATCAGCAGTGATGATCTTTTCTCTTTACCTTATTGCCCGGGTAAGACCCTGGT
DCI01_0083_D10.b : GTACTGCATCAGCAGTGATGATCTTTTCTCTTTACCTTATTGCCCGGGTAAGACCCTGGT
20110601C-003094 : GGTCGGAGCATCCTATGTCGCTTTGGAATGTGCTGGATTTCTTGCCGGCATCGGTTTAGA
---------+---------+---------+---------+---------+---------+ 1017
OVRM1_0098_A03.b :
BFLT1_0032_C05.b : GGTCGGAGCATCCTATGTCGCTTTGGGATGGGCTGGGATTCTTGGCCGCATCGGTTTAAA
OVR01_0012_B08.b : GGTCGGAGCATCCTATGTCGCTTTGGAATGTGCTGAATTTCTTGCCGGCATCCGTTTAGA
OVRT1_0148_D08.b : tcggaacatccaagtcgctttggatgtgctgaatttcttgccggcaccgtttaatgtccc
OVRT1_0063_F03.b : GTTCGGAGCATCCTATGTCccttggaaaggtgctggaattctggcggcatccgtttaaat
KDN01_0073_D07.b : GGTCGGAGCATCCTATGTCGCTTTGGAATGTGCTGGATTTCTTGCCGGCATCGGTTTAGA
ITT01_0086_F04.b : GGTCGGAGCATCCTATGTCGCTTTGGAATGTGCTGGATTTCTTGCCGGCATCGGGTTAGA
AMP01_0078_F02.b : GGTCGGAGCATCCTATGTCGCTTTGGAATGTGCTGGATTTTCTGCCGGCATCGGTTTAGA
AMP01_0078_G07.b : GGTCGGAGCATCCTATGTCGCTTTGGGATGTGCTGGATTTCTTGCCGGCATCGGTTTAGA
HTMT1_0071_F06.b : GGTCGGAGCATCCTATGTCGCTTTGGGAAGTGCTGGATTTCTTGC*GGCCTCGGTTTAAA
PST01_0050_F07.b : GGTCGGAGCATCCTATGTCGCTTTGGAATGTGCTGGATTTCTTGCCGGCATCGGTTTAGA
SPL01_0041_C09.b : GGTCGGAGCATCCTATGTCGCTTTGGAATGTGCTGGATTTCTTGCCGGCATCGGTTTAGA
DCI01_0083_D10.b : GGTCGGAGCATCCTATGTCGCTTTGGAATGTGCTGGATTTCTTGCCGGCATCGGTTTAGA
20110601C-003094 : TGTCACTGTTATGGTACGGTCCATTCTCCTGAGAGGATTTGACCAGGACATGGCCAACAA
---------+---------+---------+---------+---------+---------+ 1077
OVRM1_0098_A03.b :
BFLT1_0032_C05.b : TGTCACTGGTATGGTACGGTTCATTCTCCTGAAAGGATTTGACCAGGACTTGGCAAACAA
OVR01_0012_B08.b : TGTCACTGTTATGGTACGGTCCATTCTCCTGAGAGGATTTGACCAGGACATGGCCcaaca
OVRT1_0148_D08.b : tgttagggacggcccttccccggaaaggattgaccggaactggcaacaaatccggaacat
OVRT1_0063_F03.b : ggccctggtaaggtacggtccattctcctgaaagatttgacaaggacatggcaacaaaac
KDN01_0073_D07.b : TGTCACTGGTATGGTACGGTCCATTCTCCTGAGAGGATTTGACCAGNACATGGNCCACAA
ITT01_0086_F04.b : TGTCACTGTTATGGTACGGTCCATTCTCCTGAGAGGATTTGACCAGGACATGGCCAACAA
AMP01_0078_F02.b : TGTCACTGTTATGGTACGGTCCATTCTCCTGAGAGGATTTNGACAGGACATGGCCAAC*A
AMP01_0078_G07.b : TGTCACTGTTATGGTACGGTCCATTCTCCCTGAGAGATTTGACCCAGACATGGCCNACA*
HTMT1_0071_F06.b : TGTC*CTGTTTTGGGACGGTCCATTCTCCTGAGAGGATTTGACCATGAAATGGGCAACAA
PST01_0050_F07.b : TGTCACTGTTATGGTACGGTCCATTCTCCTGAGAGGATTTGACCAGGACATGGCCAACAA
SPL01_0041_C09.b : TGTCACTGTTATGGTACGGTCCATTCTCCTGAGAGGATTTGACCAGGACATGGCCAACAA
DCI01_0083_D10.b : TGTCACTGTTATGGTACGGTCCATTCTCCTGAGAGGATTTGACCAGGACATGGCCAACAA
20110601C-003094 : AATCGGTGAACATATGGAAGAACACGGTGTCAAGTTTATAAGACAGTTTGTACCAATAAA
---------+---------+---------+---------+---------+---------+ 1137
OVRM1_0098_A03.b :
BFLT1_0032_C05.b : Atccgtggaactttgaagaacccgggggccagtttaataaacagttggtaccataaaagt
OVR01_0012_B08.b : aattcggggaacatatggaaagaaccccgggggtcaagtttaattaaaaaaaggtttgtt
OVRT1_0148_D08.b : tggaagaccggggtcaagtttaaaacagtttgacataaaattgaaaatcgaacgggatgc
OVRT1_0063_F03.b : cggggaactaggaaaaacccggggtcagtttaaaaaaagtttgacccaataaagttaaca
KDN01_0073_D07.b : AATCGGTGAACATATGGGAGAACACGGTGTCAAGTTTTATAGACAGTTTGTACCCATAAA
ITT01_0086_F04.b : AATCGGTGAACATATGGAAGAACACGGTGTCAAGTTTATAAGACAGTTTGTACCAATAAA
AMP01_0078_F02.b : AATCNGTGAACATATGGAAGAACACNNGTGTCAGTTTNATAGACAGTTTGTACCNATAAA
AMP01_0078_G07.b : AATCNGTGAACATATGGAAGAAACACGGTGTCAGTTTATAGGACAGTTTGTACCCATAAA
HTMT1_0071_F06.b : AATCGGTAAACATTTGGAAAAACACGTGGTCAATTTAATAAAACAGTTTGTACCATTAAA
PST01_0050_F07.b : AATCGGTGAACATATGGAAGAACACGGTGTCAAGTTTATAAGACAGTTTGTACCANTAAA
SPL01_0041_C09.b : AATCGGTGAACATATGGAAGAACACGGTGTCAAGTTTATAAGACAGTTTGTACCAATAAA
DCI01_0083_D10.b : AATCGGTGAACATATGGAAGAACACGGTGTCAAGTTTATAAGACAGTTTGTACCAATAAA
20110601C-003094 : AGTTGAACAAATCGAAGCAGGGATGCCAGGCCGACTCAGGG*TGACAGCTAAGGCCACTA
---------+---------+---------+---------+---------+---------+ 1196
OVRM1_0098_A03.b :
BFLT1_0032_C05.b : tgaaaatcccaacagggatgccgggccattcgggtgaaacctaagcccttacgtgggaca
OVR01_0012_B08.b : acccaattaaaaagttgaaaacaaattccaaaagcaag
OVRT1_0148_D08.b : ccgccaaccgggtaaaccagggcctaaagtgaaaaccccggaggaattttacggtttcgg
OVRT1_0063_F03.b : aatcaaacagggattgccggccaaccgggtgaacttaaggccctaaagggacaaccccga
KDN01_0073_D07.b : gttgaacaantcgagcgggtatgcaggccgactcagggtgacgctagggcactaccgtga
ITT01_0086_F04.b : AGTTGAACAAATCGAAGCAGGGATGCAAGGCCGACTCAGGT*TGACAGCTTAGGCCcact
AMP01_0078_F02.b : AGTTGAACAAtcnagcagggatgccagnccgactcaggtgacangctaggccctacaatg
AMP01_0078_G07.b : GTTTGAACAAATCGAGC**GGGATGCCAGGCCGACTCAGGG*TGACAGCTAgggccnnct
HTMT1_0071_F06.b : ttttaaacaattccatcagggttgccaggtccactcttggtgaacactaagggcctttac
PST01_0050_F07.b : AGTTGAACAAATCGAAGCAGGGATGCCAGGCCGACTCAGGG*TGACAGCTAAGGCCACTA
SPL01_0041_C09.b : AGTTGAACAAATCGAAGCAAGGATGCCAGGCCGACTCAGGGGTGACAGCTAAGGCCACTA
DCI01_0083_D10.b : AGTTGAACAAATCGAAGCAGGGATGCCAGGCCGACTCAGGG*TGACAGCTAAGGCCACTA
20110601C-003094 : ACAGTGACGAAACCATCGAA*GGAGAGTATAATACGGTA*TTGCTGGCAATAGGAAGAGA
---------+---------+---------+---------+---------+---------+ 1254
OVRM1_0098_A03.b :
BFLT1_0032_C05.b : aacctccagggagattaaaacggtttgggtgcaatagaaaaatcttgcccaaaaaattgc
OVR01_0012_B08.b :
OVRT1_0148_D08.b : ggcaagaagaatgcgtccaaaaaatggctaaaacggggggaaaaaaaaaagaggaaaaac
OVRT1_0063_F03.b : agggaaataaacggattgggggaaaaaaaaaatgctgcaaaaaaatggcttaaatggggg
KDN01_0073_D07.b : cgaacccntcgaggagagttataccggattgctgcaatggaaaaatgctgcacagaaaaa
ITT01_0086_F04.b : acagtgacaaaacatccaaggaaagtataatacggtatgctggcataggaaagaatgctt
AMP01_0078_F02.b : acaaaccatcaaggaaatttaatacgtatgctggccatagaaaaaatcttgccacaaaac
AMP01_0078_G07.b : acatgacgaaacatccgaggaaatattataccgtattctggaataggaaaaatgctgcca
HTMT1_0071_F06.b : agtgacaaaccctcgaaggggagaatatttcgttttggtgggcaatagaaaaatgctttc
PST01_0050_F07.b : GCAGTGACGAAACCATCGAA*GGAGAGTANTATACGGTA*TTGCTGGGCATAGGAAGAGA
SPL01_0041_C09.b : ACAGTGACCAAACCATCGAAAGGAGAGTATAATACGGTATTTGCTGGCAATAGGAAaaga
DCI01_0083_D10.b : ACAGTGACGAAACCATCGAA*GGAGAGTATAATACGGTA*TTGCTGGCAATAGGAAGAGA
20110601C-003094 : TGCTTGCACAAGGAACATTGGCTTAGAAACTGTGGGGGTAGAGATAAACGAAAAGACTGG
---------+---------+---------+---------+---------+---------+ 1314
OVRM1_0098_A03.b :
BFLT1_0032_C05.b : ttaaaacgtggggggagataaaagaaaagtgaaaaatcttgtgagaaaaaaacaaaaagg
OVR01_0012_B08.b :
OVRT1_0148_D08.b : ttttgggaaaaacaatatgccttttttctctttgaaaatgggggaaacaacccccccaca
OVRT1_0063_F03.b : gggaaaaaaaaaaaggggaaaatctgtgagggaaaaaaaaaaggcgctttttctccctgg
KDN01_0073_D07.b : tggctaaaactggggggtaaaaataaccaaaacgtgaaaaatctgggcggagtagagcca
ITT01_0086_F04.b : gcccaaaaaaattgccttaaaaacggggggggaaaaataaacaaaaaacgggaaaatacc
AMP01_0078_F02.b : ttgcttaaaccggtgggggaaaaaaacaaaaaatggaaaatccgtgacgatgaaaaaaca
AMP01_0078_G07.b : aaaacatggcctaaaatggggggggaaataaaccaaaatggaaaatccgttaggggaaac
HTMT1_0071_F06.b : accagaaactttgttttaaacgtggggggaagaataaacgaaaaactgaaaaattcctgg
PST01_0050_F07.b : TGCTTTGCACAGAAACATTGGCTTAGAAACTGTGGGGGTAGAGATAAcgaaagactggaa
SPL01_0041_C09.b : aatggctttggcccagaaaacttggccttaaaaacttggggggggtaaaaaataaacgaa
DCI01_0083_D10.b : TGCTTGCACAAGGAACATTGGCTTAGAAACTGTGGGGGTAGAGATAAACGAAAAGACTGG
20110601C-003094 : AAAAATACCTGTGACGGATGAAGAGCAGACTAATGTGCCTTATGTCTATGCCATTGGTGA
---------+---------+---------+---------+---------+---------+ 1374
OVRM1_0098_A03.b :
BFLT1_0032_C05.b : cctattctcccctgggaattagggggaaacgaactcccggacatcccagaagggtgggaa
OVR01_0012_B08.b :
OVRT1_0148_D08.b : cagaggggggcgggagggggggcccccaggaaaaaaacacactttctcttaattggtgtt
OVRT1_0063_F03.b : ggaaaaggggggaacacacccccct
KDN01_0073_D07.b : caaaggcctaggctagccctggggaaatgtggagggaacaaatctcccgggaactcccgg
ITT01_0086_F04.b : tggaaggaagaaaaaccaaaaaagggcctaattcttccccttggggaaattgggggggga
AMP01_0078_F02.b : atgggccttccctcccttggaaaatgaagggaaacaacccccctccaccccgggggggtg
AMP01_0078_G07.b : aacaagggcttacccttcccttggaaaaggagggaaaccaacacccccccaaccccggag
HTMT1_0071_F06.b : cgagatagagaaaaaataagggccttttttcatcctgtggatattttggaggggacccaa
PST01_0050_F07.b : aatactggtgacgatgagacaaactatgggcctatgtcatgccatggggataatgaaggg
SPL01_0041_C09.b : aaaaacgggaaaaataccctgttaacggaagaaaaaacaaactaaatgggcctttatgtc
DCI01_0083_D10.b : AAAAATACCTGTGACGGATGAAGAGCAGACTAATGTGCCTTATGTCTATGCCATTGGTGA
20110601C-003094 : TATATTGGAGGGGAAGCCAGAGCTCACCCCCGGTAGCATCCAGGCAGGAAGGTTGCTGGC
---------+---------+---------+---------+---------+---------+ 1434
OVRM1_0098_A03.b :
BFLT1_0032_C05.b : caagtggggcccccccgggataaaaaaccaaccttt
OVR01_0012_B08.b :
OVRT1_0148_D08.b : taaagagaaagaaaaatattttgtgggaaaaaaaaagataaacaa
OVRT1_0063_F03.b :
KDN01_0073_D07.b : gaggttgggccaagggtggggccctgtcagggaataaactcccaaccttttccttgataa
ITT01_0086_F04.b : accaaaatccccccggtgaatatctggcgaaagtttgcgcgacaaagcttttggggcccc
AMP01_0078_F02.b : ggccaaggtttggggcccttcatt
AMP01_0078_G07.b : ggtggccaaggtttgggtctcccataat
HTMT1_0071_F06.b : cctcccggtataactctgggagggtttgcgacagggctgtggggccctcttagaggatta
PST01_0050_F07.b : aagccgacctccccgtagcatccagcagaaggtgcggcacaagctgtagggctccctgcc
SPL01_0041_C09.b : cttttccctttggttgaatatatttgggagggggaaaacccaaaaacttcccccccgggt
DCI01_0083_D10.b : TATATTGGAGGGGAAGCCAGAGCTCACCCCCGGTAGCATCCAGGCAGGAAGGTTGCTGGC
20110601C-003094 : ACANAGGCTGTATGGTGGCTCCCACTGTCAGTATGACTATGAAAACGTTCCAACGACCGT
---------+---------+---------+---------+---------+---------+ 1494
OVRM1_0098_A03.b :
BFLT1_0032_C05.b :
OVR01_0012_B08.b :
OVRT1_0148_D08.b :
OVRT1_0063_F03.b :
KDN01_0073_D07.b : gggtggtctctcaagagggggaattggagaaatttattaaattgtgcgggggccctcaca
ITT01_0086_F04.b : cccgcggggggaaaaaaaaactcccccaaccttttttcccttgaaaaggggtgtgggttc
AMP01_0078_F02.b :
AMP01_0078_G07.b :
HTMT1_0071_F06.b : aataccaccccgtttctccttagaagggcgtggcgtcctacaagagggcggaatgtggaa
PST01_0050_F07.b : aggtgaatgaacatccaaaccgtttaccttgaatgggcttggcctccaaaaaggtggaaa
SPL01_0041_C09.b : aaccaatccccaggccggggaaagggtttccttgggccccaaagaggggtttggatgggg
DCI01_0083_D10.b : ACANAGGCTGTATGGTGGCTCCCACTGTCAGTATGACTATGAAAACGTTCCAACGACCGT
20110601C-003094 : TTTTACTCCTTTGGAATATGGTGCTTGTGGTNCTTCCGAAGAGNANGCTGTGGAGAAATT
---------+---------+---------+---------+---------+---------+ 1554
OVRM1_0098_A03.b :
BFLT1_0032_C05.b :
OVR01_0012_B08.b :
OVRT1_0148_D08.b :
OVRT1_0063_F03.b :
KDN01_0073_D07.b : aatgtgtaacctcacaaggtgt
ITT01_0086_F04.b : cccaaaaaaggttgggaatttgggagaaaaattttatttccttttctgggtggaggaatc
AMP01_0078_F02.b :
AMP01_0078_G07.b :
HTMT1_0071_F06.b : aattatatattttcttttggtgtgaagctctacacaacattttaatactccacaaagggt
PST01_0050_F07.b : atgggaaaaatgaattcaaattttggccgggggcatcccgaaacacgtttgaaattccaa
SPL01_0041_C09.b : ggggggcttcccccctgggttcaaagggtggtgaaacttatatttaaaaaaaaaaacgtt
DCI01_0083_D10.b : TTTTACTCCTTTGGAATATGGTGCTTGTGGTNCTTCCGAAGAGNANGCTGTGGAGAAATT
20110601C-003094 : GGGGGAAGAAAAATATGAGATTACCATAGTTTACTTTGGCCGTTGGAATGGACGATTC..
---------+---------+---------+---------+---------+---------+ 1612
OVRM1_0098_A03.b :
BFLT1_0032_C05.b :
OVR01_0012_B08.b :
OVRT1_0148_D08.b :
OVRT1_0063_F03.b :
KDN01_0073_D07.b :
ITT01_0086_F04.b : cccagacacaatgtgaattgtataaaaagagggg
AMP01_0078_F02.b :
AMP01_0078_G07.b :
HTMT1_0071_F06.b : gtgtcccccactgtgagaccctcgcagga
PST01_0050_F07.b : acaaaggggtggctcccacgcccggagagaccttccgcctgggaaaaggaacacccctcc
SPL01_0041_C09.b : ttcccccaaaacacaacaccccgcgttttttttttttttatcccctctctctctctt
DCI01_0083_D10.b : GGGGGAAGAAAAATATGAGATTACCATAGTTTACTTTGGCCGTTGGAATGGACGATTCat
20110601C-003094 : ............................................................
---------+---------+---------+---------+---------+---------+ 1612
OVRM1_0098_A03.b :
BFLT1_0032_C05.b :
OVR01_0012_B08.b :
OVRT1_0148_D08.b :
OVRT1_0063_F03.b :
KDN01_0073_D07.b :
ITT01_0086_F04.b :
AMP01_0078_F02.b :
AMP01_0078_G07.b :
HTMT1_0071_F06.b :
PST01_0050_F07.b : ggttgttttnnnnggtaattgtttatttgtttatattatgaacattg
SPL01_0041_C09.b :
DCI01_0083_D10.b : caaaaaatacaacaatggtatgcaaaatagcctgcaatatcaaaaaatgacctgttgggg
20110601C-003094 : ............................................................
---------+---------+---------+---------+---------+---------+ 1612
OVRM1_0098_A03.b :
BFLT1_0032_C05.b :
OVR01_0012_B08.b :
OVRT1_0148_D08.b :
OVRT1_0063_F03.b :
KDN01_0073_D07.b :
ITT01_0086_F04.b :
AMP01_0078_F02.b :
AMP01_0078_G07.b :
HTMT1_0071_F06.b :
PST01_0050_F07.b :
SPL01_0041_C09.b :
DCI01_0083_D10.b : gctcccctacggggtcccaggctggaaagtacccagggttccagcgggctcaagtggaat
20110601C-003094 : ............................................................
---------+---------+---------+---------+---------+---------+ 1612
OVRM1_0098_A03.b :
BFLT1_0032_C05.b :
OVR01_0012_B08.b :
OVRT1_0148_D08.b :
OVRT1_0063_F03.b :
KDN01_0073_D07.b :
ITT01_0086_F04.b :
AMP01_0078_F02.b :
AMP01_0078_G07.b :
HTMT1_0071_F06.b :
PST01_0050_F07.b :
SPL01_0041_C09.b :
DCI01_0083_D10.b : gacaagaaccactgaacaccctcggatcccccccctgggcgaaggttcaaacctgtggtg
20110601C-003094 : ............................................................
---------+---------+---------+---------+---------+---------+ 1612
OVRM1_0098_A03.b :
BFLT1_0032_C05.b :
OVR01_0012_B08.b :
OVRT1_0148_D08.b :
OVRT1_0063_F03.b :
KDN01_0073_D07.b :
ITT01_0086_F04.b :
AMP01_0078_F02.b :
AMP01_0078_G07.b :
HTMT1_0071_F06.b :
PST01_0050_F07.b :
SPL01_0041_C09.b :
DCI01_0083_D10.b : acaccccccgggaaaactcccggccggtgggggaataccccgggagccgcccaacaccac