[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-003343

Length: 2,329

Sequence [FASTA format sequence]
GTCTGGAAGG CGGCAGGGAT GGCGGCGGCG GGAACTGGAC CCGGCCCGGG AGTGGGTGCA
GGAACCGGCC CAACAGCGGC CGTAAATGCA ACACCGGCAG AAGAAGGGGA GACGAAGCCG
GTAGCAGCGG TAGCAGCCGC TCCGGCTGGC GAGGGGACGT CTGTTACTCC AGCCGCGGAG
CCAGTGTCGG GAGAGGCGGA AAGCGGGGAT GCAAACTCGG TTGATGTAAG TGGTGGCTTG
GAGACGGAAT CCTCTAATGG AAAAGATACA CTAGAAGGTG CTGGGGATAC TTCAGAGGTG
ATGGATACTC AGGCGGGCTC CGTGGATGAA GAGAATGGCC GGCAATTGGG AGAGGTGGAG
CTACAGTGTG GAATATGTAC AAAGTGGTTC ACAGCAGACA CGTTCGGCAT AGATACCTCA
TCCTGTCTAC CTTTCATGAC CAACTACAGT TTCCACTGCA ATGTGTGCCA TCATAGTGGG
AATACGTATT TCCTCCGGAA GCAAGCAAAC TTGAAGGAAA TGTGCCTTAG TGCTTTGGCC
AACCTAACGT GGCAGTCTCG AACACAGGAT GAACACCCAA AAACCATGTT CTCCAAGGAT
AAGGATATCA TACCATTTAT TGATAAATAC TGGGAGTGCA TGACGACCAG ACAGAGACCT
GGGAAAATGA CTTGGCCAAA TAACATTGTT AAAACAATGA GTAAAGAAAG AGATGTGTTC
TTAGTAAAGG AACACCCTGA TCCTGGGAGT AAGGACCCAG AAGAAGATTA CCCCAAGTTT
GGCCTTCTGG ATCAGGATCT TAGTAACATT GGCCCTGCTT ATGACAACCA AAAACAAAGC
AGCACTGTTT CTACCAGTGG GAATCTAAAT GGAGGAATTG CAGCAGGAAG CAGTGGGAAA
GGAAGAGGCG CTAAGCGCAA GCAGCAGGAT GGCGGAACCA CGGGGACCAC CAAGAAGGCC
CGGAGTGACC CCTTGTTTTC TGCTCAGCGC CTTCCCCCTC ATGGCTACCC ATTGGAACAC
CCATTTAACA AAGACGGCTA TCGGTATATT CTAGCGGAGC CCGATCCCCA TGCCCCAGAC
CCTGAGAAGC TCGAACTTGA CTGCTGGGCA GGAAAACCAA TTCCTGGAGA CCTCTACAGA
GCTTGCTTGT ATGAACGGGT TTTGTTAGCC CTACATGATC GAGCTCCCCA GTTAAAGATC
TCTGATGACC GGCTGACTGT GGTTGGAGAG AAGGGCTATT CCATGGTTCG GGCTTCTCAT
GGGGTTCGGA AGGGTGCCTG GTACTTTGAA ATCACGGTGG ATGAGATGCC GCCAGACACT
GCTGCCAGAC TGGGCTGGTC CCAGCCCTTA GGTAACCTTC AAGCTCCCTT AGGTTATGAT
AAATTTAGCT ATTCTTGGCG GAGCAAAAAA GGAACCAAGT TCCACCAGTC CATTGGCAAA
CACTACTCTT CTGGCTATGG ACAGGGAGAC GTCCTAGGGT TTTATATCAA TCTTCCCGAA
GACACGGAGA CAGCCAAGTC ACTACCCGAT ACCTATAAAG ATAAGGCTTT GATAAAGTTC
AAGAGTTATT TGTATTTTGA AGAAAAAGAC TTCGTGGATA AAGCAGAGAA GAGCCTAAAG
CAGACTCCCC ATAGCGAGAT CATTTTTTAT AAAAATGGTG TCAACCAAGG CGTGGCTTAC
AAAGATATTT TCGAGGGGGT TTACTTTCCG GCCATCTCAC TATACAAGAG CTGCACGGTC
TCCATTAACT TTGGACCATG CTTCAAGTAT CCGCCGAAGG ATCTGGCTTA CCGCCCCATG
AGTGACATGG GCTGGGGCGC CGTGGTCGAA CACACTCTGG CTGATGTTTT GTATCACGTG
GAGACAGAAG TGGATGGGAG GCGGAGTCCC CCCTGGGAAC CCTGACCAAG CCCCCTTTTC
TTTGCAGACA CGGACTTTTC TGGGGAATAA TATGAGGGGG TTTTGTTTTT GTTTTTCACC
TGTCGCAAAT GTTTTCCCGA AGACACTGCA GAACACAGCC TCTGCTGTAG CAAGGTAAAG
GCCAGGTGGC CCTGGGAGAC TCCCTGCCCT GCAACACTCC CTTCAGTGAC GGTCCTCACT
CTGCGCCACA GCCCAGCGGC TGCTGGCCTG CAATCCCTTC AGTGCCCTGC ACACTGGGGC
TGTACCACCT ACTCCGCCAG CTGGGACTTG TTATCTTATG GCGTTGTCTA AGAAATGGGT
GATCTTGTCC AAGCAGCTAA CTTATTTAAA GGCATTTCCT TCTATGAGCA TCACCTCCAT
CCCACCAGAT TCCCAAGGAG GTGGTGGGGC TGTTTCCCAA ACAGCTGAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinASH2Lset1/Ash2 histone methyltransferase complex subunit ASH2 isoform a [Homo sapiens]. 11320.0O
Contig/Assembly ProteinASH2Lset1/Ash2 histone methyltransferase complex subunit ASH2 isoform b [Homo sapiens]. 10450.0O
Contig/Assembly ProteinRYR3ryanodine receptor 3 [Homo sapiens]. 51.24e-06


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinAsh2lset1/Ash2 histone methyltransferase complex subunit ASH2 isoform a [Mus musculus]. 11140.0O
Contig/Assembly ProteinAsh2lset1/Ash2 histone methyltransferase complex subunit ASH2 isoform b [Mus musculus]. 10360.0O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC475589PREDICTED: similar to Set1/Ash2 histone methyltransferase complex subunit ASH2 (ASH2-like protein) isoform 2 [Canis familiaris]. 11390.0O
Contig/Assembly ProteinLOC475589PREDICTED: similar to Set1/Ash2 histone methyltransferase complex subunit ASH2 (ASH2-like protein) isoform 3 [Canis familiaris]. 10440.0O
Contig/Assembly ProteinLOC475589PREDICTED: similar to Set1/Ash2 histone methyltransferase complex subunit ASH2 (ASH2-like protein) isoform 1 [Canis familiaris]. 9590.0O
Contig/Assembly ProteinRYR2PREDICTED: similar to Ryanodine receptor 2 (Cardiac muscle-type ryanodine receptor) (RyR2) (RYR-2) (Cardiac muscle ryanodine receptor-calcium release channel) (hRYR-2) [Canis familiaris]. 50.11e-05


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinASH2Lset1/Ash2 histone methyltransferase complex subunit ASH2 [Bos taurus]. 11400.0O
Contig/Assembly ProteinASH2LPREDICTED: ash2-like [Bos taurus]. 11400.0O
Contig/Assembly ProteinRYR3PREDICTED: ryanodine receptor 3 [Bos taurus]. 50.85e-06
Contig/Assembly ProteinRYR3PREDICTED: ryanodine receptor 3 [Bos taurus]. 50.85e-06


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinASH2Lset1/Ash2 histone methyltransferase complex subunit ASH2 [Sus scrofa]. 11550.0O


Assembly Members: 12      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010054B10ADR01_0054_B10.bDB786286 
ADR010059E12ADR01_0059_E12.bDB786770 
DCI010057H06DCI01_0057_H06.bDB794680 
DCI010094C09DCI01_0094_C09.bDB797904 
HTMT10016H09HTMT1_0016_H09.bFS665403 
HTMT10135E08HTMT1_0135_E08.bHX225472 
LVRM10176E12LVRM1_0176_E12.bCJ005131 AK233572
OVR010051G12OVR01_0051_G12.bBW964196 
OVRM10090H08OVRM1_0090_H08.bBP154510 AK235530
OVRM10107F08OVRM1_0107_F08.bBP151934 AK235713
OVRM10217C09OVRM1_0217_C09.bBP457233 
THY010079C12THY01_0079_C12.bBP163038 

  

SNPs: 2      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
405C300.600BSTTC/F
T020.400TTT/F
1569C110.400WSTAC/Y
T300.600TAT/Y


Alignment:      TOP

20110601C-003343 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRM1_0090_H08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0135_E08.b : ggagtttnnnggatggtacgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : ...GTCTGGAAGGCGGCAGGGATGGCGGCGGCGGGAACTGGACCCGGCCCGGGAGTGGGT
---------+---------+---------+---------+---------+---------+ 57
OVRM1_0090_H08.b : xxxGTCTGGAAGGCGGCAGGGATGGCGGCGGCGGGAACTGGACCCGGCCCGGGAGTGGGT
HTMT1_0135_E08.b : xxxxxxxxxxxxxxxxcatGGATGGCGGCGGCGGGAACTGGACCCGGCCCGGGAGTGGGT
LVRM1_0176_E12.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : GCAGGAACCGGCCCAACAGCGGCCGTAAATGCAACACCGGCAGAAGAAGGGGAGACGAAG
---------+---------+---------+---------+---------+---------+ 117
OVRM1_0090_H08.b : GCAGGAACCGGCCCAACAGCGGCCGTAAATGCAACACCGGCAGAAGAAGGGGAGACGAAG
HTMT1_0135_E08.b : GCAGGAACCGGCCCAACAGCGGCCGTAAATGCAACACCGGCAGAAGAAGGGGAGACGAAG
LVRM1_0176_E12.b : xxxxxxxxxxxxxxxxxxgcaactcgcgcgagacccacatagtaatctcgcgagaagtct
DCI01_0057_H06.b : gatgatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0094_C09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : CCGGTAGCAGCGGTAGCAGCCGCTCCGGCTGGCGAGGGGACGTCTGTTACTCCAGCCGCG
---------+---------+---------+---------+---------+---------+ 177
OVRM1_0090_H08.b : CCGGTAGCAGCGGTAGCAGCCGCTCCGGCTGGCGAGGGGACGTCTGTTACTCCAGCCGCG
HTMT1_0135_E08.b : CCGGTAGCAGCGGTAGCAGCCGCTCCGGCTGGCGAGGGGACGTCTGTTACTCCAGCCGCG
LVRM1_0176_E12.b : ggaaggcggcagggatggcggcggcgggaagaaggGGGGACGTCTGTTACTCCAGCCGCG
DCI01_0057_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0094_C09.b : nxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : GAGCCAGTGTCGGGAGAGGCGGAAAGCGGGGATGCAAACTCGGTTGATGTAAGTGGTGGC
---------+---------+---------+---------+---------+---------+ 237
OVRM1_0090_H08.b : GAGCCAGTGTCGGGAGAGGCGGAAAGCGGGGATGCAAACTCGGTTGATGTAAGTGGTGGC
HTMT1_0135_E08.b : GAGCCAGTGTCGGGAGAGGCGGAAAGCGGGGATGCAAACTCGGTTGATGTAAGTGGTGGC
LVRM1_0176_E12.b : GAGCCAGTGTCGGGAGAGGCGGAAAGCGGGGATGCAAACTCGGTTGATGTAAGTGGTGGC
DCI01_0057_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0094_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : TTGGAGACGGAATCCTCTAATGGAAAAGATACACTAGAAGGTGCTGGGGATACTTCAGAG
---------+---------+---------+---------+---------+---------+ 297
OVRM1_0090_H08.b : TTGGAGACGGAATCCTCTAATGGAAAAGATACACTAGAAGGTGCTGGGGATACTTCAGAG
HTMT1_0135_E08.b : TTGGAGACGGAATCCTCTAATGGAAAAGATACACTAGAAGGTGCTGGGGATACTTCAGAG
LVRM1_0176_E12.b : TTGGAGACGGAATCCTCTAATGGAAAAGATACACTAGAAGGTGCTGGGGATACTTCAGAG
DCI01_0057_H06.b : xxxxAGACGGAATCCTCTAATGGAAAAGATACACTAGAAGGTGCTGGGGATACTTCAGAG
DCI01_0094_C09.b : xxxxAGACGGAATCCTCTAATGGAAAAGATACACTAGAAGGTGCTGGGGATACTTCAGAG
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : GTGATGGATACTCAGGCGGGCTCCGTGGATGAAGAGAATGGCCGGCAATTGGGAGAGGTG
---------+---------+---------+---------+---------+---------+ 357
OVRM1_0090_H08.b : GTGATGGATACTCAGGCGGGCTCCGTGGATGAAGAGAATGGCCGGCAATTGGGAGAGGTG
HTMT1_0135_E08.b : GTGATGGATACTCAGGCGGGCTCCGTGGATGAAGAGAATGGCCGGCAATTGGGAGAGGTG
LVRM1_0176_E12.b : GTAATGGATACTCAGGCGGGCTCCGTGGATGAAGAGAATGGCCGGCAATTGGGAGAGGTG
DCI01_0057_H06.b : GTGATGGATACTCAGGCGGGCTCCGTGGATGAAGAGAATGGCCGGCAATTGGGAGAGGTG
DCI01_0094_C09.b : GTGATGGATACTCAGGCGGGCTCCGTGGATGAAGAGAATGGCCGGCAATTGGGAGAGGTG
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : GAGCTACAGTGTGGAATATGTACAAAGTGGTTCACAGCAGACACGTTCGGCATAGATACC
---------+---------+---------+---------+---------+---------+ 417
OVRM1_0090_H08.b : GAGCTACAGTGTGGAATATGTACAAAGTGGTTCACAGCAGACACGTTTGGCATAGATACC
HTMT1_0135_E08.b : GAGCTACAGTGTGGAATATGTACAAAGTGGTTCACAGCAGACACGTTCGGCATAGATACC
LVRM1_0176_E12.b : GAGCTACAGTGTGGAATATGTACAAAGTGGTTCACAGCAGACACGTTTGGCATAGATACC
DCI01_0057_H06.b : GAGCTACAGTGTGGAATATGTACAAAGTGGTTCACAGCAGACACGTTCGGCATAGATACC
DCI01_0094_C09.b : GAGCTACAGTGTGGAATATGTACAAAGTGGTTCACAGCAGACACGTTCGGCATAGATACC
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : TCATCCTGTCTACCTTTCATGACCAACTACAGTTTCCACTGCAATGTGTGCCATCATAGT
---------+---------+---------+---------+---------+---------+ 477
OVRM1_0090_H08.b : TCATCCTGTCTACCTTTCATGACCAACTACAGTTTCCACTGCAATGTGTGCCATCATAGT
HTMT1_0135_E08.b : TCATCCTGTCTACCTTTCATGACCAACTACAGTTTCCACTGCAATGTGTGCCATCATAGT
LVRM1_0176_E12.b : TCATCCTGTCTACCTTTCATGACCAACTACAGTTTCCACTGCAATGTGCGCCATCATAGT
DCI01_0057_H06.b : TCATCCTGTCTACCTTTCATGACCAACTACAGTTTCCACTGCAATGTGTGCCATCATAGT
DCI01_0094_C09.b : TCATCCTGTCTACCTTTCATGACCAACTACAGTTTCCACTGCAATGTGTGCCATCATAGT
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : GGGAATACGTATTTCCTCCGGAAGCAAGCAAACTTGAAGGAAATGTGCCTTAGTGCTTTG
---------+---------+---------+---------+---------+---------+ 537
OVRM1_0090_H08.b : GGGAATACGTATTTCCTCCGGAAGCAAGCAAACTTGAAGGAAATGTGCCTTAGTGCTTTG
HTMT1_0135_E08.b : GGGAATACGTATTTCCTCCGGAAGCAAGCAAACTTGAAGGAAATGTGCCTTAGTGCTTTG
LVRM1_0176_E12.b : GGGAATACGTATTTCCTCCGGAAGCAAGCAAACTTGAAGGAAATGTGCCTTAGTGCTTTG
DCI01_0057_H06.b : GGGAATACGTATTTCCTCCGGAAGCAAGCAAACTTGAAGGAAATGTGCCTTAGTGCTTTG
DCI01_0094_C09.b : GGGAATACGTATTTCCTCCGGAAGCAAGCAAACTTGAAGGAAATGTGCCTTAGTGCTTTG
OVRM1_0107_F08.b : cagttgtcxxxxxxx
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : GCCAACCTAACGTGGCAGTCTCGAACACAGGATGAACACCCAAAAACCATGTTCTCCAAG
---------+---------+---------+---------+---------+---------+ 597
OVRM1_0090_H08.b : GCCAACCTAACGTGGCAGTCTCGAACACAGGATGAACACCCAAAAACCATGTTCTCCAAG
HTMT1_0135_E08.b : GCCAACCTAACGTGGCAGTCTCGAACACAGGATGAACACCCAAAAACCATGTTCTCCAAG
LVRM1_0176_E12.b : GCCAACCTAACGTGGCAGTCTCGAACACAGGATGAACACCCAAAAACCATGTTCTCCAAG
DCI01_0057_H06.b : GCCAACCTAACGTGGCAGTCTCGAACACAGGATGAACACCCAAAAACCATGTTCTCCAAG
DCI01_0094_C09.b : GCCAACCTAACGTGGCAGTCTCGAACACAGGATGAACACCCAAAAACCATGTTCTCCAAG
OVRM1_0107_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCATGTTCTCCAAG
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : GATAAGGATATCATACCATTTATTGATAAATACTGGGAGTGCATGACGACCAGACAGAGA
---------+---------+---------+---------+---------+---------+ 657
OVRM1_0090_H08.b : GATAAGGATATCATACCATTTATTGATAAATACTGGGAGTGCATGACGACCAGACAGAGA
HTMT1_0135_E08.b : GATAAGGATATCATACCATTTATTGATAAATACTGGGAGTGCATGACGACCAGACAGAGA
LVRM1_0176_E12.b : GATAAGGATATCATACCATTTATTGATAAATACTGGGAGTGCATGACGACCAGACAGAGA
DCI01_0057_H06.b : GATAAGGATATCATACCATTTATTGATAAATACTGGGAGTGCATGACGACCAGACAGAGA
DCI01_0094_C09.b : GATAAGGATATCATACCATTTATTGATAAATACTGGGAGTGCATGACGACCAGACAGAGA
OVRM1_0107_F08.b : GATAAGGATATCATACCATTTATTGATAAATACTGGGAGTGCATGACGACCAGACAGAGA
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : CCTGGGAAAATGACTTGGCCAAATAACATTGTTAAAACAATGAGTAAAGAAAGAGATGTG
---------+---------+---------+---------+---------+---------+ 717
OVRM1_0090_H08.b : CCTGGGGAAATGACTTGGCCAAATAACATTGTTAAAACAATGAGTAAAGAAAGAGATGTG
HTMT1_0135_E08.b : CCTGGGAAAATGACTTGGCCAAATAACATTGTTAAAACAATGAGTAAAGAAAGAGATGTG
LVRM1_0176_E12.b : CCTGGGAAAATGACTTGGCCAAATAACATTGTTAAAACAATGAGTCAAGAAAGAGATGTG
DCI01_0057_H06.b : CCTGGGAAAATGACTTGGCCAAATAACATTGTTAAAACAATGAGTAAAGAAAGAGATGTG
DCI01_0094_C09.b : CCTGGGAAAATGACTTGGCCAAATAACATTGTTAAAACAATGAGTAAAGAAAGAGATGTG
OVRM1_0107_F08.b : CCTGGGAAAATGACTTGGCCAAATAACATTGTTAAAACAATGAGTAAAGAAAGAGATGTG
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : TTCTTAGTAAAGGAACACCCTGATCCTGGGAGTAAGGACCCAGAAGAAGATTACCCCAAG
---------+---------+---------+---------+---------+---------+ 777
OVRM1_0090_H08.b : TTCTTAGTAAAGGAACACCCTGATCCTGGGAGTAAGGACCCAGAAGAAGATTACC
HTMT1_0135_E08.b : TTCTTAGTAAAGGAACACCCTGATCCTGGGAGTAAGGACCCAGAAGAAGATTACCCCA*G
LVRM1_0176_E12.b : TTCTTAGTAAAGGAAC*CCCTGATCCTGGGAGTAAGGACCCAGACGAAGATTACCCCA*G
DCI01_0057_H06.b : TTCTTAGTAAAGGAACACCCTGATCCTGGGAGTAAGGACCCAGAAGAAGATTACCCCA*G
DCI01_0094_C09.b : TTCTTAGTAAAGGAACACCCTGATCCTGGGAGTAAGGACCCAGAAGAAGATTACCCCAAG
OVRM1_0107_F08.b : TTCTTAGTAAAGGAACACCCTGATCCTGGGAGTAAGGACCCAGAAGAAGATTACCCCAAG
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : TTTGGCCTTCTGGATCAGGATCTTAGTAACATTGGCCCTGCTTATGACAACCAAAAACAA
---------+---------+---------+---------+---------+---------+ 837
OVRM1_0090_H08.b :
HTMT1_0135_E08.b : TTTGGCCTTCTGGATCAGGATCTTAGTAACTTTGGCCCTGCTTATGACAACCAAAACAAA
LVRM1_0176_E12.b : GTTGGCCTTCCGGATCAGGATCTTAttacattggccctgt
DCI01_0057_H06.b : GTTGGCCTTCTGGATCANGATCTTAGTAACATTGGCCCTGCTTATGACNACCTAAAACAA
DCI01_0094_C09.b : TTTGGCCTTCTGGATCAGGATCTTAGTAACATTGGCCCTGCTTATGACAACCTAAAACAA
OVRM1_0107_F08.b : TTTGGCCTTCTGGATCAGGATCTTAGTAACATTGGCCCTGCTTATGACAACCAAAAACAA
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : AGCAGCACTGTTTCTACCAGTGGGAATCTAAATGGAGGAATTGCAGCAGGAAGCAGTGGG
---------+---------+---------+---------+---------+---------+ 897
OVRM1_0090_H08.b :
HTMT1_0135_E08.b : *GCAGCACTGTTTCTACCAGTGGGAATCTAAATGGAGGAATTGCAGCAGGAACCAGTGGG
LVRM1_0176_E12.b :
DCI01_0057_H06.b : *GCAGCACTGTTTCTACCAGTGGGAAT
DCI01_0094_C09.b : AGCAGCACTGTTTCTACCAGTGGGAATCTAAATGGAGGAATTGCAGCAGGAAGCAGTGGG
OVRM1_0107_F08.b : AGCAGCACTGTTTCTACCAGTGGGAATCTAAATGGAGGAATTGCAGCAGGAAGCAGTGGG
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : AAAGGAAGAGGCGCTAAGCGCAAGCAGCAGGATGGCGGAACCACGGGGACCACCAAGAAG
---------+---------+---------+---------+---------+---------+ 957
OVRM1_0090_H08.b :
HTMT1_0135_E08.b : AAAGGAAGAGGCGCTAAACCCAAGCACCAGGATG*CGGAACCCCGGGGACCACCAAAAAG
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b : AAAGGAAGAGGCGCTAAGCGCAAGCAGCAGGATGGCGGAACCACGGGGACCACCAAGAAG
OVRM1_0107_F08.b : AAAGGAAGAGGCGCTAAGCGCAAGCAGCAGGATGGCGGAACCACGGGGACCACCAAGAAG
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : GCCCGGAGTGACCCCTTGTTTTCTGCTCAGCGCCTTCCCCCTCATGGCTACCCATTGGAA
---------+---------+---------+---------+---------+---------+ 1017
OVRM1_0090_H08.b :
HTMT1_0135_E08.b : GCCggaatgacccttgttttctgctcacgccttcccctctggcttaccatggaacccctt
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b : GCCCGGAGTGACCCCTTGTTTTCTGCTCAGCGCCTTCCCCCTCATGGCTACCCATTGGAA
OVRM1_0107_F08.b : GCCCGGAGTGACCCCTTGTTTTCTGCTCAGCGCCTTCCCCCTCATGGCTACCCATTGGAA
OVRM1_0217_C09.b : gagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0079_C12.b :
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : CACCCATTTAACAAAGACGGCTATCGGTATATTCTAGCGGAGCCCGATCCCCATGCCCCA
---------+---------+---------+---------+---------+---------+ 1077
OVRM1_0090_H08.b :
HTMT1_0135_E08.b : ttacaaaaacggtttcggtatttctagggaaccgatcccctgcccaaaaccggaaagcta
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b : CACCCCATTTACAA*GACGGCTATCGGTATATTCTAGCGAAGCCCGATCCCCATGCCCCA
OVRM1_0107_F08.b : CACCCATTTAACAAAGACGGCTATCGGTATATTCTAGCGGAGCCCGATCCCCATGCCCCA
OVRM1_0217_C09.b : xxxxxxxxxxxxxxxxxCGGCTATCGGTATATTCTAGCGGAGCCCGATCCCCATGCCCCA
THY01_0079_C12.b : nnnnnnnnnnnn
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : GACCCTGAGAAGCTCGAACTTGACTGCTGGGCAGGAAAACCAATTCCTGGAGACCTCTAC
---------+---------+---------+---------+---------+---------+ 1137
OVRM1_0090_H08.b :
HTMT1_0135_E08.b : aattgatgctgggaggaaaactttcgggaaactctaaactggttgtttacggttttttac
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b : GACCNNTGAGAGCTCGAACTTGACTGCTGGGNCAGAAAAC*AATTCCTGGAGACtctaca
OVRM1_0107_F08.b : GACCCTGAGAAGCTCGAACTTGACTGCTGGGCAGGAAAACCAATTCCTGGAGACCTCTAC
OVRM1_0217_C09.b : GACCCTGAGAAGCTCGAACTTGACTGCTGGGCAGGAAAACCAATTCCTGGAGACCTCTAC
THY01_0079_C12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : AGAGCTTGCTTGTATGAACGGGTTTTGTTAGCCCTACATGATCGAGCTCCCCAGTTAAAG
---------+---------+---------+---------+---------+---------+ 1197
OVRM1_0090_H08.b :
HTMT1_0135_E08.b : ctacttttaccccccttaaattttttatacccaattggttggaaaaaggttccctgtcgg
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b : gagctggctgtatgaacggnntttgntagccctactgatcgacctcccantaangtctct
OVRM1_0107_F08.b : AGAGCTTGCTTGTATGAACGGGTTTTGTTAGCCCTACATGATCGAGCTCCCCAGTTAAAG
OVRM1_0217_C09.b : AGAGCTTGCTTGTATGAACGGGTTTTGTTAGCCCTACATGATCGAGCTCCCCAGTTAAAG
THY01_0079_C12.b : xxxxxxxxxxxxxxTGAACGGGTTTTGTTAGCCCTACATGATCGAGCTCCCCAGTTAAAG
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : ATCTCTGATGACCGGCTGACTGTGGTTGGAGAGAAGGGCTATTCCATGGTTCGGGCTTCT
---------+---------+---------+---------+---------+---------+ 1257
OVRM1_0090_H08.b :
HTMT1_0135_E08.b : cttccggggtgaaggcctgttttaacacggggaaaaccccaatcgccaaggggggcccct
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b : gatgaccgctgactgtgttgggaaaaaggcttttcatgggttcggcttccctggggttcg
OVRM1_0107_F08.b : ATCTCTGATGACCGGCTGACTGTGGTTGGAGAGAAGGGCTATTCCATGGTTCGGGCTTCT
OVRM1_0217_C09.b : ATCTCTGATGACCGGCTGACTGTGGTTGGAGAGAAGGGCTATTCCATGGTTCGGGCTTCT
THY01_0079_C12.b : ATCTCTGATGACCGGCTGACGGTGGTTGGAGAGAAGGGCTATTCCATGGTTCGGGCTTCT
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : CATGGGGTTCGGAAGGGTGCCTGGTACTTTGAAATCACGGTGGATGAGATGCCGCCAGAC
---------+---------+---------+---------+---------+---------+ 1317
OVRM1_0090_H08.b :
HTMT1_0135_E08.b : agacacccccttggaatatttcttggaaaagaaattccccttgaaaacttgggggggtcg
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b : aaggtgcctggactttaaatcaggggaaaaataccccaaactgtttccaaatggttggcc
OVRM1_0107_F08.b : CATGGGGTTCGGAAGGGTGCCTGGTACTTTG*AATCACGGTGGATGAGATGCCGCCAGAC
OVRM1_0217_C09.b : CATGGGGTTCGGAAGGGTGCCTGGTACTTTGAAATCACGGTGGATGAGATGCCGCCAGAC
THY01_0079_C12.b : CATGGGGTTCGGAAGGGTGCCTGGTACTTTGAAATCACGGTGGATGAGATGCCGCCAGAC
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : ACTGCTGCCAGACTGGGCTGGTCCCAGCCCTTAGGTAACCTTCAAGCTCCCTTAGGTTAT
---------+---------+---------+---------+---------+---------+ 1377
OVRM1_0090_H08.b :
HTMT1_0135_E08.b : ttttttccacagcgccctcccaagggttattttttaaaagaaaaacacctttattgcggt
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b : caccctagaaactccagcccttggttgaaaattacctactggggaacaaaggaacatccc
OVRM1_0107_F08.b : ACTGCTGCCAGACTGGGCTGGNTCCAGCCCTTANGTAAC
OVRM1_0217_C09.b : ACTGCTGCCAGACTGGGCTGGTCCCAGCCCTTAGGTAACCTTCAAGCTCCCTTAGGTTAT
THY01_0079_C12.b : ACTGCTGCCAGACTGGGCTGGTCCCAGCCCTTAGGTAACCTTCAAGCTCCCTTAGGTTAT
ADR01_0054_B10.b : gaaannnggtgaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0059_E12.b : nnnaaagtgaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : GATAAATTTAGCTATTCTTGGCGGAGCAAAAAAGGAACCAAGTTCCACCAGTCCATTGGC
---------+---------+---------+---------+---------+---------+ 1437
OVRM1_0090_H08.b :
HTMT1_0135_E08.b : tggtttnnnnnnnttgaggtggtggtgagtgggctagnnnnnnnnnnnnnnnnnnnnnnn
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b : ctcctgggaaacactcttggtggggggaaccctgggtttacttcccaacagaacctctct
OVRM1_0107_F08.b :
OVRM1_0217_C09.b : GATAAATTTAGCTATTCTTGGCGGAGCAAAAAAGGAACCAAGTTCCACCAGTCCATTGGC
THY01_0079_C12.b : GATAAATTTAGCTATTCTTGGCGGAGCAAAAAAGGAACCAAGTTCCACCAGTCCATTGGC
ADR01_0054_B10.b : xxxxxxxTTAGCTATTCTTGGCGGAGCAAAAAAGGAACCAAGTTCCACCAGTCCATTGGC
ADR01_0059_E12.b : xxxxxxxTTAGCTATTCTTGGCGGAGCAAAAAAGGAACCAAGTTCCACCAGTCCATTGGC
HTMT1_0016_H09.b :
OVR01_0051_G12.b :
20110601C-003343 : AAACACTACTCTTCTGGCTATGGACAGGGAGACGTCCTAGGGTTTTATATCAATCTTCCC
---------+---------+---------+---------+---------+---------+ 1497
OVRM1_0090_H08.b :
HTMT1_0135_E08.b : nnnnnnnnnnnnnnnnnnnnnnn
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b : cgccaaaaaaggttaatcaattttttaaacaggagaaaaaaacccccctttt
OVRM1_0107_F08.b :
OVRM1_0217_C09.b : AAACACTACTCTTCTGGCTATGGACAGGGAGACGTCCTAGGGTTTTATATCAATCTTCCC
THY01_0079_C12.b : AAACACTACTCTTCTGGCTATGGACAGGGAGACGTCCTAGGGTTTTATATCAATCTTCCC
ADR01_0054_B10.b : AAACACTACTCTTCTGGCTATGGACAGGGAGACGTCCTAGGGTTTTATATCAATCTTCCC
ADR01_0059_E12.b : AAACACTACTCTTCTGGCTATGGACAGGGAGACGTCCTAGGGTTTTATATCAATCTTCCC
HTMT1_0016_H09.b : tttttccgacggaagacgccanxxxxxxx
OVR01_0051_G12.b : t
20110601C-003343 : GAAGACACGGAGACAGCCAAGTCACTACCCGATACCTATAAAGATAAGGCTTTGATAAAG
---------+---------+---------+---------+---------+---------+ 1557
OVRM1_0090_H08.b :
HTMT1_0135_E08.b :
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b : GAAGACACGGAGACAGCCAAGTCACTACCCGATACCTATAAAGATAAAGCTTTGATAAAG
THY01_0079_C12.b : GAAGACACGGAGACAGCCAAGTCACTACCCGATACCTATAAAGATAAGGCTTTGATAAAG
ADR01_0054_B10.b : GAAGACACGGAGACAGCCAAGTCACTACCCGATACCTATAAAGATAAGGCTTTGATAAAG
ADR01_0059_E12.b : GAAGACACGGAGACAGCCAAGTCACTACCCGATACCTATAAAGATAAGGCTTTGATAAAG
HTMT1_0016_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACCTATAAAGATAAGGCTTTGATAAAG
OVR01_0051_G12.b : tttcgcatggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-003343 : TTCAAGAGTTATTTGTATTTTGAAGAAAAAGACTTCGTGGATAAAGCAGAGAAGAGCCTA
---------+---------+---------+---------+---------+---------+ 1617
OVRM1_0090_H08.b :
HTMT1_0135_E08.b :
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b : TTCAAGAGTTACTTGTATTTTGAAGAAAAAGACTTCGTGGATAAAGCATAGAAGAGCCTA
THY01_0079_C12.b : TTCAAGAGTTATTTGTATTTTGAAGAAAAAGACTTCGTGGATAAAGCAGAGAAGAGCCTA
ADR01_0054_B10.b : TTCAAGAGTTATTTGTATTTTGAAGAAAAAGACTTCGTGGATAAAGCAGAGAAGAGCCTA
ADR01_0059_E12.b : TTCAAGAGTTATTTGTATTTTGAAGAAAAAGACTTCGTGGATAAAGCAGAGAAGAGCCTA
HTMT1_0016_H09.b : TTCAAGAGTTACTTGTATTTTGAAGAAAAAGACTTCGTGGATAAAGCAGAGAAGAGCCTA
OVR01_0051_G12.b : xxxxxxxxxxxxxxxxxxxTTGAAGAAAAAGACTTCGTGGATAAAGCAGAGAAGAGCCTA
20110601C-003343 : AAGCAGACTCCCCATAGCGAGATCATTTTTTATAAAAATGGTGTCAACCAAGGCGTGGCT
---------+---------+---------+---------+---------+---------+ 1677
OVRM1_0090_H08.b :
HTMT1_0135_E08.b :
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b : CAGCAGACTCCCCATAGCGAGATCATTTTTTATA*AAATGGTGTCAACCCACGCGTGGCT
THY01_0079_C12.b : AAGCAGACTCCCCATAGCGAGATCATTTTTTATAAAAATGGTGTCAACCAAGGCGTGGCT
ADR01_0054_B10.b : AAGCAGACTCCCCATAGCGAGATCATTTTTTATAAAAATGGTGTCAACCAAGGCGTGGCT
ADR01_0059_E12.b : AAGCAGACTCCCCATAGCGAGATCATTTTTTATAAAAATGGTGTCAACCAAGGCGTGGCT
HTMT1_0016_H09.b : AAGCAGACTCCCCATAGCGAGATCATTTTTTATAAAAATGGTGTCAACCAAGGCGTGGCT
OVR01_0051_G12.b : AAGCAGACTCCCCATAGCGAGATCATTTTTTATAAAAATGGTGTCAACCAAGGCGTGGCT
20110601C-003343 : TACAAAGATATTTTCGAGGGGGTTTACTTTCCGGCCATCTCACTATACAAGAGCTGCACG
---------+---------+---------+---------+---------+---------+ 1737
OVRM1_0090_H08.b :
HTMT1_0135_E08.b :
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b : TACAAAGATATTTTCGAGGGTGTTTACTTTCCGGCCATCTCACTGCACA*GAGCTGCCCG
THY01_0079_C12.b : TACAAAGATATTTTCGAGGGGGTTTACTTTCCGGCCATCTCACTATACAAGAGCTGCACG
ADR01_0054_B10.b : TACAAAGATATTTTCGAGGGGGTTTACTTTCCGGCCATCTCACTATACAAGAGCTGCACG
ADR01_0059_E12.b : TACAAAGATATTTTCGAGGGGGTTTACTTTCCGGCCATCTCACTATACAAGAGCTGCACG
HTMT1_0016_H09.b : TACAAAGATATTTTCGAGGGGGTTTACTTTCCGGCCATCTCACTGTACAAGAGCTGCACG
OVR01_0051_G12.b : TACAAAGATATTTTCGAGGGGGTTTACTTTCCGGCCATCTCACTATACAAGAGCTGCACG
20110601C-003343 : GTCTCCATTAACTTTGGACCATGCTTCAAGTATCCGCCGAAGGATCTGGCTTACCGCCCC
---------+---------+---------+---------+---------+---------+ 1797
OVRM1_0090_H08.b :
HTMT1_0135_E08.b :
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b : GGCTCCATTAACTTTGGACCATGCTTCAAGTATCCCTCGCAGGATCTGGCTTCACGCCCC
THY01_0079_C12.b : GTCTCCATTAACTTTGGACCATGCTTCAAGTATCCGCCGAAGGATCTGGCTTACCGCCCC
ADR01_0054_B10.b : GTCTCCATTAACTTTGGACCATGCTTCAAGTATCCGCCGAAGGATCTGGCTTACCGCCCC
ADR01_0059_E12.b : GTCTCCATTAACTTTGGACCATGCTTCAAGTATCCGCCGAAGGATTTGGCTTACCGCCCC
HTMT1_0016_H09.b : GTCTCCATTAACTTTGGACCATGCTTCAAGTATCCGCCGAAGGATCTGGCTTACCGCCCC
OVR01_0051_G12.b : GTCTCCATTAACTTTGGACCATGCTTCAAGTATCCGCCGAAGGATCTGGCTTACCGCCCC
20110601C-003343 : ATGAGTGACATGGGCTGGGGCGCCGTGGTCGAACACACTCTGGCTGATGTTTTGTATCAC
---------+---------+---------+---------+---------+---------+ 1857
OVRM1_0090_H08.b :
HTMT1_0135_E08.b :
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b : ATGATTGACAgggctcggcgcc
THY01_0079_C12.b : ATGAGTGACATGGGCTGGGGCGCCGTGGTCGAACACACTCTGGCTGATGTTTTGTATCAC
ADR01_0054_B10.b : ATGAGTGACATGGGCTGGGGCGCCGTGGTCGAACACACTCTGGCTGATGTTTTGTATCAC
ADR01_0059_E12.b : ATGAGTGACATGGGCTGGGGCGCCGTGGTCGAACACACTCTGGCTGATGTTTTGTATCAC
HTMT1_0016_H09.b : ATGAGTGACATGGGCTGGGGCGCCGTGGTCGAACACACTCTGGCTGATGTTTTGTATCAC
OVR01_0051_G12.b : ATGAGTGACATGGGCTGGGGCGCCGTGGTCGAACACACTCTGGCTGATGTTTTGTATCAA
20110601C-003343 : GTGGAGACAGAAGTGGATGGGAGGCGGAGTCCCCCCTGGGAACCCTGACCAAGCCCCCTT
---------+---------+---------+---------+---------+---------+ 1917
OVRM1_0090_H08.b :
HTMT1_0135_E08.b :
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b : GTGGAGACAGAAGTGGATGGNNAGGCGAGTCCCCCCTGGGAACCCTGACCAAGCCCCCTT
ADR01_0054_B10.b : GTGGAGACAGAAGTGGATGGGAGGCGGAGTCCCCCCTGGGAACCCTGACCAAGCCCCCTT
ADR01_0059_E12.b : GTGGAGACAGAAGTGGATGGGAGGCGGAGTCCCCCCTGGGAACCCTGACCAAGCCCCCTT
HTMT1_0016_H09.b : GTGGAGACAGAAGTGGATGGGAGGCGGAGTCCCCCCTGGGAACCCTGACCAAGCCCCCTT
OVR01_0051_G12.b : GTGGAGACAGAAGTGGATGGGAGGCGGAGTCCCCCCTGGGAACCCTGACCAAGCCCCCTT
20110601C-003343 : TTCTTTGCAGACACGGACTTTTCTGGGGAATAATATGAGGGGGTTTTGTTTTTGTTTTTC
---------+---------+---------+---------+---------+---------+ 1977
OVRM1_0090_H08.b :
HTMT1_0135_E08.b :
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b : TTCTTTGCAGACACGGACTTTTCTGGGGAATATATNGAGGGGGTTTTGTTTTTGTTTTTC
ADR01_0054_B10.b : TTCTTTGCAGACACGGACTTTTCTGGGGAATAATATGAGGGGGTTTTGTTTTTGTTTTTC
ADR01_0059_E12.b : TTCTTTGCAGACACGGACTTTTCTGGGGAATAATATGAGGGGGTTTTGTTTTTGTTTTTC
HTMT1_0016_H09.b : TTCTTTGCAGACACGGACTTTTCTGGGGAATAATATGAGGGGGTTTTGTTTTTGTTTTTC
OVR01_0051_G12.b : TTCTTTGCAGACACGGACTTTTCTGGGGAATAATATGAGGGGGTTTTGTTTTTGTTTTTC
20110601C-003343 : ACCTGTCGCAAATGTTTTCCCGAAGACACTGCAGAACACAGCCTCTGCTGTAGCAAGGTA
---------+---------+---------+---------+---------+---------+ 2037
OVRM1_0090_H08.b :
HTMT1_0135_E08.b :
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b : AC*TGTCGCAAATGTTTTCCCCGAGACACTGCAGAACACAGCCTCTGCTGTAGCAAGGTA
ADR01_0054_B10.b : ACCTGTCGCAAATGTTTTCCCGAAGACACTGCAGAACACAGCCTCTGCTGTAGCAAGGTA
ADR01_0059_E12.b : ACCTGTCGCAAATGTTTTCCCGAAGACACTGCAGAACACAGCCTCTGCTGTAGCAAGGTA
HTMT1_0016_H09.b : ACCTGTCGCAAATGTTTTCCCGAAGACACTGCAGAACACAGCCTCTGCTGTAGCAAGGTA
OVR01_0051_G12.b : ACCTGTCGCAAATGTTTTCCCGAAGACACTGCAGAACACAGCCTCTGCTGTAGCAAGGTA
20110601C-003343 : AAGGCCAGGTGGCCCTGGGAGACTCCCTGCCCTGCAACACTCCCTTCAGTGACGGTCCTC
---------+---------+---------+---------+---------+---------+ 2097
OVRM1_0090_H08.b :
HTMT1_0135_E08.b :
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b : AAGGCCAGG
ADR01_0054_B10.b : AAGGCCAGGTGGCCCTGGGAGACTCCCTGCCCTGCAACACTCCCTTCAGTGACGGCCCTC
ADR01_0059_E12.b : AAGGCCAGGTGGCCCTGGGAGACTCCCTGCCCTGCAACACTCCCTTCAGTGACGGCCCTC
HTMT1_0016_H09.b : AAGGCCAGGTGGCCCTGGGAGACTCCCTGCCCTGCAACACTCCCTTCAGTGACGGTCCTC
OVR01_0051_G12.b : AAGGCCAGGTGGCCCTGGGAGACTCCCTGCCCTGCAACACTCCCTTCAGTGACGGCCCTC
20110601C-003343 : ACTCTGCGCCACAGCCCAGCGGCTGCTGGCCTGCAATCCCTTCAGTGCCCTGCACACTGG
---------+---------+---------+---------+---------+---------+ 2157
OVRM1_0090_H08.b :
HTMT1_0135_E08.b :
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b : ACTCTGCGCCACAGCCCAGCGGCTGCTGGCCTGCAATCCCTTCAGTGCCCTGCACACTGG
ADR01_0059_E12.b : ACTCTGCGCCACAGCCCAGCGGCTGCTGGCCTGCAATCCCTTCAGTGCCCTGCACACTGG
HTMT1_0016_H09.b : ACTCTGCGCCACAGCCCAGCGGCTGCTGGCCTGCAATCCCTTCAGTGCCCCGCACACTGG
OVR01_0051_G12.b : ACTCTGCGCCACAGCCCAGCGGCTGCTGGCCTGCAATCCCTTCAGTGCCCTGCACACTGG
20110601C-003343 : GGCTGTACCACCTACTCCGCCAGCTGGGACTTGTTATCTTATGGCGTTGTCTAAGAAATG
---------+---------+---------+---------+---------+---------+ 2217
OVRM1_0090_H08.b :
HTMT1_0135_E08.b :
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b : GGCTGTACCACCTACTCCGCCAGCTGGGACTTGTTATCTTATGGCGTTGTCTAAGAAATG
ADR01_0059_E12.b : GGCTGTACCACCTACTCCGCCAGCTGGGACTTGTTATCTTATGGCGTTGTCTAAGAAATG
HTMT1_0016_H09.b : GGCTGTACCACCTACTCCGCCAGCTGGGACTTGTTATCTTATGGCGTTGTCTAAGAAATG
OVR01_0051_G12.b : GGCTGTACCACCTACTCCGCCAGCTGGGACTTGTTATCTTATGGCGTTGTCTAAGAAATG
20110601C-003343 : GGTGATCTTGTCCAAGCAGCTAACTTATTTAAAGGCATTTCCTTCTATGAGCATCACCTC
---------+---------+---------+---------+---------+---------+ 2277
OVRM1_0090_H08.b :
HTMT1_0135_E08.b :
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b : GGTGATCTTGTCCAAGCAGCTAACTTATTT*AAGGCATTTCCTTCTATGAGCATCACCTC
ADR01_0059_E12.b : GGTGATCTTGTCCAAGCAGCTAACTTATTTAAAGGCATTTTCTTCTATGAGCATCACCTC
HTMT1_0016_H09.b : GGTGATCTTGTCCAAGCAGCTAACTTATTTAAAGGCATTTCCTTCTATGAGCATCACCTC
OVR01_0051_G12.b : GGTGATCTTGTCCAAGCAGCTAACTTATTTAAAGGCATTTCCTTCTATGAGCATCACCTT
20110601C-003343 : CATCCCACCAGATTCCCAAGGAGGTGGTGGGGCTGTTTCCCAAACAGCTGAA........
---------+---------+---------+---------+---------+---------+ 2329
OVRM1_0090_H08.b :
HTMT1_0135_E08.b :
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b : CATCCaccagaattcccagggagtggtgggcctgtttcccagacagctgaatcagtggct
ADR01_0059_E12.b : CATCCCACCAGATTCCCAAGGAGGTGGTGGGGCTGTTTCCCAAACAGCTGAAatcantgg
HTMT1_0016_H09.b : CATCCcaccagattcccaaggaggtggtggggctgtttcccagaacagctgaaatcagtg
OVR01_0051_G12.b : CATCCCACCAGATTCCCCAAGGAGTGGTGGGCCTGTTTCccagaacagctgaaaatcatg
20110601C-003343 : ............................................................
---------+---------+---------+---------+---------+---------+ 2329
OVRM1_0090_H08.b :
HTMT1_0135_E08.b :
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b : atattctaaactgtctaaaagcttttctttttggtgtgggtgggtctttattattatttc
ADR01_0059_E12.b : ctatattctaacctgtctaaaagccttttccttttgnggtgggtgtgtctttaatataat
HTMT1_0016_H09.b : gctatattctaaacctgtctaaaagctttttccttttgntgtggtgtgtctttattataa
OVR01_0051_G12.b : ggctatattctaaaccctgtctaaaagcccttttcctttttgggggggggggggggcctt
20110601C-003343 : ............................................................
---------+---------+---------+---------+---------+---------+ 2329
OVRM1_0090_H08.b :
HTMT1_0135_E08.b :
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b : cagatatgcttttgaacattgggatccctgacctactaaggtggtaaactgtaattgtgg
ADR01_0059_E12.b : tttcaagatagcttttgacactgggattcctaagctacttagtcggtaaactgtaattgg
HTMT1_0016_H09.b : tttcgagatagcttttgacactgggatctctgagctactagtctgtaaactgtatttgta
OVR01_0051_G12.b : aattaataaaattcccaaaaaaaggcttttttaaacacctgggaatcttcttgaaagcta
20110601C-003343 : ............................................................
---------+---------+---------+---------+---------+---------+ 2329
OVRM1_0090_H08.b :
HTMT1_0135_E08.b :
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b : aagaactgcctgcccttttaacattaaaacttccaaataaacgtgtcttaagtggtgggg
ADR01_0059_E12.b : gaaggaactggctgcaccttaacaattgaacctttcaaaaaaaatgggctcaagggtggg
HTMT1_0016_H09.b : aggaactgctgcaacttaacataaaaaactttcaataaacttgtctcaaatggtgggcac
OVR01_0051_G12.b : actaaggttctgtaaaaaaattggttaattttgggaaaaaggaaaattttgttttggcag
20110601C-003343 : ............................................................
---------+---------+---------+---------+---------+---------+ 2329
OVRM1_0090_H08.b :
HTMT1_0135_E08.b :
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b : gctttgctccctacaggtggggttccgtggtgaaccttcaaaagggggcttcttagaaga
ADR01_0059_E12.b : gggcatttgcttccct
HTMT1_0016_H09.b : ttgctcccctacagtgaggctccgggtgacactccgaaggggccttctgaggaaggaacc
OVR01_0051_G12.b : ccttttttaacaattttaaaaaaaactttttttcaaa
20110601C-003343 : ............................................................
---------+---------+---------+---------+---------+---------+ 2329
OVRM1_0090_H08.b :
HTMT1_0135_E08.b :
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b : gggactccctggaaaaaaaacggtttcctccccaaaaaaaaaaaaaaggcattgtcccac
ADR01_0059_E12.b :
HTMT1_0016_H09.b : gcctgaaaaaaaaaaggttctcctcaaaannanaaaaaaaaaaannannnnnnnnnnnnn
OVR01_0051_G12.b :
20110601C-003343 : ............................................................
---------+---------+---------+---------+---------+---------+ 2329
OVRM1_0090_H08.b :
HTMT1_0135_E08.b :
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b : tgggggggcccccttaaatcccgggg
ADR01_0059_E12.b :
HTMT1_0016_H09.b : nnaannnnnnnnnnnnnnnnnnnnaaaccccccccgtcctttttgggttttgtccccaaa
OVR01_0051_G12.b :
20110601C-003343 : ............................................................
---------+---------+---------+---------+---------+---------+ 2329
OVRM1_0090_H08.b :
HTMT1_0135_E08.b :
LVRM1_0176_E12.b :
DCI01_0057_H06.b :
DCI01_0094_C09.b :
OVRM1_0107_F08.b :
OVRM1_0217_C09.b :
THY01_0079_C12.b :
ADR01_0054_B10.b :
ADR01_0059_E12.b :
HTMT1_0016_H09.b : aaacttttttggcacactttggtt
OVR01_0051_G12.b :