[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-003485

Length: 1,014

Sequence [FASTA format sequence]
GTGCTGGCAC TGGCTCTGGC AGTCATACAC ACACACACAC ACACACTGGC AAGCACCCCC
TTGGTGACCT CCACGGTCTC ACCTTCAGGC TCAAAGCTGG CTCCGTGGGG AACACGGTGA
CATGGGAGGC ACAGCACAGA CTCTCATCCT GGCCTTCTCC CTCCTCTGCC TCCTCTCCAA
GGTGTGTGCC CAGCTATGCC CCACACCATG TGCCTGTCCA TGGCCACCAC CCCGATGCCC
ACCGGGGGTG CCCCTGGTGC TGGACGGCTG CAACTGCTGC CGGGTATGTG CACGGCGGCT
GGGGGAGCCC TGCGACCACC TCCACATCTG CGACTCCAGC CAGGGCCTGG TCTGCCAGCT
CGGGGCGGGC CCTGGCAGCC GGGGGGCCGT GTGCCTCTGG GGAGAGGATG ACGGCAGCTG
CGAGGTGAAC GGCCGCCTGT ACCGGGACGG GGAGACCTTC CAGCCCCACT GCAGGATTCG
CTGCCGCTGC GAGGACGGCG GTTTCACCTG CGTGCCCCTG TGCAGTGAGG ACGTGCGGCT
GCCCAGCTGG GACTGCCCGC ACCCCAGGAG GGTGGAGGTC CCCGGCAAGT GCTGCCCCGA
GTGGGTGTGC GACCCCCAGC CCCTCCCAGC AAGAGGACCC CAGTTTTCTG GCCTTGTCGC
TCCCCCAGTC CCTGGCATCC CCTGCCCAGA ATGGAGCACA GCCTGGGGCC CCTGTTCAAC
CACCTGTGGG CTGGGCGTGG CCACCCGGGT GTCCAACCAG AACCGCTTTT GCCGCCTGGA
GACCCAGCGC CGCCTGTGCC TACCTGGACC CTGCCCACCC GCCAGGGGCC ACAGCCCACG
GAACAGTGCC TTTTAGAGCT GGGCTGAGAA TGGAGACTTT GTGTCACCTC CCCAGTGGGC
AATCTGGCCT GCCGGCCACC GTCCAGCTTG GGTCTACCAT CCGGGCCCTG GAGGAAAAGA
GTTCCCAGCC AGCTGGTCCG TCTGGACCCT GAGCTACAGC CGGATGCATG ACCT


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinWISP2WNT1-inducible-signaling pathway protein 2 precursor [Homo sapiens]. 394e-110O
Contig/Assembly ProteinCTGFconnective tissue growth factor precursor [Homo sapiens]. 1962e-50O
Contig/Assembly ProteinNOVprotein NOV homolog precursor [Homo sapiens]. 1871e-47O
Contig/Assembly ProteinCYR61protein CYR61 precursor [Homo sapiens]. 1711e-42O
Contig/Assembly ProteinWISP1WNT1-inducible-signaling pathway protein 1 isoform 1 precursor [Homo sapiens]. 1602e-39O
Contig/Assembly ProteinWISP3WNT1-inducible-signaling pathway protein 3 isoform 3 [Homo sapiens]. 1095e-24O
Contig/Assembly ProteinWISP3WNT1-inducible-signaling pathway protein 3 isoform 1 [Homo sapiens]. 1095e-24O
Contig/Assembly ProteinWISP1WNT1-inducible-signaling pathway protein 1 isoform 2 precursor [Homo sapiens]. 56.25e-08O
Contig/Assembly ProteinWISP1WNT1-inducible-signaling pathway protein 1 isoform 3 precursor [Homo sapiens]. 51.21e-06O
Contig/Assembly ProteinKCPkielin/chordin-like protein isoform 2 [Homo sapiens]. 51.21e-06


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinWisp2WNT1-inducible-signaling pathway protein 2 precursor [Mus musculus]. 3452e-95O
Contig/Assembly ProteinCtgfconnective tissue growth factor precursor [Mus musculus]. 2032e-52O
Contig/Assembly ProteinNovprotein NOV homolog precursor [Mus musculus]. 1871e-47O
Contig/Assembly ProteinCyr61protein CYR61 precursor [Mus musculus]. 1679e-42O
Contig/Assembly ProteinWisp1WNT1-inducible-signaling pathway protein 1 precursor [Mus musculus]. 1579e-39O
Contig/Assembly ProteinWisp3WNT1 inducible signaling pathway protein 3 [Mus musculus]. 1141e-25O
Contig/Assembly ProteinCol1a1collagen alpha-1(I) chain precursor [Mus musculus]. 51.61e-06O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC610928PREDICTED: similar to WNT1 inducible signaling pathway protein 2 precursor (WISP-2) (Connective tissue growth factor-like protein) (CTGF-L) (Connective tissue growth factor-related protein 58) [Canis familiaris]. 417e-116O
Contig/Assembly ProteinLOC475083PREDICTED: similar to NOV protein homolog precursor (NovH) (Nephroblastoma overexpressed gene protein homolog) [Canis familiaris]. 1923e-49
Contig/Assembly ProteinLOC479967PREDICTED: similar to CYR61 protein precursor (Cysteine-rich, angiogenic inducer, 61) (Insulin-like growth factor-binding protein 10) (GIG1 protein) [Canis familiaris]. 1718e-43O
Contig/Assembly ProteinLOC482048PREDICTED: similar to WNT1 inducible signaling pathway protein 1 precursor (WISP-1) (Wnt-1-induced secreted protein) [Canis familiaris]. 1595e-39O
Contig/Assembly ProteinLOC476202PREDICTED: similar to connective tissue growth factor [Canis familiaris]. 1532e-37O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinWISP2WNT1-inducible-signaling pathway protein 2 [Bos taurus]. 431e-121O
Contig/Assembly ProteinNOVnephroblastoma overexpressed [Bos taurus]. 1887e-48O
Contig/Assembly ProteinCTGFconnective tissue growth factor precursor [Bos taurus]. 1755e-44O
Contig/Assembly ProteinCYR61protein CYR61 [Bos taurus]. 1657e-41O
Contig/Assembly ProteinWISP1PREDICTED: WNT1 inducible signaling pathway protein 1-like [Bos taurus]. 1511e-36O
Contig/Assembly ProteinWISP1PREDICTED: WNT1 inducible signaling pathway protein 1 [Bos taurus]. 1511e-36O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100522769PREDICTED: WNT1-inducible-signaling pathway protein 2-like isoform 2 [Sus scrofa]. 474e-134O
Contig/Assembly ProteinLOC100522769PREDICTED: WNT1-inducible-signaling pathway protein 2-like isoform 1 [Sus scrofa]. 474e-134O
Contig/Assembly ProteinCCN2connective tissue growth factor precursor [Sus scrofa]. 1901e-48O
Contig/Assembly ProteinLOC100154395PREDICTED: protein NOV homolog [Sus scrofa]. 1885e-48O
Contig/Assembly ProteinCYR61PREDICTED: protein CYR61 [Sus scrofa]. 1776e-45O
Contig/Assembly ProteinWISP3PREDICTED: WNT1-inducible-signaling pathway protein 3 [Sus scrofa]. 1141e-25O
Contig/Assembly ProteinLOC100627044PREDICTED: WNT1-inducible-signaling pathway protein 1-like [Sus scrofa]. 54.31e-07O
Contig/Assembly ProteinKCPPREDICTED: kielin/chordin-like protein [Sus scrofa]. 525e-07


Assembly Members: 12      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
OVR010057E03OVR01_0057_E03.bBW964703 
OVR010103A02OVR01_0103_A02.bBW968361 
OVRM10026E08OVRM1_0026_E08.bBP150620 
OVRM10135E11OVRM1_0135_E11.bBP151035 
OVRM10151H11OVRM1_0151_H11.bBP462157 
OVRT10123F02OVRT1_0123_F02.bHX236679 
TCH010065G02TCH01_0065_G02.bCJ027112 
TES010045H12TES01_0045_H12.bCJ032939 
UTR010020A10UTR01_0020_A10.bBP169770 AK240000
UTR010037G07UTR01_0037_G07.bBP172859 
UTR010061G08UTR01_0061_G08.bBP464576 
UTR010062H06UTR01_0062_H06.bBP464822 

  

SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
175A020.167MSCTA/L
C910.833CTC/L
244A130.333WSCCA/P
G800.667CCG/P
265C800.727BSGAC/D
T030.273GAT/D


Alignment:      TOP

20110601C-003485 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
UTR01_0020_A10.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0026_E08.b : xxxxxxxxxxxxxxxxxxxx
OVRT1_0123_F02.b : nnnnccgtcag
UTR01_0037_G07.b : ttttggttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0062_H06.b : agcttttatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0045_H12.b :
OVRM1_0135_E11.b :
OVRM1_0151_H11.b :
OVR01_0103_A02.b :
OVR01_0057_E03.b :
TCH01_0065_G02.b :
UTR01_0061_G08.b :
20110601C-003485 : ........................GTGCTGGCACTGGCTCTGGCAGTCATACACACACAC
---------+---------+---------+---------+---------+---------+ 36
UTR01_0020_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxGTGCTGGCACTGGCTCTGGCAGTcatacacacacac
OVRM1_0026_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtatacacacacacac
OVRT1_0123_F02.b : ctgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0037_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtcatacacacacac
UTR01_0062_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcacacacacactggcaagcaccc
TES01_0045_H12.b :
OVRM1_0135_E11.b : taattg
OVRM1_0151_H11.b : nagtt
OVR01_0103_A02.b : nttggcttggxxxxxxxxxxxxxxx
OVR01_0057_E03.b : ntttggctaggactatnacxxxxxxx
TCH01_0065_G02.b : nnttggctggacttanacxxxxxxxxxx
UTR01_0061_G08.b : gctxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-003485 : ACACACACACTGGCAAGCACCCCCTTGGTGACCTCCACGGTCTCACCTTCAGGCTCAAAG
---------+---------+---------+---------+---------+---------+ 96
UTR01_0020_A10.b : acacacacacTGGCAAGCACCCCCTTGGTGACCTCCACGGTCTCACCTTCAGGCTCAAAG
OVRM1_0026_E08.b : acacacacactggcaagcacccccttggtgacctccacggtctcaccttCAGGCTCAAAG
OVRT1_0123_F02.b : gagtgacctcacagctgccggaacataaagacttacaggtcctgcctccCAGGCTCAAAG
UTR01_0037_G07.b : acacacacactggcaagcacccccttggtgacctccacggtctcaccttCAGGCTCAAAG
UTR01_0062_H06.b : ccttggtgacctccacggtctcaccttcagacttacaggtcctgcctccCAGGCTCAAAG
TES01_0045_H12.b : nnnnatcgcgttggctctggAAG
OVRM1_0135_E11.b : tcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
OVRM1_0151_H11.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
OVR01_0103_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
OVR01_0057_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
TCH01_0065_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
UTR01_0061_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
20110601C-003485 : CTGGCTCCGTGGGGAACACGGTGACATGGGAGGCACAGCACAGACTCTCATCCTGGCCTT
---------+---------+---------+---------+---------+---------+ 156
UTR01_0020_A10.b : CTGGCTCCGTGGGGAACACGGTGACATGGGAGGCACAGCACAGACTCTCATCCTGGCCTT
OVRM1_0026_E08.b : CTGGCTCCGTGGGGAACACGGTGACATGGGAGGCACAGCACAGACTCTCATCCTGGCCTT
OVRT1_0123_F02.b : CTGGCTCCGTGGGGAACACGGTGACATGGGAGGCACAGCACAGACTCTCATCCTGGCCTT
UTR01_0037_G07.b : CTGGCTCCGTGGGGAACACGGTGACATGGGAGGCACAGCACAGACTCTCATCCTGGCCTT
UTR01_0062_H06.b : CTGGCTCCGTGGGGAACACGGTGACATGGGAGGCACAGCACAGACTCTCATCCTGGCCTT
TES01_0045_H12.b : CTGGCTCCGTGGGGA*CACGGTGACATGGGAGGCACAGCACAGACTCTCATCCTGGCCTT
OVRM1_0135_E11.b : CTGGCTCCGTGGGGAACACGGTGACATGGGAGGCACAGCACAGACTCTCATCCTGGCCTT
OVRM1_0151_H11.b : CTGGCTCCGTGGGGAACACGGTGACATGGGAGGCACAGCACAGACTCTCATCCTGGCCTT
OVR01_0103_A02.b : CTGGCTCCGTGGGGAACACGGTGACATGGGAGGCACAGCACAGACTCTCATCCTGGCCTT
OVR01_0057_E03.b : CTGGCTCCGTGGGGAACACGGTGACATGGGAGGCACAGCACAGACTCTCATCCTGGCCTT
TCH01_0065_G02.b : CTGGCTCCGTGGGGAACACGGTGACATGGGAGGCACAGCACAGACTCTCATCCTGGCCTT
UTR01_0061_G08.b : CTGGCTCCGTGGGGAACACGGTGACATGGGAGGCACAGCACAGACTCTCATCCTGGCCTT
20110601C-003485 : CTCCCTCCTCTGCCTCCTCTCCAAGGTGTGTGCCCAGCTATGCCCCACACCATGTGCCTG
---------+---------+---------+---------+---------+---------+ 216
UTR01_0020_A10.b : CTCCCTCCTCTGCCTCCTCTCCAAGGTGTGTGCCCAGCTATGCCCCACACCATGTGCCTG
OVRM1_0026_E08.b : CTCCCTCCTCTGCCTCCTATCCAAGGTGTGTGCCCAGCTATGCCCCACACCATGTGCCTG
OVRT1_0123_F02.b : CTCCCTCCTCTGCCTCCTCTCCAAGGTGTGTGCCCAGCTATGCCCCACACCATGTGCCTG
UTR01_0037_G07.b : CTCCCTCCTCTGCCTCCTCTCCAAGGTGTGTGCCCAGCTATGCCCCACACCATGTGCCTG
UTR01_0062_H06.b : CTCCCTCCTCTGCCTCCTCTCCAAGGTGTGTGCCCAGCTATGCCCCACACCATGTGCCTG
TES01_0045_H12.b : CTCCCTCCTCTGCCTCCTCTCCAAGGTGTGTGCCCAGCTATGCCCCACACCATGTGCCTG
OVRM1_0135_E11.b : CTCCCTCCTCTGCCTCCTCTCCAAGGTGTGTGCCCAGCTATGCCCCACACCATGTGCCTG
OVRM1_0151_H11.b : CTCCCTCCTCTGCCTCCTATCCAAGGTGTGTGCCCAGCTATGCCCCACACCATGTGCCTG
OVR01_0103_A02.b : CTCCCTCCTCTGCCTCCTCTCCAAGGTGTGTGCCCAGCTATGCCCCACACCATGTGCCTG
OVR01_0057_E03.b : CTCCCTCCTCTGCCTCCTCTCCAAGGTGTGTGCCCAGCTATGCCCCACACCATGTGCCTG
TCH01_0065_G02.b : CTCCCTCCTCTGCCTCCTCTCCAAGGTGTGTGCCCAGCTATGCCCCACACCATGTGCCTG
UTR01_0061_G08.b : CTCCCTCCTCTGCCTCCTCTCCAAGGTGTGTGCCCAGCTATGCCCCACACCATGTGCCTG
20110601C-003485 : TCCATGGCCACCACCCCGATGCCCACCGGGGGTGCCCCTGGTGCTGGACGGCTGCAACTG
---------+---------+---------+---------+---------+---------+ 276
UTR01_0020_A10.b : TCCATGGCCACCACCCCGATGCCCACCGGGGGTGCCCCTGGTGCTGGACGGCTGCAACTG
OVRM1_0026_E08.b : TCCATGGCCACCACCCCGATGCCCACCAGGGGTGCCCCTGGTGCTGGATGGCTGCAACTG
OVRT1_0123_F02.b : TCCATGGCCACCACCCCGATGCCCACCGGGGGTGCCCCTGGTGCTGGACGGCTGCAACTG
UTR01_0037_G07.b : TCCATGGCCACCACCCCGATGCCCACCGGGGGTGCCCCTGGTGCTGGACGGCTGCAACTG
UTR01_0062_H06.b : TCCATGGCCACCACCCCGATGCCCACCGGGGGTGCCCCTGGTGCTGGACGGCTGCAACTG
TES01_0045_H12.b : TCCATGGCCACCACCCCGATGCCCACCGGGGGTGCCCCTGGTGCTGGACGGCTGCAACTG
OVRM1_0135_E11.b : TCCATGGCCACCACCCCGATGCCCACCAGGGGTGCCCCTGGTGCTGGATGGCTGCAACTG
OVRM1_0151_H11.b : TCCATGGCCACCACCCCGATGCCCACCAGGGGTGCCCCTGGTGCTGGATGGCTGCAACTG
OVR01_0103_A02.b : TCCATGGCCACCACCCCGATGCCCACCAGGGGTGCCCCTGGTGCTGGACGGCTGCAACTG
OVR01_0057_E03.b : TCCATGGCCACCACCCCGATGCCCACCGGGGGTGCCCCTGGTGCTGGACGGCTGCAACTG
TCH01_0065_G02.b : TCCATGGCCACCACCCCGATGCCCACCGGGGGTGCCCCTGGTGCTGGACGGCTGCAACTG
UTR01_0061_G08.b : TCCATGGCCACCACCCCGATGCCCACCGGGGGTGCCCCTGGTGCTGGACGGCTGCAACTG
20110601C-003485 : CTGCCGGGTATGTGCACGGCGGCTGGGGGAGCCCTGCGACCACCTCCACATCTGCGACTC
---------+---------+---------+---------+---------+---------+ 336
UTR01_0020_A10.b : CTGCCGGGTATGTGCACGGCGGCTGGGGGAGCCCTGCGACCACCTCCACATCTGCGACTC
OVRM1_0026_E08.b : CTGCCGGGTATGTGCACGGCGGCTGGGGGAGCCCTGCGACCACCTCCACATCTGCGACTC
OVRT1_0123_F02.b : CTGCCGGGTATGTGCACGGCGGCTGGGGGAGCCCTGCGACCACCTCCACATCTGCGACTC
UTR01_0037_G07.b : CTGCCGGGTATGTGCACGGCGGCTGGGGGAGCCCTGCGACCACCTCCACATCTGCGACTC
UTR01_0062_H06.b : CTGCCGGGTATGTGCACGGCGGCTGGGGGAGCCCTGCGACCACCTCCACATCTGCGACTC
TES01_0045_H12.b : CTGCCGGGTATGTGCACGGCGGCTGGGGGAGCCCTGCGACCACCTCCACATCTGCGACTC
OVRM1_0135_E11.b : CTGCCGGGTATGTGCACGGCGGCTGGGGGAGCCCTGCGACCACCTCCACATCTGCGACTC
OVRM1_0151_H11.b : CTGCCGGGTATGTGCACGGCGGCTGGGGGAGCCCTGCGACCACCTCCACATCTGCGACTC
OVR01_0103_A02.b : CTGCCGGGTATGTGCACGGCGGCTGGGGGAGCCCTGCGACCACCTCCACATCTGCGACTC
OVR01_0057_E03.b : CTGCCGGGTATGTGCACGGCGGCTGGGGGAGCCCTGCGACCACCTCCACATCTGCGACTC
TCH01_0065_G02.b : CTGCCGGGTATGTGCACGGCGGCTGGGGGAGCCCTGCGACCACCTCCACATCTGCGACTC
UTR01_0061_G08.b : CTGCCGGGTATGTGCACGGCGGCTGGGGGAGCCCTGCGACCACCTCCACATCTGCGACTC
20110601C-003485 : CAGCCAGGGCCTGGTCTGCCAGCTCGGGGCGGGCCCTGGCAGCCGGGGGGCCGTGTGCCT
---------+---------+---------+---------+---------+---------+ 396
UTR01_0020_A10.b : CAGCCAGGGCCTGGTCTGCCAGCTCGGGGCGGGCCCTGGCAGCCGGGGGGCCGTGTGCCT
OVRM1_0026_E08.b : CAGCCAGGGCCTGGTCTGCCAGCTCGGGGCGGGCCCTGGCAGCCGGGGGGCCGTGTGCCT
OVRT1_0123_F02.b : CAGCCAGGGCCTGGTCTGCCAGCTCGGGGCGGGCCCTGGCAGCCGGGGGGCCGTGTGCCT
UTR01_0037_G07.b : CAGCCAGGGCCTGGTCTGCCAGCTCGGGGCGGGCCCTGGCAGCCGGGGGGCCGTGTGCCT
UTR01_0062_H06.b : CAGCCAGGGCCTGGTCTGCCAGCTCGGGGCGGGCCCTGGCAGCCGGGGGGCCGTGTGCCT
TES01_0045_H12.b : CAGCCAGGGCCTGGTCTGCCAGCTCGGGGCGGGCCCTGGCAGCCGGGGGGCCGTGTGCCT
OVRM1_0135_E11.b : CAGCCAGGGCCTGGTCTGCCAGCTCGGGGCGGGCCCTGGCAGCCGGGGGGCCGTGTGCCT
OVRM1_0151_H11.b : CAGCCAGGGCCTGGTCTGCCAGCTCGGGGCGGGCCCTGGCAGCCGGGGGGCCGTGTGCCT
OVR01_0103_A02.b : CAGCCAGGGCCTGGTCTGCCAGCTCGGGGCGGGCCCTGGCAGCCGGGGGGCCGTGTGCCT
OVR01_0057_E03.b : CAGCCAGGGCCTGGTCTGCCAGCTCGGGGCGGGCCCTGGCAGCCGGGGGGCCGTGTGCCT
TCH01_0065_G02.b : CAGCCAGGGCCTGGTCTGCCAGCTCGGGGCGGGCCCTGGCAGCCGGGGGGCCGTGTGCCT
UTR01_0061_G08.b : CAGCCAGGGCCTGGTCTGCCAGCTCGGGGCGGGCCCTGGCAGCCGGGGGGCCGTGTGCCT
20110601C-003485 : CTGGGGAGAGGATGACGGCAGCTGCGAGGTGAACGGCCGCCTGTACCGGGACGGGGAGAC
---------+---------+---------+---------+---------+---------+ 456
UTR01_0020_A10.b : CTGGGGAGAGGATGACGGCAGCTGCGAGGTGAACGGCCGCCTGTACCGGGACGGGGAGAC
OVRM1_0026_E08.b : CTGGGGAGAGGATGACGGCAGCTGCGAGGTGAACGGCCGCCTGTACCGGGACGGGGAGAC
OVRT1_0123_F02.b : CTGGGGAGAGGATGACGGCAGCTGCGAGGTGAACGGCCGCCTGTACCGGGACGGGGAGAC
UTR01_0037_G07.b : CTGGGGAGAGGATGACGGCAGCTGCGAGGTGAACGGCCGCCTGTACCGGGACGGGGAGAC
UTR01_0062_H06.b : CTGGGGAGAGGATGACGGCAGCTGCGAGGTGAACGGCCGCCTGTACCGGGACGGGGAGAC
TES01_0045_H12.b : CTGGGGAGAGGATGACGGCAGCTGCGAGGTGAACGGCCGCCTGTACCGGGACGGGGAGAC
OVRM1_0135_E11.b : CTGGGGAGAGGATGACGGCAGCTGCGAGGTGAACGGCCGCCTGTACCGGGACGGGGAGAC
OVRM1_0151_H11.b : CTGGGGAGAGGATGACGGCAGCTGCGAGGTGAACGGCCGCCTGTACCGGGACGGGGAGAC
OVR01_0103_A02.b : CTGGGGAGAGGATGACGGCAGCTGCGAGGTGAACGGCCGCCTGTACCGGGACGGGGAGAC
OVR01_0057_E03.b : CTGGGGAGAGGATGACGGCAGCTGCGAGGTGAACGGCCGCCTGTACCGGGACGGGGAGAC
TCH01_0065_G02.b : CTGGGGAGAGGATGACGGCAGCTGCGAGGTGAACGGCCGCCTGTACCGGGACGGGGAGAC
UTR01_0061_G08.b : CTGGGGAGAGGATGACGGCAGCTGCGAGGTGAACGGCCGCCTGTACCGGGACGGGGAGAC
20110601C-003485 : CTTCCAGCCCCACTGCAGGATTCGCTGCCGCTGCGAGGACGGCGGTTTCACCTGCGTGCC
---------+---------+---------+---------+---------+---------+ 516
UTR01_0020_A10.b : CTTCCAGCCCCACTGCAGGATTCGCTGCCGCTGCGAGGACGGCGGTTTCACCTGCGTGCC
OVRM1_0026_E08.b : CTTCCAGCCCCACTGCAGGATTCGCTGCCGCTGCGAGGACGGCGGTTTCACCTGCGTGCC
OVRT1_0123_F02.b : CTTCCAGCCCCACTGCAGGATTCGCTGCCGCTGCGAGGACGGCGGTTTCACCTGCGTGCC
UTR01_0037_G07.b : CTTCCAGCCCCACTGCAGGATTCGCTGCCGCTGCGAGGACGGCGGTTTCACCTGCGTGCC
UTR01_0062_H06.b : CTTCCAGCCCCACTGCAGGATTCGCTGCCGCTGCGAGGACGGCGGTTTCACCTGCGTGCC
TES01_0045_H12.b : CTTCCAGCCCCACTGCAGGATTCGCTGCCGCTGCGAGGACGGCGGTTTCACCTGCGTGCC
OVRM1_0135_E11.b : CTTCCAGCCCCACTGCAGGATTCGCTGCCGCTGCGAGGACGGCGGTTTCACCTGCGTGCC
OVRM1_0151_H11.b : CTTCCAGCCCCACTGCAGGATTCGCTGCCGCTGCGAGGACGGCGGTTTCACCTGCGTGCC
OVR01_0103_A02.b : CTTCCAGCCCCACTGCAGGATTCGCTGCCGCTGCGAGGACGGCGGTTTCACCTGCGTGCC
OVR01_0057_E03.b : CTTCCAGCCCCACTGCAGGATTCGCTGCCGCTGCGAGGACGGCGGTTTCACCTGCGTGCC
TCH01_0065_G02.b : CTTCCAGCCCCACTGCAGGATTCGCTGCCGCTGCGAGGACGGCGGTTTCACCTGCGTGCC
UTR01_0061_G08.b : CTTCCAGCCCCACTGCAGGATTCGCTGCCGCTGCGAGGACGGCGGTTTCACCTGCGTGCC
20110601C-003485 : CCTGTGCAGTGAGGACGTGCGGCTGCCCAGCTGGGACTGCCCGCACCCCAGGAGGGTGGA
---------+---------+---------+---------+---------+---------+ 576
UTR01_0020_A10.b : CCTGTGCAGTGAGGACGTGCGGCTGCCCAGCTGGGACTGCCCGCACCCCAGGAGGGTGGA
OVRM1_0026_E08.b : CCTGTGCAGTGAGGACGTGCGGCTGCCCAGCTGGGACTGCCCGCACCCCAGGAGGGCGGA
OVRT1_0123_F02.b : CCTGTGCAGTGAGGACGTGCGGCTGCCCAGCTGGGACTGCCCGCACCCCAGGAGGGTGGA
UTR01_0037_G07.b : CCTGTGCAGTGAGGACGTGCGGCTGCCCAGCTGGGACTGCCCGCACCCCAGGAGGGTGGA
UTR01_0062_H06.b : CCTGTGCAGTGAGGACGTGCGGCTGCCCAGCTGGGACTGCCCGCACCCCAGGAGGGTGGA
TES01_0045_H12.b : CCTGTGCAGTGAGGACGTGCGGCTGCCCAGCTGGGACTGCCCGCACCCCAGGAGGGTGGA
OVRM1_0135_E11.b : CTTGGGCAGTGAGGACGTGCGGCTGCCCAGCTGGGACTGCCCGCACCCTAAGAAGGTGGA
OVRM1_0151_H11.b : CCTGTGCAGTGAGGACGTGCGGCTGCCCAGCTGGGACTGCCCGCACCCCAGGAGGGTGGA
OVR01_0103_A02.b : CCTGTGCAATGAGGACGTGCGGCTGCCCAGCTGGGACTGCCCGCACCCCAAGAGGGTTCA
OVR01_0057_E03.b : CCTGTGCAGTGAGGACGTGCGGCTGCCCAGCTGGGACTGCCCGCACCCCAGGAGGGTGGA
TCH01_0065_G02.b : CCTGTGCAGTGAGGACGTGCGGCTGCCCAGCTGGGACTGCCCGCACCCCAGGAGGGTGGA
UTR01_0061_G08.b : CCTGTGCAGTGAGGACGTGCGGCTGCCCAGCTGGGACTGCCCGCACCCCAGGAGGGTGGA
20110601C-003485 : GGTCCCCGGCAAGTGCTGCCCCGAGTGGGTGTGCGACCCCCAGCCCCTCCCAGCAAGAGG
---------+---------+---------+---------+---------+---------+ 636
UTR01_0020_A10.b : GGTCCCCGGCAAGTGCTGCCCCGAGTGGGTGTGCGACCCCCAGCCCCTCCCAGCAAGAGG
OVRM1_0026_E08.b : GGTCCCCGGCAAGTGCTGCCCCGAGTGGGTGTGAGACCCCCACACCCTCCCATCCAGACG
OVRT1_0123_F02.b : GGTCCCCGGCAAGTGCTGCCCCGAGTGGGTGTGCGACCCCCAGCCCCTCCCAGCAAGAGG
UTR01_0037_G07.b : GGTCCCCGGCAAGTGCTGCCCCGAGTGGGTGTGCGACCCCCAGCCCCTCCCAGCAAGAGG
UTR01_0062_H06.b : GGTCCCCGGCAAGTGCTGCCCCGAGTGGGTGTGCGACCCCCAGCCCCTCCCAGCAAGAGG
TES01_0045_H12.b : GGTCCCCGGCAAGTGCTGCCCCGAGTGGGTGTGCGACCCCCAGCCCCTCCCAGCAAGAGG
OVRM1_0135_E11.b : GGTCCCCGGCAAGTGCTGCCCCGAATGGGTGTGCGATCCCCAACCCCTCCCCACAAGAGG
OVRM1_0151_H11.b : GGTCCCCGGCAAGTGCTGCCCCGAGTGGGTGTGCGACCCCCAGCCCCTCCCAGCAAGAGG
OVR01_0103_A02.b : GGTCCCCGGCAAGTGCTGCCCCGAGTGGGTGTGCGACCCCCAGCCCCTCCCAGCAAGAGG
OVR01_0057_E03.b : GGTCCCCGGCAAGTGCTGCCCCGAGTGGGTGTGCGACCCCCAGCCCCTCCCAGCAAGAGG
TCH01_0065_G02.b : GGTCCCCGGCAAGTGCTGCCCCGAGTGGGTGTGCGACCCCCAGCCCCTCCCAGCAAGAGG
UTR01_0061_G08.b : GGTCCCCGGCAAGTGCTGCCCCGAGTGGGTGTGCGACCCCCAGCCCCTCCCAGCAAGAGG
20110601C-003485 : ACCCCAGTTTTCTGGCCTTGTCGCTCCCCCAGTCCCTGGCATCCCCTGCCCAGAATGGAG
---------+---------+---------+---------+---------+---------+ 696
UTR01_0020_A10.b : ACCCCAGTTTTCTGGCCTTGTCGCTCCCCCAGTCCCTGGCATCCCCTGCCCAGAATGGAG
OVRM1_0026_E08.b : GACCCAGTTCTATGGCCTTGTCGCTCCCCCCGTCCCTCGCATACTCTGCCCAGAATGGAG
OVRT1_0123_F02.b : ACCCCAGTTTTCTGGCCTTGTCGCTCCCCCAGTCCCTGGCATCCCCTGCCCAGAATGGAG
UTR01_0037_G07.b : ACCCCAGTTTTCTGGCCTTGTCGCTCCCCCAGTCCCTGGCATCCCCTGCCCAGAATGGAG
UTR01_0062_H06.b : ACCCCAGTTTTCTGGCCTTGTCGCTCCCCCAGTCCCTGGCATCCCCTGCCCAGAATGGAG
TES01_0045_H12.b : ACCCCAGTTTTCTGGCCTTGTCGCTCCCCCAGTCCCTGGCATCCCCTGCCCAGAATGGAG
OVRM1_0135_E11.b : ACCCCAGTTTTTCTGGCTTGTCGCTCCCCCAGTCCCTtggattcccccggccagaaagta
OVRM1_0151_H11.b : ACCCCAGTTTTCTGGCCTTGTCGCTCCCCCAGTCCCTGGCATCCCCTGCCCAGAATGGAG
OVR01_0103_A02.b : ACCCCAGTTTTCTGGCCTTGTCGCTCCCCCAGTCCCTGGCATCCCCTGCCCAGAATGGAG
OVR01_0057_E03.b : ACCCCAGTTTTCTGGCCTTGTCGCTCCCCCAGTCCCTGGCATCCCCTGCCCAGAATGGAG
TCH01_0065_G02.b : ACCCCAGTTTTCTGGCCTTGTCGCTCCCCCAGTCCCTGGCATCCCCTGCCCAGAATGGAG
UTR01_0061_G08.b : ACCCCAGTTTTCTGGCCTTGTCGCTCCCCCAGTCCCTGGCATCCCCTGCCCAGAATGGAG
20110601C-003485 : CACAGCCTGGGGCCCCTGTTCAACCACCTGTGGGCTGGGCGTGGCCACCCGGGTGTCCAA
---------+---------+---------+---------+---------+---------+ 756
UTR01_0020_A10.b : CACAGCCTGGGGCCCCTGTTCAACCACCTGTGGGCTGGGCGTGGCCACCCGGGTGTCCAA
OVRM1_0026_E08.b : CACACCCTGCGGCCCCTtgttaccacctgtgggctgggcgaggccccctcgtcgtcaacc
OVRT1_0123_F02.b : CACAGCCTGGGGCCCCTGTTCAACCACCTGTGGGCTGGGCGTGGCCACCCGGGTGTCCAA
UTR01_0037_G07.b : CACAGCCTGGGGCCCCTGTTCAACCACCTGTGGGCTGGGCGTGGCCACCCGGGTGTCCAA
UTR01_0062_H06.b : CACAGCCTGGGGCCCCTGTTCAACCACCTGTGGGCTGGGCGTGGCCACCCGGGTGTCCAA
TES01_0045_H12.b : CACAGCCTGGGGCCCCTGTTCAACCACCTGTGGGCTGGGCGTGGCCACCCGGGTGTCCAA
OVRM1_0135_E11.b : gctcaacctggtggcccctgttccaccacctttgcgcttgcgaattgtcccccctggtgg
OVRM1_0151_H11.b : CACAGCCTGGGGCCCCTGTTCAACCACCTGTGGGCTGGGCGTGGCCACCCGGGTGTCCAA
OVR01_0103_A02.b : CACAGCCTGGGGCCCCTGTTCAACCACCTGTGGGCTGGGCGTGGCCACCCGGGTGTCCAA
OVR01_0057_E03.b : CACAGCCTGGGGCCCCTGTTCAACCACCTGTGGGCTGGGCGTGGCCACCCGGGTGTCCAA
TCH01_0065_G02.b : CACAGCCTGGGGCCCCTGTTCAACCACCTGTGGGCTGGGCGTGGCCACCCGGGTGTCCAA
UTR01_0061_G08.b : CACAGCCTGGGGCCCCTGTTCAACCACCTGTGGGCTGGGCGTGGCCACCCGGGTGTCCAA
20110601C-003485 : CCAGAACCGCTTTTGCCGCCTGGAGACCCAGCGCCGCCTGTGCCTACCTGGACCCTGCCC
---------+---------+---------+---------+---------+---------+ 816
UTR01_0020_A10.b : CCAGAACCGCTTTTGCCGCCTGGAGACCCAGCGCCGCCTGTGCCTACCTGGACCCTGCCC
OVRM1_0026_E08.b : cgacccgctattgcgtcctgtagcgcccccctccttggcgcaccctgaccct
OVRT1_0123_F02.b : CCAGAACCGCTTTTGCCGCCTGGAGACCCAGCGCCGCCTGTGCCTACCTGGACCCTGCCC
UTR01_0037_G07.b : CCAGAACCGCTTTTGCCGCCTGGAGACCCAGCGCCGCCTGTGCCTACCTGGACCCTGCCC
UTR01_0062_H06.b : CCAGAACCGCTTTTGCCGCCTGGAGACCCAGCGCCGCCTGTGCCTACCTGGGACCCTGCC
TES01_0045_H12.b : CCAGAACCGCTTTTGCCGCCTGGAGACCCAGCGCCGCCTGTGCCTACCTGGACCCTGCCC
OVRM1_0135_E11.b : ccccaacataaacacctttttgccccctgggagacccaacgtacccctgttggcttccta
OVRM1_0151_H11.b : CCAGAACCGCTTTTGCCGCCTGGAGACCCAGCGCCGCCTGTGCCTACCTGGACCCTGCCC
OVR01_0103_A02.b : CCAGAACCGCTTTTGCCGCCTGGAGAACCAACGCCCCCTGTGCCTTACTGAACCCTGCCC
OVR01_0057_E03.b : CCAGAACCGCTTTTGCCGCCTGGAGACCCAGCGCCGCCTGTGCCTACCTGGACCCTGCCC
TCH01_0065_G02.b : CCAGAACCGCTTTTGCCGCCTGGAGACCCAGCGCCGCCTGTGCCTACCTGGACCCTGCCC
UTR01_0061_G08.b : CCAGAACCGCTTTTGCCGCCTGGAGACCCAGCGCCGCCTGTGCCTACCTGGACCCTGCCC
20110601C-003485 : ACCCGCCAGGGGCCACAGCCCACGGAACAGTGCCTTTTAGAGCTGGGCTGAGAATGGAGA
---------+---------+---------+---------+---------+---------+ 876
UTR01_0020_A10.b : ACCCGCCAGGGGCCACAGCCCACGGAAaagt
OVRM1_0026_E08.b :
OVRT1_0123_F02.b : ACCCGCCAGGGGCCACA*CCCACGGAACAGTGCCTTTTAGAGCTGGGCTGAGAATGGAGA
UTR01_0037_G07.b : ACCCGCCAGGGGCCACAGCCCACGGAACAGTGCCTTTTAGAGCCGGGCTGAGAATGGAGA
UTR01_0062_H06.b : ACCCGCCAGGGGCCACAGCCCACGGAAACGTGCCTTTTAAAGCCGGGCTGAGAATGGAGA
TES01_0045_H12.b : ACCCGCCAGGGGCCACAGCCCACGGAACAGTGCCTTTTAGAGCTGGGCTGAGAATGGAGA
OVRM1_0135_E11.b : tgacaccccgccactccccccggttaccaataccccan
OVRM1_0151_H11.b : ACCCGCCAGGGGCCACAGCCCACGGAACAGTG
OVR01_0103_A02.b : ACCCCCCAGGGGCCACAACCCCACGAAAAGTGCCTTTTtaaaactggggctgaaaatgga
OVR01_0057_E03.b : ACCCGC*AGGGGCCAAAGCCCACGGAACATTGCCTTTTAGAACTGGGCTGAAAATGGAGA
TCH01_0065_G02.b : ACCCGCCAGGGGCCACAGCCCACGGAACAGTGCCTTTTAAAGCCGGGCTGAGAATGGAGA
UTR01_0061_G08.b : ACCCGCCAGGGGCCACAGCCCACGGAACAGTGCCTTTTAGAGCTGGGCTGAGAATGGAGA
20110601C-003485 : CTTTGTGTCACCTCCCCAGTGGGCAATCTGGCCTGCCGGCCACCGTCCAGCTTGGGTCTA
---------+---------+---------+---------+---------+---------+ 936
UTR01_0020_A10.b :
OVRM1_0026_E08.b :
OVRT1_0123_F02.b : ACTTTTGTCACCTCCCCAGTGGGCAATCTGGCCTGCCGGCCACCgtccagcttgggtcta
UTR01_0037_G07.b : CTTTGTGTCACCTCCCCAGTGGGCA
UTR01_0062_H06.b : CTTTGTGTCACCTCCCCAGTGGGCAATCTGGgccgcccggccccctccaacttttggtct
TES01_0045_H12.b : CTTTGTGTCACCTCCCCAGTGGGCAATCTGGCCTGCCGGCCACCGTCCAGCTTGGGTCTA
OVRM1_0135_E11.b :
OVRM1_0151_H11.b :
OVR01_0103_A02.b : aaactttttgtcacctcccccaatggggaaatttgggcctggccggcccaccctccaact
OVR01_0057_E03.b : CTTTGTGTCACCTCCCCATTGGGgcaatttggcctgccgggccacggtccaactttgggt
TCH01_0065_G02.b : CTTTGTGTCACCTCCCCAGTGGGCAATCTGGCCTGCCGGCCACCgtccagctttggtcta
UTR01_0061_G08.b : CTTTGTGTCACCTCCCCAGTGGGCAATCTGGCCTGCCGGCCACCcgtccacctggggtct
20110601C-003485 : CCATCCGGGCCCTGGAGGAAAAGAGTTCCCAGCCAGCTGGTCCGTCTGGACCCTGAGCTA
---------+---------+---------+---------+---------+---------+ 996
UTR01_0020_A10.b :
OVRM1_0026_E08.b :
OVRT1_0123_F02.b : catccgggccctgaaggagagaattccaaaccaactggtcgtctggacctgactacagcc
UTR01_0037_G07.b :
UTR01_0062_H06.b : accacccgggcccctgaaggaaaggaatttcccaaaccagctggtcccttctggacccct
TES01_0045_H12.b : CCATCCGGGCCCTGGAGGAAAAGAGTTCCCAGCCAGCTGGTCCGTCTGGACCCTGAGCTA
OVRM1_0135_E11.b :
OVRM1_0151_H11.b :
OVR01_0103_A02.b : tggggtctaccatcccggggccctgtaagaaaaagaagatccccaaacccaactgggtcc
OVR01_0057_E03.b : ctacccatccgggcccctgaaggaaaagaaattcccaaaaccaactggtccctttgggac
TCH01_0065_G02.b : acatcccgggccctggaggagaggagttcccaagccagctggtcccgtctggaaccctga
UTR01_0061_G08.b : accatcccggccctggaggagaggaattcccaagccagctggtccgtccggaccctgaac
20110601C-003485 : CAGCCGGATGCATGACCT..........................................
---------+---------+---------+---------+---------+---------+ 1014
UTR01_0020_A10.b :
OVRM1_0026_E08.b :
OVRT1_0123_F02.b : gatgctgaaccaacctccttccggtaccccctctggggaaatgacaagcttctttgggtc
UTR01_0037_G07.b :
UTR01_0062_H06.b : gacccggaatccttgacccaaatccccccttcctgaaaccccccatcccgggaaaaaaag
TES01_0045_H12.b : CAGCCGGATGCATGACCTagtcctccttcctgtaactcacatcctgggaagatgaacagg
OVRM1_0135_E11.b :
OVRM1_0151_H11.b :
OVR01_0103_A02.b : cctttggaacccttgaactaacaaacccggaaatggagtgaacccaaatccctccccttc
OVR01_0057_E03.b : cctgaacttacacccggaaaggctagacacccaaccccctctttctggtaaactcacaac
TCH01_0065_G02.b : gcccggaagcatggacctaatcctccttcttgtaaatccacatcctggaaaaaatgacca
UTR01_0061_G08.b : tacaaccggatgcataacctagtctcccttcctgaactcaattcctgggaaaatgaccaa
20110601C-003485 : ............................................................
---------+---------+---------+---------+---------+---------+ 1014
UTR01_0020_A10.b :
OVRM1_0026_E08.b :
OVRT1_0123_F02.b : atctcccccttttcaaaatgcctgggctccaggaaaggaaacctttcctcccaaactaaa
UTR01_0037_G07.b :
UTR01_0062_H06.b : acccgggcgtcctttcgggtccccaccccccccccttttttaaaaaaaagcccactggga
TES01_0045_H12.b : cgtcttctggtccattcaccgccttatcaaagatgcacatggacttccagaaaatggaaa
OVRM1_0135_E11.b :
OVRM1_0151_H11.b :
OVR01_0103_A02.b : ctggaaaaattcccaaaccctggggaaaaaaaaaaaacaaaggccgtctttttggggggc
OVR01_0057_E03.b : tctggggaaaaaaagaaacaaagggttcttttttgggtccattctaccccccctttttat
TCH01_0065_G02.b : agcgtctttcggggtccatttcacccccttttatcaaaaaagccccatgggactttccag
UTR01_0061_G08.b : cgcctcttctgggcccattccccgcctttttccaaaaatgcaacatggaatttccaggaa
20110601C-003485 : ............................................................
---------+---------+---------+---------+---------+---------+ 1014
UTR01_0020_A10.b :
OVRM1_0026_E08.b :
OVRT1_0123_F02.b : agggggggggtggggggcacttttggggggagaaaaggggaaaaaatttcacacctctcc
UTR01_0037_G07.b :
UTR01_0062_H06.b : ccttcccccggaaaa
TES01_0045_H12.b : acatctctcccctaacatcaaaagtggtgctgggctgggtgggctactttttcggggtgg
OVRM1_0135_E11.b :
OVRM1_0151_H11.b :
OVR01_0103_A02.b : cccatttactccgcgctcttttttcttaaaaatagtcccactggtgtgactta
OVR01_0057_E03.b : aaaaaaattcccatgggacctttcccgggaagaaggtgaaaaccctctctcctcccccta
TCH01_0065_G02.b : gaaaaaggaaaaaaccatcctctcccctttaaccatcacaaggttggtgtcttggccttg
UTR01_0061_G08.b : aaaggaaaaaccattctctccccctaaacattcaaaagggggggggtggggcttgggata
20110601C-003485 : ............................................................
---------+---------+---------+---------+---------+---------+ 1014
UTR01_0020_A10.b :
OVRM1_0026_E08.b :
OVRT1_0123_F02.b : ttctcggaaaaaaaaaatcttaaagtccccgtggggtggttctaaaaaacccttcccccg
UTR01_0037_G07.b :
UTR01_0062_H06.b :
TES01_0045_H12.b : ccataaaatggggcacacaaattt
OVRM1_0135_E11.b :
OVRM1_0151_H11.b :
OVR01_0103_A02.b :
OVR01_0057_E03.b : aaaaaataaaagaaggggggttggtga
TCH01_0065_G02.b : ggtggggccaaatttttctggggaggggccaaaaaaatatggggcaacaaaatatattcg
UTR01_0061_G08.b : aggctatttttttctgggggggggggcaaaaaaaaagtggggggaaaaaaaaaat
20110601C-003485 : ............................................................
---------+---------+---------+---------+---------+---------+ 1014
UTR01_0020_A10.b :
OVRM1_0026_E08.b :
OVRT1_0123_F02.b : gggatggtgggttattttaaaaatggggaatcctctaaagaccaatctctaatcacaacc
UTR01_0037_G07.b :
UTR01_0062_H06.b :
TES01_0045_H12.b :
OVRM1_0135_E11.b :
OVRM1_0151_H11.b :
OVR01_0103_A02.b :
OVR01_0057_E03.b :
TCH01_0065_G02.b : aaaaactcccgggcctcccttttcctgtgaaaaaaa
UTR01_0061_G08.b :
20110601C-003485 : ............................................................
---------+---------+---------+---------+---------+---------+ 1014
UTR01_0020_A10.b :
OVRM1_0026_E08.b :
OVRT1_0123_F02.b : gtgtaagattatttgcccctcaaaaaaaacattattgtttttttataaaaagaaatcccg
UTR01_0037_G07.b :
UTR01_0062_H06.b :
TES01_0045_H12.b :
OVRM1_0135_E11.b :
OVRM1_0151_H11.b :
OVR01_0103_A02.b :
OVR01_0057_E03.b :
TCH01_0065_G02.b :
UTR01_0061_G08.b :
20110601C-003485 : ............................................................
---------+---------+---------+---------+---------+---------+ 1014
UTR01_0020_A10.b :
OVRM1_0026_E08.b :
OVRT1_0123_F02.b : gaacgcgaaaa
UTR01_0037_G07.b :
UTR01_0062_H06.b :
TES01_0045_H12.b :
OVRM1_0135_E11.b :
OVRM1_0151_H11.b :
OVR01_0103_A02.b :
OVR01_0057_E03.b :
TCH01_0065_G02.b :
UTR01_0061_G08.b :