[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-006978

Length: 1,172

Sequence [FASTA format sequence]
TTGGCCTACT GGAGAGTGCT CTGCATGGCC TGGTCTTAGG TGCTTGGTGC GGTGAGGAGC
CCAGTGTGCA CTGAGGCAGC CATGGGTCTG CTGACTGGGG ATTTACTGGG GATCCTGGCC
TTGGCCATGG TCATCTTCCT GCTCCTGGTG GACTTGATGC ACCGGCGCTC ACGCTGGGCT
CCACGCTACC CACCGGGCCC CATGCCACTG CCTGGGCTGG GTAACCTGCT ACAAGTGAAC
TTCCAAGACC CACGTCTCAG CTTTATCCAG CTGCGGCGCC GCTTTGGGGA TGTATTCAGC
CTGCAGCAGA TCTGGAGGCC CGTGGTCGTG CTCAATGGGC TGGCGGCTGT GCGGGAGGCG
CTGGTGTCCC ACAGCCATGA AACCTCCGAC CGCCCACCTG TGTTCATCTT AGAGCACCTG
GGTTACGGGC CGCGCTCCGA AGGAGTGATC CTGGCGCGCT ACGGGAAAGC GTGGCGCGAG
CAGCGGCGCT TCTCGGTGTC CACCTTGCGC AACTTTGGCC TGGGCAAGAA GTCGTTGGAG
GAGTGGGTGA CCCAAGAGGC CTCGTGCCTT TGTGCCGCCT TCGCCGACCA GGCTGGACGC
CCCTTTAGCC CTAACAACCT TCTGAATAAA GCGGTGAGCA ACGTGATCGC CTCCCTCACC
TTCGCGCGCC GCTTCGAGTA CAACGACCCT CGCATGCTCA AGCTTCTGGA CCTAGTGTTG
GAAGGACTGA AGGAGGAAGT GGGCCTCATG CGCCAGGTGC TGGAAGCAAT GCCGGTTCTC
AGGCATATCC CGGGGCTGTG TGCCAAGCTC TTCCCAAGGC AGAAGGCCTT CTTGGTCATG
ATAGATGAGC TGATCACAGA GCACAAGATG ACCCGGGACC TGGCCCAGCC CCCCCGAGAC
TTGACGGATG CCTTCCTGGA CGAAATGAAA GAGGCCAAGG GGAAACCCCC GAGAGCAGCT
TCAATGATGA GAACCTCCGC CTGGTGGTGG CTGACCTGTT CTCCGCTGGG ATGATCACCA
CCTCGACCAC GCTGGCCTGG GCTCTCCTCC TCATGATCCT GCACCCAGAC GTGCAGCGAC
GCGTCCAACA GGAAAATCAA TGAGGTGATA GGGCACGTGC GGCAACCGGA AAAAAGGATC
AGGCCCTCAT GCCCTTCACC TTGGCCGTGC TC


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCYP2D6cytochrome P450 2D6 isoform 1 [Homo sapiens]. 347e-111O
Contig/Assembly ProteinCYP2D6cytochrome P450 2D6 isoform 2 [Homo sapiens]. 2355e-78O
Contig/Assembly ProteinCYP2J2cytochrome P450 2J2 [Homo sapiens]. 1401e-38O
Contig/Assembly ProteinCYP2S1cytochrome P450 2S1 [Homo sapiens]. 1202e-30O
Contig/Assembly ProteinCYP2F1cytochrome P450 2F1 [Homo sapiens]. 1195e-30O
Contig/Assembly ProteinCYP2C8cytochrome P450 2C8 isoform a [Homo sapiens]. 1172e-31O
Contig/Assembly ProteinCYP2U1cytochrome P450 2U1 [Homo sapiens]. 1152e-32
Contig/Assembly ProteinCYP2C19cytochrome P450 2C19 [Homo sapiens]. 1146e-30O
Contig/Assembly ProteinCYP2C8cytochrome P450 2C8 isoform b [Homo sapiens]. 1071e-28O
Contig/Assembly ProteinCYP2C8cytochrome P450 2C8 isoform b [Homo sapiens]. 1071e-28O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCyp2d22cytochrome P450, family 2, subfamily d, polypeptide 22 [Mus musculus]. 3034e-98O
Contig/Assembly ProteinCyp2d22cytochrome P450, family 2, subfamily d, polypeptide 22 [Mus musculus]. 3034e-98O
Contig/Assembly ProteinCyp2d26cytochrome P450 2D26 [Mus musculus]. 2954e-80O
Contig/Assembly ProteinCyp2d9cytochrome P450 2D9 [Mus musculus]. 2786e-89O
Contig/Assembly ProteinCyp2d10cytochrome P450 2D10 [Mus musculus]. 2771e-88O
Contig/Assembly ProteinCyp2d34cytochrome P450, family 2, subfamily d, polypeptide 34 [Mus musculus]. 2773e-89O
Contig/Assembly ProteinCyp2d12cytochrome P450, family 2, subfamily d, polypeptide 12 [Mus musculus]. 2738e-88O
Contig/Assembly ProteinCyp2d11cytochrome P450 2D11 [Mus musculus]. 2682e-87O
Contig/Assembly ProteinCyp2j6cytochrome P450 2J6 [Mus musculus]. 1473e-41O
Contig/Assembly ProteinCyp2j9cytochrome P450, family 2, subfamily j, polypeptide 9 [Mus musculus]. 1442e-34O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCYP2D15cytochrome P450 2D15 [Canis lupus familiaris]. 337e-105O
Contig/Assembly ProteinLOC610195PREDICTED: similar to cytochrome P450, family 2, subfamily J, polypeptide 2 [Canis familiaris]. 1423e-37O
Contig/Assembly ProteinLOC476453PREDICTED: similar to cytochrome P450 monooxygenase CYP2T1 [Canis familiaris]. 1272e-29O
Contig/Assembly ProteinLOC612477PREDICTED: similar to cytochrome P450, family 2, subfamily F, polypeptide 1 [Canis familiaris]. 1233e-28
Contig/Assembly ProteinCYP2B6cytochrome P450 2B11 [Canis lupus familiaris]. 1202e-27O
Contig/Assembly ProteinCYPIIB11PREDICTED: cytochrome P450 2B11 [Canis familiaris]. 1202e-27O
Contig/Assembly ProteinLOC484491PREDICTED: similar to cytochrome P450, family 2, subfamily S, polypeptide 1 [Canis familiaris]. 1179e-32O
Contig/Assembly ProteinLOC610105PREDICTED: similar to cytochrome P450, family 2, subfamily K, polypeptide 6 [Canis familiaris]. 1143e-29
Contig/Assembly ProteinCYP2C19cytochrome P450 2C21 [Canis lupus familiaris]. 1111e-29O
Contig/Assembly ProteinCYP2C41cytochrome P450 2C41 [Canis lupus familiaris]. 1066e-28O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMGC127055hypothetical protein LOC785824 [Bos taurus]. 384e-107O
Contig/Assembly ProteinCYP2D14cytochrome P450 2D14 [Bos taurus]. 382e-124O
Contig/Assembly ProteinLOC530929PREDICTED: cytochrome P450, family 2, subfamily J-like [Bos taurus]. 1437e-39O
Contig/Assembly ProteinLOC530929PREDICTED: cytochrome P450, family 2, subfamily J-like [Bos taurus]. 1437e-39O
Contig/Assembly ProteinLOC510406PREDICTED: cytochrome P450, family 2, subfamily J, polypeptide 2-like [Bos taurus]. 1432e-38O
Contig/Assembly ProteinLOC510406PREDICTED: cytochrome P450, family 2, subfamily J, polypeptide 2-like [Bos taurus]. 1432e-38O
Contig/Assembly ProteinLOC511936PREDICTED: similar to cytochrome P450 isoform 2J [Bos taurus]. 1372e-36O
Contig/Assembly ProteinCYP2J2cytochrome P450, family 2, subfamily J, polypeptide 2 [Bos taurus]. 1293e-35O
Contig/Assembly ProteinLOC511936PREDICTED: similar to cytochrome P450 isoform 2J isoform 1, partial [Bos taurus]. 1293e-34O
Contig/Assembly ProteinCYP2C18cytochrome P450, family 2, subfamily C, polypeptide 18 [Bos taurus]. 1243e-32O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100622269PREDICTED: vitamin D(3) 25-hydroxylase-like isoform 1 [Sus scrofa]. 482e-136O
Contig/Assembly ProteinCYP2D25vitamin D(3) 25-hydroxylase [Sus scrofa]. 482e-136O
Contig/Assembly ProteinLOC100622269PREDICTED: vitamin D(3) 25-hydroxylase-like isoform 2 [Sus scrofa]. 3562e-98O
Contig/Assembly ProteinLOC100621407PREDICTED: cytochrome P450 2J2-like, partial [Sus scrofa]. 1357e-36O
Contig/Assembly ProteinLOC100524940PREDICTED: cytochrome P450 2J2-like, partial [Sus scrofa]. 1321e-35O
Contig/Assembly ProteinLOC100525112PREDICTED: cytochrome P450 2J2-like [Sus scrofa]. 1272e-29O
Contig/Assembly ProteinCYP2C32PREDICTED: LOW QUALITY PROTEIN: cytochrome P450 2C18 [Sus scrofa]. 1258e-34O
Contig/Assembly ProteinCYP2C49cytochrome P450 2C49 [Sus scrofa]. 1243e-33O
Contig/Assembly ProteinCYP2C33cytochrome P450 2C33 [Sus scrofa]. 1155e-30O
Contig/Assembly ProteinLOC100518620PREDICTED: cytochrome P450 2U1-like [Sus scrofa]. 1092e-30


Assembly Members: 562      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
KDN010002E10KDN01_0002_E10.b  
KDN010002H04KDN01_0002_H04.b  
KDN010004C04KDN01_0004_C04.b  
KDN010004D12KDN01_0004_D12.bFS671501 
KDN010004E05KDN01_0004_E05.bFS671503 
KDN010004H05KDN01_0004_H05.b  
KDN010006F03KDN01_0006_F03.bFS671651 
KDN010007G09KDN01_0007_G09.bFS671746 
KDN010007H11KDN01_0007_H11.bFS671755 
KDN010008F06KDN01_0008_F06.bFS671810 
KDN010009E11KDN01_0009_E11.bFS671878 
KDN010009G06KDN01_0009_G06.bFS671888 
KDN010010B07KDN01_0010_B07.bFS671919 
KDN010011C05KDN01_0011_C05.bFS672002 
KDN010015F11KDN01_0015_F11.bFS672354 
KDN010016D07KDN01_0016_D07.bFS672401 
KDN010016H08KDN01_0016_H08.bFS672442 
KDN010018A10KDN01_0018_A10.bFS672527 
KDN010018F02KDN01_0018_F02.bFS672564 
KDN010018H01KDN01_0018_H01.bFS672583 
KDN010019A04KDN01_0019_A04.bFS672596 
KDN010019B01KDN01_0019_B01.bFS672599 
KDN010019E03KDN01_0019_E03.bFS672627 
KDN010020D06KDN01_0020_D06.bFS672685 
KDN010020G01KDN01_0020_G01.bFS672707 
KDN010022C02KDN01_0022_C02.bFS672829 
KDN010022C05KDN01_0022_C05.bFS672832 
KDN010022E07KDN01_0022_E07.bFS672853 
KDN010022G02KDN01_0022_G02.bFS672868 
KDN010023A09KDN01_0023_A09.bFS672896 
KDN010023B04KDN01_0023_B04.bFS672901 
KDN010023D04KDN01_0023_D04.bFS672921 
KDN010024A01KDN01_0024_A01.bFS672969 
KDN010024A12KDN01_0024_A12.bHX234759 
KDN010024C12KDN01_0024_C12.bFS673000 
KDN010024F07KDN01_0024_F07.bFS673028 
KDN010026C09KDN01_0026_C09.bFS673154 
KDN010027B01KDN01_0027_B01.bFS673216 
KDN010027B04KDN01_0027_B04.bFS673218 
KDN010028F03KDN01_0028_F03.bFS673331 
KDN010029A02KDN01_0029_A02.bFS673361 
KDN010029A12KDN01_0029_A12.bFS673368 
KDN010031A10KDN01_0031_A10.bFS673532 
KDN010031E06KDN01_0031_E06.bFS673567 
KDN010033A07KDN01_0033_A07.bFS673682 
KDN010033H08KDN01_0033_H08.bFS673755 
KDN010034C06KDN01_0034_C06.bFS673780 
KDN010034E04KDN01_0034_E04.bFS673794 
KDN010034G04KDN01_0034_G04.bFS673812 
KDN010036G08KDN01_0036_G08.bFS673981 
KDN010036H02KDN01_0036_H02.bFS673987 
KDN010037F04KDN01_0037_F04.b  
KDN010038C09KDN01_0038_C09.b  
KDN010038C11KDN01_0038_C11.bFS674000 
KDN010038D03KDN01_0038_D03.b  
KDN010038D09KDN01_0038_D09.b  
KDN010040C06KDN01_0040_C06.b  
KDN010040F02KDN01_0040_F02.b  
KDN010042D11KDN01_0042_D11.b  
KDN010043D04KDN01_0043_D04.bFS674193 
KDN010043F05KDN01_0043_F05.bFS674214 
KDN010044H06KDN01_0044_H06.bFS674314 
KDN010045D05KDN01_0045_D05.b  
KDN010045E09KDN01_0045_E09.b  
KDN010045E11KDN01_0045_E11.bFS674345 
KDN010045E12KDN01_0045_E12.b  
KDN010047C11KDN01_0047_C11.b  
KDN010047G11KDN01_0047_G11.bFS674413 
KDN010049A07KDN01_0049_A07.bFS674450 
KDN010049G10KDN01_0049_G10.bFS674480 
KDN010050B09KDN01_0050_B09.b  
KDN010051D03KDN01_0051_D03.b  
KDN010051E11KDN01_0051_E11.bFS674559 
KDN010051G03KDN01_0051_G03.b  
KDN010051H12KDN01_0051_H12.bHX234783 
KDN010053B10KDN01_0053_B10.bFS674641 
KDN010053C06KDN01_0053_C06.bFS674649 
KDN010053D04KDN01_0053_D04.bFS674655 
KDN010056D06KDN01_0056_D06.bFS674892 
KDN010057A03KDN01_0057_A03.bFS674937 
KDN010057H10KDN01_0057_H10.bFS675010 
KDN010058B03KDN01_0058_B03.bFS675024 
KDN010058B11KDN01_0058_B11.bFS675031 
KDN010060D07KDN01_0060_D07.bFS675205 
KDN010060G08KDN01_0060_G08.bFS675237 
KDN010061A09KDN01_0061_A09.bFS675256 
KDN010061E11KDN01_0061_E11.bFS675299 
KDN010062A05KDN01_0062_A05.bFS675338 
KDN010063A07KDN01_0063_A07.bFS675421 
KDN010064B07KDN01_0064_B07.bFS675517 
KDN010064G07KDN01_0064_G07.bFS675570 
KDN010065A07KDN01_0065_A07.bFS675589 
KDN010066A09KDN01_0066_A09.bFS675668 
KDN010066D01KDN01_0066_D01.bFS675693 
KDN010067C06KDN01_0067_C06.bFS675768 
KDN010068E08KDN01_0068_E08.b  
KDN010068F07KDN01_0068_F07.bFS675864 
KDN010070E10KDN01_0070_E10.bFS676015 
KDN010070G01KDN01_0070_G01.bFS676029 
KDN010071A07KDN01_0071_A07.bFS676053 
KDN010071B06KDN01_0071_B06.bFS676064 
KDN010072A12KDN01_0072_A12.bFS676135 
KDN010072D07KDN01_0072_D07.bFS676164 
KDN010073F11KDN01_0073_F11.bFS676270 
KDN010075B07KDN01_0075_B07.bFS676393 
KDN010076B02KDN01_0076_B02.bFS676463 
KDN010076G08KDN01_0076_G08.bFS676522 
KDN010077A04KDN01_0077_A04.bFS676539 
KDN010077C11KDN01_0077_C11.bFS676565 
KDN010078A01KDN01_0078_A01.bFS676611 
KDN010078B08KDN01_0078_B08.bFS676625 
KDN010078B11KDN01_0078_B11.bFS676628 
KDN010079F05KDN01_0079_F05.bFS676736 
KDN010079F10KDN01_0079_F10.bFS676740 
KDN010079G01KDN01_0079_G01.bFS676743 
KDN010080B03KDN01_0080_B03.bFS676774 
KDN010081G05KDN01_0081_G05.bFS676902 
KDN010082A06KDN01_0082_A06.bFS676921 
KDN010082E06KDN01_0082_E06.bFS676961 
KDN010083H09KDN01_0083_H09.bFS677064 
KDN010086A04KDN01_0086_A04.bFS677226 
KDN010086G07KDN01_0086_G07.bFS677290 
KDN010086G10KDN01_0086_G10.bFS677292 
KDN010088E11KDN01_0088_E11.bFS677433 
KDN010089A12KDN01_0089_A12.bFS677475 
KDN010089D05KDN01_0089_D05.bFS677502 
KDN010089D07KDN01_0089_D07.bFS677504 
KDN010089E09KDN01_0089_E09.bFS677515 
KDN010089H06KDN01_0089_H06.bFS677543 
KDN010090G09KDN01_0090_G09.bFS677616 
KDN010091A09KDN01_0091_A09.bFS677634 
KDN010092F01KDN01_0092_F01.bFS677763 
KDN010092G02KDN01_0092_G02.bFS677774 
KDN010093H09KDN01_0093_H09.bFS677872 
KDN010095H06KDN01_0095_H06.bFS678040 
KDN010096B02KDN01_0096_B02.bFS678057 
KDN010097C11KDN01_0097_C11.bFS678143 
KDN010098C03KDN01_0098_C03.bFS678213 
KDN010098G02KDN01_0098_G02.bFS678248 
KDN010099C09KDN01_0099_C09.bFS678297 
KDN010100C03KDN01_0100_C03.bFS678375 
LVR010001E01LVR01_0001_E01.bBP444566 
LVR010001G12LVR01_0001_G12.bBP447131 
LVR010001H02LVR01_0001_H02.bBP447287 
LVR010002A06LVR01_0002_A06.bBP441330 
LVR010002E01LVR01_0002_E01.bBP444567 
LVR010002G07LVR01_0002_G07.bBP446764 
LVR010003B06LVR01_0003_B06.bBP442249 
LVR010003B08LVR01_0003_B08.bBP442400 
LVR010004G04LVR01_0004_G04.bBP446544 
LVR010004H04LVR01_0004_H04.bBP447451 
LVR010005B02LVR01_0005_B02.bBP441940 
LVR010005C09LVR01_0005_C09.bBP443380 
LVR010008B10LVR01_0008_B10.bBP442553 
LVR010008C10LVR01_0008_C10.bBP443457 
LVR010009A01LVR01_0009_A01.bBP440941 
LVR010009C09LVR01_0009_C09.bBP443382 
LVR010009H05LVR01_0009_H05.bBP447527 
LVR010010A06LVR01_0010_A06.bBP441336 
LVR010010C03LVR01_0010_C03.bBP442941 
LVR010010E06LVR01_0010_E06.bBP444938 
LVR010010H03LVR01_0010_H03.bBP447374 
LVR010011E09LVR01_0011_E09.bBP445133 
LVR010012D12LVR01_0012_D12.bBP444497 
LVR010012F08LVR01_0012_F08.bBP445945 
LVR010012G01LVR01_0012_G01.bBP446316 
LVR010012G04LVR01_0012_G04.bBP446549 
LVR010013C12LVR01_0013_C12.bBP443611 
LVR010013G04LVR01_0013_G04.bBP446550 
LVR010013H08LVR01_0013_H08.bBP447766 
LVR010013H09LVR01_0013_H09.bBP447842 
LVR010014C11LVR01_0014_C11.bBP443536 
LVR010014D01LVR01_0014_D01.bBP443684 
LVR010014D07LVR01_0014_D07.bBP444131 
LVR010014G05LVR01_0014_G05.bBP446626 
LVR010014H01LVR01_0014_H01.bBP447220 
LVR010015A12LVR01_0015_A12.bBP441798 
LVR010015E08LVR01_0015_E08.bBP445071 
LVR010015E10LVR01_0015_E10.bBP445210 
LVR010016A01LVR01_0016_A01.bBP440948 
LVR010016E11LVR01_0016_E11.bBP445280 
LVR010016G11LVR01_0016_G11.bBP447065 
LVR010016G12LVR01_0016_G12.bBP447143 
LVR010017D02LVR01_0017_D02.bBP443768 
LVR010017H03LVR01_0017_H03.bBP447380 
LVR010018A11LVR01_0018_A11.bBP441728 
LVR010018D11LVR01_0018_D11.bBP444425 
LVR010018F02LVR01_0018_F02.bBP445514 
LVR010019B10LVR01_0019_B10.b  
LVR010019D11LVR01_0019_D11.bBP444426 
LVR010019G01LVR01_0019_G01.bBP446322 
LVR010019G12LVR01_0019_G12.bBP447146 
LVR010020E01LVR01_0020_E01.bBP444583 
LVR010020E12LVR01_0020_E12.bBP445361 
LVR010020F07LVR01_0020_F07.bBP445886 
LVR010021B12LVR01_0021_B12.bBP442721 
LVR010021D05LVR01_0021_D05.bBP443995 
LVR010022B07LVR01_0022_B07.bBP442338 
LVR010022E08LVR01_0022_E08.bBP445078 
LVR010022H11LVR01_0022_H11.bBP448006 
LVR010025A01LVR01_0025_A01.bBP440954 
LVR010025D07LVR01_0025_D07.bBP444138 
LVR010025E08LVR01_0025_E08.bBP445079 
LVR010025F02LVR01_0025_F02.bBP445519 
LVR010026C10LVR01_0026_C10.bBP443470 
LVR010026D05LVR01_0026_D05.bBP443997 
LVR010028B06LVR01_0028_B06.bBP442268 
LVR010028D07LVR01_0028_D07.bBP444140 
LVR010029A03LVR01_0029_A03.bBP441117 
LVR010029A04LVR01_0029_A04.bBP441196 
LVR010030B07LVR01_0030_B07.bBP442343 
LVR010030D06LVR01_0030_D06.bBP444073 
LVR010030E02LVR01_0030_E02.bBP444667 
LVR010030G08LVR01_0030_G08.bBP446852 
LVR010030H01LVR01_0030_H01.bBP447232 
LVR010030H02LVR01_0030_H02.bBP447311 
LVR010030H03LVR01_0030_H03.bBP447390 
LVR010031F06LVR01_0031_F06.bBP445823 
LVR010033B03LVR01_0033_B03.bBP442037 
LVR010033E01LVR01_0033_E01.bBP444591 
LVR010033F07LVR01_0033_F07.bBP445894 
LVR010034B02LVR01_0034_B02.bBP441961 
LVR010034B11LVR01_0034_B11.bBP442651 
LVR010034C09LVR01_0034_C09.bBP443401 
LVR010034F10LVR01_0034_F10.bBP446109 
LVR010034G01LVR01_0034_G01.bBP446331 
LVR010035C03LVR01_0035_C03.b  
LVR010035D03LVR01_0035_D03.bBP443856 
LVR010035D12LVR01_0035_D12.b  
LVR010036H12LVR01_0036_H12.bBP448095 
LVR010037A05LVR01_0037_A05.bBP441281 
LVR010037A12LVR01_0037_A12.bBP441815 
LVR010037C10LVR01_0037_C10.bBP443478 
LVR010037D04LVR01_0037_D04.bBP443929 
LVR010037G10LVR01_0037_G10.b  
LVR010038D05LVR01_0038_D05.bBP444004 
LVR010038F11LVR01_0038_F11.bBP446186 
LVR010038G10LVR01_0038_G10.bBP447005 
LVR010039B10LVR01_0039_B10.bBP442577 
LVR010039E10LVR01_0039_E10.bBP445224 
LVR010040B06LVR01_0040_B06.bBP442275 
LVR010040D10LVR01_0040_D10.bBP444367 
LVR010040F06LVR01_0040_F06.bBP445827 
LVR010040F08LVR01_0040_F08.bBP445966 
LVR010041D03LVR01_0041_D03.bBP443861 
LVR010041F12LVR01_0041_F12.bBP446264 
LVR010042F01LVR01_0042_F01.bBP445456 
LVR010042F12LVR01_0042_F12.bBP446265 
LVR010043A09LVR01_0043_A09.bBP441596 
LVR010044C05LVR01_0044_C05.bBP443119 
LVR010044D02LVR01_0044_D02.bBP443787 
LVR010044D10LVR01_0044_D10.bBP444370 
LVR010044E02LVR01_0044_E02.bBP444676 
LVR010044F11LVR01_0044_F11.bBP446192 
LVR010045D11LVR01_0045_D11.bBP444447 
LVR010045G07LVR01_0045_G07.bBP446793 
LVR010045H08LVR01_0045_H08.bBP447788 
LVR010046B09LVR01_0046_B09.bBP442511 
LVR010046B10LVR01_0046_B10.bBP442584 
LVR010046E01LVR01_0046_E01.bBP444604 
LVR010046E12LVR01_0046_E12.bBP445382 
LVR010046F04LVR01_0046_F04.bBP445685 
LVR010048E10LVR01_0048_E10.bBP445233 AK232448
LVR010048F09LVR01_0048_F09.bBP446044 
LVR010048G12LVR01_0048_G12.bBP447169 
LVR010049B01LVR01_0049_B01.bBP441897 
LVR010049E05LVR01_0049_E05.bBP444896 
LVR010050B07LVR01_0050_B07.bBP442360 
LVR010050G03LVR01_0050_G03.bBP446502 
LVR010052F08LVR01_0052_F08.bBP445977 
LVR010053B01LVR01_0053_B01.bBP441901 
LVR010053C05LVR01_0053_C05.bBP443128 
LVR010054B04LVR01_0054_B04.bBP442135 
LVR010054B06LVR01_0054_B06.bBP442287 
LVR010054D11LVR01_0054_D11.bBP444456 
LVR010054G02LVR01_0054_G02.bBP446429 
LVR010054H03LVR01_0054_H03.bBP447413 
LVR010055A08LVR01_0055_A08.bBP441530 
LVR010055B01LVR01_0055_B01.bBP441903 
LVR010055B11LVR01_0055_B11.bBP442671 
LVR010055D12LVR01_0055_D12.bBP444532 
LVR010055E11LVR01_0055_E11.bBP445311 
LVR010055H02LVR01_0055_H02.bBP447333 
LVR010057D12LVR01_0057_D12.bBP444534 
LVR010057G09LVR01_0057_G09.bBP446946 
LVR010058E02LVR01_0058_E02.bBP444690 
LVR010058E08LVR01_0058_E08.bBP445099 
LVR010058H02LVR01_0058_H02.bBP447335 
LVR010058H11LVR01_0058_H11.bBP448037 
LVR010060A08LVR01_0060_A08.bBP441535 
LVR010060B05LVR01_0060_B05.bBP442218 
LVR010060D03LVR01_0060_D03.bBP443877 
LVR010060D11LVR01_0060_D11.bBP444460 
LVR010060E10LVR01_0060_E10.bBP445244 
LVR010060H11LVR01_0060_H11.bBP448039 
LVR010061D02LVR01_0061_D02.bBP443802 
LVR010061F02LVR01_0061_F02.bBP445548 
LVR010061F10LVR01_0061_F10.bBP446133 
LVR010061G12LVR01_0061_G12.bBP447182 
LVR010062A03LVR01_0062_A03.bBP441146 
LVR010062A09LVR01_0062_A09.bBP441613 
LVR010062B11LVR01_0062_B11.bBP442678 
LVR010062B12LVR01_0062_B12.bBP442754 
LVR010062C01LVR01_0062_C01.bBP442835 
LVR010062E01LVR01_0062_E01.bBP444620 
LVR010062F02LVR01_0062_F02.bBP445549 
LVR010062G09LVR01_0062_G09.bBP446951 
LVR010063A06LVR01_0063_A06.bBP441378 
LVR010065E08LVR01_0065_E08.bBP445103 
LVR010065H01LVR01_0065_H01.bBP447264 
LVR010066E02LVR01_0066_E02.bBP444697 
LVR010066E10LVR01_0066_E10.bBP445247 
LVR010066F06LVR01_0066_F06.bBP445849 
LVR010066H12LVR01_0066_H12.bBP448121 
LVR010067B09LVR01_0067_B09.bBP442529 
LVR010067F03LVR01_0067_F03.bBP445630 
LVR010067H08LVR01_0067_H08.bBP447809 
LVR010068A05LVR01_0068_A05.bBP441307 
LVR010068A11LVR01_0068_A11.bBP441765 
LVR010068E08LVR01_0068_E08.bBP445106 
LVR010071G04LVR01_0071_G04.bBP446595 
LVR010071G06LVR01_0071_G06.bBP446744 
LVR010072E10LVR01_0072_E10.bBP445251 
LVR010072F10LVR01_0072_F10.bBP446141 
LVR010073A03LVR01_0073_A03.bBP441154 
LVR010073F12LVR01_0073_F12.bBP446290 
LVR010074A11LVR01_0074_A11.bBP441769 
LVR010074G09LVR01_0074_G09.bBP446960 
LVR010076A12LVR01_0076_A12.bBP441845 
LVR010077C08LVR01_0077_C08.bBP443361 
LVR010077G01LVR01_0077_G01.bBP446368 
LVR010078E06LVR01_0078_E06.bBP444983 
LVR010078F11LVR01_0078_F11.bBP446221 
LVR010079A02LVR01_0079_A02.bBP441080 
LVR010079D08LVR01_0079_D08.bBP444246 
LVR010082E09LVR01_0082_E09.bBP445187 
LVR010082G07LVR01_0082_G07.bBP446819 
LVR010082G08LVR01_0082_G08.bBP446892 
LVR010083A01LVR01_0083_A01.bCJ000001 
LVR010083C04LVR01_0083_C04.bCJ000025 
LVR010083E06LVR01_0083_E06.bCJ000048 
LVR010084B10LVR01_0084_B10.bCJ000108 
LVR010084C04LVR01_0084_C04.bCJ000114 
LVR010084E02LVR01_0084_E02.bCJ000136 
LVR010084E07LVR01_0084_E07.bBW962714 
LVR010085F06LVR01_0085_F06.bCJ000230 
LVR010086A09LVR01_0086_A09.bCJ000265 
LVR010086F01LVR01_0086_F01.bCJ000310 
LVR010087B02LVR01_0087_B02.bCJ000351 
LVR010088A02LVR01_0088_A02.bCJ000420 
LVR010088B03LVR01_0088_B03.bCJ000433 
LVR010088D09LVR01_0088_D09.bCJ000461 
LVR010088F10LVR01_0088_F10.bCJ000483 
LVR010089B03LVR01_0089_B03.bCJ000521 
LVR010091D09LVR01_0091_D09.b  
LVR010092B06LVR01_0092_B06.bCJ000770 
LVR010092C02LVR01_0092_C02.bCJ000778 
LVR010092D05LVR01_0092_D05.bCJ000792 
LVR010092F11LVR01_0092_F11.bCJ000820 
LVR010092H08LVR01_0092_H08.bCJ000838 
LVR010092H11LVR01_0092_H11.bCJ000841 
LVR010093G05LVR01_0093_G05.bCJ000893 
LVR010094C05LVR01_0094_C05.bCJ000934 
LVR010094C09LVR01_0094_C09.bCJ000938 
LVR010094E05LVR01_0094_E05.bBW962779 
LVR010094F09LVR01_0094_F09.bCJ000968 
LVR010094G02LVR01_0094_G02.bCJ000973 
LVR010094G09LVR01_0094_G09.bCJ000980 
LVR010094G12LVR01_0094_G12.bCJ000982 
LVR010095F03LVR01_0095_F03.bBP445641 
LVR010095F11LVR01_0095_F11.bBP446224 
LVR010095G10LVR01_0095_G10.bBP447044 
LVR010096E02LVR01_0096_E02.bBP444710 
LVR010096E08LVR01_0096_E08.bBP445117 
LVR010096H07LVR01_0096_H07.bBP447746 
LVR010097B08LVR01_0097_B08.bBP442465 
LVR010097B12LVR01_0097_B12.bBP442771 
LVR010097D05LVR01_0097_D05.bBP444044 
LVR010097E10LVR01_0097_E10.bBP445261 
LVR010097F02LVR01_0097_F02.bBP445567 
LVR010098A04LVR01_0098_A04.bBP441244 
LVR010098H03LVR01_0098_H03.bBP447440 
LVR010099F05LVR01_0099_F05.bBP445793 
LVR010099F11LVR01_0099_F11.bBP446228 
LVR010099H02LVR01_0099_H02.bBP447359 
LVR010101B03LVR01_0101_B03.bBP442086 
LVR010101F09LVR01_0101_F09.bBP446078 
LVR010102E11LVR01_0102_E11.bBP445341 
LVR010102G08LVR01_0102_G08.bBP446899 
LVR010103D03LVR01_0103_D03.bBP443903 
LVR010103D05LVR01_0103_D05.bBP444049 
LVR010103E03LVR01_0103_E03.bBP444789 
LVR010104D09LVR01_0104_D09.bBP444336 
LVR010104F07LVR01_0104_F07.bBP445934 
LVR010104H01LVR01_0104_H01.bBP447284 
LVR010104H12LVR01_0104_H12.bBP448143 
LVR010105C05LVR01_0105_C05.bBP443159 
LVR010105F12LVR01_0105_F12.bBP446306 
LVR010106C07LVR01_0106_C07.bBP443305 
LVR010106G07LVR01_0106_G07.bBP446830 
LVR010106G10LVR01_0106_G10.bBP447053 
LVRM10001D09LVRM1_0001_D09.bBP139211 
LVRM10002F07LVRM1_0002_F07.bBP140040 
LVRM10003C12LVRM1_0003_C12.bCJ001019 
LVRM10007A12LVRM1_0007_A12.bBP137914 
LVRM10007B06LVRM1_0007_B06.bBP138151 
LVRM10010B06LVRM1_0010_B06.bBP138154 
LVRM10013D06LVRM1_0013_D06.bBP450895 
LVRM10014B12LVRM1_0014_B12.bBP449669 
LVRM10015F10LVRM1_0015_F10.bBP452786 
LVRM10019H02LVRM1_0019_H02.bBP140793 
LVRM10021E12LVRM1_0021_E12.bCJ001176 
LVRM10025G08LVRM1_0025_G08.bBP140556 
LVRM10025H03LVRM1_0025_H03.bBP140837 
LVRM10026B07LVRM1_0026_B07.bBP138198 
LVRM10028A03LVRM1_0028_A03.bBP137572 
LVRM10030A07LVRM1_0030_A07.bBP137728 
LVRM10030G06LVRM1_0030_G06.bBP140476 
LVRM10031C08LVRM1_0031_C08.bBP138708 
LVRM10034H05LVRM1_0034_H05.bCJ001372 
LVRM10035A03LVRM1_0035_A03.bCJ001379 
LVRM10036G08LVRM1_0036_G08.bCJ001532 
LVRM10036G10LVRM1_0036_G10.bCJ001534 
LVRM10037C05LVRM1_0037_C05.bCJ001571 
LVRM10038A10LVRM1_0038_A10.bCJ001640 
LVRM10038F05LVRM1_0038_F05.bCJ001690 
LVRM10038H03LVRM1_0038_H03.bCJ001708 
LVRM10039A12LVRM1_0039_A12.bCJ001726 
LVRM10039D05LVRM1_0039_D05.bCJ001751 
LVRM10039E08LVRM1_0039_E08.bCJ001764 
LVRM10039F01LVRM1_0039_F01.bCJ001768 
LVRM10040D02LVRM1_0040_D02.bCJ001830 
LVRM10040H12LVRM1_0040_H12.bCJ001872 
LVRM10041A11LVRM1_0041_A11.bCJ001883 
LVRM10042H09LVRM1_0042_H09.bCJ002039 
LVRM10043C11LVRM1_0043_C11.bCJ002072 
LVRM10043G07LVRM1_0043_G07.bCJ002116 
LVRM10043H03LVRM1_0043_H03.bCJ002123 
LVRM10044D10LVRM1_0044_D10.bBW962879 
LVRM10049E05LVRM1_0049_E05.bBP451653 
LVRM10051B12LVRM1_0051_B12.bBP449675 
LVRM10052C10LVRM1_0052_C10.bBP450339 
LVRM10052F03LVRM1_0052_F03.bBP452320 
LVRM10057A03LVRM1_0057_A03.bBP137580 
LVRM10057A11LVRM1_0057_A11.bBP137893 
LVRM10058C08LVRM1_0058_C08.bBP138715 
LVRM10058G08LVRM1_0058_G08.bBP140568 
LVRM10063E06LVRM1_0063_E06.bBP139572 
LVRM10064C04LVRM1_0064_C04.bBP138554 
LVRM10064E12LVRM1_0064_E12.bBP139798 
LVRM10066A05LVRM1_0066_A05.b  
LVRM10068F12LVRM1_0068_F12.bBP140273 
LVRM10069F04LVRM1_0069_F04.bBP452382 
LVRM10071E03LVRM1_0071_E03.bBP451524 
LVRM10072A08LVRM1_0072_A08.bBP448598 
LVRM10072B12LVRM1_0072_B12.bBP449678 
LVRM10072C08LVRM1_0072_C08.bBP450198 
LVRM10072D09LVRM1_0072_D09.bBP451125 
LVRM10073C05LVRM1_0073_C05.bBP138599 
LVRM10074A09LVRM1_0074_A09.bBP137825 
LVRM10076C03LVRM1_0076_C03.bBP138521 
LVRM10078B06LVRM1_0078_B06.b  
LVRM10078D09LVRM1_0078_D09.bBP139246 
LVRM10078G01LVRM1_0078_G01.bBP140310 
LVRM10078H11LVRM1_0078_H11.bBP141192 
LVRM10079A01LVRM1_0079_A01.bBP137524 
LVRM10079B10LVRM1_0079_B10.bBP138352 
LVRM10079E01LVRM1_0079_E01.bBP139405 
LVRM10080C10LVRM1_0080_C10.bBP138814 
LVRM10080E07LVRM1_0080_E07.bBP139619 
LVRM10081D04LVRM1_0081_D04.bCJ002451 
LVRM10086F12LVRM1_0086_F12.bCJ002903 
LVRM10086H12LVRM1_0086_H12.bBW962965 
LVRM10088D02LVRM1_0088_D02.bCJ003042 
LVRM10088G03LVRM1_0088_G03.bCJ003074 
LVRM10090A09LVRM1_0090_A09.bCJ003186 
LVRM10091F05LVRM1_0091_F05.bCJ003311 
LVRM10091F06LVRM1_0091_F06.bCJ003312 
LVRM10093F10LVRM1_0093_F10.bBW963012 
LVRM10094F09LVRM1_0094_F09.bCJ003551 
LVRM10094H04LVRM1_0094_H04.bCJ003568 
LVRM10101D11LVRM1_0101_D11.bBP139337 
LVRM10103E09LVRM1_0103_E09.bBP451922 
LVRM10104H04LVRM1_0104_H04.bBP454021 
LVRM10105H04LVRM1_0105_H04.bBP454022 
LVRM10106D05LVRM1_0106_D05.bBP450837 
LVRM10107B11LVRM1_0107_B11.bBP449616 
LVRM10107G04LVRM1_0107_G04.bBP453193 
LVRM10108D05LVRM1_0108_D05.bBP450839 
LVRM10109C12LVRM1_0109_C12.bBP450494 
LVRM10110G11LVRM1_0110_G11.bBP453695 
LVRM10112B01LVRM1_0112_B01.bBP448951 
LVRM10113E08LVRM1_0113_E08.bBP451870 
LVRM10114G11LVRM1_0114_G11.bBP453699 
LVRM10115D11LVRM1_0115_D11.bBP451279 
LVRM10116C02LVRM1_0116_C02.bBP449801 
LVRM10116D10LVRM1_0116_D10.bBP451209 
LVRM10117H06LVRM1_0117_H06.bBP454177 
LVRM10118B11LVRM1_0118_B11.bBP449626 
LVRM10118C08LVRM1_0118_C08.bBP450214 
LVRM10120G07LVRM1_0120_G07.bBP453415 
LVRM10121H03LVRM1_0121_H03.bBP453970 
LVRM10122B11LVRM1_0122_B11.bBP449630 
LVRM10123C11LVRM1_0123_C11.bBP450437 
LVRM10124A12LVRM1_0124_A12.bBP448897 
LVRM10124D10LVRM1_0124_D10.bBP451217 
LVRM10125C07LVRM1_0125_C07.bBP450148 
LVRM10125H03LVRM1_0125_H03.bBP453974 
LVRM10128F12LVRM1_0128_F12.bBP452947 
LVRM10136D03LVRM1_0136_D03.bBP450725 
LVRM10138G03LVRM1_0138_G03.bBP453151 
LVRM10138H06LVRM1_0138_H06.bBP454197 
LVRM10139B01LVRM1_0139_B01.bBP448972 
LVRM10140B07LVRM1_0140_B07.bBP449371 
LVRM10142A11LVRM1_0142_A11.bBP448844 
LVRM10143H06LVRM1_0143_H06.bBP454202 
LVRM10144G03LVRM1_0144_G03.bBP453157 
LVRM10146B01LVRM1_0146_B01.bBP448978 
LVRM10148B08LVRM1_0148_B08.bBP449450 
LVRM10149C07LVRM1_0149_C07.bBP450170 
LVRM10149H10LVRM1_0149_H10.bBP454495 
LVRM10152D06LVRM1_0152_D06.bBP450953 
LVRM10156F04LVRM1_0156_F04.bBP452433 
LVRM10157D01LVRM1_0157_D01.bBP450607 
LVRM10157G10LVRM1_0157_G10.bBP453668 
LVRM10159E11LVRM1_0159_E11.bBP452114 
LVRM10160F04LVRM1_0160_F04.bBP452436 
LVRM10161B09LVRM1_0161_B09.bBP449532 
LVRM10161G01LVRM1_0161_G01.bBP453041 
LVRM10162A08LVRM1_0162_A08.bBP448654 
LVRM10162G11LVRM1_0162_G11.bBP453744 
LVRM10164F04LVRM1_0164_F04.bCJ004196 
LVRM10165A12LVRM1_0165_A12.bCJ004234 
LVRM10168E10LVRM1_0168_E10.bCJ004505 
LVRM10173H01LVRM1_0173_H01.bCJ004929 
LVRM10174F02LVRM1_0174_F02.bCJ004985 
LVRM10177C02LVRM1_0177_C02.bCJ005187 
LVRM10177D09LVRM1_0177_D09.bCJ005201 
LVRM10177D12LVRM1_0177_D12.bCJ005204 
LVRM10179B03LVRM1_0179_B03.bCJ005332 
LVRM10179B06LVRM1_0179_B06.bCJ005335 
LVRM10179B10LVRM1_0179_B10.bCJ005339 
LVRM10180D03LVRM1_0180_D03.bCJ005448 
LVRM10186H11LVRM1_0186_H11.bCJ005997 
LVRM10187B06LVRM1_0187_B06.bCJ006015 
LVRM10189F07LVRM1_0189_F07.bCJ006225 
LVRM10192E12LVRM1_0192_E12.bCJ006374 
LVRM10193E10LVRM1_0193_E10.bCJ006445 
LVRM10195C08LVRM1_0195_C08.bCJ006584 
LVRM10195E05LVRM1_0195_E05.bCJ006602 
LVRM10196A10LVRM1_0196_A10.bCJ006651 
LVRM10197C03LVRM1_0197_C03.bCJ006744 
LVRM10197D01LVRM1_0197_D01.bCJ006754 
LVRM10198E04LVRM1_0198_E04.bCJ006859 
LVRM10200E02LVRM1_0200_E02.bCJ007021 
LVRM10200F07LVRM1_0200_F07.bCJ007032 
LVRM10204E08LVRM1_0204_E08.bCJ007356 
LVRM10205F12LVRM1_0205_F12.bCJ007452 
LVRM10207A06LVRM1_0207_A06.bCJ007558 
LVRM10207E01LVRM1_0207_E01.bCJ007598 
LVRM10207H04LVRM1_0207_H04.bCJ007633 
LVRM10208C11LVRM1_0208_C11.bCJ007674 

  

SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
101A39400.720B-
G01530.280
303A01550.279BSCTA/L
G40000.721CTG/L
462C39400.745BSTAC/Y
T01350.255TAT/Y


Alignment:      TOP

20110601C-006978 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
LVR01_0048_E10.b : tgttttttttttagcttggtgcactxxxxxxxxxxxxxxxxx
LVRM1_0189_F07.b : cgttg
LVR01_0036_H12.b : gggcacttataagaxxxxxxx
LVR01_0035_C03.b : attttgggacxxxxxxxxx
LVR01_0040_F06.b : cxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_F11.b : gacttgggtgxxxxxxxxxxxxxx
LVRM1_0207_H04.b :
LVRM1_0040_H12.b :
LVRM1_0021_E12.b :
KDN01_0053_B10.b :
LVR01_0019_G12.b : atxxxxxxxxxxxxxxx
LVRM1_0204_E08.b :
LVRM1_0187_B06.b :
LVRM1_0051_B12.b :
LVRM1_0149_H10.b :
LVRM1_0143_H06.b :
LVRM1_0122_B11.b :
LVR01_0025_D07.b : xxxxxxxxxxxxxxxxxx
LVR01_0039_B10.b : aagggggcttaxxxxxxxxxx
LVR01_0038_F11.b : atttttgtggaacxxxxxxxxxx
LVR01_0042_F01.b : ggggtttagcttggtgactag
LVR01_0099_F05.b : ggcattaggtgcxxxxxxxx
LVRM1_0043_H03.b :
LVRM1_0043_G07.b :
LVRM1_0177_C02.b :
LVRM1_0109_C12.b :
LVR01_0038_D05.b : catttxxxxxxxxxxxxxx
LVR01_0019_B10.b : cattttggtgxxxxxx
LVR01_0094_G12.b : gctttagatgxxxxxxxx
LVR01_0015_A12.b : gcttttgatgxxxxxxxxxx
LVR01_0054_D11.b : gctxxxxxxxxxxxxxxxxxxx
LVR01_0104_F07.b : ttttttccctgcttggtgxxxxxxxxxxx
LVR01_0067_H08.b : gcatxxxxxxxxxxxxxxxxxx
LVRM1_0041_A11.b :
LVR01_0035_D12.b :
LVRM1_0174_F02.b :
LVRM1_0093_F10.b :
LVRM1_0025_H03.b :
LVRM1_0049_E05.b :
LVRM1_0039_A12.b :
LVRM1_0156_F04.b :
LVRM1_0161_G01.b :
LVRM1_0118_C08.b :
LVRM1_0086_H12.b : cagxxxxxxxxx
LVRM1_0112_B01.b :
LVRM1_0078_B06.b :
LVRM1_0078_G01.b :
LVRM1_0058_G08.b :
LVRM1_0161_B09.b :
LVR01_0014_D07.b : ggggggngggttaagtgacxxxxx
LVR01_0026_D05.b : ttatggttgxxxxxxxxx
LVR01_0055_E11.b : cctttttggttgxxxxxxxx
LVR01_0052_F08.b : catttatgttgcxxxxxxx
LVR01_0105_C05.b : cgtttttttggcttagtgxxxxxxx
LVR01_0019_D11.b : cxxxxxxxxxxxxxxxxx
LVR01_0062_G09.b : ccctxxxxxxxxxxxxxxxx
LVR01_0097_E10.b : catttttgggtgxxxxxxxx
LVR01_0104_D09.b : gctcttcctagcttaxxxxxxxxxx
LVR01_0094_C05.b : attttttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0002_A06.b : xxxxxxxxxxxxxxx
LVR01_0031_F06.b : caxxxxxxxxxxxxxxxx
LVR01_0071_G04.b : gaggggngtctcagcttagtgxxxxxxxxxx
LVR01_0089_B03.b : gcattatgtgxxxxxxx
LVR01_0037_C10.b : gtxxxxxxxxxxxxxxxxxxx
LVR01_0030_H01.b : ctcatggtgxxxxxxxxx
LVR01_0068_A05.b : gcatttgggtgcactacnta
LVR01_0055_H02.b : ttttcaggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0208_C11.b :
LVRM1_0088_G03.b :
LVRM1_0196_A10.b :
LVRM1_0180_D03.b :
LVRM1_0090_A09.b :
LVRM1_0078_D09.b :
LVRM1_0064_E12.b : c
LVRM1_0042_H09.b :
LVRM1_0071_E03.b :
LVRM1_0168_E10.b :
LVRM1_0179_B03.b :
LVRM1_0064_C04.b :
LVR01_0020_E12.b : ttxxxxxxxxxxxxxx
LVRM1_0091_F06.b :
LVR01_0054_G02.b : gcatttxxxxxxxxxxxxxx
LVRM1_0052_F03.b :
LVRM1_0001_D09.b :
LVRM1_0136_D03.b :
LVRM1_0043_C11.b :
LVRM1_0014_B12.b :
LVRM1_0072_A08.b :
LVRM1_0192_E12.b :
LVRM1_0081_D04.b :
LVRM1_0107_G04.b :
LVRM1_0125_C07.b :
LVRM1_0076_C03.b :
LVRM1_0139_B01.b :
LVRM1_0094_H04.b :
LVRM1_0028_A03.b :
LVRM1_0179_B10.b :
LVRM1_0207_E01.b :
LVRM1_0003_C12.b :
LVRM1_0123_C11.b :
LVRM1_0197_D01.b :
LVRM1_0197_C03.b :
LVR01_0025_E08.b : ttgggtggacxxxxxxxxxx
LVRM1_0104_H04.b :
LVRM1_0195_E05.b :
LVRM1_0177_D09.b :
LVRM1_0164_F04.b :
LVRM1_0173_H01.b :
LVRM1_0198_E04.b :
LVRM1_0025_G08.b :
LVRM1_0207_A06.b :
LVRM1_0101_D11.b :
LVRM1_0179_B06.b :
LVRM1_0039_F01.b :
LVRM1_0091_F05.b :
LVRM1_0195_C08.b :
LVRM1_0115_D11.b :
LVRM1_0038_F05.b :
LVRM1_0037_C05.b :
LVRM1_0039_E08.b :
LVRM1_0057_A03.b :
LVRM1_0128_F12.b :
LVRM1_0026_B07.b :
LVRM1_0088_D02.b :
LVRM1_0116_C02.b :
LVRM1_0105_H04.b :
LVRM1_0205_F12.b :
LVR01_0018_D11.b : aatcxxxxxxxxxxxxxxxxx
LVRM1_0193_E10.b :
LVRM1_0038_A10.b :
LVRM1_0079_E01.b :
LVRM1_0117_H06.b :
LVRM1_0125_H03.b :
LVRM1_0157_D01.b :
LVRM1_0039_D05.b :
LVRM1_0074_A09.b :
LVRM1_0160_F04.b :
LVRM1_0035_A03.b :
LVRM1_0072_B12.b :
LVRM1_0106_D05.b :
LVRM1_0124_A12.b :
LVRM1_0165_A12.b :
LVRM1_0044_D10.b :
LVRM1_0073_C05.b :
LVRM1_0177_D12.b :
LVRM1_0086_F12.b :
LVRM1_0200_F07.b :
LVRM1_0148_B08.b :
LVRM1_0036_G08.b :
LVRM1_0186_H11.b :
LVRM1_0069_F04.b :
LVRM1_0007_B06.b :
LVRM1_0162_A08.b :
LVRM1_0034_H05.b :
LVRM1_0118_B11.b :
LVRM1_0013_D06.b :
LVRM1_0068_F12.b :
LVRM1_0120_G07.b :
LVRM1_0080_E07.b :
LVRM1_0121_H03.b :
LVRM1_0146_B01.b :
LVRM1_0015_F10.b :
LVRM1_0072_D09.b :
LVRM1_0116_D10.b :
LVRM1_0007_A12.b :
LVRM1_0072_C08.b :
LVRM1_0162_G11.b :
LVRM1_0157_G10.b :
LVRM1_0036_G10.b :
LVRM1_0103_E09.b :
LVRM1_0108_D05.b :
LVRM1_0144_G03.b :
LVRM1_0019_H02.b :
LVRM1_0030_A07.b :
LVRM1_0058_C08.b :
LVRM1_0030_G06.b :
LVRM1_0057_A11.b :
LVRM1_0114_G11.b :
LVRM1_0031_C08.b :
LVRM1_0107_B11.b :
LVRM1_0138_G03.b :
LVRM1_0080_C10.b :
LVR01_0035_D03.b : tttggggaagtcttcga
LVRM1_0110_G11.b :
LVRM1_0138_H06.b :
LVRM1_0124_D10.b :
LVRM1_0159_E11.b :
LVRM1_0140_B07.b :
LVRM1_0142_A11.b :
LVRM1_0052_C10.b :
LVRM1_0063_E06.b :
LVRM1_0078_H11.b :
LVRM1_0010_B06.b :
LVRM1_0113_E08.b :
LVRM1_0002_F07.b :
LVR01_0062_B11.b : tttttggtggattcgtgxxxxxxxx
LVR01_0060_A08.b : tttattgttttttagctatgtgxxxxxxxxx
LVR01_0040_F08.b : ttttggggaacaxxxxxx
LVR01_0018_F02.b : cattttgggtgccxxxxxxxxx
LVR01_0055_B01.b : ggctxxxxxxxxxxxxxxxxxx
LVR01_0038_G10.b : ttttgggggaacxxxxxxxxxxx
LVR01_0030_G08.b : ttttgtgacctatxxxxx
LVR01_0037_G10.b : ttttttggxxxxxxxxxxxx
LVR01_0088_D09.b : cctttttggtgxxxxxxxxxx
LVR01_0084_E07.b : xxxxxxxxxxxxxxxxxxx
LVR01_0093_G05.b : tttxxxxxxxxxxxxxxxxxxx
LVR01_0094_G02.b : ggcatttagcggtgxxxxxxxxxx
LVR01_0037_A05.b : ctxxxxxxxxxxxxxxxxxxx
LVR01_0015_E10.b : cttttgggtgxxxxxxxxxx
LVR01_0106_G10.b : ctttttggtgxxxxxxxxx
LVR01_0095_G10.b : ctxxxxxxxxxxxxxxxxxxx
LVR01_0095_F03.b : cctxxxxxxxxxxxxxxxxxx
LVR01_0013_C12.b : cccxxxxxxxxxxxxxxxxxx
LVR01_0054_B04.b : gcxxxxxxxxxxxxxxxxxx
LVR01_0086_F01.b : ggctttttxxxxxxxxxxxx
LVR01_0009_A01.b : ggggcttttggtgxxxxxxxxxx
LVR01_0097_D05.b : ccttttcgtgxxxxxxxxxx
LVR01_0014_C11.b : cctxxxxxxxxxxxxxxxxxx
LVR01_0096_E08.b : cctxxxxxxxxxxxxxxxxxx
LVR01_0030_D06.b : tttggtgcacxxxxxxxx
LVR01_0094_E05.b : cttttgttgaxxxxxxxxx
LVR01_0016_E11.b : ctxxxxxxxxxxxxxxxxxx
LVR01_0106_C07.b : atttttgtgaactaxxxxxx
LVR01_0039_E10.b : gcttttggtgaaxxxxxxx
LVR01_0037_D04.b : ctttatggtgcacxxxxxxxx
LVR01_0076_A12.b : ggcxxxxxxxxxxxxxxxxxxx
LVR01_0055_D12.b : ttttttcggggggctgcttggtgxxxxxxxxx
LVR01_0077_G01.b : tttttttaagcatttgtgxxxxxxxxx
LVR01_0048_F09.b : gggtgttcttcggcttagtgxxxxxxxx
LVR01_0030_B07.b : xxxxxxxxxxxxxxxxxxx
LVR01_0011_E09.b : gggtttgggcttagtgxxxxxxxx
LVR01_0066_E02.b : gctxxxxxxxxxxxxxxxxx
LVR01_0049_E05.b : gtgtggtttttttagcttagtgxxxxxxxxx
LVR01_0005_C09.b : cattgxxxxxxxxxxxxx
LVR01_0094_F09.b : cxxxxxxxxxxxxxxxxxx
LVR01_0014_G05.b : cctxxxxxxxxxxxxxxxxxxx
LVR01_0094_G09.b : cctttagggtgxxxxxxxxx
LVR01_0015_E08.b : ctttaggggxxxxxxxxxx
LVR01_0102_G08.b : xxxxxxxxxxxxxxxxxx
LVR01_0013_H08.b : tggggtcggcttggtgxxxxxxxx
LVR01_0058_H02.b : gctxxxxxxxxxxxxxxxxx
LVR01_0025_F02.b : ttttgggggaxxxxxxxxx
LVR01_0040_D10.b : cttttgggtgxxxxxxxxx
LVR01_0086_A09.b : gcaxxxxxxxxxxxxxxxx
LVR01_0028_B06.b : tttggtgacgxxxxxxxx
LVR01_0062_B12.b : gtttctttcggcatttgtgxxxxxxxx
LVR01_0009_H05.b : cgggcxxxxxxxxxxxxxxxx
LVR01_0008_C10.b : gggcxxxxxxxxxxxxxxxx
LVR01_0014_H01.b : cctttatgtgxxxxxxxxxx
LVR01_0022_B07.b : cxxxxxxxxxxxxxxxxxxx
LVR01_0033_F07.b : cttttgggtgxxxxxxxxxx
LVR01_0045_D11.b : ccatttggtgxxxxxxxxxx
LVR01_0002_G07.b : xxxxxxxxxxxxxxxxxxx
LVR01_0044_F11.b : ccxxxxxxxxxxxxxxxxx
LVR01_0028_D07.b : tttggtgactxxxxxxx
LVR01_0079_D08.b : cctxxxxxxxxxxxxxxxxxxx
LVR01_0082_E09.b : gcctttttggtgxxxxxxxxxx
LVR01_0084_B10.b : taagcaxxxxxxxxxxxxxxxx
LVR01_0022_E08.b : cttttgggttggxxxxxxxxx
LVR01_0033_E01.b : gctttagggtgxxxxxxxxxx
LVR01_0040_B06.b : cattttgggtgxxxxxxxxxx
LVR01_0041_D03.b : gcaaxxxxxxxxxxxxxxxxx
LVR01_0088_F10.b : ggcxxxxxxxxxxxxxxxxxx
LVR01_0095_F11.b : cctxxxxxxxxxxxxxxxxxx
LVR01_0030_E02.b : txxxxxxxxxxxxxxxxxxx
LVR01_0034_C09.b : atxxxxxxxxxxxxxxxxxx
LVR01_0004_G04.b : txxxxxxxxxxxxxxxxxx
LVR01_0017_D02.b : catttttgggtgxxxxxxxxxx
LVR01_0067_F03.b : gcattttgcxxxxxxxxxxxxx
LVR01_0057_G09.b : ccttttgagtgxxxxxxxxxx
LVR01_0058_E08.b : atttttggtgxxxxxxxxx
LVR01_0053_C05.b : gggtttttttttttaggctagtgactxxxx
LVR01_0041_F12.b : gcaccaggcttggtgxxxxxxxx
LVR01_0106_G07.b : cttttttgtgaxxxxxxxxxxx
LVR01_0054_B06.b : ccttttggtggxxxxxxxxx
LVR01_0088_B03.b : ccattttgtgcxxxxxxxxx
LVR01_0002_E01.b : cxxxxxxxxxxxxxxxxxx
LVR01_0012_F08.b : gggttgggcatagtgagxxxxxxx
LVR01_0061_F10.b : ttttttaagcttagtgxxxxxxxx
LVR01_0066_E10.b : gttttaagcttagtgxxxxxxxxx
LVR01_0046_F04.b : ggcttttgagtgxxxxxxxxxx
LVR01_0020_E01.b : ccxxxxxxxxxxxxxxxxxx
LVR01_0083_E06.b : atttgggttgxxxxxxxxxx
LVR01_0087_B02.b : gcatatxxxxxxxxxxxxxx
LVR01_0010_E06.b : ctxxxxxxxxxxxxxxxxx
LVR01_0030_H03.b : axxxxxxxxxxxxxxxxx
LVR01_0065_H01.b : tacattagcttttgtgxxxxxxxxx
LVR01_0033_B03.b : cttatggtgxxxxxxxxxxx
LVR01_0085_F06.b : atxxxxxxxxxxxxxxxxxx
LVR01_0061_G12.b : tttatttggctttcgtgxxxxxxxxx
LVR01_0102_E11.b : xxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_H04.b : ttttagatggcxxxxxxxx
LVR01_0025_A01.b : actttxxxxxxxxxxxxxx
LVR01_0026_C10.b : ttttggttgxxxxxxxxx
LVR01_0104_H01.b : gttataccctgcatagtgxxxxxxxx
LVR01_0019_G01.b : ttttgatggcttttgtgxxxxxxxx
LVR01_0057_D12.b : cttggcattgcgtgxxxxxxxxxx
LVR01_0060_D03.b : tttttaagcattggtgxxxxxxxx
LVR01_0054_H03.b : gcxxxxxxxxxxxxxxxxx
LVR01_0094_C09.b : cctxxxxxxxxxxxxxxxxx
LVR01_0096_H07.b : cggtcnatctggcttaggtgctxxxxxxx
LVR01_0096_E02.b : agtcttgntggggcttagtgxxxxxxxx
LVR01_0045_G07.b : ctxxxxxxxxxxxxxxxxxxx
LVR01_0092_F11.b : ccttttcxxxxxxxxxxxx
LVR01_0049_B01.b : ggggtttattttttgcttagtgxxxxxxxx
LVR01_0013_G04.b : tttttttggcattggtgxxxxxxxx
LVR01_0082_G08.b : ccctttatggtgxxxxxxxxxx
LVR01_0048_G12.b : tgggtttttctttgcttggtgxxxxxxxxx
LVR01_0044_D02.b : gggngtggcttggtgxxxxxxxxx
LVR01_0046_B09.b : gcaxxxxxxxxxxxxxxxxx
LVR01_0050_B07.b : ggggtttttttttnagcttagtgxxxxxxxxx
LVR01_0078_F11.b : gcatttaagtgxxxxxxxxxx
LVR01_0097_B08.b : ccattatgxxxxxxxxxxxxx
LVR01_0020_F07.b : cttttggttgxxxxxxxxxx
LVR01_0098_H03.b : gcctttggttgxxxxxxxxxx
LVR01_0083_C04.b : ggactttggtgxxxxxxxxx
LVR01_0001_G12.b : agtttxxxxxxxxxxxxxx
LVR01_0068_E08.b : gcctttttagtggxxxxxxxxxx
LVR01_0045_H08.b : cttxxxxxxxxxxxxxxxxxx
LVR01_0046_B10.b : gctttatggtgxxxxxxxxxx
LVR01_0053_B01.b : ggcattangtgxxxxxxxxx
LVR01_0083_A01.b : gtggccctcxxxxxxxxxxxxx
LVR01_0034_B02.b : ccxxxxxxxxxxxxxxxxxxx
LVR01_0003_B08.b : xxxxxxxxxxxxxxxxxx
LVR01_0034_F10.b : txxxxxxxxxxxxxxxxx
LVR01_0043_A09.b : tttttttagcttggtgxxxxxxxxx
LVR01_0046_E12.b : cctttttgcxxxxxxxxxxxxx
LVR01_0097_F02.b : gcatttatgtgxxxxxxxxxx
LVR01_0037_A12.b : ctttttggtgxxxxxxxxxx
LVR01_0021_D05.b : ccatttxxxxxxxxxxxxx
LVR01_0029_A04.b : xxxxxxxxxxxxxxxxxxx
LVR01_0010_A06.b : ccattaggtgcxxxxxxxxxx
LVR01_0073_F12.b : ggcatttggtgxxxxxxxxxx
LVR01_0044_C05.b : ccxxxxxxxxxxxxxxxxxx
LVR01_0058_E02.b : ccttttgcgtgxxxxxxxxx
LVR01_0084_E02.b : caxxxxxxxxxxxxxxxx
LVR01_0058_H11.b : gcatctatgntgxxxxxxxxxx
LVR01_0088_A02.b : gcxxxxxxxxxxxxxxxxxx
LVR01_0101_F09.b : ccattgxxxxxxxxxxxxxx
LVR01_0092_H08.b : gcaxxxxxxxxxxxxxxxx
LVR01_0074_A11.b : ggcattatxxxxxxxxxxxxxx
LVR01_0074_G09.b : cctxxxxxxxxxxxxxxxxxxx
LVR01_0030_H02.b : tttatxxxxxxxxxxxxxxx
LVR01_0010_C03.b : aaagcattggtgxxxxxxxxx
LVR01_0034_B11.b : cctxxxxxxxxxxxxxxxxxx
LVR01_0079_A02.b : ggggggggtnttagcttggtgactggctxx
LVR01_0072_E10.b : gcttttggtgxxxxxxxxxxxxxxx
LVR01_0060_H11.b : gggcatttggtgxxxxxxxxxx
LVR01_0018_A11.b : gcatttngtgxxxxxxxxxx
LVR01_0097_B12.b : tggttgnaacaagcattxxxxxxxxxxxx
LVR01_0014_D01.b : gtgtacaagcatttgtgcxxxxxxx
LVR01_0044_E02.b : ggggggggctttagtgcxxxxxxx
LVR01_0061_F02.b : gggggccggcttcgtgxxxxxxxx
LVR01_0082_G07.b : gggggcattcccggctttgtgxxxxxxxxxx
LVR01_0012_D12.b : gtttttggcatagtgxxxxxxxxx
LVR01_0092_H11.b : tgttccaagctacgtgxxxxxxxx
LVR01_0068_A11.b : gggcaatacxxxxxxxxxxxxx
LVR01_0084_C04.b : ggcattagggtgxxxxxxxx
LVR01_0046_E01.b : gggggtttaagcttggtgactgtnnn
LVR01_0013_H09.b : ttttttttggcttagtgxxxxxxxx
LVR01_0055_B11.b : ggggctaagctttggtgxxxxxxxxx
LVR01_0066_H12.b : ttttttaggatttggtgxxxxxxxxx
LVR01_0034_G01.b : gggcattgggtgxxxxxxxxxx
LVR01_0016_G11.b : cctatgcgtccnxxxxxxxx
LVR01_0016_G12.b : tatctggcttaxxxxxxxxxxxx
LVR01_0092_D05.b : actttaggtgagxxxxxxxx
LVR01_0001_E01.b : cgxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0021_B12.b : ccxxxxxxxxxxxxxxxxxxx
LVR01_0071_G06.b : ttttttttcttaggcttggtgxxxxxxxxxxxxxx
LVR01_0008_B10.b : gggcaxxxxxxxxxxxxxxxx
LVR01_0105_F12.b : gctccccacagcatagtgcnxxxxxxx
LVR01_0072_F10.b : gcattttggctgxxxxxxxxxx
LVR01_0010_H03.b : ccattatgtgxxxxxxxxx
LVR01_0092_B06.b : cxxxxxxxxxxxxxxxxxx
LVR01_0012_G04.b : ggtnggggcttggtgxxxxxxxx
LVR01_0098_A04.b : ggtttttaaaagcttggtgxxxxxxxxx
LVR01_0003_B06.b : xxxxxxxxxxxxxxxxxxx
LVR01_0062_F02.b : ctgtttcaagctttcgtgxxxxxxxx
LVR01_0060_B05.b : tttttgagcatttgtgxxxxxxxx
LVR01_0063_A06.b : gcccctcacggcttagtgxxxxxxxxx
LVR01_0103_E03.b : ggtctcccagcatagtgcgxxxxxx
LVR01_0061_D02.b : gtcgaccagcttcxxxxxxxxxxxx
LVR01_0050_G03.b : gggggttnnnngcagcttagtgxxxxxxxx
LVR01_0062_A09.b : ttttaatcagccatgtgxxxxxxxxx
LVR01_0077_C08.b : ccattttgaxxxxxxxxxxxxx
LVR01_0099_H02.b : gggctctxxxxxxxxxxxxxx
LVR01_0017_H03.b : gcattaggtgcxxxxxxxxx
LVR01_0066_F06.b : tgggggcgcattggtgxxxxxxxx
LVR01_0001_H02.b : tcxxxxxxxxxxxxxxxx
LVR01_0078_E06.b : cctttttcgtggcxxxxxxxxx
LVR01_0092_C02.b : gaaagaagcattcgtgxxxxxxxx
LVR01_0005_B02.b : cxxxxxxxxxxxxxxxxx
LVR01_0104_H12.b : ggttttcattgcttcgtgxxxxxxxxx
LVR01_0042_F12.b : tggcaacaagcatagtgcnxxxxxxx
LVR01_0012_G01.b : gtttttttagcattggtgxxxxxxxxx
LVR01_0060_E10.b : gtttttaagctttggtgxxxxxxxxx
LVR01_0016_A01.b : gactgggaatggtgcxxxxxxxx
LVR01_0103_D03.b : ggttttctggcattgtgxxxxxxxx
LVR01_0022_H11.b : gcattaggtccntanntaga
LVR01_0062_E01.b : tgtgttcagcttcgtgxxxxxxxx
LVR01_0073_A03.b : ttaatgttttaaaagattagtgxxxxxxxxx
LVR01_0060_D11.b : gttttaaagctttcgtgxxxxxxxx
LVR01_0101_B03.b : gcattaggtgcntanntaga
LVR01_0067_B09.b : tgtttttgttttcactgcttggtgxxxxxxxxx
LVR01_0044_D10.b : gttttttttggccacgtgaaxxxxxxx
LVR01_0062_C01.b : gtgtaacacgcttcgtgxxxxxxxx
LVRM1_0038_H03.b :
KDN01_0100_C03.b :
KDN01_0022_C02.b :
LVRM1_0040_D02.b :
LVR01_0009_C09.b : cxxxxxxxxxxxxxxx
LVR01_0055_A08.b : tgctcgcactttggtgxxxxxx
LVR01_0029_A03.b : tttatggtgxxxxxxxx
LVR01_0103_D05.b : ggtgttcttagcctagtgxxxxxxxxx
KDN01_0047_C11.b :
KDN01_0051_D03.b :
KDN01_0081_G05.b :
KDN01_0053_C06.b :
KDN01_0038_D09.b :
KDN01_0060_D07.b :
KDN01_0089_A12.b :
KDN01_0040_F02.b :
KDN01_0056_D06.b :
KDN01_0089_H06.b :
KDN01_0022_C05.b :
KDN01_0023_B04.b :
KDN01_0077_C11.b :
KDN01_0038_D03.b :
KDN01_0089_D07.b :
KDN01_0027_B01.b :
KDN01_0002_E10.b :
KDN01_0083_H09.b :
KDN01_0004_E05.b :
KDN01_0004_C04.b :
KDN01_0020_G01.b :
KDN01_0045_E12.b :
KDN01_0045_D05.b :
KDN01_0020_D06.b :
KDN01_0004_H05.b :
KDN01_0064_G07.b :
KDN01_0004_D12.b :
KDN01_0037_F04.b :
KDN01_0002_H04.b :
KDN01_0060_G08.b :
KDN01_0023_A09.b :
KDN01_0051_G03.b :
KDN01_0019_A04.b :
KDN01_0009_G06.b :
KDN01_0057_A03.b :
KDN01_0026_C09.b :
KDN01_0070_G01.b :
KDN01_0006_F03.b :
KDN01_0047_G11.b :
KDN01_0051_E11.b :
KDN01_0007_G09.b :
KDN01_0007_H11.b :
KDN01_0072_D07.b :
KDN01_0010_B07.b :
KDN01_0009_E11.b :
KDN01_0067_C06.b :
KDN01_0033_H08.b :
KDN01_0079_F05.b :
KDN01_0008_F06.b :
KDN01_0064_B07.b :
KDN01_0089_E09.b :
KDN01_0018_H01.b :
KDN01_0058_B11.b :
KDN01_0068_F07.b :
KDN01_0078_B11.b :
KDN01_0022_G02.b :
KDN01_0018_A10.b :
KDN01_0068_E08.b :
KDN01_0019_E03.b :
KDN01_0089_D05.b :
KDN01_0049_G10.b :
KDN01_0031_A10.b :
KDN01_0011_C05.b :
KDN01_0024_A01.b :
KDN01_0029_A02.b :
KDN01_0053_D04.b :
KDN01_0057_H10.b :
KDN01_0076_G08.b :
KDN01_0031_E06.b :
KDN01_0065_A07.b :
KDN01_0090_G09.b :
KDN01_0033_A07.b :
KDN01_0023_D04.b :
KDN01_0028_F03.b :
KDN01_0022_E07.b :
KDN01_0098_G02.b :
KDN01_0034_G04.b :
KDN01_0036_G08.b :
KDN01_0042_D11.b :
KDN01_0027_B04.b :
KDN01_0045_E11.b :
KDN01_0058_B03.b :
KDN01_0086_A04.b :
KDN01_0019_B01.b :
KDN01_0077_A04.b :
KDN01_0066_D01.b :
KDN01_0018_F02.b :
KDN01_0092_G02.b :
KDN01_0096_B02.b :
KDN01_0040_C06.b :
KDN01_0062_A05.b :
KDN01_0061_A09.b :
KDN01_0082_E06.b :
KDN01_0099_C09.b :
KDN01_0043_F05.b :
KDN01_0093_H09.b :
KDN01_0071_A07.b :
KDN01_0075_B07.b :
KDN01_0080_B03.b :
KDN01_0095_H06.b :
KDN01_0072_A12.b :
KDN01_0024_F07.b :
KDN01_0071_B06.b :
KDN01_0034_C06.b :
KDN01_0016_H08.b :
KDN01_0076_B02.b :
KDN01_0066_A09.b :
KDN01_0088_E11.b :
KDN01_0038_C11.b :
KDN01_0044_H06.b :
KDN01_0036_H02.b :
KDN01_0092_F01.b :
KDN01_0016_D07.b :
KDN01_0029_A12.b :
KDN01_0024_A12.b :
KDN01_0034_E04.b :
KDN01_0098_C03.b :
KDN01_0070_E10.b :
KDN01_0024_C12.b :
KDN01_0063_A07.b :
KDN01_0073_F11.b :
KDN01_0091_A09.b :
KDN01_0015_F11.b :
KDN01_0043_D04.b :
KDN01_0079_G01.b :
KDN01_0086_G07.b :
KDN01_0078_B08.b :
KDN01_0061_E11.b :
KDN01_0082_A06.b :
KDN01_0078_A01.b :
KDN01_0079_F10.b :
KDN01_0045_E09.b :
KDN01_0038_C09.b :
KDN01_0086_G10.b :
KDN01_0097_C11.b :
LVR01_0062_A03.b : gttctaaagcatttxx
LVRM1_0066_A05.b :
LVR01_0065_E08.b :
KDN01_0051_H12.b :
KDN01_0050_B09.b :
KDN01_0049_A07.b :
LVR01_0091_D09.b :
LVRM1_0149_C07.b :
LVRM1_0152_D06.b :
LVRM1_0079_A01.b :
LVRM1_0200_E02.b :
LVRM1_0079_B10.b :
LVRM1_0094_F09.b :
20110601C-006978 : ....................................................TTGGCCTA
---------+---------+---------+---------+---------+---------+ 8
LVR01_0048_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGGCCTA
LVRM1_0189_F07.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggcCTA
LVR01_0036_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccgtgtcTA
LVR01_0035_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccctttcTA
LVR01_0040_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0207_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_H12.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_E12.b : cgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0053_B10.b : tcggcgttggct
LVR01_0019_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0204_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0187_B06.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0051_B12.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_H10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0143_H06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0122_B11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0025_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0039_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccgttctac
LVR01_0042_F01.b : tagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0043_H03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0043_G07.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0177_C02.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0109_C12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0019_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxccttt
LVR01_0094_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0041_A11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_D12.b : ccttggggttaccctgggtcccggaattcactcgagcactcgccgtcctac
LVRM1_0174_F02.b : aattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0025_H03.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_E05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_A12.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0156_F04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0161_G01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0118_C08.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0086_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0112_B01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_B06.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_G01.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0058_G08.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0161_B09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0014_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0026_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0055_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0052_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0105_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0019_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxtccctttataaaatgggcctaggctggtcaagc
LVR01_0002_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_A05.b : gacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0055_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxtccctttataaaatgggcctaggctggtcaagc
LVRM1_0208_C11.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0088_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0196_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0180_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0090_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_D09.b : agttgacaatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0064_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0042_H09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0071_E03.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0168_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0179_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0064_C04.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0020_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0091_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0052_F03.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0001_D09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0136_D03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0043_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0014_B12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_A08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0192_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0081_D04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0107_G04.b : taattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0125_C07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0076_C03.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0139_B01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0094_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0028_A03.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0179_B10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0207_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0003_C12.b : cgtttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0123_C11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0197_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0197_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0025_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0104_H04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0195_E05.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0177_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0173_H01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0198_E04.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0025_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0207_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0101_D11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0179_B06.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_F01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0091_F05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0195_C08.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0115_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_F05.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0037_C05.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_E08.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0057_A03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_F12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0026_B07.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0088_D02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0116_C02.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0105_H04.b : aatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0205_F12.b : nxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0018_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0193_E10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_A10.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0079_E01.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0117_H06.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0125_H03.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_D01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_D05.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_A09.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0160_F04.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_A03.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_B12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_D05.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0124_A12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0165_A12.b : gagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0044_D10.b : ttgtccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0073_C05.b : cgttgacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0177_D12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0086_F12.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_F07.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0148_B08.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0036_G08.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0186_H11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0069_F04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0007_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0162_A08.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_H05.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0118_B11.b : aatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0013_D06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0068_F12.b : agttttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0120_G07.b : tcagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0080_E07.b : agttgaataaagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_H03.b : tcagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_B01.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0015_F10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_D09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0116_D10.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0007_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0072_C08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0162_G11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_G10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0036_G10.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0103_E09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0108_D05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_G03.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_H02.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0030_A07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0058_C08.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0030_G06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0057_A11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0114_G11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_C08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0107_B11.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0138_G03.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0080_C10.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_D03.b : aaatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0110_G11.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0138_H06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0124_D10.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0159_E11.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0140_B07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0142_A11.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0052_C10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0063_E06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_H11.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0010_B06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0113_E08.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0002_F07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0018_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0055_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0093_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0013_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0009_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0014_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0039_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0076_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0055_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0005_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0014_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0013_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0025_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0009_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0014_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0022_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0002_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0079_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0022_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0041_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0057_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0053_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0041_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0002_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0020_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0010_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0085_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0025_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0026_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0019_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0057_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0092_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0013_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0020_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0001_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0053_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0021_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0010_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0092_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0010_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0079_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0018_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0014_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0092_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_E01.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0013_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0055_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0092_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0001_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0021_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0105_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0010_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0092_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0063_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0001_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0092_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0005_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0042_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0022_H11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_B03.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_H03.b : ncgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0100_C03.b : nnnnncctgctgtggc
KDN01_0022_C02.b : nnnnttctgctgtggc
LVRM1_0040_D02.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0009_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0055_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0047_C11.b : agaattcatacgttgg
KDN01_0051_D03.b :
KDN01_0081_G05.b : cgcgttggc
KDN01_0053_C06.b : nnnttcgcgttggc
KDN01_0038_D09.b : ctgtggc
KDN01_0060_D07.b : ctactgtggc
KDN01_0089_A12.b : cgttggc
KDN01_0040_F02.b : nttnccaacgtggc
KDN01_0056_D06.b : acgcgttggc
KDN01_0089_H06.b : nccacgttggc
KDN01_0022_C05.b : nccctgcgttggc
KDN01_0023_B04.b : nnnncccgctgtggc
KDN01_0077_C11.b : nnnnttcgctgttgc
KDN01_0038_D03.b : acctacggtggc
KDN01_0089_D07.b : nnccaacgtggc
KDN01_0027_B01.b : nnnttcctgctgtggc
KDN01_0002_E10.b : nccgttttnnnnnnnggctgacgtgtgc
KDN01_0083_H09.b : ntttttgctacgttgg
KDN01_0004_E05.b : ngccatannnnnnngctacgttgg
KDN01_0004_C04.b : nggcttttnnnnnnnncctacgttgtg
KDN01_0020_G01.b : ngggttttnnnnnnncctacgggtg
KDN01_0045_E12.b :
KDN01_0045_D05.b : ccacggtgg
KDN01_0020_D06.b : ngcgttttnnnnnnnccttacgttgtg
KDN01_0004_H05.b : nngggctttnnnnnnncctgagttgg
KDN01_0064_G07.b : nnnnnncctacgtttg
KDN01_0004_D12.b : nncccctttnnnntttcctgagttgg
KDN01_0037_F04.b : nnnnncctacgtgg
KDN01_0002_H04.b : nggctctttnnnnnnnncctacgtttgg
KDN01_0060_G08.b : nnnnncctgctgtgg
KDN01_0023_A09.b : tttttcctgctgtgg
KDN01_0051_G03.b :
KDN01_0019_A04.b : nggccgtttnnnnnttactgacgggtg
KDN01_0009_G06.b : nnccattnnnnnnncctgcgtttg
KDN01_0057_A03.b : tttcctgctgtgg
KDN01_0026_C09.b : nctcgcgttgg
KDN01_0070_G01.b : nttttcctgctgtgg
KDN01_0006_F03.b : ntttgacgttggc
KDN01_0047_G11.b : ccacgttggc
KDN01_0051_E11.b : tgcgttgg
KDN01_0007_G09.b : nnnccttnnnnnnncctgcgtttg
KDN01_0007_H11.b : nnccttttnnnnnncctgcgttgg
KDN01_0072_D07.b : nnncctgctgtgg
KDN01_0010_B07.b : nnnccttttnnnnnncctgcgtttg
KDN01_0009_E11.b : nnttcgcgttgg
KDN01_0067_C06.b : nnnnnggctacgttgg
KDN01_0033_H08.b : tttttnnnncctacggtgg
KDN01_0079_F05.b : nnncctgcagtgg
KDN01_0008_F06.b : nnccttatnnnnnnncctgcgttgg
KDN01_0064_B07.b : nnnccctgctgtgg
KDN01_0089_E09.b : ccgagttgg
KDN01_0018_H01.b : ncccttanttnntaatacgttgg
KDN01_0058_B11.b : ttcctgctgtgg
KDN01_0068_F07.b : nnnnggctgcgttgg
KDN01_0078_B11.b : ntcacggtgg
KDN01_0022_G02.b : ntttgctgctgtggc
KDN01_0018_A10.b : catcntttnncctacgttgg
KDN01_0068_E08.b : nnnccttttnnnnnnncctgcgttgg
KDN01_0019_E03.b : nggccgctttnnnnnngctacgttggc
KDN01_0089_D05.b : nctacgttgg
KDN01_0049_G10.b : gacgttggc
KDN01_0031_A10.b : cacgttgg
KDN01_0011_C05.b : cctaagnnnnnncctgcggtgg
KDN01_0024_A01.b : ccgcgttgg
KDN01_0029_A02.b : cgctgtggc
KDN01_0053_D04.b : ctcacgtgg
KDN01_0057_H10.b : nnnaactgcgtgg
KDN01_0076_G08.b : nnncctgctgtgg
KDN01_0031_E06.b : ntcacgttgg
KDN01_0065_A07.b : nntttgctacggtgg
KDN01_0090_G09.b : nttttgctgaggtgg
KDN01_0033_A07.b : ttttnaactgcggtgg
KDN01_0023_D04.b : nctcgcgttggc
KDN01_0028_F03.b : nnnnnnngtcacgttgg
KDN01_0022_E07.b : nnnnnnccctgcgttggc
KDN01_0098_G02.b : nnnnncctactgtgg
KDN01_0034_G04.b : ngctattnnnnncctgcgtttg
KDN01_0036_G08.b : nccttatnnnnnncctgcgttgg
KDN01_0042_D11.b : tttccttacgtgg
KDN01_0027_B04.b : nnnnttctgctgtgg
KDN01_0045_E11.b : ctgacgttggc
KDN01_0058_B03.b : tttactacggtgg
KDN01_0086_A04.b : nnnttgctgcgttgg
KDN01_0019_B01.b : nnggccgtcnnnnnnnccttacgggtg
KDN01_0077_A04.b : nnnnggtggctgttgc
KDN01_0066_D01.b : nnaacaactgtgg
KDN01_0018_F02.b : nccttcttnnnnccctacgttgg
KDN01_0092_G02.b : ntttcttnnnnnnncctgcgtttc
KDN01_0096_B02.b : ntttcctgcgttg
KDN01_0040_C06.b : ncctgctgtgg
KDN01_0062_A05.b : nnnnnncctgctgtgg
KDN01_0061_A09.b : gcgttgg
KDN01_0082_E06.b : nnnnncctacgttgg
KDN01_0099_C09.b : nnnnncctgcgtttg
KDN01_0043_F05.b : nttttcctgctgtgg
KDN01_0093_H09.b : nnttggctgcggtgg
KDN01_0071_A07.b : nnccgactgtgg
KDN01_0075_B07.b : nnncctgctgtgg
KDN01_0080_B03.b : nnncctgcgttgg
KDN01_0095_H06.b : nnnncctgcgttgg
KDN01_0072_A12.b : ncccgctgtgg
KDN01_0024_F07.b : nnnnncctgctgtgg
KDN01_0071_B06.b : nnncctgcggttg
KDN01_0034_C06.b : gggnnnggctacggtgg
KDN01_0016_H08.b : nccctttnnnnnnncccgcgttgg
KDN01_0076_B02.b : nnnnngctgctgtgg
KDN01_0066_A09.b : ttttttcctgcggtgg
KDN01_0088_E11.b : nnnnnggctgcgtttg
KDN01_0038_C11.b : ttttacgcagtgg
KDN01_0044_H06.b : tgtttntnnnncccgcgtttg
KDN01_0036_H02.b : tattnttnactacggtgg
KDN01_0092_F01.b : nnttttttnnnnnnncctgcgttgg
KDN01_0016_D07.b : nccctttnnnnnnncctgcgtttg
KDN01_0029_A12.b : nnnngctgcggtgg
KDN01_0024_A12.b : ccgcgttgg
KDN01_0034_E04.b : nttnnnncctacggtgg
KDN01_0098_C03.b : nnnnncctgctgttg
KDN01_0070_E10.b : nnnnactgacgtgg
KDN01_0024_C12.b : ttttnnnnncccgctgtgg
KDN01_0063_A07.b : nnnncctgctgtgg
KDN01_0073_F11.b : nnnncctgctgtgg
KDN01_0091_A09.b : ttttttcctgctgtgg
KDN01_0015_F11.b : nccctttnnnnnnncctgcgttgg
KDN01_0043_D04.b : ntttccctgctgtggc
KDN01_0079_G01.b : nnnncctgcggtgg
KDN01_0086_G07.b : nnnnggctgcgttgg
KDN01_0078_B08.b : nnnttcactgtgg
KDN01_0061_E11.b : taacgttggc
KDN01_0082_A06.b : nnnnggctgcggttgc
KDN01_0078_A01.b : ttttactgcagtgg
KDN01_0079_F10.b : nnncctgctgttg
KDN01_0045_E09.b :
KDN01_0038_C09.b : acggtg
KDN01_0086_G10.b : nnnttggctgcgttg
KDN01_0097_C11.b : tttttcctgcgttg
LVR01_0062_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0066_A05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_E08.b : tttttagcattggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0051_H12.b :
KDN01_0050_B09.b :
KDN01_0049_A07.b :
LVR01_0091_D09.b :
LVRM1_0149_C07.b :
LVRM1_0152_D06.b :
LVRM1_0079_A01.b :
LVRM1_0200_E02.b :
LVRM1_0079_B10.b :
LVRM1_0094_F09.b :
20110601C-006978 : CTGGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
---------+---------+---------+---------+---------+---------+ 65
LVR01_0048_E10.b : CTGGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0189_F07.b : CTGGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0036_H12.b : CTAGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0035_C03.b : CTGGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0040_F06.b : CTTCAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0099_F11.b : CTTCAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0207_H04.b : xTGGAGAGTGCT*CTGCATGGCCTG*GTCTTATGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0040_H12.b : xTGGACAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0021_E12.b : xTGGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0053_B10.b : aTGGAGAATGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0019_G12.b : xxGGAGAGTGCT*CTGCATGGCCTG*GTCTTATGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0204_E08.b : xxGGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0187_B06.b : xxGGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0051_B12.b : xxGGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0149_H10.b : xxGGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0143_H06.b : xxGGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0122_B11.b : xxGGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0025_D07.b : xxGGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0039_B10.b : xxGGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0038_F11.b : tgGGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0042_F01.b : xxGGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0099_F05.b : xxGGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0043_H03.b : xxxCAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0043_G07.b : xxxGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0177_C02.b : xxxGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0109_C12.b : xxxGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0038_D05.b : xxxCAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0019_B10.b : tacTAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTCCTGCAAAGAGGAGCCCAG*T
LVR01_0094_G12.b : xxxGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0015_A12.b : xxxCAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0054_D11.b : xxxGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0104_F07.b : xxxGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0067_H08.b : xxxGAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0041_A11.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0035_D12.b : ttggAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0174_F02.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0093_F10.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0025_H03.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0049_E05.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0039_A12.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0156_F04.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0161_G01.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0118_C08.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0086_H12.b : xxgaAGAGTGCTNCTGCATGGCCTGNGTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0112_B01.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0078_B06.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0078_G01.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0058_G08.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0161_B09.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0014_D07.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0026_D05.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0055_E11.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0052_F08.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0105_C05.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0019_D11.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0062_G09.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0097_E10.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0104_D09.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0094_C05.b : cttcAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0002_A06.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0031_F06.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0071_G04.b : xxxtAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0089_B03.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0037_C10.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAA*T
LVR01_0030_H01.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0068_A05.b : xxxxAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0055_H02.b : cttcAGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0208_C11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0088_G03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0196_A10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0180_D03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0090_A09.b : xxxtcGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0078_D09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0064_E12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0042_H09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0071_E03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0168_E10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0179_B03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0064_C04.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0020_E12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTACGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0091_F06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0054_G02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0052_F03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0001_D09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0136_D03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0043_C11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0014_B12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0072_A08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*C
LVRM1_0192_E12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0081_D04.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0107_G04.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAAGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0125_C07.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0076_C03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0139_B01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0094_H04.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0028_A03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0179_B10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0207_E01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0003_C12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0123_C11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0197_D01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0197_C03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0025_E08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0104_H04.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0195_E05.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0177_D09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0164_F04.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0173_H01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0198_E04.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0025_G08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0207_A06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0101_D11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0179_B06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0039_F01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0091_F05.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0195_C08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0115_D11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0038_F05.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0037_C05.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0039_E08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0057_A03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0128_F12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0026_B07.b : xxxxxGAGTGCT*CTGCATAGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0088_D02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0116_C02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0105_H04.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0205_F12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0018_D11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTCCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0193_E10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0038_A10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0079_E01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0117_H06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0125_H03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0157_D01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0039_D05.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0074_A09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0160_F04.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0035_A03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0072_B12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0106_D05.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCGG*T
LVRM1_0124_A12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0165_A12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0044_D10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0073_C05.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0177_D12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0086_F12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0200_F07.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0148_B08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0036_G08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0186_H11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0069_F04.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0007_B06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0162_A08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0034_H05.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0118_B11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0013_D06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0068_F12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0120_G07.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0080_E07.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0121_H03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0146_B01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0015_F10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0072_D09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0116_D10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0007_A12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0072_C08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0162_G11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0157_G10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0036_G10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0103_E09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0108_D05.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGGGGAGCCCAG*T
LVRM1_0144_G03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0019_H02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0030_A07.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0058_C08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0030_G06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0057_A11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0114_G11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0031_C08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0107_B11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0138_G03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0080_C10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0035_D03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0110_G11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0138_H06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0124_D10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0159_E11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0140_B07.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0142_A11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0052_C10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0063_E06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0078_H11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0010_B06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0113_E08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0002_F07.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0062_B11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0060_A08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0040_F08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0018_F02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0055_B01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0038_G10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0030_G08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0037_G10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTACGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0088_D09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0084_E07.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0093_G05.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0094_G02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0037_A05.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0015_E10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0106_G10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0095_G10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0095_F03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTACGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0013_C12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0054_B04.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0086_F01.b : xxxxxGAGTGCT*CTGCATAGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0009_A01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0097_D05.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0014_C11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGATGAGGAGCCCAG*T
LVR01_0096_E08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0030_D06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0094_E05.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0016_E11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0106_C07.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTATGTGCTTGGTGCGGTGAGGAGCCCAT*T
LVR01_0039_E10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0037_D04.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0076_A12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0055_D12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0077_G01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0048_F09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0030_B07.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0011_E09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0066_E02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0049_E05.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0005_C09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0094_F09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0014_G05.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0094_G09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0015_E08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0102_G08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0013_H08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0058_H02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0025_F02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0040_D10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0086_A09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0028_B06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0062_B12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0009_H05.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0008_C10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0014_H01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0022_B07.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0033_F07.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0045_D11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0002_G07.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0044_F11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0028_D07.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0079_D08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0082_E09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0084_B10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0022_E08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0033_E01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0040_B06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0041_D03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0088_F10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0095_F11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0030_E02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0034_C09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0004_G04.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0017_D02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0067_F03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0057_G09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0058_E08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0053_C05.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0041_F12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0106_G07.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0054_B06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0088_B03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0002_E01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0012_F08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0061_F10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTACGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0066_E10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0046_F04.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0020_E01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0083_E06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0087_B02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0010_E06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0030_H03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTAGGTGCGGTGAGGAGCCCAG*T
LVR01_0065_H01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0033_B03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0085_F06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0061_G12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0102_E11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0004_H04.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0025_A01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0026_C10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0104_H01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCAAG*T
LVR01_0019_G01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0057_D12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0060_D03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0054_H03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0094_C09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0096_H07.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0096_E02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0045_G07.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0092_F11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0049_B01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0013_G04.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0082_G08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0048_G12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTCAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0044_D02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0046_B09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0050_B07.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0078_F11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0097_B08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0020_F07.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGCTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0098_H03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0083_C04.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0001_G12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0068_E08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0045_H08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0046_B10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0053_B01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0083_A01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0034_B02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0003_B08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0034_F10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0043_A09.b : xxxxxGAGTGCT*CTGCAGGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0046_E12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0097_F02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0037_A12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0021_D05.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0029_A04.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0010_A06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0073_F12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0044_C05.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0058_E02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0084_E02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0058_H11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0088_A02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0101_F09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0092_H08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0074_A11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0074_G09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0030_H02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0010_C03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0034_B11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0079_A02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0072_E10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0060_H11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0018_A11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0097_B12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0014_D01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0044_E02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0061_F02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0082_G07.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0012_D12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0092_H11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0068_A11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0084_C04.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0046_E01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0013_H09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0055_B11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0066_H12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0034_G01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0016_G11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0016_G12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0092_D05.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0001_E01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0021_B12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0071_G06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0008_B10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0105_F12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0072_F10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0010_H03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0092_B06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTGGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0012_G04.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0098_A04.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0003_B06.b : xxxxxGAGTGCT*CTGCGTGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0062_F02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0060_B05.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0063_A06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0103_E03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGTGGTGAGGAGCCCAG*T
LVR01_0061_D02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0050_G03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0062_A09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0077_C08.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0099_H02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0017_H03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0066_F06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0001_H02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0078_E06.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0092_C02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0005_B02.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0104_H12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0042_F12.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0012_G01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0060_E10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0016_A01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0103_D03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0022_H11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0062_E01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0073_A03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0060_D11.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGGGCCCAG*T
LVR01_0101_B03.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0067_B09.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0044_D10.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0062_C01.b : xxxxxGAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0038_H03.b : xxxxxcAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0100_C03.b : tatggaAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0022_C02.b : tctggaAGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0040_D02.b : xxxxxtcGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0009_C09.b : xxxxxxxGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0055_A08.b : xxxxxxxGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0029_A03.b : xxxxxxxGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0103_D05.b : xxxxxxxGTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0047_C11.b : cactgagaTGCT*CTGCATGGCCTG*GCCTTAAGTGCTTGGTGCGGTGAGGACCCTTT*T
KDN01_0051_D03.b : ggagaTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGACCCCTTTT
KDN01_0081_G05.b : tctggagaTGCT*CTGCATGGCCTG*GTCTTAAGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0053_C06.b : tatggagaTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0038_D09.b : tatggagaTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCCC*T
KDN01_0060_D07.b : tatggagaTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAC*T
KDN01_0089_A12.b : tatggagaTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0040_F02.b : tatggagaTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAC*T
KDN01_0056_D06.b : tatggagaTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0089_H06.b : tatggagaTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0022_C05.b : tctggagaTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0023_B04.b : tctggagaTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0077_C11.b : tctggagaTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0038_D03.b : tatggagaTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGATGAGCCCCC*C
KDN01_0089_D07.b : tatggagaTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0027_B01.b : tatggagaTGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0002_E10.b : acggnananGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAN*T
KDN01_0083_H09.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0004_E05.b : cacggnaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0004_C04.b : ctatggaagGCT*CTGC*TGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAN*T
KDN01_0020_G01.b : ctcggnaagGCT*CTGC*TGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0045_E12.b : ggagagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGACCCCCTGT
KDN01_0045_D05.b : ctctggaagGCT*CTGC*TGGCCTG*GTCTTATGTGCTTGGTGCGGTGAGGAGCCTTT*T
KDN01_0020_D06.b : cacggnaagGCT*CTGC*TGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0004_H05.b : cacggnaagGCT*CTGC*TGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAN*T
KDN01_0064_G07.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0004_D12.b : cactggaagGCT*CTGC*TGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAN*T
KDN01_0037_F04.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCC**C
KDN01_0002_H04.b : cacggnaagGCT*CTGC*TGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAN*T
KDN01_0060_G08.b : ctatggaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0023_A09.b : cactgagagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0051_G03.b : gggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCTTA*T
KDN01_0019_A04.b : cacggnaagGCT*CTGC*TGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0009_G06.b : ctctggaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0057_A03.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0026_C09.b : ctctggaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0070_G01.b : ctctggaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAC*T
KDN01_0006_F03.b : tctggagatGCT*CTGC*TGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0047_G11.b : actggagagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCTTT*T
KDN01_0051_E11.b : ctatggaggGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCTTT*T
KDN01_0007_G09.b : ctcggnaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0007_H11.b : cactggaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0072_D07.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0010_B07.b : ctcggnaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0009_E11.b : ctctggaagGCT*CTGC*TGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0067_C06.b : cactggaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0033_H08.b : ctatgnaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCCC*T
KDN01_0079_F05.b : ctttggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0008_F06.b : ctatggaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0064_B07.b : ctctggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0089_E09.b : cactgnaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0018_H01.b : cacggnaaaGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0058_B11.b : ctatanaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0068_F07.b : ctatgnaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0078_B11.b : ctctggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCTG*T
KDN01_0022_G02.b : tatggagagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0018_A10.b : ctatggaagGCT*CTGC*TGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0068_E08.b : cacggnaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCTCTT*A
KDN01_0019_E03.b : cactggaagGCT*CTGC*TGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0089_D05.b : ctatanaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0049_G10.b : tatggagatGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCTT*T
KDN01_0031_A10.b : ctatggaggGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0011_C05.b : cactgnaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0024_A01.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0029_A02.b : tctggagatGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCATGT
KDN01_0053_D04.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0057_H10.b : ctctggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0076_G08.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCCG*T
KDN01_0031_E06.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0065_A07.b : ctatgnaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0090_G09.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0033_A07.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGTTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0023_D04.b : tctggagagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0028_F03.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0022_E07.b : tatggagagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0098_G02.b : ctatggaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0034_G04.b : ctctggaagGCT*CTGC*TGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0036_G08.b : ctctggaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0042_D11.b : ctacggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCTT*T
KDN01_0027_B04.b : ctctggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0045_E11.b : actggagagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGACCCCTG*T
KDN01_0058_B03.b : ctatgnaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCACCT
KDN01_0086_A04.b : ctatgnaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0019_B01.b : ctcggnaagGCT*CTGC*TGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0077_A04.b : tatggaggtGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0066_D01.b : ctctggaagGCT*CTGC*TGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0018_F02.b : ctctgnaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0092_G02.b : cacggnaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0096_B02.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0040_C06.b : cactggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCCC*T
KDN01_0062_A05.b : ctatggaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0061_A09.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0082_E06.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0099_C09.b : ctatgagagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0043_F05.b : ctatggaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0093_H09.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0071_A07.b : cactggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAC*T
KDN01_0075_B07.b : ctctgnaagGCT*CTGC*TGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0080_B03.b : ctctggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAC*T
KDN01_0095_H06.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0072_A12.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0024_F07.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0071_B06.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0034_C06.b : ctatggaagGCT*CTGC*TGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0016_H08.b : ctctggaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0076_B02.b : ctctggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0066_A09.b : ctatgnaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0088_E11.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0038_C11.b : cactgnaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCCC*T
KDN01_0044_H06.b : cactggaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0036_H02.b : ctctgnaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAC*T
KDN01_0092_F01.b : cactggaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0016_D07.b : ctcggnaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0029_A12.b : ctctggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0024_A12.b : ctatggaagGCT*CTGCATGGCCTG*ATCTTACGTGCTTGGTGCGGTGAGGAGCCCAA*T
KDN01_0034_E04.b : ctatgnaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0098_C03.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0070_E10.b : ctctggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0024_C12.b : ctctggaagGCT*CTGC*TGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0063_A07.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0073_F11.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0091_A09.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0015_F11.b : ctcggnaagGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0043_D04.b : tatggagagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCTT*T
KDN01_0079_G01.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0086_G07.b : ctctggaatGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0078_B08.b : ctctggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCTT*T
KDN01_0061_E11.b : tctggagatGCT*CTG*ATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0082_A06.b : tatggagagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0078_A01.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0079_F10.b : ctatggaagGCT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0045_E09.b : ggagatgT*CTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCTTT*G
KDN01_0038_C09.b : gctactggaagtgTCTCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCCCCA
KDN01_0086_G10.b : gctatgnaagtgcCTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0097_C11.b : gctatggaagtgcCTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAT*T
LVR01_0062_A03.b : xxxxxxxxxxxxxCTGCATGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVRM1_0066_A05.b : xxxxxxgagagctggaggTGGCCTG*GTCTTAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
LVR01_0065_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGTGCTTGGTGCGGTGAGGAGCCCAG*T
KDN01_0051_H12.b : GCTTGGTGCGGTGAGGAGCCTTTTT
KDN01_0050_B09.b : GCTTGGTGCGGTGAGGAGCCTTA*T
KDN01_0049_A07.b : ccttt
LVR01_0091_D09.b : gtttttggcatangtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_C07.b : ta
LVRM1_0152_D06.b :
LVRM1_0079_A01.b :
LVRM1_0200_E02.b :
LVRM1_0079_B10.b :
LVRM1_0094_F09.b :
20110601C-006978 : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
---------+---------+---------+---------+---------+---------+ 125
LVR01_0048_E10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVRM1_0189_F07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVR01_0036_H12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0035_C03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0040_F06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0099_F11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVRM1_0207_H04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0040_H12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0021_E12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
KDN01_0053_B10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0019_G12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVRM1_0204_E08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0187_B06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0051_B12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0149_H10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0143_H06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0122_B11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVR01_0025_D07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0039_B10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0038_F11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGG*GATTTACTGGGGATCCTGGCCTTGGC
LVR01_0042_F01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0099_F05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVRM1_0043_H03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0043_G07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0177_C02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0109_C12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVR01_0038_D05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0019_B10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0094_G12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0015_A12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0054_D11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0104_F07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0067_H08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVRM1_0041_A11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVR01_0035_D12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVRM1_0174_F02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0093_F10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0025_H03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0049_E05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0039_A12.b : GTGCACTGAGGCTGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0156_F04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0161_G01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0118_C08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGGTCCTGGCCTTGGC
LVRM1_0086_H12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0112_B01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0078_B06.b : GTGCACTGAAGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0078_G01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0058_G08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0161_B09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVR01_0014_D07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0026_D05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0055_E11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0052_F08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0105_C05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0019_D11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0062_G09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0097_E10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0104_D09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0094_C05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0002_A06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0031_F06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0071_G04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0089_B03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0037_C10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0030_H01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0068_A05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0055_H02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVRM1_0208_C11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0088_G03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0196_A10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0180_D03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0090_A09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0078_D09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0064_E12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0042_H09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0071_E03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0168_E10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0179_B03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0064_C04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVR01_0020_E12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVRM1_0091_F06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGTCTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVR01_0054_G02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVRM1_0052_F03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0001_D09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0136_D03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0043_C11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0014_B12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0072_A08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0192_E12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0081_D04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0107_G04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0125_C07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0076_C03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0139_B01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0094_H04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0028_A03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0179_B10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0207_E01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0003_C12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0123_C11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0197_D01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGTCTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0197_C03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVR01_0025_E08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVRM1_0104_H04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0195_E05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0177_D09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0164_F04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0173_H01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0198_E04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0025_G08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0207_A06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0101_D11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0179_B06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0039_F01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0091_F05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0195_C08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0115_D11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0038_F05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0037_C05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0039_E08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0057_A03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0128_F12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0026_B07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0088_D02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0116_C02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0105_H04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0205_F12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVR01_0018_D11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVRM1_0193_E10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0038_A10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0079_E01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0117_H06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0125_H03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0157_D01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0039_D05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0074_A09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0160_F04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0035_A03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0072_B12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0106_D05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0124_A12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0165_A12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0044_D10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0073_C05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0177_D12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0086_F12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0200_F07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0148_B08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0036_G08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0186_H11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0069_F04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0007_B06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0162_A08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0034_H05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0118_B11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0013_D06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0068_F12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0120_G07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0080_E07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0121_H03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0146_B01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0015_F10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0072_D09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0116_D10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0007_A12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0072_C08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0162_G11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0157_G10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0036_G10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0103_E09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0108_D05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCAGGGCCTTGGC
LVRM1_0144_G03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0019_H02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0030_A07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0058_C08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0030_G06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0057_A11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0114_G11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0031_C08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0107_B11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0138_G03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0080_C10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVR01_0035_D03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVRM1_0110_G11.b : GTGCACTGAGGCACCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0138_H06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0124_D10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0159_E11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0140_B07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0142_A11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0052_C10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0063_E06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0078_H11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0010_B06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0113_E08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVRM1_0002_F07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVR01_0062_B11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0060_A08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0040_F08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0018_F02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0055_B01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0038_G10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0030_G08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0037_G10.b : GTGCACTGACGCAACCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0088_D09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0084_E07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0093_G05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTAGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0094_G02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0037_A05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0015_E10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0106_G10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0095_G10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0095_F03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0013_C12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0054_B04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0086_F01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0009_A01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0097_D05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0014_C11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0096_E08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0030_D06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0094_E05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0016_E11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0106_C07.b : GTGCACTGAGGCAACCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0039_E10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0037_D04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0076_A12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0055_D12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0077_G01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0048_F09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0030_B07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0011_E09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0066_E02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0049_E05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0005_C09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0094_F09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0014_G05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0094_G09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0015_E08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0102_G08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0013_H08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0058_H02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0025_F02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0040_D10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0086_A09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0028_B06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0062_B12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0009_H05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0008_C10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0014_H01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0022_B07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0033_F07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0045_D11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0002_G07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0044_F11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0028_D07.b : GTGCACTAAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0079_D08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0082_E09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0084_B10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0022_E08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0033_E01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0040_B06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0041_D03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0088_F10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0095_F11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0030_E02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0034_C09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0004_G04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0017_D02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0067_F03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGAATCCTGGCCTTGGC
LVR01_0057_G09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0058_E08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0053_C05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0041_F12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0106_G07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0054_B06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0088_B03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0002_E01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0012_F08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0061_F10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0066_E10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0046_F04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0020_E01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0083_E06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0087_B02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0010_E06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0030_H03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0065_H01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0033_B03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0085_F06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0061_G12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0102_E11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0004_H04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0025_A01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0026_C10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0104_H01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0019_G01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0057_D12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0060_D03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0054_H03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0094_C09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0096_H07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0096_E02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0045_G07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0092_F11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0049_B01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0013_G04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0082_G08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0048_G12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0044_D02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0046_B09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0050_B07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0078_F11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0097_B08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0020_F07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0098_H03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0083_C04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0001_G12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0068_E08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0045_H08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0046_B10.b : GTGCACTGGGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0053_B01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0083_A01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0034_B02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0003_B08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0034_F10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0043_A09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0046_E12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0097_F02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0037_A12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0021_D05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0029_A04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0010_A06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0073_F12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0044_C05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0058_E02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0084_E02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0058_H11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0088_A02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0101_F09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0092_H08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0074_A11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0074_G09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0030_H02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0010_C03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0034_B11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0079_A02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0072_E10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0060_H11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0018_A11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0097_B12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0014_D01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0044_E02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0061_F02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0082_G07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0012_D12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0092_H11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0068_A11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0084_C04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0046_E01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0013_H09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0055_B11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0066_H12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0034_G01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0016_G11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0016_G12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0092_D05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0001_E01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0021_B12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0071_G06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0008_B10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0105_F12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0072_F10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0010_H03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0092_B06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0012_G04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0098_A04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0003_B06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0062_F02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0060_B05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0063_A06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0103_E03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0061_D02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0050_G03.b : GTGCACTGAGGCAGCCATGGGTCTGCCGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0062_A09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0077_C08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0099_H02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0017_H03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGGCTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0066_F06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0001_H02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0078_E06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0092_C02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0005_B02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0104_H12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0042_F12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0012_G01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0060_E10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0016_A01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0103_D03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0022_H11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0062_E01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0073_A03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0060_D11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0101_B03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0067_B09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0044_D10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0062_C01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVRM1_0038_H03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
KDN01_0100_C03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0022_C02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVRM1_0040_D02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVR01_0009_C09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0055_A08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0029_A03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0103_D05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0047_C11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0051_D03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0081_G05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0053_C06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0038_D09.b : *TAAAGTGAGGCAGCCATGGGTCTGCTGACTGGGGATTCATTGGGGATCCTGGCCTTGGC
KDN01_0060_D07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0089_A12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0040_F02.b : TTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0056_D06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0089_H06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0022_C05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0023_B04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0077_C11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0038_D03.b : TTTAAAGGAGGCAGCCATGGGTCTGCTGACTGGGGATTCCCTGGGGATCCTGGCCTTGGC
KDN01_0089_D07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0027_B01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0002_E10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0083_H09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0004_E05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0004_C04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0020_G01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0045_E12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGAATCCTGGCCTTGGC
KDN01_0045_D05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0020_D06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0004_H05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0064_G07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0004_D12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0037_F04.b : CTTATAGGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTTGGGATCCTGGCCTTGGC
KDN01_0002_H04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0060_G08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0023_A09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0051_G03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0019_A04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0009_G06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0057_A03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0026_C09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0070_G01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0006_F03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0047_G11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0051_E11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0007_G09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0007_H11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGGCTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0072_D07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0010_B07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0009_E11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0067_C06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0033_H08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0079_F05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0008_F06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0064_B07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0089_E09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0018_H01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0058_B11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0068_F07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0078_B11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0022_G02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0018_A10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0068_E08.b : CTACACTGAGGCAGCCATGGGTCTGCTGACTGGGGATCTATTGGGGATCCTGGCCTTGGC
KDN01_0019_E03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0089_D05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0049_G10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0031_A10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0011_C05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0024_A01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0029_A02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0053_D04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0057_H10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0076_G08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0031_E06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0065_A07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0090_G09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0033_A07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0023_D04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0028_F03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0022_E07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0098_G02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0034_G04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGACCCTGGCCTTGGC
KDN01_0036_G08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0042_D11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0027_B04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0045_E11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0058_B03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0086_A04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0019_B01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0077_A04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0066_D01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0018_F02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0092_G02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0096_B02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0040_C06.b : TAGCAGTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0062_A05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0061_A09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0082_E06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0099_C09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0043_F05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0093_H09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0071_A07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0075_B07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0080_B03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0095_H06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0072_A12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0024_F07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0071_B06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0034_C06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0016_H08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0076_B02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0066_A09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0088_E11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0038_C11.b : TTGAACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0044_H06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0036_H02.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0092_F01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0016_D07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0029_A12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0024_A12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0034_E04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0098_C03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0070_E10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0024_C12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0063_A07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0073_F11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0091_A09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0015_F11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0043_D04.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0079_G01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0086_G07.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0078_B08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0061_E11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0082_A06.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0078_A01.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0079_F10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0045_E09.b : ATG*ACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0038_C09.b : TAGAACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTCTTGGGGATCCTGGCCTTGGC
KDN01_0086_G10.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0097_C11.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0062_A03.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVRM1_0066_A05.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGGTTTACTGGGGATCCTGGCCTTGGC
LVR01_0065_E08.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0051_H12.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0050_B09.b : GTGCACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
KDN01_0049_A07.b : agtgACTGAGGCAGCCATGGGTCTGCTGACTGGGGATTTACTGGGGATCCTGGCCTTGGC
LVR01_0091_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTGGGGATCCTGGCCTTGGC
LVRM1_0149_C07.b : gttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxg
LVRM1_0152_D06.b :
LVRM1_0079_A01.b :
LVRM1_0200_E02.b :
LVRM1_0079_B10.b :
LVRM1_0094_F09.b :
20110601C-006978 : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
---------+---------+---------+---------+---------+---------+ 185
LVR01_0048_E10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0189_F07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0036_H12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0035_C03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0040_F06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0099_F11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0207_H04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0040_H12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0021_E12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0053_B10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0019_G12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0204_E08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0187_B06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0051_B12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0149_H10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0143_H06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0122_B11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0025_D07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0039_B10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0038_F11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0042_F01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0099_F05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0043_H03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0043_G07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0177_C02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0109_C12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0038_D05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0019_B10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0094_G12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0015_A12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0054_D11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0104_F07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGACGCTCACGCTGGGCTCCACG
LVR01_0067_H08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0041_A11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0035_D12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0174_F02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0093_F10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0025_H03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0049_E05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0039_A12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0156_F04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0161_G01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0118_C08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0086_H12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTAATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0112_B01.b : CATGGTCATCTTCCTGCTCCTAGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0078_B06.b : CATGGGCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0078_G01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0058_G08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0161_B09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0014_D07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0026_D05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0055_E11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0052_F08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0105_C05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0019_D11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0062_G09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0097_E10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0104_D09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0094_C05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0002_A06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0031_F06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0071_G04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0089_B03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0037_C10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0030_H01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0068_A05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0055_H02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0208_C11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0088_G03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0196_A10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0180_D03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0090_A09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0078_D09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0064_E12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTT*ACG
LVRM1_0042_H09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0071_E03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0168_E10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0179_B03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0064_C04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0020_E12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0091_F06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0054_G02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0052_F03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0001_D09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0136_D03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0043_C11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0014_B12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0072_A08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0192_E12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0081_D04.b : CATGGTCAACTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0107_G04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0125_C07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0076_C03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0139_B01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0094_H04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0028_A03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0179_B10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGTCTCCACG
LVRM1_0207_E01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0003_C12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0123_C11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0197_D01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0197_C03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0025_E08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0104_H04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0195_E05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0177_D09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0164_F04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0173_H01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0198_E04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0025_G08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0207_A06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0101_D11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0179_B06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0039_F01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0091_F05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0195_C08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0115_D11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0038_F05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0037_C05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0039_E08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0057_A03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0128_F12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0026_B07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0088_D02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0116_C02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0105_H04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0205_F12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0018_D11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0193_E10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0038_A10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0079_E01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0117_H06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0125_H03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0157_D01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0039_D05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0074_A09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0160_F04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0035_A03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0072_B12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0106_D05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0124_A12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0165_A12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0044_D10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCGCG
LVRM1_0073_C05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0177_D12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0086_F12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0200_F07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0148_B08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0036_G08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0186_H11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0069_F04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0007_B06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0162_A08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0034_H05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0118_B11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0013_D06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0068_F12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0120_G07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0080_E07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0121_H03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0146_B01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0015_F10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0072_D09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0116_D10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0007_A12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0072_C08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0162_G11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0157_G10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0036_G10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0103_E09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0108_D05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0144_G03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0019_H02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0030_A07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0058_C08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0030_G06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0057_A11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0114_G11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0031_C08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0107_B11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0138_G03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0080_C10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0035_D03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0110_G11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACTCTGGGCTCCACG
LVRM1_0138_H06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0124_D10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0159_E11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0140_B07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0142_A11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0052_C10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0063_E06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0078_H11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0010_B06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0113_E08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0002_F07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0062_B11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0060_A08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0040_F08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0018_F02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0055_B01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0038_G10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0030_G08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0037_G10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0088_D09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0084_E07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0093_G05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0094_G02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0037_A05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0015_E10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0106_G10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0095_G10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0095_F03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0013_C12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0054_B04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0086_F01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0009_A01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0097_D05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0014_C11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0096_E08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0030_D06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0094_E05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0016_E11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0106_C07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0039_E10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0037_D04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0076_A12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0055_D12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0077_G01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0048_F09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0030_B07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0011_E09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0066_E02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0049_E05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0005_C09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0094_F09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0014_G05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0094_G09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0015_E08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0102_G08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0013_H08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0058_H02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0025_F02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0040_D10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0086_A09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0028_B06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0062_B12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0009_H05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0008_C10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0014_H01.b : CATGGTCATCTTCCTACTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0022_B07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0033_F07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0045_D11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0002_G07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0044_F11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0028_D07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0079_D08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0082_E09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0084_B10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0022_E08.b : CATGTTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0033_E01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0040_B06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0041_D03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0088_F10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0095_F11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0030_E02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0034_C09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0004_G04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0017_D02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0067_F03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0057_G09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0058_E08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0053_C05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0041_F12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0106_G07.b : CATGGTCATCTTCCAGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0054_B06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0088_B03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0002_E01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0012_F08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0061_F10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0066_E10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0046_F04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACACTGGGCTCCACG
LVR01_0020_E01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0083_E06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0087_B02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0010_E06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0030_H03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0065_H01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0033_B03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0085_F06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0061_G12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0102_E11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0004_H04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0025_A01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0026_C10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0104_H01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCATCGGCGCTCACGCTGGGCTCCACG
LVR01_0019_G01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0057_D12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0060_D03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0054_H03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0094_C09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0096_H07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0096_E02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0045_G07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0092_F11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0049_B01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0013_G04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0082_G08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0048_G12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0044_D02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0046_B09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0050_B07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0078_F11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0097_B08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGGTGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0020_F07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0098_H03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0083_C04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0001_G12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0068_E08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0045_H08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0046_B10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCATG
LVR01_0053_B01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0083_A01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0034_B02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0003_B08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0034_F10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0043_A09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0046_E12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0097_F02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0037_A12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0021_D05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0029_A04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0010_A06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0073_F12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0044_C05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0058_E02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0084_E02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0058_H11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0088_A02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0101_F09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0092_H08.b : CGTGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0074_A11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0074_G09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0030_H02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0010_C03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0034_B11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0079_A02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0072_E10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0060_H11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0018_A11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0097_B12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0014_D01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0044_E02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0061_F02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0082_G07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0012_D12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0092_H11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0068_A11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0084_C04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0046_E01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0013_H09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0055_B11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0066_H12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0034_G01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0016_G11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGGTGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0016_G12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0092_D05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0001_E01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0021_B12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0071_G06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0008_B10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0105_F12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0072_F10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0010_H03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0092_B06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0012_G04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0098_A04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0003_B06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0062_F02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0060_B05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0063_A06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0103_E03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0061_D02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0050_G03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0062_A09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0077_C08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0099_H02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0017_H03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0066_F06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0001_H02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0078_E06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0092_C02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0005_B02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0104_H12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0042_F12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0012_G01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0060_E10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0016_A01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0103_D03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0022_H11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0062_E01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0073_A03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0060_D11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0101_B03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0067_B09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0044_D10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0062_C01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0038_H03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0100_C03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0022_C02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0040_D02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0009_C09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0055_A08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0029_A03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0103_D05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0047_C11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0051_D03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0081_G05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0053_C06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGTTCCACG
KDN01_0038_D09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0060_D07.b : CGTGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0089_A12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0040_F02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0056_D06.b : CACGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0089_H06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0022_C05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0023_B04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0077_C11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0038_D03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0089_D07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0027_B01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0002_E10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0083_H09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGACGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0004_E05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0004_C04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0020_G01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0045_E12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0045_D05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0020_D06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0004_H05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0064_G07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0004_D12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCATG
KDN01_0037_F04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0002_H04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0060_G08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0023_A09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0051_G03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0019_A04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0009_G06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0057_A03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0026_C09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0070_G01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0006_F03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0047_G11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0051_E11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0007_G09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0007_H11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0072_D07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0010_B07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0009_E11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0067_C06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0033_H08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0079_F05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0008_F06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0064_B07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0089_E09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0018_H01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0058_B11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0068_F07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0078_B11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0022_G02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0018_A10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0068_E08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0019_E03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0089_D05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0049_G10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0031_A10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0011_C05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0024_A01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0029_A02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0053_D04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0057_H10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0076_G08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0031_E06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0065_A07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0090_G09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0033_A07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0023_D04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0028_F03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0022_E07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0098_G02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0034_G04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0036_G08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0042_D11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0027_B04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0045_E11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0058_B03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0086_A04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0019_B01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0077_A04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0066_D01.b : CATGGTCATTTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0018_F02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0092_G02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0096_B02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0040_C06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0062_A05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0061_A09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0082_E06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0099_C09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0043_F05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0093_H09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0071_A07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0075_B07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0080_B03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0095_H06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0072_A12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0024_F07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0071_B06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0034_C06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0016_H08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0076_B02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0066_A09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0088_E11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0038_C11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0044_H06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0036_H02.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCACTCACGCTGGGCTCCACG
KDN01_0092_F01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0016_D07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0029_A12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0024_A12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0034_E04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0098_C03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0070_E10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0024_C12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0063_A07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0073_F11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0091_A09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0015_F11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0043_D04.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0079_G01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0086_G07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0078_B08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0061_E11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0082_A06.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0078_A01.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0079_F10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0045_E09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0038_C09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0086_G10.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0097_C11.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0062_A03.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVRM1_0066_A05.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0065_E08.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0051_H12.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0050_B09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
KDN01_0049_A07.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACCGGCGCTCACGCTGGGCTCCACG
LVR01_0091_D09.b : CATGGTCATCTTCCTGCTCCTGGTGGACTTGATGCACGGGCGCTCACGCTGGGCTCCACG
LVRM1_0149_C07.b : agtgctctgcatggcctggtcttaggtgcttggtgcggtgaggagcccagtgtgcactga
LVRM1_0152_D06.b : nagttgtcxxxxxxx
LVRM1_0079_A01.b : agttgacxxxx
LVRM1_0200_E02.b : tcgttgtcxxxxxxxxxxxxxxxxx
LVRM1_0079_B10.b :
LVRM1_0094_F09.b :
20110601C-006978 : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
---------+---------+---------+---------+---------+---------+ 244
LVR01_0048_E10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0189_F07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0036_H12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0035_C03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0040_F06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0099_F11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0207_H04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0040_H12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0021_E12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0053_B10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0019_G12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0204_E08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0187_B06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0051_B12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0149_H10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0143_H06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0122_B11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0025_D07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0039_B10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0038_F11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0042_F01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0099_F05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0043_H03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0043_G07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0177_C02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0109_C12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0038_D05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0019_B10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0094_G12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0015_A12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0054_D11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0104_F07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0067_H08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0041_A11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0035_D12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0174_F02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0093_F10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0025_H03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0049_E05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0039_A12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0156_F04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0161_G01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0118_C08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0086_H12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0112_B01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0078_B06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0078_G01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0058_G08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0161_B09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0014_D07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0026_D05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0055_E11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0052_F08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0105_C05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0019_D11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0062_G09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0097_E10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0104_D09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0094_C05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0002_A06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0031_F06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0071_G04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0089_B03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0037_C10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0030_H01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0068_A05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0055_H02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0208_C11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0088_G03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0196_A10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0180_D03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0090_A09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0078_D09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0064_E12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0042_H09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0071_E03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0168_E10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0179_B03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0064_C04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0020_E12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0091_F06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0054_G02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0052_F03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0001_D09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0136_D03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0043_C11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0014_B12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0072_A08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0192_E12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0081_D04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0107_G04.b : CTACCCACCGAGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0125_C07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0076_C03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0139_B01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0094_H04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0028_A03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0179_B10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0207_E01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0003_C12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0123_C11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0197_D01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0197_C03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0025_E08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0104_H04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0195_E05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0177_D09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0164_F04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0173_H01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0198_E04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0025_G08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0207_A06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0101_D11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0179_B06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0039_F01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0091_F05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0195_C08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0115_D11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0038_F05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0037_C05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0039_E08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0057_A03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0128_F12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0026_B07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0088_D02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0116_C02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0105_H04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0205_F12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0018_D11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0193_E10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0038_A10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0079_E01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0117_H06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0125_H03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0157_D01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0039_D05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0074_A09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0160_F04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0035_A03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0072_B12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0106_D05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0124_A12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0165_A12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0044_D10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0073_C05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0177_D12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0086_F12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0200_F07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0148_B08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0036_G08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0186_H11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0069_F04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0007_B06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0162_A08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0034_H05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0118_B11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0013_D06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0068_F12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0120_G07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0080_E07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0121_H03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0146_B01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0015_F10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0072_D09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0116_D10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0007_A12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0072_C08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0162_G11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0157_G10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0036_G10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0103_E09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0108_D05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0144_G03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0019_H02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0030_A07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0058_C08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0030_G06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0057_A11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0114_G11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0031_C08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0107_B11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0138_G03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAGG*TGAACTTCC
LVRM1_0080_C10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0035_D03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0110_G11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0138_H06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0124_D10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0159_E11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0140_B07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0142_A11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0052_C10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0063_E06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0078_H11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACCTCC
LVRM1_0010_B06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0113_E08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0002_F07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0062_B11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0060_A08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0040_F08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0018_F02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0055_B01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0038_G10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0030_G08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0037_G10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAC*TGAACTTCC
LVR01_0088_D09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0084_E07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0093_G05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0094_G02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAGATGAACTTCC
LVR01_0037_A05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0015_E10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0106_G10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0095_G10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0095_F03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0013_C12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0054_B04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0086_F01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0009_A01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0097_D05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0014_C11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0096_E08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0030_D06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0094_E05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0016_E11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0106_C07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCA
LVR01_0039_E10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0037_D04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0076_A12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0055_D12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0077_G01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0048_F09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0030_B07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0011_E09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0066_E02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0049_E05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0005_C09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0094_F09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0014_G05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0094_G09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0015_E08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0102_G08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0013_H08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0058_H02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0025_F02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0040_D10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0086_A09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0028_B06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGGACTTCC
LVR01_0062_B12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0009_H05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0008_C10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0014_H01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0022_B07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0033_F07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0045_D11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0002_G07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0044_F11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0028_D07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0079_D08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0082_E09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0084_B10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0022_E08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0033_E01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0040_B06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0041_D03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0088_F10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0095_F11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0030_E02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0034_C09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0004_G04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0017_D02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0067_F03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0057_G09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0058_E08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0053_C05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0041_F12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0106_G07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0054_B06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0088_B03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0002_E01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0012_F08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0061_F10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0066_E10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0046_F04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0020_E01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0083_E06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0087_B02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0010_E06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0030_H03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0065_H01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0033_B03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0085_F06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0061_G12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0102_E11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0004_H04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0025_A01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0026_C10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0104_H01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0019_G01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0057_D12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0060_D03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0054_H03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0094_C09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0096_H07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0096_E02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0045_G07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0092_F11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0049_B01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0013_G04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0082_G08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0048_G12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0044_D02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0046_B09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0050_B07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0078_F11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0097_B08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0020_F07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0098_H03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0083_C04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0001_G12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0068_E08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0045_H08.b : CTACCCACCGGCCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0046_B10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0053_B01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0083_A01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0034_B02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0003_B08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0034_F10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0043_A09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0046_E12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0097_F02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0037_A12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0021_D05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0029_A04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0010_A06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0073_F12.b : CTACCCACCGGGCCTCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0044_C05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0058_E02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0084_E02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0058_H11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0088_A02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0101_F09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0092_H08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0074_A11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0074_G09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0030_H02.b : CTACCCACCGGGCCCCATACCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0010_C03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0034_B11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0079_A02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0072_E10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0060_H11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0018_A11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0097_B12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0014_D01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0044_E02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0061_F02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0082_G07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0012_D12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0092_H11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0068_A11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0084_C04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0046_E01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0013_H09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0055_B11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0066_H12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0034_G01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0016_G11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0016_G12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0092_D05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0001_E01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0021_B12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0071_G06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0008_B10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0105_F12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0072_F10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0010_H03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACCTCC
LVR01_0092_B06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0012_G04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0098_A04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0003_B06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0062_F02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0060_B05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0063_A06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0103_E03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0061_D02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0050_G03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0062_A09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0077_C08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0099_H02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0017_H03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0066_F06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0001_H02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0078_E06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0092_C02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0005_B02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0104_H12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0042_F12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0012_G01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0060_E10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0016_A01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0103_D03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0022_H11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0062_E01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0073_A03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0060_D11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0101_B03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0067_B09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0044_D10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0062_C01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0038_H03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0100_C03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0022_C02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0040_D02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0009_C09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0055_A08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0029_A03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0103_D05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0047_C11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0051_D03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCCGCTACAAG*TGAACTTCC
KDN01_0081_G05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0053_C06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0038_D09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0060_D07.b : CTACCCACTGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0089_A12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0040_F02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0056_D06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0089_H06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0022_C05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0023_B04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0077_C11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0038_D03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0089_D07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0027_B01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0002_E10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0083_H09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0004_E05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0004_C04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0020_G01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0045_E12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0045_D05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0020_D06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0004_H05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0064_G07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0004_D12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0037_F04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGGAACCTGCTACAAG*TGAACTTCC
KDN01_0002_H04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0060_G08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0023_A09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0051_G03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0019_A04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0009_G06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0057_A03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0026_C09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0070_G01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0006_F03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0047_G11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0051_E11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0007_G09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0007_H11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0072_D07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0010_B07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0009_E11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0067_C06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0033_H08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0079_F05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0008_F06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0064_B07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0089_E09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0018_H01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0058_B11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0068_F07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0078_B11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0022_G02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0018_A10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0068_E08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0019_E03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0089_D05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0049_G10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0031_A10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0011_C05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0024_A01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0029_A02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0053_D04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0057_H10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0076_G08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0031_E06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0065_A07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0090_G09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0033_A07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0023_D04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0028_F03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0022_E07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0098_G02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0034_G04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0036_G08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0042_D11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0027_B04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0045_E11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0058_B03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0086_A04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0019_B01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0077_A04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0066_D01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0018_F02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0092_G02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0096_B02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0040_C06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGGAACCTGCTACAAG*TGAACTTCC
KDN01_0062_A05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0061_A09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0082_E06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0099_C09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0043_F05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0093_H09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0071_A07.b : CTACCCACCGGGCCCCATGCCACTGCCTGAGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0075_B07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0080_B03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0095_H06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0072_A12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0024_F07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0071_B06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0034_C06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0016_H08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0076_B02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0066_A09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0088_E11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0038_C11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGGAACCTGCTACAAG*TGAACTTCC
KDN01_0044_H06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0036_H02.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0092_F01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0016_D07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0029_A12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0024_A12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0034_E04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0098_C03.b : CCACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0070_E10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0024_C12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0063_A07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0073_F11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0091_A09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0015_F11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0043_D04.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0079_G01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0086_G07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0078_B08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0061_E11.b : CTACCCACCGGGCCCCATGCCACCGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0082_A06.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0078_A01.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0079_F10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0045_E09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0038_C09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0086_G10.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0097_C11.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0062_A03.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0066_A05.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0065_E08.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0051_H12.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0050_B09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
KDN01_0049_A07.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVR01_0091_D09.b : CTACCCACCGGGCCCCATGCCACTGCCTGGGCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0149_C07.b : ggcagccatgggtctgctgactgggggtttaCTGGGTAACCTGCTACAAG*TGAACTTCC
LVRM1_0152_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAAG*TGAACTTCC
LVRM1_0079_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgG*TGAACTTCC
LVRM1_0200_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgttgttggcctactggtggCTTCC
LVRM1_0079_B10.b : agttgacxxxxxxxxxxxxxxxx
LVRM1_0094_F09.b :
20110601C-006978 : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
---------+---------+---------+---------+---------+---------+ 303
LVR01_0048_E10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVRM1_0189_F07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVR01_0036_H12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0035_C03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0040_F06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0099_F11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVRM1_0207_H04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0040_H12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0021_E12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
KDN01_0053_B10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0019_G12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVRM1_0204_E08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0187_B06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0051_B12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0149_H10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0143_H06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0122_B11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVR01_0025_D07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0039_B10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0038_F11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0042_F01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0099_F05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVRM1_0043_H03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0043_G07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0177_C02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0109_C12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVR01_0038_D05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0019_B10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0094_G12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0015_A12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0054_D11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0104_F07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0067_H08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVRM1_0041_A11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVR01_0035_D12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVRM1_0174_F02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0093_F10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0025_H03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0049_E05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0039_A12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0156_F04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0161_G01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0118_C08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0086_H12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0112_B01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0078_B06.b : CAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCACTTCTGGGATGTATTCAGCCTA
LVRM1_0078_G01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0058_G08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0161_B09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVR01_0014_D07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0026_D05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0055_E11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCATCCTG
LVR01_0052_F08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0105_C05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0019_D11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0062_G09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0097_E10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0104_D09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0094_C05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0002_A06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0031_F06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0071_G04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0089_B03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0037_C10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0030_H01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0068_A05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0055_H02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVRM1_0208_C11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0088_G03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0196_A10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0180_D03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0090_A09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0078_D09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0064_E12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0042_H09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0071_E03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0168_E10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0179_B03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0064_C04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVR01_0020_E12.b : CAGACCCACGTCTCATCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVRM1_0091_F06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVR01_0054_G02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVRM1_0052_F03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0001_D09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0136_D03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0043_C11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0014_B12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0072_A08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0192_E12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGCATTCAGCCTA
LVRM1_0081_D04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0107_G04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0125_C07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0076_C03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0139_B01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0094_H04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0028_A03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0179_B10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0207_E01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0003_C12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0123_C11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0197_D01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0197_C03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVR01_0025_E08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVRM1_0104_H04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0195_E05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0177_D09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0164_F04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0173_H01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0198_E04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0025_G08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0207_A06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0101_D11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0179_B06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0039_F01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0091_F05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0195_C08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0115_D11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0038_F05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0037_C05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0039_E08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0057_A03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0128_F12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0026_B07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0088_D02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0116_C02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0105_H04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0205_F12.b : AAGACCCACGTCTCAGCTTTGTCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVR01_0018_D11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVRM1_0193_E10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0038_A10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0079_E01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0117_H06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0125_H03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0157_D01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0039_D05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0074_A09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0160_F04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0035_A03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0072_B12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0106_D05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0124_A12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCCGGGATGTATTCAGCCTA
LVRM1_0165_A12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGGTGTATTCAGCCTA
LVRM1_0044_D10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0073_C05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0177_D12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0086_F12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0200_F07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0148_B08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0036_G08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0186_H11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0069_F04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0007_B06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0162_A08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0034_H05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0118_B11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0013_D06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0068_F12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0120_G07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0080_E07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0121_H03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0146_B01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0015_F10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0072_D09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0116_D10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0007_A12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0072_C08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0162_G11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0157_G10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0036_G10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0103_E09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0108_D05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0144_G03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0019_H02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0030_A07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0058_C08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0030_G06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0057_A11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0114_G11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0031_C08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0107_B11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0138_G03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0080_C10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVR01_0035_D03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVRM1_0110_G11.b : AAGACCCACGTCTCATCTTTATCCAGCTGCG*GCGCCGCTTCCGGGATGTATTCACCCTA
LVRM1_0138_H06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0124_D10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0159_E11.b : AAGACCCACGTCTCAGCTTTAACCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0140_B07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0142_A11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0052_C10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0063_E06.b : AAGACCCACGTCTCAGC*TTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0078_H11.b : NAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0010_B06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0113_E08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0002_F07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVR01_0062_B11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0060_A08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0040_F08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAACCTG
LVR01_0018_F02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCC*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0055_B01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0038_G10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0030_G08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0037_G10.b : CAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0088_D09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0084_E07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0093_G05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0094_G02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0037_A05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0015_E10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0106_G10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0095_G10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0095_F03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCATCCTG
LVR01_0013_C12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0054_B04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0086_F01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0009_A01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0097_D05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0014_C11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0096_E08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0030_D06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0094_E05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0016_E11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0106_C07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0039_E10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0037_D04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0076_A12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0055_D12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCTGCTTTGGGGATGTATTCAGCCTG
LVR01_0077_G01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0048_F09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0030_B07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0011_E09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0066_E02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0049_E05.b : AAGACCCACGTCTCAGCTTTATCCAGCGGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0005_C09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0094_F09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0014_G05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0094_G09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0015_E08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0102_G08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0013_H08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0058_H02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0025_F02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0040_D10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0086_A09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0028_B06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0062_B12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0009_H05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0008_C10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0014_H01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0022_B07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0033_F07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0045_D11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0002_G07.b : AAGACCCACGTCTCAGCCTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0044_F11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0028_D07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0079_D08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0082_E09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0084_B10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0022_E08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0033_E01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0040_B06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0041_D03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0088_F10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0095_F11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0030_E02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0034_C09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0004_G04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0017_D02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0067_F03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0057_G09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0058_E08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0053_C05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0041_F12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0106_G07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0054_B06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0088_B03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0002_E01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0012_F08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0061_F10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0066_E10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0046_F04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0020_E01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0083_E06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0087_B02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0010_E06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0030_H03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0065_H01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0033_B03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0085_F06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0061_G12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0102_E11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0004_H04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0025_A01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0026_C10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0104_H01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0019_G01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0057_D12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0060_D03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0054_H03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0094_C09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0096_H07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0096_E02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0045_G07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0092_F11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0049_B01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0013_G04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0082_G08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0048_G12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0044_D02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0046_B09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0050_B07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0078_F11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0097_B08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0020_F07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0098_H03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0083_C04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0001_G12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0068_E08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0045_H08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0046_B10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0053_B01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0083_A01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0034_B02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0003_B08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0034_F10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0043_A09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0046_E12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0097_F02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0037_A12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0021_D05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0029_A04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0010_A06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0073_F12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0044_C05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0058_E02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0084_E02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0058_H11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0088_A02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0101_F09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCT*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0092_H08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0074_A11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0074_G09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0030_H02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0010_C03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0034_B11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0079_A02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0072_E10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0060_H11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0018_A11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0097_B12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0014_D01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0044_E02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0061_F02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0082_G07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0012_D12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0092_H11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0068_A11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0084_C04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0046_E01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0013_H09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0055_B11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0066_H12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0034_G01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0016_G11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0016_G12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0092_D05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0001_E01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0021_B12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0071_G06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0008_B10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0105_F12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0072_F10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0010_H03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0092_B06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0012_G04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0098_A04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0003_B06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0062_F02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0060_B05.b : AAGACCCACGTCTCAACTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0063_A06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0103_E03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0061_D02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0050_G03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0062_A09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0077_C08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGAGGATGTATTCAGCCTG
LVR01_0099_H02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0017_H03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0066_F06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0001_H02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0078_E06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0092_C02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0005_B02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0104_H12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0042_F12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0012_G01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0060_E10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0016_A01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0103_D03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTACTCAGCCTG
LVR01_0022_H11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0062_E01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0073_A03.b : AAGACCCACGTCTCAGCTTTATCCAGCCGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0060_D11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0101_B03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0067_B09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0044_D10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0062_C01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVRM1_0038_H03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
KDN01_0100_C03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0022_C02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVRM1_0040_D02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVR01_0009_C09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0055_A08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0029_A03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0103_D05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0047_C11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0051_D03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0081_G05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0053_C06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0038_D09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0060_D07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0089_A12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0040_F02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0056_D06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0089_H06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0022_C05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0023_B04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0077_C11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0038_D03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0089_D07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0027_B01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0002_E10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0083_H09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0004_E05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0004_C04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0020_G01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0045_E12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0045_D05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0020_D06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0004_H05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0064_G07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0004_D12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0037_F04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0002_H04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0060_G08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0023_A09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0051_G03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0019_A04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0009_G06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0057_A03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0026_C09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0070_G01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0006_F03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0047_G11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0051_E11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0007_G09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0007_H11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0072_D07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0010_B07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0009_E11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0067_C06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0033_H08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0079_F05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0008_F06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0064_B07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0089_E09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0018_H01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0058_B11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0068_F07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0078_B11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0022_G02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0018_A10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0068_E08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0019_E03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0089_D05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0049_G10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0031_A10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0011_C05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0024_A01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0029_A02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0053_D04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0057_H10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0076_G08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0031_E06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0065_A07.b : AGGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0090_G09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0033_A07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0023_D04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0028_F03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0022_E07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0098_G02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0034_G04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0036_G08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0042_D11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0027_B04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGGG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0045_E11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0058_B03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0086_A04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0019_B01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0077_A04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTG
KDN01_0066_D01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0018_F02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0092_G02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0096_B02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0040_C06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0062_A05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0061_A09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0082_E06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0099_C09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0043_F05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0093_H09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0071_A07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0075_B07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0080_B03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0095_H06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0072_A12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0024_F07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0071_B06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0034_C06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0016_H08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0076_B02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0066_A09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGTG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0088_E11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0038_C11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0044_H06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0036_H02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0092_F01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0016_D07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0029_A12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0024_A12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0034_E04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0098_C03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0070_E10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0024_C12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0063_A07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0073_F11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0091_A09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0015_F11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0043_D04.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0079_G01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0086_G07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0078_B08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0061_E11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0082_A06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0078_A01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0079_F10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0045_E09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0038_C09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0086_G10.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0097_C11.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0062_A03.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVRM1_0066_A05.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCTCTTCGGGGATGTATTCAGCCTA
LVR01_0065_E08.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0051_H12.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0050_B09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
KDN01_0049_A07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTTGGGGATGTATTCAGCCTG
LVR01_0091_D09.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCGAGCGCCGCTTTGGGGATGTATTCAGCCTG
LVRM1_0149_C07.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0152_D06.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0079_A01.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0200_E02.b : AAGACCCACGTCTCAGCTTTATCCAGCTGCG*GCGCCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0079_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgCGCTTCGGGGATGTATTCAGCCTA
LVRM1_0094_F09.b : aattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-006978 : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
---------+---------+---------+---------+---------+---------+ 363
LVR01_0048_E10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0189_F07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0036_H12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0035_C03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0040_F06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCCCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0099_F11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0207_H04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0040_H12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0021_E12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0053_B10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0019_G12.b : CACCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGTGGCTGTGCGGGAGGCGCTG
LVRM1_0204_E08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0187_B06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0051_B12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0149_H10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0143_H06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0122_B11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0025_D07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0039_B10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0038_F11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0042_F01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0099_F05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0043_H03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0043_G07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0177_C02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0109_C12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0038_D05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0019_B10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0094_G12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0015_A12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0054_D11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0104_F07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0067_H08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0041_A11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCCGGCGGCTGTGCGGGAGGCGCTG
LVR01_0035_D12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0174_F02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0093_F10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0025_H03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0049_E05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0039_A12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0156_F04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0161_G01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0118_C08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0086_H12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0112_B01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0078_B06.b : CAGCAGATCTGGAGGCCCGTGATCGAGCTCAATGGGCTGTCGGCTGTGCGGGAGGCGCTG
LVRM1_0078_G01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0058_G08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0161_B09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0014_D07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0026_D05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0055_E11.b : CAGCAGATCTGGAGGCCCGCGGTCGTGCTCAATGGGCTGGCGGCTGTTTGGCAGGCGCTA
LVR01_0052_F08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0105_C05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0019_D11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0062_G09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0097_E10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0104_D09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0094_C05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0002_A06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0031_F06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0071_G04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0089_B03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0037_C10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0030_H01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0068_A05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0055_H02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0208_C11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0088_G03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0196_A10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0180_D03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0090_A09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGATGCGCTG
LVRM1_0078_D09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0064_E12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0042_H09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0071_E03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0168_E10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0179_B03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0064_C04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0020_E12.b : CAGCAAATCTGGAGGCCCGTGGTCCTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0091_F06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0054_G02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0052_F03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0001_D09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0136_D03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0043_C11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0014_B12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0072_A08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0192_E12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0081_D04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0107_G04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0125_C07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0076_C03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0139_B01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0094_H04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0028_A03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0179_B10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0207_E01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0003_C12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0123_C11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0197_D01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0197_C03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0025_E08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0104_H04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0195_E05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0177_D09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0164_F04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0173_H01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0198_E04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0025_G08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0207_A06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0101_D11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0179_B06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0039_F01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0091_F05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0195_C08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0115_D11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0038_F05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0037_C05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0039_E08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0057_A03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0128_F12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0026_B07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0088_D02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0116_C02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0105_H04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0205_F12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0018_D11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0193_E10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0038_A10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0079_E01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0117_H06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0125_H03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0157_D01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0039_D05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0074_A09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0160_F04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0035_A03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0072_B12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0106_D05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0124_A12.b : CAGCAGATCTGGAGGTCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0165_A12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0044_D10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0073_C05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0177_D12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0086_F12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0200_F07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0148_B08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0036_G08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0186_H11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0069_F04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0007_B06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0162_A08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0034_H05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0118_B11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0013_D06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0068_F12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0120_G07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0080_E07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0121_H03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0146_B01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0015_F10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0072_D09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0116_D10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0007_A12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0072_C08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0162_G11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0157_G10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0036_G10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0103_E09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0108_D05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0144_G03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0019_H02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0030_A07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0058_C08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0030_G06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0057_A11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0114_G11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0031_C08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0107_B11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0138_G03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCAGGTGGCGCCG
LVRM1_0080_C10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0035_D03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0110_G11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGATGCGCTG
LVRM1_0138_H06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0124_D10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0159_E11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0140_B07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0142_A11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0052_C10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0063_E06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0078_H11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0010_B06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0113_E08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0002_F07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0062_B11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0060_A08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0040_F08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0018_F02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0055_B01.b : CAGCAGATCTGGAGG*CCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0038_G10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0030_G08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0037_G10.b : CAGCACATCTGGACGCCCGTGGTCTTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0088_D09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0084_E07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0093_G05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0094_G02.b : CAGCATATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0037_A05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0015_E10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0106_G10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0095_G10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0095_F03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0013_C12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0054_B04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0086_F01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0009_A01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0097_D05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0014_C11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0096_E08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0030_D06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0094_E05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0016_E11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0106_C07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0039_E10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0037_D04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0076_A12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0055_D12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0077_G01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0048_F09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGAGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0030_B07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0011_E09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0066_E02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0049_E05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0005_C09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0094_F09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0014_G05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0094_G09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0015_E08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0102_G08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0013_H08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0058_H02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0025_F02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0040_D10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0086_A09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0028_B06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0062_B12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0009_H05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0008_C10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0014_H01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAG**GCTG
LVR01_0022_B07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0033_F07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0045_D11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0002_G07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0044_F11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0028_D07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0079_D08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0082_E09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0084_B10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0022_E08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0033_E01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0040_B06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0041_D03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0088_F10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0095_F11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0030_E02.b : CAGCAGATCTGGAGGCCCGTGGCCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0034_C09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0004_G04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0017_D02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0067_F03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0057_G09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0058_E08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0053_C05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0041_F12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0106_G07.b : CAGCACATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0054_B06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0088_B03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0002_E01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0012_F08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0061_F10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0066_E10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0046_F04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0020_E01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0083_E06.b : CAGCAGATCTGGAGGCCCGTGGTCGAGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0087_B02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0010_E06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGTGGCTGTGCGGGAGGCGCTG
LVR01_0030_H03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0065_H01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0033_B03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0085_F06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0061_G12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0102_E11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0004_H04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCCGTGCGGGAGGCGCTG
LVR01_0025_A01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0026_C10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0104_H01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0019_G01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0057_D12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0060_D03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0054_H03.b : CATCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0094_C09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0096_H07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0096_E02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0045_G07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0092_F11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0049_B01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0013_G04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0082_G08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0048_G12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0044_D02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0046_B09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0050_B07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0078_F11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0097_B08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0020_F07.b : CAGCAGATCTGGAGGCCCGTG*TCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0098_H03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0083_C04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0001_G12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0068_E08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0045_H08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0046_B10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0053_B01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0083_A01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0034_B02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0003_B08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0034_F10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0043_A09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0046_E12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0097_F02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0037_A12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0021_D05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0029_A04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0010_A06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0073_F12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0044_C05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0058_E02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0084_E02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0058_H11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0088_A02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0101_F09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0092_H08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0074_A11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0074_G09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0030_H02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0010_C03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0034_B11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0079_A02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0072_E10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0060_H11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0018_A11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0097_B12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0014_D01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0044_E02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0061_F02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0082_G07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0012_D12.b : CAGCAGATCTGGAGGCCCGTAGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0092_H11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0068_A11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0084_C04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0046_E01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0013_H09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0055_B11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCCCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0066_H12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0034_G01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0016_G11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0016_G12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0092_D05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0001_E01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0021_B12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0071_G06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0008_B10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0105_F12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0072_F10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0010_H03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0092_B06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0012_G04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0098_A04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0003_B06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0062_F02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0060_B05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0063_A06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0103_E03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0061_D02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0050_G03.b : CAGCAGATCTGGAGGCCCGCGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0062_A09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0077_C08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0099_H02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0017_H03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0066_F06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0001_H02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0078_E06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0092_C02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0005_B02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0104_H12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0042_F12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0012_G01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0060_E10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0016_A01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0103_D03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0022_H11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0062_E01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0073_A03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0060_D11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0101_B03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0067_B09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0044_D10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0062_C01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0038_H03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0100_C03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0022_C02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0040_D02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0009_C09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0055_A08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0029_A03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0103_D05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0047_C11.b : CAGCATATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0051_D03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0081_G05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAAGCGCTG
KDN01_0053_C06.b : CAGTAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0038_D09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0060_D07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0089_A12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0040_F02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0056_D06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0089_H06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0022_C05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0023_B04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0077_C11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0038_D03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0089_D07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0027_B01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0002_E10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0083_H09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0004_E05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0004_C04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0020_G01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0045_E12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0045_D05.b : CAGCATATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0020_D06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0004_H05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0064_G07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0004_D12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0037_F04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0002_H04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0060_G08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0023_A09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0051_G03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0019_A04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0009_G06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0057_A03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0026_C09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0070_G01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0006_F03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0047_G11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0051_E11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0007_G09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0007_H11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0072_D07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0010_B07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0009_E11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0067_C06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0033_H08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0079_F05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0008_F06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0064_B07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0089_E09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0018_H01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0058_B11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0068_F07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0078_B11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0022_G02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0018_A10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0068_E08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0019_E03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0089_D05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0049_G10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0031_A10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0011_C05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0024_A01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0029_A02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0053_D04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0057_H10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0076_G08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0031_E06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0065_A07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0090_G09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0033_A07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0023_D04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0028_F03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0022_E07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0098_G02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0034_G04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0036_G08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0042_D11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0027_B04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0045_E11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0058_B03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0086_A04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0019_B01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0077_A04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0066_D01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0018_F02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0092_G02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0096_B02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0040_C06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0062_A05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0061_A09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0082_E06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0099_C09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0043_F05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGAGAGGCGCTG
KDN01_0093_H09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0071_A07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0075_B07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0080_B03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0095_H06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0072_A12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0024_F07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0071_B06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0034_C06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0016_H08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0076_B02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0066_A09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0088_E11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0038_C11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0044_H06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0036_H02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0092_F01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0016_D07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTTCGGGAGGCGCTG
KDN01_0029_A12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0024_A12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0034_E04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0098_C03.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0070_E10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0024_C12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0063_A07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0073_F11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0091_A09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0015_F11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0043_D04.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0079_G01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0086_G07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0078_B08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0061_E11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0082_A06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0078_A01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0079_F10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0045_E09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0038_C09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0086_G10.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0097_C11.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0062_A03.b : CAGCAGATCTGGGGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0066_A05.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0065_E08.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0051_H12.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0050_B09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
KDN01_0049_A07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVR01_0091_D09.b : CAGCAAATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0149_C07.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0152_D06.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0079_A01.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0200_E02.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0079_B10.b : CAGCAGATCTGGAGGCCCGTGGTCGCGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
LVRM1_0094_F09.b : CAGCAGATCTGGAGGCCCGTGGTCGTGCTCAATGGGCTGGCGGCTGTGCGGGAGGCGCTG
20110601C-006978 : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
---------+---------+---------+---------+---------+---------+ 421
LVR01_0048_E10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0189_F07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0036_H12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0035_C03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0040_F06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0099_F11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0207_H04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0040_H12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0021_E12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0053_B10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0019_G12.b : GTGTCCCACAGCCATGAAACCTC*CCACCGCCCACCTGTGTTCATCTTACAGC*ACCTGG
LVRM1_0204_E08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0187_B06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0051_B12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0149_H10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0143_H06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0122_B11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0025_D07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0039_B10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0038_F11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0042_F01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0099_F05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0043_H03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0043_G07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0177_C02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0109_C12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0038_D05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0019_B10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0094_G12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0015_A12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0054_D11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0104_F07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0067_H08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0041_A11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTANAGC*ACCTGG
LVR01_0035_D12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0174_F02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0093_F10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTATAGC*ACCTGG
LVRM1_0025_H03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0049_E05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCC*ACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0039_A12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCACCTTAGAGC*ACCTGG
LVRM1_0156_F04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0161_G01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0118_C08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0086_H12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0112_B01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGGGC*ACCTGG
LVRM1_0078_B06.b : GTGTCCCACAGCCATGAAACCTC*CCACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0078_G01.b : GTGTCCCACAGCCATGAAACCTC*CNACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0058_G08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0161_B09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0014_D07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTANAGC*ACCTGG
LVR01_0026_D05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0055_E11.b : GAGTCCCTCATCCATGAAACCTCGCGACCGCCCACCTGTGTCCATCTTATACCCACCTGG
LVR01_0052_F08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0105_C05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0019_D11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0062_G09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0097_E10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0104_D09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0094_C05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0002_A06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0031_F06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0071_G04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0089_B03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0037_C10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAAAGC*ACCTGG
LVR01_0030_H01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0068_A05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0055_H02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0208_C11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCCACTTAGAGC*ACCTGG
LVRM1_0088_G03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0196_A10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTACAGC*ACCTGG
LVRM1_0180_D03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0090_A09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0078_D09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0064_E12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0042_H09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0071_E03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0168_E10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAAAGC*ACCTGG
LVRM1_0179_B03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAAAGC*ACCTGG
LVRM1_0064_C04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0020_E12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*CCCTGG
LVRM1_0091_F06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0054_G02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0052_F03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0001_D09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0136_D03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0043_C11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0014_B12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTANAGC*ACCTGG
LVRM1_0072_A08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0192_E12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0081_D04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0107_G04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0125_C07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0076_C03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0139_B01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0094_H04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTANAGC*ACCTGG
LVRM1_0028_A03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTCAAAGC*ACCTGG
LVRM1_0179_B10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0207_E01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0003_C12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0123_C11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0197_D01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0197_C03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0025_E08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0104_H04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0195_E05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0177_D09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0164_F04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0173_H01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0198_E04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0025_G08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0207_A06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0101_D11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0179_B06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0039_F01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0091_F05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0195_C08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0115_D11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0038_F05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0037_C05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0039_E08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0057_A03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0128_F12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGA
LVRM1_0026_B07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0088_D02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0116_C02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0105_H04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0205_F12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0018_D11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0193_E10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0038_A10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0079_E01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0117_H06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0125_H03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0157_D01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0039_D05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0074_A09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0160_F04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0035_A03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0072_B12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0106_D05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0124_A12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0165_A12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0044_D10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0073_C05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0177_D12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0086_F12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0200_F07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0148_B08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0036_G08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0186_H11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0069_F04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0007_B06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0162_A08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0034_H05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0118_B11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0013_D06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0068_F12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0120_G07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0080_E07.b : ATGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0121_H03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0146_B01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0015_F10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0072_D09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0116_D10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0007_A12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCCGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0072_C08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0162_G11.b : GTGTCCCGCAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0157_G10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0036_G10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0103_E09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0108_D05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0144_G03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0019_H02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0030_A07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0058_C08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0030_G06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0057_A11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0114_G11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0031_C08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0107_B11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0138_G03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0080_C10.b : ATGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0035_D03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0110_G11.b : GTGTCCCACAGCCATGAAACCTC*CAACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0138_H06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0124_D10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0159_E11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0140_B07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0142_A11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0052_C10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0063_E06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0078_H11.b : GTGTCCCACAGCCATGAAACCTC*CNACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0010_B06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0113_E08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0002_F07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0062_B11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0060_A08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0040_F08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAAAGC*ACCTGG
LVR01_0018_F02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0055_B01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0038_G10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0030_G08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0037_G10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0088_D09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0084_E07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0093_G05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0094_G02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTATAGC*ACCTGG
LVR01_0037_A05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0015_E10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0106_G10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0095_G10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0095_F03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0013_C12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0054_B04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0086_F01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0009_A01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0097_D05.b : GTGTCCCACAGCCATGAAACCTC*CGACCACCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0014_C11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0096_E08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAAAGC*ACCTGG
LVR01_0030_D06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0094_E05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0016_E11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0106_C07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTACAGC*ACCTGG
LVR01_0039_E10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0037_D04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0076_A12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0055_D12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0077_G01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0048_F09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0030_B07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0011_E09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0066_E02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0049_E05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0005_C09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0094_F09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0014_G05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0094_G09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0015_E08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTANAGC*ACCTGG
LVR01_0102_G08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0013_H08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0058_H02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0025_F02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0040_D10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0086_A09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0028_B06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0062_B12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0009_H05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0008_C10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0014_H01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0022_B07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0033_F07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0045_D11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0002_G07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0044_F11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0028_D07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0079_D08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0082_E09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0084_B10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0022_E08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0033_E01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0040_B06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0041_D03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0088_F10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0095_F11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0030_E02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0034_C09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0004_G04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGGGTTCATCTTAGAGC*ACCTGG
LVR01_0017_D02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0067_F03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0057_G09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0058_E08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0053_C05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0041_F12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0106_G07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0054_B06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0088_B03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0002_E01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0012_F08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0061_F10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0066_E10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0046_F04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0020_E01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0083_E06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0087_B02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0010_E06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0030_H03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0065_H01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0033_B03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAAAGC*ACCTGG
LVR01_0085_F06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0061_G12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0102_E11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0004_H04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0025_A01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0026_C10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0104_H01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0019_G01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0057_D12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0060_D03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0054_H03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTATAGC*ACCTGG
LVR01_0094_C09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0096_H07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0096_E02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0045_G07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCAGG
LVR01_0092_F11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0049_B01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0013_G04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0082_G08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0048_G12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0044_D02.b : GTGTCCCACAGCCATGAAGCCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0046_B09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0050_B07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0078_F11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0097_B08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0020_F07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTTATCTTAGAGC*ACCTGG
LVR01_0098_H03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0083_C04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0001_G12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0068_E08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0045_H08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0046_B10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0053_B01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0083_A01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0034_B02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0003_B08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0034_F10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0043_A09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0046_E12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0097_F02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0037_A12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0021_D05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0029_A04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0010_A06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0073_F12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0044_C05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0058_E02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0084_E02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0058_H11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0088_A02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0101_F09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0092_H08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0074_A11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0074_G09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0030_H02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0010_C03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0034_B11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0079_A02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0072_E10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0060_H11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0018_A11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0097_B12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0014_D01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0044_E02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0061_F02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0082_G07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0012_D12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0092_H11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0068_A11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0084_C04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0046_E01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0013_H09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0055_B11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0066_H12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0034_G01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0016_G11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0016_G12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0092_D05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0001_E01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0021_B12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0071_G06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0008_B10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0105_F12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0072_F10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0010_H03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0092_B06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0012_G04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0098_A04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0003_B06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0062_F02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0060_B05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0063_A06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0103_E03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0061_D02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0050_G03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0062_A09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0077_C08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0099_H02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0017_H03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0066_F06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0001_H02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0078_E06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0092_C02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0005_B02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0104_H12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0042_F12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0012_G01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0060_E10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0016_A01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0103_D03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0022_H11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0062_E01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0073_A03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0060_D11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0101_B03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0067_B09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0044_D10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0062_C01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0038_H03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0100_C03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0022_C02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0040_D02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0009_C09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0055_A08.b : ATGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0029_A03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0103_D05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0047_C11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0051_D03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0081_G05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0053_C06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0038_D09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0060_D07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0089_A12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0040_F02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0056_D06.b : GTGTTCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0089_H06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0022_C05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0023_B04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0077_C11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0038_D03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0089_D07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0027_B01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0002_E10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0083_H09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0004_E05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0004_C04.b : GTGTCCCACAGCCACGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0020_G01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0045_E12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0045_D05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0020_D06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0004_H05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0064_G07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0004_D12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0037_F04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0002_H04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0060_G08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0023_A09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0051_G03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0019_A04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0009_G06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0057_A03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0026_C09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0070_G01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0006_F03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0047_G11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0051_E11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0007_G09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0007_H11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0072_D07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0010_B07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0009_E11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0067_C06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0033_H08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0079_F05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0008_F06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0064_B07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0089_E09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0018_H01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0058_B11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0068_F07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0078_B11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0022_G02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0018_A10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0068_E08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0019_E03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0089_D05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0049_G10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0031_A10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0011_C05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0024_A01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0029_A02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0053_D04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0057_H10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0076_G08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0031_E06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0065_A07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0090_G09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0033_A07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0023_D04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0028_F03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0022_E07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0098_G02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0034_G04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0036_G08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0042_D11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0027_B04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0045_E11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0058_B03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0086_A04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0019_B01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0077_A04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0066_D01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0018_F02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0092_G02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0096_B02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0040_C06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0062_A05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0061_A09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0082_E06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0099_C09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0043_F05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0093_H09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0071_A07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0075_B07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0080_B03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0095_H06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0072_A12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0024_F07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0071_B06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0034_C06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0016_H08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0076_B02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0066_A09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0088_E11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0038_C11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0044_H06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0036_H02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0092_F01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0016_D07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0029_A12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0024_A12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0034_E04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0098_C03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0070_E10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0024_C12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0063_A07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0073_F11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0091_A09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0015_F11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0043_D04.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0079_G01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0086_G07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0078_B08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0061_E11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGT*ACCTGG
KDN01_0082_A06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0078_A01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0079_F10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0045_E09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0038_C09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0086_G10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0097_C11.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0062_A03.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0066_A05.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0065_E08.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0051_H12.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0050_B09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
KDN01_0049_A07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVR01_0091_D09.b : GTGTCCCACAGCCAAGAAACCTC*CGACCGCCCACCTGAGTTCATCTTAGAGC*ACCTGG
LVRM1_0149_C07.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGGGC*ACCTGG
LVRM1_0152_D06.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0079_A01.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGGGC*ACCTGG
LVRM1_0200_E02.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGGGC*ACCTGG
LVRM1_0079_B10.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCCGTGTTCATCTTAGAGC*ACCTGG
LVRM1_0094_F09.b : GTGTCCCACAGCCATGAAACCTC*CGACCGCCCACCTGTGTTCATCTTAGAGC*ACCTGG
20110601C-006978 : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
---------+---------+---------+---------+---------+---------+ 479
LVR01_0048_E10.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVRM1_0189_F07.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVR01_0036_H12.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0035_C03.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0040_F06.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0099_F11.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVRM1_0207_H04.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVRM1_0040_H12.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVRM1_0021_E12.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
KDN01_0053_B10.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0019_G12.b : *GTTACGGGCCGCGCTCCGAACGAGTGATCCTGGCGCGCTACAGGA*AAGCGTGGCTCGA
LVRM1_0204_E08.b : *GTTACGGGCCGCGCTTCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVRM1_0187_B06.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVRM1_0051_B12.b : *GTTACGGGCCGCGCTCCGAAAGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVRM1_0149_H10.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVRM1_0143_H06.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVRM1_0122_B11.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVR01_0025_D07.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0039_B10.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0038_F11.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0042_F01.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0099_F05.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVRM1_0043_H03.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAACGTGGCTCGA
LVRM1_0043_G07.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVRM1_0177_C02.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVRM1_0109_C12.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVR01_0038_D05.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0019_B10.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0094_G12.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0015_A12.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0054_D11.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0104_F07.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0067_H08.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVRM1_0041_A11.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVR01_0035_D12.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVRM1_0174_F02.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVRM1_0093_F10.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVRM1_0025_H03.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVRM1_0049_E05.b : *GTTACTGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCACGA
LVRM1_0039_A12.b : *GTTACGGGCTGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVRM1_0156_F04.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVRM1_0161_G01.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVRM1_0118_C08.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVRM1_0086_H12.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVRM1_0112_B01.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVRM1_0078_B06.b : *GTTACGGGCCGCGCTCCGAAAGAGTGATCCTGGCGCGCTATGGAA*AAGCGTGACGCGA
LVRM1_0078_G01.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVRM1_0058_G08.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVRM1_0161_B09.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTATGGGA*AAGCGTGGCGCGA
LVR01_0014_D07.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0026_D05.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0055_E11.b : *GTTACGGGCTGCGCTCCGAAGGAGTGATCCTGGCGCGCTACAGTATAAGCGTGGCCCGA
LVR01_0052_F08.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0105_C05.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0019_D11.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0062_G09.b : *GTTGCGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0097_E10.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0104_D09.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0094_C05.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0002_A06.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0031_F06.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0071_G04.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0089_B03.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTACGGGA*AAGCGTGGCGCGA
LVR01_0037_C10.b : *GTTACGGGCCGCGCTCCGAAGGAGTGATCCTGGCGCGCTA