[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-006984

Length: 1,384

Sequence [FASTA format sequence]
TTGTTGGCCT ACTGGGAGAC TCACCTCATC AGGCCCTGCT GCAGTGGGAG CAGGGAGAGT
AGCAGTGGTA GGGGCAGCAT GCTGGCCAGG GGGCTTGCCC TCCGCTCAGT CCTGGTCAAA
GGCTGCCAGC CCTTCCTGAG TGCCCCTCGG GAGTGCCCAG GGCATCCCAG GGTGGGCACT
GGAGAGGGAG CATGCATCTC CACTAAAACC CCTCGCCCCT TCAGTGAGAT CCCCTCTCCT
GGTGACAATG GCTGGATTAA CCTGTACCGT TTCTGGAAGG AGAAGGGCAC ACAGAAAATC
CACTATCACC ATGTCCAGAA CTTCCAGAAG TATGGTCCCA TTTACAGGGA GAAGCTCGGC
AACTTGGAAT CTGTTTATAT CATCGACCCT GAAGATGTGG CCCTTCTCTT TAAGTTCGAA
GGACCCAACC CAGAACGATA CAACATCCCG CCCTGGGTTG CCTATCACCA GCATTACCAG
AAGCCTGTTG GGGTCCTGCT GAAGAAGTCA GGAGCCTGGA AGAAAGACCG GTTGGTCCTG
AACACGGAGG TAATGGCTCC AGAGGCCATA AAGAACTTCA TCCCCCTACT GGACACAGTG
TCTCAGGACT TCGTCGGCGT CCTGCACAGG CGCATCAAGC AGCAGGGTTC TGGAAAGTTC
TCAGGTGACA TCAGGGAAGA CCTGTTTCGC TTCGCCTTTG AGTCCATCAC CAATGTCATA
TTTGGAGAGC GCCTGGGGAT GCTGGAGGAA ATAGTGGACC CTGAGGCTCA GAAGTTCATT
GATGCTGTCT ACCAGATGTT CCACACTAGT GTCCCCATGC TCAATCTCCC CCCTGACCTG
TTCCGTCTGT TCAGGACCAA GACCTGGAGG GACCATGTAG CCGCATGGGA CACTATTTTC
AATAAAGCTG AAAATATACC CCCAGAACTT CTACTGGGAC CTGAGACGGA AAAGAGAATT
TAACAATTAC CCAGGCATCC TCTACCGCCT CCTGGGAAAT GACAAGCTGC TCTCAGAAGA
TGTTAAGGCC AATGTTACCG AGATGCTGGC AGGGGGTGTA GACACGACAT CCATGACTCT
GCAATGGCAC TTGTATGAGA TGGCACGTAG CCTGAATGTG CAGGAGATGC TGCGGGAGGA
GGTCCTCCAT GCCCGGCGCC AGGCCCATGG GGAACACAGC AAGATGCTGN CATTGGTCCC
ACTCCTCAAG CTAGCATTAA AGAGACACTG AGACTCCACC CATCTCCGTG ACCCTGCAGA
GGTACCTCGT GAATGACTTG GGGTCTCGAG ATACATGATT CCTGCCAAGA CATTGGTACA
AGTGGCCGTC TATGCCATGG GCCGAGAACC CGCCTTCTTC TCAAATCAGG NCCAGTTTGA
CCCA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCYP11A1cholesterol side-chain cleavage enzyme, mitochondrial isoform a precursor [Homo sapiens]. 483e-178O
Contig/Assembly ProteinCYP11A1cholesterol side-chain cleavage enzyme, mitochondrial isoform b [Homo sapiens]. 2142e-97O
Contig/Assembly ProteinCYP11B2cytochrome P450 11B2, mitochondrial precursor [Homo sapiens]. 1743e-57O
Contig/Assembly ProteinCYP11B1cytochrome P450 11B1, mitochondrial isoform 1 precursor [Homo sapiens]. 1749e-58O
Contig/Assembly ProteinCYP11B1cytochrome P450 11B1, mitochondrial isoform 2 precursor [Homo sapiens]. 1748e-54O
Contig/Assembly ProteinCYP24A11,25-dihydroxyvitamin D(3) 24-hydroxylase, mitochondrial isoform 1 precursor [Homo sapiens]. 1254e-34O
Contig/Assembly ProteinCYP24A11,25-dihydroxyvitamin D(3) 24-hydroxylase, mitochondrial isoform 2 precursor [Homo sapiens]. 1254e-34O
Contig/Assembly ProteinCYP27B125-hydroxyvitamin D-1 alpha hydroxylase, mitochondrial [Homo sapiens]. 1042e-34O
Contig/Assembly ProteinCYP27C1cytochrome P450 27C1 [Homo sapiens]. 53.15e-17O
Contig/Assembly ProteinCYP27A1sterol 26-hydroxylase, mitochondrial precursor [Homo sapiens]. 50.47e-07O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCyp11a1cholesterol side-chain cleavage enzyme, mitochondrial precursor [Mus musculus]. 446e-167O
Contig/Assembly ProteinCyp11b2cytochrome P450 11B2, mitochondrial [Mus musculus]. 1757e-44O
Contig/Assembly ProteinCyp11b1cytochrome P450, family 11, subfamily b, polypeptide 1 [Mus musculus]. 1688e-51O
Contig/Assembly ProteinCyp24a11,25-dihydroxyvitamin D(3) 24-hydroxylase, mitochondrial precursor [Mus musculus]. 1295e-36O
Contig/Assembly ProteinCyp27b125-hydroxyvitamin D-1 alpha hydroxylase, mitochondrial [Mus musculus]. 1083e-36O
Contig/Assembly ProteinCyp27a1sterol 26-hydroxylase, mitochondrial [Mus musculus]. 50.83e-07O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC478365PREDICTED: similar to Cytochrome P450 11A1, mitochondrial precursor (CYPXIA1) (P450(scc)) (Cholesterol side-chain cleavage enzyme) (Cholesterol desmolase) [Canis familiaris]. 5000.0O
Contig/Assembly ProteinLOC482071PREDICTED: similar to Cytochrome P450 11B2, mitochondrial precursor (CYPXIB2) (P-450Aldo) (Aldosterone synthase) (ALDOS) (Aldosterone-synthesizing enzyme) (Steroid 18-hydroxylase) (P-450C18) [Canis familiaris]. 1665e-41
Contig/Assembly ProteinLOC485935PREDICTED: similar to Cytochrome P450 24A1, mitochondrial precursor (P450-CC24) (Vitamin D(3) 24-hydroxylase) (1,25-dihydroxyvitamin D(3) 24-hydroxylase) (24-OHase) [Canis familiaris]. 1218e-33O
Contig/Assembly ProteinLOC481133PREDICTED: similar to 25-hydroxyvitamin D-1 alpha hydroxylase, mitochondrial precursor (Calcidiol 1-monooxygenase) (25-OHD-1 alpha-hydroxylase) (25-hydroxyvitamin D(3) 1-alpha-hydroxylase) (VD3 1A hydroxylase) (P450C1 alpha) (P450VD1-alpha) [Canis familiaris]. 1132e-37O
Contig/Assembly ProteinLOC610489PREDICTED: similar to Cytochrome P450 27, mitochondrial precursor (Cytochrome P-450C27/25) (Sterol 26-hydroxylase) (Sterol 27-hydroxylase) (Vitamin D(3) 25-hydroxylase) (5-beta-cholestane-3-alpha,7-alpha,12-alpha-triol 27-hydroxylase) [Canis familiaris]. 86.32e-25O
Contig/Assembly ProteinLOC483869PREDICTED: similar to cytochrome P450, family 27, subfamily b, polypeptide 1 [Canis familiaris]. 84.37e-27O
Contig/Assembly ProteinLOC608494PREDICTED: similar to cytochrome P450, subfamily XIB polypeptide 2 precursor, partial [Canis familiaris]. 60.83e-09
Contig/Assembly ProteinLOC609093PREDICTED: similar to cytochrome P450, family 11, subfamily B, polypeptide 1 isoform 1 precursor [Canis familiaris]. 58.51e-08


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCYP11A1cholesterol side-chain cleavage enzyme, mitochondrial precursor [Bos taurus]. 4840.0O
Contig/Assembly ProteinCYP11B2cytochrome P450 11B1, mitochondrial precursor [Bos taurus]. 1703e-55O
Contig/Assembly ProteinLOC540080PREDICTED: cytochrome P450, family 24, subfamily A, polypeptide 1-like isoform 2 [Bos taurus]. 1249e-34O
Contig/Assembly ProteinLOC540080PREDICTED: cytochrome P450, family 24, subfamily A, polypeptide 1-like isoform 1 [Bos taurus]. 1249e-34O
Contig/Assembly ProteinLOC540080PREDICTED: cytochrome P450, family 24, subfamily A, polypeptide 1-like isoform 2 [Bos taurus]. 1232e-33O
Contig/Assembly ProteinCYP24A11,25-dihydroxyvitamin D(3) 24-hydroxylase, mitochondrial [Bos taurus]. 1232e-33O
Contig/Assembly ProteinCYP27B1PREDICTED: cytochrome P450, family 27, subfamily B, polypeptide 1 [Bos taurus]. 1174e-37O
Contig/Assembly ProteinCYP27B125-hydroxyvitamin D-1 alpha hydroxylase, mitochondrial [Bos taurus]. 1174e-37O
Contig/Assembly ProteinLOC617338PREDICTED: FLJ16008 protein-like [Bos taurus]. 92.42e-29O
Contig/Assembly ProteinLOC617338PREDICTED: FLJ16008 protein-like [Bos taurus]. 92.42e-29O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCYP11A1cholesterol side-chain cleavage enzyme, mitochondrial precursor [Sus scrofa]. 5820.0O
Contig/Assembly ProteinCYP24A11,25-dihydroxyvitamin D(3) 24-hydroxylase, mitochondrial [Sus scrofa]. 1174e-33O
Contig/Assembly ProteinCYP27B125-hydroxyvitamin D-1 alpha hydroxylase, mitochondrial [Sus scrofa]. 1143e-37O
Contig/Assembly ProteinCYP27A1sterol 26-hydroxylase, mitochondrial precursor [Sus scrofa]. 78.61e-23O


Assembly Members: 526      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010002B08ADR01_0002_B08.bDB781671 
ADR010002H05ADR01_0002_H05.bDB781732 
ADR010007G11ADR01_0007_G11.bDB782176 
ADR010008E04ADR01_0008_E04.bDB782238 
ADR010011H08ADR01_0011_H08.bDB782544 
ADR010012H04ADR01_0012_H04.bDB782631 
ADR010013F03ADR01_0013_F03.bDB782699 
ADR010014D04ADR01_0014_D04.bDB782767 
ADR010015F03ADR01_0015_F03.bDB782868 
ADR010015F09ADR01_0015_F09.bDB782871 
ADR010016E06ADR01_0016_E06.bDB782936 
ADR010017D03ADR01_0017_D03.b  
ADR010020B08ADR01_0020_B08.bDB783227 
ADR010023D01ADR01_0023_D01.bDB783511 
ADR010025B07ADR01_0025_B07.bDB783676 
ADR010026C02ADR01_0026_C02.bDB783770 
ADR010028A03ADR01_0028_A03.bDB783923 
ADR010029F09ADR01_0029_F09.bDB784075 
ADR010033E01ADR01_0033_E01.bDB784427 
ADR010033H12ADR01_0033_H12.bDB784470 
ADR010034A11ADR01_0034_A11.bDB784481 
ADR010037A02ADR01_0037_A02.bDB784734 
ADR010038F09ADR01_0038_F09.bDB784891 
ADR010040E04ADR01_0040_E04.bDB785057 
ADR010040F06ADR01_0040_F06.bDB785069 
ADR010044A05ADR01_0044_A05.bDB785370 
ADR010046F08ADR01_0046_F08.bDB785609 
ADR010047F02ADR01_0047_F02.bDB785694 
ADR010048C05ADR01_0048_C05.bDB785754 
ADR010048C11ADR01_0048_C11.bDB785760 
ADR010054D10ADR01_0054_D10.bDB786309 
ADR010055H06ADR01_0055_H06.bDB786437 
ADR010055H09ADR01_0055_H09.bDB786440 
ADR010056B06ADR01_0056_B06.bDB786459 
ADR010056E05ADR01_0056_E05.bDB786490 
ADR010056H11ADR01_0056_H11.bDB786530 
ADR010057A05ADR01_0057_A05.b  
ADR010057H08ADR01_0057_H08.bDB786616 
ADR010059B08ADR01_0059_B08.bDB786730 
ADR010060C04ADR01_0060_C04.bDB786833 
ADR010064A10ADR01_0064_A10.bDB787172 
ADR010066F07ADR01_0066_F07.bDB787389 
ADR010068E08ADR01_0068_E08.bDB787555 
ADR010068E12ADR01_0068_E12.bDB787559 
ADR010068G03ADR01_0068_G03.bDB787573 
ADR010068G09ADR01_0068_G09.bDB787579 
ADR010069E06ADR01_0069_E06.bDB787640 
ADR010073A09ADR01_0073_A09.bDB787948 
ADR010076H12ADR01_0076_H12.bDB788299 
ADR010077G06ADR01_0077_G06.bDB788376 
ADR010077G11ADR01_0077_G11.bDB788381 
ADR010078D02ADR01_0078_D02.bDB788431 
ADR010083D11ADR01_0083_D11.bDB788881 
ADR010084F09ADR01_0084_F09.bDB788989 
ADR010085H02ADR01_0085_H02.bDB789089 
ADR010086C09ADR01_0086_C09.bDB789126 
ADR010089G03ADR01_0089_G03.bDB789429 
ADR010089G09ADR01_0089_G09.bDB789435 
ADR010093A06ADR01_0093_A06.bDB789724 
ADR010093F01ADR01_0093_F01.bDB789779 
ADR010093G08ADR01_0093_G08.bDB789796 
ADR010094H08ADR01_0094_H08.bDB789895 
ADR010095A11ADR01_0095_A11.bDB789909 
ADR010098F04ADR01_0098_F04.bDB790220 
ADR010099A01ADR01_0099_A01.bDB790252 
ADR010100A06ADR01_0100_A06.bDB790347 
ADR010100B08ADR01_0100_B08.bDB790360 
ADR010100G01ADR01_0100_G01.bDB790412 
ADR010101E12ADR01_0101_E12.bDB790490 
OVR010005C04OVR01_0005_C04.bBP142247 
OVR010007A11OVR01_0007_A11.bBP141624 
OVR010017F06OVR01_0017_F06.bBP143682 
OVR010066B08OVR01_0066_B08.bBW965473 
OVRM10003H12OVRM1_0003_H12.bBP154884 
OVRM10004E03OVRM1_0004_E03.bBP458610 
OVRM10005A11OVRM1_0005_A11.bBP455397 
OVRM10005D02OVRM1_0005_D02.bBP457567 
OVRM10006F01OVRM1_0006_F01.bBP151143 
OVRM10008A11OVRM1_0008_A11.bBP145914 
OVRM10008C10OVRM1_0008_C10.bBP148321 
OVRM10011C11OVRM1_0011_C11.bBP148434 
OVRM10012B06OVRM1_0012_B06.bBP146660 
OVRM10012F10OVRM1_0012_F10.bBP152073 
OVRM10013A03OVRM1_0013_A03.bBP145050 
OVRM10014A04OVRM1_0014_A04.bBP145158 
OVRM10015A08OVRM1_0015_A08.bBP145591 
OVRM10016H03OVRM1_0016_H03.bBP153891 
OVRM10016H07OVRM1_0016_H07.bBP154338 
OVRM10017E08OVRM1_0017_E08.bBP150615 
OVRM10018C04OVRM1_0018_C04.bBP456764 
OVRM10018E05OVRM1_0018_E05.bBP458779 
OVRM10021F03OVRM1_0021_F03.bBP151351 
OVRM10022A04OVRM1_0022_A04.bBP145163 
OVRM10024F02OVRM1_0024_F02.bBP459485 
OVRM10025B07OVRM1_0025_B07.bBP146774 
OVRM10025G06OVRM1_0025_G06.bBP152901 
OVRM10025H03OVRM1_0025_H03.bBP153896 
OVRM10026H12OVRM1_0026_H12.bBP154900 
OVRM10027B10OVRM1_0027_B10.bBP147099 
OVRM10028F10OVRM1_0028_F10.bBP152084 
OVRM10030B11OVRM1_0030_B11.bBP147213 
OVRM10030F08OVRM1_0030_F08.bBP151872 
OVRM10033H11OVRM1_0033_H11.bBP154791 
OVRM10034A08OVRM1_0034_A08.bBP145602 
OVRM10035B03OVRM1_0035_B03.bBP146360 
OVRM10037B05OVRM1_0037_B05.bBP455884 
OVRM10037D05OVRM1_0037_D05.bBP457808 
OVRM10038G01OVRM1_0038_G01.bBP460407 
OVRM10038G03OVRM1_0038_G03.bBP460571 
OVRM10038H04OVRM1_0038_H04.bBP461608 
OVRM10039D09OVRM1_0039_D09.bBP458133 
OVRM10039E10OVRM1_0039_E10.bBP459175 
OVRM10041C12OVRM1_0041_C12.bBP457413 
OVRM10041F06OVRM1_0041_F06.bBP459829 
OVRM10041G01OVRM1_0041_G01.bBP460410 AK235016
OVRM10042A09OVRM1_0042_A09.bBP455270 
OVRM10043C09OVRM1_0043_C09.bBP457176 
OVRM10043E11OVRM1_0043_E11.bBP459250 
OVRM10044E06OVRM1_0044_E06.bBP458862 
OVRM10046B09OVRM1_0046_B09.bBP147000 
OVRM10047H02OVRM1_0047_H02.bBP153797 
OVRM10048D11OVRM1_0048_D11.bBP458302 
OVRM10049C12OVRM1_0049_C12.bBP148571 
OVRM10051C05OVRM1_0051_C05.bBP147814 
OVRM10052B01OVRM1_0052_B01.bBP146157 
OVRM10052C11OVRM1_0052_C11.bBP148458 
OVRM10053A09OVRM1_0053_A09.bBP145715 
OVRM10053B09OVRM1_0053_B09.bBP147005 
OVRM10053B10OVRM1_0053_B10.bBP147114 
OVRM10054D10OVRM1_0054_D10.bBP149626 
OVRM10055D12OVRM1_0055_D12.bBP149848 
OVRM10056B09OVRM1_0056_B09.bBP147008 
OVRM10056D09OVRM1_0056_D09.bBP149516 
OVRM10057F04OVRM1_0057_F04.bBP151475 
OVRM10058E02OVRM1_0058_E02.bBP150034 
OVRM10058E11OVRM1_0058_E11.bBP150961 
OVRM10058G06OVRM1_0058_G06.bBP152920 
OVRM10059A02OVRM1_0059_A02.bBP144969 
OVRM10060C07OVRM1_0060_C07.bBP148033 
OVRM10060C10OVRM1_0060_C10.bBP148356 
OVRM10062H01OVRM1_0062_H01.bBP153707 
OVRM10063C02OVRM1_0063_C02.bBP147523 
OVRM10063C06OVRM1_0063_C06.bBP147936 
OVRM10064C05OVRM1_0064_C05.bBP147826 
OVRM10064E06OVRM1_0064_E06.bBP150439 
OVRM10065E04OVRM1_0065_E04.bBP150245 
OVRM10065F04OVRM1_0065_F04.bBP151482 
OVRM10067E11OVRM1_0067_E11.bBP150969 
OVRM10068H06OVRM1_0068_H06.bBP154258 
OVRM10070E09OVRM1_0070_E09.bBP150749 
OVRM10071A08OVRM1_0071_A08.bBP145626 
OVRM10073C06OVRM1_0073_C06.bBP147944 
OVRM10074D06OVRM1_0074_D06.bBP149213 
OVRM10074F05OVRM1_0074_F05.bBP151600 
OVRM10076E10OVRM1_0076_E10.bBP150862 
OVRM10078B12OVRM1_0078_B12.bBP147355 
OVRM10081A02OVRM1_0081_A02.bBP144989 
OVRM10081E07OVRM1_0081_E07.bBP150556 
OVRM10083A06OVRM1_0083_A06.bBP145419 
OVRM10083B02OVRM1_0083_B02.b  
OVRM10084C05OVRM1_0084_C05.bBP147845 
OVRM10084D08OVRM1_0084_D08.bBP149432 
OVRM10085F01OVRM1_0085_F01.bBP151192 
OVRM10086G06OVRM1_0086_G06.bBP152946 
OVRM10087A04OVRM1_0087_A04.bBP145209 
OVRM10089H07OVRM1_0089_H07.bBP154394 
OVRM10090H03OVRM1_0090_H03.bBP153947 
OVRM10092C11OVRM1_0092_C11.bBP148498 
OVRM10093A08OVRM1_0093_A08.bBP145644 
OVRM10094E08OVRM1_0094_E08.bBP150669 
OVRM10095B08OVRM1_0095_B08.bBP146934 
OVRM10096B07OVRM1_0096_B07.bBP146829 
OVRM10096G04OVRM1_0096_G04.bBP152739 
OVRM10099C02OVRM1_0099_C02.bBP147551 
OVRM10099D12OVRM1_0099_D12.bBP149888 
OVRM10100A02OVRM1_0100_A02.bBP145006 
OVRM10100H04OVRM1_0100_H04.bBP154067 
OVRM10101C12OVRM1_0101_C12.bBP148618 
OVRM10101F02OVRM1_0101_F02.bBP151308 
OVRM10101H04OVRM1_0101_H04.bBP154068 
OVRM10102A05OVRM1_0102_A05.bBP145329 
OVRM10102E10OVRM1_0102_E10.bBP150887 
OVRM10102G02OVRM1_0102_G02.bBP152533 
OVRM10104B11OVRM1_0104_B11.bBP147268 
OVRM10104F02OVRM1_0104_F02.bBP151311 
OVRM10107G11OVRM1_0107_G11.bBP153524 
OVRM10108D03OVRM1_0108_D03.bBP148933 
OVRM10110A04OVRM1_0110_A04.bBP145229 
OVRM10110A12OVRM1_0110_A12.bBP146108 
OVRM10110F10OVRM1_0110_F10.bBP152147 
OVRM10111B09OVRM1_0111_B09.bBP147055 
OVRM10113C01OVRM1_0113_C01.bBP147476 
OVRM10115C06OVRM1_0115_C06.bBP147982 
OVRM10115D01OVRM1_0115_D01.bBP148729 
OVRM10115H09OVRM1_0115_H09.bBP154637 
OVRM10116C01OVRM1_0116_C01.bBP147478 
OVRM10116H07OVRM1_0116_H07.bBP154420 
OVRM10118B11OVRM1_0118_B11.bBP147281 
OVRM10119H06OVRM1_0119_H06.bBP154307 
OVRM10121A12OVRM1_0121_A12.bBP146117 
OVRM10122B03OVRM1_0122_B03.bBP146430 
OVRM10122E08OVRM1_0122_E08.bBP150695 
OVRM10123A09OVRM1_0123_A09.bBP145784 
OVRM10125D11OVRM1_0125_D11.bBP149804 
OVRM10125E11OVRM1_0125_E11.bBP151025 
OVRM10126A12OVRM1_0126_A12.bBP146122 
OVRM10126H10OVRM1_0126_H10.bBP154760 
OVRM10128B11OVRM1_0128_B11.bBP147291 
OVRM10128H12OVRM1_0128_H12.bBP154986 
OVRM10129D09OVRM1_0129_D09.bBP149587 
OVRM10129E03OVRM1_0129_E03.bBP150205 
OVRM10130C02OVRM1_0130_C02.bBP147579 
OVRM10130F10OVRM1_0130_F10.bBP152166 
OVRM10131B12OVRM1_0131_B12.bBP147402 AK395233
OVRM10134B04OVRM1_0134_B04.bBP146550 
OVRM10134H10OVRM1_0134_H10.bBP154767 
OVRM10138G02OVRM1_0138_G02.bBP152565 
OVRM10147C12OVRM1_0147_C12.bBP457419 
OVRM10147H09OVRM1_0147_H09.bBP461994 
OVRM10148H06OVRM1_0148_H06.bBP461758 
OVRM10149H05OVRM1_0149_H05.bBP461686 
OVRM10150E06OVRM1_0150_E06.bBP458868 
OVRM10151A08OVRM1_0151_A08.bBP455205 
OVRM10151D09OVRM1_0151_D09.bBP458144 
OVRM10151H10OVRM1_0151_H10.bBP462082 
OVRM10152C04OVRM1_0152_C04.bBP456779 
OVRM10152H08OVRM1_0152_H08.bBP461918 
OVRM10153G05OVRM1_0153_G05.bBP460746 
OVRM10153H10OVRM1_0153_H10.bBP462084 
OVRM10154E11OVRM1_0154_E11.bBP459259 
OVRM10154G07OVRM1_0154_G07.bBP460916 
OVRM10155C08OVRM1_0155_C08.bBP457111 
OVRM10155D02OVRM1_0155_D02.bBP457587 
OVRM10155D09OVRM1_0155_D09.bBP458147 
OVRM10155E05OVRM1_0155_E05.bBP458798 
OVRM10157F04OVRM1_0157_F04.bBP459668 
OVRM10160H07OVRM1_0160_H07.bBP461844 
OVRM10161C10OVRM1_0161_C10.bBP457268 
OVRM10161D01OVRM1_0161_D01.bBP457510 
OVRM10163B07OVRM1_0163_B07.bBP456081 
OVRM10165B02OVRM1_0165_B02.bBP455662 
OVRM10166B04OVRM1_0166_B04.bBP455827 
OVRM10166E12OVRM1_0166_E12.bBP459348 
OVRM10166H03OVRM1_0166_H03.bBP461556 
OVRM10167C04OVRM1_0167_C04.bBP456791 
OVRM10167G07OVRM1_0167_G07.bBP460920 
OVRM10168E06OVRM1_0168_E06.bBP458882 
OVRM10168E07OVRM1_0168_E07.bBP458962 
OVRM10169D04OVRM1_0169_D04.bBP457752 
OVRM10169E04OVRM1_0169_E04.bBP458727 
OVRM10170D10OVRM1_0170_D10.bBP458240 
OVRM10174H12OVRM1_0174_H12.bBP462256 
OVRM10179C09OVRM1_0179_C09.bCJ016141 
OVRM10182B11OVRM1_0182_B11.bBP456415 
OVRM10182F08OVRM1_0182_F08.bBP460023 
OVRM10184H12OVRM1_0184_H12.bBP462261 
OVRM10185D06OVRM1_0185_D06.bBP457926 
OVRM10188F10OVRM1_0188_F10.bBP460204 
OVRM10188H04OVRM1_0188_H04.bBP461636 
OVRM10189D06OVRM1_0189_D06.bBP457929 
OVRM10192B02OVRM1_0192_B02.bBP455683 
OVRM10193G04OVRM1_0193_G04.bBP460694 
OVRM10195D02OVRM1_0195_D02.bBP457616 
OVRM10197B04OVRM1_0197_B04.bBP455850 
OVRM10197F04OVRM1_0197_F04.bBP459703 
OVRM10197F12OVRM1_0197_F12.bBP460371 
OVRM10199C09OVRM1_0199_C09.bBP457219 
OVRM10200F01OVRM1_0200_F01.bBP459457 
OVRM10201D04OVRM1_0201_D04.bBP457778 
OVRM10201F06OVRM1_0201_F06.bBP459870 
OVRM10201H02OVRM1_0201_H02.bBP461499 
OVRM10202D12OVRM1_0202_D12.bBP458427 
OVRM10202G08OVRM1_0202_G08.bBP461017 
OVRM10203G04OVRM1_0203_G04.bBP460704 
OVRM10204E08OVRM1_0204_E08.bBP459073 
OVRM10204F10OVRM1_0204_F10.bBP460219 
OVRM10204G10OVRM1_0204_G10.bBP461186 
OVRM10205D04OVRM1_0205_D04.bBP457782 
OVRM10206C01OVRM1_0206_C01.bBP456585 
OVRM10206G08OVRM1_0206_G08.bBP461020 
OVRM10209A07OVRM1_0209_A07.bBP455172 
OVRM10209A08OVRM1_0209_A08.bBP455244 
OVRM10209G04OVRM1_0209_G04.bBP460709 AK395366
OVRM10210G10OVRM1_0210_G10.bBP461192 
OVRM10211H03OVRM1_0211_H03.bBP461592 
OVRM10213B06OVRM1_0213_B06.bBP456036 
OVRM10213C10OVRM1_0213_C10.bBP457310 
OVRM10214B01OVRM1_0214_B01.bBP455619 
OVRM10216G12OVRM1_0216_G12.bBP461353 
OVRM10218B03OVRM1_0218_B03.bBP455787 
OVRM10219C06OVRM1_0219_C06.b  
OVRM10220B01OVRM1_0220_B01.bBP455624 
OVRM10221H02OVRM1_0221_H02.bBP461518 
OVRM10222F02OVRM1_0222_F02.bBP459561 
OVRM10223D04OVRM1_0223_D04.bBP457799 
OVRM10225F12OVRM1_0225_F12.bBP460398 
OVRT10002C06OVRT1_0002_C06.bFS686521 
OVRT10002F02OVRT1_0002_F02.bFS686551 
OVRT10003A11OVRT1_0003_A11.bFS686593 
OVRT10003D12OVRT1_0003_D12.bFS686621 
OVRT10006B03OVRT1_0006_B03.bFS686844 
OVRT10009H05OVRT1_0009_H05.bFS687163 
OVRT10010H09OVRT1_0010_H09.bFS687245 
OVRT10011A03OVRT1_0011_A03.bFS687250 
OVRT10011B12OVRT1_0011_B12.bFS687269 
OVRT10011C01OVRT1_0011_C01.b  
OVRT10011D12OVRT1_0011_D12.bFS687288 
OVRT10011G03OVRT1_0011_G03.bFS687313 
OVRT10011H12OVRT1_0011_H12.bFS687332 
OVRT10012A03OVRT1_0012_A03.bFS687335 
OVRT10012D11OVRT1_0012_D11.bFS687375 
OVRT10012E10OVRT1_0012_E10.bFS687385 
OVRT10013A10OVRT1_0013_A10.bFS687428 
OVRT10014D12OVRT1_0014_D12.bFS687542 
OVRT10014H02OVRT1_0014_H02.bFS687577 
OVRT10016G11OVRT1_0016_G11.bFS687746 
OVRT10017H10OVRT1_0017_H10.bFS687830 
OVRT10020C05OVRT1_0020_C05.bFS688019 
OVRT10022H05OVRT1_0022_H05.bFS688235 
OVRT10024E02OVRT1_0024_E02.bFS688372 
OVRT10024G05OVRT1_0024_G05.bFS688397 
OVRT10025A01OVRT1_0025_A01.bFS688413 
OVRT10026A10OVRT1_0026_A10.bFS688507 
OVRT10026C01OVRT1_0026_C01.bFS688518 
OVRT10027D01OVRT1_0027_D01.bFS688613 
OVRT10030G12OVRT1_0030_G12.bFS688866 
OVRT10031C09OVRT1_0031_C09.bFS688906 
OVRT10031D02OVRT1_0031_D02.bFS688910 
OVRT10034A01OVRT1_0034_A01.bFS689124 
OVRT10035A04OVRT1_0035_A04.bFS689209 
OVRT10035D04OVRT1_0035_D04.bFS689241 
OVRT10036D04OVRT1_0036_D04.bFS689331 
OVRT10039C02OVRT1_0039_C02.bFS689565 
OVRT10039F01OVRT1_0039_F01.bFS689598 
OVRT10041A12OVRT1_0041_A12.bFS689719 
OVRT10041E06OVRT1_0041_E06.bFS689757 
OVRT10042C08OVRT1_0042_C08.bFS689819 
OVRT10042E07OVRT1_0042_E07.bFS689840 
OVRT10044A11OVRT1_0044_A11.bFS689967 
OVRT10044D01OVRT1_0044_D01.bFS689990 
OVRT10044F07OVRT1_0044_F07.bFS690015 
OVRT10045D08OVRT1_0045_D08.bFS690072 
OVRT10045H07OVRT1_0045_H07.bFS690107 
OVRT10046C01OVRT1_0046_C01.b  
OVRT10047C08OVRT1_0047_C08.bFS690224 
OVRT10049D06OVRT1_0049_D06.bFS690405 
OVRT10050B01OVRT1_0050_B01.bFS690464 
OVRT10050B08OVRT1_0050_B08.bFS690471 
OVRT10050D04OVRT1_0050_D04.bFS690487 
OVRT10050E07OVRT1_0050_E07.bFS690498 
OVRT10050F11OVRT1_0050_F11.bFS690513 
OVRT10051C07OVRT1_0051_C07.bFS690563 
OVRT10051G05OVRT1_0051_G05.bFS690603 
OVRT10052B08OVRT1_0052_B08.bFS690633 
OVRT10052E08OVRT1_0052_E08.bFS690665 
OVRT10053D04OVRT1_0053_D04.bFS690728 
OVRT10056E03OVRT1_0056_E03.bFS690980 
OVRT10057H12OVRT1_0057_H12.bFS691101 
OVRT10058D10OVRT1_0058_D10.bFS691143 
OVRT10061C11OVRT1_0061_C11.bFS691385 
OVRT10062B06OVRT1_0062_B06.bFS691450 
OVRT10063D01OVRT1_0063_D01.bFS691545 
OVRT10065C01OVRT1_0065_C01.bFS691706 
OVRT10065C04OVRT1_0065_C04.bFS691709 
OVRT10065G10OVRT1_0065_G10.bFS691760 
OVRT10068D10OVRT1_0068_D10.bFS691972 
OVRT10069A03OVRT1_0069_A03.bFS692019 
OVRT10069A05OVRT1_0069_A05.bFS692020 
OVRT10069G06OVRT1_0069_G06.bFS692082 
OVRT10071A02OVRT1_0071_A02.bFS692179 
OVRT10073C11OVRT1_0073_C11.bFS692343 
OVRT10073H01OVRT1_0073_H01.bFS692385 
OVRT10074A07OVRT1_0074_A07.bFS692400 
OVRT10074B07OVRT1_0074_B07.bFS692412 
OVRT10075D07OVRT1_0075_D07.bFS692520 
OVRT10076F07OVRT1_0076_F07.bFS692618 
OVRT10076G04OVRT1_0076_G04.bFS692627 
OVRT10076G06OVRT1_0076_G06.bFS692628 
OVRT10077A05OVRT1_0077_A05.bFS692645 
OVRT10077F08OVRT1_0077_F08.bFS692699 
OVRT10077H01OVRT1_0077_H01.bFS692715 
OVRT10077H08OVRT1_0077_H08.bFS692721 
OVRT10078A09OVRT1_0078_A09.bFS692731 
OVRT10079D12OVRT1_0079_D12.bFS692852 
OVRT10080D08OVRT1_0080_D08.bFS692925 
OVRT10081D11OVRT1_0081_D11.bFS693010 
OVRT10082F05OVRT1_0082_F05.bFS693104 
OVRT10083A05OVRT1_0083_A05.bFS693134 
OVRT10083G05OVRT1_0083_G05.bFS693195 
OVRT10083G08OVRT1_0083_G08.bFS693198 
OVRT10084E08OVRT1_0084_E08.bFS693257 
OVRT10084F12OVRT1_0084_F12.bFS693271 
OVRT10088E10OVRT1_0088_E10.bFS693586 
OVRT10089B04OVRT1_0089_B04.bFS693632 
OVRT10089C09OVRT1_0089_C09.bFS693646 
OVRT10090D02OVRT1_0090_D02.bFS693734 
OVRT10090H04OVRT1_0090_H04.bFS693774 
OVRT10090H12OVRT1_0090_H12.bFS693782 
OVRT10091A02OVRT1_0091_A02.bFS693784 
OVRT10091B08OVRT1_0091_B08.bFS693799 
OVRT10091C05OVRT1_0091_C05.bFS693806 
OVRT10092A02OVRT1_0092_A02.b  
OVRT10092A10OVRT1_0092_A10.bFS693870 
OVRT10092H04OVRT1_0092_H04.bFS693936 
OVRT10093A09OVRT1_0093_A09.bFS693953 
OVRT10093C11OVRT1_0093_C11.bFS693976 
OVRT10094C07OVRT1_0094_C07.bFS694056 
OVRT10094C10OVRT1_0094_C10.bFS694059 
OVRT10096A11OVRT1_0096_A11.bFS694207 
OVRT10098C06OVRT1_0098_C06.bFS694392 
OVRT10099A10OVRT1_0099_A10.bFS694458 
OVRT10099B12OVRT1_0099_B12.bFS694468 
OVRT10099H11OVRT1_0099_H11.bFS694534 
OVRT10101D03OVRT1_0101_D03.bHX234865 
OVRT10102C07OVRT1_0102_C07.bHX234936 
OVRT10102H08OVRT1_0102_H08.bHX234994 
OVRT10103D08OVRT1_0103_D08.bHX235037 
OVRT10105C12OVRT1_0105_C12.bHX235185 
OVRT10105E02OVRT1_0105_E02.bHX235198 
OVRT10105H03OVRT1_0105_H03.bHX235229 
OVRT10106A12OVRT1_0106_A12.bHX235247 
OVRT10107B08OVRT1_0107_B08.bHX235335 
OVRT10107H10OVRT1_0107_H10.bHX235401 
OVRT10108H10OVRT1_0108_H10.bHX235481 
OVRT10109G08OVRT1_0109_G08.bHX235554 
OVRT10111A02OVRT1_0111_A02.bHX235654 
OVRT10111D06OVRT1_0111_D06.bHX235689 
OVRT10111F06OVRT1_0111_F06.bHX235711 
OVRT10112G12OVRT1_0112_G12.bHX235814 
OVRT10114A04OVRT1_0114_A04.bHX235907 
OVRT10114H02OVRT1_0114_H02.bHX235983 
OVRT10115E04OVRT1_0115_E04.bHX236034 
OVRT10117E12OVRT1_0117_E12.bHX236211 
OVRT10118C04OVRT1_0118_C04.bHX236268 
OVRT10119C10OVRT1_0119_C10.bHX236356 
OVRT10119D08OVRT1_0119_D08.bHX236364 
OVRT10120D02OVRT1_0120_D02.bHX236438 
OVRT10121A06OVRT1_0121_A06.bHX236476 
OVRT10121B03OVRT1_0121_B03.bHX236482 
OVRT10121F03OVRT1_0121_F03.bHX236523 
OVRT10124B08OVRT1_0124_B08.bHX236719 
OVRT10124G05OVRT1_0124_G05.bHX236766 
OVRT10125E05OVRT1_0125_E05.bHX236823 
OVRT10125H07OVRT1_0125_H07.bHX236857 
OVRT10126A02OVRT1_0126_A02.bHX236863 
OVRT10126A12OVRT1_0126_A12.bHX236871 
OVRT10126C10OVRT1_0126_C10.bHX236891 
OVRT10129D07OVRT1_0129_D07.bHX237138 
OVRT10129G10OVRT1_0129_G10.bHX237175 
OVRT10131A01OVRT1_0131_A01.bHX237263 
OVRT10131C01OVRT1_0131_C01.bHX237284 
OVRT10131C09OVRT1_0131_C09.bHX237291 
OVRT10131D01OVRT1_0131_D01.bHX237295 
OVRT10131E01OVRT1_0131_E01.bHX237304 
OVRT10131E10OVRT1_0131_E10.bHX237313 
OVRT10131G03OVRT1_0131_G03.bHX237325 
OVRT10133F09OVRT1_0133_F09.bHX237472 
OVRT10134A09OVRT1_0134_A09.bHX237503 
OVRT10134G06OVRT1_0134_G06.bHX237561 
OVRT10135H01OVRT1_0135_H01.bHX237655 
OVRT10136E10OVRT1_0136_E10.bHX237716 
OVRT10137C07OVRT1_0137_C07.bHX237771 
OVRT10139F06OVRT1_0139_F06.bHX237961 
OVRT10139G04OVRT1_0139_G04.bHX237969 
OVRT10140F02OVRT1_0140_F02.bHX238037 
OVRT10140G01OVRT1_0140_G01.bHX238046 
OVRT10141C03OVRT1_0141_C03.bHX238092 
OVRT10142C11OVRT1_0142_C11.bHX238181 
OVRT10142F01OVRT1_0142_F01.bHX238203 
OVRT10145D12OVRT1_0145_D12.bHX238444 
OVRT10146B02OVRT1_0146_B02.bHX238498 
OVRT10146H11OVRT1_0146_H11.bHX238568 
OVRT10147E03OVRT1_0147_E03.bHX238611 
OVRT10150E06OVRT1_0150_E06.bHX238870 
OVRT10151D11OVRT1_0151_D11.bHX238942 
OVRT10151G10OVRT1_0151_G10.bHX238971 
PCT010003E06PCT01_0003_E06.bFS694794 
PCT010003F08PCT01_0003_F08.bFS694804 
PCT010031H09PCT01_0031_H09.bFS696718 
TES010003A05TES01_0003_A05.bCJ030158 
TES010011A12TES01_0011_A12.bCJ030714 
TES010012F02TES01_0012_F02.bCJ030815 AK398133
TES010013F09TES01_0013_F09.bCJ030887 
TES010017H01TES01_0017_H01.bCJ031172 
TES010018G07TES01_0018_G07.b  
TES010019C11TES01_0019_C11.bFS722171 
TES010021F02TES01_0021_F02.bCJ031418 
TES010021F12TES01_0021_F12.bCJ031424 
TES010022E08TES01_0022_E08.bCJ031482 
TES010025A12TES01_0025_A12.bCJ031660 
TES010025B01TES01_0025_B01.b  
TES010026C02TES01_0026_C02.bCJ031720 
TES010030E12TES01_0030_E12.bCJ031998 
TES010031A12TES01_0031_A12.bCJ032031 
TES010034D06TES01_0034_D06.b  
TES010035H05TES01_0035_H05.bCJ032340 
TES010049A10TES01_0049_A10.bCJ033099 
TES010052G04TES01_0052_G04.bCJ033354 
TES010054C05TES01_0054_C05.b  
TES010056F08TES01_0056_F08.bCJ033585 
TES010056G01TES01_0056_G01.bCJ033590 
TES010058C10TES01_0058_C10.bCJ033705 
TES010063B06TES01_0063_B06.bCJ034037 
TES010063E04TES01_0063_E04.bCJ034066 
TES010070A06TES01_0070_A06.bCJ034491 
TES010073H05TES01_0073_H05.bCJ034739 
TES010075B05TES01_0075_B05.bCJ034803 
TES010078F02TES01_0078_F02.bCJ035026 
TES010079C10TES01_0079_C10.bCJ035078 
TES010079E09TES01_0079_E09.bCJ035095 
TES010083C03TES01_0083_C03.bCJ035342 
TES010084H03TES01_0084_H03.bCJ035455 
TES010092F11TES01_0092_F11.bCJ035982 
TES010092H08TES01_0092_H08.bCJ036000 
TES010095A07TES01_0095_A07.bCJ036156 
TES010095G02TES01_0095_G02.bCJ036209 
TES010097D11TES01_0097_D11.bCJ036337 
TES010100B10TES01_0100_B10.bCJ036544 
TES010100H12TES01_0100_H12.bCJ036596 
TES010101E11TES01_0101_E11.b  AK398301
TES010104B12TES01_0104_B12.bCJ036839 
TES010105A06TES01_0105_A06.bCJ036898 
TES010107F08TES01_0107_F08.bCJ037079 
TES010111G06TES01_0111_G06.bCJ037344 
TES010111H12TES01_0111_H12.bCJ037361 
TES010112E11TES01_0112_E11.bFS722290 

  

SNPs: 2      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
228A411070.299OSGAA/E
G248990.701GAG/E
891C530.727MSGAC/D
T030.273GAT/D


Alignment:      TOP

20110601C-006984 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRM1_0209_G04.b :
OVRM1_0222_F02.b :
OVRM1_0168_E07.b :
ADR01_0100_A06.b :
OVRT1_0090_H12.b :
TES01_0034_D06.b :
TES01_0101_E11.b :
OVRM1_0131_B12.b :
TES01_0079_C10.b :
OVRM1_0161_D01.b :
OVRM1_0076_E10.b :
OVRM1_0018_E05.b :
OVRM1_0038_G03.b :
OVRM1_0095_B08.b :
TES01_0025_B01.b :
OVRT1_0011_C01.b :
OVRT1_0091_C05.b :
OVRM1_0195_D02.b :
OVRM1_0035_B03.b :
OVRM1_0104_B11.b :
ADR01_0037_A02.b :
OVRM1_0008_A11.b :
OVRT1_0024_G05.b :
OVRT1_0146_B02.b :
OVRT1_0058_D10.b :
OVRT1_0090_H04.b :
OVRT1_0026_C01.b :
OVRT1_0036_D04.b :
ADR01_0033_H12.b :
ADR01_0084_F09.b :
OVRT1_0035_D04.b :
OVRT1_0088_E10.b :
OVRT1_0074_A07.b : n
OVRM1_0039_E10.b :
OVRM1_0096_G04.b :
OVRM1_0062_H01.b :
OVRM1_0201_F06.b :
OVRM1_0206_G08.b :
OVRM1_0058_G06.b :
OVRM1_0204_E08.b :
OVRM1_0053_B10.b :
OVRM1_0107_G11.b :
OVRM1_0123_A09.b :
OVRM1_0115_H09.b :
OVRM1_0030_B11.b :
ADR01_0020_B08.b :
OVRT1_0117_E12.b :
OVRT1_0134_G06.b : nn
ADR01_0077_G06.b :
ADR01_0048_C05.b :
OVRT1_0076_F07.b :
OVRM1_0148_H06.b :
OVRM1_0151_A08.b :
OVRM1_0166_E12.b :
OVRM1_0096_B07.b :
OVRM1_0005_D02.b :
OVRM1_0168_E06.b :
OVRM1_0102_G02.b :
OVRM1_0216_G12.b :
OVRM1_0188_F10.b :
OVRM1_0056_B09.b :
OVRM1_0121_A12.b :
OVRM1_0025_G06.b :
ADR01_0011_H08.b :
ADR01_0038_F09.b :
OVRT1_0111_D06.b :
TES01_0049_A10.b :
OVRT1_0102_C07.b :
OVRT1_0099_B12.b :
OVRT1_0069_G06.b :
OVRT1_0099_A10.b :
ADR01_0044_A05.b :
OVRT1_0120_D02.b :
OVRT1_0061_C11.b :
OVRT1_0134_A09.b : nnn
OVR01_0007_A11.b : cggggcccctatctt
OVRT1_0013_A10.b :
ADR01_0059_B08.b :
OVRT1_0062_B06.b :
OVRT1_0011_B12.b :
OVRT1_0099_H11.b :
OVRM1_0223_D04.b :
OVRM1_0163_B07.b :
OVRM1_0200_F01.b :
OVRM1_0153_G05.b :
OVRM1_0192_B02.b :
OVRM1_0087_A04.b :
OVRM1_0199_C09.b :
OVRM1_0085_F01.b :
OVRM1_0099_C02.b :
OVRM1_0155_D09.b :
OVRM1_0185_D06.b :
OVRM1_0119_H06.b :
OVRM1_0056_D09.b :
OVRM1_0204_G10.b :
OVRM1_0184_H12.b :
OVRT1_0137_C07.b : nn
OVRT1_0108_H10.b :
OVRT1_0014_H02.b :
OVRT1_0140_F02.b :
OVRT1_0131_G03.b :
PCT01_0003_F08.b :
OVRT1_0102_H08.b :
OVRT1_0045_D08.b :
OVRT1_0131_A01.b : nnnacgaaannnnnnnnccgttagcgttacgaggttxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0147_E03.b :
OVRT1_0101_D03.b :
OVRT1_0006_B03.b :
OVRT1_0042_C08.b :
OVRT1_0111_A02.b :
OVRT1_0126_A12.b :
OVRT1_0056_E03.b :
OVRT1_0051_C07.b :
OVRT1_0049_D06.b :
ADR01_0089_G09.b :
OVRT1_0079_D12.b :
OVRT1_0050_B01.b : nn
OVRT1_0136_E10.b :
OVRT1_0121_A06.b :
OVRT1_0003_A11.b :
OVRT1_0069_A03.b :
OVRT1_0045_H07.b :
OVRT1_0022_H05.b :
OVRT1_0026_A10.b :
OVRT1_0012_A03.b : nnntttcgtcagctgan
OVRT1_0003_D12.b :
OVRT1_0124_B08.b :
OVRT1_0020_C05.b :
OVRT1_0012_E10.b :
OVRM1_0008_C10.b : gtgggtcgtcgacctttttttcccgttca
OVRM1_0041_G01.b :
OVRM1_0046_B09.b :
OVRM1_0155_C08.b :
ADR01_0017_D03.b :
OVRM1_0068_H06.b :
OVRM1_0225_F12.b :
OVRM1_0037_B05.b :
OVRM1_0039_D09.b :
OVRM1_0064_C05.b :
OVRM1_0071_A08.b :
OVR01_0066_B08.b :
OVRM1_0152_C04.b :
OVRM1_0182_F08.b :
OVRM1_0160_H07.b :
OVRM1_0165_B02.b :
OVRM1_0161_C10.b :
OVRM1_0157_F04.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0197_B04.b :
ADR01_0028_A03.b :
ADR01_0016_E06.b :
TES01_0073_H05.b :
OVRM1_0203_G04.b :
OVRM1_0197_F04.b :
OVRM1_0193_G04.b :
OVRM1_0150_E06.b :
OVRM1_0081_E07.b :
OVRM1_0108_D03.b :
OVRM1_0152_H08.b :
OVRM1_0214_B01.b :
OVRM1_0134_B04.b :
OVRM1_0149_H05.b :
OVRM1_0155_D02.b :
OVRM1_0052_B01.b :
OVRM1_0073_C06.b :
OVRM1_0034_A08.b :
OVRM1_0134_H10.b :
OVRM1_0074_F05.b :
OVRM1_0154_G07.b :
OVRM1_0059_A02.b :
OVRM1_0065_F04.b :
OVRM1_0018_C04.b :
OVRM1_0147_C12.b :
OVRM1_0153_H10.b :
OVRM1_0154_E11.b :
OVRM1_0074_D06.b :
OVRM1_0014_A04.b :
OVRM1_0013_A03.b :
OVRM1_0211_H03.b :
OVRM1_0130_C02.b :
OVRM1_0065_E04.b :
OVRM1_0147_H09.b :
OVRM1_0218_B03.b :
OVRM1_0167_C04.b :
OVRM1_0063_C06.b :
OVRM1_0151_D09.b :
OVRM1_0057_F04.b :
OVRM1_0048_D11.b :
OVRM1_0113_C01.b :
OVRM1_0197_F12.b :
OVRM1_0205_D04.b :
OVRM1_0115_D01.b :
OVRM1_0209_A08.b :
OVRM1_0206_C01.b :
OVRM1_0169_E04.b :
OVRM1_0209_A07.b :
OVRM1_0169_D04.b :
OVRM1_0041_C12.b :
OVRM1_0116_C01.b :
OVRM1_0138_G02.b :
OVRM1_0038_G01.b :
OVRM1_0201_D04.b :
OVRM1_0041_F06.b :
OVRM1_0063_C02.b :
OVRM1_0100_A02.b :
OVRM1_0101_F02.b :
ADR01_0015_F03.b :
OVRM1_0067_E11.b :
OVRM1_0051_C05.b :
OVRM1_0179_C09.b :
OVRM1_0006_F01.b :
OVRM1_0182_B11.b :
OVRM1_0037_D05.b :
OVRM1_0213_B06.b :
OVRM1_0053_A09.b :
OVRM1_0083_A06.b :
OVRM1_0043_E11.b :
OVRM1_0058_E11.b :
OVRM1_0125_D11.b :
OVRM1_0128_B11.b :
ADR01_0002_B08.b :
OVRM1_0083_B02.b : nxxxxx
OVRM1_0128_H12.b :
OVRM1_0060_C07.b :
ADR01_0025_B07.b :
OVRM1_0043_C09.b :
ADR01_0068_E12.b :
OVRM1_0033_H11.b :
OVRM1_0084_C05.b :
OVRM1_0129_D09.b :
OVRM1_0024_F02.b :
OVRM1_0129_E03.b :
OVRM1_0118_B11.b :
OVRM1_0102_A05.b :
OVRM1_0028_F10.b :
OVRM1_0122_B03.b :
OVRM1_0130_F10.b :
OVRT1_0139_F06.b : nncc
OVRM1_0125_E11.b :
OVRM1_0015_A08.b :
OVRM1_0017_E08.b :
OVRM1_0210_G10.b :
OVRM1_0053_B09.b :
OVRM1_0202_G08.b :
OVRM1_0110_A04.b :
OVRM1_0099_D12.b :
OVRM1_0167_G07.b :
OVRM1_0102_E10.b :
OVRM1_0052_C11.b :
OVRM1_0166_B04.b : aatcccttcatctagcaacaacgatgcaataatctactttctctcgtgctatc
OVRM1_0084_D08.b :
OVRM1_0086_G06.b :
OVRM1_0089_H07.b :
OVRM1_0092_C11.b :
OVRM1_0170_D10.b :
OVRM1_0116_H07.b :
OVRM1_0070_E09.b :
OVRM1_0101_H04.b :
OVRM1_0005_A11.b :
OVRM1_0115_C06.b :
OVRM1_0100_H04.b :
OVRM1_0060_C10.b :
OVRM1_0078_B12.b :
OVRM1_0049_C12.b :
OVRM1_0054_D10.b :
OVRM1_0025_H03.b :
OVRM1_0042_A09.b :
OVRM1_0204_F10.b :
OVRM1_0022_A04.b :
OVRM1_0110_A12.b :
OVRM1_0213_C10.b :
OVRM1_0003_H12.b :
OVRM1_0093_A08.b :
OVRM1_0055_D12.b :
OVRM1_0110_F10.b :
OVRM1_0027_B10.b :
OVRM1_0012_B06.b :
OVRM1_0202_D12.b :
OVRM1_0094_E08.b :
OVRM1_0122_E08.b :
OVRM1_0025_B07.b :
OVRM1_0026_H12.b :
TES01_0105_A06.b :
OVRM1_0012_F10.b :
OVRM1_0011_C11.b :
ADR01_0026_C02.b :
OVRT1_0131_C01.b : n
ADR01_0007_G11.b :
ADR01_0023_D01.b :
OVRT1_0131_E10.b :
OVRT1_0089_C09.b :
TES01_0030_E12.b :
OVRT1_0131_E01.b : nn
ADR01_0046_F08.b :
OVRT1_0142_C11.b : nnn
ADR01_0040_E04.b :
ADR01_0013_F03.b :
ADR01_0008_E04.b :
OVRT1_0107_H10.b :
OVRT1_0103_D08.b :
OVRT1_0146_H11.b :
ADR01_0056_H11.b :
ADR01_0014_D04.b :
ADR01_0064_A10.b :
OVRT1_0083_A05.b :
OVRT1_0105_H03.b :
OVRT1_0065_C04.b :
OVRT1_0046_C01.b :
OVRT1_0131_D01.b : nn
OVRT1_0125_H07.b :
OVRT1_0065_C01.b :
OVRT1_0092_H04.b : nn
OVRT1_0112_G12.b :
ADR01_0069_E06.b :
ADR01_0040_F06.b :
OVRT1_0114_A04.b :
OVRT1_0080_D08.b :
OVRT1_0011_G03.b :
ADR01_0047_F02.b :
OVRT1_0142_F01.b : nn
OVRT1_0073_H01.b :
OVRT1_0083_G08.b :
OVRT1_0114_H02.b :
OVRT1_0009_H05.b :
OVRT1_0084_E08.b :
OVRT1_0131_C09.b : n
OVRT1_0076_G04.b :
OVRT1_0016_G11.b :
OVRT1_0115_E04.b :
OVRT1_0083_G05.b :
OVRT1_0129_D07.b :
OVRT1_0071_A02.b :
OVRT1_0073_C11.b :
OVRT1_0039_F01.b :
OVRT1_0014_D12.b :
OVRT1_0109_G08.b :
OVRT1_0025_A01.b :
OVRT1_0041_A12.b :
OVRT1_0092_A10.b :
OVRT1_0141_C03.b : nnna
OVRT1_0053_D04.b : n
OVRT1_0002_C06.b :
OVRT1_0042_E07.b :
OVRT1_0124_G05.b :
ADR01_0029_F09.b :
OVRT1_0139_G04.b : nna
OVRT1_0151_D11.b :
ADR01_0034_A11.b :
OVRT1_0050_B08.b : nnnt
OVRT1_0111_F06.b :
OVRT1_0011_D12.b :
OVRT1_0044_A11.b :
OVRT1_0077_A05.b :
OVRT1_0135_H01.b : nnn
OVRT1_0031_C09.b :
OVRT1_0105_E02.b :
OVRT1_0118_C04.b :
OVRT1_0077_H01.b :
OVRT1_0044_D01.b :
OVRT1_0129_G10.b : nn
OVRT1_0050_F11.b : nnn
OVRT1_0074_B07.b :
OVRT1_0024_E02.b :
OVRT1_0011_A03.b :
ADR01_0100_G01.b :
OVRT1_0034_A01.b :
OVRT1_0052_E08.b : nn
OVRT1_0105_C12.b :
OVRT1_0002_F02.b :
OVRT1_0041_E06.b :
OVRT1_0050_D04.b :
OVRT1_0084_F12.b :
OVRT1_0106_A12.b :
OVRT1_0030_G12.b :
OVRT1_0121_F03.b :
OVRT1_0121_B03.b :
ADR01_0086_C09.b :
OVRT1_0012_D11.b :
OVRT1_0027_D01.b :
OVRT1_0077_H08.b :
ADR01_0056_E05.b :
OVRT1_0125_E05.b :
OVRT1_0098_C06.b :
ADR01_0002_H05.b :
OVRT1_0057_H12.b :
OVRT1_0091_B08.b :
OVRT1_0126_C10.b :
OVRT1_0081_D11.b :
OVRT1_0096_A11.b :
OVRT1_0078_A09.b :
ADR01_0066_F07.b :
ADR01_0060_C04.b :
OVRT1_0093_A09.b : n
OVRT1_0051_G05.b :
OVRT1_0126_A02.b :
ADR01_0054_D10.b :
OVRT1_0075_D07.b :
ADR01_0100_B08.b :
ADR01_0077_G11.b :
OVRT1_0107_B08.b :
OVRT1_0069_A05.b : n
OVRT1_0011_H12.b :
OVRT1_0133_F09.b : nn
OVRT1_0039_C02.b :
ADR01_0093_F01.b :
ADR01_0068_G03.b :
OVRT1_0063_D01.b :
ADR01_0089_G03.b :
OVR01_0005_C04.b : tttgaacatctagcxxxxxx
OVRT1_0065_G10.b :
OVRT1_0151_G10.b :
ADR01_0033_E01.b :
OVRT1_0091_A02.b :
ADR01_0057_A05.b :
OVRT1_0035_A04.b :
OVRT1_0093_C11.b :
OVRT1_0050_E07.b : n
ADR01_0056_B06.b :
OVRT1_0094_C10.b :
ADR01_0078_D02.b :
OVRT1_0031_D02.b :
OVR01_0017_F06.b :
OVRT1_0082_F05.b :
ADR01_0095_A11.b :
ADR01_0055_H09.b :
ADR01_0068_E08.b :
ADR01_0094_H08.b :
ADR01_0048_C11.b :
ADR01_0057_H08.b :
ADR01_0085_H02.b :
ADR01_0101_E12.b :
ADR01_0083_D11.b :
ADR01_0098_F04.b :
ADR01_0068_G09.b :
OVRT1_0150_E06.b :
OVRT1_0119_D08.b :
OVRT1_0089_B04.b :
OVRT1_0145_D12.b :
OVRT1_0094_C07.b :
OVRT1_0010_H09.b :
OVRT1_0076_G06.b :
OVRT1_0044_F07.b :
OVRT1_0090_D02.b :
OVRT1_0068_D10.b :
OVRT1_0052_B08.b :
OVRT1_0047_C08.b :
TES01_0078_F02.b :
TES01_0075_B05.b :
OVRM1_0221_H02.b :
OVRM1_0151_H10.b :
OVRM1_0126_H10.b :
TES01_0095_A07.b :
TES01_0056_G01.b :
ADR01_0076_H12.b :
TES01_0097_D11.b :
TES01_0112_E11.b :
TES01_0026_C02.b :
OVRM1_0090_H03.b :
TES01_0035_H05.b :
TES01_0022_E08.b :
TES01_0107_F08.b :
TES01_0100_B10.b :
TES01_0083_C03.b :
TES01_0092_H08.b :
OVRT1_0017_H10.b :
TES01_0013_F09.b :
TES01_0012_F02.b :
TES01_0104_B12.b :
TES01_0017_H01.b :
TES01_0092_F11.b :
TES01_0063_E04.b :
TES01_0111_G06.b :
OVRM1_0188_H04.b :
TES01_0052_G04.b :
TES01_0084_H03.b :
TES01_0054_C05.b :
TES01_0056_F08.b :
TES01_0058_C10.b :
TES01_0100_H12.b :
ADR01_0093_A06.b :
TES01_0011_A12.b :
TES01_0003_A05.b :
TES01_0111_H12.b :
TES01_0079_E09.b :
OVRM1_0081_A02.b :
OVRM1_0166_H03.b :
TES01_0021_F12.b :
OVRT1_0119_C10.b :
TES01_0019_C11.b :
ADR01_0073_A09.b :
OVRT1_0092_A02.b :
OVRM1_0111_B09.b :
OVRT1_0140_G01.b :
TES01_0025_A12.b :
TES01_0063_B06.b :
TES01_0021_F02.b :
TES01_0031_A12.b :
TES01_0070_A06.b :
TES01_0018_G07.b :
PCT01_0031_H09.b :
PCT01_0003_E06.b :
OVRM1_0021_F03.b :
TES01_0095_G02.b :
OVRM1_0044_E06.b :
ADR01_0099_A01.b :
OVRM1_0064_E06.b :
OVRM1_0219_C06.b :
OVRT1_0077_F08.b :
OVRM1_0101_C12.b :
OVRM1_0155_E05.b :
OVRM1_0189_D06.b :
OVRM1_0047_H02.b :
OVRM1_0016_H03.b :
OVRM1_0004_E03.b :
OVRM1_0126_A12.b :
OVRM1_0220_B01.b :
OVRM1_0174_H12.b :
ADR01_0055_H06.b :
ADR01_0093_G08.b :
OVRM1_0201_H02.b :
ADR01_0015_F09.b :
OVRM1_0104_F02.b :
OVRM1_0016_H07.b :
OVRM1_0038_H04.b :
OVRM1_0030_F08.b :
OVRM1_0058_E02.b :
ADR01_0012_H04.b :
20110601C-006984 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRM1_0209_G04.b : gaattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0222_F02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0168_E07.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0100_A06.b : aaaaaanggatcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0090_H12.b : nnttgtttnnnngnnnccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0034_D06.b :
TES01_0101_E11.b : ttttat
OVRM1_0131_B12.b : ncagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0079_C10.b : nccctccgcagcggctct
OVRM1_0161_D01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0076_E10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0018_E05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0038_G03.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0095_B08.b : cagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0025_B01.b :
OVRT1_0011_C01.b : nncccccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0091_C05.b : nnttaccgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0195_D02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0035_B03.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0104_B11.b : nagttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0037_A02.b : nnnnggtgaagcxxxxxxxxxxxxxxxxxxx
OVRM1_0008_A11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0024_G05.b : nnntttctatagctgacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0146_B02.b : nnnnccttctgcgnaggagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0058_D10.b : ctgttttnnnnnnnnccctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0090_H04.b : ncctgttnnnnnnncacgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0026_C01.b : nnnnncctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0036_D04.b : nnnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0033_H12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxx
ADR01_0084_F09.b : aaaaannggactaacxxxxxxxxxxxxxxxxxxx
OVRT1_0035_D04.b : nnnnnccgtcagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0088_E10.b : nnccttttttnnnnnnccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0074_A07.b : cctcatnnnnnnnnanccgttagcgnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0039_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0096_G04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0062_H01.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0201_F06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0206_G08.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0058_G06.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0204_E08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0053_B10.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0107_G11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0123_A09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0115_H09.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0030_B11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0020_B08.b : ntgtgaacaxxxxxxxxxxxxxxxxx
OVRT1_0117_E12.b : nncctcgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0134_G06.b : aaccacttnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0077_G06.b : nnnnnggatgaacaxxxxxxxxxxxxxxxx
ADR01_0048_C05.b : nttttaagatatacaxxxxxxxxxxxxxxxxx
OVRT1_0076_F07.b : nccgtttttnnnnnnccctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0148_H06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0151_A08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0166_E12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0096_B07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0005_D02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0168_E06.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0102_G02.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0216_G12.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0188_F10.b : gagtttgtcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0056_B09.b : ggagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0121_A12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0025_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0011_H08.b : nnttatcaacaxxxxxxxxxxxxxxxx
ADR01_0038_F09.b : nnnnggtgaaacaxxxxxxxxxxxxxxxxxxxxx
OVRT1_0111_D06.b : nnnnnacgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0049_A10.b : nttactacgttgctctgat
OVRT1_0102_C07.b : nnnnccttcgcggaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0099_B12.b : nntttactcagcgcacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0069_G06.b : nnggcctttnnnnnnnncctttagcgcacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0099_A10.b : nccccccgacagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0044_A05.b : naaagaaacaxxxxxxxxxxxxxxxxxxxx
OVRT1_0120_D02.b : naacgtttgctnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0061_C11.b : ngggcttttngggnttccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0134_A09.b : ccctaatnnnnnnnnccgttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0007_A11.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0013_A10.b : nnnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0059_B08.b : nnnnccatgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0062_B06.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0011_B12.b : nccttccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0099_H11.b : nccttccttcagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0223_D04.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0163_B07.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0200_F01.b : gcagttgtcatxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0153_G05.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0192_B02.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0087_A04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0199_C09.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxx
OVRM1_0085_F01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0099_C02.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0155_D09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0185_D06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0119_H06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0056_D09.b : agttgacxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0204_G10.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0184_H12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0137_C07.b : aaaattcaccccnnnnnccgtatagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0108_H10.b : nnnccgttcgctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0014_H02.b : ntttcgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0140_F02.b : nnaaaggaaacnnnnnnnccgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0131_G03.b : nnaactttttnnngnnnccgttagcgttacgaggxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0003_F08.b : nnnggcgtttaaaannnncctgcgttggctactggaa
OVRT1_0102_H08.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0045_D08.b : nnncccttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0131_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxgcttctcgcttaaccttgagctggtggttataag
OVRT1_0147_E03.b : nnncccctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0101_D03.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0006_B03.b : nnnnncctctcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0042_C08.b : nnnncccttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0111_A02.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0126_A12.b : nnnnccctttagctgtcgagtgxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0056_E03.b : nngggtttnnnnnnnnnccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0051_C07.b : nnccgcttnnnnnggnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0049_D06.b : nnttagttnnnnggnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0089_G09.b : nnnggtttaannnngggtxxxxxxxxxxxxxxxxxxxx
OVRT1_0079_D12.b : ggggtccatattgctgcatgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0050_B01.b : nccgttnnnnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0136_E10.b : nnaaacttctnnnnnnnnccgtttgcgttacgaggxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0121_A06.b : nccgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0003_A11.b : nnnnccctctagcgnacngagtgxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0069_A03.b : nnggcttttnnnnnnnccattggcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0045_H07.b : nncccccttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0022_H05.b : nggactcgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0026_A10.b : nntttcctatagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0012_A03.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaag
OVRT1_0003_D12.b : ttttccctctagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0124_B08.b : nnnnccgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0020_C05.b : nggtgtttnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0012_E10.b : nnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0008_C10.b : tatatggccatatatggcttacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0041_G01.b : caattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0046_B09.b : cggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0155_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0017_D03.b : taaacaxxxxxxxxxxxxxxxxxxx
OVRM1_0068_H06.b : nagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0225_F12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0037_B05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0039_D09.b : xxxxxxxxxxxxxxxxxxxxx
OVRM1_0064_C05.b : gagttgacacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0071_A08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0066_B08.b : nnttgctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0152_C04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0182_F08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0160_H07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0165_B02.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0161_C10.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0157_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0197_B04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0028_A03.b : ntgaaacaxxxxxxxxxxxxxxxxxxx
ADR01_0016_E06.b : aatgaacaxxxxxxxxxxxxxxx
TES01_0073_H05.b :
OVRM1_0203_G04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0197_F04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0193_G04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0150_E06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0081_E07.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0108_D03.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0152_H08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0214_B01.b : nagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0134_B04.b : tcagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0149_H05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0155_D02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0052_B01.b : agttgacacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0073_C06.b : tccctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0034_A08.b : aattttgtgcaactxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0134_H10.b : ncagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0074_F05.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0154_G07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0059_A02.b : xxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0065_F04.b : xxxxxxxxxxxxxxxxxxxxx
OVRM1_0018_C04.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0147_C12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0153_H10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0154_E11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0074_D06.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0014_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0013_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0211_H03.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0130_C02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0065_E04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0147_H09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0218_B03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0167_C04.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0063_C06.b : tagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0151_D09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0057_F04.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0048_D11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0113_C01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0197_F12.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0205_D04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0115_D01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0209_A08.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0206_C01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0169_E04.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0209_A07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0169_D04.b : gagttgtcatxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0041_C12.b : xxxxxxxxxxxxxxxxxxxxx
OVRM1_0116_C01.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0138_G02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0038_G01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0201_D04.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0041_F06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0063_C02.b : taattgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0100_A02.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0101_F02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0015_F03.b : taaatgaacaxxxxxxxxxxxxxxxxxxxx
OVRM1_0067_E11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0051_C05.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0179_C09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0006_F01.b : agatttgtcgaaactxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0182_B11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0037_D05.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0213_B06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0053_A09.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0083_A06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0043_E11.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0058_E11.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0125_D11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0128_B11.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0002_B08.b : atcaacaxxxxxxxxxxxxxxxxxxxx
OVRM1_0083_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0128_H12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0060_C07.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0025_B07.b : aaacaxxxxxxxxxxxxxxxxxxx
OVRM1_0043_C09.b : xxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0068_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0033_H11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0084_C05.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0129_D09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0024_F02.b : nagtttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0129_E03.b : nagttgtcnxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0118_B11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0102_A05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0028_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0122_B03.b : tcagtttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0130_F10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0139_F06.b : cggtcttaatnnnnnccttattgcgttacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0125_E11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0015_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0017_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0210_G10.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0053_B09.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0202_G08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0110_A04.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0099_D12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0167_G07.b : gagtttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0102_E10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0052_C11.b : ccttgaacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0166_B04.b : gcctttttttctttctttttttccatttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0084_D08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0086_G06.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0089_H07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0092_C11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0170_D10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0116_H07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0070_E09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0101_H04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0005_A11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0115_C06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0100_H04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0060_C10.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0078_B12.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0049_C12.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0054_D10.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0025_H03.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0042_A09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0204_F10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0022_A04.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0110_A12.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0213_C10.b : agttgacatxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0003_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0093_A08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0055_D12.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0110_F10.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0027_B10.b : aatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0012_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0202_D12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0094_E08.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0122_E08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0025_B07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0026_H12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0105_A06.b :
OVRM1_0012_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0011_C11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0026_C02.b : nggatgaacaxxxxxxxxxxxxxxxxxxxxx
OVRT1_0131_C01.b : nccaaatannnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0007_G11.b : nnnnnggtgaacaxxxxxxxxxxxxxxxxxxxx
ADR01_0023_D01.b : taaacaxxxxxxxxxxxxxxxxxxx
OVRT1_0131_E10.b : nnnggcactacnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0089_C09.b : nnncctatagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0030_E12.b :
OVRT1_0131_E01.b : naagtttnnnnnnnnnccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0046_F08.b : nnggtgaaacaxxxxxxxxxxxxxxxxxxxx
OVRT1_0142_C11.b : aagttttnnnnnnnnccgttcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0040_E04.b : nnttgaaacaxxxxxxxxxxxxxxxxxxxx
ADR01_0013_F03.b : nnnnaatgaacaxxxxxxxxxxxxxxxxxxxx
ADR01_0008_E04.b : nnnnaatgaacaxxxxxxxxxxxxxxxxxx
OVRT1_0107_H10.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0103_D08.b : nnnnccgtcagctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0146_H11.b : tttttcctatagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0056_H11.b : nnnnccgtnnaaaagagtaacaxxxxxxxxxxxxxxxxxxxx
ADR01_0014_D04.b : nnnngatgaacaxxxxxxxxxxxxxxxxxxxxx
ADR01_0064_A10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRT1_0083_A05.b : nggactcgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0105_H03.b : nnnccgtcagctgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0065_C04.b : nncccccttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0046_C01.b : nnnnnccttagctnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0131_D01.b : nggcgtttnnnnnnnnccgttagcgttacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0125_H07.b : nnccgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0065_C01.b : nnnnnccgtttgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0092_H04.b : ttcgttnnnnngnnnccgcttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0112_G12.b : nnnnnnnnnnnnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0069_E06.b : nnnccctttanaannggagtaagcagcxxxxxxxxxxxxxxxx
ADR01_0040_F06.b : nttgaaacaxxxxxxxxxxxxxxxxxxxx
OVRT1_0114_A04.b : nnnccccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0080_D08.b : nnnnntctttttgctgcatgagtgcacgacagctcatxxxxxxxxxxxxxx
OVRT1_0011_G03.b : nnnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0047_F02.b : ntttcaagatgaacaxxxxxxxxxxxxxxxxxxxx
OVRT1_0142_F01.b : ggggttttnnnnnnnccgatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0073_H01.b : nntttacgttagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0083_G08.b : nnaaaccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0114_H02.b : nntttccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0009_H05.b : ggctccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0084_E08.b : nnaacccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0131_C09.b : nccatatccnnnnnnnccgttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0076_G04.b : ngggatactatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0016_G11.b : nntttccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0115_E04.b : nnnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0083_G05.b : ngggattcgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0129_D07.b : nnccaattttnnnnnnnccgttagcgttacgaggxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0071_A02.b : nnggtcttnnnnnnnncgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0073_C11.b : gttttccgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0039_F01.b : nnttttttnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0014_D12.b : nnttccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0109_G08.b : nnncccgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0025_A01.b : ngggctttnnnnnncnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0041_A12.b : ngggttttnnnncnnccgttagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0092_A10.b : nnaattccgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0141_C03.b : aacactcnnnnnnnnccgttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0053_D04.b : ccgttttttnnnnnnncctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0002_C06.b : nnaatccgttcagcgacngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0042_E07.b : nnnnnccgtttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0124_G05.b : nnnaacgttcagctgtggxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0029_F09.b : nnttaaggagtaaacaxxxxxxxxxxxxxxxx
OVRT1_0139_G04.b : aagagtgtttnnnnnnccgttctgcttagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0151_D11.b : nntttccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0034_A11.b : nnncctttaaaaataactaaagcagcxxxxxxxxxxxxxxxx
OVRT1_0050_B08.b : tggctnnnnnngnnnccttttgcgttacgaggttxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0111_F06.b : nnnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0011_D12.b : ttttcccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0044_A11.b : naaaaccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0077_A05.b : nnncctcatattgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0135_H01.b : aatatatnnnnnnnncccgttagcgttacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0031_C09.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0105_E02.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0118_C04.b : nnnnccgttagctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0077_H01.b : nnttttacgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0044_D01.b : nnnnnccgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0129_G10.b : nccatacnnnnnnnnccgttcgcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0050_F11.b : ccgctnnnnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0074_B07.b : ncgcttttnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0024_E02.b : nnccccctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0011_A03.b : nncctccttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0100_G01.b : aaaaannggataaacaxxxxxxxxxxxxxxxxxxx
OVRT1_0034_A01.b : nntttccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0052_E08.b : cccgcttnnnnggnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0105_C12.b : nnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0002_F02.b : nnnnncctctagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0041_E06.b : nnggtgtnnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0050_D04.b : nnggttttnnnnnnnnccgttagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0084_F12.b : nttttcccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0106_A12.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0030_G12.b : nngggcttnnnnggntnccgtcgcgttagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0121_F03.b : ncgacagctgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0121_B03.b : nnccgttagctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0086_C09.b : nngggaaaannnnggactaacagctggaxxxxxxxxxxxxx
OVRT1_0012_D11.b : nntttccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0027_D01.b : nnnnccttttgcggacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0077_H08.b : nnncctacttctgcgcacgagtgxxxxxxxxxxxxxxxxxxxxxx
ADR01_0056_E05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRT1_0125_E05.b : nncctttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0098_C06.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0002_H05.b : tatgaacaxxxxxxxxxxxxxxxxxxxx
OVRT1_0057_H12.b : nttttccgttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0091_B08.b : nggaaccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0126_C10.b : nnnccccgttagctgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0081_D11.b : ntttccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0096_A11.b : nntttccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0078_A09.b : nggtttactatagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0066_F07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ADR01_0060_C04.b : nnnaacgctaaacaxxxxxxxxxxxxxxxxxxxx
OVRT1_0093_A09.b : nggtttnnnnnnnnnccgatagcggacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0051_G05.b : nnnttacgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0126_A02.b : nnncccctatagctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0054_D10.b : nnnntcggnnnnnggagaaacaxxxxxxxxxxxxxxxxxxxxx
OVRT1_0075_D07.b : ngggaccctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0100_B08.b : nnnaaaacataaaaanggataaagcagcggtxxxxxxxxxxxxxx
ADR01_0077_G11.b : nnnnnnggactaacaxxxxxxxxxxxxxxxxxxxxx
OVRT1_0107_B08.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0069_A05.b : nncgttnnnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0011_H12.b : nntttccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0133_F09.b : nccgtaatnnnnnnnnccgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0039_C02.b : nnnnnccgttagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0093_F01.b : nnnccgtttnnnnttgatcaagcagcxxxxxxxxxxxxxxxxxx
ADR01_0068_G03.b : nccattaannnnggatgaacaxxxxxxxxxxxxxxxxxxxx
OVRT1_0063_D01.b : ngcgcctttnnnntttccgtcagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0089_G03.b : nnncctttannnnnggagtaagcagcggnaxxxxxxxxxxxx
OVR01_0005_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0065_G10.b : ntttttccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0151_G10.b : nntttacgttagcgtaggagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0033_E01.b : nnnggttttttaanggactaaacaxxxxxxxxxxxxxxxxxxx
OVRT1_0091_A02.b : nnccgtttnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0057_A05.b : nnnnnaatgaacaxxxxxxxxxxxxxxxxxxxxx
OVRT1_0035_A04.b : nnntttcgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0093_C11.b : nngggcttnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0050_E07.b : nccgcctnnnnggnnncctatagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0056_B06.b : ggggnaggatgaacxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0094_C10.b : nggctttnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0078_D02.b : nnnnnnggataaacaxxxxxxxxxxxxxxxxxxx
OVRT1_0031_D02.b : ntcttttnnnnnnncccttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0017_F06.b : gggggggacctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0082_F05.b : nnncccctttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0095_A11.b : nnccgttaaaaaanggactxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0055_H09.b : nnnttcgaannnnggataaagcagcxxxxxxxxxxxxxxxxxx
ADR01_0068_E08.b : nnngggttaannnnnggatatagcagcxxxxxxxxxxxxxxxxx
ADR01_0094_H08.b : nnccgttaannnnatgatatagcagcggtccggntccggaxx
ADR01_0048_C11.b : nnnnnaagatgaacaxxxxxxxxxxxxxxxxxxxx
ADR01_0057_H08.b : nnnaatgtgxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0085_H02.b : nnntttgataaacagctggaxxxxxxxxxxxx
ADR01_0101_E12.b : ttaatcggataaacagctgnaxxxxxxxxxxxx
ADR01_0083_D11.b : nnnnnnggactaacaxxxxxxxxxxxxxxxxxxxx
ADR01_0098_F04.b : cataaanggagtaacxxxxxxxxxxxxxxxxxxxx
ADR01_0068_G09.b : nggctttnnnnnnggactaacaxxxxxxxxxxxxxxxxxxxxx
OVRT1_0150_E06.b : nnnnncctatagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0119_D08.b : ccttcgctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0089_B04.b : ncctattgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0145_D12.b : ttttccgttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0094_C07.b : nnaacccgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0010_H09.b : ntttcgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0076_G06.b : ngggactctatagctgtacgagtgxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0044_F07.b : nnntttcgtttgctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0090_D02.b : nngggcttnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0068_D10.b : nnggtcttttnnnnnncccatcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0052_B08.b : nnnnggtttnnnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0047_C08.b : nnccttctgcgccggagtgxxxxxxxxxxxxxxxxxxxxxxx
TES01_0078_F02.b :
TES01_0075_B05.b :
OVRM1_0221_H02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0151_H10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0126_H10.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0095_A07.b :
TES01_0056_G01.b :
ADR01_0076_H12.b : nnggcttnnaaaaaggataaagcagcxxxxxxxxxxxxx
TES01_0097_D11.b :
TES01_0112_E11.b :
TES01_0026_C02.b :
OVRM1_0090_H03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0035_H05.b :
TES01_0022_E08.b :
TES01_0107_F08.b :
TES01_0100_B10.b :
TES01_0083_C03.b :
TES01_0092_H08.b :
OVRT1_0017_H10.b : nttccgttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0013_F09.b :
TES01_0012_F02.b :
TES01_0104_B12.b :
TES01_0017_H01.b :
TES01_0092_F11.b :
TES01_0063_E04.b :
TES01_0111_G06.b :
OVRM1_0188_H04.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0052_G04.b :
TES01_0084_H03.b :
TES01_0054_C05.b :
TES01_0056_F08.b :
TES01_0058_C10.b :
TES01_0100_H12.b :
ADR01_0093_A06.b : nnntttgatgaacaxxxxxxxxxxxxxxxx
TES01_0011_A12.b :
TES01_0003_A05.b :
TES01_0111_H12.b :
TES01_0079_E09.b :
OVRM1_0081_A02.b :
OVRM1_0166_H03.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxx
TES01_0021_F12.b :
OVRT1_0119_C10.b : cgtcagcgtaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0019_C11.b :
ADR01_0073_A09.b : nnnccctaaannnntgataacaxxxxxxxxxxxxx
OVRT1_0092_A02.b : nnnccccgtcagcgcaggxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0111_B09.b : nagttgtcxxxxxxxxxxxxxxxxxxx
OVRT1_0140_G01.b : nnaaaataatnnnnnnnnnccgttagcgttggxxxxxxxxxxxxxxxxxxxxx
TES01_0025_A12.b :
TES01_0063_B06.b :
TES01_0021_F02.b :
TES01_0031_A12.b :
TES01_0070_A06.b :
TES01_0018_G07.b :
PCT01_0031_H09.b : nnnccgg
PCT01_0003_E06.b : nnn
OVRM1_0021_F03.b :
TES01_0095_G02.b :
OVRM1_0044_E06.b : ttgt
ADR01_0099_A01.b :
OVRM1_0064_E06.b :
OVRM1_0219_C06.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0077_F08.b : nnaactcattctgct
OVRM1_0101_C12.b :
OVRM1_0155_E05.b :
OVRM1_0189_D06.b :
OVRM1_0047_H02.b :
OVRM1_0016_H03.b :
OVRM1_0004_E03.b :
OVRM1_0126_A12.b :
OVRM1_0220_B01.b :
OVRM1_0174_H12.b :
ADR01_0055_H06.b :
ADR01_0093_G08.b :
OVRM1_0201_H02.b :
ADR01_0015_F09.b :
OVRM1_0104_F02.b :
OVRM1_0016_H07.b :
OVRM1_0038_H04.b :
OVRM1_0030_F08.b :
OVRM1_0058_E02.b :
ADR01_0012_H04.b :
20110601C-006984 : .......TTGTTGGCCTACTGGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
---------+---------+---------+---------+---------+---------+ 49
OVRM1_0209_G04.b : xxxxxxxTTGTTGGCCTACTGG*AGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0222_F02.b : xxxxxxxxxxxxxxCCTACTGG*AGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0168_E07.b : xxxxxxxxxxttggCCTACTGG*AGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0100_A06.b : xxxxxxxxxxxxxxCCTACTGG*AGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0090_H12.b : xxxxxxxxxxxxxxxxxACTGT*AGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0034_D06.b : ccacactggctCTGG*AGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0101_E11.b : acgttggctctggggcctCTGG*AGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0131_B12.b : xxxxxxxxxxxxxxxxxxCTGG*AGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0079_C10.b : gggatcgagncggccttgCTGG*AGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0161_D01.b : xxxxxxxxxxxxxxxxxxxTGG*AGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0076_E10.b : xxxxxxxxxxxxxxxxxxxTGGCAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0018_E05.b : xxxxxxxxxxxxxxxxxxxTGGCAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0038_G03.b : xxxxxxxxxxxxxxxxxxxTGG*AGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0095_B08.b : xxxxxxxxxxxxxxxxxxxTGG*AGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0025_B01.b : tggctCTGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0011_C01.b : xxxxxxxxxxxxxxxxxxxTGG*AGACTCACC*TCATCACG**CCCTGCTGCA*ATGGGA
OVRT1_0091_C05.b : xxxxxxxxxxxxxxxxxxxCTGTAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0195_D02.b : xxxxxxxxxxxxxxxxxxxxGG*AGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0035_B03.b : xxxxxxxxxxxxxxxxxxxxTGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0104_B11.b : xxxxxxxxxxxxxxxxxxxxTGGAGACTCACC*TCATTAGG**CCCTGCTGCA*GTGGGA
ADR01_0037_A02.b : xxxxxxxxxxxxxxxxxxxxGG*AGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0008_A11.b : xxxxxxxxxxxxxxxxxxxxTGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0024_G05.b : xxxxxxxxxxxxxxxxxxxxTGGAGACTCACC*TCATCAGG**TCCTGCTGCA*GTGGGA
OVRT1_0146_B02.b : xxxxxxxxxxxxxxxxxxxxTGGAGACTCACC*TTATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0058_D10.b : xxxxxxxxxxxxxxxxxxxxTGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0090_H04.b : xxxxxxxxxxxxxxxxxxxxTGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0026_C01.b : xxxxxxxxxxxxxxxxxxxxTGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0036_D04.b : xxxxxxxxxxxxxxxxxxxxTGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0033_H12.b : xxxxxxxxxxxxxxxxxxxxTGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0084_F09.b : xxxxxxxxxxxxxxxxxxxxTGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0035_D04.b : xxxxxxxxxxxxxxxxxxxxTGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0088_E10.b : xxxxxxxxxxxxxxxxxxxxTGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0074_A07.b : xxxxxxxxxxxxxxxxxxcaTGTAGACTCACC*TCATTAGG**CCCTGCTGCA*GTGGGA
OVRM1_0039_E10.b : xxxxxxxxxxxxxxxxxxxxxGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0096_G04.b : xxxxxxxxxxxxxxxxxxxxxGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0062_H01.b : xxxxxxxxxxxxxxxxxxxxxGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0201_F06.b : xxxxxxxxxxxxxxxxxxxxxGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0206_G08.b : xxxxxxxxxxxxxxxxxxxxxTGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0058_G06.b : xxxxxxxxxxxxxxxxxxxxxGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0204_E08.b : xxxxxxxxxxxxxxxxxxxxxGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0053_B10.b : xxxxxxxxxxxxxxxxxxxxxGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0107_G11.b : xxxxxxxxxxxxxxxxxxxxxGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0123_A09.b : xxxxxxxxxxxxxxxxxxxxxGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0115_H09.b : xxxxxxxxxxxxxxxxxxxacGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0030_B11.b : xxxxxxxxxxxxxxxxxxxxxGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0020_B08.b : xxxxxxxxxxxxxxxxxxxxxGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0117_E12.b : xxxxxxxxxxxxxxxxxxcctTGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0134_G06.b : xxxxxxxxxxxxxxxxxxxtgGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0077_G06.b : xxxxxxxxxxxxxxxxxxxxxGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0048_C05.b : xxxxxxxxxxxxxxxxxxxxxTGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0076_F07.b : xxxxxxxxxxxxxxxxxxxxxGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0148_H06.b : xxxxxxxxxxxxxxxxxxxxxxCAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0151_A08.b : xxxxxxxxxxxxxxxxxxxxxxGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0166_E12.b : xxxxxxxxxxxxxxxxxxxxxxGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0096_B07.b : xxxxxxxxxxxxxxxxxxxxxxGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0005_D02.b : xxxxxxxxxxxxxxxxxxxxxcGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0168_E06.b : xxxxxxxxxxxxxxxxxxxxxxCAGACTCACC*TCATCAGG**CCCTGCTGCA*GTAGGA
OVRM1_0102_G02.b : xxxxxxxxxxxxxxxxxxxxxxGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0216_G12.b : xxxxxxxxxxxxxxxxxxxxxxGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0188_F10.b : xxxxxxxxxxxxxxxxxxxxxxAAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0056_B09.b : xxxxxxxxxxxxxxxxxxxxxxGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0121_A12.b : xxxxxxxxxxxxxxxxxxxxxxCAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0025_G06.b : xxxxxxxxxxxxxxxxxxxxxxTAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0011_H08.b : xxxxxxxxxxxxxxxxxxxxxcGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0038_F09.b : xxxxxxxxxxxxxxxxxxxxxxCAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0111_D06.b : xxxxxxxxxxxxxxxxxxxxxxAAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0049_A10.b : gagtagccttgttggcctactgGAGACTCACC*TCATCAGG**CCCTGCCCCT*TTGGGA
OVRT1_0102_C07.b : xxxxxxxxxxxxxxxxxxxxxaCAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0099_B12.b : xxxxxxxxxxxxxxxxxxxxxxTAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0069_G06.b : xxxxxxxxxxxxxxxxxxatggCAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0099_A10.b : xxxxxxxxxxxxxxxxxxxxcgTAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0044_A05.b : xxxxxxxxxxxxxxxxxxxxxxCAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0120_D02.b : xxxxxxxxxxxxxxxxxxxxxxCAGATTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0061_C11.b : xxxxxxxxxxxxxxxxxxxxxxTAGACTCGCC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0134_A09.b : xxxxxxxxxxxxxxxxxxxxxxGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVR01_0007_A11.b : xxxxxxxxxxxxxxxxxxxxxxCAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0013_A10.b : xxxxxxxxxxxxxxxxxxxxxxTAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0059_B08.b : xxxxxxxxxxxxxxxxxxxxxxCAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0062_B06.b : xxxxxxxxxxxxxxxxxxxxxgTAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0011_B12.b : xxxxxxxxxxxxxxxxxxxxxxCAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0099_H11.b : xxxxxxxxxxxxxxxxxxxxxxTAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0223_D04.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0163_B07.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0200_F01.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0153_G05.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0192_B02.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0087_A04.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0199_C09.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0085_F01.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0099_C02.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0155_D09.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0185_D06.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0119_H06.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0056_D09.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0204_G10.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0184_H12.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0137_C07.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0108_H10.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0014_H02.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0140_F02.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0131_G03.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
PCT01_0003_F08.b : gctgggcccaggcgcccgaggccAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0102_H08.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0045_D08.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0131_A01.b : ctgggccccaggcgcccgaggccAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0147_E03.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0101_D03.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0006_B03.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0042_C08.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0111_A02.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0126_A12.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0056_E03.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0051_C07.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0049_D06.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0089_G09.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0079_D12.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0050_B01.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0136_E10.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0121_A06.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0003_A11.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0069_A03.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0045_H07.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0022_H05.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0026_A10.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0012_A03.b : ctgggccccaggcgcccgaggccAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0003_D12.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0124_B08.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0020_C05.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0012_E10.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0008_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0041_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0046_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0155_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0017_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCCTG**TTATGCTGCA*GTGGGA
OVRM1_0068_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0225_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0037_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0039_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAAG**CCCTGCTGCA*GTGGGA
OVRM1_0064_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0071_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVR01_0066_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0152_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0182_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0160_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0165_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0161_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0157_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0197_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0028_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0016_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0073_H05.b : tttttcctgctgttgctatggcGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0203_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0197_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0193_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0150_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0081_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0108_D03.b : xxxxxxxxxxxxxxxxxxxxxxxcGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0152_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0214_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0134_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0149_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0155_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0052_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0073_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0034_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTTACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0134_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0074_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0154_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0059_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0065_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0018_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0147_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0153_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0154_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0074_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0014_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0013_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0211_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0130_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TTATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0065_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0147_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0218_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0167_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACCCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0063_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0151_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0057_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0048_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0113_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0197_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0205_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0115_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0209_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0206_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0169_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0209_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0169_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0041_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0116_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0138_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0038_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0201_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0041_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0063_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0100_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0101_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0015_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCACC**CTCTGCTGCA*GTGGGA
OVRM1_0067_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0051_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0179_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0006_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0182_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0037_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxTACTCACC*TCATCAGG**CCCTGCTGCA*CTGGGA
OVRM1_0213_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0053_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATTAGG**CCCTGCTGCA*GTGGGA
OVRM1_0083_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0043_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0058_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0125_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0128_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0002_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCACG**CCCTGCTGCA*GTGGGA
OVRM1_0083_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACCCTCATCAGGGCCCTGGCTGCANGTGGGA
OVRM1_0128_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0060_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0025_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0043_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0068_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0033_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GAGGGA
OVRM1_0084_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0129_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0024_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0129_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0118_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0102_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0028_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0122_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0130_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0139_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0125_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0015_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0017_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0210_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0053_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0202_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0110_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0099_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0167_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0102_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0052_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0166_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0084_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0086_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0089_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0092_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0170_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0116_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0070_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0101_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0005_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0115_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCG*GTGGGA
OVRM1_0100_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0060_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0078_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0049_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0054_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0025_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0042_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0204_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0022_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0110_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0213_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0003_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0093_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0055_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0110_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0027_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0012_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0202_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0094_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0122_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCAACAGG**CCCTGCTGCA*GTGGGA
OVRM1_0025_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0026_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0105_A06.b : tttttcctgctgtggctctggAGACCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0012_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0011_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0026_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAAG**CCCTGCTGCA*GTGGGA
OVRT1_0131_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0007_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0023_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0131_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0089_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0030_E12.b : cggcgttggctatGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0131_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0046_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0142_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0040_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0013_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0008_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0107_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0103_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0146_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0056_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0014_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0064_A10.b : nnnnnxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0083_A05.b : xxxxxxxxxxxxxxxxxxxxcggtGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0105_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGG*A
OVRT1_0065_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0046_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCATG**CCCTGCTGCA*ATGGGA
OVRT1_0131_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0125_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0065_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0092_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0112_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0069_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0040_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0114_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0080_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0011_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0047_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAAG**CCCTGCTGCA*GTGGGA
OVRT1_0142_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0073_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0083_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0114_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0009_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0084_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0131_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0076_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0016_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0115_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0083_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0129_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0071_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0073_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0039_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0014_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0109_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0025_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0041_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0092_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0141_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0053_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0002_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0042_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0124_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0029_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0139_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0151_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0034_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0050_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0111_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0011_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0044_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0077_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0135_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0031_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0105_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0118_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0077_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0044_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0129_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0050_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0074_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0024_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0011_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0100_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0034_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0052_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0105_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0002_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0041_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0050_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0084_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0106_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0030_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0121_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0121_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0086_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0012_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCGGG**CCCTGCTGCA*GTGGGA
OVRT1_0027_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0077_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0056_E05.b : nxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0125_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0098_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0002_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCACG**CCCTGCTGCA*GTGGGA
OVRT1_0057_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0091_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0126_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0081_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0096_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0078_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0066_F07.b : nnnxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0060_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0093_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0051_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0126_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0054_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0075_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0100_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0077_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0107_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0069_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0011_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0133_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0039_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0093_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0068_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0063_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0089_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVR01_0005_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0065_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TTATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0151_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0033_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0091_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0057_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCACG**CCCTGCTGCA*GTGGGA
OVRT1_0035_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0093_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0050_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0056_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0094_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0078_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0031_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVR01_0017_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0082_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0095_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0055_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0068_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0094_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0048_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0057_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0085_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0101_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0083_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0098_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0068_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0150_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxtACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0119_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxcACTTACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0089_B04.b : xxxxxxxxxxxxxxxxxxxxxxxatACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0145_D12.b : xxxxxxxxxxxxxxxxxxxxxxxatACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0094_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0010_H09.b : xxxxxxxxxxxxxxxxxxxxxcgatACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0076_G06.b : xxxxxxxxxxxxxxxxxxxxxxxatACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0044_F07.b : xxxxxxxxxxxxxxxxxxxxxxxatACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0090_D02.b : xxxxxxxxxxxxxxxxxxxxxxxatACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0068_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0052_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxtACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0047_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0078_F02.b : ttcccgctgtggctatggctgggCTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0075_B05.b : tttttcgctgttgctatgCTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0221_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0151_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0126_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0095_A07.b : tttttcctcgcgttggcttggaATCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0056_G01.b : ntttcctgcgttgctactggaATCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0076_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0097_D11.b : tttttccggagtggctctggctggagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0112_E11.b : tttcctgcgttggctatgagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0026_C02.b : tgtggctctggctctggggagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0090_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0035_H05.b : tttttcctgctgtggctatggagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0022_E08.b : tcgcgttggctatggagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0107_F08.b : ttttncctgctgtggctatgggagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0100_B10.b : tttccggcgtggctatggagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0083_C03.b : tttttcctgcgttggctctggagaCCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0092_H08.b : tttttcctgacgttgctagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0017_H10.b : xxxxxxxxxxxxxxxxxxxxxxxcgatTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0013_F09.b : ttttcctaacggttgctatggagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0012_F02.b : ttctactgtggctctgggagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0104_B12.b : nntttcctactgttgctatggagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0017_H01.b : tttggctctggtggagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0092_F11.b : nnggtgactgtggctagcgacTCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0063_E04.b : ntttctgcgtggctatggagaTCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0111_G06.b : ncctgctgtggctctggagaTCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0188_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0052_G04.b : nnnttctactgttgctctggagaTCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0084_H03.b : tttttcctgcggtggctatggagaTCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0054_C05.b : ncctacggtggctctggagaTCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0056_F08.b : ttttctgctgtggctctggagaTCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0058_C10.b : tcgctgttggctgagaTCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0100_H12.b : ntttactacgttggctatggagaTCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0093_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0011_A12.b : tcgcgttggctctggagaTCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0003_A05.b : tttcgctgtggctctggcaacTCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0111_H12.b : ttcctgctgttgctctggagacCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0079_E09.b : ttttttcctactgttgctatgggagacCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0081_A02.b : tggaaaactgCC*TCGTCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0166_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0021_F12.b : gttggctctgggggagatcCC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0119_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxccacttCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0019_C11.b : gttggctcagactcCC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0073_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0092_A02.b : xxxxxxxxxxxxxxxxxxxxxacagtaatagC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0111_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0140_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0025_A12.b : acctcTCAGG**CCCTGCTGCA*GTGGGA
TES01_0063_B06.b : tttcctgcgtggctatgagatcacctcTCAGG**CCCTGCTGCA*GTGGGA
TES01_0021_F02.b : tttctgctgttgctctggagaccactcTCAGG**CCCTGCTGCA*GTGGGA
TES01_0031_A12.b : ttttcctaacggttgctatggagatcactcTCAGG**CCCTGCTGCA*GTGGGA
TES01_0070_A06.b : tttttgctgctgttgctagatcactcnCAGG**CCCTGCTGCA*GTGGGA
TES01_0018_G07.b : ccgcgttggctatggagaccactcnCAGG**CCCTGCTGCA*GTGGGA
PCT01_0031_H09.b : cttttnnnnnnngcagcgttggccanggntctactcatcGG**CCCTGCCGCA*NTGGGA
PCT01_0003_E06.b : ttcggttaannnnnncctgcgggtgctaaatccctcatcGG**CCCTGCTGCA*GTGGGA
OVRM1_0021_F03.b : G**CCCTGGTGCA*GTGGGA
TES01_0095_G02.b : ttttactcgcgttgctcatcaggcccGCTGCA*GTGGGA
OVRM1_0044_E06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGAGA
ADR01_0099_A01.b : ttaaagtgagtaac
OVRM1_0064_E06.b :
OVRM1_0219_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxagtcaattgcgtctcgacccgctgccgcgccac
OVRT1_0077_F08.b : gcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0101_C12.b :
OVRM1_0155_E05.b :
OVRM1_0189_D06.b :
OVRM1_0047_H02.b :
OVRM1_0016_H03.b :
OVRM1_0004_E03.b :
OVRM1_0126_A12.b :
OVRM1_0220_B01.b :
OVRM1_0174_H12.b :
ADR01_0055_H06.b :
ADR01_0093_G08.b :
OVRM1_0201_H02.b :
ADR01_0015_F09.b :
OVRM1_0104_F02.b :
OVRM1_0016_H07.b :
OVRM1_0038_H04.b :
OVRM1_0030_F08.b :
OVRM1_0058_E02.b :
ADR01_0012_H04.b :
20110601C-006984 : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
---------+---------+---------+---------+---------+---------+ 104
OVRM1_0209_G04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0222_F02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0168_E07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0100_A06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0090_H12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0034_D06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0101_E11.b : GCAGG*GACAGTATCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0131_B12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0079_C10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0161_D01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0076_E10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0018_E05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0038_G03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0095_B08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0025_B01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0011_C01.b : GCAGG*GAGATTAGCACTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0091_C05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0195_D02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0035_B03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0104_B11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0037_A02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0008_A11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0024_G05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0146_B02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0058_D10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0090_H04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0026_C01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0036_D04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0033_H12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0084_F09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0035_D04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0088_E10.b : GCAGG*GAGAGTAGTAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0074_A07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0039_E10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0096_G04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0062_H01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0201_F06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0206_G08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0058_G06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0204_E08.b : GCAGG*GAGAGTAGCGGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0053_B10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0107_G11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0123_A09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0115_H09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0030_B11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0020_B08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0117_E12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0134_G06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0077_G06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0048_C05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0076_F07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0148_H06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0151_A08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0166_E12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0096_B07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCCCCG
OVRM1_0005_D02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0168_E06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0102_G02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0216_G12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0188_F10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0056_B09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0121_A12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0025_G06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0011_H08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0038_F09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0111_D06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCA
TES01_0049_A10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATCC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0102_C07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0099_B12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0069_G06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0099_A10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0044_A05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0120_D02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0061_C11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0134_A09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVR01_0007_A11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0013_A10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0059_B08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0062_B06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0011_B12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0099_H11.b : GCAGG*GAGAGTAGTAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0223_D04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0163_B07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0200_F01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0153_G05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0192_B02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0087_A04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0199_C09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0085_F01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0099_C02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0155_D09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0185_D06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0119_H06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0056_D09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0204_G10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0184_H12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0137_C07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0108_H10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0014_H02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0140_F02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0131_G03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
PCT01_0003_F08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0102_H08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0045_D08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0131_A01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0147_E03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0101_D03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0006_B03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0042_C08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0111_A02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0126_A12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0056_E03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0051_C07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0049_D06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0089_G09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0079_D12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0050_B01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0136_E10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0121_A06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0003_A11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0069_A03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0045_H07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0022_H05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0026_A10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0012_A03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0003_D12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0124_B08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0020_C05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0012_E10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0008_C10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0041_G01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0046_B09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0155_C08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0017_D03.b : GCAGG*GAGAGTAGCAGTGG*TCC*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0068_H06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0225_F12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0037_B05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0039_D09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0064_C05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0071_A08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVR01_0066_B08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCCCCG
OVRM1_0152_C04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0182_F08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCC*
OVRM1_0160_H07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0165_B02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0161_C10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0157_F04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0197_B04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0028_A03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0016_E06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0073_H05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0203_G04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0197_F04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0193_G04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0150_E06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0081_E07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0108_D03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0152_H08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0214_B01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0134_B04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0149_H05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0155_D02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0052_B01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0073_C06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0034_A08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0134_H10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0074_F05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0154_G07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGACCAGGG*GGCTTGCCCTCCG
OVRM1_0059_A02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0065_F04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0018_C04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0147_C12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0153_H10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0154_E11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0074_D06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0014_A04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0013_A03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0211_H03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0130_C02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0065_E04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0147_H09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0218_B03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0167_C04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0063_C06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0151_D09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0057_F04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0048_D11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0113_C01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0197_F12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0205_D04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0115_D01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0209_A08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0206_C01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0169_E04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0209_A07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0169_D04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0041_C12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0116_C01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0138_G02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0038_G01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0201_D04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0041_F06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0063_C02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0100_A02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0101_F02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0015_F03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0067_E11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0051_C05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0179_C09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0006_F01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0182_B11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0037_D05.b : GCATG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0213_B06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0053_A09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0083_A06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0043_E11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0058_E11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0125_D11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0128_B11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0002_B08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0083_B02.b : GCAGGNGAGAGTAGCAGTGGGTAGGGNGCAGCATGCTTGGCCAGGGNGGCTTGCCCTCCG
OVRM1_0128_H12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0060_C07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0025_B07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0043_C09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0068_E12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGGAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0033_H11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0084_C05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0129_D09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0024_F02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0129_E03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0118_B11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0102_A05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0028_F10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0122_B03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0130_F10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0139_F06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0125_E11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0015_A08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0017_E08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0210_G10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0053_B09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0202_G08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0110_A04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0099_D12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0167_G07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0102_E10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0052_C11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0166_B04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0084_D08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0086_G06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0089_H07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0092_C11.b : GCAGG*GAGAGCAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0170_D10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0116_H07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0070_E09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0101_H04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0005_A11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0115_C06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0100_H04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0060_C10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0078_B12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0049_C12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0054_D10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0025_H03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0042_A09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0204_F10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GACTTGCCCTCCG
OVRM1_0022_A04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0110_A12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCTG
OVRM1_0213_C10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0003_H12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0093_A08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0055_D12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0110_F10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0027_B10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0012_B06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0202_D12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0094_E08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0122_E08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0025_B07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0026_H12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0105_A06.b : GCAGG*GAGAGTAGCGGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0012_F10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0011_C11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0026_C02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0131_C01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0007_G11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0023_D01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0131_E10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0089_C09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0030_E12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0131_E01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0046_F08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0142_C11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0040_E04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0013_F03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCTGGG*GGCTTGCCCTCCG
ADR01_0008_E04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0107_H10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0103_D08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0146_H11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0056_H11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0014_D04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0064_A10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0083_A05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0105_H03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0065_C04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0046_C01.b : GCAGG*GAGAGTATCAGTGG*TAG*GGGCGGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0131_D01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0125_H07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0065_C01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0092_H04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0112_G12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0069_E06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0040_F06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0114_A04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0080_D08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0011_G03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0047_F02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0142_F01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0073_H01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0083_G08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0114_H02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0009_H05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0084_E08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0131_C09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0076_G04.b : GCACG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0016_G11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0115_E04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0083_G05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0129_D07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0071_A02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0073_C11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0039_F01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0014_D12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0109_G08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0025_A01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0041_A12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0092_A10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0141_C03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0053_D04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0002_C06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0042_E07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0124_G05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0029_F09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0139_G04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0151_D11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0034_A11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0050_B08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0111_F06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0011_D12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0044_A11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0077_A05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0135_H01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0031_C09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0105_E02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0118_C04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0077_H01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0044_D01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0129_G10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0050_F11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0074_B07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0024_E02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0011_A03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0100_G01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0034_A01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0052_E08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0105_C12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0002_F02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0041_E06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0050_D04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0084_F12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0106_A12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0030_G12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0121_F03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0121_B03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0086_C09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0012_D11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0027_D01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0077_H08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0056_E05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0125_E05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0098_C06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0002_H05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0057_H12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0091_B08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0126_C10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0081_D11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0096_A11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0078_A09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0066_F07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0060_C04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0093_A09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0051_G05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0126_A02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0054_D10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0075_D07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0100_B08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0077_G11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0107_B08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0069_A05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0011_H12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0133_F09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0039_C02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0093_F01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0068_G03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0063_D01.b : GCAGG*GAGAGTGGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0089_G03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVR01_0005_C04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0065_G10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0151_G10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0033_E01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0091_A02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0057_A05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0035_A04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0093_C11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0050_E07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0056_B06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0094_C10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0078_D02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0031_D02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVR01_0017_F06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0082_F05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0095_A11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0055_H09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0068_E08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGGAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0094_H08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0048_C11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0057_H08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0085_H02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0101_E12.b : GCAGG*GAGAGTAGCGGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0083_D11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0098_F04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0068_G09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0150_E06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0119_D08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0089_B04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0145_D12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0094_C07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0010_H09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0076_G06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0044_F07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0090_D02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0068_D10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0052_B08.b : GCAGG*GACAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0047_C08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0078_F02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0075_B05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0221_H02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0151_H10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0126_H10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0095_A07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0056_G01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0076_H12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0097_D11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0112_E11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0026_C02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0090_H03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0035_H05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0022_E08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0107_F08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0100_B10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0083_C03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0092_H08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0017_H10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0013_F09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0012_F02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0104_B12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0017_H01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0092_F11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0063_E04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0111_G06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0188_H04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0052_G04.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCTGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0084_H03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0054_C05.b : GCAGG*GAGAGTAGCAGTGG*TAGTGGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0056_F08.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0058_C10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0100_H12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0093_A06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0011_A12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0003_A05.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0111_H12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0079_E09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0081_A02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0166_H03.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0021_F12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0119_C10.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0019_C11.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0073_A09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0092_A02.b : GCAGG*GACCTTAACAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0111_B09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRT1_0140_G01.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0025_A12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0063_B06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0021_F02.b : GCAGG*AAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0031_A12.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0070_A06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0018_G07.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
PCT01_0031_H09.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
PCT01_0003_E06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0021_F03.b : GCCGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
TES01_0095_G02.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
OVRM1_0044_E06.b : GCAGG*GAGAGTAGCAGTGG*TAG*GGGCAGCATGC*TGGCCAGGG*GGCTTGCCCTCCG
ADR01_0099_A01.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGG*GGCTTGCCCTCCG
OVRM1_0064_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGCCCTCCG
OVRM1_0219_C06.b : catggatagtcacagcgatcaggcgcctcttgctcggccaggtcgccttggcacatccgc
OVRT1_0077_F08.b : gactcacctcatcaggccctgctgcagtgggagcagggagagtagcagtggtaggggcag
OVRM1_0101_C12.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0155_E05.b :
OVRM1_0189_D06.b :
OVRM1_0047_H02.b :
OVRM1_0016_H03.b :
OVRM1_0004_E03.b :
OVRM1_0126_A12.b :
OVRM1_0220_B01.b :
OVRM1_0174_H12.b :
ADR01_0055_H06.b :
ADR01_0093_G08.b :
OVRM1_0201_H02.b :
ADR01_0015_F09.b :
OVRM1_0104_F02.b :
OVRM1_0016_H07.b :
OVRM1_0038_H04.b :
OVRM1_0030_F08.b :
OVRM1_0058_E02.b :
ADR01_0012_H04.b :
20110601C-006984 : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
---------+---------+---------+---------+---------+---------+ 163
OVRM1_0209_G04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0222_F02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0168_E07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0100_A06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0090_H12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0034_D06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0101_E11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0131_B12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0079_C10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0161_D01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0076_E10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0018_E05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0038_G03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0095_B08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0025_B01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0011_C01.b : CTCATTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*ATGGC
OVRT1_0091_C05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0195_D02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0035_B03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0104_B11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0037_A02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0008_A11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0024_G05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0146_B02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0058_D10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0090_H04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0026_C01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0036_D04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0033_H12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0084_F09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0035_D04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0088_E10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0074_A07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0039_E10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0096_G04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0062_H01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0201_F06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0206_G08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0058_G06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0204_E08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0053_B10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0107_G11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0123_A09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0115_H09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0030_B11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0020_B08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0117_E12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0134_G06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0077_G06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0048_C05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0076_F07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0148_H06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0151_A08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0166_E12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0096_B07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0005_D02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0168_E06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0102_G02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0216_G12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0188_F10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0056_B09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0121_A12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0025_G06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0011_H08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0038_F09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0111_D06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0049_A10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0102_C07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0099_B12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0069_G06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0099_A10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0044_A05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0120_D02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0061_C11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0134_A09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVR01_0007_A11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGGGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0013_A10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0059_B08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0062_B06.b : CTCAGTCCTGGTCAAAGGCTGCCGGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0011_B12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0099_H11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0223_D04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0163_B07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0200_F01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0153_G05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0192_B02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0087_A04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0199_C09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0085_F01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0099_C02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0155_D09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0185_D06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0119_H06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0056_D09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0204_G10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0184_H12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0137_C07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0108_H10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0014_H02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0140_F02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0131_G03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
PCT01_0003_F08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0102_H08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0045_D08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0131_A01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0147_E03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0101_D03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0006_B03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0042_C08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0111_A02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0126_A12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0056_E03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0051_C07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0049_D06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0089_G09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0079_D12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0050_B01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0136_E10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0121_A06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0003_A11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0069_A03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0045_H07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0022_H05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0026_A10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0012_A03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0003_D12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0124_B08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0020_C05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0012_E10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0008_C10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0041_G01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0046_B09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0155_C08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0017_D03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0068_H06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0225_F12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0037_B05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0039_D09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0064_C05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0071_A08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVR01_0066_B08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0152_C04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0182_F08.b : *TCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0160_H07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0165_B02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0161_C10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0157_F04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0197_B04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0028_A03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0016_E06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0073_H05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0203_G04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0197_F04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0193_G04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0150_E06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0081_E07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0108_D03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0152_H08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0214_B01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0134_B04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0149_H05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0155_D02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0052_B01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0073_C06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0034_A08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0134_H10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0074_F05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0154_G07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0059_A02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0065_F04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0018_C04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0147_C12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0153_H10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCGGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0154_E11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0074_D06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0014_A04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGGGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0013_A03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0211_H03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0130_C02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0065_E04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0147_H09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0218_B03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0167_C04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0063_C06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0151_D09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0057_F04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0048_D11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0113_C01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0197_F12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0205_D04.b : CTCAGTCCTGGTCAAAGGCTGCCGGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0115_D01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0209_A08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0206_C01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0169_E04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0209_A07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0169_D04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0041_C12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0116_C01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0138_G02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0038_G01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0201_D04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0041_F06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0063_C02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0100_A02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0101_F02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0015_F03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0067_E11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0051_C05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0179_C09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0006_F01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0182_B11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0037_D05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0213_B06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0053_A09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0083_A06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0043_E11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0058_E11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0125_D11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0128_B11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0002_B08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0083_B02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0128_H12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0060_C07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0025_B07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0043_C09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0068_E12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0033_H11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0084_C05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0129_D09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0024_F02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCGGAGGGC
OVRM1_0129_E03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0118_B11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0102_A05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0028_F10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0122_B03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0130_F10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0139_F06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCCGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0125_E11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0015_A08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0017_E08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0210_G10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0053_B09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0202_G08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0110_A04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0099_D12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0167_G07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0102_E10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0052_C11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0166_B04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0084_D08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0086_G06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0089_H07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0092_C11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0170_D10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0116_H07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0070_E09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0101_H04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0005_A11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0115_C06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0100_H04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0060_C10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0078_B12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0049_C12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0054_D10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0025_H03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0042_A09.b : CTCAGTCCTGGTCAGAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0204_F10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0022_A04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0110_A12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0213_C10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0003_H12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0093_A08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0055_D12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0110_F10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0027_B10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0012_B06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0202_D12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0094_E08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0122_E08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGT
OVRM1_0025_B07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0026_H12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0105_A06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0012_F10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0011_C11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0026_C02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0131_C01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0007_G11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0023_D01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0131_E10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0089_C09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0030_E12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0131_E01.b : CTCAGTCCTGGTCAGAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGGGTGCCC*AGGGC
ADR01_0046_F08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0142_C11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0040_E04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0013_F03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0008_E04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0107_H10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0103_D08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0146_H11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0056_H11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0014_D04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0064_A10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0083_A05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0105_H03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0065_C04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0046_C01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0131_D01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0125_H07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0065_C01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0092_H04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0112_G12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0069_E06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0040_F06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0114_A04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0080_D08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0011_G03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0047_F02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0142_F01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0073_H01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0083_G08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0114_H02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0009_H05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0084_E08.b : CTCAGTCCTGGTCAAAGGCTGCTAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0131_C09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0076_G04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0016_G11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0115_E04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0083_G05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0129_D07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0071_A02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0073_C11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0039_F01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0014_D12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0109_G08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0025_A01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0041_A12.b : CTCAGTCCTGGTCAAACGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0092_A10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0141_C03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0053_D04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0002_C06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0042_E07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0124_G05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0029_F09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0139_G04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0151_D11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0034_A11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0050_B08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0111_F06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0011_D12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0044_A11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0077_A05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0135_H01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0031_C09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0105_E02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCCGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0118_C04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0077_H01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0044_D01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0129_G10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0050_F11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0074_B07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0024_E02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0011_A03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0100_G01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0034_A01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0052_E08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0105_C12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0002_F02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0041_E06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0050_D04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0084_F12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0106_A12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0030_G12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0121_F03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0121_B03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0086_C09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0012_D11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0027_D01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0077_H08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0056_E05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0125_E05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0098_C06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0002_H05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0057_H12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0091_B08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0126_C10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0081_D11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0096_A11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0078_A09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0066_F07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0060_C04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0093_A09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0051_G05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0126_A02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0054_D10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0075_D07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0100_B08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0077_G11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0107_B08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0069_A05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0011_H12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0133_F09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0039_C02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0093_F01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0068_G03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0063_D01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0089_G03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVR01_0005_C04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0065_G10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0151_G10.b : CACAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0033_E01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0091_A02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0057_A05.b : CTCACTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0035_A04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0093_C11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0050_E07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0056_B06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0094_C10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0078_D02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0031_D02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVR01_0017_F06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0082_F05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0095_A11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0055_H09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0068_E08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0094_H08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0048_C11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0057_H08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0085_H02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0101_E12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0083_D11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0098_F04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0068_G09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0150_E06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0119_D08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0089_B04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0145_D12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0094_C07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0010_H09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0076_G06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0044_F07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0090_D02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0068_D10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0052_B08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0047_C08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0078_F02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0075_B05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0221_H02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0151_H10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0126_H10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0095_A07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0056_G01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0076_H12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0097_D11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0112_E11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0026_C02.b : CTCAGTCCTGGTCAAAGGCCGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0090_H03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0035_H05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0022_E08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0107_F08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0100_B10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0083_C03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0092_H08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0017_H10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0013_F09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0012_F02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0104_B12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGTCCCTCGGGAGTGCCC*AGGGC
TES01_0017_H01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0092_F11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0063_E04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0111_G06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0188_H04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0052_G04.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0084_H03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0054_C05.b : CTCAGCCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0056_F08.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0058_C10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0100_H12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0093_A06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0011_A12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0003_A05.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0111_H12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0079_E09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0081_A02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0166_H03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0021_F12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0119_C10.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0019_C11.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0073_A09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0092_A02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0111_B09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0140_G01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0025_A12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0063_B06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0021_F02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0031_A12.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0070_A06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0018_G07.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
PCT01_0031_H09.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
PCT01_0003_E06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0021_F03.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
TES01_0095_G02.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0044_E06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
ADR01_0099_A01.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0064_E06.b : CTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0219_C06.b : aTCAGTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRT1_0077_F08.b : catgcTCCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0101_C12.b : xxxxxxxCTGGTCAAAGGCTGCCAGCCCTTCCTGAGTGCCCCTCGGGAGTGCCC*AGGGC
OVRM1_0155_E05.b : catxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC*AGGGC
OVRM1_0189_D06.b : xxxxxxx
OVRM1_0047_H02.b : a
OVRM1_0016_H03.b :
OVRM1_0004_E03.b :
OVRM1_0126_A12.b :
OVRM1_0220_B01.b :
OVRM1_0174_H12.b :
ADR01_0055_H06.b :
ADR01_0093_G08.b :
OVRM1_0201_H02.b :
ADR01_0015_F09.b :
OVRM1_0104_F02.b :
OVRM1_0016_H07.b :
OVRM1_0038_H04.b :
OVRM1_0030_F08.b :
OVRM1_0058_E02.b :
ADR01_0012_H04.b :
20110601C-006984 : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
---------+---------+---------+---------+---------+---------+ 222
OVRM1_0209_G04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0222_F02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0168_E07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0100_A06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0090_H12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0034_D06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0101_E11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0131_B12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0079_C10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0161_D01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0076_E10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATACATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0018_E05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0038_G03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0095_B08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0025_B01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0011_C01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0091_C05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0195_D02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0035_B03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0104_B11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0037_A02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0008_A11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0024_G05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0146_B02.b : ATCCCAGGGTGGGC*GCTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0058_D10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTCC
OVRT1_0090_H04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0026_C01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCACGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0036_D04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0033_H12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0084_F09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0035_D04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0088_E10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0074_A07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0039_E10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0096_G04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0062_H01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0201_F06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTG
OVRM1_0206_G08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0058_G06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0204_E08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0053_B10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0107_G11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0123_A09.b : ATCCCAGGGTGGGC*GCTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0115_H09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0030_B11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0020_B08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0117_E12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0134_G06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0077_G06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0048_C05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0076_F07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0148_H06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0151_A08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0166_E12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0096_B07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0005_D02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0168_E06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0102_G02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0216_G12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0188_F10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0056_B09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACCAAAACCCCTCGCCCCTTC
OVRM1_0121_A12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0025_G06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0011_H08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0038_F09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0111_D06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0049_A10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0102_C07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0099_B12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0069_G06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0099_A10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0044_A05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0120_D02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0061_C11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0134_A09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGAATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVR01_0007_A11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0013_A10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0059_B08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0062_B06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0011_B12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0099_H11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0223_D04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0163_B07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0200_F01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0153_G05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0192_B02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0087_A04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0199_C09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0085_F01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0099_C02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0155_D09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0185_D06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0119_H06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0056_D09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0204_G10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0184_H12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0137_C07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0108_H10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCTCCTTC
OVRT1_0014_H02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0140_F02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCTTCGCCCCTTC
OVRT1_0131_G03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
PCT01_0003_F08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0102_H08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0045_D08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0131_A01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0147_E03.b : ATCCCAGGGTGGGC*ACTGGAGGGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0101_D03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0006_B03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0042_C08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0111_A02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0126_A12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0056_E03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0051_C07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0049_D06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0089_G09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0079_D12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0050_B01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0136_E10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0121_A06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0003_A11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0069_A03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0045_H07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0022_H05.b : ATCCCAGGGTGGGT*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0026_A10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0012_A03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0003_D12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0124_B08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0020_C05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0012_E10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0008_C10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0041_G01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0046_B09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0155_C08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0017_D03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0068_H06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0225_F12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0037_B05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0039_D09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0064_C05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0071_A08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVR01_0066_B08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0152_C04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0182_F08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0160_H07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0165_B02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0161_C10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0157_F04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0197_B04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0028_A03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0016_E06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0073_H05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0203_G04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0197_F04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0193_G04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0150_E06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0081_E07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0108_D03.b : ATCCCAAGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0152_H08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0214_B01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0134_B04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0149_H05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0155_D02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0052_B01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0073_C06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0034_A08.b : ATCCCAGGGTGGTTTTTTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0134_H10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0074_F05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0154_G07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0059_A02.b : ATCCCTGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0065_F04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0018_C04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0147_C12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0153_H10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0154_E11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0074_D06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0014_A04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0013_A03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0211_H03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0130_C02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0065_E04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0147_H09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0218_B03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0167_C04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0063_C06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0151_D09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0057_F04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0048_D11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0113_C01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0197_F12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0205_D04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0115_D01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0209_A08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0206_C01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0169_E04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0209_A07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0169_D04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0041_C12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0116_C01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0138_G02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0038_G01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0201_D04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0041_F06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0063_C02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0100_A02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0101_F02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0015_F03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0067_E11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0051_C05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0179_C09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0006_F01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0182_B11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0037_D05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCACCCCTTC
OVRM1_0213_B06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0053_A09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0083_A06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0043_E11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0058_E11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0125_D11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0128_B11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0002_B08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0083_B02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0128_H12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0060_C07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0025_B07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0043_C09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0068_E12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0033_H11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0084_C05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0129_D09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0024_F02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0129_E03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0118_B11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0102_A05.b : ATCCCAGGGTGGGC*ACTGGAGTGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0028_F10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0122_B03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0130_F10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0139_F06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0125_E11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0015_A08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0017_E08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0210_G10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0053_B09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0202_G08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0110_A04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0099_D12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0167_G07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0102_E10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0052_C11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0166_B04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0084_D08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0086_G06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0089_H07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0092_C11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0170_D10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0116_H07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0070_E09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0101_H04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0005_A11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0115_C06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0100_H04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0060_C10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0078_B12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0049_C12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0054_D10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0025_H03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0042_A09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0204_F10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0022_A04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0110_A12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0213_C10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0003_H12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0093_A08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0055_D12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0110_F10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0027_B10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0012_B06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0202_D12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0094_E08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0122_E08.b : ATCCCAGAGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0025_B07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0026_H12.b : ATCCCAGGGCGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0105_A06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0012_F10.b : GTCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0011_C11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0026_C02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0131_C01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0007_G11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0023_D01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0131_E10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0089_C09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0030_E12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTTGCCCCTTC
OVRT1_0131_E01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0046_F08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0142_C11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0040_E04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0013_F03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0008_E04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0107_H10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0103_D08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0146_H11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0056_H11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0014_D04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0064_A10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0083_A05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0105_H03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0065_C04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0046_C01.b : ATCCCAGGGTGGGC*ACTGGAAAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0131_D01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0125_H07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0065_C01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTTGCCCCTTC
OVRT1_0092_H04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0112_G12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0069_E06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0040_F06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCCTC
OVRT1_0114_A04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0080_D08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0011_G03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0047_F02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0142_F01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0073_H01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0083_G08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0114_H02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0009_H05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0084_E08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0131_C09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0076_G04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0016_G11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0115_E04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0083_G05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0129_D07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0071_A02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0073_C11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0039_F01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCCCGCCCCTTC
OVRT1_0014_D12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0109_G08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0025_A01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0041_A12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0092_A10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0141_C03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0053_D04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0002_C06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0042_E07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0124_G05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0029_F09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0139_G04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0151_D11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0034_A11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0050_B08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0111_F06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0011_D12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0044_A11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0077_A05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0135_H01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0031_C09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0105_E02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0118_C04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0077_H01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0044_D01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0129_G10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0050_F11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0074_B07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0024_E02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0011_A03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0100_G01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0034_A01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0052_E08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0105_C12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0002_F02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0041_E06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0050_D04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0084_F12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0106_A12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0030_G12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0121_F03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0121_B03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0086_C09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0012_D11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0027_D01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGGGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0077_H08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0056_E05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0125_E05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0098_C06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0002_H05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0057_H12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0091_B08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0126_C10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0081_D11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0096_A11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0078_A09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0066_F07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0060_C04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0093_A09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0051_G05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0126_A02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0054_D10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0075_D07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0100_B08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCCCCACTAAAACCCCTCGCCCCTTC
ADR01_0077_G11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0107_B08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0069_A05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0011_H12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0133_F09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0039_C02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0093_F01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0068_G03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0063_D01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0089_G03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVR01_0005_C04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0065_G10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0151_G10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0033_E01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0091_A02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0057_A05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0035_A04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0093_C11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0050_E07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0056_B06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0094_C10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0078_D02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0031_D02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVR01_0017_F06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0082_F05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCACCCCTTC
ADR01_0095_A11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0055_H09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0068_E08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0094_H08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0048_C11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0057_H08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0085_H02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0101_E12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0083_D11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0098_F04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0068_G09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0150_E06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0119_D08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCTACTAAAACCCCTCGCCCCTTC
OVRT1_0089_B04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0145_D12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0094_C07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0010_H09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0076_G06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0044_F07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0090_D02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0068_D10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0052_B08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0047_C08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0078_F02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0075_B05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0221_H02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0151_H10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0126_H10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0095_A07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0056_G01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0076_H12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0097_D11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCGTGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0112_E11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0026_C02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0090_H03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0035_H05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0022_E08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0107_F08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0100_B10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0083_C03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0092_H08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0017_H10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0013_F09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0012_F02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0104_B12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0017_H01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0092_F11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0063_E04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0111_G06.b : ATCCCAGGGTGGGC*ACTGGTGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0188_H04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCCCCACTAAAACCCCTCGCCCCTTC
TES01_0052_G04.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0084_H03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0054_C05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0056_F08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0058_C10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0100_H12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0093_A06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0011_A12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0003_A05.b : ATTCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0111_H12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0079_E09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0081_A02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAGACCCCTCGCCCCTTC
OVRM1_0166_H03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0021_F12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0119_C10.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0019_C11.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0073_A09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0092_A02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0111_B09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0140_G01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0025_A12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0063_B06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0021_F02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0031_A12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0070_A06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0018_G07.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
PCT01_0031_H09.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
PCT01_0003_E06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0021_F03.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
TES01_0095_G02.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0044_E06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
ADR01_0099_A01.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0064_E06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0219_C06.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRT1_0077_F08.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0101_C12.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0155_E05.b : ATCCCAGGGTGGGC*ACTGGAGAGGGAGCATGCATCTCCACTAAAACCCCTCGCCCCTTC
OVRM1_0189_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAAAACCCCTCGCCCCTTC
OVRM1_0047_H02.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0016_H03.b : cxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0004_E03.b :
OVRM1_0126_A12.b :
OVRM1_0220_B01.b :
OVRM1_0174_H12.b :
ADR01_0055_H06.b :
ADR01_0093_G08.b :
OVRM1_0201_H02.b :
ADR01_0015_F09.b :
OVRM1_0104_F02.b :
OVRM1_0016_H07.b :
OVRM1_0038_H04.b :
OVRM1_0030_F08.b :
OVRM1_0058_E02.b :
ADR01_0012_H04.b :
20110601C-006984 : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
---------+---------+---------+---------+---------+---------+ 281
OVRM1_0209_G04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGGAGGA
OVRM1_0222_F02.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0168_E07.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0100_A06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0090_H12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0034_D06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0101_E11.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0131_B12.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0079_C10.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0161_D01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0076_E10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0018_E05.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0038_G03.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0095_B08.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0025_B01.b : AGTGAGATCCCCTCTCTTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0011_C01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0091_C05.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0195_D02.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0035_B03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0104_B11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0037_A02.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0008_A11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0024_G05.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0146_B02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0058_D10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0090_H04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0026_C01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0036_D04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0033_H12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0084_F09.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0035_D04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0088_E10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0074_A07.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0039_E10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0096_G04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0062_H01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0201_F06.b : GGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0206_G08.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0058_G06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0204_E08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0053_B10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0107_G11.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0123_A09.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0115_H09.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0030_B11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0020_B08.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0117_E12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0134_G06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0077_G06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0048_C05.b : AGTGAGATCCCCCCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0076_F07.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0148_H06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0151_A08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0166_E12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0096_B07.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0005_D02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0168_E06.b : AGTGAGATTCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0102_G02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0216_G12.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0188_F10.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0056_B09.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0121_A12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0025_G06.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0011_H08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0038_F09.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0111_D06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0049_A10.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0102_C07.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0099_B12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0069_G06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0099_A10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0044_A05.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0120_D02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0061_C11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0134_A09.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVR01_0007_A11.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0013_A10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0059_B08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0062_B06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0011_B12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0099_H11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0223_D04.b : AGTGAGATCCCCTCTCCTGGTGACAGTGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0163_B07.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0200_F01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATCAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0153_G05.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0192_B02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0087_A04.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0199_C09.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0085_F01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0099_C02.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0155_D09.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0185_D06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0119_H06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0056_D09.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0204_G10.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0184_H12.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0137_C07.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0108_H10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0014_H02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0140_F02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0131_G03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
PCT01_0003_F08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0102_H08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0045_D08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0131_A01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0147_E03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0101_D03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0006_B03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0042_C08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0111_A02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0126_A12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0056_E03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0051_C07.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0049_D06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0089_G09.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0079_D12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0050_B01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0136_E10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0121_A06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0003_A11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0069_A03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0045_H07.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0022_H05.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0026_A10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0012_A03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0003_D12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0124_B08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0020_C05.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0012_E10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0008_C10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0041_G01.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0046_B09.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0155_C08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0017_D03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0068_H06.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0225_F12.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0037_B05.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGGTTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0039_D09.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0064_C05.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0071_A08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVR01_0066_B08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0152_C04.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0182_F08.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0160_H07.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0165_B02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0161_C10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0157_F04.b : AGTGAGATCCCCTCTCCTGGTGACAATCGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0197_B04.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0028_A03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0016_E06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0073_H05.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0203_G04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0197_F04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0193_G04.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0150_E06.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0081_E07.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0108_D03.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCCGGAAGGA
OVRM1_0152_H08.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0214_B01.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0134_B04.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0149_H05.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0155_D02.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0052_B01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTTTGGAAGGA
OVRM1_0073_C06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0034_A08.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0134_H10.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0074_F05.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0154_G07.b : AGTGAAATTCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0059_A02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0065_F04.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0018_C04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0147_C12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0153_H10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0154_E11.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0074_D06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0014_A04.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0013_A03.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0211_H03.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0130_C02.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0065_E04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0147_H09.b : AGCGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0218_B03.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0167_C04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0063_C06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATCAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0151_D09.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0057_F04.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0048_D11.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0113_C01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0197_F12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0205_D04.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0115_D01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0209_A08.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0206_C01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0169_E04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0209_A07.b : GGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0169_D04.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0041_C12.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0116_C01.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0138_G02.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0038_G01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0201_D04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0041_F06.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0063_C02.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0100_A02.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0101_F02.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0015_F03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0067_E11.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0051_C05.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0179_C09.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0006_F01.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0182_B11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0037_D05.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0213_B06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0053_A09.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0083_A06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0043_E11.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0058_E11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0125_D11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0128_B11.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0002_B08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0083_B02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0128_H12.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0060_C07.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0025_B07.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0043_C09.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0068_E12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0033_H11.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0084_C05.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0129_D09.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0024_F02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0129_E03.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0118_B11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0102_A05.b : AGTGAAATCCCCTCTCCTGGTGACAAAGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0028_F10.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0122_B03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0130_F10.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0139_F06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0125_E11.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0015_A08.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0017_E08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0210_G10.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0053_B09.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0202_G08.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0110_A04.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0099_D12.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0167_G07.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0102_E10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0052_C11.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0166_B04.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0084_D08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0086_G06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0089_H07.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0092_C11.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0170_D10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0116_H07.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0070_E09.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0101_H04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0005_A11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0115_C06.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0100_H04.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0060_C10.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0078_B12.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0049_C12.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0054_D10.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0025_H03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0042_A09.b : AGTGGAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0204_F10.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0022_A04.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGGAGGA
OVRM1_0110_A12.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGG
OVRM1_0213_C10.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0003_H12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0093_A08.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0055_D12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0110_F10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0027_B10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0012_B06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0202_D12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0094_E08.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0122_E08.b : AGTGAGATCCCCTCTCCTGGTGACGATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0025_B07.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0026_H12.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0105_A06.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0012_F10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0011_C11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0026_C02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0131_C01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0007_G11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0023_D01.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0131_E10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0089_C09.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0030_E12.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0131_E01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0046_F08.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0142_C11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0040_E04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0013_F03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0008_E04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0107_H10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0103_D08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0146_H11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0056_H11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0014_D04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0064_A10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0083_A05.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0105_H03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0065_C04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TCCTGGAAGGA
OVRT1_0046_C01.b : ATTGAGATCCCCTCTCCTGGTGACAATGACTGGATTAACCTGTACCGT*TTCTGGAATGA
OVRT1_0131_D01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0125_H07.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0065_C01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0092_H04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0112_G12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0069_E06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0040_F06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0114_A04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0080_D08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0011_G03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0047_F02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0142_F01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0073_H01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0083_G08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0114_H02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0009_H05.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0084_E08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0131_C09.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0076_G04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0016_G11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCCGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0115_E04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0083_G05.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0129_D07.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0071_A02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0073_C11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0039_F01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0014_D12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0109_G08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0025_A01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0041_A12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0092_A10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0141_C03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0053_D04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0002_C06.b : AGTGAGATACCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0042_E07.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0124_G05.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0029_F09.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0139_G04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0151_D11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0034_A11.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0050_B08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0111_F06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0011_D12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0044_A11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0077_A05.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0135_H01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGAATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0031_C09.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0105_E02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0118_C04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0077_H01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0044_D01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0129_G10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0050_F11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0074_B07.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0024_E02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0011_A03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0100_G01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0034_A01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0052_E08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0105_C12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0002_F02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0041_E06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0050_D04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0084_F12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0106_A12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0030_G12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0121_F03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0121_B03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0086_C09.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0012_D11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0027_D01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0077_H08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0056_E05.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0125_E05.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0098_C06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0002_H05.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0057_H12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0091_B08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0126_C10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0081_D11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0096_A11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0078_A09.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0066_F07.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0060_C04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0093_A09.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0051_G05.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0126_A02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0054_D10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0075_D07.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0100_B08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0077_G11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0107_B08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0069_A05.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0011_H12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0133_F09.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0039_C02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0093_F01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0068_G03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0063_D01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0089_G03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVR01_0005_C04.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0065_G10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0151_G10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0033_E01.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0091_A02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0057_A05.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0035_A04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0093_C11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0050_E07.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0056_B06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0094_C10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0078_D02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0031_D02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVR01_0017_F06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0082_F05.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0095_A11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0055_H09.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0068_E08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0094_H08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0048_C11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0057_H08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0085_H02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0101_E12.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0083_D11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0098_F04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0068_G09.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0150_E06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0119_D08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0089_B04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0145_D12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0094_C07.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0010_H09.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0076_G06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0044_F07.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0090_D02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0068_D10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0052_B08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0047_C08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0078_F02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0075_B05.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0221_H02.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0151_H10.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0126_H10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0095_A07.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0056_G01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0076_H12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0097_D11.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0112_E11.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0026_C02.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0090_H03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0035_H05.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0022_E08.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0107_F08.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0100_B10.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0083_C03.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0092_H08.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0017_H10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0013_F09.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0012_F02.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0104_B12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0017_H01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0092_F11.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0063_E04.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0111_G06.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0188_H04.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0052_G04.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0084_H03.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0054_C05.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0056_F08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0058_C10.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0100_H12.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0093_A06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0011_A12.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0003_A05.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0111_H12.b : AGTGAAATCCCCTCTCCTGGTGACAATGACTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0079_E09.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0081_A02.b : AGTGAGATGCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGTGTTCTGGAAGGA
OVRM1_0166_H03.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0021_F12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0119_C10.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0019_C11.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0073_A09.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0092_A02.b : AGTGAGATCCCCTCTCCTGCTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0111_B09.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0140_G01.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0025_A12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0063_B06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0021_F02.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0031_A12.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0070_A06.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0018_G07.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
PCT01_0031_H09.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
PCT01_0003_E06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0021_F03.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
TES01_0095_G02.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0044_E06.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
ADR01_0099_A01.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0064_E06.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0219_C06.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRT1_0077_F08.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0101_C12.b : AGTGAGATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0155_E05.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0189_D06.b : AGTGAAATCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0047_H02.b : xxxxxxxTCCCCTCTCCTGGTGACAATGGCTGGATTAACCTGTACCGT*TTCTGGAAGGA
OVRM1_0016_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGTACCGT*TTCTGGAAGGA
OVRM1_0004_E03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0126_A12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0220_B01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0174_H12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0055_H06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ADR01_0093_G08.b : nccattaaannnnnggataaagcagcxxx
OVRM1_0201_H02.b : agttgtcatxxxxxxxxxxxx
ADR01_0015_F09.b :
OVRM1_0104_F02.b :
OVRM1_0016_H07.b :
OVRM1_0038_H04.b :
OVRM1_0030_F08.b :
OVRM1_0058_E02.b :
ADR01_0012_H04.b :
20110601C-006984 : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
---------+---------+---------+---------+---------+---------+ 340
OVRM1_0209_G04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0222_F02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0168_E07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0100_A06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0090_H12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0034_D06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0101_E11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0131_B12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0079_C10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0161_D01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTTCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0076_E10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0018_E05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0038_G03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0095_B08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0025_B01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0011_C01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0091_C05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0195_D02.b : GAAGGGCACACAGAAAATCCACTACCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0035_B03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0104_B11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0037_A02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0008_A11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0024_G05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0146_B02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0058_D10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0090_H04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0026_C01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0036_D04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0033_H12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0084_F09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0035_D04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0088_E10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0074_A07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GGAGTATGGTCCCA
OVRM1_0039_E10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0096_G04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0062_H01.b : GAAGGGCACACAGAANATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0201_F06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0206_G08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0058_G06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0204_E08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0053_B10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0107_G11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0123_A09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0115_H09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0030_B11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0020_B08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0117_E12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0134_G06.b : GAAGGGTACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0077_G06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0048_C05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0076_F07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0148_H06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0151_A08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0166_E12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0096_B07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0005_D02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0168_E06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0102_G02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0216_G12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0188_F10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0056_B09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0121_A12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0025_G06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0011_H08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0038_F09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0111_D06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0049_A10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0102_C07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0099_B12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0069_G06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0099_A10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0044_A05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0120_D02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0061_C11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0134_A09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVR01_0007_A11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0013_A10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0059_B08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0062_B06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0011_B12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0099_H11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0223_D04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0163_B07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0200_F01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0153_G05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0192_B02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0087_A04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0199_C09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0085_F01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0099_C02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0155_D09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0185_D06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0119_H06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0056_D09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0204_G10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0184_H12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0137_C07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0108_H10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0014_H02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0140_F02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0131_G03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
PCT01_0003_F08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCA*AACTTCCA*GAAGTATGGTCCCA
OVRT1_0102_H08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0045_D08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0131_A01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0147_E03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0101_D03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0006_B03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0042_C08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0111_A02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0126_A12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0056_E03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0051_C07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0049_D06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0089_G09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0079_D12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0050_B01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0136_E10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0121_A06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0003_A11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0069_A03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0045_H07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0022_H05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0026_A10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0012_A03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0003_D12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0124_B08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0020_C05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0012_E10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0008_C10.b : GAAGGGCACACAGAATATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGCCCTA
OVRM1_0041_G01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0046_B09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0155_C08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0017_D03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0068_H06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0225_F12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0037_B05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0039_D09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0064_C05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0071_A08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVR01_0066_B08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0152_C04.b : GAAGGGCACACAGAAAATCCACTATCGCCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0182_F08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0160_H07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0165_B02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0161_C10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0157_F04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0197_B04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0028_A03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0016_E06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0073_H05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0203_G04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0197_F04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0193_G04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0150_E06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0081_E07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0108_D03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0152_H08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0214_B01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0134_B04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0149_H05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0155_D02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0052_B01.b : GAAGGGCACACAGAANATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0073_C06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0034_A08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0134_H10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0074_F05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0154_G07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0059_A02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0065_F04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0018_C04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0147_C12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0153_H10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0154_E11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0074_D06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0014_A04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0013_A03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0211_H03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0130_C02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0065_E04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0147_H09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0218_B03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0167_C04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0063_C06.b : GAAGGGCACACAGAANATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0151_D09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0057_F04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0048_D11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0113_C01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTTCCA
OVRM1_0197_F12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0205_D04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0115_D01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0209_A08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0206_C01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0169_E04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0209_A07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0169_D04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0041_C12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0116_C01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0138_G02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0038_G01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0201_D04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0041_F06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0063_C02.b : GAAGGGCACACAGAANATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0100_A02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0101_F02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0015_F03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0067_E11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0051_C05.b : GAAGGGCACACAGAANATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0179_C09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0006_F01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0182_B11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0037_D05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0213_B06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0053_A09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0083_A06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0043_E11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0058_E11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0125_D11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0128_B11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0002_B08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0083_B02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0128_H12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0060_C07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0025_B07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0043_C09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0068_E12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0033_H11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0084_C05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0129_D09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0024_F02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0129_E03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0118_B11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0102_A05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0028_F10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0122_B03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0130_F10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0139_F06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0125_E11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0015_A08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0017_E08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0210_G10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAAAACTTCCA*GAAGTATGGTCCCA
OVRM1_0053_B09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0202_G08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0110_A04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0099_D12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0167_G07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0102_E10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0052_C11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0166_B04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0084_D08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0086_G06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0089_H07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0092_C11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0170_D10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0116_H07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0070_E09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0101_H04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0005_A11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0115_C06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0100_H04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTACCA*GAAGTATGGTCCCA
OVRM1_0060_C10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0078_B12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0049_C12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0054_D10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0025_H03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0042_A09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0204_F10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0022_A04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0110_A12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0213_C10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0003_H12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0093_A08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0055_D12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0110_F10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0027_B10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0012_B06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0202_D12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0094_E08.b : GAAGGGCACACAGGAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0122_E08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0025_B07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0026_H12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0105_A06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0012_F10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0011_C11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0026_C02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0131_C01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0007_G11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0023_D01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0131_E10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0089_C09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0030_E12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0131_E01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0046_F08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0142_C11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0040_E04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0013_F03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0008_E04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0107_H10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0103_D08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0146_H11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0056_H11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0014_D04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0064_A10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0083_A05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0105_H03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0065_C04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0046_C01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0131_D01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0125_H07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0065_C01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0092_H04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0112_G12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0069_E06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0040_F06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0114_A04.b : GAAGGGCACACAGAAAACCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0080_D08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0011_G03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0047_F02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0142_F01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0073_H01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0083_G08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0114_H02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTGTGGTCCCA
OVRT1_0009_H05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0084_E08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0131_C09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0076_G04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0016_G11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0115_E04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0083_G05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0129_D07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0071_A02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0073_C11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0039_F01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0014_D12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0109_G08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0025_A01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0041_A12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0092_A10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0141_C03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0053_D04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0002_C06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0042_E07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0124_G05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0029_F09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0139_G04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0151_D11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0034_A11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0050_B08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0111_F06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0011_D12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0044_A11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0077_A05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0135_H01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0031_C09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0105_E02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0118_C04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0077_H01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0044_D01.b : GAAGGGCACACAGAAAATCCACTATCACCACGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0129_G10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0050_F11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0074_B07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0024_E02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0011_A03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0100_G01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0034_A01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0052_E08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0105_C12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0002_F02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0041_E06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0050_D04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0084_F12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0106_A12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0030_G12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0121_F03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0121_B03.b : GAAGGGCACACAGAAAACCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0086_C09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0012_D11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0027_D01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0077_H08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0056_E05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0125_E05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0098_C06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0002_H05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0057_H12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0091_B08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0126_C10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0081_D11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0096_A11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0078_A09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0066_F07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0060_C04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0093_A09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0051_G05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0126_A02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0054_D10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0075_D07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0100_B08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0077_G11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0107_B08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0069_A05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0011_H12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0133_F09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0039_C02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0093_F01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0068_G03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0063_D01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0089_G03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGCCCCA
OVR01_0005_C04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0065_G10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0151_G10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0033_E01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0091_A02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0057_A05.b : GAAGGGCACACAAAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0035_A04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0093_C11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0050_E07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0056_B06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0094_C10.b : GAAGGGCACACAGAAAACCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0078_D02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0031_D02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVR01_0017_F06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0082_F05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0095_A11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0055_H09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0068_E08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0094_H08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0048_C11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0057_H08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0085_H02.b : GGAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0101_E12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0083_D11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0098_F04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0068_G09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0150_E06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0119_D08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0089_B04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0145_D12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0094_C07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0010_H09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0076_G06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0044_F07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0090_D02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0068_D10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0052_B08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0047_C08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0078_F02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0075_B05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0221_H02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0151_H10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0126_H10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0095_A07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0056_G01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0076_H12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0097_D11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0112_E11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0026_C02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0090_H03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0035_H05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0022_E08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0107_F08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0100_B10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0083_C03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0092_H08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAGGTATGGTCCCA
OVRT1_0017_H10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0013_F09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0012_F02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0104_B12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0017_H01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0092_F11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0063_E04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0111_G06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0188_H04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0052_G04.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0084_H03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0054_C05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0056_F08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0058_C10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0100_H12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0093_A06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0011_A12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0003_A05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0111_H12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0079_E09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0081_A02.b : GAAGGGCACACAGAAGATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0166_H03.b : GAAGGGCACACAGAAAACCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0021_F12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0119_C10.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0019_C11.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0073_A09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0092_A02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*AAAGTATGGTCCCA
OVRM1_0111_B09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0140_G01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0025_A12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0063_B06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0021_F02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0031_A12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0070_A06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
TES01_0018_G07.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
PCT01_0031_H09.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
PCT01_0003_E06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAGGTATGGTCCCA
OVRM1_0021_F03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCAAGAAGTATGGTCCCA
TES01_0095_G02.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0044_E06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0099_A01.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0064_E06.b : GAAGGGCACACAGAAAATCCACTATCACCACGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0219_C06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRT1_0077_F08.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0101_C12.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0155_E05.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0189_D06.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0047_H02.b : GAAGGGCACACAGAAAATCCATTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0016_H03.b : GAAGGGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0004_E03.b : xxxxxGCACACAGAAAATCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0126_A12.b : xxxxxxxxxxxxxxxxxTCCACTATCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0220_B01.b : xxxxxxxxxxxxgttggcctactggCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0174_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxCCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0055_H06.b : nnnnnnnxxxxxxxxxxxxxxxxxxxxxxxTGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0093_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0201_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtTTCCA*GAAGTATGGTCCCA
ADR01_0015_F09.b : tatcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0104_F02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0016_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0038_H04.b : ttgtcxxxxxxxxxxxxxxxxxxx
OVRM1_0030_F08.b : aatxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0058_E02.b : cgttgaccnaagxxxxxxxx
ADR01_0012_H04.b : nnnnaatgaacax
20110601C-006984 : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
---------+---------+---------+---------+---------+---------+ 400
OVRM1_0209_G04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0222_F02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0168_E07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0100_A06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0090_H12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0034_D06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0101_E11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0131_B12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0079_C10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0161_D01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0076_E10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0018_E05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0038_G03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0095_B08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0025_B01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0011_C01.b : TTTACAGGGAGAAGCTCGACAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0091_C05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0195_D02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0035_B03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0104_B11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0037_A02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0008_A11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0024_G05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0146_B02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0058_D10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0090_H04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0026_C01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0036_D04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0033_H12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0084_F09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0035_D04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0088_E10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0074_A07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0039_E10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0096_G04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0062_H01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0201_F06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0206_G08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0058_G06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0204_E08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0053_B10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0107_G11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0123_A09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0115_H09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0030_B11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0020_B08.b : TTTACAGGGAGAGGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0117_E12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0134_G06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0077_G06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0048_C05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0076_F07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0148_H06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0151_A08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0166_E12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0096_B07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0005_D02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0168_E06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0102_G02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0216_G12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0188_F10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0056_B09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0121_A12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0025_G06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0011_H08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0038_F09.b : TTTACAGGGAGAAACTCGGCAACTTGGAATCTGTTTATATCATCGGCCCTGAAGATGTGG
OVRT1_0111_D06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0049_A10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0102_C07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0099_B12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0069_G06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0099_A10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0044_A05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0120_D02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0061_C11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0134_A09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVR01_0007_A11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0013_A10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0059_B08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0062_B06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0011_B12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0099_H11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0223_D04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0163_B07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0200_F01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0153_G05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0192_B02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0087_A04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0199_C09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0085_F01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0099_C02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0155_D09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0185_D06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0119_H06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0056_D09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0204_G10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0184_H12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0137_C07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0108_H10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0014_H02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0140_F02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0131_G03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
PCT01_0003_F08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0102_H08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0045_D08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0131_A01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0147_E03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0101_D03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0006_B03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0042_C08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0111_A02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0126_A12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0056_E03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0051_C07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0049_D06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0089_G09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0079_D12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0050_B01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0136_E10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0121_A06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0003_A11.b : TTTGCAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0069_A03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0045_H07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0022_H05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0026_A10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0012_A03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0003_D12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0124_B08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0020_C05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0012_E10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0008_C10.b : TTTACAGGGAGAAGCTCGGCAGCTTGGACTCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0041_G01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0046_B09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0155_C08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0017_D03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0068_H06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0225_F12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0037_B05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0039_D09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0064_C05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0071_A08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVR01_0066_B08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0152_C04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0182_F08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0160_H07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0165_B02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0161_C10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0157_F04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCAACCCTGAAGATGTGG
OVRM1_0197_B04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0028_A03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATTGACCCTGAAGATGTGG
ADR01_0016_E06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0073_H05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0203_G04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0197_F04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0193_G04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0150_E06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0081_E07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0108_D03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAGTCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0152_H08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0214_B01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0134_B04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0149_H05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0155_D02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0052_B01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0073_C06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0034_A08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0134_H10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0074_F05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0154_G07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0059_A02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0065_F04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0018_C04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0147_C12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0153_H10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0154_E11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0074_D06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0014_A04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0013_A03.b : TTTACAGGGAGAAGCTCGGCAACTTGGGATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0211_H03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0130_C02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0065_E04.b : TTTACTGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0147_H09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0218_B03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0167_C04.b : TT*ACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0063_C06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0151_D09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0057_F04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0048_D11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0113_C01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0197_F12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0205_D04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0115_D01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0209_A08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0206_C01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0169_E04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0209_A07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0169_D04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0041_C12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0116_C01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0138_G02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0038_G01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0201_D04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0041_F06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0063_C02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0100_A02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0101_F02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0015_F03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0067_E11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0051_C05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0179_C09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0006_F01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0182_B11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0037_D05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0213_B06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0053_A09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0083_A06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0043_E11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0058_E11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0125_D11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0128_B11.b : TTTACAGGGAGAAGCTCGGCAACTCGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0002_B08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATTGACCCTGAAGATGTGG
OVRM1_0083_B02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0128_H12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0060_C07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0025_B07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0043_C09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0068_E12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0033_H11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGGTGTGG
OVRM1_0084_C05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0129_D09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0024_F02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0129_E03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0118_B11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0102_A05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0028_F10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0122_B03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0130_F10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0139_F06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0125_E11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0015_A08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0017_E08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0210_G10.b : TTTACAGGGAGAGGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0053_B09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0202_G08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0110_A04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0099_D12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGGAGATGTGG
OVRM1_0167_G07.b : TTTACAGGGAGAGGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0102_E10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0052_C11.b : TTTACAGGGAGGAGCTCGGCAACTTGGGATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0166_B04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0084_D08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0086_G06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0089_H07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0092_C11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0170_D10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0116_H07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0070_E09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0101_H04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0005_A11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0115_C06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0100_H04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0060_C10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0078_B12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0049_C12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0054_D10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0025_H03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0042_A09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0204_F10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0022_A04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0110_A12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0213_C10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0003_H12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0093_A08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0055_D12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0110_F10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0027_B10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0012_B06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0202_D12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0094_E08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0122_E08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0025_B07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0026_H12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0105_A06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0012_F10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0011_C11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0026_C02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0131_C01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAGTCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0007_G11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0023_D01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0131_E10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0089_C09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0030_E12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0131_E01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0046_F08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0142_C11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0040_E04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0013_F03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0008_E04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0107_H10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0103_D08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0146_H11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0056_H11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0014_D04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0064_A10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCCACCCTGAAGATGTGG
OVRT1_0083_A05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0105_H03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0065_C04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0046_C01.b : TTTACAGGGAGAAGCTCGGCAACTTGTAATCTGTTTATATCATCGACCCTGAATATGTGG
OVRT1_0131_D01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0125_H07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0065_C01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0092_H04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0112_G12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0069_E06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0040_F06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0114_A04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0080_D08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0011_G03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0047_F02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0142_F01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0073_H01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0083_G08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0114_H02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0009_H05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0084_E08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0131_C09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0076_G04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0016_G11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0115_E04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0083_G05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0129_D07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0071_A02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0073_C11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0039_F01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0014_D12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0109_G08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0025_A01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0041_A12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0092_A10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0141_C03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0053_D04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0002_C06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0042_E07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0124_G05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0029_F09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0139_G04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0151_D11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0034_A11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0050_B08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0111_F06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0011_D12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0044_A11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0077_A05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0135_H01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0031_C09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0105_E02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0118_C04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0077_H01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0044_D01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0129_G10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0050_F11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0074_B07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCCGAAGATGTGG
OVRT1_0024_E02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0011_A03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0100_G01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0034_A01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0052_E08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0105_C12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0002_F02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0041_E06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0050_D04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0084_F12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0106_A12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0030_G12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0121_F03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0121_B03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0086_C09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0012_D11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0027_D01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0077_H08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0056_E05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0125_E05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0098_C06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0002_H05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0057_H12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0091_B08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0126_C10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0081_D11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0096_A11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0078_A09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0066_F07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0060_C04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0093_A09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0051_G05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0126_A02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0054_D10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0075_D07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0100_B08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0077_G11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0107_B08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0069_A05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0011_H12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0133_F09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0039_C02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0093_F01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0068_G03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0063_D01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0089_G03.b : TTTATAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVR01_0005_C04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0065_G10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0151_G10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0033_E01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0091_A02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0057_A05.b : TTTACAGGGAGAAACTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0035_A04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0093_C11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0050_E07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0056_B06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0094_C10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0078_D02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0031_D02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVR01_0017_F06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0082_F05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0095_A11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0055_H09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0068_E08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0094_H08.b : TTTACAGGGAGAAGCTCGGCAACTCGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0048_C11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0057_H08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0085_H02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0101_E12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0083_D11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0098_F04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0068_G09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0150_E06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0119_D08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0089_B04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0145_D12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0094_C07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0010_H09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0076_G06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0044_F07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0090_D02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0068_D10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0052_B08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0047_C08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0078_F02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0075_B05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0221_H02.b : TTTACAGGGAGAAGCTCGGCAACTTGGGATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0151_H10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0126_H10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0095_A07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0056_G01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0076_H12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0097_D11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0112_E11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0026_C02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0090_H03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0035_H05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0022_E08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0107_F08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0100_B10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0083_C03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0092_H08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0017_H10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0013_F09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0012_F02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0104_B12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0017_H01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0092_F11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0063_E04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0111_G06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0188_H04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0052_G04.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0084_H03.b : TTTACGGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0054_C05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0056_F08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0058_C10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0100_H12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0093_A06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0011_A12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0003_A05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0111_H12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0079_E09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0081_A02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0166_H03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0021_F12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0119_C10.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0019_C11.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0073_A09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0092_A02.b : TTTACAGGGAGAAGCTCGGCAACTTGTAATCTGTTTATATCATCAACCCTGAAGATGAGG
OVRM1_0111_B09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0140_G01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0025_A12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0063_B06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0021_F02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0031_A12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0070_A06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0018_G07.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
PCT01_0031_H09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
PCT01_0003_E06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0021_F03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
TES01_0095_G02.b : TTTACAGGGAGAAGCTCGACAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0044_E06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0099_A01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0064_E06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0219_C06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRT1_0077_F08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0101_C12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0155_E05.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0189_D06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0047_H02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0016_H03.b : TCTACAGGGAGAAGCTCGACAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0004_E03.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0126_A12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0220_B01.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0174_H12.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0055_H06.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0093_G08.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0201_H02.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
ADR01_0015_F09.b : TTTACAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0104_F02.b : xxxxCAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0016_H07.b : xxxxCAGGGAGAAGCTCGGCAACTTGGAATCTGTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0038_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0030_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATATCATCGACCCTGAAGATGTGG
OVRM1_0058_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCATCGACCCTGAAGATGTGG
ADR01_0012_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGACCCTGAAGATGTGG
20110601C-006984 : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
---------+---------+---------+---------+---------+---------+ 460
OVRM1_0209_G04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGAGTTG
OVRM1_0222_F02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0168_E07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0100_A06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0090_H12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0034_D06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0101_E11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0131_B12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0079_C10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0161_D01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0076_E10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0018_E05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0038_G03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0095_B08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0025_B01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0011_C01.b : CCCTTCTCTTTAATTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0091_C05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0195_D02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0035_B03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0104_B11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0037_A02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0008_A11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0024_G05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0146_B02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATGCAACATCCCGCCCTGGGTTG
OVRT1_0058_D10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0090_H04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0026_C01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0036_D04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0033_H12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0084_F09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0035_D04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0088_E10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACGTCCCGCCCTGGGTTG
OVRT1_0074_A07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0039_E10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0096_G04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0062_H01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0201_F06.b : CCCTTCTCTTTGAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0206_G08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0058_G06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0204_E08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0053_B10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0107_G11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0123_A09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0115_H09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0030_B11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0020_B08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0117_E12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0134_G06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0077_G06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0048_C05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0076_F07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0148_H06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0151_A08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0166_E12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0096_B07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0005_D02.b : CCCTTCTCTTTAAGTTCGAATGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0168_E06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0102_G02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGGTACAACATCCCGCCCTGGGTTG
OVRM1_0216_G12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0188_F10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0056_B09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0121_A12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0025_G06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0011_H08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0038_F09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0111_D06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0049_A10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0102_C07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0099_B12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0069_G06.b : CACTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0099_A10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0044_A05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0120_D02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0061_C11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0134_A09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVR01_0007_A11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0013_A10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0059_B08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0062_B06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0011_B12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0099_H11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0223_D04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCGGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0163_B07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0200_F01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0153_G05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0192_B02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0087_A04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0199_C09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0085_F01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0099_C02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0155_D09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0185_D06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0119_H06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0056_D09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0204_G10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0184_H12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0137_C07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0108_H10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0014_H02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0140_F02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0131_G03.b : CCCTTCCCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
PCT01_0003_F08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0102_H08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0045_D08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0131_A01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0147_E03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0101_D03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0006_B03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0042_C08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0111_A02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0126_A12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0056_E03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0051_C07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0049_D06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0089_G09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0079_D12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0050_B01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0136_E10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0121_A06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0003_A11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0069_A03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0045_H07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0022_H05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0026_A10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0012_A03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0003_D12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0124_B08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0020_C05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0012_E10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0008_C10.b : CCCTTCTCTTTAAGTTCGAATGACCCcaacccagaaacgatacatctatctcgccctgag
OVRM1_0041_G01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0046_B09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0155_C08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0017_D03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0068_H06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0225_F12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0037_B05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0039_D09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0064_C05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0071_A08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVR01_0066_B08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0152_C04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0182_F08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0160_H07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0165_B02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0161_C10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0157_F04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0197_B04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0028_A03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0016_E06.b : CCCTTCCCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0073_H05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0203_G04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0197_F04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0193_G04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0150_E06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0081_E07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0108_D03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0152_H08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0214_B01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0134_B04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0149_H05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0155_D02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0052_B01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0073_C06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0034_A08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0134_H10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0074_F05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0154_G07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0059_A02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0065_F04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0018_C04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0147_C12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0153_H10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0154_E11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0074_D06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0014_A04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0013_A03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0211_H03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0130_C02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0065_E04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0147_H09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0218_B03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0167_C04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0063_C06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0151_D09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0057_F04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0048_D11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0113_C01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0197_F12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0205_D04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0115_D01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0209_A08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0206_C01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0169_E04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0209_A07.b : CCCTTCTCTGTAAGTTCGAAGGACCCAACCCACAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0169_D04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0041_C12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0116_C01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0138_G02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0038_G01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0201_D04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0041_F06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0063_C02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0100_A02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0101_F02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0015_F03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0067_E11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0051_C05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0179_C09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0006_F01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0182_B11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0037_D05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0213_B06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0053_A09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0083_A06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0043_E11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0058_E11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0125_D11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0128_B11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0002_B08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0083_B02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0128_H12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0060_C07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0025_B07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0043_C09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0068_E12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACCACATCCCGCCCTGGGTTG
OVRM1_0033_H11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0084_C05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0129_D09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0024_F02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0129_E03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0118_B11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0102_A05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCGGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0028_F10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0122_B03.b : CCCTTCTCTTTAAGTTCGGAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0130_F10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0139_F06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0125_E11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0015_A08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0017_E08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0210_G10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0053_B09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0202_G08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0110_A04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0099_D12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0167_G07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGGTACAACATCCCGCCCTGGGTTG
OVRM1_0102_E10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0052_C11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0166_B04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0084_D08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0086_G06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0089_H07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0092_C11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0170_D10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0116_H07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0070_E09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0101_H04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0005_A11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0115_C06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0100_H04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0060_C10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0078_B12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0049_C12.b : CCCTTCCCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0054_D10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0025_H03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCTAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0042_A09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0204_F10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0022_A04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0110_A12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGGACGATACAACATCCCGCCCTGGGTTG
OVRM1_0213_C10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0003_H12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0093_A08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0055_D12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0110_F10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0027_B10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0012_B06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0202_D12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0094_E08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0122_E08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0025_B07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0026_H12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0105_A06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0012_F10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0011_C11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0026_C02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0131_C01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0007_G11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0023_D01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0131_E10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0089_C09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0030_E12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0131_E01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0046_F08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0142_C11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0040_E04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0013_F03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0008_E04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0107_H10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0103_D08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0146_H11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0056_H11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0014_D04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0064_A10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0083_A05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0105_H03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0065_C04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0046_C01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGAGTTG
OVRT1_0131_D01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0125_H07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0065_C01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0092_H04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0112_G12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0069_E06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0040_F06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0114_A04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0080_D08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0011_G03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0047_F02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0142_F01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0073_H01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0083_G08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0114_H02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0009_H05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0084_E08.b : CCCTTCTCTCTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0131_C09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0076_G04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0016_G11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0115_E04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0083_G05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0129_D07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0071_A02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0073_C11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0039_F01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0014_D12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0109_G08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0025_A01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0041_A12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0092_A10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0141_C03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0053_D04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0002_C06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0042_E07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0124_G05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0029_F09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0139_G04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0151_D11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0034_A11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0050_B08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0111_F06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0011_D12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0044_A11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0077_A05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0135_H01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0031_C09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0105_E02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0118_C04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0077_H01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0044_D01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0129_G10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0050_F11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0074_B07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0024_E02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0011_A03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0100_G01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0034_A01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0052_E08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0105_C12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0002_F02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0041_E06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0050_D04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0084_F12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0106_A12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0030_G12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0121_F03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0121_B03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0086_C09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0012_D11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0027_D01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0077_H08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0056_E05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0125_E05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0098_C06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0002_H05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0057_H12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0091_B08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0126_C10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0081_D11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0096_A11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0078_A09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0066_F07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0060_C04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0093_A09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0051_G05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0126_A02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0054_D10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0075_D07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0100_B08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0077_G11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0107_B08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0069_A05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0011_H12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0133_F09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0039_C02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0093_F01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0068_G03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0063_D01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0089_G03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVR01_0005_C04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0065_G10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0151_G10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0033_E01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0091_A02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0057_A05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0035_A04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0093_C11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0050_E07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0056_B06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0094_C10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0078_D02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0031_D02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVR01_0017_F06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0082_F05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0095_A11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0055_H09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0068_E08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0094_H08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0048_C11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACAATACAACATCCCGCCCTGGGTTG
ADR01_0057_H08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0085_H02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0101_E12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0083_D11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0098_F04.b : CCCTTCTCTTTAAGTTCGGAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0068_G09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0150_E06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0119_D08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0089_B04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0145_D12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0094_C07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0010_H09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0076_G06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0044_F07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0090_D02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0068_D10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0052_B08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0047_C08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0078_F02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0075_B05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0221_H02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0151_H10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0126_H10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0095_A07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0056_G01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0076_H12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0097_D11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0112_E11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0026_C02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0090_H03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0035_H05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0022_E08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0107_F08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0100_B10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0083_C03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0092_H08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0017_H10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0013_F09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0012_F02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0104_B12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCGGAACGATACAACATCCCGCCCTGGGTTG
TES01_0017_H01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0092_F11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0063_E04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0111_G06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0188_H04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0052_G04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0084_H03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0054_C05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0056_F08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0058_C10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0100_H12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0093_A06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0011_A12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0003_A05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0111_H12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0079_E09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0081_A02.b : GCCTTCTCTTTGAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGGCCTGGGTTG
OVRM1_0166_H03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0021_F12.b : CCCTTCTCTT*AAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0119_C10.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0019_C11.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0073_A09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0092_A02.b : CCCTTCTCTTTAAGTTCGAAGGACCCACCCCCGACCGATACAACATCCCGCCCTGGGTTG
OVRM1_0111_B09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0140_G01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0025_A12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0063_B06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0021_F02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0031_A12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0070_A06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0018_G07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
PCT01_0031_H09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
PCT01_0003_E06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0021_F03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
TES01_0095_G02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0044_E06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0099_A01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0064_E06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0219_C06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRT1_0077_F08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0101_C12.b : CCCTTCTCTTTAAGCTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0155_E05.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0189_D06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0047_H02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0016_H03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0004_E03.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0126_A12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0220_B01.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0174_H12.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0055_H06.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0093_G08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0201_H02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0015_F09.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0104_F02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0016_H07.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0038_H04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0030_F08.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
OVRM1_0058_E02.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
ADR01_0012_H04.b : CCCTTCTCTTTAAGTTCGAAGGACCCAACCCAGAACGATACAACATCCCGCCCTGGGTTG
20110601C-006984 : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
---------+---------+---------+---------+---------+---------+ 518
OVRM1_0209_G04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0222_F02.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0168_E07.b : CCTATCACCAGCACTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
ADR01_0100_A06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0090_H12.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
TES01_0034_D06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAAAAATCAAGAG*CCTG
TES01_0101_E11.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0131_B12.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
TES01_0079_C10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0161_D01.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0076_E10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0018_E05.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0038_G03.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0095_B08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
TES01_0025_B01.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0011_C01.b : CCTATCACCAGCATTACCAGAATCCTG*TTGGGGTCCTGCTGAAGAAGTCACGAG*CCTG
OVRT1_0091_C05.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0195_D02.b : CCTATCACCACCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0035_B03.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0104_B11.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
ADR01_0037_A02.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0008_A11.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0024_G05.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0146_B02.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0058_D10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0090_H04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0026_C01.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0036_D04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
ADR01_0033_H12.b : CCTATCACCAGCATTACCAGAGGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
ADR01_0084_F09.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0035_D04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0088_E10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0074_A07.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0039_E10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0096_G04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0062_H01.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0201_F06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0206_G08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0058_G06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0204_E08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0053_B10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGCCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0107_G11.b : CCTATCACCACCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0123_A09.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0115_H09.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0030_B11.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
ADR01_0020_B08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0117_E12.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0134_G06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
ADR01_0077_G06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
ADR01_0048_C05.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0076_F07.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0148_H06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0151_A08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0166_E12.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0096_B07.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0005_D02.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0168_E06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0102_G02.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0216_G12.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0188_F10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0056_B09.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0121_A12.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0025_G06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
ADR01_0011_H08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
ADR01_0038_F09.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAGGAAGTCAGGAG*CCTG
OVRT1_0111_D06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
TES01_0049_A10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0102_C07.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0099_B12.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0069_G06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0099_A10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
ADR01_0044_A05.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0120_D02.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0061_C11.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0134_A09.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVR01_0007_A11.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0013_A10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
ADR01_0059_B08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0062_B06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0011_B12.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0099_H11.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0223_D04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0163_B07.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0200_F01.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCCG
OVRM1_0153_G05.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0192_B02.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0087_A04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0199_C09.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0085_F01.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0099_C02.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0155_D09.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0185_D06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0119_H06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0056_D09.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0204_G10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0184_H12.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0137_C07.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0108_H10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0014_H02.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0140_F02.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0131_G03.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
PCT01_0003_F08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0102_H08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0045_D08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0131_A01.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0147_E03.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGCCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0101_D03.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0006_B03.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0042_C08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0111_A02.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0126_A12.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0056_E03.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0051_C07.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0049_D06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
ADR01_0089_G09.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0079_D12.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0050_B01.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0136_E10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0121_A06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0003_A11.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0069_A03.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0045_H07.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0022_H05.b : CCTATCACCAGCATTACCAAAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0026_A10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0012_A03.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0003_D12.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0124_B08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0020_C05.b : CCTATCACCAGCATCACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0012_E10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0008_C10.b : ttgcctatctccagcattaaccaaaagccctgtgaggttctgatgaagaattctaggaac
OVRM1_0041_G01.b : CCTATCACCAGCATTACCAGAAACCTG*TTGGGGTCCTGCTGAATAACTCAGGAG*CCTG
OVRM1_0046_B09.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAACAAGTCAGGAG*CCTG
OVRM1_0155_C08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAATCAGGAT*CCTG
ADR01_0017_D03.b : CCTATCACCAGCATTACCAGAAGCCTGTTTGGGGTCCTGCTGAAGAAGTCAGGAT*CCTG
OVRM1_0068_H06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0225_F12.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0037_B05.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0039_D09.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAATATATCAAGAG*CCTG
OVRM1_0064_C05.b : CCTATCANCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAAAAGTCAGGAG*CCTG
OVRM1_0071_A08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAATCAGGAG*CCTG
OVR01_0066_B08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0152_C04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0182_F08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0160_H07.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0165_B02.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0161_C10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0157_F04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0197_B04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
ADR01_0028_A03.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
ADR01_0016_E06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
TES01_0073_H05.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0203_G04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0197_F04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0193_G04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0150_E06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0081_E07.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0108_D03.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAATCAGGAG*CCTG
OVRM1_0152_H08.b : CCTATCACCAGCATTGCCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0214_B01.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0134_B04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0149_H05.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0155_D02.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0052_B01.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0073_C06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0034_A08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAAAAGTCAGGAG*CCTG
OVRM1_0134_H10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0074_F05.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0154_G07.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0059_A02.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0065_F04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0018_C04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0147_C12.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0153_H10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0154_E11.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0074_D06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0014_A04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0013_A03.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0211_H03.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0130_C02.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0065_E04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0147_H09.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0218_B03.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0167_C04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0063_C06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCCG
OVRM1_0151_D09.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0057_F04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0048_D11.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0113_C01.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0197_F12.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0205_D04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0115_D01.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0209_A08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0206_C01.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0169_E04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0209_A07.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0169_D04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0041_C12.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0116_C01.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0138_G02.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0038_G01.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0201_D04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0041_F06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGGAGAAGTCAGGAG*CCTG
OVRM1_0063_C02.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0100_A02.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0101_F02.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
ADR01_0015_F03.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0067_E11.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0051_C05.b : CCTATCACCAGCATTACCAGAAGCCTA*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0179_C09.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0006_F01.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0182_B11.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0037_D05.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0213_B06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0053_A09.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0083_A06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0043_E11.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0058_E11.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0125_D11.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0128_B11.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
ADR01_0002_B08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0083_B02.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0128_H12.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0060_C07.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
ADR01_0025_B07.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0043_C09.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
ADR01_0068_E12.b : CCTATCACCAGCATTACCAGAAGCCTG*GTGGGGTCCTGCTGAAGAAGTCAAGGA*CCTG
OVRM1_0033_H11.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0084_C05.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0129_D09.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0024_F02.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0129_E03.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0118_B11.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0102_A05.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0028_F10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0122_B03.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0130_F10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRT1_0139_F06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0125_E11.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0015_A08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0017_E08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0210_G10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0053_B09.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0202_G08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0110_A04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0099_D12.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0167_G07.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0102_E10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0052_C11.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0166_B04.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0084_D08.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0086_G06.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0089_H07.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0092_C11.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0170_D10.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0116_H07.b : CCTATCACCAGCATTACCAGAAGCCTG*TTGGGGTCCTGCTGAAGAAGTCAGGAG*CCTG
OVRM1_0070_E09.b : CCTATC