
[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-006984

Length: 1,384

Sequence [FASTA format sequence]

SNP mapping information
SNP IDRel.Chr.Location (cM)

Assembly Overview:      TOP
Change score limit to  

BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCYP11A1cholesterol side-chain cleavage enzyme, mitochondrial isoform a precursor [Homo sapiens]. 483e-178O
Contig/Assembly ProteinCYP11A1cholesterol side-chain cleavage enzyme, mitochondrial isoform b [Homo sapiens]. 2142e-97O
Contig/Assembly ProteinCYP11B2cytochrome P450 11B2, mitochondrial precursor [Homo sapiens]. 1743e-57O
Contig/Assembly ProteinCYP11B1cytochrome P450 11B1, mitochondrial isoform 1 precursor [Homo sapiens]. 1749e-58O
Contig/Assembly ProteinCYP11B1cytochrome P450 11B1, mitochondrial isoform 2 precursor [Homo sapiens]. 1748e-54O
Contig/Assembly ProteinCYP24A11,25-dihydroxyvitamin D(3) 24-hydroxylase, mitochondrial isoform 1 precursor [Homo sapiens]. 1254e-34O
Contig/Assembly ProteinCYP24A11,25-dihydroxyvitamin D(3) 24-hydroxylase, mitochondrial isoform 2 precursor [Homo sapiens]. 1254e-34O
Contig/Assembly ProteinCYP27B125-hydroxyvitamin D-1 alpha hydroxylase, mitochondrial [Homo sapiens]. 1042e-34O
Contig/Assembly ProteinCYP27C1cytochrome P450 27C1 [Homo sapiens]. 53.15e-17O
Contig/Assembly ProteinCYP27A1sterol 26-hydroxylase, mitochondrial precursor [Homo sapiens]. 50.47e-07O

BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCyp11a1cholesterol side-chain cleavage enzyme, mitochondrial precursor [Mus musculus]. 446e-167O
Contig/Assembly ProteinCyp11b2cytochrome P450 11B2, mitochondrial [Mus musculus]. 1757e-44O
Contig/Assembly ProteinCyp11b1cytochrome P450, family 11, subfamily b, polypeptide 1 [Mus musculus]. 1688e-51O
Contig/Assembly ProteinCyp24a11,25-dihydroxyvitamin D(3) 24-hydroxylase, mitochondrial precursor [Mus musculus]. 1295e-36O
Contig/Assembly ProteinCyp27b125-hydroxyvitamin D-1 alpha hydroxylase, mitochondrial [Mus musculus]. 1083e-36O
Contig/Assembly ProteinCyp27a1sterol 26-hydroxylase, mitochondrial [Mus musculus]. 50.83e-07O

BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC478365PREDICTED: similar to Cytochrome P450 11A1, mitochondrial precursor (CYPXIA1) (P450(scc)) (Cholesterol side-chain cleavage enzyme) (Cholesterol desmolase) [Canis familiaris]. 5000.0O
Contig/Assembly ProteinLOC482071PREDICTED: similar to Cytochrome P450 11B2, mitochondrial precursor (CYPXIB2) (P-450Aldo) (Aldosterone synthase) (ALDOS) (Aldosterone-synthesizing enzyme) (Steroid 18-hydroxylase) (P-450C18) [Canis familiaris]. 1665e-41
Contig/Assembly ProteinLOC485935PREDICTED: similar to Cytochrome P450 24A1, mitochondrial precursor (P450-CC24) (Vitamin D(3) 24-hydroxylase) (1,25-dihydroxyvitamin D(3) 24-hydroxylase) (24-OHase) [Canis familiaris]. 1218e-33O
Contig/Assembly ProteinLOC481133PREDICTED: similar to 25-hydroxyvitamin D-1 alpha hydroxylase, mitochondrial precursor (Calcidiol 1-monooxygenase) (25-OHD-1 alpha-hydroxylase) (25-hydroxyvitamin D(3) 1-alpha-hydroxylase) (VD3 1A hydroxylase) (P450C1 alpha) (P450VD1-alpha) [Canis familiaris]. 1132e-37O
Contig/Assembly ProteinLOC610489PREDICTED: similar to Cytochrome P450 27, mitochondrial precursor (Cytochrome P-450C27/25) (Sterol 26-hydroxylase) (Sterol 27-hydroxylase) (Vitamin D(3) 25-hydroxylase) (5-beta-cholestane-3-alpha,7-alpha,12-alpha-triol 27-hydroxylase) [Canis familiaris]. 86.32e-25O
Contig/Assembly ProteinLOC483869PREDICTED: similar to cytochrome P450, family 27, subfamily b, polypeptide 1 [Canis familiaris]. 84.37e-27O
Contig/Assembly ProteinLOC608494PREDICTED: similar to cytochrome P450, subfamily XIB polypeptide 2 precursor, partial [Canis familiaris]. 60.83e-09
Contig/Assembly ProteinLOC609093PREDICTED: similar to cytochrome P450, family 11, subfamily B, polypeptide 1 isoform 1 precursor [Canis familiaris]. 58.51e-08

BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCYP11A1cholesterol side-chain cleavage enzyme, mitochondrial precursor [Bos taurus]. 4840.0O
Contig/Assembly ProteinCYP11B2cytochrome P450 11B1, mitochondrial precursor [Bos taurus]. 1703e-55O
Contig/Assembly ProteinLOC540080PREDICTED: cytochrome P450, family 24, subfamily A, polypeptide 1-like isoform 2 [Bos taurus]. 1249e-34O
Contig/Assembly ProteinLOC540080PREDICTED: cytochrome P450, family 24, subfamily A, polypeptide 1-like isoform 1 [Bos taurus]. 1249e-34O
Contig/Assembly ProteinLOC540080PREDICTED: cytochrome P450, family 24, subfamily A, polypeptide 1-like isoform 2 [Bos taurus]. 1232e-33O
Contig/Assembly ProteinCYP24A11,25-dihydroxyvitamin D(3) 24-hydroxylase, mitochondrial [Bos taurus]. 1232e-33O
Contig/Assembly ProteinCYP27B1PREDICTED: cytochrome P450, family 27, subfamily B, polypeptide 1 [Bos taurus]. 1174e-37O
Contig/Assembly ProteinCYP27B125-hydroxyvitamin D-1 alpha hydroxylase, mitochondrial [Bos taurus]. 1174e-37O
Contig/Assembly ProteinLOC617338PREDICTED: FLJ16008 protein-like [Bos taurus]. 92.42e-29O
Contig/Assembly ProteinLOC617338PREDICTED: FLJ16008 protein-like [Bos taurus]. 92.42e-29O

BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCYP11A1cholesterol side-chain cleavage enzyme, mitochondrial precursor [Sus scrofa]. 5820.0O
Contig/Assembly ProteinCYP24A11,25-dihydroxyvitamin D(3) 24-hydroxylase, mitochondrial [Sus scrofa]. 1174e-33O
Contig/Assembly ProteinCYP27B125-hydroxyvitamin D-1 alpha hydroxylase, mitochondrial [Sus scrofa]. 1143e-37O
Contig/Assembly ProteinCYP27A1sterol 26-hydroxylase, mitochondrial precursor [Sus scrofa]. 78.61e-23O

Assembly Members: 526      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
OVRM10041G01OVRM1_0041_G01.bBP460410 AK235016
OVRM10131B12OVRM1_0131_B12.bBP147402 AK395233
OVRM10209G04OVRM1_0209_G04.bBP460709 AK395366
TES010012F02TES01_0012_F02.bCJ030815 AK398133
TES010101E11TES01_0101_E11.b  AK398301


SNPs: 2      TOP
Loc.AlleleIndividualsFreq.TypeAA Change

Alignment:      TOP

20110601C-006984 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRM1_0209_G04.b :
OVRM1_0222_F02.b :
OVRM1_0168_E07.b :
ADR01_0100_A06.b :
OVRT1_0090_H12.b :
TES01_0034_D06.b :
TES01_0101_E11.b :
OVRM1_0131_B12.b :
TES01_0079_C10.b :
OVRM1_0161_D01.b :
OVRM1_0076_E10.b :
OVRM1_0018_E05.b :
OVRM1_0038_G03.b :
OVRM1_0095_B08.b :
TES01_0025_B01.b :
OVRT1_0011_C01.b :
OVRT1_0091_C05.b :
OVRM1_0195_D02.b :
OVRM1_0035_B03.b :
OVRM1_0104_B11.b :
ADR01_0037_A02.b :
OVRM1_0008_A11.b :
OVRT1_0024_G05.b :
OVRT1_0146_B02.b :
OVRT1_0058_D10.b :
OVRT1_0090_H04.b :
OVRT1_0026_C01.b :
OVRT1_0036_D04.b :
ADR01_0033_H12.b :
ADR01_0084_F09.b :
OVRT1_0035_D04.b :
OVRT1_0088_E10.b :
OVRT1_0074_A07.b : n
OVRM1_0039_E10.b :
OVRM1_0096_G04.b :
OVRM1_0062_H01.b :
OVRM1_0201_F06.b :
OVRM1_0206_G08.b :
OVRM1_0058_G06.b :
OVRM1_0204_E08.b :
OVRM1_0053_B10.b :
OVRM1_0107_G11.b :
OVRM1_0123_A09.b :
OVRM1_0115_H09.b :
OVRM1_0030_B11.b :
ADR01_0020_B08.b :
OVRT1_0117_E12.b :
OVRT1_0134_G06.b : nn
ADR01_0077_G06.b :
ADR01_0048_C05.b :
OVRT1_0076_F07.b :
OVRM1_0148_H06.b :
OVRM1_0151_A08.b :
OVRM1_0166_E12.b :
OVRM1_0096_B07.b :
OVRM1_0005_D02.b :
OVRM1_0168_E06.b :
OVRM1_0102_G02.b :
OVRM1_0216_G12.b :
OVRM1_0188_F10.b :
OVRM1_0056_B09.b :
OVRM1_0121_A12.b :
OVRM1_0025_G06.b :
ADR01_0011_H08.b :
ADR01_0038_F09.b :
OVRT1_0111_D06.b :
TES01_0049_A10.b :
OVRT1_0102_C07.b :
OVRT1_0099_B12.b :
OVRT1_0069_G06.b :
OVRT1_0099_A10.b :
ADR01_0044_A05.b :
OVRT1_0120_D02.b :
OVRT1_0061_C11.b :
OVRT1_0134_A09.b : nnn
OVR01_0007_A11.b : cggggcccctatctt
OVRT1_0013_A10.b :
ADR01_0059_B08.b :
OVRT1_0062_B06.b :
OVRT1_0011_B12.b :
OVRT1_0099_H11.b :
OVRM1_0223_D04.b :
OVRM1_0163_B07.b :
OVRM1_0200_F01.b :
OVRM1_0153_G05.b :
OVRM1_0192_B02.b :
OVRM1_0087_A04.b :
OVRM1_0199_C09.b :
OVRM1_0085_F01.b :
OVRM1_0099_C02.b :
OVRM1_0155_D09.b :
OVRM1_0185_D06.b :
OVRM1_0119_H06.b :
OVRM1_0056_D09.b :
OVRM1_0204_G10.b :
OVRM1_0184_H12.b :
OVRT1_0137_C07.b : nn
OVRT1_0108_H10.b :
OVRT1_0014_H02.b :
OVRT1_0140_F02.b :
OVRT1_0131_G03.b :
PCT01_0003_F08.b :
OVRT1_0102_H08.b :
OVRT1_0045_D08.b :
OVRT1_0131_A01.b : nnnacgaaannnnnnnnccgttagcgttacgaggttxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0147_E03.b :
OVRT1_0101_D03.b :
OVRT1_0006_B03.b :
OVRT1_0042_C08.b :
OVRT1_0111_A02.b :
OVRT1_0126_A12.b :
OVRT1_0056_E03.b :
OVRT1_0051_C07.b :
OVRT1_0049_D06.b :
ADR01_0089_G09.b :
OVRT1_0079_D12.b :
OVRT1_0050_B01.b : nn
OVRT1_0136_E10.b :
OVRT1_0121_A06.b :
OVRT1_0003_A11.b :
OVRT1_0069_A03.b :
OVRT1_0045_H07.b :
OVRT1_0022_H05.b :
OVRT1_0026_A10.b :
OVRT1_0012_A03.b : nnntttcgtcagctgan
OVRT1_0003_D12.b :
OVRT1_0124_B08.b :
OVRT1_0020_C05.b :
OVRT1_0012_E10.b :
OVRM1_0008_C10.b : gtgggtcgtcgacctttttttcccgttca
OVRM1_0041_G01.b :
OVRM1_0046_B09.b :
OVRM1_0155_C08.b :
ADR01_0017_D03.b :
OVRM1_0068_H06.b :
OVRM1_0225_F12.b :
OVRM1_0037_B05.b :
OVRM1_0039_D09.b :
OVRM1_0064_C05.b :
OVRM1_0071_A08.b :
OVR01_0066_B08.b :
OVRM1_0152_C04.b :
OVRM1_0182_F08.b :
OVRM1_0160_H07.b :
OVRM1_0165_B02.b :
OVRM1_0161_C10.b :
OVRM1_0157_F04.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0197_B04.b :
ADR01_0028_A03.b :
ADR01_0016_E06.b :
TES01_0073_H05.b :
OVRM1_0203_G04.b :
OVRM1_0197_F04.b :
OVRM1_0193_G04.b :
OVRM1_0150_E06.b :
OVRM1_0081_E07.b :
OVRM1_0108_D03.b :
OVRM1_0152_H08.b :
OVRM1_0214_B01.b :
OVRM1_0134_B04.b :
OVRM1_0149_H05.b :
OVRM1_0155_D02.b :
OVRM1_0052_B01.b :
OVRM1_0073_C06.b :
OVRM1_0034_A08.b :
OVRM1_0134_H10.b :
OVRM1_0074_F05.b :
OVRM1_0154_G07.b :
OVRM1_0059_A02.b :
OVRM1_0065_F04.b :
OVRM1_0018_C04.b :
OVRM1_0147_C12.b :
OVRM1_0153_H10.b :
OVRM1_0154_E11.b :
OVRM1_0074_D06.b :
OVRM1_0014_A04.b :
OVRM1_0013_A03.b :
OVRM1_0211_H03.b :
OVRM1_0130_C02.b :
OVRM1_0065_E04.b :
OVRM1_0147_H09.b :
OVRM1_0218_B03.b :
OVRM1_0167_C04.b :
OVRM1_0063_C06.b :
OVRM1_0151_D09.b :
OVRM1_0057_F04.b :
OVRM1_0048_D11.b :
OVRM1_0113_C01.b :
OVRM1_0197_F12.b :
OVRM1_0205_D04.b :
OVRM1_0115_D01.b :
OVRM1_0209_A08.b :
OVRM1_0206_C01.b :
OVRM1_0169_E04.b :
OVRM1_0209_A07.b :
OVRM1_0169_D04.b :
OVRM1_0041_C12.b :
OVRM1_0116_C01.b :
OVRM1_0138_G02.b :
OVRM1_0038_G01.b :
OVRM1_0201_D04.b :
OVRM1_0041_F06.b :
OVRM1_0063_C02.b :
OVRM1_0100_A02.b :
OVRM1_0101_F02.b :
ADR01_0015_F03.b :
OVRM1_0067_E11.b :
OVRM1_0051_C05.b :
OVRM1_0179_C09.b :
OVRM1_0006_F01.b :
OVRM1_0182_B11.b :
OVRM1_0037_D05.b :
OVRM1_0213_B06.b :
OVRM1_0053_A09.b :
OVRM1_0083_A06.b :
OVRM1_0043_E11.b :
OVRM1_0058_E11.b :
OVRM1_0125_D11.b :
OVRM1_0128_B11.b :
ADR01_0002_B08.b :
OVRM1_0083_B02.b : nxxxxx
OVRM1_0128_H12.b :
OVRM1_0060_C07.b :
ADR01_0025_B07.b :
OVRM1_0043_C09.b :
ADR01_0068_E12.b :
OVRM1_0033_H11.b :
OVRM1_0084_C05.b :
OVRM1_0129_D09.b :
OVRM1_0024_F02.b :
OVRM1_0129_E03.b :
OVRM1_0118_B11.b :
OVRM1_0102_A05.b :
OVRM1_0028_F10.b :
OVRM1_0122_B03.b :
OVRM1_0130_F10.b :
OVRT1_0139_F06.b : nncc
OVRM1_0125_E11.b :
OVRM1_0015_A08.b :
OVRM1_0017_E08.b :
OVRM1_0210_G10.b :
OVRM1_0053_B09.b :
OVRM1_0202_G08.b :
OVRM1_0110_A04.b :
OVRM1_0099_D12.b :
OVRM1_0167_G07.b :
OVRM1_0102_E10.b :
OVRM1_0052_C11.b :
OVRM1_0166_B04.b : aatcccttcatctagcaacaacgatgcaataatctactttctctcgtgctatc
OVRM1_0084_D08.b :
OVRM1_0086_G06.b :
OVRM1_0089_H07.b :
OVRM1_0092_C11.b :
OVRM1_0170_D10.b :
OVRM1_0116_H07.b :
OVRM1_0070_E09.b :
OVRM1_0101_H04.b :
OVRM1_0005_A11.b :
OVRM1_0115_C06.b :
OVRM1_0100_H04.b :
OVRM1_0060_C10.b :
OVRM1_0078_B12.b :
OVRM1_0049_C12.b :
OVRM1_0054_D10.b :
OVRM1_0025_H03.b :
OVRM1_0042_A09.b :
OVRM1_0204_F10.b :
OVRM1_0022_A04.b :
OVRM1_0110_A12.b :
OVRM1_0213_C10.b :
OVRM1_0003_H12.b :
OVRM1_0093_A08.b :
OVRM1_0055_D12.b :
OVRM1_0110_F10.b :
OVRM1_0027_B10.b :
OVRM1_0012_B06.b :
OVRM1_0202_D12.b :
OVRM1_0094_E08.b :
OVRM1_0122_E08.b :
OVRM1_0025_B07.b :
OVRM1_0026_H12.b :
TES01_0105_A06.b :
OVRM1_0012_F10.b :
OVRM1_0011_C11.b :
ADR01_0026_C02.b :
OVRT1_0131_C01.b : n
ADR01_0007_G11.b :
ADR01_0023_D01.b :
OVRT1_0131_E10.b :
OVRT1_0089_C09.b :
TES01_0030_E12.b :
OVRT1_0131_E01.b : nn
ADR01_0046_F08.b :
OVRT1_0142_C11.b : nnn
ADR01_0040_E04.b :
ADR01_0013_F03.b :
ADR01_0008_E04.b :
OVRT1_0107_H10.b :
OVRT1_0103_D08.b :
OVRT1_0146_H11.b :
ADR01_0056_H11.b :
ADR01_0014_D04.b :
ADR01_0064_A10.b :
OVRT1_0083_A05.b :
OVRT1_0105_H03.b :
OVRT1_0065_C04.b :
OVRT1_0046_C01.b :
OVRT1_0131_D01.b : nn
OVRT1_0125_H07.b :
OVRT1_0065_C01.b :
OVRT1_0092_H04.b : nn
OVRT1_0112_G12.b :
ADR01_0069_E06.b :
ADR01_0040_F06.b :
OVRT1_0114_A04.b :
OVRT1_0080_D08.b :
OVRT1_0011_G03.b :
ADR01_0047_F02.b :
OVRT1_0142_F01.b : nn
OVRT1_0073_H01.b :
OVRT1_0083_G08.b :
OVRT1_0114_H02.b :
OVRT1_0009_H05.b :
OVRT1_0084_E08.b :
OVRT1_0131_C09.b : n
OVRT1_0076_G04.b :
OVRT1_0016_G11.b :
OVRT1_0115_E04.b :
OVRT1_0083_G05.b :
OVRT1_0129_D07.b :
OVRT1_0071_A02.b :
OVRT1_0073_C11.b :
OVRT1_0039_F01.b :
OVRT1_0014_D12.b :
OVRT1_0109_G08.b :
OVRT1_0025_A01.b :
OVRT1_0041_A12.b :
OVRT1_0092_A10.b :
OVRT1_0141_C03.b : nnna
OVRT1_0053_D04.b : n
OVRT1_0002_C06.b :
OVRT1_0042_E07.b :
OVRT1_0124_G05.b :
ADR01_0029_F09.b :
OVRT1_0139_G04.b : nna
OVRT1_0151_D11.b :
ADR01_0034_A11.b :
OVRT1_0050_B08.b : nnnt
OVRT1_0111_F06.b :
OVRT1_0011_D12.b :
OVRT1_0044_A11.b :
OVRT1_0077_A05.b :
OVRT1_0135_H01.b : nnn
OVRT1_0031_C09.b :
OVRT1_0105_E02.b :
OVRT1_0118_C04.b :
OVRT1_0077_H01.b :
OVRT1_0044_D01.b :
OVRT1_0129_G10.b : nn
OVRT1_0050_F11.b : nnn
OVRT1_0074_B07.b :
OVRT1_0024_E02.b :
OVRT1_0011_A03.b :
ADR01_0100_G01.b :
OVRT1_0034_A01.b :
OVRT1_0052_E08.b : nn
OVRT1_0105_C12.b :
OVRT1_0002_F02.b :
OVRT1_0041_E06.b :
OVRT1_0050_D04.b :
OVRT1_0084_F12.b :
OVRT1_0106_A12.b :
OVRT1_0030_G12.b :
OVRT1_0121_F03.b :
OVRT1_0121_B03.b :
ADR01_0086_C09.b :
OVRT1_0012_D11.b :
OVRT1_0027_D01.b :
OVRT1_0077_H08.b :
ADR01_0056_E05.b :
OVRT1_0125_E05.b :
OVRT1_0098_C06.b :
ADR01_0002_H05.b :
OVRT1_0057_H12.b :
OVRT1_0091_B08.b :
OVRT1_0126_C10.b :
OVRT1_0081_D11.b :
OVRT1_0096_A11.b :
OVRT1_0078_A09.b :
ADR01_0066_F07.b :
ADR01_0060_C04.b :
OVRT1_0093_A09.b : n
OVRT1_0051_G05.b :
OVRT1_0126_A02.b :
ADR01_0054_D10.b :
OVRT1_0075_D07.b :
ADR01_0100_B08.b :
ADR01_0077_G11.b :
OVRT1_0107_B08.b :
OVRT1_0069_A05.b : n
OVRT1_0011_H12.b :
OVRT1_0133_F09.b : nn
OVRT1_0039_C02.b :
ADR01_0093_F01.b :
ADR01_0068_G03.b :
OVRT1_0063_D01.b :
ADR01_0089_G03.b :
OVR01_0005_C04.b : tttgaacatctagcxxxxxx
OVRT1_0065_G10.b :
OVRT1_0151_G10.b :
ADR01_0033_E01.b :
OVRT1_0091_A02.b :
ADR01_0057_A05.b :
OVRT1_0035_A04.b :
OVRT1_0093_C11.b :
OVRT1_0050_E07.b : n
ADR01_0056_B06.b :
OVRT1_0094_C10.b :
ADR01_0078_D02.b :
OVRT1_0031_D02.b :
OVR01_0017_F06.b :
OVRT1_0082_F05.b :
ADR01_0095_A11.b :
ADR01_0055_H09.b :
ADR01_0068_E08.b :
ADR01_0094_H08.b :
ADR01_0048_C11.b :
ADR01_0057_H08.b :
ADR01_0085_H02.b :
ADR01_0101_E12.b :
ADR01_0083_D11.b :
ADR01_0098_F04.b :
ADR01_0068_G09.b :
OVRT1_0150_E06.b :
OVRT1_0119_D08.b :
OVRT1_0089_B04.b :
OVRT1_0145_D12.b :
OVRT1_0094_C07.b :
OVRT1_0010_H09.b :
OVRT1_0076_G06.b :
OVRT1_0044_F07.b :
OVRT1_0090_D02.b :
OVRT1_0068_D10.b :
OVRT1_0052_B08.b :
OVRT1_0047_C08.b :
TES01_0078_F02.b :
TES01_0075_B05.b :
OVRM1_0221_H02.b :
OVRM1_0151_H10.b :
OVRM1_0126_H10.b :
TES01_0095_A07.b :
TES01_0056_G01.b :
ADR01_0076_H12.b :
TES01_0097_D11.b :
TES01_0112_E11.b :
TES01_0026_C02.b :
OVRM1_0090_H03.b :
TES01_0035_H05.b :
TES01_0022_E08.b :
TES01_0107_F08.b :
TES01_0100_B10.b :
TES01_0083_C03.b :
TES01_0092_H08.b :
OVRT1_0017_H10.b :
TES01_0013_F09.b :
TES01_0012_F02.b :
TES01_0104_B12.b :
TES01_0017_H01.b :
TES01_0092_F11.b :
TES01_0063_E04.b :
TES01_0111_G06.b :
OVRM1_0188_H04.b :
TES01_0052_G04.b :
TES01_0084_H03.b :
TES01_0054_C05.b :
TES01_0056_F08.b :
TES01_0058_C10.b :
TES01_0100_H12.b :
ADR01_0093_A06.b :
TES01_0011_A12.b :
TES01_0003_A05.b :
TES01_0111_H12.b :
TES01_0079_E09.b :
OVRM1_0081_A02.b :
OVRM1_0166_H03.b :
TES01_0021_F12.b :
OVRT1_0119_C10.b :
TES01_0019_C11.b :
ADR01_0073_A09.b :
OVRT1_0092_A02.b :
OVRM1_0111_B09.b :
OVRT1_0140_G01.b :
TES01_0025_A12.b :
TES01_0063_B06.b :
TES01_0021_F02.b :
TES01_0031_A12.b :
TES01_0070_A06.b :
TES01_0018_G07.b :
PCT01_0031_H09.b :
PCT01_0003_E06.b :
OVRM1_0021_F03.b :
TES01_0095_G02.b :
OVRM1_0044_E06.b :
ADR01_0099_A01.b :
OVRM1_0064_E06.b :
OVRM1_0219_C06.b :
OVRT1_0077_F08.b :
OVRM1_0101_C12.b :
OVRM1_0155_E05.b :
OVRM1_0189_D06.b :
OVRM1_0047_H02.b :
OVRM1_0016_H03.b :
OVRM1_0004_E03.b :
OVRM1_0126_A12.b :
OVRM1_0220_B01.b :
OVRM1_0174_H12.b :
ADR01_0055_H06.b :
ADR01_0093_G08.b :
OVRM1_0201_H02.b :
ADR01_0015_F09.b :
OVRM1_0104_F02.b :
OVRM1_0016_H07.b :
OVRM1_0038_H04.b :
OVRM1_0030_F08.b :
OVRM1_0058_E02.b :
ADR01_0012_H04.b :
20110601C-006984 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRM1_0209_G04.b : gaattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0222_F02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0168_E07.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0100_A06.b : aaaaaanggatcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0090_H12.b : nnttgtttnnnngnnnccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0034_D06.b :
TES01_0101_E11.b : ttttat
OVRM1_0131_B12.b : ncagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0079_C10.b : nccctccgcagcggctct
OVRM1_0161_D01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0076_E10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0018_E05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0038_G03.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0095_B08.b : cagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0025_B01.b :
OVRT1_0011_C01.b : nncccccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0091_C05.b : nnttaccgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0195_D02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0035_B03.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0104_B11.b : nagttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0037_A02.b : nnnnggtgaagcxxxxxxxxxxxxxxxxxxx
OVRM1_0008_A11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0024_G05.b : nnntttctatagctgacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0146_B02.b : nnnnccttctgcgnaggagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0058_D10.b : ctgttttnnnnnnnnccctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0090_H04.b : ncctgttnnnnnnncacgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0026_C01.b : nnnnncctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0036_D04.b : nnnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0033_H12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxx
ADR01_0084_F09.b : aaaaannggactaacxxxxxxxxxxxxxxxxxxx
OVRT1_0035_D04.b : nnnnnccgtcagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0088_E10.b : nnccttttttnnnnnnccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0074_A07.b : cctcatnnnnnnnnanccgttagcgnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0039_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0096_G04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0062_H01.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0201_F06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0206_G08.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0058_G06.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0204_E08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0053_B10.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0107_G11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0123_A09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0115_H09.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0030_B11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0020_B08.b : ntgtgaacaxxxxxxxxxxxxxxxxx
OVRT1_0117_E12.b : nncctcgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0134_G06.b : aaccacttnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0077_G06.b : nnnnnggatgaacaxxxxxxxxxxxxxxxx
ADR01_0048_C05.b : nttttaagatatacaxxxxxxxxxxxxxxxxx
OVRT1_0076_F07.b : nccgtttttnnnnnnccctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0148_H06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0151_A08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0166_E12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0096_B07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0005_D02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0168_E06.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0102_G02.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0216_G12.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0188_F10.b : gagtttgtcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0056_B09.b : ggagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0121_A12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0025_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0011_H08.b : nnttatcaacaxxxxxxxxxxxxxxxx
ADR01_0038_F09.b : nnnnggtgaaacaxxxxxxxxxxxxxxxxxxxxx
OVRT1_0111_D06.b : nnnnnacgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0049_A10.b : nttactacgttgctctgat
OVRT1_0102_C07.b : nnnnccttcgcggaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0099_B12.b : nntttactcagcgcacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0069_G06.b : nnggcctttnnnnnnnncctttagcgcacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0099_A10.b : nccccccgacagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0044_A05.b : naaagaaacaxxxxxxxxxxxxxxxxxxxx
OVRT1_0120_D02.b : naacgtttgctnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0061_C11.b : ngggcttttngggnttccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0134_A09.b : ccctaatnnnnnnnnccgttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0007_A11.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0013_A10.b : nnnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0059_B08.b : nnnnccatgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0062_B06.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0011_B12.b : nccttccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0099_H11.b : nccttccttcagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0223_D04.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0163_B07.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0200_F01.b : gcagttgtcatxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0153_G05.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0192_B02.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0087_A04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0199_C09.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxx
OVRM1_0085_F01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0099_C02.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0155_D09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0185_D06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0119_H06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0056_D09.b : agttgacxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0204_G10.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0184_H12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0137_C07.b : aaaattcaccccnnnnnccgtatagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0108_H10.b : nnnccgttcgctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0014_H02.b : ntttcgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0140_F02.b : nnaaaggaaacnnnnnnnccgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0131_G03.b : nnaactttttnnngnnnccgttagcgttacgaggxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0003_F08.b : nnnggcgtttaaaannnncctgcgttggctactggaa
OVRT1_0102_H08.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0045_D08.b : nnncccttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0131_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxgcttctcgcttaaccttgagctggtggttataag
OVRT1_0147_E03.b : nnncccctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0101_D03.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0006_B03.b : nnnnncctctcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0042_C08.b : nnnncccttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0111_A02.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0126_A12.b : nnnnccctttagctgtcgagtgxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0056_E03.b : nngggtttnnnnnnnnnccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0051_C07.b : nnccgcttnnnnnggnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0049_D06.b : nnttagttnnnnggnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0089_G09.b : nnnggtttaannnngggtxxxxxxxxxxxxxxxxxxxx
OVRT1_0079_D12.b : ggggtccatattgctgcatgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0050_B01.b : nccgttnnnnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0136_E10.b : nnaaacttctnnnnnnnnccgtttgcgttacgaggxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0121_A06.b : nccgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0003_A11.b : nnnnccctctagcgnacngagtgxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0069_A03.b : nnggcttttnnnnnnnccattggcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0045_H07.b : nncccccttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0022_H05.b : nggactcgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0026_A10.b : nntttcctatagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0012_A03.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtaag
OVRT1_0003_D12.b : ttttccctctagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0124_B08.b : nnnnccgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0020_C05.b : nggtgtttnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0012_E10.b : nnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0008_C10.b : tatatggccatatatggcttacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0041_G01.b : caattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0046_B09.b : cggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0155_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0017_D03.b : taaacaxxxxxxxxxxxxxxxxxxx
OVRM1_0068_H06.b : nagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0225_F12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0037_B05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0039_D09.b : xxxxxxxxxxxxxxxxxxxxx
OVRM1_0064_C05.b : gagttgacacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0071_A08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0066_B08.b : nnttgctaggactataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0152_C04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0182_F08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0160_H07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0165_B02.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0161_C10.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0157_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0197_B04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0028_A03.b : ntgaaacaxxxxxxxxxxxxxxxxxxx
ADR01_0016_E06.b : aatgaacaxxxxxxxxxxxxxxx
TES01_0073_H05.b :
OVRM1_0203_G04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0197_F04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0193_G04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0150_E06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0081_E07.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0108_D03.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0152_H08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0214_B01.b : nagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0134_B04.b : tcagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0149_H05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0155_D02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0052_B01.b : agttgacacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0073_C06.b : tccctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0034_A08.b : aattttgtgcaactxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0134_H10.b : ncagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0074_F05.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0154_G07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0059_A02.b : xxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0065_F04.b : xxxxxxxxxxxxxxxxxxxxx
OVRM1_0018_C04.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0147_C12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0153_H10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0154_E11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0074_D06.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0014_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0013_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0211_H03.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0130_C02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0065_E04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0147_H09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0218_B03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0167_C04.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0063_C06.b : tagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0151_D09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0057_F04.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0048_D11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0113_C01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0197_F12.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0205_D04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0115_D01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0209_A08.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0206_C01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0169_E04.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0209_A07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0169_D04.b : gagttgtcatxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0041_C12.b : xxxxxxxxxxxxxxxxxxxxx
OVRM1_0116_C01.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0138_G02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0038_G01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0201_D04.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0041_F06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0063_C02.b : taattgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0100_A02.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0101_F02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0015_F03.b : taaatgaacaxxxxxxxxxxxxxxxxxxxx
OVRM1_0067_E11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0051_C05.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0179_C09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0006_F01.b : agatttgtcgaaactxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0182_B11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0037_D05.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0213_B06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0053_A09.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0083_A06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0043_E11.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0058_E11.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0125_D11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0128_B11.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0002_B08.b : atcaacaxxxxxxxxxxxxxxxxxxxx
OVRM1_0083_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0128_H12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0060_C07.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0025_B07.b : aaacaxxxxxxxxxxxxxxxxxxx
OVRM1_0043_C09.b : xxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0068_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0033_H11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0084_C05.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0129_D09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0024_F02.b : nagtttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0129_E03.b : nagttgtcnxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0118_B11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0102_A05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0028_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0122_B03.b : tcagtttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0130_F10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0139_F06.b : cggtcttaatnnnnnccttattgcgttacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0125_E11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0015_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0017_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0210_G10.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0053_B09.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0202_G08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0110_A04.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0099_D12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0167_G07.b : gagtttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0102_E10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0052_C11.b : ccttgaacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0166_B04.b : gcctttttttctttctttttttccatttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0084_D08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0086_G06.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0089_H07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0092_C11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0170_D10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0116_H07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0070_E09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0101_H04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0005_A11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0115_C06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0100_H04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0060_C10.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0078_B12.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0049_C12.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0054_D10.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0025_H03.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0042_A09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0204_F10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0022_A04.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0110_A12.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0213_C10.b : agttgacatxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0003_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0093_A08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0055_D12.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0110_F10.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0027_B10.b : aatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0012_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0202_D12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0094_E08.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0122_E08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0025_B07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0026_H12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0105_A06.b :
OVRM1_0012_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0011_C11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0026_C02.b : nggatgaacaxxxxxxxxxxxxxxxxxxxxx
OVRT1_0131_C01.b : nccaaatannnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0007_G11.b : nnnnnggtgaacaxxxxxxxxxxxxxxxxxxxx
ADR01_0023_D01.b : taaacaxxxxxxxxxxxxxxxxxxx
OVRT1_0131_E10.b : nnnggcactacnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0089_C09.b : nnncctatagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0030_E12.b :
OVRT1_0131_E01.b : naagtttnnnnnnnnnccgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0046_F08.b : nnggtgaaacaxxxxxxxxxxxxxxxxxxxx
OVRT1_0142_C11.b : aagttttnnnnnnnnccgttcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0040_E04.b : nnttgaaacaxxxxxxxxxxxxxxxxxxxx
ADR01_0013_F03.b : nnnnaatgaacaxxxxxxxxxxxxxxxxxxxx
ADR01_0008_E04.b : nnnnaatgaacaxxxxxxxxxxxxxxxxxx
OVRT1_0107_H10.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0103_D08.b : nnnnccgtcagctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0146_H11.b : tttttcctatagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0056_H11.b : nnnnccgtnnaaaagagtaacaxxxxxxxxxxxxxxxxxxxx
ADR01_0014_D04.b : nnnngatgaacaxxxxxxxxxxxxxxxxxxxxx
ADR01_0064_A10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRT1_0083_A05.b : nggactcgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0105_H03.b : nnnccgtcagctgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0065_C04.b : nncccccttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0046_C01.b : nnnnnccttagctnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0131_D01.b : nggcgtttnnnnnnnnccgttagcgttacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0125_H07.b : nnccgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0065_C01.b : nnnnnccgtttgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0092_H04.b : ttcgttnnnnngnnnccgcttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0112_G12.b : nnnnnnnnnnnnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0069_E06.b : nnnccctttanaannggagtaagcagcxxxxxxxxxxxxxxxx
ADR01_0040_F06.b : nttgaaacaxxxxxxxxxxxxxxxxxxxx
OVRT1_0114_A04.b : nnnccccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0080_D08.b : nnnnntctttttgctgcatgagtgcacgacagctcatxxxxxxxxxxxxxx
OVRT1_0011_G03.b : nnnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0047_F02.b : ntttcaagatgaacaxxxxxxxxxxxxxxxxxxxx
OVRT1_0142_F01.b : ggggttttnnnnnnnccgatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0073_H01.b : nntttacgttagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0083_G08.b : nnaaaccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0114_H02.b : nntttccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0009_H05.b : ggctccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0084_E08.b : nnaacccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0131_C09.b : nccatatccnnnnnnnccgttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0076_G04.b : ngggatactatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0016_G11.b : nntttccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0115_E04.b : nnnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0083_G05.b : ngggattcgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0129_D07.b : nnccaattttnnnnnnnccgttagcgttacgaggxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0071_A02.b : nnggtcttnnnnnnnncgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0073_C11.b : gttttccgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0039_F01.b : nnttttttnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0014_D12.b : nnttccgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0109_G08.b : nnncccgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0025_A01.b : ngggctttnnnnnncnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0041_A12.b : ngggttttnnnncnnccgttagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0092_A10.b : nnaattccgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0141_C03.b : aacactcnnnnnnnnccgttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0053_D04.b : ccgttttttnnnnnnncctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0002_C06.b : nnaatccgttcagcgacngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0042_E07.b : nnnnnccgtttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0124_G05.b : nnnaacgttcagctgtggxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0029_F09.b : nnttaaggagtaaacaxxxxxxxxxxxxxxxx
OVRT1_0139_G04.b : aagagtgtttnnnnnnccgttctgcttagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0151_D11.b : nntttccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0034_A11.b : nnncctttaaaaataactaaagcagcxxxxxxxxxxxxxxxx
OVRT1_0050_B08.b : tggctnnnnnngnnnccttttgcgttacgaggttxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0111_F06.b : nnnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0011_D12.b : ttttcccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0044_A11.b : naaaaccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0077_A05.b : nnncctcatattgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0135_H01.b : aatatatnnnnnnnncccgttagcgttacgaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0031_C09.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0105_E02.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0118_C04.b : nnnnccgttagctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0077_H01.b : nnttttacgttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0044_D01.b : nnnnnccgttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0129_G10.b : nccatacnnnnnnnnccgttcgcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0050_F11.b : ccgctnnnnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0074_B07.b : ncgcttttnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0024_E02.b : nnccccctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0011_A03.b : nncctccttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0100_G01.b : aaaaannggataaacaxxxxxxxxxxxxxxxxxxx
OVRT1_0034_A01.b : nntttccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0052_E08.b : cccgcttnnnnggnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0105_C12.b : nnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0002_F02.b : nnnnncctctagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0041_E06.b : nnggtgtnnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0050_D04.b : nnggttttnnnnnnnnccgttagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0084_F12.b : nttttcccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0106_A12.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0030_G12.b : nngggcttnnnnggntnccgtcgcgttagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0121_F03.b : ncgacagctgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0121_B03.b : nnccgttagctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0086_C09.b : nngggaaaannnnggactaacagctggaxxxxxxxxxxxxx
OVRT1_0012_D11.b : nntttccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0027_D01.b : nnnnccttttgcggacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0077_H08.b : nnncctacttctgcgcacgagtgxxxxxxxxxxxxxxxxxxxxxx
ADR01_0056_E05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRT1_0125_E05.b : nncctttagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0098_C06.b : nnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0002_H05.b : tatgaacaxxxxxxxxxxxxxxxxxxxx
OVRT1_0057_H12.b : nttttccgttcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0091_B08.b : nggaaccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0126_C10.b : nnnccccgttagctgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0081_D11.b : ntttccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0096_A11.b : nntttccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0078_A09.b : nggtttactatagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0066_F07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ADR01_0060_C04.b : nnnaacgctaaacaxxxxxxxxxxxxxxxxxxxx
OVRT1_0093_A09.b : nggtttnnnnnnnnnccgatagcggacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0051_G05.b : nnnttacgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0126_A02.b : nnncccctatagctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0054_D10.b : nnnntcggnnnnnggagaaacaxxxxxxxxxxxxxxxxxxxxx
OVRT1_0075_D07.b : ngggaccctatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0100_B08.b : nnnaaaacataaaaanggataaagcagcggtxxxxxxxxxxxxxx
ADR01_0077_G11.b : nnnnnnggactaacaxxxxxxxxxxxxxxxxxxxxx
OVRT1_0107_B08.b : nnnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0069_A05.b : nncgttnnnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0011_H12.b : nntttccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0133_F09.b : nccgtaatnnnnnnnnccgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0039_C02.b : nnnnnccgttagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0093_F01.b : nnnccgtttnnnnttgatcaagcagcxxxxxxxxxxxxxxxxxx
ADR01_0068_G03.b : nccattaannnnggatgaacaxxxxxxxxxxxxxxxxxxxx
OVRT1_0063_D01.b : ngcgcctttnnnntttccgtcagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0089_G03.b : nnncctttannnnnggagtaagcagcggnaxxxxxxxxxxxx
OVR01_0005_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0065_G10.b : ntttttccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0151_G10.b : nntttacgttagcgtaggagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0033_E01.b : nnnggttttttaanggactaaacaxxxxxxxxxxxxxxxxxxx
OVRT1_0091_A02.b : nnccgtttnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0057_A05.b : nnnnnaatgaacaxxxxxxxxxxxxxxxxxxxxx
OVRT1_0035_A04.b : nnntttcgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0093_C11.b : nngggcttnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0050_E07.b : nccgcctnnnnggnnncctatagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0056_B06.b : ggggnaggatgaacxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0094_C10.b : nggctttnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0078_D02.b : nnnnnnggataaacaxxxxxxxxxxxxxxxxxxx
OVRT1_0031_D02.b : ntcttttnnnnnnncccttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0017_F06.b : gggggggacctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0082_F05.b : nnncccctttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0095_A11.b : nnccgttaaaaaanggactxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0055_H09.b : nnnttcgaannnnggataaagcagcxxxxxxxxxxxxxxxxxx
ADR01_0068_E08.b : nnngggttaannnnnggatatagcagcxxxxxxxxxxxxxxxxx
ADR01_0094_H08.b : nnccgttaannnnatgatatagcagcggtccggntccggaxx
ADR01_0048_C11.b : nnnnnaagatgaacaxxxxxxxxxxxxxxxxxxxx
ADR01_0057_H08.b : nnnaatgtgxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0085_H02.b : nnntttgataaacagctggaxxxxxxxxxxxx
ADR01_0101_E12.b : ttaatcggataaacagctgnaxxxxxxxxxxxx
ADR01_0083_D11.b : nnnnnnggactaacaxxxxxxxxxxxxxxxxxxxx
ADR01_0098_F04.b : cataaanggagtaacxxxxxxxxxxxxxxxxxxxx
ADR01_0068_G09.b : nggctttnnnnnnggactaacaxxxxxxxxxxxxxxxxxxxxx
OVRT1_0150_E06.b : nnnnncctatagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0119_D08.b : ccttcgctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0089_B04.b : ncctattgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0145_D12.b : ttttccgttcgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0094_C07.b : nnaacccgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0010_H09.b : ntttcgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0076_G06.b : ngggactctatagctgtacgagtgxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0044_F07.b : nnntttcgtttgctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0090_D02.b : nngggcttnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0068_D10.b : nnggtcttttnnnnnncccatcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0052_B08.b : nnnnggtttnnnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0047_C08.b : nnccttctgcgccggagtgxxxxxxxxxxxxxxxxxxxxxxx
TES01_0078_F02.b :
TES01_0075_B05.b :
OVRM1_0221_H02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0151_H10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0126_H10.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0095_A07.b :
TES01_0056_G01.b :
ADR01_0076_H12.b : nnggcttnnaaaaaggataaagcagcxxxxxxxxxxxxx
TES01_0097_D11.b :
TES01_0112_E11.b :
TES01_0026_C02.b :
OVRM1_0090_H03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0035_H05.b :
TES01_0022_E08.b :
TES01_0107_F08.b :
TES01_0100_B10.b :
TES01_0083_C03.b :
TES01_0092_H08.b :
OVRT1_0017_H10.b : nttccgttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0013_F09.b :
TES01_0012_F02.b :
TES01_0104_B12.b :
TES01_0017_H01.b :
TES01_0092_F11.b :
TES01_0063_E04.b :
TES01_0111_G06.b :
OVRM1_0188_H04.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0052_G04.b :
TES01_0084_H03.b :
TES01_0054_C05.b :
TES01_0056_F08.b :
TES01_0058_C10.b :
TES01_0100_H12.b :
ADR01_0093_A06.b : nnntttgatgaacaxxxxxxxxxxxxxxxx
TES01_0011_A12.b :
TES01_0003_A05.b :
TES01_0111_H12.b :
TES01_0079_E09.b :
OVRM1_0081_A02.b :
OVRM1_0166_H03.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxx
TES01_0021_F12.b :
OVRT1_0119_C10.b : cgtcagcgtaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0019_C11.b :
ADR01_0073_A09.b : nnnccctaaannnntgataacaxxxxxxxxxxxxx
OVRT1_0092_A02.b : nnnccccgtcagcgcaggxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0111_B09.b : nagttgtcxxxxxxxxxxxxxxxxxxx
OVRT1_0140_G01.b : nnaaaataatnnnnnnnnnccgttagcgttggxxxxxxxxxxxxxxxxxxxxx
TES01_0025_A12.b :
TES01_0063_B06.b :
TES01_0021_F02.b :
TES01_0031_A12.b :
TES01_0070_A06.b :
TES01_0018_G07.b :
PCT01_0031_H09.b : nnnccgg
PCT01_0003_E06.b : nnn
OVRM1_0021_F03.b :
TES01_0095_G02.b :
OVRM1_0044_E06.b : ttgt
ADR01_0099_A01.b :
OVRM1_0064_E06.b :
OVRM1_0219_C06.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0077_F08.b : nnaactcattctgct
OVRM1_0101_C12.b :
OVRM1_0155_E05.b :
OVRM1_0189_D06.b :
OVRM1_0047_H02.b :
OVRM1_0016_H03.b :
OVRM1_0004_E03.b :
OVRM1_0126_A12.b :
OVRM1_0220_B01.b :
OVRM1_0174_H12.b :
ADR01_0055_H06.b :
ADR01_0093_G08.b :
OVRM1_0201_H02.b :
ADR01_0015_F09.b :
OVRM1_0104_F02.b :
OVRM1_0016_H07.b :
OVRM1_0038_H04.b :
OVRM1_0030_F08.b :
OVRM1_0058_E02.b :
ADR01_0012_H04.b :
---------+---------+---------+---------+---------+---------+ 49
ADR01_0037_A02.b : xxxxxxxxxxxxxxxxxxxxGG*AGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0020_B08.b : xxxxxxxxxxxxxxxxxxxxxGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0077_G06.b : xxxxxxxxxxxxxxxxxxxxxGGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0048_C05.b : xxxxxxxxxxxxxxxxxxxxxTGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0148_H06.b : xxxxxxxxxxxxxxxxxxxxxxCAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0151_A08.b : xxxxxxxxxxxxxxxxxxxxxxGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0166_E12.b : xxxxxxxxxxxxxxxxxxxxxxGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0096_B07.b : xxxxxxxxxxxxxxxxxxxxxxGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0005_D02.b : xxxxxxxxxxxxxxxxxxxxxcGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0168_E06.b : xxxxxxxxxxxxxxxxxxxxxxCAGACTCACC*TCATCAGG**CCCTGCTGCA*GTAGGA
OVRM1_0102_G02.b : xxxxxxxxxxxxxxxxxxxxxxGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0216_G12.b : xxxxxxxxxxxxxxxxxxxxxxGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0188_F10.b : xxxxxxxxxxxxxxxxxxxxxxAAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0056_B09.b : xxxxxxxxxxxxxxxxxxxxxxGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0121_A12.b : xxxxxxxxxxxxxxxxxxxxxxCAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0025_G06.b : xxxxxxxxxxxxxxxxxxxxxxTAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0011_H08.b : xxxxxxxxxxxxxxxxxxxxxcGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0038_F09.b : xxxxxxxxxxxxxxxxxxxxxxCAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0111_D06.b : xxxxxxxxxxxxxxxxxxxxxxAAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0049_A10.b : gagtagccttgttggcctactgGAGACTCACC*TCATCAGG**CCCTGCCCCT*TTGGGA
OVRT1_0102_C07.b : xxxxxxxxxxxxxxxxxxxxxaCAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0099_B12.b : xxxxxxxxxxxxxxxxxxxxxxTAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0069_G06.b : xxxxxxxxxxxxxxxxxxatggCAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0099_A10.b : xxxxxxxxxxxxxxxxxxxxcgTAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0044_A05.b : xxxxxxxxxxxxxxxxxxxxxxCAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0120_D02.b : xxxxxxxxxxxxxxxxxxxxxxCAGATTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0061_C11.b : xxxxxxxxxxxxxxxxxxxxxxTAGACTCGCC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0134_A09.b : xxxxxxxxxxxxxxxxxxxxxxGAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVR01_0007_A11.b : xxxxxxxxxxxxxxxxxxxxxxCAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0013_A10.b : xxxxxxxxxxxxxxxxxxxxxxTAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0059_B08.b : xxxxxxxxxxxxxxxxxxxxxxCAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0062_B06.b : xxxxxxxxxxxxxxxxxxxxxgTAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0011_B12.b : xxxxxxxxxxxxxxxxxxxxxxCAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0099_H11.b : xxxxxxxxxxxxxxxxxxxxxxTAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0223_D04.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0163_B07.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0200_F01.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0153_G05.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0192_B02.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0087_A04.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0199_C09.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0085_F01.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0099_C02.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0155_D09.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0185_D06.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0119_H06.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0056_D09.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0204_G10.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0184_H12.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0137_C07.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0108_H10.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0014_H02.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0140_F02.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0131_G03.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
PCT01_0003_F08.b : gctgggcccaggcgcccgaggccAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0102_H08.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0045_D08.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0131_A01.b : ctgggccccaggcgcccgaggccAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0147_E03.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0101_D03.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0006_B03.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0042_C08.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0111_A02.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0126_A12.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0056_E03.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0051_C07.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0049_D06.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0089_G09.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0079_D12.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0050_B01.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0136_E10.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0121_A06.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0003_A11.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0069_A03.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0045_H07.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0022_H05.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0026_A10.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0012_A03.b : ctgggccccaggcgcccgaggccAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0003_D12.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0124_B08.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0020_C05.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0012_E10.b : xxxxxxxxxxxxxxxxxxxxxxxAGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0008_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0041_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0046_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0155_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0017_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCCTG**TTATGCTGCA*GTGGGA
OVRM1_0068_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0225_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0037_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0039_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAAG**CCCTGCTGCA*GTGGGA
OVRM1_0064_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0071_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVR01_0066_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0152_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0182_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0160_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0165_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0161_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0157_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0197_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0028_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0016_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0073_H05.b : tttttcctgctgttgctatggcGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0203_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0197_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0193_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0150_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0081_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0108_D03.b : xxxxxxxxxxxxxxxxxxxxxxxcGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0152_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0214_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0134_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0149_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0155_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0052_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0073_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0034_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTTACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0134_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0074_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0154_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0059_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0065_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0018_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0147_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0153_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0154_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0074_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0014_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0013_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0211_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0130_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TTATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0065_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0147_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0218_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0167_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACCCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0063_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0151_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0057_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0048_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0113_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0197_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0205_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0115_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0209_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0206_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0169_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0209_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0169_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0041_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0116_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0138_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0038_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0201_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0041_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0063_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0100_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0101_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0015_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCACC**CTCTGCTGCA*GTGGGA
OVRM1_0067_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0051_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0179_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0006_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0182_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0037_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxTACTCACC*TCATCAGG**CCCTGCTGCA*CTGGGA
OVRM1_0213_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0053_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATTAGG**CCCTGCTGCA*GTGGGA
OVRM1_0083_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0043_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0058_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0125_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0128_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0002_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCACG**CCCTGCTGCA*GTGGGA
OVRM1_0128_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0060_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0025_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0043_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0068_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0033_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GAGGGA
OVRM1_0084_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0129_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0024_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0129_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0118_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0102_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0028_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0122_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0130_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0139_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0125_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0015_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0017_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0210_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0053_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0202_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0110_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0099_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0167_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0102_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0052_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0166_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0084_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0086_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0089_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0092_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0170_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0116_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0070_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0101_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0005_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0115_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCG*GTGGGA
OVRM1_0100_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0060_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0078_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0049_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0054_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0025_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0042_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0204_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0022_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0110_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0213_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0003_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0093_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0055_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0110_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0027_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0012_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0202_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0094_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0122_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCAACAGG**CCCTGCTGCA*GTGGGA
OVRM1_0025_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0026_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0105_A06.b : tttttcctgctgtggctctggAGACCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0012_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0011_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0026_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAAG**CCCTGCTGCA*GTGGGA
OVRT1_0131_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0007_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0023_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0131_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0089_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0131_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0046_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0142_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0040_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0013_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0008_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0107_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0103_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0146_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0056_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0014_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0064_A10.b : nnnnnxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0083_A05.b : xxxxxxxxxxxxxxxxxxxxcggtGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0105_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGG*A
OVRT1_0065_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0046_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCATG**CCCTGCTGCA*ATGGGA
OVRT1_0131_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0125_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0065_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0092_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0112_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0069_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0040_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0114_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0080_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0011_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0047_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAAG**CCCTGCTGCA*GTGGGA
OVRT1_0142_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0073_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0083_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0114_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0009_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0084_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0131_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0076_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0016_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0115_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0083_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0129_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0071_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0073_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0039_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0014_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0109_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0025_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0041_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0092_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0141_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0053_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0002_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0042_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0124_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0029_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0139_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0151_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0034_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0050_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0111_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0011_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0044_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0077_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0135_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0031_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0105_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0118_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0077_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0044_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0129_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0050_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0074_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0024_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0011_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0100_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0034_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0052_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0105_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0002_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0041_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0050_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0084_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0106_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0030_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0121_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0121_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0086_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0012_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCGGG**CCCTGCTGCA*GTGGGA
OVRT1_0027_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0077_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0056_E05.b : nxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0125_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0098_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0002_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCACG**CCCTGCTGCA*GTGGGA
OVRT1_0057_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0091_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0126_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0081_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0096_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0078_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0066_F07.b : nnnxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0060_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0093_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0051_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0126_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0054_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0075_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0100_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0077_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0107_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0069_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0011_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0133_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0039_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0093_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0068_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0063_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0089_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVR01_0005_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0065_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TTATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0151_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0033_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0091_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0057_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCACG**CCCTGCTGCA*GTGGGA
OVRT1_0035_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0093_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0050_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0056_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0094_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0078_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0031_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVR01_0017_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0082_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0095_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0055_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0068_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0094_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0048_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0057_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0085_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0101_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0083_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0098_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0068_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxGACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0150_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxtACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0119_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxcACTTACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0089_B04.b : xxxxxxxxxxxxxxxxxxxxxxxatACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0145_D12.b : xxxxxxxxxxxxxxxxxxxxxxxatACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0094_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0010_H09.b : xxxxxxxxxxxxxxxxxxxxxcgatACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0076_G06.b : xxxxxxxxxxxxxxxxxxxxxxxatACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0044_F07.b : xxxxxxxxxxxxxxxxxxxxxxxatACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0090_D02.b : xxxxxxxxxxxxxxxxxxxxxxxatACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0068_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0052_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxtACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0047_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxACTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0078_F02.b : ttcccgctgtggctatggctgggCTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0075_B05.b : tttttcgctgttgctatgCTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0221_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0151_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0126_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0095_A07.b : tttttcctcgcgttggcttggaATCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0056_G01.b : ntttcctgcgttgctactggaATCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0076_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxCTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0097_D11.b : tttttccggagtggctctggctggagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0112_E11.b : tttcctgcgttggctatgagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0026_C02.b : tgtggctctggctctggggagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0090_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0035_H05.b : tttttcctgctgtggctatggagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0022_E08.b : tcgcgttggctatggagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0107_F08.b : ttttncctgctgtggctatgggagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0100_B10.b : tttccggcgtggctatggagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0083_C03.b : tttttcctgcgttggctctggagaCCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0092_H08.b : tttttcctgacgttgctagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0017_H10.b : xxxxxxxxxxxxxxxxxxxxxxxcgatTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0013_F09.b : ttttcctaacggttgctatggagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0012_F02.b : ttctactgtggctctgggagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0104_B12.b : nntttcctactgttgctatggagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0017_H01.b : tttggctctggtggagaTCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0092_F11.b : nnggtgactgtggctagcgacTCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0063_E04.b : ntttctgcgtggctatggagaTCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0111_G06.b : ncctgctgtggctctggagaTCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0188_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0052_G04.b : nnnttctactgttgctctggagaTCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0084_H03.b : tttttcctgcggtggctatggagaTCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0054_C05.b : ncctacggtggctctggagaTCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0056_F08.b : ttttctgctgtggctctggagaTCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0058_C10.b : tcgctgttggctgagaTCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0100_H12.b : ntttactacgttggctatggagaTCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0093_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxCACC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0011_A12.b : tcgcgttggctctggagaTCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0003_A05.b : tttcgctgtggctctggcaacTCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0111_H12.b : ttcctgctgttgctctggagacCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0079_E09.b : ttttttcctactgttgctatgggagacCCC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0166_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0021_F12.b : gttggctctgggggagatcCC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0119_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxccacttCC*TCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0019_C11.b : gttggctcagactcCC*TCATCAGG**CCCTGCTGCA*GTGGGA
ADR01_0073_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0092_A02.b : xxxxxxxxxxxxxxxxxxxxxacagtaatagC*TCATCAGG**CCCTGCTGCA*GTGGGA
OVRM1_0111_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCATCAGG**CCCTGCTGCA*GTGGGA
OVRT1_0140_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCAGG**CCCTGCTGCA*GTGGGA
TES01_0063_B06.b : tttcctgcgtggctatgagatcacctcTCAGG**CCCTGCTGCA*GTGGGA
TES01_0021_F02.b : tttctgctgttgctctggagaccactcTCAGG**CCCTGCTGCA*GTGGGA
TES01_0031_A12.b : ttttcctaacggttgctatggagatcactcTCAGG**CCCTGCTGCA*GTGGGA
TES01_0070_A06.b : tttttgctgctgttgctagatcactcnCAGG**CCCTGCTGCA*GTGGGA
TES01_0018_G07.b : ccgcgttggctatggagaccactcnCAGG**CCCTGCTGCA*GTGGGA
PCT01_0031_H09.b : cttttnnnnnnngcagcgttggccanggntctactcatcGG**CCCTGCCGCA*NTGGGA
PCT01_0003_E06.b : ttcggttaannnnnncctgcgggtgctaaatccctcatcGG**CCCTGCTGCA*GTGGGA
TES01_0095_G02.b : ttttactcgcgttgctcatcaggcccGCTGCA*GTGGGA
OVRM1_0044_E06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGAGA
ADR01_0099_A01.b : ttaaagtgagtaac
OVRM1_0064_E06.b :
OVRM1_0219_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxagtcaattgcgtctcgacccgctgccgcgccac
OVRT1_0077_F08.b : gcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0101_C12.b :
OVRM1_0155_E05.b :
OVRM1_0189_D06.b :
OVRM1_0047_H02.b :
OVRM1_0016_H03.b :
OVRM1_0004_E03.b :
OVRM1_0126_A12.b :
OVRM1_0220_B01.b :
OVRM1_0174_H12.b :
ADR01_0055_H06.b :
ADR01_0093_G08.b :
OVRM1_0201_H02.b :
ADR01_0015_F09.b :
OVRM1_0104_F02.b :
OVRM1_0016_H07.b :
OVRM1_0038_H04.b :
OVRM1_0030_F08.b :
OVRM1_0058_E02.b :
ADR01_0012_H04.b :
---------+---------+---------+---------+---------+---------+ 104
ADR01_0099_A01.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGG*GGCTTGCCCTCCG
OVRM1_0064_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGCCCTCCG
OVRM1_0219_C06.b : catggatagtcacagcgatcaggcgcctcttgctcggccaggtcgccttggcacatccgc
OVRT1_0077_F08.b : gactcacctcatcaggccctgctgcagtgggagcagggagagtagcagtggtaggggcag
OVRM1_0101_C12.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0155_E05.b :
OVRM1_0189_D06.b :
OVRM1_0047_H02.b :
OVRM1_0016_H03.b :
OVRM1_0004_E03.b :
OVRM1_0126_A12.b :
OVRM1_0220_B01.b :
OVRM1_0174_H12.b :
ADR01_0055_H06.b :
ADR01_0093_G08.b :
OVRM1_0201_H02.b :
ADR01_0015_F09.b :
OVRM1_0104_F02.b :
OVRM1_0016_H07.b :
OVRM1_0038_H04.b :
OVRM1_0030_F08.b :
OVRM1_0058_E02.b :
ADR01_0012_H04.b :
---------+---------+---------+---------+---------+---------+ 163
OVRM1_0155_E05.b : catxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC*AGGGC
OVRM1_0189_D06.b : xxxxxxx
OVRM1_0047_H02.b : a
OVRM1_0016_H03.b :
OVRM1_0004_E03.b :
OVRM1_0126_A12.b :
OVRM1_0220_B01.b :
OVRM1_0174_H12.b :
ADR01_0055_H06.b :
ADR01_0093_G08.b :
OVRM1_0201_H02.b :
ADR01_0015_F09.b :
OVRM1_0104_F02.b :
OVRM1_0016_H07.b :
OVRM1_0038_H04.b :
OVRM1_0030_F08.b :
OVRM1_0058_E02.b :
ADR01_0012_H04.b :
---------+---------+---------+---------+---------+---------+ 222
OVRM1_0189_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTAAAACCCCTCGCCCCTTC
OVRM1_0047_H02.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0016_H03.b : cxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0004_E03.b :
OVRM1_0126_A12.b :
OVRM1_0220_B01.b :
OVRM1_0174_H12.b :
ADR01_0055_H06.b :
ADR01_0093_G08.b :
OVRM1_0201_H02.b :
ADR01_0015_F09.b :
OVRM1_0104_F02.b :
OVRM1_0016_H07.b :
OVRM1_0038_H04.b :
OVRM1_0030_F08.b :
OVRM1_0058_E02.b :
ADR01_0012_H04.b :
---------+---------+---------+---------+---------+---------+ 281
OVRM1_0016_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGTACCGT*TTCTGGAAGGA
OVRM1_0004_E03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0126_A12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0220_B01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0174_H12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0055_H06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ADR01_0093_G08.b : nccattaaannnnnggataaagcagcxxx
OVRM1_0201_H02.b : agttgtcatxxxxxxxxxxxx
ADR01_0015_F09.b :
OVRM1_0104_F02.b :
OVRM1_0016_H07.b :
OVRM1_0038_H04.b :
OVRM1_0030_F08.b :
OVRM1_0058_E02.b :
ADR01_0012_H04.b :
---------+---------+---------+---------+---------+---------+ 340
OVRM1_0220_B01.b : xxxxxxxxxxxxgttggcctactggCACCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0174_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxCCATGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0055_H06.b : nnnnnnnxxxxxxxxxxxxxxxxxxxxxxxTGTCCAGAACTTCCA*GAAGTATGGTCCCA
ADR01_0093_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAACTTCCA*GAAGTATGGTCCCA
OVRM1_0201_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtTTCCA*GAAGTATGGTCCCA
ADR01_0015_F09.b : tatcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0104_F02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0016_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0038_H04.b : ttgtcxxxxxxxxxxxxxxxxxxx
OVRM1_0030_F08.b : aatxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0058_E02.b : cgttgaccnaagxxxxxxxx
ADR01_0012_H04.b : nnnnaatgaacax
---------+---------+---------+---------+---------+---------+ 400
OVRM1_0038_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTATATCATCGACCCTGAAGATGTGG
OVRM1_0030_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATATCATCGACCCTGAAGATGTGG
OVRM1_0058_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCATCGACCCTGAAGATGTGG
ADR01_0012_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGACCCTGAAGATGTGG
---------+---------+---------+---------+---------+---------+ 460
OVRM1_0008_C10.b : CCCTTCTCTTTAAGTTCGAATGACCCcaacccagaaacgatacatctatctcgccctgag
---------+---------+---------+---------+---------+---------+ 518
OVRM1_0008_C10.b : ttgcctatctccagcattaaccaaaagccctgtgaggttctgatgaagaattctaggaac