[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-007023

Length: 1,363

Sequence [FASTA format sequence]
CAGAGGCTTC GGGCATATAT AAGACTGAAG ATCTCTCAGT TAAGACCACA AGCAAAGGAT
GGTTTCTTGG GACTTCCAAA AACTTAAAAT CATGAAACCT CTATTACTGC TACTATTGTG
TGTTTTTATA ATTAAGGCCC AAGCTGCCAT TGACTACGAT GAGGACGAAG ATGGCAGACC
TAAGGTTCAT GTGGATGCCC GTGGTCATCG GCCCTATGAC AAGAGGAGGG AAGAGGCTCC
CAGCCTGAGA CCTGTCGCCC CTCCCATCAG TGCAGGTGGC TATCAACCTC GTCCAGCCAA
AGTAGCTATT GGCCAGAAGA AAGTGGAGAG AAAACCCCCT GATGCTGGGG GCTGCCTGCA
TGCTGATCCG GACCTGGGTG TGTTGTGTCC TACAGGATGT CAGTTGCAAG ATACTCTGCT
GAAACAGGAA AGACCAATCA AAACCAGTAT AGAAGAGCTG AATAGTAACA TAGACTCTGT
TTCCCAGTCC TCTTCTTCCA CCTTTCAGTA CATGACTCTG CTGAAACGCC TGTGGAAAGA
CAGGCAGAAG CAAAGAAGAG ATAATGAAAA TGTCATAAAT GAGTTCTCGT CCGAGCTGGA
AAAGCACCAG CTCTATATAG ATGAAACTGT GAACAGCAAC ATCCCCACTA ACTTGCGTGT
GCTCCGTGCC ATCCTGGAAA ACTTGAGAAG CAAAATACAG AAATTAGAAT CGGATGTCTT
GGCTCAGATG GAATACTGCC GTACTCCATG TACCGTCACT TGCAATATTC CTGTGGTGTC
TGGCAAAGAA TGTGAGGAAA TTATCAGGAA TGGAGGCGAA ACATCTGAAA TGTATCTCAT
TCAGCCTAGT GATTCCATCG AACCCTATAG AGTGTACTGT GATATGAAGA CAGAAAGAGG
AGGATGGACA GTAATTCAGA ACCGTCAAGA CGGTAGTGTT GACTTTGGCA GGAAATGGGA
TCCATATAAG CAAGGAATTT GGAAATATTG CAACCAGTGC AAATGGGAAA AAAATATTGT
GGCATACCAG GTGAGTATTG GCTTGGAAAT GATAAAATTA GCCAGCTTAC CAGGATGGGA
CCCACAAAGC TTTTGATCGA AATGGAGGAC TGGGAAGGAG GCAAGGTGAA GGCAATCTAC
GAAGGATTCA CTGTGCAGAA CGAAGCCAAT AAATACCAGA TCTCGCTGAG CAAATACAAG
GGAACAGCTG GCAACGCCCT CTTGGAAGGA GCCTCTCAAC TGGTGGGAGA AAACCCGAAC
CATGAACATC CACAACAGCA TGTTCTTCAG CACCTACAAC AGAGACAACG AACGGCTGGA
AAACCACAGA TCCCAGAAAG CAGTGTTCCT AAAAAGGATG GTG


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFGBfibrinogen beta chain isoform 1 preproprotein [Homo sapiens]. 483e-138O
Contig/Assembly ProteinFGBfibrinogen beta chain isoform 2 preproprotein [Homo sapiens]. 3303e-92O
Contig/Assembly ProteinFGGfibrinogen gamma chain isoform gamma-B precursor [Homo sapiens]. 95.18e-28O
Contig/Assembly ProteinFGGfibrinogen gamma chain isoform gamma-A precursor [Homo sapiens]. 95.18e-28O
Contig/Assembly ProteinANGPT2angiopoietin-2 isoform b precursor [Homo sapiens]. 78.22e-26
Contig/Assembly ProteinANGPT2angiopoietin-2 isoform a precursor [Homo sapiens]. 76.37e-26
Contig/Assembly ProteinANGPT2angiopoietin-2 isoform c precursor [Homo sapiens]. 76.37e-26O
Contig/Assembly ProteinFGL2fibroleukin precursor [Homo sapiens]. 69.74e-25O
Contig/Assembly ProteinANGPTL7angiopoietin-related protein 7 precursor [Homo sapiens]. 68.25e-24O
Contig/Assembly ProteinANGPTL1angiopoietin-related protein 1 precursor [Homo sapiens]. 67.82e-24


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFgbfibrinogen beta chain precursor [Mus musculus]. 444e-127O
Contig/Assembly ProteinFggfibrinogen gamma chain precursor [Mus musculus]. 95.97e-20O
Contig/Assembly ProteinAngpt2angiopoietin-2 precursor [Mus musculus]. 73.24e-25
Contig/Assembly ProteinFibcd1fibrinogen C domain-containing protein 1 [Mus musculus]. 70.11e-21O
Contig/Assembly ProteinAngpt1angiopoietin-1 precursor [Mus musculus]. 66.24e-22
Contig/Assembly ProteinAngptl1angiopoietin-related protein 1 precursor [Mus musculus]. 65.96e-24
Contig/Assembly ProteinAngptl7angiopoietin-related protein 7 precursor [Mus musculus]. 64.35e-21O
Contig/Assembly ProteinAngptl6angiopoietin-related protein 6 precursor [Mus musculus]. 63.57e-20O
Contig/Assembly ProteinFgl2fibroleukin precursor [Mus musculus]. 62.82e-23O
Contig/Assembly ProteinFcnbficolin-2 precursor [Mus musculus]. 61.63e-21O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC475472PREDICTED: similar to Fibrinogen beta chain precursor isoform 2 [Canis familiaris]. 478e-136O
Contig/Assembly ProteinLOC475472PREDICTED: similar to Fibrinogen beta chain precursor isoform 1 [Canis familiaris]. 473e-135O
Contig/Assembly ProteinLOC475472PREDICTED: similar to Fibrinogen beta chain precursor isoform 3 [Canis familiaris]. 1357e-34O
Contig/Assembly ProteinLOC475474PREDICTED: similar to fibrinogen, gamma chain isoform gamma-A precursor isoform 1 [Canis familiaris]. 943e-29O
Contig/Assembly ProteinLOC475474PREDICTED: similar to Fibrinogen gamma chain precursor isoform 2 [Canis familiaris]. 943e-29O
Contig/Assembly ProteinLOC475474PREDICTED: similar to fibrinogen, gamma chain isoform gamma-A precursor isoform 4 [Canis familiaris]. 93.64e-29O
Contig/Assembly ProteinLOC475902PREDICTED: similar to Fibroleukin precursor (Fibrinogen-like protein 2) (pT49) [Canis familiaris]. 721e-26O
Contig/Assembly ProteinLOC612843PREDICTED: similar to angiopoietin-like 1 precursor isoform 3 [Canis familiaris]. 69.32e-24
Contig/Assembly ProteinLOC612843PREDICTED: similar to angiopoietin-like 1 precursor isoform 4 [Canis familiaris]. 679e-24
Contig/Assembly ProteinLOC612843PREDICTED: similar to angiopoietin-like 1 precursor isoform 2 [Canis familiaris]. 679e-24


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFGBfibrinogen beta chain [Bos taurus]. 500e-144O
Contig/Assembly ProteinFGGfibrinogen gamma-B chain precursor [Bos taurus]. 94.44e-27O
Contig/Assembly ProteinFGL2fibroleukin precursor [Bos taurus]. 75.11e-27O
Contig/Assembly ProteinFIBCD1PREDICTED: microfibrillar-associated protein 4-like [Bos taurus]. 69.79e-19O
Contig/Assembly ProteinFIBCD1PREDICTED: microfibrillar-associated protein 4-like [Bos taurus]. 69.72e-21O
Contig/Assembly ProteinANGPTL7angiopoietin-related protein 7 precursor [Bos taurus]. 67.86e-23O
Contig/Assembly ProteinANGPTL1angiopoietin-related protein 1 precursor [Bos taurus]. 66.28e-24
Contig/Assembly ProteinANGPT1angiopoietin-1 precursor [Bos taurus]. 66.25e-22
Contig/Assembly ProteinFCN2ficolin-2 precursor [Bos taurus]. 62.83e-21O
Contig/Assembly ProteinTNNtenascin-N [Bos taurus]. 57.82e-17


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFGBPREDICTED: fibrinogen beta chain isoform 1 [Sus scrofa]. 604e-176O
Contig/Assembly ProteinFGBPREDICTED: fibrinogen beta chain isoform 2 [Sus scrofa]. 582e-169O
Contig/Assembly ProteinFGBPREDICTED: fibrinogen beta chain [Sus scrofa]. 424e-122O
Contig/Assembly ProteinLOC100627396PREDICTED: fibrinogen gamma chain-like [Sus scrofa]. 947e-29O
Contig/Assembly ProteinFGGPREDICTED: fibrinogen gamma chain [Sus scrofa]. 947e-29O
Contig/Assembly ProteinFGL2fibroleukin [Sus scrofa]. 74.33e-27O
Contig/Assembly ProteinANGPTL7angiopoietin-related protein 7 [Sus scrofa]. 70.12e-24O
Contig/Assembly ProteinFIBCD1PREDICTED: fibrinogen C domain-containing protein 1 [Sus scrofa]. 68.92e-21O
Contig/Assembly ProteinANGPTL1angiopoietin-related protein 1 [Sus scrofa]. 677e-24
Contig/Assembly ProteinANGPT1angiopoietin-1 precursor [Sus scrofa]. 66.28e-22


Assembly Members: 368      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
KDN010019E05KDN01_0019_E05.bFS672629 
KDN010053E04KDN01_0053_E04.bFS674665 
KDN010057C08KDN01_0057_C08.bHX234792 
KDN010066F07KDN01_0066_F07.bFS675718 
KDN010097C09KDN01_0097_C09.b  
LVR010001C02LVR01_0001_C02.bBP442860 
LVR010001E05LVR01_0001_E05.bBP444862 
LVR010001F03LVR01_0001_F03.bBP445577 
LVR010003A06LVR01_0003_A06.bBP441331 
LVR010003B03LVR01_0003_B03.bBP442014 
LVR010003B12LVR01_0003_B12.bBP442707 
LVR010003F09LVR01_0003_F09.bBP446014 
LVR010004A07LVR01_0004_A07.bBP441408 
LVR010004A10LVR01_0004_A10.bBP441642 
LVR010004B02LVR01_0004_B02.bBP441939 
LVR010004C11LVR01_0004_C11.bBP443528 
LVR010004D01LVR01_0004_D01.bBP443676 
LVR010004E01LVR01_0004_E01.bBP444569 
LVR010004H02LVR01_0004_H02.bBP447290 
LVR010005H01LVR01_0005_H01.bBP447213 
LVR010008A03LVR01_0008_A03.bBP441099 
LVR010008C04LVR01_0008_C04.bBP443017 
LVR010008D12LVR01_0008_D12.bBP444493 
LVR010009A05LVR01_0009_A05.bBP441258 
LVR010009G07LVR01_0009_G07.bBP446768 
LVR010010G11LVR01_0010_G11.bBP447060 
LVR010011E12LVR01_0011_E12.bBP445352 
LVR010011G06LVR01_0011_G06.bBP446700 
LVR010012A03LVR01_0012_A03.bBP441103 
LVR010012B05LVR01_0012_B05.bBP442177 
LVR010012D03LVR01_0012_D03.bBP443837 
LVR010012D05LVR01_0012_D05.bBP443986 
LVR010012F10LVR01_0012_F10.bBP446092 
LVR010012G12LVR01_0012_G12.bBP447139 
LVR010012H08LVR01_0012_H08.bBP447765 
LVR010013A09LVR01_0013_A09.bBP441572 
LVR010013C02LVR01_0013_C02.bBP442870 
LVR010013C04LVR01_0013_C04.bBP443022 
LVR010013D09LVR01_0013_D09.bBP444270 
LVR010014D02LVR01_0014_D02.bBP443765 
LVR010015A08LVR01_0015_A08.bBP441496 
LVR010015F07LVR01_0015_F07.bBP445882 
LVR010015F12LVR01_0015_F12.bBP446244 
LVR010016C04LVR01_0016_C04.bBP443024 
LVR010016D09LVR01_0016_D09.bBP444273 
LVR010017A12LVR01_0017_A12.bBP441800 
LVR010017E09LVR01_0017_E09.bBP445139 
LVR010017G09LVR01_0017_G09.bBP446914 
LVR010017H04LVR01_0017_H04.bBP447461 
LVR010018C06LVR01_0018_C06.bBP443176 
LVR010018D09LVR01_0018_D09.bBP444275 
LVR010019D03LVR01_0019_D03.bBP443844 
LVR010019F09LVR01_0019_F09.bBP446026 
LVR010020H07LVR01_0020_H07.bBP447695 AK232334
LVR010021C03LVR01_0021_C03.bBP442952 
LVR010021C05LVR01_0021_C05.bBP443104 
LVR010021D09LVR01_0021_D09.bBP444278 
LVR010021F04LVR01_0021_F04.bBP445668 
LVR010021G05LVR01_0021_G05.bBP446632 
LVR010022A02LVR01_0022_A02.bBP441034 
LVR010022A03LVR01_0022_A03.bBP441113 
LVR010022C07LVR01_0022_C07.bBP443250 
LVR010022C11LVR01_0022_C11.bBP443543 
LVR010025H03LVR01_0025_H03.bBP447386 
LVR010026A11LVR01_0026_A11.bBP441733 
LVR010026G01LVR01_0026_G01.bBP446326 
LVR010026H02LVR01_0026_H02.bBP447308 
LVR010029B03LVR01_0029_B03.bBP442034 
LVR010029E12LVR01_0029_E12.bBP445367 
LVR010029F04LVR01_0029_F04.bBP445673 
LVR010029F09LVR01_0029_F09.bBP446032 
LVR010029H02LVR01_0029_H02.bBP447310 
LVR010029H03LVR01_0029_H03.bBP447389 
LVR010030B05LVR01_0030_B05.bBP442192 
LVR010030C01LVR01_0030_C01.bBP442804 
LVR010031B11LVR01_0031_B11.bBP442649 
LVR010031D05LVR01_0031_D05.bBP444000 
LVR010031F09LVR01_0031_F09.b  
LVR010033A04LVR01_0033_A04.bBP441199 
LVR010033G06LVR01_0033_G06.bBP446715 
LVR010034C07LVR01_0034_C07.bBP443257 
LVR010034F02LVR01_0034_F02.bBP445526 
LVR010035B09LVR01_0035_B09.bBP442502 
LVR010036C02LVR01_0036_C02.bBP442888 
LVR010037C02LVR01_0037_C02.bBP442889 
LVR010037E10LVR01_0037_E10.bBP445222 
LVR010037H04LVR01_0037_H04.bBP447474 
LVR010038H01LVR01_0038_H01.bBP447239 
LVR010040C01LVR01_0040_C01.bBP442813 
LVR010040H07LVR01_0040_H07.bBP447710 
LVR010041B05LVR01_0041_B05.bBP442201 
LVR010041C01LVR01_0041_C01.bBP442814 
LVR010041E01LVR01_0041_E01.bBP444599 
LVR010042A03LVR01_0042_A03.bBP441128 
LVR010042D12LVR01_0042_D12.bBP444521 
LVR010042E08LVR01_0042_E08.bBP445088 
LVR010042F09LVR01_0042_F09.bBP446038 
LVR010043C02LVR01_0043_C02.bBP442894 
LVR010043E12LVR01_0043_E12.bBP445379 
LVR010043F11LVR01_0043_F11.bBP446191 
LVR010044A10LVR01_0044_A10.bBP441673 
LVR010044H04LVR01_0044_H04.bBP447481 
LVR010045D08LVR01_0045_D08.bBP444218 
LVR010045D10LVR01_0045_D10.bBP444371 
LVR010045F09LVR01_0045_F09.bBP446041 
LVR010045G06LVR01_0045_G06.bBP446723 
LVR010046A09LVR01_0046_A09.bBP441599 
LVR010046F08LVR01_0046_F08.bBP445971 
LVR010046H09LVR01_0046_H09.b  
LVR010047B07LVR01_0047_B07.bBP442357 
LVR010047H02LVR01_0047_H02.bBP447325 
LVR010048B05LVR01_0048_B05.bBP442207 
LVR010048C04LVR01_0048_C04.bBP443049 
LVR010048G03LVR01_0048_G03.bBP446500 
LVR010049C01LVR01_0049_C01.bBP442822 
LVR010049D04LVR01_0049_D04.bBP443941 
LVR010049D06LVR01_0049_D06.bBP444086 
LVR010050D08LVR01_0050_D08.bBP444223 
LVR010051E01LVR01_0051_E01.bBP444609 
LVR010051E05LVR01_0051_E05.bBP444897 
LVR010052B12LVR01_0052_B12.bBP442746 
LVR010053F05LVR01_0053_F05.bBP445765 
LVR010054F09LVR01_0054_F09.bBP446050 
LVR010054G11LVR01_0054_G11.bBP447098 
LVR010054H06LVR01_0054_H06.bBP447644 
LVR010055D08LVR01_0055_D08.bBP444227 
LVR010056A12LVR01_0056_A12.bBP441831 
LVR010056B11LVR01_0056_B11.bBP442672 
LVR010056E11LVR01_0056_E11.bBP445312 
LVR010056F02LVR01_0056_F02.bBP445543 
LVR010057C11LVR01_0057_C11.bBP443569 
LVR010057E02LVR01_0057_E02.bBP444689 
LVR010059G08LVR01_0059_G08.bBP446879 
LVR010060G12LVR01_0060_G12.bBP447181 
LVR010060H07LVR01_0060_H07.bBP447729 
LVR010061B06LVR01_0061_B06.bBP442294 
LVR010061F01LVR01_0061_F01.bBP445474 
LVR010061F07LVR01_0061_F07.bBP445915 
LVR010061F08LVR01_0061_F08.bBP445985 
LVR010062A06LVR01_0062_A06.bBP441377 
LVR010062H06LVR01_0062_H06.bBP447651 
LVR010062H09LVR01_0062_H09.bBP447884 
LVR010063B03LVR01_0063_B03.bBP442066 
LVR010063D11LVR01_0063_D11.bBP444463 
LVR010063E05LVR01_0063_E05.bBP444907 
LVR010063E09LVR01_0063_E09.bBP445175 
LVR010065B03LVR01_0065_B03.bBP442067 
LVR010065B05LVR01_0065_B05.bBP442222 
LVR010065C11LVR01_0065_C11.bBP443576 
LVR010065D03LVR01_0065_D03.bBP443881 
LVR010066D02LVR01_0066_D02.bBP443806 
LVR010066E12LVR01_0066_E12.bBP445399 
LVR010066G01LVR01_0066_G01.bBP446360 
LVR010066G02LVR01_0066_G02.bBP446438 
LVR010066H06LVR01_0066_H06.bBP447654 
LVR010067B07LVR01_0067_B07.bBP442376 
LVR010067C11LVR01_0067_C11.bBP443578 
LVR010068A01LVR01_0068_A01.bBP440993 
LVR010068B09LVR01_0068_B09.bBP442530 
LVR010068D08LVR01_0068_D08.bBP444239 
LVR010068F02LVR01_0068_F02.bBP445554 
LVR010071F06LVR01_0071_F06.bBP445852 
LVR010072A04LVR01_0072_A04.bBP441232 
LVR010072F09LVR01_0072_F09.bBP446065 
LVR010072H02LVR01_0072_H02.bBP447346 
LVR010076A06LVR01_0076_A06.bBP441387 
LVR010076B07LVR01_0076_B07.bBP442381 
LVR010076B09LVR01_0076_B09.bBP442533 
LVR010076H04LVR01_0076_H04.bBP447506 
LVR010077D09LVR01_0077_D09.bBP444324 
LVR010077E11LVR01_0077_E11.bBP445329 
LVR010077F02LVR01_0077_F02.bBP445560 
LVR010077H03LVR01_0077_H03.bBP447432 
LVR010078D08LVR01_0078_D08.bBP444245 
LVR010078H03LVR01_0078_H03.bBP447433 
LVR010078H05LVR01_0078_H05.bBP447585 
LVR010079B01LVR01_0079_B01.bBP441921 
LVR010081C10LVR01_0081_C10.bBP443512 
LVR010081D04LVR01_0081_D04.bBP443967 
LVR010081E01LVR01_0081_E01.bBP444633 
LVR010081E08LVR01_0081_E08.bBP445114 
LVR010081F12LVR01_0081_F12.bBP446296 
LVR010081G09LVR01_0081_G09.bBP446965 
LVR010081H02LVR01_0081_H02.bBP447353 
LVR010081H05LVR01_0081_H05.bBP447586 
LVR010082A04LVR01_0082_A04.bBP441240 
LVR010082A12LVR01_0082_A12.bBP441850 
LVR010082F10LVR01_0082_F10.bBP446148 
LVR010082H03LVR01_0082_H03.bBP447436 
LVR010083C09LVR01_0083_C09.bCJ000030 
LVR010083G01LVR01_0083_G01.bCJ000066 
LVR010083G02LVR01_0083_G02.bCJ000067 
LVR010083G04LVR01_0083_G04.bCJ000069 
LVR010083G05LVR01_0083_G05.bCJ000070 
LVR010083G12LVR01_0083_G12.bCJ000077 
LVR010084A01LVR01_0084_A01.bCJ000089 
LVR010084B12LVR01_0084_B12.bCJ000110 
LVR010084E09LVR01_0084_E09.bCJ000142 
LVR010084G10LVR01_0084_G10.bCJ000162 
LVR010084H11LVR01_0084_H11.bCJ000174 
LVR010085C12LVR01_0085_C12.bCJ000205 
LVR010085D05LVR01_0085_D05.bCJ000210 
LVR010085H06LVR01_0085_H06.bCJ000250 
LVR010087F01LVR01_0087_F01.bCJ000388 
LVR010087F02LVR01_0087_F02.bCJ000389 
LVR010087F12LVR01_0087_F12.bCJ000397 
LVR010087G11LVR01_0087_G11.bCJ000407 
LVR010087H01LVR01_0087_H01.bCJ000409 
LVR010088C10LVR01_0088_C10.bCJ000451 
LVR010088H10LVR01_0088_H10.bCJ000505 
LVR010089F06LVR01_0089_F06.bCJ000566 
LVR010089F11LVR01_0089_F11.bCJ000571 
LVR010089G11LVR01_0089_G11.bCJ000583 
LVR010090A06LVR01_0090_A06.bCJ000602 
LVR010090B04LVR01_0090_B04.bCJ000611 
LVR010090C04LVR01_0090_C04.bCJ000623 
LVR010090C08LVR01_0090_C08.bCJ000627 
LVR010090H04LVR01_0090_H04.bCJ000674 
LVR010091A12LVR01_0091_A12.bBW962750 
LVR010091C08LVR01_0091_C08.bCJ000707 
LVR010091H11LVR01_0091_H11.bCJ000759 
LVR010092B09LVR01_0092_B09.bCJ000773 
LVR010092D12LVR01_0092_D12.bCJ000799 
LVR010092G02LVR01_0092_G02.bCJ000823 
LVR010093E07LVR01_0093_E07.bBW962767 
LVR010094B10LVR01_0094_B10.bCJ000928 
LVR010094C06LVR01_0094_C06.bCJ000935 
LVR010094C10LVR01_0094_C10.bCJ000939 
LVR010094D01LVR01_0094_D01.bCJ000942 
LVR010094E04LVR01_0094_E04.bCJ000955 
LVR010094G07LVR01_0094_G07.bCJ000978 
LVR010095C01LVR01_0095_C01.bBP442850 
LVR010096B09LVR01_0096_B09.bBP442540 
LVR010096G08LVR01_0096_G08.bBP446894 
LVR010097A05LVR01_0097_A05.bBP441320 
LVR010097F04LVR01_0097_F04.bBP445718 
LVR010098D12LVR01_0098_D12.bBP444557 
LVR010098H04LVR01_0098_H04.bBP447515 
LVR010098H07LVR01_0098_H07.bBP447748 
LVR010099D08LVR01_0099_D08.bBP444253 
LVR010099D12LVR01_0099_D12.bBP444558 
LVR010100A07LVR01_0100_A07.bBP441479 
LVR010100B08LVR01_0100_B08.bBP442468 
LVR010100C10LVR01_0100_C10.bBP443519 
LVR010100D12LVR01_0100_D12.bBP444559 
LVR010100G04LVR01_0100_G04.bBP446609 
LVR010100G12LVR01_0100_G12.bBP447202 
LVR010100H06LVR01_0100_H06.bBP447671 
LVR010100H10LVR01_0100_H10.bBP447982 
LVR010101C12LVR01_0101_C12.bBP443667 
LVR010101D05LVR01_0101_D05.bBP444047 
LVR010101D12LVR01_0101_D12.bBP444560 
LVR010102B05LVR01_0102_B05.bBP442243 
LVR010102D12LVR01_0102_D12.bBP444561 
LVR010102E06LVR01_0102_E06.bBP444993 
LVR010102F05LVR01_0102_F05.bBP445796 
LVR010102H05LVR01_0102_H05.bBP447595 
LVR010103A12LVR01_0103_A12.bBP441857 
LVR010103E08LVR01_0103_E08.bBP445123 
LVR010103H02LVR01_0103_H02.bBP447363 
LVR010104A09LVR01_0104_A09.bBP441637 
LVR010104B07LVR01_0104_B07.bBP442396 
LVR010104B09LVR01_0104_B09.bBP442548 
LVR010104F05LVR01_0104_F05.bBP445798 
LVR010105B01LVR01_0105_B01.bBP441934 
LVR010105C08LVR01_0105_C08.bBP443375 
LVR010105E06LVR01_0105_E06.bBP444996 
LVR010106A03LVR01_0106_A03.bBP441173 
LVR010106B03LVR01_0106_B03.bBP442091 
LVR010106D12LVR01_0106_D12.bBP444565 
LVR010106F08LVR01_0106_F08.b  
LVR010106G06LVR01_0106_G06.bBP446762 
LVRM10003A01LVRM1_0003_A01.bBW962785 
LVRM10003D01LVRM1_0003_D01.bCJ001020 
LVRM10006H05LVRM1_0006_H05.bBP140908 
LVRM10007G11LVRM1_0007_G11.bBP140666 
LVRM10010B02LVRM1_0010_B02.bBP137993 
LVRM10011C06LVRM1_0011_C06.bBP450047 
LVRM10011F08LVRM1_0011_F08.bBP452641 
LVRM10016D03LVRM1_0016_D03.bBP450682 
LVRM10017F02LVRM1_0017_F02.bBP452244 
LVRM10019E11LVRM1_0019_E11.bBP139743 
LVRM10023F03LVRM1_0023_F03.bBP139895 
LVRM10027F12LVRM1_0027_F12.bBP140254 
LVRM10027H01LVRM1_0027_H01.bBP140759 
LVRM10028G07LVRM1_0028_G07.bBP140515 
LVRM10029E04LVRM1_0029_E04.bBP139492 
LVRM10030E04LVRM1_0030_E04.bBP139493 
LVRM10033D08LVRM1_0033_D08.bCJ001245 
LVRM10035E05LVRM1_0035_E05.bCJ001425 
LVRM10037F03LVRM1_0037_F03.bCJ001600 
LVRM10038A08LVRM1_0038_A08.bCJ001638 
LVRM10050E12LVRM1_0050_E12.bBP452126 
LVRM10051E12LVRM1_0051_E12.bBP452127 
LVRM10053B09LVRM1_0053_B09.bBP138292 
LVRM10054B08LVRM1_0054_B08.bBP138251 
LVRM10055C03LVRM1_0055_C03.bBP138512 
LVRM10056G01LVRM1_0056_G01.bBP140300 
LVRM10062D10LVRM1_0062_D10.bBP139278 
LVRM10073A05LVRM1_0073_A05.bBP137663 
LVRM10074D03LVRM1_0074_D03.bBP139008 
LVRM10075B05LVRM1_0075_B05.bBP138140 
LVRM10079E07LVRM1_0079_E07.bBP139618 
LVRM10084G08LVRM1_0084_G08.bCJ002746 
LVRM10086G08LVRM1_0086_G08.bCJ002908 
LVRM10090E08LVRM1_0090_E08.b  
LVRM10092D11LVRM1_0092_D11.bCJ003382 
LVRM10093B03LVRM1_0093_B03.bCJ003435 
LVRM10094H11LVRM1_0094_H11.bCJ003575 
LVRM10095G01LVRM1_0095_G01.bCJ003634 
LVRM10098E04LVRM1_0098_E04.bCJ003856 
LVRM10100E06LVRM1_0100_E06.bCJ004027 
LVRM10100F06LVRM1_0100_F06.bCJ004039 
LVRM10101B11LVRM1_0101_B11.bBP138397 
LVRM10103A09LVRM1_0103_A09.bBP448669 
LVRM10103A11LVRM1_0103_A11.bBP448812 
LVRM10103B07LVRM1_0103_B07.bBP449336 
LVRM10105E05LVRM1_0105_E05.bBP451662 
LVRM10108F05LVRM1_0108_F05.bBP452456 
LVRM10108F11LVRM1_0108_F11.bBP452870 
LVRM10110A07LVRM1_0110_A07.bBP448540 
LVRM10112C12LVRM1_0112_C12.bBP450497 
LVRM10116D11LVRM1_0116_D11.bBP451280 
LVRM10119D08LVRM1_0119_D08.bBP451067 
LVRM10124C02LVRM1_0124_C02.bBP449808 
LVRM10125E06LVRM1_0125_E06.bBP451750 
LVRM10126A03LVRM1_0126_A03.bBP448291 
LVRM10127B08LVRM1_0127_B08.bBP449430 
LVRM10129B02LVRM1_0129_B02.bBP449031 
LVRM10139B03LVRM1_0139_B03.bBP449105 
LVRM10139C01LVRM1_0139_C01.bBP449757 
LVRM10139E03LVRM1_0139_E03.bBP451561 
LVRM10140E08LVRM1_0140_E08.bBP451893 
LVRM10141D03LVRM1_0141_D03.bBP450728 
LVRM10142E11LVRM1_0142_E11.bBP452098 
LVRM10145C09LVRM1_0145_C09.bBP450312 
LVRM10146A05LVRM1_0146_A05.bBP448442 
LVRM10149D01LVRM1_0149_D01.bBP450600 
LVRM10151C01LVRM1_0151_C01.bBP449767 
LVRM10152G12LVRM1_0152_G12.bBP453803 
LVRM10153B02LVRM1_0153_B02.bBP449050 
LVRM10153B09LVRM1_0153_B09.bBP449524 
LVRM10154D04LVRM1_0154_D04.bBP450810 
LVRM10157F10LVRM1_0157_F10.bBP452846 
LVRM10158C09LVRM1_0158_C09.bBP450325 
LVRM10159F01LVRM1_0159_F01.bBP452234 
LVRM10161C11LVRM1_0161_C11.bBP450472 
LVRM10168B03LVRM1_0168_B03.bCJ004468 
LVRM10169H09LVRM1_0169_H09.bCJ004612 
LVRM10174A09LVRM1_0174_A09.bCJ004947 
LVRM10174G07LVRM1_0174_G07.bCJ004999 
LVRM10176F12LVRM1_0176_F12.bCJ005143 
LVRM10178A08LVRM1_0178_A08.bCJ005240 
LVRM10184G02LVRM1_0184_G02.bCJ005803 
LVRM10185G07LVRM1_0185_G07.bCJ005896 
LVRM10187E07LVRM1_0187_E07.bCJ006048 
LVRM10191F11LVRM1_0191_F11.bCJ006310 
LVRM10193A08LVRM1_0193_A08.bCJ006410 
LVRM10194C12LVRM1_0194_C12.bCJ006501 
LVRM10194F05LVRM1_0194_F05.bCJ006529 
LVRM10194H12LVRM1_0194_H12.bBW963296 
LVRM10198G08LVRM1_0198_G08.bCJ006885 
LVRM10199C05LVRM1_0199_C05.bCJ006927 
LVRM10202G02LVRM1_0202_G02.bCJ007207 
LVRM10204H03LVRM1_0204_H03.bCJ007382 
LVRM10206G03LVRM1_0206_G03.bCJ007535 
LVRM10208B12LVRM1_0208_B12.bCJ007664 
PST010014D11PST01_0014_D11.bFS698093 

  

SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
130A26700.750BSATA/I
T0890.250ATT/I


Alignment:      TOP

20110601C-007023 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
LVR01_0020_H07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0095_G01.b : ttgtcxxxxxxxxxxxx
LVRM1_0003_A01.b :
LVR01_0041_C01.b : ggcatcaagcatagtgactagtagacxxxxxxxxxxxxxxxxxx
LVR01_0004_A07.b : acatcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0019_E05.b :
KDN01_0097_C09.b :
LVRM1_0187_E07.b :
LVRM1_0033_D08.b :
LVR01_0084_H11.b : ggggctttggt
LVR01_0087_F01.b : gcactttxxxxxx
LVR01_0096_B09.b : tctttaccgggcttagt
LVRM1_0149_D01.b :
LVR01_0045_D10.b : ccatttggtgxxxx
LVR01_0106_B03.b : ggtttgtaaag
LVR01_0072_A04.b : ggctccaagtgxx
LVRM1_0094_H11.b :
LVRM1_0103_A11.b :
LVRM1_0011_C06.b :
LVR01_0063_E09.b : ctttttggg
LVR01_0018_D09.b : aattttgg
LVR01_0016_C04.b : catttgg
LVR01_0045_D08.b : ccatttxxx
LVRM1_0011_F08.b :
LVR01_0093_E07.b : gggg
LVRM1_0184_G02.b :
LVRM1_0093_B03.b :
LVRM1_0199_C05.b :
LVRM1_0146_A05.b :
LVRM1_0017_F02.b :
LVR01_0019_D03.b : xxxxxxx
LVR01_0081_G09.b : ttxxxxxx
LVR01_0040_H07.b : ccxxxxx
LVR01_0081_H05.b : xxxxxxxxxxx
LVR01_0021_G05.b : ccxxxx
LVR01_0022_A02.b : ccattagcgt
LVR01_0084_E09.b : cttttc
LVR01_0018_C06.b : ccxxxxxx
LVR01_0005_H01.b : gcaxxxxxxxx
LVR01_0083_G01.b : cttgacgggtct
LVR01_0066_D02.b : ttaaatagct
LVR01_0067_C11.b : ttttttgttttttatagcat
LVR01_0004_B02.b : tctac
LVR01_0094_D01.b : gcaxxxxxxxxxxxx
LVR01_0098_H04.b : ggatxxxxx
LVRM1_0055_C03.b :
LVRM1_0127_B08.b :
LVR01_0035_B09.b :
LVRM1_0185_G07.b :
LVRM1_0079_E07.b :
LVRM1_0158_C09.b :
LVR01_0043_F11.b : ccxxxx
LVR01_0085_D05.b : tcxxx
LVR01_0019_F09.b : gxxxxxxx
LVR01_0094_C10.b : axxxxxx
LVR01_0066_E12.b : gcatgta
LVR01_0078_D08.b : cxxxxxx
LVR01_0031_B11.b : cttttt
LVR01_0072_F09.b : ggctattt
LVR01_0012_H08.b : ggggctagca
LVR01_0009_A05.b : ccatt
LVR01_0061_F08.b : tatttagggc
LVR01_0012_B05.b : gggttttggc
LVR01_0067_B07.b : tttttttgttttaacgcaaagt
LVR01_0003_A06.b :
LVR01_0060_G12.b : taatcaggcatt
LVRM1_0168_B03.b :
LVR01_0081_E01.b : ggtcxxxxxxxx
LVRM1_0194_H12.b :
LVRM1_0062_D10.b :
LVRM1_0084_G08.b :
LVR01_0079_B01.b : ggatcaxxxx
LVRM1_0174_A09.b :
LVRM1_0110_A07.b :
LVRM1_0126_A03.b :
LVRM1_0151_C01.b :
LVRM1_0202_G02.b :
LVRM1_0194_F05.b :
LVRM1_0194_C12.b :
LVR01_0036_C02.b :
LVRM1_0204_H03.b :
LVRM1_0038_A08.b :
LVRM1_0178_A08.b :
LVRM1_0098_E04.b :
LVRM1_0100_F06.b :
LVRM1_0105_E05.b :
LVRM1_0119_D08.b :
LVRM1_0053_B09.b :
LVRM1_0092_D11.b :
LVRM1_0169_H09.b :
LVRM1_0035_E05.b :
LVRM1_0056_G01.b :
LVRM1_0003_D01.b :
LVRM1_0112_C12.b :
LVRM1_0050_E12.b :
LVRM1_0051_E12.b :
LVRM1_0208_B12.b :
LVRM1_0191_F11.b :
LVRM1_0103_B07.b :
LVRM1_0029_E04.b :
LVRM1_0139_E03.b :
LVRM1_0153_B02.b :
LVRM1_0116_D11.b :
LVRM1_0108_F05.b :
LVRM1_0139_C01.b :
LVRM1_0101_B11.b :
LVR01_0029_F09.b : ttt
LVRM1_0140_E08.b :
LVRM1_0142_E11.b :
LVRM1_0023_F03.b : caccccaaaacatcgagatactggagaaggtgacgaaaacgcgggggggacgagtngaaa
LVRM1_0006_H05.b :
LVR01_0096_G08.b : atttt
LVR01_0100_B08.b : gtggaaatttaaaggca
LVR01_0065_C11.b : tttaaagct
LVR01_0076_A06.b : gccxxxxx
LVR01_0087_G11.b : cttttc
LVR01_0065_D03.b : tttttacacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_C07.b : atxxxx
LVR01_0103_A12.b : attagagcatta
LVR01_0055_D08.b : cxxxxxx
LVR01_0046_F08.b : ggcgcggggcatt
LVR01_0097_A05.b : catxxxx
LVR01_0013_D09.b : ctttt
LVR01_0021_D09.b : ctttttg
LVR01_0097_F04.b : cttttg
LVR01_0015_F07.b : taggggcat
LVR01_0013_A09.b : ccxxxx
LVR01_0084_A01.b : tttggcat
LVR01_0076_H04.b : ggctttt
LVR01_0094_E04.b : ctxxxx
LVR01_0037_C02.b : ctttt
LVR01_0094_G07.b : atttttg
LVR01_0030_B05.b : tttt
LVR01_0091_A12.b : taaattggcatttngtgxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_A12.b : gggcaaaaaaaagcttagtgxxxxxxxxxxx
LVR01_0033_G06.b : attagx
LVR01_0087_F02.b : ctxxxx
LVR01_0092_G02.b : ggcatt
LVR01_0012_F10.b : gggtttggct
LVR01_0038_H01.b : cttttg
LVR01_0087_H01.b : agccttt
LVR01_0071_F06.b : acttxxxx
LVR01_0016_D09.b : attttg
LVR01_0061_F07.b : ggxxxxxxx
LVR01_0078_H03.b : agtcxxxxx
LVR01_0095_C01.b : gctxxxx
LVR01_0087_F12.b : ccxxxx
LVR01_0082_F10.b : ccxxxxxx
LVR01_0046_H09.b : ggccttt
LVR01_0085_H06.b : gcatt
LVR01_0088_H10.b : ggcaxx
LVR01_0062_H09.b : ggctxxx
LVR01_0102_H05.b : gccxxxx
LVR01_0029_H02.b : xxxx
LVR01_0021_C05.b : ccaxxx
LVR01_0102_F05.b : ctttag
LVR01_0017_E09.b : gttgggc
LVR01_0100_G12.b : gcattxx
LVR01_0026_G01.b : tctttctaactt
LVR01_0045_F09.b : ctxxxxx
LVR01_0077_D09.b : ggggggttacttnnggctt
LVR01_0048_C04.b : ggggggttttnacct
LVR01_0106_G06.b : gtgttttggggat
LVR01_0103_H02.b : agttaacctgc
LVR01_0078_H05.b : agxxxxxxxx
LVR01_0091_C08.b : ccttta
LVR01_0092_B09.b : acaaaagcat
LVR01_0003_B12.b : cactc
LVR01_0089_G11.b : catxxxxxxxxxxxxxx
LVR01_0105_C08.b : gggggcangggct
LVR01_0104_B09.b : gtaaacattgca
LVR01_0082_H03.b : ggggngcccagcat
LVR01_0011_G06.b : ggggcaggct
LVR01_0048_G03.b : gggggntttncctgca
LVR01_0013_C04.b : ggggaaaggc
LVR01_0015_F12.b : cxxxx
LVR01_0029_E12.b : txxxxx
LVR01_0025_H03.b : tttx
LVR01_0042_F09.b : ccttttg
LVR01_0008_D12.b : gggctt
LVR01_0022_C07.b : axxxxx
LVR01_0034_F02.b : catttg
LVR01_0083_G12.b : ggcata
LVR01_0089_F11.b : gtxxxx
LVR01_0014_D02.b : cxxxx
LVR01_0029_F04.b : xxxx
LVR01_0029_B03.b : xxx
LVR01_0102_E06.b : cttatt
LVR01_0001_E05.b : tat
LVR01_0042_E08.b : gcxxxxx
LVR01_0085_C12.b : gxxxxxx
LVR01_0094_B10.b : cgcaxxx
LVR01_0100_H10.b : ggctxxx
LVR01_0105_E06.b : cattat
LVR01_0030_C01.b : axxxx
LVR01_0100_G04.b : gacaxxx
LVR01_0015_A08.b : cxxxxx
LVR01_0017_G09.b : cxxxxx
LVR01_0033_A04.b : ctxxxx
LVR01_0090_H04.b : gcaxxx
LVR01_0090_A06.b : gggcatctx
LVR01_0008_C04.b : gggccc
LVR01_0061_F01.b : ttcttccggct
LVR01_0041_B05.b : ctataaggct
LVR01_0065_B03.b : gatactggct
LVR01_0083_G05.b : gggcaxxx
LVR01_0099_D12.b : tgggcttt
LVR01_0101_D12.b : acggcatt
LVR01_0054_G11.b : cctxxxx
LVR01_0004_C11.b : ctgtc
LVR01_0065_B05.b : ataatgagc
LVR01_0012_D03.b : gggttaagca
LVR01_0098_D12.b : ggctxxxx
LVR01_0057_C11.b : gcattt
LVR01_0063_E05.b : ttttttttcggct
LVR01_0056_A12.b : ttaatcggcttt
LVR01_0052_B12.b : atatctttgtttttttgc
LVR01_0050_D08.b : gtgtttttttttcgct
LVR01_0089_F06.b : gatxxx
LVR01_0012_D05.b : ggggnnggca
LVR01_0072_H02.b : cattaatttatcctgct
LVR01_0076_B07.b : cca
LVR01_0066_H06.b : ggccxxxx
LVR01_0068_F02.b : ggcxxxx
LVR01_0102_B05.b : catttt
LVR01_0011_E12.b : ggtttaggca
LVR01_0098_H07.b : gacxxxx
LVR01_0012_A03.b : tgtgggaatgatacgtgx
LVR01_0026_A11.b : cacxxx
LVR01_0001_C02.b : xxxx
LVR01_0091_H11.b : gcaxx
LVR01_0092_D12.b : ttattggcat
LVR01_0068_A01.b : ggcxxxx
LVR01_0106_A03.b : gggttgtaaacga
LVR01_0017_A12.b : ggcattta
LVR01_0083_C09.b : gagcaxxx
LVR01_0100_A07.b : gcatcxx
LVR01_0003_B03.b : tcta
LVR01_0104_B07.b : ggtttcttatgca
LVR01_0021_C03.b : gctttta
LVR01_0101_D05.b : catttttg
LVR01_0062_A06.b : aaaaaaaggc
LVR01_0056_E11.b : gcatttag
LVR01_0004_H02.b : xxxx
LVR01_0068_B09.b : ggcxxxx
LVR01_0001_F03.b : tttt
LVR01_0056_B11.b : gtatcagctt
LVR01_0077_H03.b : gggggttttaggcat
LVR01_0106_D12.b : gtttttgccttg
LVR01_0056_F02.b : ccxxxxx
LVRM1_0075_B05.b :
LVRM1_0073_A05.b :
LVRM1_0074_D03.b :
LVRM1_0019_E11.b :
LVR01_0106_F08.b : tttta
LVR01_0017_H04.b : gca
LVR01_0008_A03.b : ttttg
LVRM1_0152_G12.b :
LVR01_0043_C02.b : gggcacttgg
LVR01_0059_G08.b : ccttttt
LVRM1_0086_G08.b :
LVRM1_0161_C11.b :
LVRM1_0129_B02.b :
LVRM1_0028_G07.b :
LVRM1_0206_G03.b :
LVRM1_0037_F03.b :
LVRM1_0193_A08.b :
LVRM1_0198_G08.b :
LVRM1_0100_E06.b :
LVRM1_0125_E06.b :
LVRM1_0176_F12.b :
LVRM1_0027_F12.b :
LVRM1_0124_C02.b :
LVRM1_0159_F01.b :
LVRM1_0174_G07.b :
LVRM1_0108_F11.b :
LVRM1_0103_A09.b :
LVRM1_0016_D03.b :
LVRM1_0154_D04.b :
LVRM1_0157_F10.b :
LVRM1_0030_E04.b :
LVRM1_0139_B03.b :
LVRM1_0145_C09.b :
LVR01_0077_F02.b : ggggggcx
LVR01_0104_A09.b : tttaggc
LVR01_0081_H02.b : gggggtgggca
LVR01_0094_C06.b : ctt
LVR01_0013_C02.b : ttttttcccttctatag
LVR01_0031_D05.b : xxx
LVR01_0090_B04.b : cct
LVR01_0041_E01.b : gggtttc
LVR01_0076_B09.b : gcxxx
LVR01_0081_F12.b : ggccatxx
LVR01_0066_G02.b : tttttaag
LVR01_0054_F09.b : ccat
LVR01_0042_D12.b : gcatt
LVR01_0026_H02.b : tctt
LVR01_0045_G06.b : ctxx
LVR01_0090_C08.b : cctt
LVR01_0099_D08.b : ct
LVR01_0003_F09.b : xxx
LVR01_0053_F05.b : gtgggtgttttttta
LVR01_0022_C11.b : cttxx
LVR01_0057_E02.b : ccxxx
LVR01_0082_A04.b : gtcatxx
LVR01_0048_B05.b : ggggnttaataa
LVR01_0047_B07.b : ggggtttttttgg
LVR01_0090_C04.b : gctg
LVR01_0029_H03.b : xxx
LVR01_0084_G10.b : caxx
LVR01_0004_D01.b : ttt
LVR01_0063_D11.b : cctxxx
LVR01_0101_C12.b : gcttt
LVR01_0009_G07.b : gctt
LVR01_0044_H04.b : ccxx
LVR01_0084_B12.b : gggc
LVR01_0083_G02.b : taggc
LVR01_0004_A10.b : cta
LVR01_0054_H06.b : gacx
LVR01_0100_C10.b : gcatc
LVR01_0100_H06.b : gcctt
LVR01_0012_G12.b : ggtattgg
LVR01_0060_H07.b : tggccag
LVR01_0103_E08.b : ttttttttg
LVR01_0010_G11.b : gcatt
LVR01_0049_D06.b : gggggtattntgg
LVR01_0104_F05.b : ggtccccaca
LVR01_0047_H02.b : tggggtttttatt
LVR01_0051_E01.b : gggggggnnntcctg
LVR01_0049_D04.b : ggggttttcttttg
LVR01_0063_B03.b : gggcctccgag
LVR01_0042_A03.b : gtcaaaac
LVR01_0051_E05.b : tgggtttttttttttc
LVR01_0105_B01.b : gggtgntaaa
LVR01_0021_F04.b : ctttt
LVR01_0043_E12.b : catt
LVR01_0077_E11.b : cctt
LVR01_0022_A03.b : gcatt
LVR01_0040_C01.b : gggtnaagg
LVR01_0062_H06.b : ttttacgagc
LVR01_0083_G04.b : gggcax
LVR01_0066_G01.b : cttttcctag
LVR01_0037_E10.b : ccat
LVR01_0046_A09.b : gcatt
LVR01_0061_B06.b : tataatttag
LVR01_0044_A10.b : tattattag
LVRM1_0027_H01.b :
KDN01_0053_E04.b :
KDN01_0066_F07.b :
PST01_0014_D11.b :
KDN01_0057_C08.b :
LVR01_0100_D12.b : gacccxx
LVRM1_0054_B08.b :
LVRM1_0141_D03.b :
LVR01_0004_E01.b :
LVR01_0081_C10.b : a
LVR01_0088_C10.b : c
LVRM1_0090_E08.b :
LVR01_0031_F09.b : aagggcg
LVR01_0081_E08.b :
LVR01_0102_D12.b :
LVRM1_0153_B09.b :
LVRM1_0010_B02.b :
LVR01_0068_D08.b :
LVRM1_0007_G11.b :
LVR01_0049_C01.b :
LVR01_0081_D04.b :
LVR01_0037_H04.b :
20110601C-007023 : ...............................CAGAGGCTTCGGGCATATATAAGACTGAA
---------+---------+---------+---------+---------+---------+ 29
LVR01_0020_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGAGGCTTCGGGCATATATAAGACTGAA
LVRM1_0095_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgaggcaTATATAAGACTGAA
LVRM1_0003_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATATAAGACTGAA
LVR01_0041_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATATAAGACTGAA
LVR01_0004_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATATAAGACTGAA
KDN01_0019_E05.b : gcaattatntnnnnnggctgacggtgtgctctggATATTAGACTGAA
KDN01_0097_C09.b : nnnncctgcgtggctctggatttAGACTGAA
LVRM1_0187_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_D08.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_H11.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_B09.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_D01.b : caattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_B03.b : catagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0094_H11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0103_A11.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0011_C06.b : cccttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0063_E09.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0018_D09.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_C04.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0011_F08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0093_E07.b : ggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0184_G02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_B03.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0199_C05.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_A05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0017_F02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0019_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0021_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0022_A02.b : gaantatanngacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0018_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0005_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_G01.b : tgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_D02.b : aggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_C11.b : agtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_B02.b : gtgacctactagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0055_C03.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0127_B08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_B09.b : ccttggtgttacccgggtacctggaattcctccgagc
LVRM1_0185_G07.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0079_E07.b : ttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0158_C09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0085_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0019_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_E12.b : gggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_B11.b : gatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_F09.b : ggtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_H08.b : ttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0009_A05.b : tacgtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_F08.b : attagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_B05.b : ttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_B07.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_A06.b : acacggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_G12.b : cgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0168_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0194_H12.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0062_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0084_G08.b : cgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0079_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0174_A09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0110_A07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_A03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0151_C01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0202_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0194_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0194_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0036_C02.b : ctttggggttaacccgtgtaccgaxxxxxxxxxxxxx
LVRM1_0204_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_A08.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0178_A08.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0098_E04.b : ccgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0100_F06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0105_E05.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0119_D08.b : gtgttgttgttntcattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0053_B09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0092_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0169_H09.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_E05.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0056_G01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0003_D01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0112_C12.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0050_E12.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0051_E12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0208_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0191_F11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0103_B07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0029_E04.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0139_E03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0153_B02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0116_D11.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0108_F05.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0139_C01.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0101_B11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_F09.b : ggtggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0140_E08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0142_E11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0023_F03.b : acggacgaagaaggggaaggcattgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0006_H05.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_G08.b : gggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0100_B08.b : tagtgagtatanxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_C11.b : ttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0076_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_G11.b : gtgactxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0055_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_F08.b : tggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0013_D09.b : ggttgagtattagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0021_D09.b : gtgcacttataagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_F04.b : ggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_F07.b : tggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0013_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_A01.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0076_H04.b : atgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_C02.b : ggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_G07.b : gggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_B05.b : ggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0092_G02.b : aggtgaatatanngacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_F10.b : ttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_H01.b : gttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_D09.b : gtggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0085_H06.b : tggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0021_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_F05.b : ggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_E09.b : ttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0100_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0026_G01.b : agtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_D09.b : tagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_C04.b : tagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_G06.b : tagtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_H02.b : atagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_C08.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0092_B09.b : ttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_B12.b : ggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0105_C08.b : tggtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_B09.b : tagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_H03.b : tagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_G06.b : tagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_G03.b : tagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0013_C04.b : ttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0025_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0042_F09.b : gtgccnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_D12.b : tagtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0022_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_F02.b : gagccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_G12.b : ngtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0014_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_E06.b : ggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0001_E05.b : cgtgcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0042_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0085_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0100_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0105_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0100_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_C04.b : tacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_F01.b : ttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0041_B05.b : tagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_B03.b : ttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_D12.b : agtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_C11.b : gctgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_B05.b : ttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_D03.b : ttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0057_C11.b : gcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0063_E05.b : tggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0056_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0052_B12.b : attagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_D08.b : tagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_D05.b : ttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_H02.b : tggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0076_B07.b : ttttagggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_B05.b : ggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_E12.b : tagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0026_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0001_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0092_D12.b : tagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_A03.b : ttcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_A12.b : tgtccnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0100_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_B03.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_B07.b : tagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0021_C03.b : tggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_D05.b : gtgccnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_A06.b : ttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0056_E11.b : ggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0001_F03.b : ggtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0056_B11.b : tcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_H03.b : tagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_D12.b : ctttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0056_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0075_B05.b : ttgaaacaagxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0073_A05.b : cgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_D03.b : cgttgaataaagxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_E11.b : cgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_F08.b : tggtgtgagattaataaaagtttgtataaaaagcacgcgtggtccggtcccgaattcctc
LVR01_0017_H04.b : ttttggtccnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_A03.b : catatggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0152_G12.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_C02.b : ccatgtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0059_G08.b : agggtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0086_G08.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0161_C11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0129_B02.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0028_G07.b : cgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0206_G03.b : nxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0037_F03.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0193_A08.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0198_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0100_E06.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0125_E06.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_F12.b : xxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0027_F12.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0124_C02.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0159_F01.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0174_G07.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0108_F11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0103_A09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0016_D03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0154_D04.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_F10.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0030_E04.b : ncagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0139_B03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_C09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_C06.b : tttgtggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0013_C02.b : cttagtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_B04.b : tttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0041_E01.b : ggctttgtgactagtagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0076_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_G02.b : cttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_F09.b : ttggttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0042_D12.b : tggtgccnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0026_H02.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_C08.b : tggtgccnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_D08.b : tttggtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0053_F05.b : gcattggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0022_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0057_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_B05.b : gcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0047_B07.b : gctagtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_C04.b : tatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_D01.b : tgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0063_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_C12.b : tgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0009_G07.b : ttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_B12.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_G02.b : atttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_A10.b : tacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0100_C10.b : ttcgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0100_H06.b : tttgtgcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_G12.b : cttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_H07.b : cttttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_E08.b : gcttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0010_G11.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_D06.b : gattaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_F05.b : gcttcgtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0047_H02.b : gcttggtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_E01.b : gcttgcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_D04.b : gattaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0063_B03.b : cttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0042_A03.b : cttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_E05.b : gcatttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0105_B01.b : gcatagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0021_F04.b : ggtgccntacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_E12.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_E11.b : ttagtggacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0022_A03.b : tggctgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_C01.b : cttagtgacctgtagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_H06.b : attggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_G01.b : ctttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_E10.b : tacgtgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_A09.b : tggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_B06.b : ttcagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_A10.b : gcttggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0027_H01.b : txxxxxxxx
KDN01_0053_E04.b :
KDN01_0066_F07.b : n
PST01_0014_D11.b : gatttatt
KDN01_0057_C08.b :
LVR01_0100_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0054_B08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_D03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_E01.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_C10.b : gtcttttanggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_C10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0090_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_F09.b : gaccgtaatagcaagcgtttcgtcaagacaacacgctaxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_E08.b : ggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_D12.b : gcxxxxxxxxxxxxxxxxx
LVRM1_0153_B09.b :
LVRM1_0010_B02.b :
LVR01_0068_D08.b :
LVRM1_0007_G11.b :
LVR01_0049_C01.b : gg
LVR01_0081_D04.b :
LVR01_0037_H04.b :
20110601C-007023 : GATCTCTCAGTTAAGACCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
---------+---------+---------+---------+---------+---------+ 88
LVR01_0020_H07.b : GATCTCTCAGTTAAGACCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0095_G01.b : GATCTCTCAGTTAAGACCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0003_A01.b : GATCTCTCAGTTAAGACCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0041_C01.b : GATCTCTCAGTTAAGACCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0004_A07.b : GATCTCTCAGTTAAGACCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
KDN01_0019_E05.b : GATCTCTCAGNTTAGACCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
KDN01_0097_C09.b : GATCTCTCANTTA*GACCACA*GCAAAGGATGGTTTCT*TGGGACTTCCA*AAACTTAAA
LVRM1_0187_E07.b : xxxxxxxxxxxxxxGACCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0033_D08.b : xxxxxxxxxxctggGACCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0084_H11.b : xxxxxxxxxxxxxxGACCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0087_F01.b : xxxxxxxxxxxxxxGACCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0096_B09.b : xxxxxxxxxxxxxxGACCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0149_D01.b : xxxxxxxxxxxxxxxTGGACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0045_D10.b : xxxxxxxxxxctggcTGGACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0106_B03.b : xxxxxxxxxxxxxxxTGGACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0072_A04.b : xxxxxxxxxxxxtacTGGACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0094_H11.b : xxxxxxxxxxxxxxxxCCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0103_A11.b : xxxxxxxxxxxxxxxxGGACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0011_C06.b : xxxxxxxxxxxxxxxxGGACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0063_E09.b : xxxxxxxxxxxxxxxxCCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0018_D09.b : xxxxxxxxxxxxxxxtCCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0016_C04.b : xxxxxxxxxxxxxxxxGGACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0045_D08.b : xxxxxxxxxxxxxxxxCCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0011_F08.b : xxxxxxxxxxxxxxxxxCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0093_E07.b : xxxxxxxxxxxxxxxxxCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0184_G02.b : xxxxxxxxxxxxxxxxxCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0093_B03.b : xxxxxxxxxxxxxxxxxCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0199_C05.b : xxxxxxxxxxxxxxxxxCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0146_A05.b : xxxxxxxxxxxxxxxxxCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0017_F02.b : xxxxxxxxxxxxxxxxxCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0019_D03.b : xxxxxxxxxxxxxxxxxCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0081_G09.b : xxxxxxxxxxxxxxxxxCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0040_H07.b : xxxxxxxxxxxxxxxxxGACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0081_H05.b : xxxxxxxxxxxxxxxxxCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0021_G05.b : xxxxxxxxxxxxxxxxxCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0022_A02.b : xxxxxxxxxxxxxxxxxGACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0084_E09.b : xxxxxxxxxxxxxxxxxCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0018_C06.b : xxxxxxxxxxxxxxxxxCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0005_H01.b : xxxxxxxxxxxxxtcgaGACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0083_G01.b : xxxxxxxxxxxxxxxxxCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0066_D02.b : xxxxxxxxxxxxxxxxxCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0067_C11.b : xxxxxxxxxxxxxxxxxCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0004_B02.b : xxxxxxxxxxxxxxxxxGACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0094_D01.b : xxxxxxxxxxxxxxxxxCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0098_H04.b : xxxxxxxxxxxxxxxxxCACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0055_C03.b : xxxxxxxxxxxxxxxxxxACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0127_B08.b : xxxxxxxxxxxxxxxxxxACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0035_B09.b : actgccctttctactcggACAAGCAAAGGATGGTTTCTATGGGACTTCCAAAAACTTAAA
LVRM1_0185_G07.b : xxxxxxxxxxxxxxxxxxACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0079_E07.b : xxxxxxxxxxxxxxxxxxACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0158_C09.b : xxxxxxxxxxxxxxxxxxACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0043_F11.b : xxxxxxxxxxxxxxxxxxTCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0085_D05.b : xxxxxxxxxxxxxxxxxxACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0019_F09.b : xxxxxxxxxxxxxxxxgaACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0094_C10.b : xxxxxxxxxxxxxxxxxtACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0066_E12.b : xxxxxxxxxxxxxxxxxxACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0078_D08.b : xxxxxxxxxxxxxxxxxxTCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0031_B11.b : xxxxxxxxxxxxxxxxxxTCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0072_F09.b : xxxxxxxxxxxxxxxxxxTCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0012_H08.b : xxxxxxxxxxxxxxxxxxACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0009_A05.b : xxxxxxxxxxxxxxxxxxACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0061_F08.b : xxxxxxxxxxxxxxxxxxACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0012_B05.b : xxxxxxxxxxxxxxxxxxTCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0067_B07.b : xxxxxxxxxxxxxxxxttACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0003_A06.b : xxxxxxxxxxxxxxxxxxACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0060_G12.b : xxxxxxxxxxxxxxxxttACAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0168_B03.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0081_E01.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0194_H12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0062_D10.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0084_G08.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0079_B01.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTCAAA
LVRM1_0174_A09.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0110_A07.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0126_A03.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0151_C01.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0202_G02.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0194_F05.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0194_C12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0036_C02.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCTCTGGGACTTCCAAAAACTTAAA
LVRM1_0204_H03.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0038_A08.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0178_A08.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0098_E04.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0100_F06.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0105_E05.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0119_D08.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0053_B09.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0092_D11.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0169_H09.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0035_E05.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0056_G01.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0003_D01.b : xxxxxxxxxxxxxxgngacCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0112_C12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0050_E12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0051_E12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0208_B12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0191_F11.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0103_B07.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0029_E04.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0139_E03.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0153_B02.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0116_D11.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0108_F05.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0139_C01.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0101_B11.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0029_F09.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0140_E08.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0142_E11.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAGA
LVRM1_0023_F03.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0006_H05.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0096_G08.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0100_B08.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0065_C11.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0076_A06.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0087_G11.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0065_D03.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0034_C07.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0103_A12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0055_D08.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0046_F08.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCGAAAACTTAAA
LVR01_0097_A05.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0013_D09.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0021_D09.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0097_F04.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0015_F07.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0013_A09.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0084_A01.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0076_H04.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0094_E04.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0037_C02.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0094_G07.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0030_B05.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0091_A12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCTTGGGGACTTCCAAAAACTTAAA
LVR01_0082_A12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0033_G06.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0087_F02.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0092_G02.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0012_F10.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0038_H01.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0087_H01.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0071_F06.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0016_D09.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0061_F07.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0078_H03.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0095_C01.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0087_F12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0082_F10.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0046_H09.b : xxxxxxxxxxxxxxxxxxxCAAGCCAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0085_H06.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0088_H10.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0062_H09.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0102_H05.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0029_H02.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0021_C05.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0102_F05.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0017_E09.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0100_G12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0026_G01.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0045_F09.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0077_D09.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0048_C04.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0106_G06.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0103_H02.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0078_H05.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0091_C08.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0092_B09.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0003_B12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0089_G11.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0105_C08.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0104_B09.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0082_H03.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0011_G06.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0048_G03.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0013_C04.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0015_F12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0029_E12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0025_H03.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0042_F09.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0008_D12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0022_C07.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0034_F02.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0083_G12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0089_F11.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0014_D02.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0029_F04.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0029_B03.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0102_E06.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0001_E05.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0042_E08.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0085_C12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0094_B10.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAATACTTAAA
LVR01_0100_H10.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0105_E06.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0030_C01.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0100_G04.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0015_A08.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0017_G09.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0033_A04.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0090_H04.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0090_A06.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0008_C04.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0061_F01.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0041_B05.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0065_B03.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0083_G05.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0099_D12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0101_D12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0054_G11.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0004_C11.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0065_B05.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0012_D03.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0098_D12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0057_C11.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0063_E05.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0056_A12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0052_B12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0050_D08.b : xxxxxxxxxxxxxxxxxxgGAAGCAAAGGATGGTTTCT*TGGGACTCCCAAAAACTTAAA
LVR01_0089_F06.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0012_D05.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0072_H02.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0076_B07.b : xxxxxxxxxxxxxxxxxxgGAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0066_H06.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0068_F02.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0102_B05.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0011_E12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0098_H07.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0012_A03.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*AGGGACTTCCAAAAACTTAAA
LVR01_0026_A11.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0001_C02.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0091_H11.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0092_D12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0068_A01.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0106_A03.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0017_A12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0083_C09.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0100_A07.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0003_B03.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGCTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0104_B07.b : xxxxxxxxxxxxxxxxxctGAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0021_C03.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0101_D05.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0062_A06.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0056_E11.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0004_H02.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0068_B09.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0001_F03.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0056_B11.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0077_H03.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0106_D12.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAGCTTAAA
LVR01_0056_F02.b : xxxxxxxxxxxxxxxxxxxCAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0075_B05.b : xxxxxxxxxxxxxxxxxxxxCAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0073_A05.b : xxxxxxxxxxxxxxxxxxxxCAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0074_D03.b : xxxxxxxxxxxxxxxxxxxxCAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0019_E11.b : xxxxxxxxxxxxxxxxxxxxCAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0106_F08.b : tagcactgttgggctactggAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0017_H04.b : xxxxxxxxxxxxxxxxxxxxAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0008_A03.b : xxxxxxxxxxxxxxxxxxxxAAGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0152_G12.b : xxxxxxxxxxxxxxxxxxxxtAGCAAAAGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0043_C02.b : xxxxxxxxxxxxxxxxxxxxxCGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0059_G08.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0086_G08.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0161_C11.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0129_B02.b : xxxxxxxxxxxxxxxxxxctacGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0028_G07.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0206_G03.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0037_F03.b : xxxxxxxxxxxxxxxxxxxxxcGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0193_A08.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0198_G08.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0100_E06.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0125_E06.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0176_F12.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0027_F12.b : xxxxxxxxxxxxxxxxxxxctcGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0124_C02.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0159_F01.b : xxxxxxxxxxxxxxxxxxxctcGCAAAGGATGGATTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0174_G07.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0108_F11.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0103_A09.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0016_D03.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0154_D04.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0157_F10.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0030_E04.b : xxxxxxxxxxxxxxxxxxxctcGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0139_B03.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0145_C09.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAGAACTTAAA
LVR01_0077_F02.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0104_A09.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0081_H02.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0094_C06.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0013_C02.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0031_D05.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0090_B04.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0041_E01.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0076_B09.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0081_F12.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0066_G02.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0054_F09.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0042_D12.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0026_H02.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0045_G06.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0090_C08.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0099_D08.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTTT*TGGGACTTCCAAAAACTTAAA
LVR01_0003_F09.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0053_F05.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0022_C11.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0057_E02.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0082_A04.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0048_B05.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0047_B07.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0090_C04.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0029_H03.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0084_G10.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0004_D01.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0063_D11.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0101_C12.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0009_G07.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0044_H04.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0084_B12.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0083_G02.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0004_A10.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0054_H06.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0100_C10.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0100_H06.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0012_G12.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0060_H07.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0103_E08.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0010_G11.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0049_D06.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0104_F05.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0047_H02.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0051_E01.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0049_D04.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0063_B03.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0042_A03.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0051_E05.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0105_B01.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0021_F04.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0043_E12.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGCTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0077_E11.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0022_A03.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0040_C01.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0062_H06.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0083_G04.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0066_G01.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0037_E10.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0046_A09.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0061_B06.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0044_A10.b : xxxxxxxxxxxxxxxxxxxxxxGCAAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0027_H01.b : xxxxxxxxxxxxxxxxxxxxtcaGCAAGGATGGTTTCT*TGGGACTTCCA*AAACTTAAA
KDN01_0053_E04.b : cggcgttggctctggacaGCAAGGATGGTTTCT*TGGGACTTCCA*AAACTTAAA
KDN01_0066_F07.b : nnnncctgctgtggctctggacaGCAAGGATGGTTTCT*TGGGACTTCCA*AAACTTAAA
PST01_0014_D11.b : ntttncctgcgttggctcggacaGCAAGGATGGTTTCT*TGGGACTTCCA*AAACTTAAA
KDN01_0057_C08.b : nnnncctgctgtggctctggacaGCAAGGATGGTTTCT*TGGGACTTCCA*AAACTTAAA
LVR01_0100_D12.b : xxxxxxxxxxxxxxxxxxxxxxgcgAAGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0054_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0141_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0004_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0081_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVR01_0088_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGGATGGTTTCT*TGGGACTTCCAAAAACTTAAA
LVRM1_0090_E08.b : xxxxxxxxxxxxxxxxxcacaagcctctGATGGTTTCC*TGAGACTTCCACTAACTTAAG
LVR01_0031_F09.b : xxxxxxxxxxxxxxxxxxxxxxgcacacgatggatttccTGGGACTTCCAAAAACTTAAA
LVR01_0081_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTAAA
LVR01_0102_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0153_B09.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0010_B02.b : atxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_D08.b : gctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0007_G11.b : xxxxxxxxxxxxxxxxxxxxx
LVR01_0049_C01.b : tgggttataatcgcattgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_D04.b :
LVR01_0037_H04.b :
20110601C-007023 : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
---------+---------+---------+---------+---------+---------+ 148
LVR01_0020_H07.b : ATCATGAAACCTCTATTACTGCTGCTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVRM1_0095_G01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0003_A01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVR01_0041_C01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0004_A07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
KDN01_0019_E05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
KDN01_0097_C09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVRM1_0187_E07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0033_D08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVR01_0084_H11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0087_F01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0096_B09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVRM1_0149_D01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVR01_0045_D10.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0106_B03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0072_A04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVRM1_0094_H11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0103_A11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0011_C06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVR01_0063_E09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGGC
LVR01_0018_D09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0016_C04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0045_D08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVRM1_0011_F08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVR01_0093_E07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVRM1_0184_G02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0093_B03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0199_C05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0146_A05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0017_F02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVR01_0019_D03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0081_G09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0040_H07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0081_H05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0021_G05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0022_A02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0084_E09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0018_C06.b : ATCATGAAACCTCTATTACTGCTACTGTTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0005_H01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0083_G01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0066_D02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0067_C11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0004_B02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0094_D01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0098_H04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVRM1_0055_C03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0127_B08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVR01_0035_B09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVRM1_0185_G07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0079_E07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0158_C09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVR01_0043_F11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0085_D05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0019_F09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0094_C10.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0066_E12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0078_D08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0031_B11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0072_F09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0012_H08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0009_A05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0061_F08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0012_B05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0067_B07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0003_A06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0060_G12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVRM1_0168_B03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVR01_0081_E01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVRM1_0194_H12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0062_D10.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0084_G08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVR01_0079_B01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVRM1_0174_A09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0110_A07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0126_A03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0151_C01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0202_G02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0194_F05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGCGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0194_C12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVR01_0036_C02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVRM1_0204_H03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0038_A08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0178_A08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0098_E04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0100_F06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0105_E05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0119_D08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0053_B09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0092_D11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0169_H09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0035_E05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0056_G01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0003_D01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0112_C12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0050_E12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0051_E12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0208_B12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0191_F11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0103_B07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0029_E04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0139_E03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0153_B02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0116_D11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0108_F05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0139_C01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0101_B11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVR01_0029_F09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVRM1_0140_E08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0142_E11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0023_F03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0006_H05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVR01_0096_G08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0100_B08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0065_C11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0076_A06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0087_G11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0065_D03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0034_C07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0103_A12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0055_D08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0046_F08.b : ATCATGAAACCTCTATTACTGCTACAATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0097_A05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0013_D09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0021_D09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0097_F04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0015_F07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0013_A09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0084_A01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0076_H04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0094_E04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0037_C02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0094_G07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0030_B05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0091_A12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0082_A12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0033_G06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0087_F02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0092_G02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0012_F10.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0038_H01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0087_H01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0071_F06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0016_D09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0061_F07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0078_H03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0095_C01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0087_F12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0082_F10.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0046_H09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAACGCCCAAGCTGCC
LVR01_0085_H06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0088_H10.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0062_H09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0102_H05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0029_H02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0021_C05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0102_F05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0017_E09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0100_G12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0026_G01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0045_F09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0077_D09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0048_C04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0106_G06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0103_H02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0078_H05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0091_C08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0092_B09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0003_B12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0089_G11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0105_C08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0104_B09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0082_H03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0011_G06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0048_G03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0013_C04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0015_F12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0029_E12.b : ATCGTGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0025_H03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0042_F09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0008_D12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0022_C07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0034_F02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0083_G12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0089_F11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0014_D02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0029_F04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0029_B03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0102_E06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0001_E05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0042_E08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0085_C12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0094_B10.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0100_H10.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0105_E06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0030_C01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0100_G04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0015_A08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0017_G09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0033_A04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0090_H04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0090_A06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0008_C04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0061_F01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0041_B05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0065_B03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0083_G05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0099_D12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0101_D12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0054_G11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0004_C11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0065_B05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0012_D03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0098_D12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0057_C11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0063_E05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0056_A12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0052_B12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0050_D08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0089_F06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0012_D05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0072_H02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAACTAAGGCCCAAGCTGCC
LVR01_0076_B07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0066_H06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0068_F02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0102_B05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0011_E12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0098_H07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0012_A03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0026_A11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0001_C02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0091_H11.b : ATCATGGAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0092_D12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0068_A01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0106_A03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0017_A12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0083_C09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0100_A07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0003_B03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0104_B07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0021_C03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0101_D05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0062_A06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0056_E11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0004_H02.b : ATCATGAAACCTCTATTACTGCTGCTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0068_B09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0001_F03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0056_B11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0077_H03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0106_D12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0056_F02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVRM1_0075_B05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0073_A05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0074_D03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0019_E11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVR01_0106_F08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0017_H04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0008_A03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVRM1_0152_G12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVR01_0043_C02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0059_G08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVRM1_0086_G08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0161_C11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0129_B02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0028_G07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0206_G03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0037_F03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0193_A08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0198_G08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0100_E06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0125_E06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0176_F12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0027_F12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0124_C02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0159_F01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0174_G07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0108_F11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0103_A09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0016_D03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0154_D04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0157_F10.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0030_E04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0139_B03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0145_C09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVR01_0077_F02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0104_A09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0081_H02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0094_C06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0013_C02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0031_D05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0090_B04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0041_E01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0076_B09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0081_F12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0066_G02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0054_F09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0042_D12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0026_H02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0045_G06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0090_C08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0099_D08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0003_F09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0053_F05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0022_C11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0057_E02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0082_A04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0048_B05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0047_B07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0090_C04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0029_H03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0084_G10.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0004_D01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0063_D11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0101_C12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0009_G07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0044_H04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0084_B12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0083_G02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0004_A10.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0054_H06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0100_C10.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0100_H06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0012_G12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0060_H07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0103_E08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0010_G11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0049_D06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0104_F05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0047_H02.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0051_E01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0049_D04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0063_B03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0042_A03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0051_E05.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0105_B01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTACC
LVR01_0021_F04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0043_E12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0077_E11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0022_A03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0040_C01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0062_H06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0083_G04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0066_G01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0037_E10.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0046_A09.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0061_B06.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0044_A10.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVRM1_0027_H01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
KDN01_0053_E04.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
KDN01_0066_F07.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
PST01_0014_D11.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
KDN01_0057_C08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0100_D12.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVRM1_0054_B08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0141_D03.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVR01_0004_E01.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0081_C10.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0088_C10.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVRM1_0090_E08.b : ATCCTGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATTATTAATGCCCACGCTGCC
LVR01_0031_F09.b : ATCCTGAAACCTCTATTACTGCCACTATTGTGTGTTTTTATACTTACCGCCCAAGCTGCC
LVR01_0081_E08.b : ATCATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVR01_0102_D12.b : xxgATGAAACCTCTATTACTGCTACTATTGTGTGTTTTTATAATTAAGGCCCAAGCTGCC
LVRM1_0153_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxaTGTGTGTTTTTATTATTAAGGCCCAAGCTGCC
LVRM1_0010_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATTATTAAGGCCCAAGCTGCC
LVR01_0068_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAATTAAGGCCCAAGCTGCC
LVRM1_0007_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATTAAGGCCCAAGCTGCC
LVR01_0049_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcaagcaaaggatggtttcttgggact
LVR01_0081_D04.b :
LVR01_0037_H04.b :
20110601C-007023 : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
---------+---------+---------+---------+---------+---------+ 208
LVR01_0020_H07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0095_G01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0003_A01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0041_C01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0004_A07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
KDN01_0019_E05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
KDN01_0097_C09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0187_E07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0033_D08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0084_H11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0087_F01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0096_B09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0149_D01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0045_D10.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0106_B03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0072_A04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0094_H11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0103_A11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0011_C06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0063_E09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0018_D09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0016_C04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0045_D08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0011_F08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0093_E07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0184_G02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0093_B03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0199_C05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0146_A05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0017_F02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0019_D03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0081_G09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0040_H07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0081_H05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0021_G05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0022_A02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0084_E09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0018_C06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0005_H01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0083_G01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0066_D02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0067_C11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0004_B02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0094_D01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0098_H04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0055_C03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0127_B08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0035_B09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0185_G07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0079_E07.b : ATTGACTACGATGAGGACGAAGATGGCAGGCCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0158_C09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0043_F11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0085_D05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCAGGTGGATGCCCGTGGTCAT
LVR01_0019_F09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0094_C10.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0066_E12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0078_D08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0031_B11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0072_F09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0012_H08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0009_A05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0061_F08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0012_B05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0067_B07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0003_A06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0060_G12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0168_B03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0081_E01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0194_H12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0062_D10.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0084_G08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0079_B01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0174_A09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0110_A07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0126_A03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0151_C01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0202_G02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0194_F05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0194_C12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0036_C02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0204_H03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0038_A08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0178_A08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0098_E04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0100_F06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0105_E05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0119_D08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0053_B09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0092_D11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0169_H09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0035_E05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0056_G01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0003_D01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0112_C12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0050_E12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0051_E12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0208_B12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0191_F11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0103_B07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTCCATGTGGATGCCCGTGGTCAT
LVRM1_0029_E04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0139_E03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0153_B02.b : ATTGACTACGATGAGGACGAAGATGGCGGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0116_D11.b : ATTGACTACGATGAGGACGAAGGTGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0108_F05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0139_C01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0101_B11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0029_F09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0140_E08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0142_E11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0023_F03.b : ATTGACTACAATGAGGACGAACATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0006_H05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0096_G08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0100_B08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0065_C11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0076_A06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0087_G11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0065_D03.b : ATTGACTACGATGAGGACGAAAATGGCAAACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0034_C07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0103_A12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0055_D08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0046_F08.b : ATTGACTACGATGAGGACAAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0097_A05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0013_D09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0021_D09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0097_F04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0015_F07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0013_A09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0084_A01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0076_H04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0094_E04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0037_C02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0094_G07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0030_B05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0091_A12.b : ATTGACTACAATGAGGACAAAAATGGCAAACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0082_A12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0033_G06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0087_F02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0092_G02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0012_F10.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0038_H01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0087_H01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0071_F06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0016_D09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0061_F07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0078_H03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0095_C01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0087_F12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0082_F10.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0046_H09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0085_H06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0088_H10.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0062_H09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0102_H05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0029_H02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0021_C05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0102_F05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0017_E09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0100_G12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0026_G01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0045_F09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0077_D09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0048_C04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0106_G06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0103_H02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0078_H05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0091_C08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0092_B09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0003_B12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0089_G11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0105_C08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0104_B09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0082_H03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0011_G06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0048_G03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0013_C04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0015_F12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0029_E12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0025_H03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0042_F09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0008_D12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0022_C07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGCGGATGCCCGTGGTCAT
LVR01_0034_F02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0083_G12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0089_F11.b : ATTGACTACGATGAGGACGGAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0014_D02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0029_F04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0029_B03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0102_E06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0001_E05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0042_E08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0085_C12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0094_B10.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0100_H10.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0105_E06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0030_C01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0100_G04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0015_A08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0017_G09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0033_A04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0090_H04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0090_A06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0008_C04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0061_F01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0041_B05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0065_B03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0083_G05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0099_D12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0101_D12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0054_G11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0004_C11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0065_B05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0012_D03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0098_D12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0057_C11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0063_E05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0056_A12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0052_B12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0050_D08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0089_F06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0012_D05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0072_H02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0076_B07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0066_H06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0068_F02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0102_B05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0011_E12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0098_H07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0012_A03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0026_A11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0001_C02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0091_H11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0092_D12.b : ATTGACTACGATGAGGACGAAGATGGCAGACTTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0068_A01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0106_A03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0017_A12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0083_C09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0100_A07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0003_B03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0104_B07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0021_C03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0101_D05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0062_A06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0056_E11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0004_H02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0068_B09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0001_F03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0056_B11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0077_H03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0106_D12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0056_F02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0075_B05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0073_A05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGCTCATGTGGATGCCCGTGGTCAT
LVRM1_0074_D03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0019_E11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0106_F08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0017_H04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0008_A03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0152_G12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0043_C02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0059_G08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0086_G08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0161_C11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0129_B02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0028_G07.b : ATTGACTACNATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0206_G03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0037_F03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0193_A08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0198_G08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0100_E06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0125_E06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0176_F12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0027_F12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGCGGATGCCCGTGGTCAT
LVRM1_0124_C02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0159_F01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0174_G07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0108_F11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0103_A09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0016_D03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0154_D04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0157_F10.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0030_E04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0139_B03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0145_C09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0077_F02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0104_A09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0081_H02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0094_C06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0013_C02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0031_D05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0090_B04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0041_E01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0076_B09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0081_F12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0066_G02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0054_F09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0042_D12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0026_H02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0045_G06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0090_C08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0099_D08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0003_F09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0053_F05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0022_C11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0057_E02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0082_A04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0048_B05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0047_B07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0090_C04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0029_H03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0084_G10.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0004_D01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0063_D11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0101_C12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0009_G07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0044_H04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0084_B12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0083_G02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0004_A10.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0054_H06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0100_C10.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0100_H06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0012_G12.b : ATTGACTACGATGAGGACGAAGATGGCAAACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0060_H07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0103_E08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0010_G11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0049_D06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0104_F05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0047_H02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0051_E01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0049_D04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0063_B03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0042_A03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0051_E05.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0105_B01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0021_F04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0043_E12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0077_E11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0022_A03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0040_C01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0062_H06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0083_G04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0066_G01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0037_E10.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0046_A09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0061_B06.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0044_A10.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0027_H01.b : ATCGACTACGATGAGGACTAATATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
KDN01_0053_E04.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
KDN01_0066_F07.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
PST01_0014_D11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
KDN01_0057_C08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0100_D12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0054_B08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0141_D03.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0004_E01.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGT*GATGCCCGTGGTCAT
LVR01_0081_C10.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0088_C10.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0090_E08.b : ATTGACTACAATGAGGACGAACATGGCATACCTGATGTTCATGTGGATGCCCCTGGTCAT
LVR01_0031_F09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0081_E08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0102_D12.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0153_B09.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0010_B02.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0068_D08.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVRM1_0007_G11.b : ATTGACTACGATGAGGACGAAGATGGCAGACCTAAGGTTCATGTGGATGCCCGTGGTCAT
LVR01_0049_C01.b : tccaaaaacttaaaatcatgaaacctctattactgctactattgtgtgtttttataatta
LVR01_0081_D04.b :
LVR01_0037_H04.b :
20110601C-007023 : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
---------+---------+---------+---------+---------+---------+ 268
LVR01_0020_H07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0095_G01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0003_A01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0041_C01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0004_A07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
KDN01_0019_E05.b : CGGCCCTACGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
KDN01_0097_C09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0187_E07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0033_D08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0084_H11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0087_F01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0096_B09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0149_D01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0045_D10.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0106_B03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0072_A04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0094_H11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0103_A11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0011_C06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0063_E09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0018_D09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0016_C04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0045_D08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0011_F08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0093_E07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0184_G02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0093_B03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0199_C05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0146_A05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0017_F02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0019_D03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCAAC
LVR01_0081_G09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0040_H07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0081_H05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0021_G05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0022_A02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0084_E09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0018_C06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0005_H01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0083_G01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0066_D02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0067_C11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0004_B02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCACC
LVR01_0094_D01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0098_H04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0055_C03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0127_B08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0035_B09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0185_G07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0079_E07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGGGACCTGTCGCCCCTCCCATC
LVRM1_0158_C09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0043_F11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0085_D05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0019_F09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0094_C10.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0066_E12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0078_D08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0031_B11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0072_F09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0012_H08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCC*CCCATC
LVR01_0009_A05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0061_F08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0012_B05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0067_B07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0003_A06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0060_G12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0168_B03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0081_E01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0194_H12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0062_D10.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0084_G08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCCCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0079_B01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0174_A09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0110_A07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0126_A03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0151_C01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0202_G02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0194_F05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0194_C12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0036_C02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0204_H03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0038_A08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0178_A08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0098_E04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0100_F06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0105_E05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0119_D08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0053_B09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0092_D11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0169_H09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0035_E05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0056_G01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0003_D01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0112_C12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0050_E12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0051_E12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0208_B12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0191_F11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0103_B07.b : NCGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0029_E04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0139_E03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0153_B02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0116_D11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0108_F05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0139_C01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0101_B11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0029_F09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0140_E08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0142_E11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0023_F03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0006_H05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0096_G08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0100_B08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0065_C11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0076_A06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0087_G11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0065_D03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0034_C07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0103_A12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0055_D08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0046_F08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0097_A05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0013_D09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0021_D09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0097_F04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0015_F07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0013_A09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0084_A01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0076_H04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0094_E04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0037_C02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0094_G07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0030_B05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0091_A12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0082_A12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0033_G06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0087_F02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0092_G02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0012_F10.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0038_H01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0087_H01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0071_F06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0016_D09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0061_F07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0078_H03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0095_C01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0087_F12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0082_F10.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0046_H09.b : CCGCCCTATGACAAAAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCTCCCCTCCCATC
LVR01_0085_H06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0088_H10.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0062_H09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0102_H05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0029_H02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0021_C05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0102_F05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0017_E09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0100_G12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0026_G01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0045_F09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0077_D09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0048_C04.b : CGGCCCTATGACAGGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0106_G06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0103_H02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0078_H05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0091_C08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0092_B09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0003_B12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0089_G11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0105_C08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0104_B09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0082_H03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0011_G06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0048_G03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0013_C04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0015_F12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0029_E12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0025_H03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0042_F09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0008_D12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0022_C07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0034_F02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0083_G12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0089_F11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0014_D02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0029_F04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0029_B03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0102_E06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0001_E05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0042_E08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0085_C12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0094_B10.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0100_H10.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0105_E06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0030_C01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0100_G04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0015_A08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0017_G09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0033_A04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0090_H04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0090_A06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0008_C04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0061_F01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0041_B05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0065_B03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0083_G05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0099_D12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0101_D12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0054_G11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0004_C11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0065_B05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0012_D03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0098_D12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0057_C11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0063_E05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0056_A12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0052_B12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0050_D08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0089_F06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0012_D05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0072_H02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0076_B07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0066_H06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0068_F02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0102_B05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0011_E12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0098_H07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0012_A03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0026_A11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0001_C02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0091_H11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0092_D12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0068_A01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0106_A03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0017_A12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0083_C09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0100_A07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0003_B03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0104_B07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0021_C03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0101_D05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0062_A06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0056_E11.b : CGGCCCTATGACAAGAGGAAGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0004_H02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0068_B09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0001_F03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0056_B11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0077_H03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0106_D12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0056_F02.b : CGGCCCTATGACAAGAGGAAGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0075_B05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0073_A05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0074_D03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0019_E11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0106_F08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0017_H04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0008_A03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0152_G12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0043_C02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0059_G08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0086_G08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0161_C11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0129_B02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0028_G07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0206_G03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0037_F03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0193_A08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0198_G08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0100_E06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0125_E06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0176_F12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0027_F12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0124_C02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0159_F01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0174_G07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0108_F11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0103_A09.b : NCGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0016_D03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGGGACCTGTCGCCCCTCCCATC
LVRM1_0154_D04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0157_F10.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0030_E04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0139_B03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0145_C09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0077_F02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0104_A09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0081_H02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0094_C06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0013_C02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0031_D05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0090_B04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0041_E01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0076_B09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0081_F12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0066_G02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0054_F09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0042_D12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0026_H02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0045_G06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0090_C08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0099_D08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0003_F09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0053_F05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0022_C11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0057_E02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0082_A04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0048_B05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0047_B07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0090_C04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0029_H03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0084_G10.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0004_D01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0063_D11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0101_C12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0009_G07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0044_H04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0084_B12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0083_G02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0004_A10.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0054_H06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0100_C10.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0100_H06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0012_G12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0060_H07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0103_E08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0010_G11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0049_D06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0104_F05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0047_H02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0051_E01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0049_D04.b : CGGCCCTATGACAAGAGGAGGGAGGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0063_B03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0042_A03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0051_E05.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0105_B01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0021_F04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0043_E12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0077_E11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0022_A03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0040_C01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0062_H06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0083_G04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0066_G01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0037_E10.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0046_A09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0061_B06.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0044_A10.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0027_H01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
KDN01_0053_E04.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
KDN01_0066_F07.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
PST01_0014_D11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
KDN01_0057_C08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0100_D12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0054_B08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0141_D03.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0004_E01.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0081_C10.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0088_C10.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0090_E08.b : CGGCCCTATGACGAGATGAGGGAAGAGGCTCCCATCCTGACAACTGTCGCCCCTCCCATC
LVR01_0031_F09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0081_E08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0102_D12.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0153_B09.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0010_B02.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0068_D08.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVRM1_0007_G11.b : CGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0049_C01.b : aGGCCCTATGACAAGAGGAGGGAAGAGGCTCCCAGCCTGAGACCTGTCGCCCCTCCCATC
LVR01_0081_D04.b :
LVR01_0037_H04.b :
20110601C-007023 : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
---------+---------+---------+---------+---------+---------+ 328
LVR01_0020_H07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0095_G01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0003_A01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0041_C01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0004_A07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
KDN01_0019_E05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
KDN01_0097_C09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0187_E07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0033_D08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0084_H11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0087_F01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0096_B09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0149_D01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0045_D10.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0106_B03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0072_A04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0094_H11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0103_A11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0011_C06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0063_E09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0018_D09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0016_C04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0045_D08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0011_F08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0093_E07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0184_G02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAG*AGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0093_B03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0199_C05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0146_A05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0017_F02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0019_D03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0081_G09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0040_H07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0081_H05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0021_G05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0022_A02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0084_E09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0018_C06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0005_H01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0083_G01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0066_D02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0067_C11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0004_B02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0094_D01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0098_H04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0055_C03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0127_B08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0035_B09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0185_G07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0079_E07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0158_C09.b : AGTGCAGGTGGCTGTCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0043_F11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0085_D05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0019_F09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0094_C10.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0066_E12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0078_D08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0031_B11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0072_F09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0012_H08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0009_A05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0061_F08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0012_B05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0067_B07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0003_A06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0060_G12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0168_B03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0081_E01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0194_H12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0062_D10.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0084_G08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0079_B01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0174_A09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0110_A07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0126_A03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0151_C01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0202_G02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0194_F05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0194_C12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0036_C02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0204_H03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0038_A08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0178_A08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0098_E04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0100_F06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0105_E05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0119_D08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0053_B09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0092_D11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0169_H09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0035_E05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0056_G01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0003_D01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0112_C12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0050_E12.b : AGTGCAGGTGGCTACCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0051_E12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0208_B12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0191_F11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0103_B07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0029_E04.b : GGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0139_E03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0153_B02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0116_D11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0108_F05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0139_C01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0101_B11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0029_F09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0140_E08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0142_E11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0023_F03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0006_H05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0096_G08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0100_B08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0065_C11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0076_A06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0087_G11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0065_D03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0034_C07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0103_A12.b : AGTGCAGGTGGCTATCAGCCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0055_D08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0046_F08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0097_A05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0013_D09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0021_D09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0097_F04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0015_F07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0013_A09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0084_A01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0076_H04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0094_E04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0037_C02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0094_G07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0030_B05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0091_A12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0082_A12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0033_G06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0087_F02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0092_G02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0012_F10.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0038_H01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0087_H01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0071_F06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0016_D09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0061_F07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0078_H03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0095_C01.b : AGTGCAGATGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0087_F12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0082_F10.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0046_H09.b : AATGCAGGTGGCTATCAACCTCTTCCAGCCAAAGTAGCTATTGGCCAGAACAAAGTGGAG
LVR01_0085_H06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0088_H10.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0062_H09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0102_H05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0029_H02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0021_C05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0102_F05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0017_E09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0100_G12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0026_G01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0045_F09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0077_D09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0048_C04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0106_G06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCGAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0103_H02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0078_H05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0091_C08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0092_B09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0003_B12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0089_G11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0105_C08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0104_B09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0082_H03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0011_G06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0048_G03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0013_C04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0015_F12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0029_E12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0025_H03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0042_F09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0008_D12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0022_C07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0034_F02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0083_G12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0089_F11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCTAGAAGAAAGTGGAG
LVR01_0014_D02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0029_F04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0029_B03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0102_E06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0001_E05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0042_E08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0085_C12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0094_B10.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0100_H10.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0105_E06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0030_C01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0100_G04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0015_A08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0017_G09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0033_A04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0090_H04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAGGTGGAG
LVR01_0090_A06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0008_C04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0061_F01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0041_B05.b : AGTGCAGGTGGCTACCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0065_B03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0083_G05.b : AGTGCAGGTGGCTATCAGCCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0099_D12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0101_D12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0054_G11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0004_C11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTGGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0065_B05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0012_D03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0098_D12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0057_C11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0063_E05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGTCAGAAGAAAGTGGAG
LVR01_0056_A12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0052_B12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0050_D08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0089_F06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0012_D05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0072_H02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0076_B07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0066_H06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0068_F02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0102_B05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0011_E12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0098_H07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0012_A03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0026_A11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0001_C02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0091_H11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0092_D12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0068_A01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0106_A03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0017_A12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0083_C09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0100_A07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0003_B03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0104_B07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0021_C03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0101_D05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0062_A06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0056_E11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0004_H02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0068_B09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0001_F03.b : AGTGCAGGTGGCTATCAACCTCGCCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0056_B11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0077_H03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0106_D12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0056_F02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0075_B05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGCAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0073_A05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0074_D03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0019_E11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0106_F08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0017_H04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0008_A03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0152_G12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0043_C02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0059_G08.b : AGTGCAGGTGGCTATCTCCCTCGTCCAGCCAAAATAGCTATTGGCCAGAAGAAACTGCAG
LVRM1_0086_G08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0161_C11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0129_B02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0028_G07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0206_G03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0037_F03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0193_A08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0198_G08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0100_E06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0125_E06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0176_F12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0027_F12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0124_C02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0159_F01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGTCTAGAAGAAAGTGGAG
LVRM1_0174_G07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0108_F11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0103_A09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0016_D03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0154_D04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0157_F10.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0030_E04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0139_B03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0145_C09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0077_F02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0104_A09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAAAAAGTGGAG
LVR01_0081_H02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0094_C06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0013_C02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0031_D05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0090_B04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0041_E01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0076_B09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0081_F12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0066_G02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0054_F09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0042_D12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0026_H02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0045_G06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0090_C08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0099_D08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0003_F09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0053_F05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0022_C11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0057_E02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0082_A04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0048_B05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0047_B07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0090_C04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0029_H03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0084_G10.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0004_D01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0063_D11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0101_C12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0009_G07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0044_H04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0084_B12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0083_G02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0004_A10.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0054_H06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0100_C10.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0100_H06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0012_G12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0060_H07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0103_E08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0010_G11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0049_D06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0104_F05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0047_H02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0051_E01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0049_D04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTACTGGCCAGAAGAAAGTGGAG
LVR01_0063_B03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0042_A03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0051_E05.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0105_B01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0021_F04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0043_E12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0077_E11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0022_A03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0040_C01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0062_H06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0083_G04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0066_G01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0037_E10.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0046_A09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0061_B06.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0044_A10.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0027_H01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
KDN01_0053_E04.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
KDN01_0066_F07.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
PST01_0014_D11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
KDN01_0057_C08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0100_D12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0054_B08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0141_D03.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0004_E01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0081_C10.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0088_C10.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0090_E08.b : AGTGCACGTGGCTATCAGCCTCGTCCACCCAAAGTACCTATTGGCCAGAGTAAAGTGAAT
LVR01_0031_F09.b : AGTGCAGGTGGCTATCCACCTCGTCCAGCCAAAGTAACTATTGGCCACAACAAAGTGGAG
LVR01_0081_E08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0102_D12.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0153_B09.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0010_B02.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0068_D08.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVRM1_0007_G11.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0049_C01.b : AGTGCAGGTGGCTATCAACCTCGTCCAGCCAAAGTAGCTATTGGCCAGAAGAAAGTGGAG
LVR01_0081_D04.b :
LVR01_0037_H04.b :
20110601C-007023 : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
---------+---------+---------+---------+---------+---------+ 388
LVR01_0020_H07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0095_G01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0003_A01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0041_C01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0004_A07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
KDN01_0019_E05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
KDN01_0097_C09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0187_E07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0033_D08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0084_H11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0087_F01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0096_B09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0149_D01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0045_D10.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0106_B03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0072_A04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0094_H11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0103_A11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0011_C06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0063_E09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0018_D09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0016_C04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0045_D08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0011_F08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0093_E07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0184_G02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0093_B03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0199_C05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGCGTGTTGTGT
LVRM1_0146_A05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0017_F02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0019_D03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0081_G09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0040_H07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0081_H05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0021_G05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0022_A02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0084_E09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0018_C06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0005_H01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0083_G01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0066_D02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0067_C11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0004_B02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0094_D01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0098_H04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0055_C03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0127_B08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0035_B09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0185_G07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0079_E07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0158_C09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0043_F11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0085_D05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0019_F09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0094_C10.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0066_E12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0078_D08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0031_B11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0072_F09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0012_H08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0009_A05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0061_F08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0012_B05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0067_B07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0003_A06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0060_G12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0168_B03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0081_E01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCNGACCTGGGTGTGTTGTGT
LVRM1_0194_H12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0062_D10.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0084_G08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0079_B01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0174_A09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0110_A07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0126_A03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGATCTGGGTGTGTTGTGT
LVRM1_0151_C01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0202_G02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0194_F05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0194_C12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0036_C02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0204_H03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0038_A08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0178_A08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0098_E04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0100_F06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0105_E05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGG*GTGTTGTGT
LVRM1_0119_D08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0053_B09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0092_D11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0169_H09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0035_E05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0056_G01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0003_D01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0112_C12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0050_E12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0051_E12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0208_B12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0191_F11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0103_B07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0029_E04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0139_E03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0153_B02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0116_D11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0108_F05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0139_C01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0101_B11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0029_F09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0140_E08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0142_E11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0023_F03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0006_H05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0096_G08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0100_B08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0065_C11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0076_A06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0087_G11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0065_D03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0034_C07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0103_A12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0055_D08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0046_F08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGAGTGTTGTGT
LVR01_0097_A05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0013_D09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0021_D09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0097_F04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0015_F07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0013_A09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0084_A01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0076_H04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0094_E04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0037_C02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0094_G07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0030_B05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0091_A12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0082_A12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0033_G06.b : AGAAAACCCCCTGATGCTGGGG*CTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0087_F02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0092_G02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0012_F10.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0038_H01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0087_H01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0071_F06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0016_D09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0061_F07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0078_H03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0095_C01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0087_F12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0082_F10.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0046_H09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0085_H06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCCGATCCGGACCTGGGTGTGTTGTGT
LVR01_0088_H10.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0062_H09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0102_H05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0029_H02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0021_C05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0102_F05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0017_E09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0100_G12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0026_G01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0045_F09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0077_D09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0048_C04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTACATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0106_G06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0103_H02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0078_H05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0091_C08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0092_B09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0003_B12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0089_G11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0105_C08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0104_B09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0082_H03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0011_G06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0048_G03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0013_C04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0015_F12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0029_E12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0025_H03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0042_F09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0008_D12.b : AGAAAACCCCCTGATGCTGGGGGCCGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0022_C07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0034_F02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0083_G12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0089_F11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0014_D02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0029_F04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0029_B03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0102_E06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0001_E05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0042_E08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0085_C12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGGCCTGGGTGTGTTGTGT
LVR01_0094_B10.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0100_H10.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0105_E06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0030_C01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0100_G04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0015_A08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0017_G09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0033_A04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0090_H04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0090_A06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0008_C04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0061_F01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0041_B05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0065_B03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0083_G05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0099_D12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0101_D12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0054_G11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0004_C11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0065_B05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0012_D03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0098_D12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0057_C11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0063_E05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0056_A12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0052_B12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0050_D08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0089_F06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0012_D05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0072_H02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0076_B07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0066_H06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0068_F02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGCGTTGTGT
LVR01_0102_B05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0011_E12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0098_H07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0012_A03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0026_A11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0001_C02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0091_H11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0092_D12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0068_A01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0106_A03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0017_A12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0083_C09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0100_A07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0003_B03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0104_B07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0021_C03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0101_D05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0062_A06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0056_E11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0004_H02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0068_B09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0001_F03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0056_B11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0077_H03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0106_D12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0056_F02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0075_B05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0073_A05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0074_D03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0019_E11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0106_F08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0017_H04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0008_A03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0152_G12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0043_C02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0059_G08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCCTGCAGATCTGGACCTGCGTGTGTTGTGT
LVRM1_0086_G08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0161_C11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0129_B02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0028_G07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0206_G03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0037_F03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0193_A08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0198_G08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0100_E06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0125_E06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0176_F12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0027_F12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0124_C02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0159_F01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0174_G07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0108_F11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0103_A09.b : AGAAAACCCCCTGATGCTGGGGGCCGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0016_D03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0154_D04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0157_F10.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0030_E04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0139_B03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0145_C09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0077_F02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0104_A09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0081_H02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0094_C06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0013_C02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0031_D05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0090_B04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0041_E01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0076_B09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0081_F12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0066_G02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0054_F09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0042_D12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0026_H02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0045_G06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCCGGGTGTGTTGTGT
LVR01_0090_C08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0099_D08.b : AGAAAGCCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0003_F09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0053_F05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0022_C11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0057_E02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0082_A04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0048_B05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0047_B07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0090_C04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0029_H03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0084_G10.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0004_D01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0063_D11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0101_C12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0009_G07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0044_H04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0084_B12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0083_G02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0004_A10.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0054_H06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0100_C10.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0100_H06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0012_G12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0060_H07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0103_E08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0010_G11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0049_D06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0104_F05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0047_H02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0051_E01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0049_D04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0063_B03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0042_A03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0051_E05.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0105_B01.b : AGAAAACCCCCTGATGCTGAGGGCTGCCTGCATGCTGATCTGGACCTGGGTGTGTTGTGT
LVR01_0021_F04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0043_E12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0077_E11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0022_A03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0040_C01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0062_H06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0083_G04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0066_G01.b : AGGAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0037_E10.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0046_A09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0061_B06.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0044_A10.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0027_H01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
KDN01_0053_E04.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
KDN01_0066_F07.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
PST01_0014_D11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
KDN01_0057_C08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0100_D12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0054_B08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0141_D03.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0004_E01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0081_C10.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0088_C10.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0090_E08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCGTGCTGATCCGGACCTGTGTGTGTTGTGT
LVR01_0031_F09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0081_E08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0102_D12.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0153_B09.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0010_B02.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0068_D08.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVRM1_0007_G11.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0049_C01.b : AGAAAACCCCCTGATGCTGGGGGCTGCCTGCATGCTGATCCGGACCTGGGTGTGTTGTGT
LVR01_0081_D04.b : c
LVR01_0037_H04.b :
20110601C-007023 : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
---------+---------+---------+---------+---------+---------+ 447
LVR01_0020_H07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0095_G01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0003_A01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0041_C01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0004_A07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
KDN01_0019_E05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
KDN01_0097_C09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0187_E07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0033_D08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0084_H11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0087_F01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0096_B09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0149_D01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0045_D10.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0106_B03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0072_A04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0094_H11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0103_A11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0011_C06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0063_E09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0018_D09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0016_C04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0045_D08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0011_F08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCACAACCAG
LVR01_0093_E07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0184_G02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0093_B03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0199_C05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0146_A05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0017_F02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0019_D03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0081_G09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0040_H07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0081_H05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0021_G05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0022_A02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0084_E09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0018_C06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0005_H01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0083_G01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0066_D02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0067_C11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0004_B02.b : CCTACAGGGTGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0094_D01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0098_H04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0055_C03.b : CCTACAGGATGTCAGTTGCCAGATACTC*TGCTGAAACAGGAAAGACCAATCCAAACCAG
LVRM1_0127_B08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0035_B09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0185_G07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAAACCAATCAAAACCAG
LVRM1_0079_E07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0158_C09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0043_F11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0085_D05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0019_F09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0094_C10.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0066_E12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0078_D08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0031_B11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0072_F09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0012_H08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0009_A05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0061_F08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0012_B05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0067_B07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0003_A06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0060_G12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0168_B03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAGACGGGAGAGACCCGTCAGAACCCG
LVR01_0081_E01.b : TCTAACGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAAACCAtcaaaaccgtt
LVRM1_0194_H12.b : CCTACAGGATGCCAGTTGCAAGATACTC*TGCTGAAACATGAAAGACCAATCAAAACCAG
LVRM1_0062_D10.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAGAGACCAATCAAAACCAG
LVRM1_0084_G08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAGACAGGAAAGACCAATCGAAACCAG
LVR01_0079_B01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0174_A09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0110_A07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0126_A03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0151_C01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0202_G02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0194_F05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0194_C12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0036_C02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0204_H03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0038_A08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0178_A08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0098_E04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0100_F06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0105_E05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0119_D08.b : CCTACAGGATGTCAGTTGCTAGATACTCGTGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0053_B09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0092_D11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0169_H09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0035_E05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0056_G01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCTATCAAAACCAG
LVRM1_0003_D01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0112_C12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0050_E12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0051_E12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0208_B12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0191_F11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0103_B07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0029_E04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0139_E03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0153_B02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0116_D11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0108_F05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0139_C01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0101_B11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0029_F09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0140_E08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0142_E11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0023_F03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0006_H05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0096_G08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0100_B08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0065_C11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0076_A06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0087_G11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0065_D03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0034_C07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0103_A12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0055_D08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0046_F08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACCGGAAGGACCAATCAAAACCAG
LVR01_0097_A05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0013_D09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0021_D09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0097_F04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0015_F07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0013_A09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0084_A01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0076_H04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0094_E04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0037_C02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCGATCAAAACCAG
LVR01_0094_G07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0030_B05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0091_A12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0082_A12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0033_G06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0087_F02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0092_G02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0012_F10.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0038_H01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0087_H01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0071_F06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0016_D09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0061_F07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0078_H03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0095_C01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0087_F12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0082_F10.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0046_H09.b : CCTACAAGATGTCAGTTGCTAGATACTC*TGCTGAAACAAGAAAGACCAATCAAAACCAG
LVR01_0085_H06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0088_H10.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0062_H09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0102_H05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0029_H02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0021_C05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0102_F05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0017_E09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0100_G12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0026_G01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0045_F09.b : CCTACAGGATGTCAGCTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0077_D09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0048_C04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0106_G06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0103_H02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0078_H05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0091_C08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0092_B09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0003_B12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0089_G11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0105_C08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0104_B09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0082_H03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0011_G06.b : CCTACAGGGTGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0048_G03.b : CCTACAGGATGTCAGTTGCAAGATACTC*CGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0013_C04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0015_F12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0029_E12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0025_H03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0042_F09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0008_D12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0022_C07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0034_F02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0083_G12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0089_F11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0014_D02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0029_F04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0029_B03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0102_E06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0001_E05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0042_E08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0085_C12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0094_B10.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0100_H10.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0105_E06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0030_C01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0100_G04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0015_A08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0017_G09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0033_A04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0090_H04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0090_A06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0008_C04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0061_F01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0041_B05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0065_B03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0083_G05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0099_D12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0101_D12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0054_G11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0004_C11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0065_B05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0012_D03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0098_D12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0057_C11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0063_E05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0056_A12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0052_B12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0050_D08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0089_F06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0012_D05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0072_H02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0076_B07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0066_H06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0068_F02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0102_B05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0011_E12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0098_H07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0012_A03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0026_A11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0001_C02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0091_H11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0092_D12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0068_A01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0106_A03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0017_A12.b : CCTACGGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0083_C09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0100_A07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0003_B03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0104_B07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0021_C03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0101_D05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0062_A06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0056_E11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0004_H02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0068_B09.b : CCTACAGGATGTCAGTTGCAAGATACCC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0001_F03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0056_B11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0077_H03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0106_D12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0056_F02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0075_B05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0073_A05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0074_D03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0019_E11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0106_F08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0017_H04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0008_A03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0152_G12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0043_C02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAGCAGGAAAGACCAATCAAAACCAG
LVR01_0059_G08.b : GCTACAGGATGTCCGTTGCAACATACTC*TGCaaacccatgagatacaaatactaactaa
LVRM1_0086_G08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAGCAGGAGGAACCAATCAAAGCCAG
LVRM1_0161_C11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0129_B02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0028_G07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0206_G03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0037_F03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0193_A08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0198_G08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0100_E06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0125_E06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0176_F12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0027_F12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0124_C02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0159_F01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0174_G07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0108_F11.b : CCTGCAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0103_A09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0016_D03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0154_D04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0157_F10.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0030_E04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0139_B03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0145_C09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0077_F02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0104_A09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0081_H02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0094_C06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0013_C02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0031_D05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0090_B04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0041_E01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0076_B09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0081_F12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0066_G02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0054_F09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0042_D12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0026_H02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0045_G06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0090_C08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0099_D08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0003_F09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0053_F05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0022_C11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0057_E02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0082_A04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0048_B05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0047_B07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0090_C04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0029_H03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0084_G10.b : CCTACAGGATGTCAGCTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0004_D01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0063_D11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0101_C12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0009_G07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0044_H04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0084_B12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0083_G02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0004_A10.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0054_H06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0100_C10.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0100_H06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0012_G12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0060_H07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0103_E08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0010_G11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TACTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0049_D06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0104_F05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0047_H02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0051_E01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCGAAACCAG
LVR01_0049_D04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0063_B03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0042_A03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0051_E05.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0105_B01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0021_F04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0043_E12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0077_E11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0022_A03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0040_C01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0062_H06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0083_G04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0066_G01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0037_E10.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0046_A09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0061_B06.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0044_A10.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0027_H01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
KDN01_0053_E04.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
KDN01_0066_F07.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
PST01_0014_D11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
KDN01_0057_C08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0100_D12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0054_B08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0141_D03.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0004_E01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0081_C10.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0088_C10.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0090_E08.b : CCTACGTGATGTCAGTTGCTAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0031_F09.b : CCTACCGGATGTCAATTGCCAGATACTC*TGCTGAAGCAGGAAAGACCAATCTTAACCAG
LVR01_0081_E08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0102_D12.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0153_B09.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0010_B02.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0068_D08.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVRM1_0007_G11.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0049_C01.b : CCTACAGGATGTCAGTTGCAAGATACTC*TGCTGAAACAGGAAAGACCAATCAAAACCAG
LVR01_0081_D04.b : ttttggtgtactatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_H04.b :
20110601C-007023 : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
---------+---------+---------+---------+---------+---------+ 505
LVR01_0020_H07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0095_G01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0003_A01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0041_C01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0004_A07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
KDN01_0019_E05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
KDN01_0097_C09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0187_E07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0033_D08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0084_H11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0087_F01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0096_B09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0149_D01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0045_D10.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0106_B03.b : TATAG*GAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0072_A04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0094_H11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0103_A11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0011_C06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0063_E09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0018_D09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0016_C04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0045_D08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0011_F08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0093_E07.b : TATAG*AAGAGCTGAAT*AGTAACATAAACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0184_G02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0093_B03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0199_C05.b : TATAG*AAGAGCTGAAT*AGTAACCTAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0146_A05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0017_F02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0019_D03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0081_G09.b : TATAG*AACAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0040_H07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0081_H05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0021_G05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0022_A02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0084_E09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0018_C06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0005_H01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0083_G01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0066_D02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0067_C11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0004_B02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0094_D01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCCTCCACCTTT
LVR01_0098_H04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0055_C03.b : TATAG*AAGAGCTGCAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0127_B08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0035_B09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0185_G07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0079_E07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0158_C09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0043_F11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0085_D05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0019_F09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0094_C10.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0066_E12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0078_D08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0031_B11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0072_F09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0012_H08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0009_A05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0061_F08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0012_B05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0067_B07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0003_A06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0060_G12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0168_B03.b : TATGC*AAGAGCTGgaatacagcatagactcgggttcacggtcctcgacatacccctttc
LVR01_0081_E01.b : taaaaaaccgaaatattacataactccgttttcccagcccccttcttcccccttttcata
LVRM1_0194_H12.b : TATAGTAATAGCTGAAT*AGTAACATAAACTCTGTTTCCCAGTCCTCCTCTTCAACCTTT
LVRM1_0062_D10.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTGCCAGTGCTGTTCTTCCACCTTT
LVRM1_0084_G08.b : TATAG*AAGAGCTGAAT*AGCAACATACACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0079_B01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0174_A09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0110_A07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0126_A03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0151_C01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0202_G02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0194_F05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0194_C12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCTACCTTT
LVR01_0036_C02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0204_H03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0038_A08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0178_A08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0098_E04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0100_F06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0105_E05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0119_D08.b : TATAG*AAGAGCTGAGTGAGTAACATAGACTCTGTTTCCCAATCCTCTTCTTCCACCTTT
LVRM1_0053_B09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0092_D11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0169_H09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0035_E05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0056_G01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0003_D01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0112_C12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0050_E12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0051_E12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0208_B12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0191_F11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0103_B07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0029_E04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0139_E03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0153_B02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0116_D11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0108_F05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0139_C01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0101_B11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0029_F09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0140_E08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0142_E11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0023_F03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0006_H05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0096_G08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0100_B08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0065_C11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0076_A06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0087_G11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0065_D03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0034_C07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0103_A12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0055_D08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0046_F08.b : TATAG*AAGAGCTGAAT*AGTAACATACACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0097_A05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0013_D09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0021_D09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0097_F04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0015_F07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0013_A09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0084_A01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0076_H04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0094_E04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0037_C02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0094_G07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0030_B05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0091_A12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0082_A12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0033_G06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0087_F02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0092_G02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0012_F10.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0038_H01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0087_H01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0071_F06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0016_D09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0061_F07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0078_H03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0095_C01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0087_F12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0082_F10.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0046_H09.b : TATAC*AACAGCTGAAT*ATTAACATATACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0085_H06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0088_H10.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0062_H09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0102_H05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0029_H02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTCTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0021_C05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0102_F05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0017_E09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0100_G12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0026_G01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0045_F09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0077_D09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0048_C04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0106_G06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0103_H02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0078_H05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0091_C08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0092_B09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0003_B12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0089_G11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0105_C08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0104_B09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0082_H03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0011_G06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0048_G03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0013_C04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0015_F12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0029_E12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0025_H03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0042_F09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0008_D12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0022_C07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0034_F02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0083_G12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0089_F11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0014_D02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0029_F04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0029_B03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0102_E06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0001_E05.b : TATAG*AAGAGCTGAAT*ATTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0042_E08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0085_C12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0094_B10.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0100_H10.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0105_E06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0030_C01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0100_G04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0015_A08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0017_G09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0033_A04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0090_H04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0090_A06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0008_C04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0061_F01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0041_B05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0065_B03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0083_G05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0099_D12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0101_D12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0054_G11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0004_C11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0065_B05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0012_D03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0098_D12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0057_C11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0063_E05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0056_A12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0052_B12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0050_D08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0089_F06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0012_D05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0072_H02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0076_B07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0066_H06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0068_F02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0102_B05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0011_E12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0098_H07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0012_A03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0026_A11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0001_C02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0091_H11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0092_D12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0068_A01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0106_A03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0017_A12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0083_C09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0100_A07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0003_B03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0104_B07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0021_C03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0101_D05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0062_A06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0056_E11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0004_H02.b : TATAG*AAGGGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0068_B09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0001_F03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0056_B11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0077_H03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0106_D12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0056_F02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0075_B05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0073_A05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0074_D03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0019_E11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0106_F08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0017_H04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0008_A03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0152_G12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0043_C02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0059_G08.b : aatagaagagctgaatgctagcctatattgagttttcctagtccacttcctccaactttg
LVRM1_0086_G08.b : TATAG*AAaggctgacgtataacatagcactctgtttcgcaatcctcctcttccacctta
LVRM1_0161_C11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0129_B02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0028_G07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0206_G03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0037_F03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACCCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0193_A08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0198_G08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0100_E06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0125_E06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0176_F12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0027_F12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0124_C02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0159_F01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0174_G07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0108_F11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0103_A09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0016_D03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0154_D04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0157_F10.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0030_E04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0139_B03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0145_C09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0077_F02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0104_A09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0081_H02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0094_C06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0013_C02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0031_D05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0090_B04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0041_E01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTTCCAGTCCTCTTCTTCCACCTTT
LVR01_0076_B09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0081_F12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0066_G02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0054_F09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0042_D12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0026_H02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0045_G06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0090_C08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0099_D08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0003_F09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0053_F05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0022_C11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0057_E02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0082_A04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0048_B05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0047_B07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0090_C04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0029_H03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0084_G10.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0004_D01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0063_D11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0101_C12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0009_G07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0044_H04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0084_B12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0083_G02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0004_A10.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0054_H06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0100_C10.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0100_H06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0012_G12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0060_H07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0103_E08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0010_G11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0049_D06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0104_F05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0047_H02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0051_E01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0049_D04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0063_B03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0042_A03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0051_E05.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0105_B01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0021_F04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0043_E12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0077_E11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0022_A03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0040_C01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0062_H06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0083_G04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0066_G01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0037_E10.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0046_A09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0061_B06.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0044_A10.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0027_H01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
KDN01_0053_E04.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
KDN01_0066_F07.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
PST01_0014_D11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
KDN01_0057_C08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0100_D12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0054_B08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0141_D03.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0004_E01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0081_C10.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0088_C10.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0090_E08.b : TATAG*AAGAGCTGAAT*AGTAACATATACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0031_F09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGATTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0081_E08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0102_D12.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0153_B09.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0010_B02.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0068_D08.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVRM1_0007_G11.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0049_C01.b : TATAG*AAGAGCTGAAT*AGTAACATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0081_D04.b : xxxxxxxxxxxxxxxxxxxxxxxCATAGACTCTGTTTCCCAGTCCTCTTCTTCCACCTTT
LVR01_0037_H04.b :
20110601C-007023 : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
---------+---------+---------+---------+---------+---------+ 563
LVR01_0020_H07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0095_G01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0003_A01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0041_C01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0004_A07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
KDN01_0019_E05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
KDN01_0097_C09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0187_E07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0033_D08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0084_H11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0087_F01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0096_B09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0149_D01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0045_D10.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0106_B03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0072_A04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0094_H11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0103_A11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0011_C06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0063_E09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0018_D09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0016_C04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0045_D08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0011_F08.b : CCATACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGTGTAA*GCCA*GAACAGATA
LVR01_0093_E07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACTGGCAAAA*TCAAAGAAGAGATA
LVRM1_0184_G02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0093_B03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0199_C05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0146_A05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0017_F02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0019_D03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0081_G09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*CCAAAGAAGAGATA
LVR01_0040_H07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0081_H05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0021_G05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0022_A02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0084_E09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0018_C06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0005_H01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0083_G01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0066_D02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0067_C11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0004_B02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0094_D01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0098_H04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0055_C03.b : CAGTACATGACTCTGCTGAAACGCCctgtggaaagactggcgcgaaccaattagagacat
LVRM1_0127_B08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0035_B09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*TCAAAGAAGAGATA
LVRM1_0185_G07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0079_E07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0158_C09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0043_F11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0085_D05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0019_F09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0094_C10.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0066_E12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAGGAAGAGATA
LVR01_0078_D08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0031_B11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0072_F09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0012_H08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0009_A05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0061_F08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0012_B05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0067_B07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0003_A06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0060_G12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0168_B03.b : gatgaatgaccctgctgacacgcctgtgggaaatatggcataaggccaagacgcgccacg
LVR01_0081_E01.b : aatgaactctcctaaaaaccccggggaaaaaccggggaaaacacaaaaaaaaaaaataaa
LVRM1_0194_H12.b : CAGTACATGACCCCGCTGAAACGCCctgtggaaataccagcaccaccccagttatacagc
LVRM1_0062_D10.b : CTGTACATGACTCTCTCTGAACGCCTGgtgaaatgacggcggaggcaaataatagagaat
LVRM1_0084_G08.b : CAGTACGTGACTCTGCTGAAACCCCTGTGG*AAAGgacaggcggaaacgaccaacacata
LVR01_0079_B01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAAAA*GCAAAGAAGAGATA
LVRM1_0174_A09.b : CAGTACATGACTCTGCTGANACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0110_A07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCCAAGAAGAGATA
LVRM1_0126_A03.b : CAGTACATGACTCTGCTGTAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0151_C01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCCAAGAAGAGATA
LVRM1_0202_G02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0194_F05.b : CAGTACATGACTCTGCTGAAACGCCTGCGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0194_C12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0036_C02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0204_H03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0038_A08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0178_A08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0098_E04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0100_F06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0105_E05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0119_D08.b : CAGTACATGACTCTGCTGAAACGCCGGTGGGAAAGACAGGCAGAT*GCAAAGAAGAGATA
LVRM1_0053_B09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0092_D11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0169_H09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0035_E05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0056_G01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0003_D01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0112_C12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAACAGATA
LVRM1_0050_E12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0051_E12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0208_B12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0191_F11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0103_B07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0029_E04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0139_E03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0153_B02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0116_D11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGAGA
LVRM1_0108_F05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0139_C01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAAAGATA
LVRM1_0101_B11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0029_F09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAAAGCAAAGAAGAGATA
LVRM1_0140_E08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0142_E11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0023_F03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0006_H05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0096_G08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0100_B08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0065_C11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0076_A06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0087_G11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0065_D03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAAAGATA
LVR01_0034_C07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0103_A12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0055_D08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0046_F08.b : TAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0097_A05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0013_D09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0021_D09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0097_F04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0015_F07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0013_A09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0084_A01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0076_H04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0094_E04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0037_C02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0094_G07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0030_B05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0091_A12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0082_A12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0033_G06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0087_F02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0092_G02.b : CAGTACATGACTCTGCTGAAACGTCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0012_F10.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0038_H01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0087_H01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0071_F06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0016_D09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0061_F07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0078_H03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0095_C01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0087_F12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0082_F10.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0046_H09.b : TAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCACAA*GCAAAGAAGACATA
LVR01_0085_H06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0088_H10.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0062_H09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0102_H05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0029_H02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0021_C05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0102_F05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0017_E09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0100_G12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0026_G01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0045_F09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0077_D09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0048_C04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0106_G06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0103_H02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0078_H05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0091_C08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0092_B09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0003_B12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0089_G11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0105_C08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0104_B09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0082_H03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0011_G06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0048_G03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0013_C04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0015_F12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0029_E12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0025_H03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0042_F09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0008_D12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0022_C07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0034_F02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0083_G12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0089_F11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0014_D02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0029_F04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0029_B03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0102_E06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0001_E05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0042_E08.b : CAGTACATGACTCTGCTGAAACACCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0085_C12.b : CAGCACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0094_B10.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0100_H10.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0105_E06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0030_C01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0100_G04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0015_A08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0017_G09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0033_A04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0090_H04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0090_A06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0008_C04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0061_F01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0041_B05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0065_B03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0083_G05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0099_D12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0101_D12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0054_G11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0004_C11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0065_B05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0012_D03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0098_D12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0057_C11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0063_E05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0056_A12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0052_B12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0050_D08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0089_F06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0012_D05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0072_H02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0076_B07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0066_H06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0068_F02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0102_B05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0011_E12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0098_H07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0012_A03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGGA*GCAAAGAAGAGATA
LVR01_0026_A11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0001_C02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0091_H11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0092_D12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0068_A01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0106_A03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0017_A12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0083_C09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0100_A07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0003_B03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0104_B07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0021_C03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0101_D05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0062_A06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACATGCAGAA*GCAAAGAAGAGATA
LVR01_0056_E11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0004_H02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0068_B09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0001_F03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0056_B11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0077_H03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0106_D12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0056_F02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0075_B05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAATAGATA
LVRM1_0073_A05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0074_D03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0019_E11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0106_F08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0017_H04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0008_A03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0152_G12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0043_C02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0059_G08.b : cttacttgaccactcgcagatatacggtgcaacacaccggctgatacatacatcaaattt
LVRM1_0086_G08.b : cgtgaaggactctgctgacccgcttgtgaagagacaggccgacgcatccaatatatgatg
LVRM1_0161_C11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0129_B02.b : CAGTACATGACTCTGCTGATACGCCTGTGG*AAAGACAGGCAGAA*GCAAACATGAGATA
LVRM1_0028_G07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0206_G03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0037_F03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0193_A08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCACAA*GCAAAGAAGAGATA
LVRM1_0198_G08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0100_E06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0125_E06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0176_F12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0027_F12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0124_C02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0159_F01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0174_G07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0108_F11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0103_A09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0016_D03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0154_D04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0157_F10.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0030_E04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0139_B03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0145_C09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0077_F02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0104_A09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AA*GACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0081_H02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0094_C06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0013_C02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0031_D05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0090_B04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0041_E01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0076_B09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0081_F12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0066_G02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0054_F09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0042_D12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0026_H02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0045_G06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0090_C08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0099_D08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0003_F09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0053_F05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0022_C11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0057_E02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0082_A04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0048_B05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0047_B07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0090_C04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0029_H03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0084_G10.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0004_D01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0063_D11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0101_C12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0009_G07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0044_H04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0084_B12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0083_G02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0004_A10.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0054_H06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0100_C10.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACGGGCAGAA*GCAAAGAAGAGATA
LVR01_0100_H06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0012_G12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0060_H07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0103_E08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0010_G11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0049_D06.b : CAGTACGTGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0104_F05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0047_H02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0051_E01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0049_D04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0063_B03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0042_A03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0051_E05.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0105_B01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0021_F04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0043_E12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0077_E11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0022_A03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0040_C01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0062_H06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0083_G04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0066_G01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0037_E10.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0046_A09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAG*GCAAAGAAGAGATA
LVR01_0061_B06.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0044_A10.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0027_H01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAACGAATAGATA
KDN01_0053_E04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
KDN01_0066_F07.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
PST01_0014_D11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
KDN01_0057_C08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0100_D12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0054_B08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCTGAA*GCAAAGAAGAGATA
LVRM1_0141_D03.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0004_E01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0081_C10.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0088_C10.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0090_E08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCATAA*GCAAAGAAGAGATA
LVR01_0031_F09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0081_E08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0102_D12.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0153_B09.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0010_B02.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0068_D08.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVRM1_0007_G11.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0049_C01.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0081_D04.b : CAGTACATGACTCTGCTGAAACGCCTGTGG*AAAGACAGGCAGAA*GCAAAGAAGAGATA
LVR01_0037_H04.b : ttttttggggxxxxxxxxxxxxxxxxxxxx
20110601C-007023 : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
---------+---------+---------+---------+---------+---------+ 621
LVR01_0020_H07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0095_G01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAGAGCACCAGCTCTATATA*CA
LVRM1_0003_A01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGGAAAGCACCAGCTCTATATA*GA
LVR01_0041_C01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0004_A07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
KDN01_0019_E05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
KDN01_0097_C09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0187_E07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0033_D08.b : ATGAANATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0084_H11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0087_F01.b : ATGAAAATGT*CATAAATGAGCTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0096_B09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0149_D01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0045_D10.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0106_B03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0072_A04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0094_H11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*CA
LVRM1_0103_A11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0011_C06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0063_E09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0018_D09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0016_C04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0045_D08.b : ATGAAAATGT*CATAAATGAGCTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0011_F08.b : ATGACAATGT*CACAAATGAGTCCTCGTCCGAGCTGGAAAACCACCgactccacatggat
LVR01_0093_E07.b : ATGAAAATGTTCATAAATGAGTTCTCGTCCAAGCTGGAAAAGCTCCACTTCTATATA*GA
LVRM1_0184_G02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0093_B03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0199_C05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0146_A05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0017_F02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0019_D03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0081_G09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0040_H07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0081_H05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0021_G05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0022_A02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0084_E09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0018_C06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGGGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0005_H01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0083_G01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0066_D02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0067_C11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0004_B02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0094_D01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0098_H04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0055_C03.b : cgatcatgccttaaatgagttcccgtccgagcctggtacacacccgctcctttccggtga
LVRM1_0127_B08.b : ATGAAAATGT*CATANATGAGTTCTCGTCCGAGCTGGGAAAGCACCAGCTCTATATA*GA
LVR01_0035_B09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATAAGA
LVRM1_0185_G07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0079_E07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0158_C09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0043_F11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0085_D05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0019_F09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0094_C10.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0066_E12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0078_D08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0031_B11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0072_F09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0012_H08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0009_A05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0061_F08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0012_B05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0067_B07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0003_A06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0060_G12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0168_B03.b : catgagtaaccaagtgaaatgctagtccgcaactgggggagcgatgacagtatgaacctc
LVR01_0081_E01.b : aaatgttaaaaaaaggttttcccccccaaccgggaaaaaccccccccccttttaaaaaaa
LVRM1_0194_H12.b : agcaactgacacaatcgacctctcgttacaagtggcaaaacagcaaatcatattaccaaa
LVRM1_0062_D10.b : gggagatggcctggactccgtttttgtgcgatcatggtgtgtaccagctctttgtagagt
LVRM1_0084_G08.b : atgaacatgtcacaggtgagtccctcgcgcgagccgggaaagccacatctccatgtaaag
LVR01_0079_B01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCcacctctatataaa
LVRM1_0174_A09.b : ATGANAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0110_A07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0126_A03.b : ATGAAAATGT*CATAGATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0151_C01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0202_G02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0194_F05.b : ATGAAAATGT*CATANATGAGTTCTCGTCCGAGCTGGTAAAGCACCAGCTCTATATA*GA
LVRM1_0194_C12.b : ATGAANATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0036_C02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0204_H03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0038_A08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0178_A08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0098_E04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0100_F06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0105_E05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0119_D08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGCGAAAGCACCAGCTCTATATA*GA
LVRM1_0053_B09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAAGCTGGAAAGCACCAGCTCTATATA*GA
LVRM1_0092_D11.b : ATGAAAATGT*CATANATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0169_H09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0035_E05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0056_G01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0003_D01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0112_C12.b : ATGAAAATGT*CATACATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0050_E12.b : ATGAAAATGT*CTTAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0051_E12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0208_B12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0191_F11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0103_B07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0029_E04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0139_E03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0153_B02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0116_D11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0108_F05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0139_C01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0101_B11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0029_F09.b : ATGAAAATGT*CATAAATGATTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0140_E08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0142_E11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0023_F03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0006_H05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0096_G08.b : ATGAAAAGG**CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0100_B08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0065_C11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0076_A06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCAC*AGCTCTATATA*GA
LVR01_0087_G11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0065_D03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0034_C07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0103_A12.b : ATGAAAATGT*CATAAATGAATTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0055_D08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0046_F08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0097_A05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0013_D09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0021_D09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0097_F04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0015_F07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0013_A09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0084_A01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0076_H04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0094_E04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0037_C02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0094_G07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0030_B05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0091_A12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0082_A12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0033_G06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0087_F02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0092_G02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0012_F10.b : ATGAAAATGT*TATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0038_H01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0087_H01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0071_F06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0016_D09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0061_F07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0078_H03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0095_C01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0087_F12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0082_F10.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0046_H09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0085_H06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0088_H10.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0062_H09.b : ATGAAGATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0102_H05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0029_H02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0021_C05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0102_F05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0017_E09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0100_G12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATGTA*GA
LVR01_0026_G01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0045_F09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0077_D09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0048_C04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0106_G06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0103_H02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0078_H05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0091_C08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0092_B09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0003_B12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0089_G11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0105_C08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0104_B09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0082_H03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAA*GCACCAGCTCTATATA*GA
LVR01_0011_G06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0048_G03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0013_C04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0015_F12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0029_E12.b : ATGAAAGTGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0025_H03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0042_F09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0008_D12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0022_C07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0034_F02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0083_G12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0089_F11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0014_D02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0029_F04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0029_B03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0102_E06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0001_E05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0042_E08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0085_C12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0094_B10.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0100_H10.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0105_E06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0030_C01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0100_G04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0015_A08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0017_G09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0033_A04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0090_H04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0090_A06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0008_C04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0061_F01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0041_B05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0065_B03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0083_G05.b : ATGAAAATGT*CATAAGTGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0099_D12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0101_D12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0054_G11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0004_C11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0065_B05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0012_D03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0098_D12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0057_C11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0063_E05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0056_A12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0052_B12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0050_D08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0089_F06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0012_D05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0072_H02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0076_B07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0066_H06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0068_F02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0102_B05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0011_E12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0098_H07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0012_A03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0026_A11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0001_C02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0091_H11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0092_D12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0068_A01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0106_A03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0017_A12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0083_C09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0100_A07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0003_B03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0104_B07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0021_C03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0101_D05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0062_A06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0056_E11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0004_H02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0068_B09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0001_F03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0056_B11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0077_H03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0106_D12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0056_F02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0075_B05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGTACCAGCTCTATATA*GA
LVRM1_0073_A05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0074_D03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0019_E11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0106_F08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0017_H04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0008_A03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0152_G12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0043_C02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0059_G08.b : gaaaaatatcttaccgaatatctcctcccaatatgggaaccccgaggacttgctctcccc
LVRM1_0086_G08.b : aaatcgcaccgatgaaccggcgaccgaccggcggaacccaggcccccccaataaaaaaag
LVRM1_0161_C11.b : ATGAAAATGT*CATTAATGAGTTCTCGTCCGAGCTGGAAAAGCACacctctatatagatg
LVRM1_0129_B02.b : ATGAAGATGC*CATAATTGAGTTCTCGTCCGAGCTGGGAAAGCACCAGCTCTgtctcagt
LVRM1_0028_G07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0206_G03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0037_F03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0193_A08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCTGATCTGGACAATCACCAGCTCTATATA*CA
LVRM1_0198_G08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0100_E06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0125_E06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0176_F12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0027_F12.b : ATGAAAATGT*CATANATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0124_C02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0159_F01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0174_G07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0108_F11.b : ATGAAAATGT*CATANATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0103_A09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0016_D03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0154_D04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0157_F10.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0030_E04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0139_B03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0145_C09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0077_F02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0104_A09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0081_H02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0094_C06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0013_C02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0031_D05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0090_B04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0041_E01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0076_B09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0081_F12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0066_G02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0054_F09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0042_D12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGTTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0026_H02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0045_G06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0090_C08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0099_D08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0003_F09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0053_F05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0022_C11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0057_E02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTACATA*GA
LVR01_0082_A04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0048_B05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0047_B07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0090_C04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0029_H03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0084_G10.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0004_D01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0063_D11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0101_C12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0009_G07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGGAAAGCACCAGCTCTATATA*GA
LVR01_0044_H04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0084_B12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0083_G02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0004_A10.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0054_H06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0100_C10.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0100_H06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0012_G12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0060_H07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCGCCAGCTCTATATA*GA
LVR01_0103_E08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0010_G11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0049_D06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0104_F05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0047_H02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0051_E01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0049_D04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0063_B03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0042_A03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0051_E05.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0105_B01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0021_F04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0043_E12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0077_E11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0022_A03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0040_C01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0062_H06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0083_G04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0066_G01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0037_E10.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0046_A09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0061_B06.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0044_A10.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0027_H01.b : ATGAGGATGT*CATCAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGGTCTATATA*GA
KDN01_0053_E04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
KDN01_0066_F07.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
PST01_0014_D11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
KDN01_0057_C08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0100_D12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0054_B08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0141_D03.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0004_E01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0081_C10.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0088_C10.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0090_E08.b : ATGAAAATGT*CATACATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0031_F09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0081_E08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0102_D12.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0153_B09.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0010_B02.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0068_D08.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVRM1_0007_G11.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0049_C01.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCACCAGCTCTATATA*GA
LVR01_0081_D04.b : ATGAAAATGT*CATAAATGAGTTCTCGTCCGAGCTGGAAAAGCGCCAGCTCTATATA*GA
LVR01_0037_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTA*GA
20110601C-007023 : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
---------+---------+---------+---------+---------+---------+ 675
LVR01_0020_H07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0095_G01.b : TGA*AACTGTA*GAACACCACAT*CCCCACTAA*CTTGCGTGTGCACG*ATGCCAT*CCT
LVRM1_0003_A01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0041_C01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0004_A07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
KDN01_0019_E05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
KDN01_0097_C09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0187_E07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0033_D08.b : TGA*AACTGTG*AACAGCAATAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0084_H11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0087_F01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0096_B09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0149_D01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0045_D10.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0106_B03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0072_A04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0094_H11.b : TGA*AACTGTG*AACAGGCACAT*CCCCCCTAA*CTTGCGTGTGCTCC*TTGCCAT*CCT
LVRM1_0103_A11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0011_C06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0063_E09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0018_D09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0016_C04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0045_D08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0011_F08.b : gcaaatgcaaaccgtaccctccgctactacttgcgtgtcctccgcccctctcagacgcag
LVR01_0093_E07.b : TGA*AACTGTG*AACATCAACAT*CCCCACTAA*CTTGCGTGTGGCTCCATGCCATTCCT
LVRM1_0184_G02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0093_B03.b : TGA*AACTGTG*GACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0199_C05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0146_A05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0017_F02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0019_D03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0081_G09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCATGTGCTCC*GTGCCAT*CCT
LVR01_0040_H07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0081_H05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0021_G05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0022_A02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0084_E09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0018_C06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0005_H01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0083_G01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0066_D02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0067_C11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0004_B02.b : TGA*AACTGTG*AACAACAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0094_D01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0098_H04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0055_C03.b : aaattgtgtaccggtatcacccctatcaactcgggtgtgccccgcgttcgtccctggaaa
LVRM1_0127_B08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0035_B09.b : TGA*AACTGTGAAACAGCATCTT*CCCCCCTAA*CTTGCGTGTGCTCC*GAGCCAT*CCT
LVRM1_0185_G07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0079_E07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCCATCCT
LVRM1_0158_C09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0043_F11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0085_D05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0019_F09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0094_C10.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0066_E12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0078_D08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0031_B11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0072_F09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0012_H08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0009_A05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0061_F08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0012_B05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0067_B07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0003_A06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0060_G12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0168_B03.b : aatatgttagcgatcgaatataacggatagactgaggtgcgcgactcgaagaggggccaa
LVR01_0081_E01.b : aaaatttgaaaaaaaaaaactccccccaaaattttggggtttcccccgggcccctccgga
LVRM1_0194_H12.b : acactggggaccataattccctccgaacttgattatacgaccttgccatatatgatatct
LVRM1_0062_D10.b : agttctgtagactgcttttgtctcgctacgttggtggaggtttgtcccattaatctagac
LVRM1_0084_G08.b : tgaacgtgggacaaccaacgtacccacgaagcttgcgtgtgatccgggccaatctgggaa
LVR01_0079_B01.b : tgaaacttgtaaacacaacatcccccactaacttggcttgtgctccctgcccatcctgga
LVRM1_0174_A09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0110_A07.b : TGA*AACTGTG*GACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0126_A03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0151_C01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0202_G02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0194_F05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0194_C12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0036_C02.b : TGA*AACTGTG*AACAGCATCAT*CCCCACTAA*CTTGCATGTGCTCCCGTGCCATCCCT
LVRM1_0204_H03.b : TGA*AACTGTGAAACAGC*ACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0038_A08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0178_A08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0098_E04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0100_F06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0105_E05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0119_D08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCN
LVRM1_0053_B09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0092_D11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0169_H09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0035_E05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0056_G01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0003_D01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0112_C12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0050_E12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0051_E12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCCT*CCT
LVRM1_0208_B12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0191_F11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0103_B07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0029_E04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0139_E03.b : TGA*AACTGTG*AACAGCAACAC*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0153_B02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0116_D11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0108_F05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCCT*CCT
LVRM1_0139_C01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0101_B11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0029_F09.b : TGA*AACTGTG*AACAGCAACATTCCCCACTAACCTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0140_E08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0142_E11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0023_F03.b : TGA*AACTGTG*AACAGCAACAN*TCCTACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0006_H05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0096_G08.b : TGAAAACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCATCCCT
LVR01_0100_B08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0065_C11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0076_A06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0087_G11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0065_D03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0034_C07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0103_A12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0055_D08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0046_F08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0097_A05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCATCCCT
LVR01_0013_D09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCCT*CCT
LVR01_0021_D09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0097_F04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0015_F07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0013_A09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0084_A01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0076_H04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CTT
LVR01_0094_E04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0037_C02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0094_G07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0030_B05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0091_A12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0082_A12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0033_G06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0087_F02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0092_G02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0012_F10.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0038_H01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0087_H01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0071_F06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0016_D09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0061_F07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0078_H03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0095_C01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0087_F12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0082_F10.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0046_H09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0085_H06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0088_H10.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0062_H09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0102_H05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0029_H02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0021_C05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0102_F05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0017_E09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0100_G12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0026_G01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0045_F09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0077_D09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0048_C04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0106_G06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0103_H02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0078_H05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0091_C08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0092_B09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0003_B12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0089_G11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0105_C08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0104_B09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0082_H03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0011_G06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0048_G03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0013_C04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0015_F12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0029_E12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0025_H03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0042_F09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0008_D12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0022_C07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0034_F02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0083_G12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0089_F11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0014_D02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0029_F04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0029_B03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0102_E06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0001_E05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0042_E08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0085_C12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0094_B10.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0100_H10.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0105_E06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0030_C01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0100_G04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0015_A08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0017_G09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0033_A04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0090_H04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0090_A06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0008_C04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0061_F01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0041_B05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0065_B03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0083_G05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0099_D12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0101_D12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0054_G11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0004_C11.b : TGA*AACTGGG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0065_B05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0012_D03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0098_D12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0057_C11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0063_E05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0056_A12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0052_B12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0050_D08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0089_F06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0012_D05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0072_H02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0076_B07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0066_H06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0068_F02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0102_B05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0011_E12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0098_H07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0012_A03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0026_A11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0001_C02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0091_H11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0092_D12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0068_A01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0106_A03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0017_A12.b : TGA*AACTGTG*AACAGCAACAC*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0083_C09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0100_A07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0003_B03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0104_B07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0021_C03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0101_D05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0062_A06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0056_E11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0004_H02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0068_B09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0001_F03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0056_B11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0077_H03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0106_D12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0056_F02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0075_B05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0073_A05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0074_D03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0019_E11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTTC*GTGCCAT*CCT
LVR01_0106_F08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCCTTCCT
LVR01_0017_H04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0008_A03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0152_G12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0043_C02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0059_G08.b : acactatgcatgggaactctgccgttgactcctaaagactcattccaaccccgaaaccca
LVRM1_0086_G08.b : agagcgcctccccagccagatgtgcgcggcctctgccacgcactgggtgaatggcaggac
LVRM1_0161_C11.b : aacttgtgacagcaacatcccacctaattgcttgtgctctgtgccctccgggaaaactgg
LVRM1_0129_B02.b : gaaactggggattgccacatcgccccaccttgcgggtgccccgtgccctcctgtcccctt
LVRM1_0028_G07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0206_G03.b : TGA*AACTGTG*AACAG*AACAT*CCCCACTAA*CTTGCGTGCGCTCC*GTGCCAT*CCT
LVRM1_0037_F03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0193_A08.b : TGA*AACTGTG*AACAGCAACAT*CTCCACTAA*CTTGCGTGTGCTCC*GTGTCAT*CCT
LVRM1_0198_G08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0100_E06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0125_E06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0176_F12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0027_F12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0124_C02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0159_F01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0174_G07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0108_F11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0103_A09.b : TGA*GACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0016_D03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0154_D04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0157_F10.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0030_E04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0139_B03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0145_C09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0077_F02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0104_A09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACCTAACTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0081_H02.b : TGA*AACTGTG*TACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0094_C06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0013_C02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0031_D05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0090_B04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0041_E01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0076_B09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0081_F12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0066_G02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0054_F09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0042_D12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0026_H02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0045_G06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0090_C08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0099_D08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0003_F09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0053_F05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0022_C11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0057_E02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0082_A04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0048_B05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0047_B07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0090_C04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0029_H03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0084_G10.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0004_D01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0063_D11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0101_C12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0009_G07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0044_H04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0084_B12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0083_G02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0004_A10.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0054_H06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0100_C10.b : TGA*AACTGCG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0100_H06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0012_G12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0060_H07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0103_E08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0010_G11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0049_D06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0104_F05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0047_H02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0051_E01.b : TGG*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0049_D04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0063_B03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0042_A03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0051_E05.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0105_B01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0021_F04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0043_E12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0077_E11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0022_A03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0040_C01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0062_H06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0083_G04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0066_G01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0037_E10.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0046_A09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0061_B06.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0044_A10.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0027_H01.b : TGA*AACTGTG*AACAGCCGCAT*CCCCACTAA*CTTGCATGTGCTCC*GTGCCAT*CCT
KDN01_0053_E04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
KDN01_0066_F07.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
PST01_0014_D11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
KDN01_0057_C08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0100_D12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0054_B08.b : TGA*AACTGTG*GACAGCAACAT*CCCC*CTAA*CTTGCGTGTGCTCC*CTGCCAT*CCT
LVRM1_0141_D03.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0004_E01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0081_C10.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0088_C10.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0090_E08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0031_F09.b : TGA*AACTGTG*AACAGCAACAT*CACCACTAAACTTGCTTGTGCTCC*GTGCCAT*CCT
LVR01_0081_E08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0102_D12.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0153_B09.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0010_B02.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0068_D08.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVRM1_0007_G11.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0049_C01.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0081_D04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
LVR01_0037_H04.b : TGA*AACTGTG*AACAGCAACAT*CCCCACTAA*CTTGCGTGTGCTCC*GTGCCAT*CCT
20110601C-007023 : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
---------+---------+---------+---------+---------+---------+ 729
LVR01_0020_H07.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0095_G01.b : GC*AAAA*TTGACAACCAAA**TACAGA**AATTAAAA*TCGGAGGC*CTTGGCcagatg
LVRM1_0003_A01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0041_C01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0004_A07.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
KDN01_0019_E05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
KDN01_0097_C09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0187_E07.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0033_D08.b : GG*AAAACTTGAGAAGC*AAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0084_H11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0087_F01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0096_B09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0149_D01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0045_D10.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0106_B03.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0072_A04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0094_H11.b : GG*AAAACTTGACAAGCAGAC*TACATA**ATTTAGAC*TCGGATGT*CCTGGCTTAAAT
LVRM1_0103_A11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAAAT
LVRM1_0011_C06.b : GG*AAAACTTGAGAAGCAAAA*TACANA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0063_E09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0018_D09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0016_C04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0045_D08.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0011_F08.b : tcgagaccccgcgtcgcccagcccatacgcaaacaagcccgacccaccaccccctgccct
LVR01_0093_E07.b : GG*AAAACTTGAAAAACCAAA*TACAAA**CATTAAAA*Ttcggatgtctttggctcata
LVRM1_0184_G02.b : GG*AAAACTTGAGAAGCAA*A*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAAAT
LVRM1_0093_B03.b : GG*AAAACTTGAAGAACACAA*TACAGA**AATTAGAA*TCNGATGT*CTTGGCTCAGAT
LVRM1_0199_C05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0146_A05.b : GG*AAAACTTGAGAAGCACAA*TACAGA**AATTATAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0017_F02.b : GN*AAAACTTGNAGAAGCAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0019_D03.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0081_G09.b : GGAAAAACTTGAGAAGCAAAA*TACAGA**AATTAGAAATCGGATGT*CTTGGCTCAGAT
LVR01_0040_H07.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0081_H05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0021_G05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0022_A02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0084_E09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0018_C06.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0005_H01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0083_G01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0066_D02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0067_C11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0004_B02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0094_D01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0098_H04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0055_C03.b : ctttgtttaggcaagtacagcattcggcattccgagttttggctttgatggcaaacggcg
LVRM1_0127_B08.b : GG*AAAACTTTGAGAAGCAAA*TACCGG**AATTCGAA*TCGGATGT*CTTGGCTCCGAT
LVR01_0035_B09.b : GG*AAAACTTGAGAAGCAAAA*TACTAA**AATATAAA*TCGGATGT*CTTGGCTCAAAT
LVRM1_0185_G07.b : GG*AAAACTTGAGAAGCAAAA*TACGGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0079_E07.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0158_C09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0043_F11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0085_D05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0019_F09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0094_C10.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0066_E12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0078_D08.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0031_B11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0072_F09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0012_H08.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0009_A05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0061_F08.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0012_B05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0067_B07.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0003_A06.b : GG*AAAACTTGAGAGGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0060_G12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0168_B03.b : ttggcggtagtggcctcgggaactgcgacacacaaagcctagcccaagacaaaggagtac
LVR01_0081_E01.b : aaaaaatttttaaaaaaaaaaaaaaaaaaaaatttaaaaaccggaggtttcttgggcccc
LVRM1_0194_H12.b : agtaagctttttaaggacgtggcagccgcatctaatcttcacaagcgcattaacagacac
LVRM1_0062_D10.b : gattagtatccaggcacggagatcttgatgtttagtggcttcgttagtatcgcgtacggc
LVRM1_0084_G08.b : gatctgcgaaagtacagtgtgaaaatcagaaccgagagagctcggatccgagtgaaaccg
LVR01_0079_B01.b : aaaatttgaaaaacaaaatacaaaaattaaaaatcgaaagttcttggcctaaaatggaaa
LVRM1_0174_A09.b : GG*AACACTTGACAAGC*AAA*TACAG***AATTAGAA*TCGGATGT*CTTGGCTCAAAT
LVRM1_0110_A07.b : GT*AAAACTTTAGAAGCAAAA*TACACA**AATTTNAA*TCGGATGT*CTTGGCTCAAAT
LVRM1_0126_A03.b : GG*GAAGCTTGAGAAGCAAA**TACAGA**ATTTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0151_C01.b : GG*AGAACTTGAGAAGCAAAA*TACAAA**AATTANAA*TCCGATGT*CTTGGCTCAGAT
LVRM1_0202_G02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0194_F05.b : TG*GAAACTTGAGAAGCANAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0194_C12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0036_C02.b : GT*AAAACTTGAGAAGCCAAA*TACAGA**AATTAAAA*TCGGATGTCCTTGGCTCAAAT
LVRM1_0204_H03.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0038_A08.b : GG*ANAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0178_A08.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAAAT
LVRM1_0098_E04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAAAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0100_F06.b : GG*AAAACTTGAGAAGNCAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0105_E05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAAAT
LVRM1_0119_D08.b : GT*GAAACGTGAGA*GTGNAA*TACGNA**AATTATAA*TCTGATGT*CTTGGCTCANAT
LVRM1_0053_B09.b : NG*GAAACTTGAGAAGCNAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0092_D11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0169_H09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AAATAGAA*TCGGATGT*CTTGGCTCGGAT
LVRM1_0035_E05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0056_G01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0003_D01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0112_C12.b : GG*AAAACCTTGAGAGCAAGA*TACANA**AATTACAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0050_E12.b : GG*AAAACTTTGAGAAGCAAA*TACACA**AATTATAA*TCGGATGT*CTTGGCTCACAT
LVRM1_0051_E12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTATAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0208_B12.b : GG*GAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0191_F11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0103_B07.b : GG*GAAACTTGAGAAAGCAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0029_E04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0139_E03.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0153_B02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0116_D11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0108_F05.b : GG*AAAACT*GTGAAACAAAA*TACAGA**AATTANAA*TCCGATGT*CTTGTCTCACAT
LVRM1_0139_C01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0101_B11.b : GG*ANAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0029_F09.b : TGGAAAACTTGACAAACAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0140_E08.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0142_E11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0023_F03.b : GG*AAAACTTGAGAAAGCAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0006_H05.b : GG*NAAACTTGAGAAGCANAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAAAT
LVR01_0096_G08.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAAAA*TCCGATGT*CTTGGCTCAGAT
LVR01_0100_B08.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0065_C11.b : GG*AAAACTTGAAAAGCAAAA*TACAGA**AATTAGAA*TCGGATGTCCTTGGCTCAGAT
LVR01_0076_A06.b : GG*AAAACTTGAGAAGC*AAA*TACAGA**AATTAGA**TCGGATGT*CTTGGCTCAGAT
LVR01_0087_G11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0065_D03.b : GGAAAAACTTGAAAAGCAAAA*TACAGA**AATTAGAA*TCGGATGTCTTTGGCTCAAAT
LVR01_0034_C07.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0103_A12.b : GG*AAAACTTGATAAGCAAAA*TACAAA**AATTAAAA*TCGGATGT*CTTGGCTCATAT
LVR01_0055_D08.b : GG*AAAACTTGAGAAGCAAAA*TACAGAA*AATTAGAA*TCGGATGT*CTTGTCTCAGAT
LVR01_0046_F08.b : GG*AAAACTTGAGAAGCAAAAATACTTA**AATTATAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0097_A05.b : GGAAAAACTTGGGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAAAT
LVR01_0013_D09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAAAT
LVR01_0021_D09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0097_F04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0015_F07.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0013_A09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0084_A01.b : GG*AAAACTCGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0076_H04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0094_E04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0037_C02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0094_G07.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0030_B05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0091_A12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAAAT
LVR01_0082_A12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0033_G06.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0087_F02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0092_G02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGTTGT*CTTGGCTCAGAT
LVR01_0012_F10.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0038_H01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0087_H01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0071_F06.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0016_D09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0061_F07.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0078_H03.b : GA*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0095_C01.b : GG*GAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0087_F12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0082_F10.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0046_H09.b : GG*AAAACTTGACAAGCAAAA*TACATA**AATTACAA*TCTGATGT*CTTGGCTCACAT
LVR01_0085_H06.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0088_H10.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0062_H09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0102_H05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0029_H02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0021_C05.b : GG*GAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0102_F05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0017_E09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0100_G12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0026_G01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0045_F09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0077_D09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0048_C04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAC
LVR01_0106_G06.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0103_H02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0078_H05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0091_C08.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0092_B09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0003_B12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0089_G11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0105_C08.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0104_B09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0082_H03.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCNGATGT*CTTGGCTCAAAT
LVR01_0011_G06.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0048_G03.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0013_C04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0015_F12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0029_E12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0025_H03.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0042_F09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0008_D12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0022_C07.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0034_F02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0083_G12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0089_F11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0014_D02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0029_F04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0029_B03.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0102_E06.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0001_E05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0042_E08.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0085_C12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0094_B10.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0100_H10.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0105_E06.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0030_C01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0100_G04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0015_A08.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0017_G09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0033_A04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0090_H04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0090_A06.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0008_C04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0061_F01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0041_B05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0065_B03.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0083_G05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0099_D12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0101_D12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0054_G11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0004_C11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0065_B05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0012_D03.b : GG*AAAACTTGAGAAGCAAAA*TACAGG**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0098_D12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0057_C11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0063_E05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0056_A12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0052_B12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0050_D08.b : GG*AAAACTTGGGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0089_F06.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0012_D05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTCGGCTCAGAT
LVR01_0072_H02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0076_B07.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGGA*TCGGATGT*CTTGGCTCAGAT
LVR01_0066_H06.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0068_F02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0102_B05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0011_E12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0098_H07.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0012_A03.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0026_A11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0001_C02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0091_H11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0092_D12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0068_A01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0106_A03.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0017_A12.b : GG*AAAACTTGAGAAGCAAAA*TACAGAGGAATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0083_C09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0100_A07.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0003_B03.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0104_B07.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0021_C03.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0101_D05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0062_A06.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0056_E11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0004_H02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0068_B09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0001_F03.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0056_B11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0077_H03.b : GN*AAAACTTGAGAGGC*AAA*TACAAA**AATTAGA**TCGGATGT*CTTGGCTCAGAT
LVR01_0106_D12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0056_F02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0075_B05.b : GG*AAAGCTTGACAAGCCAAA*TACCG***AATTTCAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0073_A05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CCTGGCTCAGAT
LVRM1_0074_D03.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**ACTTAGAA*TCGGATGT*CTTGGCTCACAT
LVRM1_0019_E11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0106_F08.b : GG*AAAACTTGAAAAGCAAAA*TACAAA**AATTAAAATCCGGATGT*CTTGGCTCAGAT
LVR01_0017_H04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0008_A03.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0152_G12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0043_C02.b : GG*AAAACTTGAGAAGCAACA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0059_G08.b : tggtaagtttcctttcctcattccaagactggttctctacccagaaagcatccaggctat
LVRM1_0086_G08.b : cacgcggggggtggagatggatgctgatatacacaggccgggacgtacggggacggtcgg
LVRM1_0161_C11.b : aaaaccaaataccaaatttaaaccgatgtcttggcccaaagaatatggcctccccct
LVRM1_0129_B02.b : gttacgcaattttccaacctgacgtcggatgtttcggccgatagagaacatgccggaacc
LVRM1_0028_G07.b : GG*GAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0206_G03.b : GG*GAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0037_F03.b : GG*AAAACTTGAGAAGCTAAA*TACAGA**TATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0193_A08.b : GG*GAAACTTGAGAAACAAAA*TACAGA**AATTATAA*TCGGATGT*CTTGGCTCACAT
LVRM1_0198_G08.b : GG*AAAACTTGAGAAAGCAAA*TACAGA**AATTAAAA*TCGGATGT*CTGGNCTCAAAT
LVRM1_0100_E06.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0125_E06.b : GT*GAAACTTGAGTAACAAAA*TACAGA**AATTAGAATCCGGATGT*CTTGGCTCAAAT
LVRM1_0176_F12.b : GG*GAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0027_F12.b : GG*AAAACTTGAGAAGCACAA*TACAGA**CATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0124_C02.b : GG*AAAACTTGAGAAGCGAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAAAT
LVRM1_0159_F01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0174_G07.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0108_F11.b : GG*AAAACTTGAGAAGCAAA**TACAGA**AATTAGAA*TCCGATGT*CTTGGCTCAGAT
LVRM1_0103_A09.b : GG*NAAACTTGAGAAGCAAAA*TACAGA**AATTANAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0016_D03.b : GG*AAAACTTGAGAAGCAGA**TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCACAT
LVRM1_0154_D04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0157_F10.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0030_E04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0139_B03.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0145_C09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0077_F02.b : GA*AAAACTTGA*AAGCAAAA*TACAGA**AATTAAAA*TCGAATGT*CTTGGCTCAAAT
LVR01_0104_A09.b : GG*AAAACTTGAGAAGCAAAA*TACAAA**AATTTAAA*TCCGATGT*CTTGGCTCATAT
LVR01_0081_H02.b : GG*AAAACTTGAGAAGCAAAA*TACAAA**AATAAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0094_C06.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0013_C02.b : GG*AAAACTTGAGAAAGCAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0031_D05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAAAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0090_B04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0041_E01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0076_B09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTCGGCTCAAAT
LVR01_0081_F12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0066_G02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0054_F09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0042_D12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0026_H02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0045_G06.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0090_C08.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0099_D08.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0003_F09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**GATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0053_F05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0022_C11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0057_E02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0082_A04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0048_B05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0047_B07.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0090_C04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0029_H03.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0084_G10.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0004_D01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0063_D11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0101_C12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0009_G07.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAAATCGGATGT*CTTGGCTCAGAT
LVR01_0044_H04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0084_B12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0083_G02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0004_A10.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0054_H06.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0100_C10.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0100_H06.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0012_G12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0060_H07.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0103_E08.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0010_G11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0049_D06.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0104_F05.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0047_H02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0051_E01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0049_D04.b : GG*ANAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0063_B03.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0042_A03.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0051_E05.b : GG*AAAACTTGAGAAGCAAAA*TACGGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0105_B01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0021_F04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0043_E12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0077_E11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0022_A03.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0040_C01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0062_H06.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0083_G04.b : GG*AAAACTTGAGAGGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0066_G01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0037_E10.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0046_A09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0061_B06.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0044_A10.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0027_H01.b : GG*AA*ACTTGAGAAGCATCC*TACAGC**AGTTAGAA*TCGGATGT*CTTGGCTCAGAT
KDN01_0053_E04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
KDN01_0066_F07.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
PST01_0014_D11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
KDN01_0057_C08.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0100_D12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0054_B08.b : GG*NAAACTTGTGAAGCAAAA*TACAGA**AAT*ATAA*TCGGATGT*CCTGGCTCAGAT
LVRM1_0141_D03.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0004_E01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0081_C10.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0088_C10.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0090_E08.b : GG*ATAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0031_F09.b : GG*AAAACTTGAGAAGCAGAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAAAT
LVR01_0081_E08.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0102_D12.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0153_B09.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0010_B02.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0068_D08.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVRM1_0007_G11.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**TATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0049_C01.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0081_D04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
LVR01_0037_H04.b : GG*AAAACTTGAGAAGCAAAA*TACAGA**AATTAGAA*TCGGATGT*CTTGGCTCAGAT
20110601C-007023 : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
---------+---------+---------+---------+---------+---------+ 781
LVR01_0020_H07.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0095_G01.b : gaaaccggc
LVRM1_0003_A01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*T
LVR01_0041_C01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0004_A07.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
KDN01_0019_E05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
KDN01_0097_C09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0187_E07.b : *GGAATACTGCCCTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTG
LVRM1_0033_D08.b : *GGGATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0084_H11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0087_F01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGCGT*CT
LVR01_0096_B09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0149_D01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0045_D10.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0106_B03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0072_A04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0094_H11.b : *GGTATACTGGCGTACT*CCATGT*C*CGCCAC*TTGGAAT*ATTC*CTGT*GGTGA*CT
LVRM1_0103_A11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0011_C06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0063_E09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0018_D09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0016_C04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0045_D08.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0011_F08.b : gccacccaatatttgcccccccatagcctagtcccccccgcaccatgatccgacgagacc
LVR01_0093_E07.b : tggaatactgccgatactccatgatacccccacctgcaatattccctggaggtgtctggc
LVRM1_0184_G02.b : *GGAATACTGCCGTAAC*TCATGTAC*CGTCCC*TTGCGATATTCCgggggagtcggg
LVRM1_0093_B03.b : *GGGATACTGCCGTACT*CCCTGTAC*CGTCAC*TCGCAGT*AATC*CGGT*GGTG
LVRM1_0199_C05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGn
LVRM1_0146_A05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0017_F02.b : *GGGATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0019_D03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0081_G09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0040_H07.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0081_H05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0021_G05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0022_A02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0084_E09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0018_C06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0005_H01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0083_G01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0066_D02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0067_C11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0004_B02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0094_D01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0098_H04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0055_C03.b : ggttttcctcgttctcgtcatcgccattttcgctgcggcgtgctgggcaatgaactagag
LVRM1_0127_B08.b : *AGGAAACTGGCGTACT*CCtggtaccgcccttgcataaatctgtggggttcgcaaaaaa
LVR01_0035_B09.b : *GGAATACTGCCGTACT*CCATGGAC*CGTCCC*TTGCAATAATTC*Cctgtgggtgtct
LVRM1_0185_G07.b : *GGAATACTGCCGTACT*C*ATGTAA*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0079_E07.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCTAT*ATTC*CTGT*GGTGT*CT
LVRM1_0158_C09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC**TGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0043_F11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0085_D05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0019_F09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0094_C10.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0066_E12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0078_D08.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0031_B11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0072_F09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0012_H08.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0009_A05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0061_F08.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0012_B05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0067_B07.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0003_A06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0060_G12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0168_B03.b : gcccatacacacccggggcacgcacataggaggacggcgtaa
LVR01_0081_E01.b : aaaaggaaaaaaccccccccccccccccggggccccccccccccctcaaaaaatttcccg
LVRM1_0194_H12.b : accgttctgatcatcaccaacctccagacgatatcgctcaaccccgcgtgctttctctn
LVRM1_0062_D10.b : agccgccaccgtccacgcgtactggccgctctgttcgcgagtcctttgtcgagcatgtat
LVRM1_0084_G08.b : gaccgccagcgggatacgtgcccgttccataagccgctgcgggagctcgg
LVR01_0079_B01.b : acctgcccaaactcccatggacccgtccccttgcaaaaattccctggggggggccgggga
LVRM1_0174_A09.b : *GGAATACCCCCGTACcccatgaccgtcacttgcaacatcaggggtgcccggccaacatc
LVRM1_0110_A07.b : *GGAATAATGGCGTACT*CCAgttccggcacttgcaatatcctgtggtgtccggcaaaaa
LVRM1_0126_A03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCCttgcaatat
LVRM1_0151_C01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATcctgtggtgtctggc
LVRM1_0202_G02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGNCAT*ATTC*CTGT*GGTGT*CT
LVRM1_0194_F05.b : *GGAATACTGCCGTACT*CATGTTAC*CGTCAC*TTGCAAT*AATC*CTGT*GGTGT*CT
LVRM1_0194_C12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTTGCAT*ATTC*CTGT*GGTGT*CT
LVR01_0036_C02.b : GGGAATCCTGCCGTTCTCCCATGTAC*CGTCAC*TTGCAATATTTC*CTGT*GGTGT*Cc
LVRM1_0204_H03.b : *GGAATACTGCCGTACT*CAATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0038_A08.b : *GGAATACTGCCGTACT*CCCTGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGg
LVRM1_0178_A08.b : *GGAAATACTGCGTACT*CCATGTAC*CGTCAC*TTGCAAT*AT*C*CTGT*GGTGT*CT
LVRM1_0098_E04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0100_F06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0105_E05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0119_D08.b : *GGAAAACTGCCGTACT*CCCTGGAC*CGGCAC*TTGCAAT*AGTC*CTGT*Gtgtcttg
LVRM1_0053_B09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0092_D11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0169_H09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CG
LVRM1_0035_E05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGNCAT*ATTC*CTGT*GGTGT*CT
LVRM1_0056_G01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGGCAT*ATTC*CTGT*GGTGT*CT
LVRM1_0003_D01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCGAT*ATTC*CTGT*GGTGT*CT
LVRM1_0112_C12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCATT*AT*C*CCGT*GGTGT*CT
LVRM1_0050_E12.b : *GGAATACTGGCGTACT*CCATGTTA*CGTCAC*TTGGCAT*ATTC*CTGT*GGTGT*CT
LVRM1_0051_E12.b : *GGAATACTGCCGTACT*CCATGTTC*CGTCAC*TTTGCAA*ATTC*CTGT*GGTGT*CT
LVRM1_0208_B12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0191_F11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTTGCAT*ATTC*CTGT*GGTGT*CT
LVRM1_0103_B07.b : *GGGATACTGNCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0029_E04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0139_E03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0153_B02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0116_D11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCNAT*ATTC*CTGT*GGTGT*CT
LVRM1_0108_F05.b : *GGAATACTGACGTACT*CCATGTAC*CGGCAC*TTGCAAT*ATAC*CTGTTGGTGC*CT
LVRM1_0139_C01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0101_B11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGNCAT*ATTC*CTGT*GGTGT*CT
LVR01_0029_F09.b : GGAAATACTGCCGTACTCCCATGTACCCGTCTC*TTGCAATAATTC*CTGT*GGTGCCCT
LVRM1_0140_E08.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0142_E11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGNCAT*ATTC*CTGT*GGTGT*CT
LVRM1_0023_F03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAn
LVRM1_0006_H05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0096_G08.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0100_B08.b : *GGA*TACTGCCCTACT*CCATGTAA*CGTCAC*TTTGCAT*ATTC*CTGT*TGTGT*CT
LVR01_0065_C11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0076_A06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GNTGT*CT
LVR01_0087_G11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0065_D03.b : *GGAATACTGCCGTACT*CCATGTACCCTTCAC*TTTGCAT*ATTC*CTGT*GGTGT*CT
LVR01_0034_C07.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0103_A12.b : *GGAATACTGCCCTACTCCAATGTTC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0055_D08.b : *GGAATACTGCCGTACT*CCATTGTACCGTCCC*CTTGCAT*ATTC*CTGT*GGTGT*CT
LVR01_0046_F08.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0097_A05.b : *GGAATACTGCCGTACTCCCATGTAC*CGTCAC*TTGCAAT*ATTCCCTGT*GGTGT*CT
LVR01_0013_D09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCCC*TTGCAAT*ATTTCCTGTGGGTGT*CT
LVR01_0021_D09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0097_F04.b : *GGAATACTGCCGTACT*CCATGTACCCGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0015_F07.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0013_A09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0084_A01.b : *CGAATACTGCCGTACTCCCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0076_H04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCCAT*ATTC*CTGT*GGTGT*CT
LVR01_0094_E04.b : GGAAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0037_C02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0094_G07.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGG*CT
LVR01_0030_B05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0091_A12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAATATTTC*CTGT*GGTGTCCT
LVR01_0082_A12.b : *GGAATACTGCCGTACC*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0033_G06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTTGCAATATTC*CTGT*GGTGT*CT
LVR01_0087_F02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0092_G02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0012_F10.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0038_H01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0087_H01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0071_F06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0016_D09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0061_F07.b : *GGAATACTGCCGTACT*CCATGCAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0078_H03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTNGCAT*ATTC*CTGT*GGTGT*CT
LVR01_0095_C01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAATATTCC*CTGT*GGTGT*CT
LVR01_0087_F12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0082_F10.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0046_H09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*AGTGT*CT
LVR01_0085_H06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0088_H10.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0062_H09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0102_H05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0029_H02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0021_C05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0102_F05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0017_E09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0100_G12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0026_G01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0045_F09.b : GGAAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0077_D09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAATATTTC*CTGT*GGTGT*CT
LVR01_0048_C04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0106_G06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0103_H02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0078_H05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0091_C08.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0092_B09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0003_B12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0089_G11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0105_C08.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0104_B09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0082_H03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0011_G06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0048_G03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0013_C04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0015_F12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0029_E12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0025_H03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0042_F09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0008_D12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0022_C07.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0034_F02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0083_G12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0089_F11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0014_D02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0029_F04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0029_B03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0102_E06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0001_E05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0042_E08.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0085_C12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0094_B10.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0100_H10.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0105_E06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0030_C01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0100_G04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0015_A08.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0017_G09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0033_A04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0090_H04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0090_A06.b : *GGAATACTGCCGTACT*CCATGCAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0008_C04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0061_F01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0041_B05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0065_B03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0083_G05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0099_D12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0101_D12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0054_G11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0004_C11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0065_B05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0012_D03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0098_D12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0057_C11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0063_E05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0056_A12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0052_B12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0050_D08.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0089_F06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0012_D05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0072_H02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0076_B07.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0066_H06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0068_F02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0102_B05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0011_E12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0098_H07.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0012_A03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0026_A11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0001_C02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0091_H11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0092_D12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0068_A01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0106_A03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0017_A12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0083_C09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0100_A07.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0003_B03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0104_B07.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0021_C03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0101_D05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0062_A06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0056_E11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0004_H02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0068_B09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0001_F03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0056_B11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0077_H03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0106_D12.b : *GGAATACTGCCGCACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0056_F02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0075_B05.b : *GTAATACTGCCGCACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGC*GGTGT*CT
LVRM1_0073_A05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0074_D03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCCAT*ATTC*CTGC*GGTGT*CT
LVRM1_0019_E11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0106_F08.b : *GGAATACTGCCGTACTCCATTGTAC*CGTCAC*TTGGCAT*ATTC*CTGGTGGTGT*CG
LVR01_0017_H04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0008_A03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0152_G12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCNAT*ATTC*CTGT*GGTGT*CT
LVR01_0043_C02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0059_G08.b : ctctatcacgtctcatctgataaaaaaatctttttttttctatatttctttgctatttaa
LVRM1_0086_G08.b : gaacaagacggcagacgggggggtgggcccataatgtag
LVRM1_0161_C11.b :
LVRM1_0129_B02.b : atagtgcgctgtatgggtgtcccgatgggccccgggccattggtcggcaatttttgg
LVRM1_0028_G07.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAATn
LVRM1_0206_G03.b : *GGAATACTGCCGTACT*CCATGTAA*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0037_F03.b : *GGGATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGTn
LVRM1_0193_A08.b : *GGAATACTGCCGTACT*CCATGTCA*CGTCAC*TTGCGAT*ATTC*CTGT*GGTGT*CT
LVRM1_0198_G08.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC**TGT*GGTGT*CT
LVRM1_0100_E06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGNCAT*ATTC*CTGT*GGTGT*CT
LVRM1_0125_E06.b : *GGGATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCGAT*ATTC*CTGT*GGGTGTCT
LVRM1_0176_F12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGGCAT*ATTC*CTGT*GGTGT*CT
LVRM1_0027_F12.b : *GGGATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0124_C02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCCAT*ATTC*CTGT*GGTGT*CT
LVRM1_0159_F01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCNAT*ATTC*CCTG*TGTGT*CT
LVRM1_0174_G07.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGNCAT*ATTC*CTGT*GGTGT*CT
LVRM1_0108_F11.b : *GGAATATTGCCGTACT*CCATGTAC*CGTCAC*TTGGCAT*ATTT*CTGT*GGTGT*CG
LVRM1_0103_A09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0016_D03.b : *GGAATACTGCCGTACT*CCATGTAC*CGGCAC*TTGCGAT*ATTC*CTGG*GGGGG*CG
LVRM1_0154_D04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0157_F10.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0030_E04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0139_B03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0145_C09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGNCAT*ATTC*CTGT*GGTGT*CT
LVR01_0077_F02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CC
LVR01_0104_A09.b : *GGAATACTGCCGAACT*CCATGTAC*CGTCACTTTGCAGATATTC*CTGT*GGTGT*CT
LVR01_0081_H02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCCC*TTGCAAT*ATTC*TTGT*GGTGT*CT
LVR01_0094_C06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0013_C02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0031_D05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0090_B04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0041_E01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0076_B09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0081_F12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0066_G02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0054_F09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTTCCTGT*GGTGT*CT
LVR01_0042_D12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0026_H02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0045_G06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0090_C08.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0099_D08.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0003_F09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0053_F05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0022_C11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0057_E02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0082_A04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0048_B05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0047_B07.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0090_C04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0029_H03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0084_G10.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0004_D01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0063_D11.b : *GGAATACTGCCGTACTCCCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGTCTG
LVR01_0101_C12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0009_G07.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0044_H04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0084_B12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0083_G02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0004_A10.b : *GGAATACTGCCGTACT*CCATGTAC*CGGCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0054_H06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0100_C10.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0100_H06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0012_G12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0060_H07.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0103_E08.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0010_G11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0049_D06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0104_F05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0047_H02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0051_E01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0049_D04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0063_B03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0042_A03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0051_E05.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CN
LVR01_0105_B01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0021_F04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0043_E12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0077_E11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0022_A03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0040_C01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0062_H06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0083_G04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0066_G01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0037_E10.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0046_A09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0061_B06.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0044_A10.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0027_H01.b : *GAAATACTGACTGTAT*CCATGTA
KDN01_0053_E04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*ATGT*GGTGT*CT
KDN01_0066_F07.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
PST01_0014_D11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
KDN01_0057_C08.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*ATGT*GGTGT*CT
LVR01_0100_D12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0054_B08.b : *GGA*TACTGCCGTACT*CCATGTAC*CGTCAC*TCGCCAT*ATTC**TGG*GGTGT*CT
LVRM1_0141_D03.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGNCAT*ATTC*CTGT*GGTGT*CT
LVR01_0004_E01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0081_C10.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAC*ATTC*CTGT*GGTGT*CT
LVR01_0088_C10.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0090_E08.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0031_F09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*AGTC*CTGT*GGTGT*CT
LVR01_0081_E08.b : *GGAATACTGCCGTACC*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0102_D12.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0153_B09.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0010_B02.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0068_D08.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVRM1_0007_G11.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0049_C01.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0081_D04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
LVR01_0037_H04.b : *GGAATACTGCCGTACT*CCATGTAC*CGTCAC*TTGCAAT*ATTC*CTGT*GGTGT*CT
20110601C-007023 : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
---------+---------+---------+---------+---------+---------+ 828
LVR01_0020_H07.b : GGGCAA******GAAT*GTGAGG*AAATTATC*AAGAATGG*AGGCGAAAC*AT*CTGA*
LVRM1_0095_G01.b :
LVRM1_0003_A01.b :
LVR01_0041_C01.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0004_A07.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AC*CTGA*
KDN01_0019_E05.b : GGGCAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
KDN01_0097_C09.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVRM1_0187_E07.b :
LVRM1_0033_D08.b : GGCAAA******GAAT*GTGAGG*AAATTATCAAGA
LVR01_0084_H11.b : GGCAAA******GAAT*GTGAGG*AAAATATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0087_F01.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0096_B09.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVRM1_0149_D01.b : G
LVR01_0045_D10.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0106_B03.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0072_A04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVRM1_0094_H11.b : GGCAAAAcatgtaacgaaactat
LVRM1_0103_A11.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCG
LVRM1_0011_C06.b : GGCAAA******GA*T*GTGAAG*AAATTATC*AGGATTGG*AGcg
LVR01_0063_E09.b : GGGCAA******AGAATGTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0018_D09.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0016_C04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0045_D08.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVRM1_0011_F08.b : acacacct
LVR01_0093_E07.b : aaagaaattgtgaagaaaaattatcatggattggaggggaaaaaatctgaaaacgaatcc
LVRM1_0184_G02.b :
LVRM1_0093_B03.b :
LVRM1_0199_C05.b :
LVRM1_0146_A05.b : GGCAAA******GAAT*GTGAGGGAAATTTcttgaatggacgcg
LVRM1_0017_F02.b : GGCAAA******GAAT*GTGAGG*GAATTATC*AGGAATGG
LVR01_0019_D03.b : GGCAAA******GAAT*GTGAGG*AAAATTATCAGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0081_G09.b : GGCAAA******GACT*GTGAAG*AAATTATC*AGGAATGG*AAGCCAAAC*AT*CTGA*
LVR01_0040_H07.b : GGGCAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0081_H05.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0021_G05.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0022_A02.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0084_E09.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0018_C06.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0005_H01.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0083_G01.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0066_D02.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0067_C11.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0004_B02.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0094_D01.b : GGCAAA******GAAT*GCGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0098_H04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVRM1_0055_C03.b : gaat
LVRM1_0127_B08.b : tgaaagg
LVR01_0035_B09.b : ggctaaaaatgctaagaaattatcaggatagtgagccaaaactcctaaatgtatctcctt
LVRM1_0185_G07.b : GGCGAA******GATg
LVRM1_0079_E07.b : GGCAAA******GAAT*GTGAAG*GAATTATC*AGGA
LVRM1_0158_C09.b : GGCAAA******GAAT*GTGGAG*GAATTATC*ACGAt
LVR01_0043_F11.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCCAAAC*ATCCTGA*
LVR01_0085_D05.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0019_F09.b : GGCNAA******GAAT*GTGAGGAAAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0094_C10.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0066_E12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0078_D08.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0031_B11.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0072_F09.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0012_H08.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0009_A05.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0061_F08.b : GGCAAA******GAAT*GTGAGGAAATTAATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0012_B05.b : GGCAAA******GAAT*GTGAGG*AAATCATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0067_B07.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0003_A06.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0060_G12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVRM1_0168_B03.b :
LVR01_0081_E01.b : ggggggggggggggggggaaaaaaatgtgggggagaaaatttttttttgggggagggggg
LVRM1_0194_H12.b :
LVRM1_0062_D10.b : tgttgtcctc
LVRM1_0084_G08.b :
LVR01_0079_B01.b : aaaaaagtggggggaaaattattcagggaaagggaggggcaaaaactttctaaaaattgt
LVRM1_0174_A09.b : gcgagcat
LVRM1_0110_A07.b : agtgaggaaattttccgaatggaagggaaacactcga
LVRM1_0126_A03.b :
LVRM1_0151_C01.b :
LVRM1_0202_G02.b : Gc
LVRM1_0194_F05.b : GGG
LVRM1_0194_C12.b : GGCAA
LVR01_0036_C02.b : tggccaaaaactggtgaggaaaatttattcattaatggagggccaaacatctgaatatta
LVRM1_0204_H03.b : GGCAAAA
LVRM1_0038_A08.b :
LVRM1_0178_A08.b :
LVRM1_0098_E04.b :
LVRM1_0100_F06.b : G
LVRM1_0105_E05.b : GGC
LVRM1_0119_D08.b : gcaagtaatgtgaggaaatttctggaatggaggcta
LVRM1_0053_B09.b : GGGCAAAaagtgan
LVRM1_0092_D11.b : GGCAAA******GAAT*GTGAGG*AAATTATC
LVRM1_0169_H09.b : GGCAAA******GATGTG
LVRM1_0035_E05.b : GGGCAA******GAAT*G
LVRM1_0056_G01.b : GGCAAA******GAAT*GT
LVRM1_0003_D01.b : GGCAAA******GAAT*GT
LVRM1_0112_C12.b : GGCAAA******TAAT*GTttagaat
LVRM1_0050_E12.b : GGCAAA******AAAA*GTG
LVRM1_0051_E12.b : GGCCAA******GAAT*GTGAG
LVRM1_0208_B12.b : GGCAAA******GGATGTNGAGG**AATTATC*ACGAA
LVRM1_0191_F11.b : GGGNCA******AGAT*GTGANGAAAT
LVRM1_0103_B07.b : GGCAA*******GAAT*GTGAGGAAttatc
LVRM1_0029_E04.b : GGCAAA******GA*T*GTGAGGAAA
LVRM1_0139_E03.b : GGCAAA******GAAT*GTGAGGAAAT
LVRM1_0153_B02.b : GCCAAA******GAAT*GTGATGGAAT
LVRM1_0116_D11.b : GGCAAA******GAAT*GTGANG*AAAATATC*AGG
LVRM1_0108_F05.b : GGCCAA******GAAT*GTGAGG*AAATTTTC*AGGAgtgtgag
LVRM1_0139_C01.b : GGCAAA******GAAT*GTGAGG*AATTNATCAGGAAT
LVRM1_0101_B11.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*GAGCGAAACtc
LVR01_0029_F09.b : GGCAAA******GAATTGTGAGG*AAATTATC*AGGgaatggaggcaaaaaatctaaaaa
LVRM1_0140_E08.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTG
LVRM1_0142_E11.b : GGCAA*******GAAT*GTGAGG*GAATTATC*AGGAATGG*AGGCGAAAC*AT*CTG
LVRM1_0023_F03.b :
LVRM1_0006_H05.b : GGCAAA******GACT*GTGAGG*AAATTATC*AGGAATGG*ANGCGAAAC*AT*CTCG*
LVR01_0096_G08.b : GGGCAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CGGA*
LVR01_0100_B08.b : GGAAAA******AATG*GTGAGG*AAATTATC*AGGAATGG*AGGCCAAACctcttgaaa
LVR01_0065_C11.b : GGCAAA******AAAT*GTGAGG*AAATTATC*AGGAATGGAAGGCGAAAA*AT*CTGA*
LVR01_0076_A06.b : GGCAAA******GAAT*GTGAAG*AAATTATC*AAGAATGA*AGGCGAAAC*AT*CTGA*
LVR01_0087_G11.b : GGAAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCCAAAC*AT*CTGAA
LVR01_0065_D03.b : GGCAAA******AAAATGTGAGGAAAATTATCCAGGAATGG*AGGCGAAAC*TT*CTGA*
LVR01_0034_C07.b : GGGCAA******AAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0103_A12.b : GGCAAA******AAAT*GTGTAG*AAATTATCAGGGATTGG*AGGCCAACC*AT*CTTAA
LVR01_0055_D08.b : GGCAAA******GAAT*GTGAGG*GAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0046_F08.b : GGCCAA******GAAT*GTGAGGAAAATTATC*AGGCATGG*AGGCGAAACCAT*CTGA*
LVR01_0097_A05.b : GGCAAAG*****AAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0013_D09.b : GGCAAA******AAAT*GGGGAGAAATTAATT*AGGAATGGGAGGCGAAAC*AT*CGGA*
LVR01_0021_D09.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGAA
LVR01_0097_F04.b : GGGAAA******GAAT*GTGAGGGAAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0015_F07.b : GGCAAA******GAAT*GTGAGGAAAATTATC*AGGATTGG*AGGCGAAAC*AT*CTGA*
LVR01_0013_A09.b : GGCAAA******GAAT*GTGAGG*AAATTATCAGGAAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0084_A01.b : GGCAAA******GAATGGTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0076_H04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGA*AGGCAAAAC*AT*CTGA*
LVR01_0094_E04.b : GGCAAA******GAAT*GTGAGGAAATTTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0037_C02.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0094_G07.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AAGAATGG*AAGCGAAAC*AT*CTGA*
LVR01_0030_B05.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0091_A12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0082_A12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0033_G06.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0087_F02.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0092_G02.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0012_F10.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0038_H01.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0087_H01.b : GGCAAA******GAAT*GTGAGGGAAATTTATCAGGAATGGAGGGCGAAAC*AT*CTGAA
LVR01_0071_F06.b : GGCAAAGTTTCAGAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0016_D09.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0061_F07.b : GGCAAA******GAAT*GTGAGG*AAAATATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0078_H03.b : GGGCAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0095_C01.b : GGGCAA******GAAT*GTGAGGAAAATTATC*AGGAATGG*AGGCGAAAACATCCTGA*
LVR01_0087_F12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0082_F10.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0046_H09.b : GGCAAA******GAAT*GTGAGG*TAATTATC*ACGAATGT*AGGCTAAAC*AT*CTGA*
LVR01_0085_H06.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0088_H10.b : GGCNAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0062_H09.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0102_H05.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0029_H02.b : GGCAAA******GAAT*GTAAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGAA
LVR01_0021_C05.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0102_F05.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0017_E09.b : GGNCAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0100_G12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0026_G01.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGT*
LVR01_0045_F09.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AAGAATGT*AGGCGAAAC*AT*CTGA*
LVR01_0077_D09.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0048_C04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0106_G06.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0103_H02.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0078_H05.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0091_C08.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0092_B09.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0003_B12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0089_G11.b : GGCAAA******GAT**GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0105_C08.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0104_B09.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0082_H03.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCCAAAC*AT*CTGA*
LVR01_0011_G06.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0048_G03.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0013_C04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0015_F12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0029_E12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0025_H03.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0042_F09.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0008_D12.b : GGCNAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0022_C07.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0034_F02.b : GGCAAA******GAAT*GTGAGGAAAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0083_G12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0089_F11.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0014_D02.b : GGCAAAG*****AAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0029_F04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0029_B03.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0102_E06.b : GGCAAA******GAAATGTGAGGGAAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0001_E05.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0042_E08.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0085_C12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0094_B10.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0100_H10.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0105_E06.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0030_C01.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0100_G04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0015_A08.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0017_G09.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0033_A04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0090_H04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0090_A06.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0008_C04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*ANGCGAAAC*AT*CTGA*
LVR01_0061_F01.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0041_B05.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0065_B03.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0083_G05.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0099_D12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0101_D12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0054_G11.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0004_C11.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0065_B05.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0012_D03.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGN*
LVR01_0098_D12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0057_C11.b : GGCATA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0063_E05.b : GGCAAA******GAAT*GTGAGG*GAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0056_A12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0052_B12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0050_D08.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0089_F06.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0012_D05.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0072_H02.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0076_B07.b : GGCAAA******GAAT*GTAAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0066_H06.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0068_F02.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0102_B05.b : GGCAAA******GAAT*GTGAGG*AAATTATCAGGAAATGG*AGGCGAAAACAT*CTGA*
LVR01_0011_E12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0098_H07.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0012_A03.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0026_A11.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0001_C02.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0091_H11.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0092_D12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0068_A01.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0106_A03.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0017_A12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0083_C09.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0100_A07.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0003_B03.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0104_B07.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0021_C03.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0101_D05.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0062_A06.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0056_E11.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0004_H02.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0068_B09.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0001_F03.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0056_B11.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0077_H03.b : GGCAAA******AA****TGTGAGGAAATATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0106_D12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0056_F02.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVRM1_0075_B05.b : GGCAAA******GAc
LVRM1_0073_A05.b : GGCACA******GAtg
LVRM1_0074_D03.b : GGCAAACAT***GT
LVRM1_0019_E11.b : GGGCAA******GAAATGTGAGGAAttatcaggaatggnaggcgaacatctg
LVR01_0106_F08.b : GGCAAA******AAAT*GTGAGG*AAATTATC*TAGGATGG*AGGCGAAAC*AT*CTGA*
LVR01_0017_H04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0008_A03.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVRM1_0152_G12.b : GGCNAA******GAAT*GTGAGG*AAATTATC*AAGGATGG*AGGCGAAACtcn
LVR01_0043_C02.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0059_G08.b : ttttaacgtaaaccaaaaatttttattttatatagttatccatatattttctaaccctac
LVRM1_0086_G08.b :
LVRM1_0161_C11.b :
LVRM1_0129_B02.b :
LVRM1_0028_G07.b :
LVRM1_0206_G03.b : GGCAA
LVRM1_0037_F03.b :
LVRM1_0193_A08.b : GGCAAc
LVRM1_0198_G08.b : GGCAAA******AAn
LVRM1_0100_E06.b : GGCAA
LVRM1_0125_E06.b : GGCAAAagag
LVRM1_0176_F12.b : GGCAAA******GAAT*GTGAGGAAATn
LVRM1_0027_F12.b : GGCAAA******GA*T*GTGACGAAAt
LVRM1_0124_C02.b : GGCAAA******GAAgtga
LVRM1_0159_F01.b : GGGCAA******GAtgtgangnaaatatc
LVRM1_0174_G07.b : GGCAAA******GAAT*GTG
LVRM1_0108_F11.b : GGCAAA*******AAT*GTGAaaaan
LVRM1_0103_A09.b : GGCAAA******GAAT*GTGAGn
LVRM1_0016_D03.b : GGCAAA******GA*T*GTGAGGAAAtttacacgaa
LVRM1_0154_D04.b : GGCNAA******GAAT*GTGAGGAAATa
LVRM1_0157_F10.b : GCC*AA******GAAT*GTGAGGAAATatcaggaatgcaaggcgaacatc
LVRM1_0030_E04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*A
LVRM1_0139_B03.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAAg
LVRM1_0145_C09.b : GGGCAA******GAAT*GTGAGGAAATTTATC*AGAAATGG*AGcgaa
LVR01_0077_F02.b : GGCAAA******GAAT*GTGAGGAAATTAATC*AGGAATGG*AGGCaaacttccgaattg
LVR01_0104_A09.b : GGCAAA******AAAT*GTAACG*AAATTATC*GCGAATGG*ACGCCAAGA*AT*CTGA*
LVR01_0081_H02.b : GGCAAA******AAAT*GTGAGG*AAATTATC*AGGAAATGAAGGCGAAAC*AT*CTAA*
LVR01_0094_C06.b : GGGCAA******AGAATGTGAAG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0013_C02.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0031_D05.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGAA
LVR01_0090_B04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0041_E01.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGGCAACC*AT*CTGA*
LVR01_0076_B09.b : GGCAAA******AAAT*GTGAGG*AAATTATC*AGGAATGG*AAGCGAAAC*AT*CTGA*
LVR01_0081_F12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0066_G02.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0054_F09.b : GGGCAAA*****GAAT*GTGAGG*AAATTATC*AGGAATGG*GAGGGAAAC*AT*CTGA*
LVR01_0042_D12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0026_H02.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0045_G06.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0090_C08.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0099_D08.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0003_F09.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0053_F05.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0022_C11.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0057_E02.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0082_A04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0048_B05.b : GGCAAA******GAAT*GTGAGGAAATTAATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0047_B07.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGG**TAAC*AT*CTGA*
LVR01_0090_C04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0029_H03.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0084_G10.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0004_D01.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0063_D11.b : GGCAAAG*****AAAT*GTGAGG*AAATTATCAGGTAATGGGAGGCGAAAC*ATCCTGA*
LVR01_0101_C12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0009_G07.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0044_H04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0084_B12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0083_G02.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0004_A10.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0054_H06.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0100_C10.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGGATGG*AGGCGAAAC*AT*CTGA*
LVR01_0100_H06.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0012_G12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*GGGCGAAAC*AT*CTGA*
LVR01_0060_H07.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0103_E08.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0010_G11.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0049_D06.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0104_F05.b : GGCNAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0047_H02.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0051_E01.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGGATGG*AGGCGAAAC*AT*CTGA*
LVR01_0049_D04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*GGGCGAAAC*AT*CTGA*
LVR01_0063_B03.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0042_A03.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0051_E05.b : TGGCAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0105_B01.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0021_F04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCAAAAC*AT*CTGA*
LVR01_0043_E12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0077_E11.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0022_A03.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0040_C01.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0062_H06.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*TTGA*
LVR01_0083_G04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0066_G01.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0037_E10.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ACGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0046_A09.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0061_B06.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0044_A10.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVRM1_0027_H01.b :
KDN01_0053_E04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
KDN01_0066_F07.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
PST01_0014_D11.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
KDN01_0057_C08.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0100_D12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVRM1_0054_B08.b : GGCAAA******GAA**GTGAGG*AAATtac
LVRM1_0141_D03.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGA
LVR01_0004_E01.b : GGCAAA******GAAT*GTGAGG*AAATTATC*ANGAATGG*AGGCGNAAC*AT*CTGA*
LVR01_0081_C10.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0088_C10.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVRM1_0090_E08.b : GGCn
LVR01_0031_F09.b : GGCAAA******AAAT*GTGAAG*AAATTATC*AGGAAAGG*GGGCGAAAC*AT*CTGA*
LVR01_0081_E08.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0102_D12.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVRM1_0153_B09.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVRM1_0010_B02.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0068_D08.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVRM1_0007_G11.b : GGNCAA******GATT*GTGAGG*AAATTATC*ACGAATGG*AGGCGAGAC*AT*CTGA*
LVR01_0049_C01.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0081_D04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
LVR01_0037_H04.b : GGCAAA******GAAT*GTGAGG*AAATTATC*AGGAATGG*AGGCGAAAC*AT*CTGA*
20110601C-007023 : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
---------+---------+---------+---------+---------+---------+ 881
LVR01_0020_H07.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCCAACCCTATAAAG*TGTACTG*TG
LVRM1_0095_G01.b :
LVRM1_0003_A01.b :
LVR01_0041_C01.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0004_A07.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
KDN01_0019_E05.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCAA**TCGAACCCTATAGAG*TGTACTG*TG
KDN01_0097_C09.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVRM1_0187_E07.b :
LVRM1_0033_D08.b :
LVR01_0084_H11.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAAACCTATAGAG*TGTACTG*TG
LVR01_0087_F01.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0096_B09.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVRM1_0149_D01.b :
LVR01_0045_D10.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0106_B03.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0072_A04.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVRM1_0094_H11.b :
LVRM1_0103_A11.b :
LVRM1_0011_C06.b :
LVR01_0063_E09.b : AATGTATTCTCATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0018_D09.b : AATGTATCTC*ATTCACC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0016_C04.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0045_D08.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVRM1_0011_F08.b :
LVR01_0093_E07.b : ctatctagtctagtgattctcattctactccaatataagggtgcaaagggaatatggaaa
LVRM1_0184_G02.b :
LVRM1_0093_B03.b :
LVRM1_0199_C05.b :
LVRM1_0146_A05.b :
LVRM1_0017_F02.b :
LVR01_0019_D03.b : AATGTATCCTCATTCAGC*CTAGTG*ATTTCCATCCAAACCCTATAGAG*TGTACTG*TG
LVR01_0081_G09.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCCAACCCCTATAAA*TGAACTG*TG
LVR01_0040_H07.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAAAG*TGTACTG*TG
LVR01_0081_H05.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0021_G05.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0022_A02.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0084_E09.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0018_C06.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTTCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0005_H01.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0083_G01.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0066_D02.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0067_C11.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0004_B02.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0094_D01.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0098_H04.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAAACCTATAGAG*TGTACTG*TG
LVRM1_0055_C03.b :
LVRM1_0127_B08.b :
LVR01_0035_B09.b : ccagctagtgtattccttcaaatccaacataactgcactgtgaatattaaaactacataa
LVRM1_0185_G07.b :
LVRM1_0079_E07.b :
LVRM1_0158_C09.b :
LVR01_0043_F11.b : AATGTATCTC*ATTCCGC*CTAGTG*ATTCCCATTCGAACCCTATAGAG*TGTACTG*TG
LVR01_0085_D05.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0019_F09.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTTCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0094_C10.b : AATGTATCTC*ATTCAGC*CTAGTG*ATCCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0066_E12.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0078_D08.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0031_B11.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0072_F09.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAAAG*TGTACTG*TG
LVR01_0012_H08.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0009_A05.b : AATGTATCCC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0061_F08.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAAAG*TGTACTG*TG
LVR01_0012_B05.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0067_B07.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0003_A06.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0060_G12.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVRM1_0168_B03.b :
LVR01_0081_E01.b : gggggggaaaacaccccccctaaaaaagtttttttcttcctttttccccccccccccctg
LVRM1_0194_H12.b :
LVRM1_0062_D10.b :
LVRM1_0084_G08.b :
LVR01_0079_B01.b : ttcccctttttccccccaatggaatttcccttcccaacccccaaaaaaaatgtttttttt
LVRM1_0174_A09.b :
LVRM1_0110_A07.b :
LVRM1_0126_A03.b :
LVRM1_0151_C01.b :
LVRM1_0202_G02.b :
LVRM1_0194_F05.b :
LVRM1_0194_C12.b :
LVR01_0036_C02.b : tcctcattttcacctaagtgattcccttcgaaccccctttatagtgcctcgcgttcatga
LVRM1_0204_H03.b :
LVRM1_0038_A08.b :
LVRM1_0178_A08.b :
LVRM1_0098_E04.b :
LVRM1_0100_F06.b :
LVRM1_0105_E05.b :
LVRM1_0119_D08.b :
LVRM1_0053_B09.b :
LVRM1_0092_D11.b :
LVRM1_0169_H09.b :
LVRM1_0035_E05.b :
LVRM1_0056_G01.b :
LVRM1_0003_D01.b :
LVRM1_0112_C12.b :
LVRM1_0050_E12.b :
LVRM1_0051_E12.b :
LVRM1_0208_B12.b :
LVRM1_0191_F11.b :
LVRM1_0103_B07.b :
LVRM1_0029_E04.b :
LVRM1_0139_E03.b :
LVRM1_0153_B02.b :
LVRM1_0116_D11.b :
LVRM1_0108_F05.b :
LVRM1_0139_C01.b :
LVRM1_0101_B11.b :
LVR01_0029_F09.b : tgtttctcattcaacccaagtgaaatccatccaaacccctgaaagggaactgtgaatatg
LVRM1_0140_E08.b :
LVRM1_0142_E11.b :
LVRM1_0023_F03.b :
LVRM1_0006_H05.b : AATGTATTTCATTCgcctagtgatt
LVR01_0096_G08.b : AAatgatcctccattcacccaatgaattccttcaaaccctataaagtgtactggtgattg
LVR01_0100_B08.b : agttttttttttcgcccattgaattccttccaacccttaaaaattttactggggatttta
LVR01_0065_C11.b : AATGTATCTC*ATTCACC*CTAatggatccattcaacccctatagagtggtactgtgata
LVR01_0076_A06.b : ATTGTATCTC*ATTCCACCCTAGTG*ATCCAA**TCGAAaccctataaagtgtactgggg
LVR01_0087_G11.b : AATGTATCTC*ATTCCGC*CTAGTG*ATTCCC**TCCAAACCcttataaaatgtactgtg
LVR01_0065_D03.b : AATGTATtctcattcaccctaaatgatttccatcaaacccaataaatggactgttaaaat
LVR01_0034_C07.b : AATGTATCTC*ATTCACC*CTAGTG*AATTCAT*CGAAACCCTATAGAagtgtactgtgg
LVR01_0103_A12.b : AATGTTCCTC*TTTCAGC*CTACTG*ATTCCA**TCGAACCCTATAaaattgacggtgat
LVR01_0055_D08.b : AATGTATCTC*ATTCAGC*CAAGTG*ATTCCT**TCAAACCCTAAAGAG*TGgtactggc
LVR01_0046_F08.b : AATGTATCTCATTCCCCC*CTATTG*ATTCCA**TCCAACCCTATAGAGcggaactgtgg
LVR01_0097_A05.b : AATGTATCTC*ATTCACCCTTAGTG*ATTCCAT*CGAAACCCTATAGAG*TGTACTtggg
LVR01_0013_D09.b : AATGTATCCTCATTTCAC*CTAATG*ATTCCA**TCGAACCCTATAAAG*TGTACTG*TG
LVR01_0021_D09.b : AATGTATCTC*ATTCAGC*CTAATTGATTCCAT*CGAACCCCTATAAAG*TGTACTG*TG
LVR01_0097_F04.b : AATGGATCTC*ATTCAGC*CCAGTG*ATTCCC**TCGAACCCTATAAAG*TGTACTGTGA
LVR01_0015_F07.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0013_A09.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAAAG*TGTACTG*TG
LVR01_0084_A01.b : AATGTATCTC*ATTCAGC*CTATTG*ATTCCA**TCGAACCCCTATAAG*TGTACTG*GT
LVR01_0076_H04.b : AATGTATCTC*ATTCAGC*CTATTG*ATCCCA**TCGAACCCTAATAAG*TGTACTG*TA
LVR01_0094_E04.b : AATGTATCTCATTTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*GG
LVR01_0037_C02.b : AATGTATCTC*ATTCAGC*CTATTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0094_G07.b : AATGTATCTCCATTCAGC*CTAATG*ATTCCA**TCAAACCCTATAAAG*GGAACTG*TG
LVR01_0030_B05.b : AATGTATCTC*ATTCAGC*CTAGTG*GATCCA**TCGAACCCTATAGAA*TGTACTG*TG
LVR01_0091_A12.b : AATGTATCTC*ATTCAGC*CTAGTGATTTCCT**TCAAACCCTATAAAT*TGTACTG*TG
LVR01_0082_A12.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0033_G06.b : AATGTATCTC*ATTCCGC*CTATTG*ATTC*AT*CCAACCCCAATAAAG*TGTACTG*TG
LVR01_0087_F02.b : AATGTATCTC*ATTCACC*CTAGTG*ATTCCA**TCGAAACCTATAGAG*TGTACTG*TG
LVR01_0092_G02.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0012_F10.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0038_H01.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGGACCCTATAGAG*TGTACTG*TG
LVR01_0087_H01.b : AATGTATCTT*ATTCACC*CTAGTG*ATTCCCTTCAAACCCCTATAAAG*TGTACTG*TG
LVR01_0071_F06.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0016_D09.b : AATGTATCTC*ATTCAAC*CCAGTG*ATTCC***TCCAACCCTATAGAG*TGTACTG*TG
LVR01_0061_F07.b : AATGTATCTC*ATTCAGC*CTAGTG*ATCCCA**TCGAACCCTATAAAG*TGTACTG*TG
LVR01_0078_H03.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0095_C01.b : AATGGATCTC*ATTCAGC*CTAGTGGATTCCA**TCGAACCCTATAAAGGTGTACTG*GT
LVR01_0087_F12.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0082_F10.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0046_H09.b : AATGTATCTC*ATTCAGC*CTATTG*ATTCCA**TCGAACCCGATACAG*TGTACTG*TG
LVR01_0085_H06.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0088_H10.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0062_H09.b : AATGTATCTC*ATTCAGC*CTATTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0102_H05.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0029_H02.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0021_C05.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0102_F05.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0017_E09.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0100_G12.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0026_G01.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0045_F09.b : AATGTATCTC*ATTCCGC*CTAGTG*ATTCCC**TCGAACCCCTATAAG*TGTACTG*TG
LVR01_0077_D09.b : AATGTATCTC*ATTCAGC*CTAATG*ATTCCA**TCGAAACCTATAGAT*TGTACTG*TG
LVR01_0048_C04.b : AATGTATCTC*ATTTCAC*CTAGTG*ATTTCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0106_G06.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCCAACCCTATAGAG*TGTACTG*TG
LVR01_0103_H02.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0078_H05.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0091_C08.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0092_B09.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0003_B12.b : AATGTATCTC*ATTCAGC*CTAGTG*ATTCCA**TCGAACCCTATAGAG*TGTACTG*TG
LVR01_0089_G11.b : AATGTAT