[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-007088

Length: 1,641

Sequence [FASTA format sequence]
GGCGGGGCCC GCCGGGACGG GGCGGGGTCG GTGGTGTTTC CGTTGCTTGG AGCCGACAGA
AAGTAGCTGC TTGGAGCGTT CTCCGCCTGC ATCCCAGCCA GTTCCGCGCG CCGCCGCCCC
GCGACCCGCA GCTCTCCCGG AGGTTGGGGT CTGGTCCTGC ATCAGTCACC TTTTCCTGAC
CTGGGCAGTC GCTATGGCAC AGGTTCTCAG AGGCACTGTG ACTGACTTCC CTGGATTTGA
TGAGCGGGCT GATGCAGAAA CTCTTCGGAA GGCCATGAAA GGCCTGGGCA CTGACGAGGA
GAGCATCCTG ACTCTGTTGA CCTCCCGCAG TAATGCTCAG CGCCAGGAGA TCGCTGTGGC
TTTTAAAACT CTCTTTGGCA GGGACCTTCT GGATGACCTG AAATCAGAGC TGACTGGAAA
ATTTGAAAAA TTAATCGTGG CTTTGATGAA ACCTTCTCGG CTGTACGATG CCTATGAACT
GAAGCATGCT CTTAAGGGAG CTGGGACAGA TGAGAAAATC CTGACAGAAA TTATTGCTTC
AAGGACACCT GAAGAATTAA GAGCCATAAA ACAAGTTTAT GAAGAAGAAT ATGGCTCAAG
CCTGGAAGAT GATGTGGTGG GAGATACATC AGGGTACTAC CAGAGGATGC TGGTGGTCCT
CCTTCAGGCT AATAGAGATC CTGATGGTAG AATTGATGAA GCACAGGTTG AACAAGATGC
TCAGGCATTG TTTCAGGCTG GAGAACTTAA ATGGGGAACA GATGAAGAAA AGTTTATTAC
TATCTTTGGA ACACGAAGTG TGTCACATTT GAGAAGGGTG TTTGACAAAT ACATGACTAT
ATCAGGATTT CAAATTGAAG AAACCATTGA CCGGGAGACT TCTGGTAATT TGGAGCAACT
GCTCCTTGCT GTTGTGAAAT CTATTCGGAG TATCCCTGCC TACCTTGCAG AAACTCTCTA
CTATGCAATG AAGGGAGCTG GGACAGATGA TCATACCCTC ATCAGAGTCA TGGTTTCCAG
GAGTGAGATT GATCTGTTTA ACATTAGGAA GGAGTTTAGG AAGAATTTTG CCACCTCTCT
TTATTCCATG ATTAAGGGTG ACACATCTGG GGACTATAAG AAGGCCCTCC TGCTGCTCTG
TGGAGGCGAA GATGACTGAT GGGGTCCTGG GGAGAGACCC CACGCTGTGC CCACTGCCGC
CACTGCCTTC CTTCAGCACA TCTCACTGCA CTGCTTGTAG CCAGGGCTTG GCACATGGCC
TTAACCACAC TAGCATGCAT GCTAGGACCA AAACATGTAC GTTGTAGGAG AAAGTAGTGG
TGCTTCTCTC TGATCTCCAT TAAGATCTTT CTCTTTGTTG TAGTACTGAA GTGTACTTAT
GTTACTAAGA TTAAAATCTG GATCATTTAT ATTTTCCTTT AAGAGGTCAG ACTGCTTTTA
GCCTATTTTA AAAGCTTCAT TTATATTAAA TTGATAACCA TATTACCTTA ATCGGAACCT
GAGCCTCAGA ATTGTGAACT CCTGGAAGTG TTACTGATCT AGTTTGCTAC CAAATTAAAC
CTGGAAAATT ATGGTAGTTG CATTCAAAAG ATTAGTGGGT AATAAACATT TCCTTTCTCC
TGAAAAAAAA AAAAAAAAAA A


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinANXA5annexin A5 [Homo sapiens]. 605e-173O
Contig/Assembly ProteinANXA4annexin A4 [Homo sapiens]. 369e-102O
Contig/Assembly ProteinANXA6annexin A6 isoform 1 [Homo sapiens]. 367e-101O
Contig/Assembly ProteinANXA11annexin A11 [Homo sapiens]. 3425e-94
Contig/Assembly ProteinANXA11annexin A11 [Homo sapiens]. 3425e-94
Contig/Assembly ProteinANXA11annexin A11 [Homo sapiens]. 3425e-94
Contig/Assembly ProteinANXA6annexin A6 isoform 2 [Homo sapiens]. 3411e-93O
Contig/Assembly ProteinANXA8L2annexin A8-like protein 2 [Homo sapiens]. 3242e-88O
Contig/Assembly ProteinANXA8annexin A8 [Homo sapiens]. 3226e-88O
Contig/Assembly ProteinANXA8L1annexin A8-like protein 1 [Homo sapiens]. 3202e-87O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinAnxa5annexin A5 [Mus musculus]. 586e-167O
Contig/Assembly ProteinAnxa6annexin A6 isoform b [Mus musculus]. 375e-104O
Contig/Assembly ProteinAnxa6annexin A6 isoform a [Mus musculus]. 375e-104O
Contig/Assembly ProteinAnxa4annexin A4 [Mus musculus]. 364e-100O
Contig/Assembly ProteinAnxa11annexin A11 [Mus musculus]. 3403e-93
Contig/Assembly ProteinAnxa8annexin A8 [Mus musculus]. 3272e-89O
Contig/Assembly ProteinAnxa3annexin A3 [Mus musculus]. 3133e-85O
Contig/Assembly ProteinAnxa7annexin A7 [Mus musculus]. 2995e-81
Contig/Assembly ProteinAnxa7annexin A7 [Mus musculus]. 2995e-81
Contig/Assembly ProteinAnxa2annexin A2 [Mus musculus]. 2803e-75O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC476094PREDICTED: similar to Annexin A5 (Annexin V) (Lipocortin V) (Endonexin II) (Calphobindin I) (CBP-I) (Placental anticoagulant protein I) (PAP-I) (PP4) (Thromboplastin inhibitor) (Vascular anticoagulant-alpha) (VAC-alpha) (Anchorin CII) [Canis familiaris]. 606e-173O
Contig/Assembly ProteinLOC479325PREDICTED: similar to annexin VI isoform 2 isoform 1 [Canis familiaris]. 372e-103O
Contig/Assembly ProteinLOC479325PREDICTED: similar to Annexin A6 (Annexin VI) (Lipocortin VI) (P68) (P70) (Protein III) (Chromobindin 20) (67 kDa calelectrin) (Calphobindin-II) (CPB-II) isoform 3 [Canis familiaris]. 372e-103O
Contig/Assembly ProteinLOC479325PREDICTED: similar to Annexin A6 (Annexin VI) (Lipocortin VI) (P68) (P70) (Protein III) (Chromobindin 20) (67 kDa calelectrin) (Calphobindin-II) (CPB-II) isoform 2 [Canis familiaris]. 372e-103O
Contig/Assembly ProteinANXA4annexin A4 [Canis lupus familiaris]. 3603e-99O
Contig/Assembly ProteinLOC479259PREDICTED: similar to annexin A11 (predicted) [Canis familiaris]. 3471e-95
Contig/Assembly ProteinLOC479270PREDICTED: similar to Annexin A8 (Annexin VIII) (Vascular anticoagulant-beta) (VAC-beta) isoform 1 [Canis familiaris]. 3273e-89O
Contig/Assembly ProteinLOC478447PREDICTED: similar to Annexin A3 (Annexin III) (Lipocortin III) (Placental anticoagulant protein III) (PAP-III) (35-alpha calcimedin) (Inositol 1,2-cyclic phosphate 2-phosphohydrolase) [Canis familiaris]. 3165e-86O
Contig/Assembly ProteinLOC479246PREDICTED: similar to annexin VII isoform 2 isoform 2 [Canis familiaris]. 3102e-84
Contig/Assembly ProteinLOC479270PREDICTED: similar to Annexin A8 (Annexin VIII) (Vascular anticoagulant-beta) (VAC-beta) isoform 3 [Canis familiaris]. 2834e-76O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinANXA5annexin A5 [Bos taurus]. 614e-176O
Contig/Assembly ProteinANXA4annexin A4 [Bos taurus]. 365e-101O
Contig/Assembly ProteinANXA6annexin A6 [Bos taurus]. 363e-100O
Contig/Assembly ProteinANXA11annexin A11 [Bos taurus]. 3472e-95
Contig/Assembly ProteinANXA8L1annexin A8 [Bos taurus]. 3271e-89O
Contig/Assembly ProteinANXA3annexin A3 [Bos taurus]. 3094e-84O
Contig/Assembly ProteinANXA7annexin A7 [Bos taurus]. 3056e-83
Contig/Assembly ProteinANXA2annexin A2 [Bos taurus]. 2812e-75O
Contig/Assembly ProteinANXA1annexin A1 [Bos taurus]. 2565e-68O
Contig/Assembly ProteinANXA10annexin A10 [Bos taurus]. 2335e-61O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100521982PREDICTED: annexin A5-like [Sus scrofa]. 623e-179O
Contig/Assembly ProteinANXA4annexin A4 [Sus scrofa]. 368e-102O
Contig/Assembly ProteinLOC100156481PREDICTED: annexin A11 [Sus scrofa]. 3486e-96
Contig/Assembly ProteinANXA8annexin A8 [Sus scrofa]. 3272e-89O
Contig/Assembly ProteinANXA7PREDICTED: annexin A7 isoform 1 [Sus scrofa]. 3055e-83
Contig/Assembly ProteinANXA7PREDICTED: annexin A7 [Sus scrofa]. 3055e-83
Contig/Assembly ProteinANXA2annexin A2 [Sus scrofa]. 2786e-75O
Contig/Assembly ProteinANXA13PREDICTED: annexin A13 isoform 2 [Sus scrofa]. 2771e-74O
Contig/Assembly ProteinANXA13PREDICTED: annexin A13 isoform 1 [Sus scrofa]. 2771e-74O
Contig/Assembly ProteinANXA1annexin A1 [Sus scrofa]. 2562e-68O


Assembly Members: 197      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010003A08ADR01_0003_A08.bDB781746 
ADR010015C03ADR01_0015_C03.bDB782841 
ADR010021D09ADR01_0021_D09.bDB783336 
ADR010031H08ADR01_0031_H08.bDB784284 
ADR010043F01ADR01_0043_F01.bDB785331 
ADR010043F12ADR01_0043_F12.bDB785342 
ADR010054C11ADR01_0054_C11.bDB786299 
ADR010062D01ADR01_0062_D01.bDB787020 
ADR010066E12ADR01_0066_E12.bDB787383 
ADR010084E10ADR01_0084_E10.bDB788979 
ADR010088D04ADR01_0088_D04.bDB789310 
AMP010004G06AMP01_0004_G06.bBW955267 
AMP010004H04AMP01_0004_H04.bBW955274 
AMP010026F11AMP01_0026_F11.bBW956970 
AMP010034G08AMP01_0034_G08.bBW957473 
AMP010035H04AMP01_0035_H04.bBW957564 
AMP010036A06AMP01_0036_A06.bBW957577 
AMP010037A08AMP01_0037_A08.bBW957657 
AMP010040B02AMP01_0040_B02.b  
AMP010040G04AMP01_0040_G04.b  AK389690
AMP010041C02AMP01_0041_C02.bBW957905 
AMP010046C10AMP01_0046_C10.bBW958242 
AMP010051C04AMP01_0051_C04.bBW958606 
AMP010055F08AMP01_0055_F08.bBW958953 
AMP010061G12AMP01_0061_G12.bBW959460 
AMP010065H04AMP01_0065_H04.bBW959734 
AMP010072H01AMP01_0072_H01.bBW960240 
AMP010075G02AMP01_0075_G02.bBW960416 
AMP010079C06AMP01_0079_C06.bBW960689 
AMP010081C08AMP01_0081_C08.bBW960831 
AMP010081E01AMP01_0081_E01.bBW960847 
AMP010082H09AMP01_0082_H09.bBW960967 
AMP010084H11AMP01_0084_H11.bBW961135 
AMP010092E11AMP01_0092_E11.bBW961783 
AMP010092G07AMP01_0092_G07.bBW961800 
AMP010094G04AMP01_0094_G04.bBW961972 
AMP010095E05AMP01_0095_E05.bBW962040 
AMP010095H05AMP01_0095_H05.bBW962075 
AMP010096A12AMP01_0096_A12.bBW962092 
AMP010102A06AMP01_0102_A06.bBW962620 
BFLT10088D11BFLT1_0088_D11.bFS646979 
BKFL10020G05BKFL1_0020_G05.bFS649112 
BKFL10035A11BKFL1_0035_A11.bFS650334 
BMWN10023E06BMWN1_0023_E06.bHX206969 
CBLT10020A02CBLT1_0020_A02.bHX213203 
CBLT10022A01CBLT1_0022_A01.bHX213346 
CBLT10038B08CBLT1_0038_B08.bHX214431 
CBLT10072B06CBLT1_0072_B06.bHX216876 
CLNT10112G05CLNT1_0112_G05.bHX220102 
DCI010002B11DCI01_0002_B11.bDB790696 
DCI010011E08DCI01_0011_E08.bDB791296 
DCI010016B01DCI01_0016_B01.bDB791688 
DCI010016H09DCI01_0016_H09.bDB791765 
DCI010020A05DCI01_0020_A05.bDB792041 
DCI010025H04DCI01_0025_H04.bDB792571 
DCI010026C05DCI01_0026_C05.bDB792606 
DCI010026C12DCI01_0026_C12.bDB792612 
DCI010029G12DCI01_0029_G12.bDB792909 
DCI010030E04DCI01_0030_E04.bDB792967 
DCI010030F09DCI01_0030_F09.bDB792982 
DCI010036G01DCI01_0036_G01.bDB793534 
DCI010037C07DCI01_0037_C07.bDB793584 
DCI010038B03DCI01_0038_B03.bDB793655 
DCI010040C09DCI01_0040_C09.bDB793781 
DCI010042H03DCI01_0042_H03.bDB793972 
DCI010063A03DCI01_0063_A03.bDB795139 
DCI010078G10DCI01_0078_G10.bDB796529 
DCI010084G07DCI01_0084_G07.bDB797053 
DCI010085H04DCI01_0085_H04.bDB797150 
DCI010087H02DCI01_0087_H02.bDB797327 
DCI010091E02DCI01_0091_E02.bDB797647 
DCI010094E12DCI01_0094_E12.bDB797928 
DCI010099H08DCI01_0099_H08.bDB798404 
DCI010100D11DCI01_0100_D11.bDB798452 
DCI010104B09DCI01_0104_B09.bDB798781 
DCI010105A03DCI01_0105_A03.bDB798850 
DCI010105B09DCI01_0105_B09.bDB798865 
DCI010109B06DCI01_0109_B06.bDB799195 
DCI010111B10DCI01_0111_B10.bDB799381 
DCI010115F06DCI01_0115_F06.bDB799782 
HTMT10001E03HTMT1_0001_E03.bFS664409 
HTMT10032G04HTMT1_0032_G04.bFS666571 AK399872
HTMT10083D05HTMT1_0083_D05.bFS670049 
ILNT10067G12ILNT1_0067_G12.bHX232120 
ITT010002G08ITT01_0002_G08.bBW976203 
ITT010021B12ITT01_0021_B12.bBW977870 
ITT010081C02ITT01_0081_C02.bBW983181 
ITT010085B11ITT01_0085_B11.bBW983530 
ITT010093F08ITT01_0093_F08.bBW984280 
ITT010095D03ITT01_0095_D03.bBW984436 
ITT010097G08ITT01_0097_G08.bBW984656 
KDN010003A10KDN01_0003_A10.bFS671439 
KDN010033G12KDN01_0033_G12.bFS673749 
KDN010042H03KDN01_0042_H03.bFS674154 
KDN010067D11KDN01_0067_D11.b  
KDN010072A05KDN01_0072_A05.bFS676130 
LNG010005H01LNG01_0005_H01.bBP439956 
LNG010023G12LNG01_0023_G12.bBP439890 
LNG010031H02LNG01_0031_H02.bBP440058 
LNG010036H08LNG01_0036_H08.bBP440551 
LNG010062E09LNG01_0062_E09.bBP437638 
LNG010070G03LNG01_0070_G03.bBP439168 
LVRM10176A04LVRM1_0176_A04.bCJ005080 
MLN010077F11MLN01_0077_F11.bCJ013769 
OVR010009B12OVR01_0009_B12.bBP142090 
OVR010020G04OVR01_0020_G04.bBP144071 
OVR010062D01OVR01_0062_D01.bBW965137 
OVR010079A04OVR01_0079_A04.bBW966575 
OVR010091C02OVR01_0091_C02.bBW967444 
OVR010095C07OVR01_0095_C07.bBW967747 
OVR010100A01OVR01_0100_A01.bBW968113 
OVRM10002H03OVRM1_0002_H03.bBP461524 
OVRM10004H06OVRM1_0004_H06.bBP461745 
OVRM10013C11OVRM1_0013_C11.bBP148436 
OVRM10018F04OVRM1_0018_F04.bBP459647 
OVRM10030F06OVRM1_0030_F06.bBP151675 AK234913
OVRM10033A09OVRM1_0033_A09.bBP145705 
OVRM10053H08OVRM1_0053_H08.bBP154476 
OVRM10056A12OVRM1_0056_A12.bBP146058 
OVRM10062C08OVRM1_0062_C08.bBP148142 
OVRM10079B03OVRM1_0079_B03.bBP146393 
OVRM10085E02OVRM1_0085_E02.bBP150058 
OVRM10094D09OVRM1_0094_D09.bBP149554 
OVRM10112H04OVRM1_0112_H04.bBP154079 
OVRM10126A08OVRM1_0126_A08.bBP145675 
OVRM10126C10OVRM1_0126_C10.bBP148415 
OVRM10129E08OVRM1_0129_E08.bBP150702 
OVRM10152H06OVRM1_0152_H06.bBP461762 
OVRM10171H11OVRM1_0171_H11.bBP462174 
OVRM10183C11OVRM1_0183_C11.bBP457363 
OVRM10186E11OVRM1_0186_E11.bBP459281 
OVRM10186H09OVRM1_0186_H09.bBP462026 
OVRM10192A03OVRM1_0192_A03.bBP454851 
OVRM10193A03OVRM1_0193_A03.bBP454852 
OVRM10194A03OVRM1_0194_A03.bBP454853 
OVRM10196H04OVRM1_0196_H04.bBP461644 
OVRM10199B09OVRM1_0199_B09.bBP456268 
OVRM10203E02OVRM1_0203_E02.bBP458588 
OVRM10206F10OVRM1_0206_F10.bBP460221 
OVRM10210F02OVRM1_0210_F02.bBP459549 
OVRM10215D06OVRM1_0215_D06.bBP457955 
OVRM10215H02OVRM1_0215_H02.bBP461513 
OVRT10017H05OVRT1_0017_H05.bFS687827 
OVRT10020B04OVRT1_0020_B04.bFS688010 
OVRT10040B12OVRT1_0040_B12.bFS689649 
OVRT10050D03OVRT1_0050_D03.bFS690486 
OVRT10053H03OVRT1_0053_H03.bFS690770 
OVRT10054C01OVRT1_0054_C01.bFS690797 
OVRT10069F05OVRT1_0069_F05.bFS692070 
OVRT10075F04OVRT1_0075_F04.bFS692536 
OVRT10094F02OVRT1_0094_F02.bFS694086 
OVRT10097A07OVRT1_0097_A07.bFS694286 
OVRT10102G05OVRT1_0102_G05.bHX234980 
OVRT10113A10OVRT1_0113_A10.bHX235830 
OVRT10116A03OVRT1_0116_A03.bHX236073 
OVRT10134F02OVRT1_0134_F02.bHX237547 
OVRT10144H03OVRT1_0144_H03.bHX238394 
OVRT10152H12OVRT1_0152_H12.bHX239063 
PBL010065D04PBL01_0065_D04.bBW972005 
PBL010074E03PBL01_0074_E03.bBW972748 
PCT010001B08PCT01_0001_B08.bFS694637 
PCT010013E03PCT01_0013_E03.bFS695516 
PCT010020F06PCT01_0020_F06.bFS695975 
PST010005D11PST01_0005_D11.bFS697389 
PST010016F01PST01_0016_F01.bFS698262 
PST010031B05PST01_0031_B05.b  
PST010073H04PST01_0073_H04.bFS702617 
PST010085F04PST01_0085_F04.b  
PTG010063A11PTG01_0063_A11.bFS709886 
SKNB10008C07SKNB1_0008_C07.bDB800514 
SKNB10010D02SKNB1_0010_D02.bDB800590 
SKNB10015C04SKNB1_0015_C04.bDB800799 
SKNB10037B01SKNB1_0037_B01.bDB801989 
SKNB10064A01SKNB1_0064_A01.bDB803853 
SMG010038D02SMG01_0038_D02.bFS716600 
SMG010075G01SMG01_0075_G01.bFS719778 AK397574
SMG010103H07SMG01_0103_H07.bFS722143 
SPL010002H11SPL01_0002_H11.bBP159313 
SPL010003G03SPL01_0003_G03.bBP158761 
SPL010014E09SPL01_0014_E09.bBP158255 
SPL010026F05SPL01_0026_F05.bBP158502 
SPL010034B08SPL01_0034_B08.bCJ016675 
SPL010051G12SPL01_0051_G12.bCJ017643 
SPL010056C04SPL01_0056_C04.bCJ018040 
SPL010058E05SPL01_0058_E05.bCJ018244 
SPL010060F01SPL01_0060_F01.bCJ018427 
SPL010061A03SPL01_0061_A03.bCJ018461 
SPL010074C01SPL01_0074_C01.bCJ019656 
SPL010075B02SPL01_0075_B02.bCJ019740 
SPL010089A03SPL01_0089_A03.bCJ020994 
SPL010102C02SPL01_0102_C02.bCJ022162 
SPLT10035A03SPLT1_0035_A03.bHX241875 
SPLT10100H02SPLT1_0100_H02.bHX247033 
TCH010079G12TCH01_0079_G12.bCJ028175 
TCH010091A11TCH01_0091_A11.bCJ029045 
UTR010088C08UTR01_0088_C08.bCJ038110 
UTR010095F06UTR01_0095_F06.bCJ038784 

  

SNPs: 5      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
117C81260.669W-
T5300.331
124A12500.753W-
C14270.247
148A7600.418WSGGA/G
G74320.582GGG/G
151C13300.735WSGTC/V
T16320.265GTT/V
787G2820.390ONTTG/L
T4250.610TTT/F


Alignment:      TOP

20110601C-007088 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
HTMT1_0032_G04.b :
DCI01_0030_F09.b : nnaattatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0035_A03.b :
CBLT1_0022_A01.b :
OVRM1_0030_F06.b :
SPL01_0075_B02.b :
ITT01_0095_D03.b :
CBLT1_0072_B06.b :
ADR01_0043_F01.b :
SMG01_0075_G01.b :
SPL01_0051_G12.b :
OVR01_0009_B12.b : a
DCI01_0036_G01.b : nttatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0112_H04.b :
DCI01_0020_A05.b : nnnncgtaacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0026_F11.b : nnnaatggtattttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0046_C10.b : aattaagcgtatcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0077_F11.b :
ADR01_0062_D01.b :
OVRM1_0199_B09.b :
OVR01_0062_D01.b :
ITT01_0021_B12.b :
UTR01_0095_F06.b :
HTMT1_0001_E03.b :
AMP01_0095_E05.b : ggcgtaaactcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0193_A03.b :
OVRT1_0113_A10.b :
OVRM1_0126_C10.b :
KDN01_0033_G12.b :
LVRM1_0176_A04.b :
OVRM1_0079_B03.b :
SPL01_0026_F05.b :
CBLT1_0020_A02.b :
OVR01_0095_C07.b :
OVRT1_0040_B12.b :
DCI01_0040_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0023_E06.b :
AMP01_0082_H09.b : naaaaggtatttaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0030_E04.b : nnnggtatctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0038_B03.b : nnggtatctatagggctgctcccgcgccgxxxxxxxx
AMP01_0092_E11.b : naaaacgtattttxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0042_H03.b : nttacatactatagggctxxxxxxxxxxxxxxxxxxxxx
AMP01_0096_A12.b : ggccgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0079_C06.b : taatctttaggggatacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0041_C02.b : nngggataaanntaagggatacttggggctgctcxxxxxxxxxxxxx
DCI01_0099_H08.b : nnnntttgatacttxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0094_E12.b : naatcataannnaaacgatacttgggggctxxxxxxxxxxxxxxxxx
AMP01_0094_G04.b : gcggttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0095_H05.b : ttgcgatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0084_G07.b : nnaaaacgtaacttxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0171_H11.b :
AMP01_0040_G04.b : nnnggatatatatagggatacttxxxxxxxxxxxxxxxxx
LNG01_0023_G12.b :
ITT01_0085_B11.b :
OVRT1_0144_H03.b :
SPL01_0058_E05.b :
SPL01_0056_C04.b :
DCI01_0085_H04.b : cttttccgtaatctaagggctxxxxxxxxxxxxx
DCI01_0087_H02.b : nnnnaaagatacatxxxxxxxxxxxxxxxxxx
DCI01_0109_B06.b : aaaanttcgaatcctaaxxxxxxxxxxxxxxxxx
DCI01_0002_B11.b : ntgagatctattggggatacttaxxxxxxxxxxxxxxxxxx
SPL01_0014_E09.b :
DCI01_0025_H04.b : nnnaacatactaaxxxxxxxxxxxxxxxx
DCI01_0026_C12.b : nntaacgtaactaxxxxxxxxxxxxxx
AMP01_0004_G06.b : ttttttcgtatctaaxxxxxxxxxxxxxxx
AMP01_0037_A08.b : nngggatatatatagggatacttxxxxxxxxxxxxxxxx
DCI01_0063_A03.b : nnnaaactaccatxxxxxxxxxxxxxxx
HTMT1_0083_D05.b :
AMP01_0102_A06.b : ggggtaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0075_F04.b :
AMP01_0036_A06.b : nnggcgatatanttagggatacttxxxxxxxxxxxxxx
AMP01_0061_G12.b : nnnggagaaaaanttttaggacactatxxxxxxxxxxxxxx
DCI01_0011_E08.b : nnnaacgatactaxxxxxxxxxxxxxxx
KDN01_0003_A10.b :
PST01_0085_F04.b :
PST01_0005_D11.b :
ADR01_0084_E10.b :
OVRM1_0194_A03.b :
OVRM1_0004_H06.b :
OVRM1_0196_H04.b :
OVRM1_0056_A12.b :
OVRM1_0053_H08.b :
OVRM1_0085_E02.b :
OVRM1_0062_C08.b :
OVRM1_0186_H09.b :
OVRM1_0129_E08.b :
SPL01_0074_C01.b :
SPL01_0102_C02.b :
ADR01_0003_A08.b :
SPL01_0034_B08.b :
SPL01_0089_A03.b :
SPL01_0003_G03.b :
UTR01_0088_C08.b :
SMG01_0038_D02.b :
ITT01_0002_G08.b :
ITT01_0097_G08.b :
OVRT1_0054_C01.b :
PBL01_0065_D04.b :
OVRT1_0094_F02.b :
OVR01_0100_A01.b :
ITT01_0081_C02.b :
OVR01_0091_C02.b :
AMP01_0040_B02.b : nngggtataatatagcgatacttxxxxxxxxxx
AMP01_0004_H04.b : atttaacgtatctaaxxxxxxxxxx
DCI01_0016_B01.b : nntttacatactaaxxxxxxxx
DCI01_0091_E02.b : nnntttggatactaaxxxxxxxxx
OVRT1_0069_F05.b :
DCI01_0029_G12.b : nnaagaatctaaxxxxxxxx
DCI01_0026_C05.b : nnttacgatacxxxxxxxx
DCI01_0104_B09.b : nnnaaacgaatccatxxxxxxxxx
DCI01_0105_B09.b : nnnnaaacgatactaaxxxxxxxxx
AMP01_0081_E01.b : naaatgtattatxxxxxxx
AMP01_0065_H04.b : tatagcgaatcttxxxxxxx
AMP01_0092_G07.b : nnnncgtatcttxxxxxxxx
AMP01_0084_H11.b : nnaaatcgtattatxxxxxxxxx
AMP01_0081_C08.b : nttaaggtattttxxxxxxxxxx
SPL01_0060_F01.b :
OVRT1_0017_H05.b :
OVRM1_0152_H06.b :
OVRM1_0192_A03.b :
OVRM1_0018_F04.b :
OVRM1_0215_H02.b :
OVRM1_0203_E02.b :
SPL01_0061_A03.b :
OVRM1_0186_E11.b :
OVRM1_0126_A08.b :
OVR01_0079_A04.b :
ADR01_0043_F12.b :
OVRT1_0097_A07.b :
PCT01_0020_F06.b :
OVRT1_0134_F02.b :
SPL01_0002_H11.b :
OVRT1_0152_H12.b :
OVRT1_0102_G05.b :
KDN01_0072_A05.b :
OVRT1_0116_A03.b :
ADR01_0066_E12.b :
ITT01_0093_F08.b :
ADR01_0088_D04.b :
KDN01_0067_D11.b :
CLNT1_0112_G05.b :
PCT01_0013_E03.b :
AMP01_0035_H04.b : caactctatagggatacttxxxxxx
ADR01_0031_H08.b :
AMP01_0055_F08.b : nnnccagaaaantatagggacatctat
SKNB1_0010_D02.b :
BFLT1_0088_D11.b :
ADR01_0054_C11.b :
AMP01_0034_G08.b : nnngatgataannnataggatat
DCI01_0115_F06.b : nnnttcgaaannnnncgatact
DCI01_0111_B10.b : nnnnnnnnnnnnnnnnnnn
PCT01_0001_B08.b :
PST01_0073_H04.b :
PST01_0016_F01.b :
PST01_0031_B05.b :
OVRT1_0053_H03.b :
TCH01_0079_G12.b :
AMP01_0075_G02.b : cctatagggat
SKNB1_0064_A01.b :
OVRM1_0013_C11.b :
OVRM1_0183_C11.b :
PBL01_0074_E03.b :
LNG01_0062_E09.b :
OVRT1_0050_D03.b :
PTG01_0063_A11.b :
ADR01_0015_C03.b :
BKFL1_0020_G05.b : nnnnnnnn
DCI01_0100_D11.b :
OVRM1_0215_D06.b :
AMP01_0051_C04.b : n
KDN01_0042_H03.b :
LNG01_0031_H02.b :
AMP01_0072_H01.b :
OVRM1_0033_A09.b :
OVRM1_0002_H03.b :
OVRM1_0094_D09.b :
OVRM1_0206_F10.b :
SMG01_0103_H07.b :
LNG01_0036_H08.b :
LNG01_0070_G03.b :
OVR01_0020_G04.b :
OVRM1_0210_F02.b :
SKNB1_0008_C07.b :
SKNB1_0037_B01.b :
DCI01_0016_H09.b :
OVRT1_0020_B04.b :
DCI01_0037_C07.b :
DCI01_0105_A03.b :
DCI01_0078_G10.b :
BKFL1_0035_A11.b :
SKNB1_0015_C04.b :
ADR01_0021_D09.b :
TCH01_0091_A11.b :
LNG01_0005_H01.b :
CBLT1_0038_B08.b :
SPLT1_0100_H02.b :
ILNT1_0067_G12.b :
20110601C-007088 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
HTMT1_0032_G04.b : nttcgacggaacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0030_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0035_A03.b : nnggggcgagtagaggxxxxxxx
CBLT1_0022_A01.b : ttttccacggtagaxxxxxxxxxxxx
OVRM1_0030_F06.b : cxxxxxxxxxxxxxxxx
SPL01_0075_B02.b : nnnnggctagtgacttnacxxxxxxxxxxxxxxx
ITT01_0095_D03.b : nnggtgaa
CBLT1_0072_B06.b : nnnnnggcaggagacx
ADR01_0043_F01.b : nggtg
SMG01_0075_G01.b : tttttttggat
SPL01_0051_G12.b : nttttagcttggactatgacxxxxxxxxxxxxxx
OVR01_0009_B12.b : ggaactttggaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0036_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0112_H04.b : cagttgtcxxxxxxxx
DCI01_0020_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0026_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0046_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0077_F11.b : nggctaggacttgacagtttgtacxxxx
ADR01_0062_D01.b : acgtttcxxx
OVRM1_0199_B09.b : tagttgtcxxxxx
OVR01_0062_D01.b : nnnttggataggactatgacxxxxxxxxxxxx
ITT01_0021_B12.b : nnggg
UTR01_0095_F06.b : nnnnggctaggactataacagtttgtacxx
HTMT1_0001_E03.b :
AMP01_0095_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0193_A03.b : agttgtc
OVRT1_0113_A10.b : ntttccgtcagcgnacg
OVRM1_0126_C10.b : nagtttg
KDN01_0033_G12.b :
LVRM1_0176_A04.b : agtt
OVRM1_0079_B03.b : cgtt
SPL01_0026_F05.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0020_A02.b : ttt
OVR01_0095_C07.b : gcttggacttagacagttt
OVRT1_0040_B12.b : nntttccgttcggcgcac
DCI01_0040_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0023_E06.b : nnnnnggcagagtagaggx
AMP01_0082_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0030_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0038_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0092_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0042_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0096_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0079_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0041_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0099_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0094_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0094_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0095_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0084_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0171_H11.b :
AMP01_0040_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0023_G12.b : ttggatggtttatagtaaaataaa
ITT01_0085_B11.b :
OVRT1_0144_H03.b : nnnccacattnnnnnnn
SPL01_0058_E05.b : nnnnggctagga
SPL01_0056_C04.b : nnnnggctagg
DCI01_0085_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0109_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0002_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0014_E09.b : tttttggtggxxxxx
DCI01_0025_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0026_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0004_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0037_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0063_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0083_D05.b :
AMP01_0102_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0075_F04.b : nggg
AMP01_0036_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0061_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0011_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0003_A10.b :
PST01_0085_F04.b :
PST01_0005_D11.b :
ADR01_0084_E10.b :
OVRM1_0194_A03.b :
OVRM1_0004_H06.b :
OVRM1_0196_H04.b :
OVRM1_0056_A12.b :
OVRM1_0053_H08.b :
OVRM1_0085_E02.b :
OVRM1_0062_C08.b :
OVRM1_0186_H09.b :
OVRM1_0129_E08.b :
SPL01_0074_C01.b : nnnnggatt
SPL01_0102_C02.b : nnnccgcta
ADR01_0003_A08.b :
SPL01_0034_B08.b : tttttggca
SPL01_0089_A03.b : nnnnggcta
SPL01_0003_G03.b : gcttttggtggaax
UTR01_0088_C08.b : nnnggataggactataa
SMG01_0038_D02.b :
ITT01_0002_G08.b :
ITT01_0097_G08.b :
OVRT1_0054_C01.b : nnntttcttnnnnn
PBL01_0065_D04.b :
OVRT1_0094_F02.b :
OVR01_0100_A01.b : ncctgcta
ITT01_0081_C02.b :
OVR01_0091_C02.b : nnnnagctt
AMP01_0040_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0004_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0016_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0091_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0069_F05.b :
DCI01_0029_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0026_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0104_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0105_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0081_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0065_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0092_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0084_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0081_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0060_F01.b : tttg
OVRT1_0017_H05.b :
OVRM1_0152_H06.b :
OVRM1_0192_A03.b :
OVRM1_0018_F04.b :
OVRM1_0215_H02.b :
OVRM1_0203_E02.b :
SPL01_0061_A03.b : tt
OVRM1_0186_E11.b :
OVRM1_0126_A08.b :
OVR01_0079_A04.b :
ADR01_0043_F12.b :
OVRT1_0097_A07.b :
PCT01_0020_F06.b :
OVRT1_0134_F02.b : nnnccgt
SPL01_0002_H11.b : gcttttc
OVRT1_0152_H12.b :
OVRT1_0102_G05.b :
KDN01_0072_A05.b :
OVRT1_0116_A03.b :
ADR01_0066_E12.b :
ITT01_0093_F08.b :
ADR01_0088_D04.b :
KDN01_0067_D11.b :
CLNT1_0112_G05.b :
PCT01_0013_E03.b :
AMP01_0035_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0031_H08.b :
AMP01_0055_F08.b : gggctgctcccncgccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0010_D02.b :
BFLT1_0088_D11.b :
ADR01_0054_C11.b :
AMP01_0034_G08.b : cttgggctgctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0115_F06.b : atagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0111_B10.b : nnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0001_B08.b :
PST01_0073_H04.b :
PST01_0016_F01.b :
PST01_0031_B05.b :
OVRT1_0053_H03.b :
TCH01_0079_G12.b :
AMP01_0075_G02.b : acttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0064_A01.b :
OVRM1_0013_C11.b :
OVRM1_0183_C11.b :
PBL01_0074_E03.b :
LNG01_0062_E09.b :
OVRT1_0050_D03.b :
PTG01_0063_A11.b :
ADR01_0015_C03.b :
BKFL1_0020_G05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxx
DCI01_0100_D11.b : nnnnnnccgtacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0215_D06.b :
AMP01_0051_C04.b : nggagaaaaantaagcgatatcttagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0042_H03.b :
LNG01_0031_H02.b :
AMP01_0072_H01.b : aactttagcgtaaccttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0033_A09.b :
OVRM1_0002_H03.b :
OVRM1_0094_D09.b :
OVRM1_0206_F10.b :
SMG01_0103_H07.b :
LNG01_0036_H08.b :
LNG01_0070_G03.b :
OVR01_0020_G04.b :
OVRM1_0210_F02.b :
SKNB1_0008_C07.b :
SKNB1_0037_B01.b :
DCI01_0016_H09.b : nnnaaacgtactaaxxxxxxx
OVRT1_0020_B04.b :
DCI01_0037_C07.b : nnnnng
DCI01_0105_A03.b :
DCI01_0078_G10.b :
BKFL1_0035_A11.b :
SKNB1_0015_C04.b :
ADR01_0021_D09.b :
TCH01_0091_A11.b :
LNG01_0005_H01.b :
CBLT1_0038_B08.b :
SPLT1_0100_H02.b :
ILNT1_0067_G12.b :
20110601C-007088 : ..............GGCGGGGCCCGCCGGGACGGGGCGGGGTCGGTGGTGTTTCCGTTGC
---------+---------+---------+---------+---------+---------+ 46
HTMT1_0032_G04.b : xxxxxxxxxxxxxxGGCGGGGCCCGCCGGGACGGGGCGGGGTCGGTGGTGTTTCCGTTGC
DCI01_0030_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGGTGGTGTTTCCGTTGC
SPLT1_0035_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgggggTCGGTGGTGTTTCCGTTGC
CBLT1_0022_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggggggTCGGTCGTGTTTCCGTTGC
OVRM1_0030_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTGTTTCCGTTGC
SPL01_0075_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTGTTTCCGTTGC
ITT01_0095_D03.b : acaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTGTTTCCGTTGC
CBLT1_0072_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTGTTTCCGTTGC
ADR01_0043_F01.b : taacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGTTTCCGTTGC
SMG01_0075_G01.b : aaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGTTTCCGTTGC
SPL01_0051_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGTTTCCGTTGC
OVR01_0009_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGTTTCCGTTGC
DCI01_0036_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGTTTCCGTTGC
OVRM1_0112_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgttTTTTTCCGTTGC
DCI01_0020_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTTCCGTTGC
AMP01_0026_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTTTCCGTTGC
AMP01_0046_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGTTTCCGTTGC
MLN01_0077_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTTTTTCCGTTGC
ADR01_0062_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTTCCGTTGC
OVRM1_0199_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgaGTTTCCGTTGC
OVR01_0062_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTTCCGTTGC
ITT01_0021_B12.b : tgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTTCCGTTGC
UTR01_0095_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTTCCGTTGC
HTMT1_0001_E03.b : nnnaagcatacttgggatttaatgattgGTTTCCGTTGC
AMP01_0095_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCCGTTGC
OVRM1_0193_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCCGTTGC
OVRT1_0113_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCGTTGC
OVRM1_0126_C10.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGTTGC
KDN01_0033_G12.b : naaactgcggtggctctgggtttCGTTGC
LVRM1_0176_A04.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTGC
OVRM1_0079_B03.b : gacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTGC
SPL01_0026_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTGC
CBLT1_0020_A02.b : tggacggtagaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGTTGC
OVR01_0095_C07.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTGC
OVRT1_0040_B12.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTGC
DCI01_0040_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC
BMWN1_0023_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgctTTGC
AMP01_0082_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGC
DCI01_0030_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGC
DCI01_0038_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
AMP01_0092_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
DCI01_0042_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
AMP01_0096_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
AMP01_0079_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
AMP01_0041_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0099_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0094_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0094_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0095_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0084_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0171_H11.b : gtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0040_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0023_G12.b : aaaatttttttgaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0085_B11.b : nnnngatcaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0144_H03.b : nccgttagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0058_E05.b : ctatnacagtttgtcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0056_C04.b : actatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0085_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0087_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0109_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0002_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0014_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0025_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0026_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0004_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0037_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0063_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0083_D05.b : nnggctagtacgaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0102_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0075_F04.b : accctctagctntangagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0036_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0061_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0011_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0003_A10.b : nnggcattttnntttannnccta
PST01_0085_F04.b : ntttcctgacgtggctctggagt
PST01_0005_D11.b : nccatnnnnnnnnccccgcg
ADR01_0084_E10.b : nnnnngggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0194_A03.b : aagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0004_H06.b : nxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0196_H04.b : agttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0056_A12.b : agttgaccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0053_H08.b : acgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0085_E02.b : caattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0062_C08.b : nagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0186_H09.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0129_E08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0074_C01.b : gtacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0102_C02.b : ggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0003_A08.b : nnnaatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0034_B08.b : tggactatnacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0089_A03.b : gtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0003_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0088_C08.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0038_D02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ITT01_0002_G08.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0097_G08.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0054_C01.b : nnnccgtatagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0065_D04.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0094_F02.b : nnnnncctatagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0100_A01.b : ggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0081_C02.b : nnnggtgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0091_C02.b : ggacttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0040_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0004_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0016_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0091_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0069_F05.b : nnncctctttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0029_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0026_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0104_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0105_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0081_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0065_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0092_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0084_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0081_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0060_F01.b : ggcatgtgcattnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0017_H05.b : nntttctaattgctgtacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0152_H06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0192_A03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0018_F04.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0215_H02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0203_E02.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0061_A03.b : ttggctagtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0186_E11.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0126_A08.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0079_A04.b : nnggctaggacttagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0043_F12.b : naatgaaacaxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0097_A07.b : nnccctcagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0020_F06.b : nnnttactttatannnnc
OVRT1_0134_F02.b : tttnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0002_H11.b : gtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0152_H12.b : tttttccgtctagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0102_G05.b : nnnccgtcagcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0072_A05.b : nncct
OVRT1_0116_A03.b : nnnccccgacagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0066_E12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ITT01_0093_F08.b : nnaatgatacaxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0088_D04.b : aaaannggatcaacagctggaxxxxxxxxxxxxxxxxx
KDN01_0067_D11.b : tttttcct
CLNT1_0112_G05.b : nnnnnccgtcagcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0013_E03.b : nnncctctttannnnnnc
AMP01_0035_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0031_H08.b : nncccttaannanaactaaagcagcggtaxxxxxxxxxxx
AMP01_0055_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0010_D02.b : n
BFLT1_0088_D11.b : ggatacctttagcgnacgagtgxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0054_C11.b : gcannnggagtaacaxxxxxxxxxxxxxxxx
AMP01_0034_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0115_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0111_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0001_B08.b : nncccatttn
PST01_0073_H04.b :
PST01_0016_F01.b : tgcgt
PST01_0031_B05.b :
OVRT1_0053_H03.b : nnnnnccgttagctgtcngxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0079_G12.b : nnnnggataggaaataaacxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0075_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0064_A01.b :
OVRM1_0013_C11.b : xxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0183_C11.b : gagtttgtcxxxxxxxxxxx
PBL01_0074_E03.b : nnnggatacacaxxx
LNG01_0062_E09.b : nnaaaggattggacttgacxxxxxxxxxxxxxxxxxxxx
OVRT1_0050_D03.b : ncctctttnnnnnnnnnccgttagcgttacgaggxxxxxxxxx
PTG01_0063_A11.b : nnnnnnnnnnnnnnnnnnnnnnnnn
ADR01_0015_C03.b : aatgaacax
BKFL1_0020_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0100_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0215_D06.b : nagttgtcxxxxxxx
AMP01_0051_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0042_H03.b :
LNG01_0031_H02.b : tggtttccatggcatagtgxxxxxxxxxxxxxx
AMP01_0072_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0033_A09.b : cxxxxxxxxx
OVRM1_0002_H03.b : nagtttgt
OVRM1_0094_D09.b : cagttg
OVRM1_0206_F10.b : ncgttg
SMG01_0103_H07.b : nnggccttttnnnn
LNG01_0036_H08.b : gcttttgctccnxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0070_G03.b : ttgggtgctggactatnacagtttgt
OVR01_0020_G04.b : tgggggcacxxxxxxxxxxxxxxxxxx
OVRM1_0210_F02.b : agttgt
SKNB1_0008_C07.b :
SKNB1_0037_B01.b :
DCI01_0016_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0020_B04.b :
DCI01_0037_C07.b : gatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0105_A03.b :
DCI01_0078_G10.b :
BKFL1_0035_A11.b :
SKNB1_0015_C04.b :
ADR01_0021_D09.b :
TCH01_0091_A11.b :
LNG01_0005_H01.b :
CBLT1_0038_B08.b :
SPLT1_0100_H02.b :
ILNT1_0067_G12.b :
20110601C-007088 : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
---------+---------+---------+---------+---------+---------+ 105
HTMT1_0032_G04.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0030_F09.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
SPLT1_0035_A03.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
CBLT1_0022_A01.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVRM1_0030_F06.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
SPL01_0075_B02.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
ITT01_0095_D03.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
CBLT1_0072_B06.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
ADR01_0043_F01.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
SMG01_0075_G01.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
SPL01_0051_G12.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVR01_0009_B12.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
DCI01_0036_G01.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVRM1_0112_H04.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
DCI01_0020_A05.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0026_F11.b : TTGGAGCCGACAGGAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0046_C10.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
MLN01_0077_F11.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
ADR01_0062_D01.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVRM1_0199_B09.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
OVR01_0062_D01.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
ITT01_0021_B12.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
UTR01_0095_F06.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
HTMT1_0001_E03.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0095_E05.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVRM1_0193_A03.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
OVRT1_0113_A10.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVRM1_0126_C10.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
KDN01_0033_G12.b : TTGGAGCCGAC*GAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
LVRM1_0176_A04.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
OVRM1_0079_B03.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
SPL01_0026_F05.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
CBLT1_0020_A02.b : TTGGACCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVR01_0095_C07.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVRT1_0040_B12.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0040_C09.b : TTGGAGCCGACCGAAAGTAGCT*GCCTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
BMWN1_0023_E06.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0082_H09.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0030_E04.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0038_B03.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0092_E11.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0042_H03.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0096_A12.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
AMP01_0079_C06.b : TTGGAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0041_C02.b : xxxxAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0099_H08.b : xxxxAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0094_E12.b : xxxxAGCCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0094_G04.b : xxxxxxCCGACAGAAGGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0095_H05.b : xxxxxxCCGACAGAAGGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0084_G07.b : xxxxxxaCGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVRM1_0171_H11.b : xxxxxxxxGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCACCTGCATCCCAGCCAGTTcc
AMP01_0040_G04.b : xxxxxxxaGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
LNG01_0023_G12.b : xxxxxxxxGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
ITT01_0085_B11.b : xxxxxxxxGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVRT1_0144_H03.b : xxxxxxxxGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
SPL01_0058_E05.b : xxxxxxxxGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
SPL01_0056_C04.b : xxxxxxxxGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0085_H04.b : xxxxxxxaGACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0087_H02.b : xxxxxxxxxACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0109_B06.b : xxxxxxxxxACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0002_B11.b : xxxxxxxxxACAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
SPL01_0014_E09.b : xxxxxxxxxxCAGAAAGTAGCTCGCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0025_H04.b : xxxxxxxxxxxAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0026_C12.b : xxxxxxxxxxxAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0004_G06.b : xxxxxxxxxxxAGAAAGTAGCT*GCTTGGGGCGTTCTCCGCCTGCATCCCAGCCAGTTTC
AMP01_0037_A08.b : xxxxxxxxxxxAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0063_A03.b : xxxxxxxxxxxAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
HTMT1_0083_D05.b : xxxxxxxxxxgAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0102_A06.b : xxxxxxxxxxxAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVRT1_0075_F04.b : xxxxxxxxxxaAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0036_A06.b : xxxxxxxxxxxAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0061_G12.b : xxxxxxxxxxxAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0011_E08.b : xxxxxxxxxxxAGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
KDN01_0003_A10.b : cgttgtgctcgtGAAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
PST01_0085_F04.b : tgcttggaccgacgAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
PST01_0005_D11.b : ttggctctgggacgAAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
ADR01_0084_E10.b : xxxxxxxxxxxxxxxAGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVRM1_0194_A03.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
OVRM1_0004_H06.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
OVRM1_0196_H04.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVRM1_0056_A12.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
OVRM1_0053_H08.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
OVRM1_0085_E02.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
OVRM1_0062_C08.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
OVRM1_0186_H09.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
OVRM1_0129_E08.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
SPL01_0074_C01.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
SPL01_0102_C02.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
ADR01_0003_A08.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
SPL01_0034_B08.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
SPL01_0089_A03.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
SPL01_0003_G03.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
UTR01_0088_C08.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
SMG01_0038_D02.b : nnnxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
ITT01_0002_G08.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
ITT01_0097_G08.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVRT1_0054_C01.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
PBL01_0065_D04.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVRT1_0094_F02.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVR01_0100_A01.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
ITT01_0081_C02.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVR01_0091_C02.b : xxxxxxxxxxxxxxxxGTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0040_B02.b : xxxxxxxxxxxxxxxxxTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
AMP01_0004_H04.b : xxxxxxxxxxxxxxxxxTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0016_B01.b : xxxxxxxxxxxxxxxxxTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0091_E02.b : xxxxxxxxxxxxxxxxxTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVRT1_0069_F05.b : xxxxxxxxxxxxxxxxxTAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0029_G12.b : xxxxxxxxxxxxxxxxxxAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0026_C05.b : xxxxxxxxxxxxxxxxxxAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0104_B09.b : xxxxxxxxxxxxxxxxxxAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0105_B09.b : xxxxxxxxxxxxxxxxxxAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0081_E01.b : xxxxxxxxxxxxxxxxxxAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0065_H04.b : xxxxxxxxxxxxxxxxxxAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0092_G07.b : xxxxxxxxxxxxxxxxxxAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0084_H11.b : xxxxxxxxxxxxxxxxxxAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0081_C08.b : xxxxxxxxxxxxxxxxxxAGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
SPL01_0060_F01.b : xxxxxxxxxxxxxxxxxxxGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVRT1_0017_H05.b : xxxxxxxxxxxxxxxxxxxGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVRM1_0152_H06.b : xxxxxxxxxxxxxxxxxxxGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
OVRM1_0192_A03.b : xxxxxxxxxxxxxxxxxxxGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
OVRM1_0018_F04.b : xxxxxxxxxxxxxxxxxxxGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
OVRM1_0215_H02.b : xxxxxxxxxxxxxxxxxxxGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
OVRM1_0203_E02.b : xxxxxxxxxxxxxxxxxxxGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
SPL01_0061_A03.b : xxxxxxxxxxxxxxxxxxxGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVRM1_0186_E11.b : xxxxxxxxxxxxxxxxxxxGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
OVRM1_0126_A08.b : xxxxxxxxxxxxxxxxxxxGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
OVR01_0079_A04.b : xxxxxxxxxxxxxxxxxxxGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
ADR01_0043_F12.b : xxxxxxxxxxxxxxxxxxxGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVRT1_0097_A07.b : xxxxxxxxxxxxxxxxxxxGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
PCT01_0020_F06.b : ctacgggtgctcggnaagtGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVRT1_0134_F02.b : xxxxxxxxxxxxxxxxxxxGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
SPL01_0002_H11.b : xxxxxxxxxxxxxxxxxxxGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVRT1_0152_H12.b : xxxxxxxxxxxxxxxxxxxGCT*GCTTGGAGCGTTTTCCGCCTGCATCCCAGCCAGTTCC
OVRT1_0102_G05.b : xxxxxxxxxxxxxxxxxxxGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
KDN01_0072_A05.b : gcggtggctctggagaagtGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
OVRT1_0116_A03.b : xxxxxxxxxxxxxxxxxxxGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
ADR01_0066_E12.b : xxxxxxxxxxxxxxxxxxxGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
ITT01_0093_F08.b : xxxxxxxxxxxxxxxxxxxGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
ADR01_0088_D04.b : xxxxxxxxxxxxxxxxxxxGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
KDN01_0067_D11.b : gctgtggctctggagaagtGCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
CLNT1_0112_G05.b : xxxxxxxxxxxxxxxxxxxtCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
PCT01_0013_E03.b : ctacgtttgcacggnaagtaCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0035_H04.b : xxxxxxxxxxxxxxxxxxxxCT*GCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
ADR01_0031_H08.b : xxxxxxxxxxxxxxxxxxxxxxxGCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0055_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxCTTGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTcc
SKNB1_0010_D02.b : nntttctcacgttggctctggacngcTGGAGCGTTCTCCGCCTGCATCCC*GCCAGTTCC
BFLT1_0088_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
ADR01_0054_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0034_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0115_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
DCI01_0111_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCGTTCTCCGCCTGCATCCCAGCCAGTTCC
PCT01_0001_B08.b : nnnnnactgagggtgctctggactgcttggaCGTTCTCCGCCTGCATCCCAGCCAGTTCC
PST01_0073_H04.b : ttcctgctgtggctctggactgcttggaCGTTCTCCGCCTGCATCCCAGCCAGTTCC
PST01_0016_F01.b : ttntnncctgcgttggctcggagcgcttggaCGTTCTCCGCCTGCATCCCAGCCAGTTCC
PST01_0031_B05.b : gcgttggctctggagGTTCTCCGCCTGCATCCC*GCCAGTTCC
OVRT1_0053_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGTTCTCCGCCTGCATCCCAGCCAGTTCC
TCH01_0079_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCTCCGCCTGCATCCCAGCCAGTTCC
AMP01_0075_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCTCCGCCTGCATCCCAGCCAGTTcc
SKNB1_0064_A01.b : nnnttccacactgtggcctggagcgctggagcgttnCCGCCTGCATCCCAGCCAGTTCC
OVRM1_0013_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggCTGCATCCCAGCCAGTTcc
OVRM1_0183_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGCATCCCAGCCAGTTcc
PBL01_0074_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggCTGCATCCCAGCCAGTTCC
LNG01_0062_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGCATCCCAGCCAGTTCC
OVRT1_0050_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGCATCCCAGCCAGTTCC
PTG01_0063_A11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxGCATCCCAGCCANTTcc
ADR01_0015_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCATCCCAGCCAGTTCC
BKFL1_0020_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCCCAGCCAGTTCC
DCI01_0100_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATCCCAGCCAGTTCC
OVRM1_0215_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCCCAGCCAGTTcc
AMP01_0051_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGCCAGTTCC
KDN01_0042_H03.b : nntttaactgcgttggctatggctgctcccGCCAGTTCC
LNG01_0031_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxagAGTTCC
AMP01_0072_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGTTcc
OVRM1_0033_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTcc
OVRM1_0002_H03.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTcc
OVRM1_0094_D09.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTcc
OVRM1_0206_F10.b : tcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTcc
SMG01_0103_H07.b : nttagtaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCC
LNG01_0036_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttggcctactcgGTTCC
LNG01_0070_G03.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtcGTTCC
OVR01_0020_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTcc
OVRM1_0210_F02.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgacTTcc
SKNB1_0008_C07.b : nnaaacactcgcgttggctctggatccgccagttc
SKNB1_0037_B01.b : nnccgggnnnnnnttaatgcgttggctatggggttc
DCI01_0016_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0020_B04.b : nnaaccctatttgcgtaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0037_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0105_A03.b :
DCI01_0078_G10.b :
BKFL1_0035_A11.b :
SKNB1_0015_C04.b :
ADR01_0021_D09.b :
TCH01_0091_A11.b :
LNG01_0005_H01.b :
CBLT1_0038_B08.b :
SPLT1_0100_H02.b :
ILNT1_0067_G12.b :
20110601C-007088 : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
---------+---------+---------+---------+---------+---------+ 165
HTMT1_0032_G04.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
DCI01_0030_F09.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
SPLT1_0035_A03.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
CBLT1_0022_A01.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
OVRM1_0030_F06.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
SPL01_0075_B02.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
ITT01_0095_D03.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
CBLT1_0072_B06.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
ADR01_0043_F01.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
SMG01_0075_G01.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGTAGGTTGGAGTCTGGTCCTGCATCAG
SPL01_0051_G12.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
OVR01_0009_B12.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
DCI01_0036_G01.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
OVRM1_0112_H04.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
DCI01_0020_A05.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
AMP01_0026_F11.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
AMP01_0046_C10.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
MLN01_0077_F11.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
ADR01_0062_D01.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
OVRM1_0199_B09.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVR01_0062_D01.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
ITT01_0021_B12.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
UTR01_0095_F06.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
HTMT1_0001_E03.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
AMP01_0095_E05.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
OVRM1_0193_A03.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVRT1_0113_A10.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
OVRM1_0126_C10.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
KDN01_0033_G12.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
LVRM1_0176_A04.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVRM1_0079_B03.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
SPL01_0026_F05.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
CBLT1_0020_A02.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
OVR01_0095_C07.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
OVRT1_0040_B12.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
DCI01_0040_C09.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGCCCTGCATCAG
BMWN1_0023_E06.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
AMP01_0082_H09.b : GCGCGCCGCCGCCCTGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
DCI01_0030_E04.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
DCI01_0038_B03.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
AMP01_0092_E11.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
DCI01_0042_H03.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
AMP01_0096_A12.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
AMP01_0079_C06.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
AMP01_0041_C02.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
DCI01_0099_H08.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
DCI01_0094_E12.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
AMP01_0094_G04.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
AMP01_0095_H05.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
DCI01_0084_G07.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
OVRM1_0171_H11.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
AMP01_0040_G04.b : gcgcgcccccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAC
LNG01_0023_G12.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
ITT01_0085_B11.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
OVRT1_0144_H03.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
SPL01_0058_E05.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
SPL01_0056_C04.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
DCI01_0085_H04.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
DCI01_0087_H02.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
DCI01_0109_B06.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
DCI01_0002_B11.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
SPL01_0014_E09.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
DCI01_0025_H04.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
DCI01_0026_C12.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
AMP01_0004_G06.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
AMP01_0037_A08.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
DCI01_0063_A03.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
HTMT1_0083_D05.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
AMP01_0102_A06.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
OVRT1_0075_F04.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGG*TGGGGTCTGGTCCTGCATCAG
AMP01_0036_A06.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
AMP01_0061_G12.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
DCI01_0011_E08.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
KDN01_0003_A10.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
PST01_0085_F04.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
PST01_0005_D11.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
ADR01_0084_E10.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
OVRM1_0194_A03.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVRM1_0004_H06.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVRM1_0196_H04.b : GCAcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVRM1_0056_A12.b : gcgcgccgccgccccgcgccccgcAGCCCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVRM1_0053_H08.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVRM1_0085_E02.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVRM1_0062_C08.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVRM1_0186_H09.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVRM1_0129_E08.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
SPL01_0074_C01.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
SPL01_0102_C02.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
ADR01_0003_A08.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
SPL01_0034_B08.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
SPL01_0089_A03.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
SPL01_0003_G03.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
UTR01_0088_C08.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
SMG01_0038_D02.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
ITT01_0002_G08.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
ITT01_0097_G08.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
OVRT1_0054_C01.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
PBL01_0065_D04.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
OVRT1_0094_F02.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
OVR01_0100_A01.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
ITT01_0081_C02.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
OVR01_0091_C02.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
AMP01_0040_B02.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
AMP01_0004_H04.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
DCI01_0016_B01.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
DCI01_0091_E02.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
OVRT1_0069_F05.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
DCI01_0029_G12.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
DCI01_0026_C05.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
DCI01_0104_B09.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
DCI01_0105_B09.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCGTCAG
AMP01_0081_E01.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
AMP01_0065_H04.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
AMP01_0092_G07.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
AMP01_0084_H11.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
AMP01_0081_C08.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
SPL01_0060_F01.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
OVRT1_0017_H05.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCCGCATCAG
OVRM1_0152_H06.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVRM1_0192_A03.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVRM1_0018_F04.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVRM1_0215_H02.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVRM1_0203_E02.b : gcgcgccgcc*ccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
SPL01_0061_A03.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
OVRM1_0186_E11.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVRM1_0126_A08.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVR01_0079_A04.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
ADR01_0043_F12.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
OVRT1_0097_A07.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
PCT01_0020_F06.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
OVRT1_0134_F02.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
SPL01_0002_H11.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
OVRT1_0152_H12.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
OVRT1_0102_G05.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
KDN01_0072_A05.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
OVRT1_0116_A03.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
ADR01_0066_E12.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
ITT01_0093_F08.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
ADR01_0088_D04.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
KDN01_0067_D11.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
CLNT1_0112_G05.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
PCT01_0013_E03.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
AMP01_0035_H04.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
ADR01_0031_H08.b : GCGCGTCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
AMP01_0055_F08.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
SKNB1_0010_D02.b : GCGCGCCGTTGCCCCGCGCCCCGCAGCTCTCCCGGAGGTTGGGGTTTCGTCCTGCATCAG
BFLT1_0088_D11.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
ADR01_0054_C11.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
AMP01_0034_G08.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
DCI01_0115_F06.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
DCI01_0111_B10.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
PCT01_0001_B08.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
PST01_0073_H04.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
PST01_0016_F01.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
PST01_0031_B05.b : GCGCGCCGCCGTCCCGCGACCCCTATATCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
OVRT1_0053_H03.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
TCH01_0079_G12.b : GCGCGCCGCCGCCCCGCGACCCGCAACTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAA
AMP01_0075_G02.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
SKNB1_0064_A01.b : GCGCGCCGCCTCCCCGCGCCCCGCAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVRM1_0013_C11.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVRM1_0183_C11.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
PBL01_0074_E03.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
LNG01_0062_E09.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
OVRT1_0050_D03.b : GCGCGCCGCCGTCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
PTG01_0063_A11.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
ADR01_0015_C03.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGTAGTCTGGTCCTGCATCAG
BKFL1_0020_G05.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
DCI01_0100_D11.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
OVRM1_0215_D06.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
AMP01_0051_C04.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCCGGTCCTGCATCAG
KDN01_0042_H03.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCTGAGGTTGGAGTCTGGTCCTGCATCAG
LNG01_0031_H02.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
AMP01_0072_H01.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVRM1_0033_A09.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVRM1_0002_H03.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVRM1_0094_D09.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVRM1_0206_F10.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
SMG01_0103_H07.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
LNG01_0036_H08.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
LNG01_0070_G03.b : GCGCGCCGCCGCCCCGCGACCCGCAGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
OVR01_0020_G04.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
OVRM1_0210_F02.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
SKNB1_0008_C07.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCCGTGGTTGGGGTTTGGTCCTGCATCAG
SKNB1_0037_B01.b : gcgcgccgccgccccgcgccccgcAGCTCTCCCGGAGGTTGGGGTTTGGTCCTGCATCAG
DCI01_0016_H09.b : xxxxxxxxxxxxxxxxxxACCCGCAGCTCTCCCGGAGGTTGGAGTCTGGTCCTGCATCAG
OVRT1_0020_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxGCTCTCCCGGAGGTTGGGGTCTGGTCCTGCATCAG
DCI01_0037_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGTTGGAGTCTGGTCCTGCATCAG
DCI01_0105_A03.b : nngggataaannaaacgatacttaxxxxxxxxxxxxxxxxxxxx
DCI01_0078_G10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0035_A11.b : nnnnnnnnnnnnnnnnn
SKNB1_0015_C04.b :
ADR01_0021_D09.b :
TCH01_0091_A11.b :
LNG01_0005_H01.b :
CBLT1_0038_B08.b :
SPLT1_0100_H02.b :
ILNT1_0067_G12.b :
20110601C-007088 : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
---------+---------+---------+---------+---------+---------+ 225
HTMT1_0032_G04.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0030_F09.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
SPLT1_0035_A03.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
CBLT1_0022_A01.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0030_F06.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
SPL01_0075_B02.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
ITT01_0095_D03.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
CBLT1_0072_B06.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
ADR01_0043_F01.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
SMG01_0075_G01.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
SPL01_0051_G12.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVR01_0009_B12.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0036_G01.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0112_H04.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0020_A05.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0026_F11.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGCGACTGA
AMP01_0046_C10.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
MLN01_0077_F11.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
ADR01_0062_D01.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0199_B09.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVR01_0062_D01.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
ITT01_0021_B12.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
UTR01_0095_F06.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
HTMT1_0001_E03.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0095_E05.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0193_A03.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRT1_0113_A10.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0126_C10.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
KDN01_0033_G12.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
LVRM1_0176_A04.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0079_B03.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
SPL01_0026_F05.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
CBLT1_0020_A02.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVR01_0095_C07.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRT1_0040_B12.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0040_C09.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
BMWN1_0023_E06.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0082_H09.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0030_E04.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0038_B03.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0092_E11.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0042_H03.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0096_A12.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0079_C06.b : TCACCCTTTCCTGACCTGGGTAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0041_C02.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0099_H08.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0094_E12.b : CCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0094_G04.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0095_H05.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0084_G07.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0171_H11.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0040_G04.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACACGTTCTCACAGGCACTGTGACTGA
LNG01_0023_G12.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
ITT01_0085_B11.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRT1_0144_H03.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACCGTGACTGA
SPL01_0058_E05.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
SPL01_0056_C04.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0085_H04.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0087_H02.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0109_B06.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0002_B11.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
SPL01_0014_E09.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0025_H04.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0026_C12.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0004_G06.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0037_A08.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0063_A03.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
HTMT1_0083_D05.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0102_A06.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRT1_0075_F04.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0036_A06.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0061_G12.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0011_E08.b : TCACCTTTTCCTGACCTAGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
KDN01_0003_A10.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
PST01_0085_F04.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
PST01_0005_D11.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
ADR01_0084_E10.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0194_A03.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0004_H06.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0196_H04.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0056_A12.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0053_H08.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0085_E02.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0062_C08.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0186_H09.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0129_E08.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
SPL01_0074_C01.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
SPL01_0102_C02.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
ADR01_0003_A08.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
SPL01_0034_B08.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
SPL01_0089_A03.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
SPL01_0003_G03.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
UTR01_0088_C08.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
SMG01_0038_D02.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
ITT01_0002_G08.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
ITT01_0097_G08.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRT1_0054_C01.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
PBL01_0065_D04.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRT1_0094_F02.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVR01_0100_A01.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
ITT01_0081_C02.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVR01_0091_C02.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0040_B02.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0004_H04.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0016_B01.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0091_E02.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRT1_0069_F05.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0029_G12.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0026_C05.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0104_B09.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0105_B09.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0081_E01.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0065_H04.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0092_G07.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0084_H11.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0081_C08.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
SPL01_0060_F01.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRT1_0017_H05.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0152_H06.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0192_A03.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCACAGGCACTGTGACTGA
OVRM1_0018_F04.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0215_H02.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0203_E02.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGACACAGGTTCTCAGAGGCACTGTGACTGA
SPL01_0061_A03.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0186_E11.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0126_A08.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVR01_0079_A04.b : TCACCTTTTCCTGACCTGGGCAGTCCCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
ADR01_0043_F12.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRT1_0097_A07.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
PCT01_0020_F06.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRT1_0134_F02.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
SPL01_0002_H11.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRT1_0152_H12.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRT1_0102_G05.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
KDN01_0072_A05.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRT1_0116_A03.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
ADR01_0066_E12.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
ITT01_0093_F08.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
ADR01_0088_D04.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
KDN01_0067_D11.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
CLNT1_0112_G05.b : TCACCTTTTCCTGACCTGGACAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
PCT01_0013_E03.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0035_H04.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
ADR01_0031_H08.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0055_F08.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
SKNB1_0010_D02.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
BFLT1_0088_D11.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
ADR01_0054_C11.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0034_G08.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0115_F06.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0111_B10.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
PCT01_0001_B08.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
PST01_0073_H04.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
PST01_0016_F01.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
PST01_0031_B05.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRT1_0053_H03.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
TCH01_0079_G12.b : TCACCTTTTCCTGACCTGCGCAGTCACTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0075_G02.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
SKNB1_0064_A01.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0013_C11.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0183_C11.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
PBL01_0074_E03.b : TCACTTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
LNG01_0062_E09.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRT1_0050_D03.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
PTG01_0063_A11.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
ADR01_0015_C03.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
BKFL1_0020_G05.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCCGAGGCACTGTGACTGA
DCI01_0100_D11.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0215_D06.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0051_C04.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
KDN01_0042_H03.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
LNG01_0031_H02.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
AMP01_0072_H01.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0033_A09.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0002_H03.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0094_D09.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0206_F10.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
SMG01_0103_H07.b : TCACCTTTTCCTGACCTGGGCAGCCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
LNG01_0036_H08.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
LNG01_0070_G03.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVR01_0020_G04.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRM1_0210_F02.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
SKNB1_0008_C07.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
SKNB1_0037_B01.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0016_H09.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
OVRT1_0020_B04.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0037_C07.b : TCACCTTTTCCTGACCTGGGCAGTCGCTATGGCACAGGTTCTCAGAGGCACTGTGACTGA
DCI01_0105_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0078_G10.b : nnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0035_A11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0015_C04.b :
ADR01_0021_D09.b :
TCH01_0091_A11.b :
LNG01_0005_H01.b :
CBLT1_0038_B08.b :
SPLT1_0100_H02.b :
ILNT1_0067_G12.b :
20110601C-007088 : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
---------+---------+---------+---------+---------+---------+ 285
HTMT1_0032_G04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0030_F09.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
SPLT1_0035_A03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
CBLT1_0022_A01.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0030_F06.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
SPL01_0075_B02.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
ITT01_0095_D03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
CBLT1_0072_B06.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
ADR01_0043_F01.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
SMG01_0075_G01.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
SPL01_0051_G12.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVR01_0009_B12.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATAAAAGGCCT
DCI01_0036_G01.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0112_H04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0020_A05.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGGAGGCCATGAAAGGCCT
AMP01_0026_F11.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0046_C10.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
MLN01_0077_F11.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
ADR01_0062_D01.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0199_B09.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVR01_0062_D01.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
ITT01_0021_B12.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
UTR01_0095_F06.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
HTMT1_0001_E03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0095_E05.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0193_A03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRT1_0113_A10.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0126_C10.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
KDN01_0033_G12.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
LVRM1_0176_A04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0079_B03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
SPL01_0026_F05.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
CBLT1_0020_A02.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVR01_0095_C07.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCTT
OVRT1_0040_B12.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0040_C09.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCCGAAGGCCATGAAAGGCCT
BMWN1_0023_E06.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0082_H09.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0030_E04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0038_B03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0092_E11.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0042_H03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0096_A12.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0079_C06.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0041_C02.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0099_H08.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0094_E12.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0094_G04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0095_H05.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0084_G07.b : CTTCCCTGGATTTGATGAGTGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0171_H11.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0040_G04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCACAAACTCTTCGGAAGGCCATGAAAGGCCT
LNG01_0023_G12.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
ITT01_0085_B11.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRT1_0144_H03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
SPL01_0058_E05.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
SPL01_0056_C04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0085_H04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0087_H02.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0109_B06.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0002_B11.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCACAAACTCTTCGGAAGGCCATGAAAGGCCT
SPL01_0014_E09.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0025_H04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0026_C12.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAAGCCATGAAAGGCCT
AMP01_0004_G06.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0037_A08.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCACAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0063_A03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
HTMT1_0083_D05.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0102_A06.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRT1_0075_F04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0036_A06.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCACAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0061_G12.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0011_E08.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
KDN01_0003_A10.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
PST01_0085_F04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
PST01_0005_D11.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
ADR01_0084_E10.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0194_A03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0004_H06.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0196_H04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0056_A12.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0053_H08.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0085_E02.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0062_C08.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0186_H09.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0129_E08.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
SPL01_0074_C01.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
SPL01_0102_C02.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
ADR01_0003_A08.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
SPL01_0034_B08.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
SPL01_0089_A03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
SPL01_0003_G03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
UTR01_0088_C08.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
SMG01_0038_D02.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
ITT01_0002_G08.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
ITT01_0097_G08.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRT1_0054_C01.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
PBL01_0065_D04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRT1_0094_F02.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVR01_0100_A01.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
ITT01_0081_C02.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVR01_0091_C02.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0040_B02.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCANAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0004_H04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0016_B01.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0091_E02.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRT1_0069_F05.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0029_G12.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0026_C05.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0104_B09.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0105_B09.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0081_E01.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0065_H04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0092_G07.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0084_H11.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0081_C08.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
SPL01_0060_F01.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRT1_0017_H05.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0152_H06.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0192_A03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0018_F04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0215_H02.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0203_E02.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
SPL01_0061_A03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0186_E11.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0126_A08.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAAAAACTCTTCGGAAGGCCATGAAAGGCCT
OVR01_0079_A04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
ADR01_0043_F12.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRT1_0097_A07.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
PCT01_0020_F06.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRT1_0134_F02.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
SPL01_0002_H11.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRT1_0152_H12.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRT1_0102_G05.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
KDN01_0072_A05.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRT1_0116_A03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
ADR01_0066_E12.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAAAAACTCTTCGGAAGGCCATGAAAGGCCT
ITT01_0093_F08.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
ADR01_0088_D04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
KDN01_0067_D11.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
CLNT1_0112_G05.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
PCT01_0013_E03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0035_H04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
ADR01_0031_H08.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0055_F08.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
SKNB1_0010_D02.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
BFLT1_0088_D11.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
ADR01_0054_C11.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0034_G08.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCACAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0115_F06.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0111_B10.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
PCT01_0001_B08.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
PST01_0073_H04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAGGGCCT
PST01_0016_F01.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
PST01_0031_B05.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGGGG
OVRT1_0053_H03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
TCH01_0079_G12.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCATAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0075_G02.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
SKNB1_0064_A01.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0013_C11.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0183_C11.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
PBL01_0074_E03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
LNG01_0062_E09.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRT1_0050_D03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
PTG01_0063_A11.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
ADR01_0015_C03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
BKFL1_0020_G05.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0100_D11.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0215_D06.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0051_C04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
KDN01_0042_H03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
LNG01_0031_H02.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
AMP01_0072_H01.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0033_A09.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0002_H03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0094_D09.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRM1_0206_F10.b : CTTCACTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
SMG01_0103_H07.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
LNG01_0036_H08.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
LNG01_0070_G03.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVR01_0020_G04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCAGGAAAGGCCT
OVRM1_0210_F02.b : CTTCCCTGGATTTGATGAGCGGGCTGGTGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
SKNB1_0008_C07.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGACCATGAAAGGCCT
SKNB1_0037_B01.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0016_H09.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
OVRT1_0020_B04.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0037_C07.b : CTTCCCTGGATTTGATGAGCGGGCTGATGCAGAAACTCTTCGGAAGGCCATGAAAGGCCT
DCI01_0105_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0078_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0035_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0015_C04.b :
ADR01_0021_D09.b :
TCH01_0091_A11.b :
LNG01_0005_H01.b :
CBLT1_0038_B08.b :
SPLT1_0100_H02.b :
ILNT1_0067_G12.b :
20110601C-007088 : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
---------+---------+---------+---------+---------+---------+ 345
HTMT1_0032_G04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0030_F09.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
SPLT1_0035_A03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
CBLT1_0022_A01.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0030_F06.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
SPL01_0075_B02.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
ITT01_0095_D03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
CBLT1_0072_B06.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
ADR01_0043_F01.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
SMG01_0075_G01.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
SPL01_0051_G12.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVR01_0009_B12.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0036_G01.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0112_H04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0020_A05.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0026_F11.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0046_C10.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
MLN01_0077_F11.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
ADR01_0062_D01.b : GGGCACTGACGAGGAGGGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0199_B09.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVR01_0062_D01.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
ITT01_0021_B12.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
UTR01_0095_F06.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
HTMT1_0001_E03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0095_E05.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0193_A03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRT1_0113_A10.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0126_C10.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
KDN01_0033_G12.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
LVRM1_0176_A04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0079_B03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
SPL01_0026_F05.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
CBLT1_0020_A02.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVR01_0095_C07.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRT1_0040_B12.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0040_C09.b : GGGCACTGACGAGGAGAGCATCCCGACTCTGTTGACCTCCCCCAGTAATGCTCAGCGCCC
BMWN1_0023_E06.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0082_H09.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0030_E04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0038_B03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0092_E11.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0042_H03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0096_A12.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0079_C06.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0041_C02.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0099_H08.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0094_E12.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0094_G04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0095_H05.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0084_G07.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0171_H11.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0040_G04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
LNG01_0023_G12.b : GGGCACTGACAAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
ITT01_0085_B11.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRT1_0144_H03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
SPL01_0058_E05.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
SPL01_0056_C04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0085_H04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0087_H02.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0109_B06.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0002_B11.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
SPL01_0014_E09.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0025_H04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0026_C12.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0004_G06.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCCCAGCGCCA
AMP01_0037_A08.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0063_A03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
HTMT1_0083_D05.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0102_A06.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRT1_0075_F04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0036_A06.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0061_G12.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0011_E08.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
KDN01_0003_A10.b : GGGCACTGACGAGGGGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
PST01_0085_F04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
PST01_0005_D11.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
ADR01_0084_E10.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0194_A03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0004_H06.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCACTAATGCTCAGCGCCA
OVRM1_0196_H04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0056_A12.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0053_H08.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0085_E02.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0062_C08.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCN
OVRM1_0186_H09.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0129_E08.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
SPL01_0074_C01.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
SPL01_0102_C02.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
ADR01_0003_A08.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
SPL01_0034_B08.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
SPL01_0089_A03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
SPL01_0003_G03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
UTR01_0088_C08.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
SMG01_0038_D02.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
ITT01_0002_G08.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
ITT01_0097_G08.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRT1_0054_C01.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
PBL01_0065_D04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRT1_0094_F02.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVR01_0100_A01.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
ITT01_0081_C02.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVR01_0091_C02.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0040_B02.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0004_H04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0016_B01.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0091_E02.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRT1_0069_F05.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0029_G12.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0026_C05.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0104_B09.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0105_B09.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0081_E01.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0065_H04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0092_G07.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0084_H11.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0081_C08.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
SPL01_0060_F01.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRT1_0017_H05.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0152_H06.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0192_A03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0018_F04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0215_H02.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0203_E02.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
SPL01_0061_A03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0186_E11.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0126_A08.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVR01_0079_A04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
ADR01_0043_F12.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRT1_0097_A07.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
PCT01_0020_F06.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRT1_0134_F02.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
SPL01_0002_H11.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRT1_0152_H12.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRT1_0102_G05.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
KDN01_0072_A05.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRT1_0116_A03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
ADR01_0066_E12.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
ITT01_0093_F08.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
ADR01_0088_D04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
KDN01_0067_D11.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
CLNT1_0112_G05.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
PCT01_0013_E03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0035_H04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
ADR01_0031_H08.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0055_F08.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
SKNB1_0010_D02.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
BFLT1_0088_D11.b : GGGCACTGATGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
ADR01_0054_C11.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATACTCAGCGCCA
AMP01_0034_G08.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0115_F06.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0111_B10.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
PCT01_0001_B08.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
PST01_0073_H04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
PST01_0016_F01.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
PST01_0031_B05.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRT1_0053_H03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
TCH01_0079_G12.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCATCGCCA
AMP01_0075_G02.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
SKNB1_0064_A01.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0013_C11.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0183_C11.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
PBL01_0074_E03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
LNG01_0062_E09.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRT1_0050_D03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
PTG01_0063_A11.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
ADR01_0015_C03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
BKFL1_0020_G05.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0100_D11.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0215_D06.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0051_C04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
KDN01_0042_H03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
LNG01_0031_H02.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
AMP01_0072_H01.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0033_A09.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0002_H03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0094_D09.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0206_F10.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
SMG01_0103_H07.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
LNG01_0036_H08.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
LNG01_0070_G03.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVR01_0020_G04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRM1_0210_F02.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
SKNB1_0008_C07.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
SKNB1_0037_B01.b : GGGCACTGACGAGGAGAGCATCCTGTCTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0016_H09.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
OVRT1_0020_B04.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0037_C07.b : GGGCACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0105_A03.b : xxxxACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
DCI01_0078_G10.b : xxxxACTGACGAGGAGAGCATCCTGACTCTGTTGACCTCCCGCAGTAATGCTCAGCGCCA
BKFL1_0035_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACCTCCCGCAGTAATGCTCAGCGCCA
SKNB1_0015_C04.b :
ADR01_0021_D09.b :
TCH01_0091_A11.b :
LNG01_0005_H01.b :
CBLT1_0038_B08.b :
SPLT1_0100_H02.b :
ILNT1_0067_G12.b :
20110601C-007088 : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
---------+---------+---------+---------+---------+---------+ 404
HTMT1_0032_G04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0030_F09.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SPLT1_0035_A03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
CBLT1_0022_A01.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0030_F06.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SPL01_0075_B02.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
ITT01_0095_D03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
CBLT1_0072_B06.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
ADR01_0043_F01.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SMG01_0075_G01.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SPL01_0051_G12.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVR01_0009_B12.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0036_G01.b : GGAGATCGCTGAGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0112_H04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0020_A05.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0026_F11.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0046_C10.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
MLN01_0077_F11.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
ADR01_0062_D01.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0199_B09.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVR01_0062_D01.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
ITT01_0021_B12.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
UTR01_0095_F06.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
HTMT1_0001_E03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0095_E05.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0193_A03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRT1_0113_A10.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAC
OVRM1_0126_C10.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
KDN01_0033_G12.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
LVRM1_0176_A04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0079_B03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SPL01_0026_F05.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
CBLT1_0020_A02.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVR01_0095_C07.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRT1_0040_B12.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0040_C09.b : GGAGATCGCTGTGGCTTTTACAACTCTCTTTGGCACGGACCTTCTGGATGACCCTGAAAT
BMWN1_0023_E06.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0082_H09.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0030_E04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0038_B03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0092_E11.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0042_H03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0096_A12.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0079_C06.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0041_C02.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0099_H08.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0094_E12.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAGT
AMP01_0094_G04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0095_H05.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0084_G07.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0171_H11.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0040_G04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
LNG01_0023_G12.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
ITT01_0085_B11.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRT1_0144_H03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SPL01_0058_E05.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SPL01_0056_C04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0085_H04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0087_H02.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0109_B06.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0002_B11.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SPL01_0014_E09.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0025_H04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0026_C12.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0004_G06.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0037_A08.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0063_A03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
HTMT1_0083_D05.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0102_A06.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRT1_0075_F04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0036_A06.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0061_G12.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0011_E08.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
KDN01_0003_A10.b : GGAGATCGCTGTGGCTTTTAAA*CTCTCTTTGGCAGGNACCTTCTGGATGNN*ACTGAAT
PST01_0085_F04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
PST01_0005_D11.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
ADR01_0084_E10.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0194_A03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0004_H06.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0196_H04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0056_A12.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0053_H08.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0085_E02.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0062_C08.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0186_H09.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0129_E08.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SPL01_0074_C01.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SPL01_0102_C02.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
ADR01_0003_A08.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SPL01_0034_B08.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SPL01_0089_A03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SPL01_0003_G03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
UTR01_0088_C08.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SMG01_0038_D02.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
ITT01_0002_G08.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
ITT01_0097_G08.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRT1_0054_C01.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
PBL01_0065_D04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRT1_0094_F02.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVR01_0100_A01.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
ITT01_0081_C02.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVR01_0091_C02.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0040_B02.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0004_H04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGACGAC*CTGAAAT
DCI01_0016_B01.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0091_E02.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRT1_0069_F05.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0029_G12.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0026_C05.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0104_B09.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0105_B09.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0081_E01.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0065_H04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0092_G07.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0084_H11.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0081_C08.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SPL01_0060_F01.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRT1_0017_H05.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0152_H06.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0192_A03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0018_F04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0215_H02.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0203_E02.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SPL01_0061_A03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0186_E11.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0126_A08.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVR01_0079_A04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
ADR01_0043_F12.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRT1_0097_A07.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
PCT01_0020_F06.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRT1_0134_F02.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SPL01_0002_H11.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRT1_0152_H12.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRT1_0102_G05.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
KDN01_0072_A05.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRT1_0116_A03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
ADR01_0066_E12.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
ITT01_0093_F08.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
ADR01_0088_D04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
KDN01_0067_D11.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
CLNT1_0112_G05.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
PCT01_0013_E03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0035_H04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
ADR01_0031_H08.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0055_F08.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SKNB1_0010_D02.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
BFLT1_0088_D11.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
ADR01_0054_C11.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0034_G08.b : GGAGATCGCTGTGGCTTTTAAAACTCCCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0115_F06.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0111_B10.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
PCT01_0001_B08.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
PST01_0073_H04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
PST01_0016_F01.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
PST01_0031_B05.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRT1_0053_H03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
TCH01_0079_G12.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0075_G02.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SKNB1_0064_A01.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0013_C11.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0183_C11.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
PBL01_0074_E03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAGT
LNG01_0062_E09.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRT1_0050_D03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
PTG01_0063_A11.b : GGAGATCGCTGTGGCTTTTAAA*CTCTCTTTGGCAGGGACCTTCTGGAGGAC*CTGAAAT
ADR01_0015_C03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
BKFL1_0020_G05.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0100_D11.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0215_D06.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0051_C04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
KDN01_0042_H03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
LNG01_0031_H02.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
AMP01_0072_H01.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0033_A09.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0002_H03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0094_D09.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0206_F10.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SMG01_0103_H07.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
LNG01_0036_H08.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
LNG01_0070_G03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVR01_0020_G04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRM1_0210_F02.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SKNB1_0008_C07.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SKNB1_0037_B01.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0016_H09.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
OVRT1_0020_B04.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0037_C07.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0105_A03.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
DCI01_0078_G10.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
BKFL1_0035_A11.b : GGAGATCGCTGTGGCTTTTAAAACTCTCTTTGGCAGGGACCTTCTGGATGAC*CTGAAAT
SKNB1_0015_C04.b :
ADR01_0021_D09.b : ntcaacaxxxxxxxxxxx
TCH01_0091_A11.b : nnnnagctag
LNG01_0005_H01.b :
CBLT1_0038_B08.b :
SPLT1_0100_H02.b :
ILNT1_0067_G12.b :
20110601C-007088 : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
---------+---------+---------+---------+---------+---------+ 463
HTMT1_0032_G04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0030_F09.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SPLT1_0035_A03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
CBLT1_0022_A01.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0030_F06.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SPL01_0075_B02.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
ITT01_0095_D03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
CBLT1_0072_B06.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
ADR01_0043_F01.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SMG01_0075_G01.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SPL01_0051_G12.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVR01_0009_B12.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0036_G01.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0112_H04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0020_A05.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0026_F11.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0046_C10.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
MLN01_0077_F11.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
ADR01_0062_D01.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0199_B09.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVR01_0062_D01.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
ITT01_0021_B12.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
UTR01_0095_F06.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
HTMT1_0001_E03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0095_E05.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAATCTTCTCGGCTG
OVRM1_0193_A03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGAGG*CTTTGATGAAACCTTCTCGGCTG
OVRT1_0113_A10.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0126_C10.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
KDN01_0033_G12.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
LVRM1_0176_A04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0079_B03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SPL01_0026_F05.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
CBLT1_0020_A02.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVR01_0095_C07.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRT1_0040_B12.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0040_C09.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGACACCTTCTCGGCTG
BMWN1_0023_E06.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0082_H09.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0030_E04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0038_B03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0092_E11.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0042_H03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0096_A12.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0079_C06.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTGTGATGAAACCTTCTCGGCTG
AMP01_0041_C02.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0099_H08.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGGTGAAACCTTCTCGGCTG
DCI01_0094_E12.b : CAGAGCTGACAGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0094_G04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0095_H05.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0084_G07.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0171_H11.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGGACTTTAATGAAACCATCTCGGCTG
AMP01_0040_G04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
LNG01_0023_G12.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
ITT01_0085_B11.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRT1_0144_H03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SPL01_0058_E05.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SPL01_0056_C04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0085_H04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0087_H02.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0109_B06.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0002_B11.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SPL01_0014_E09.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0025_H04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0026_C12.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0004_G06.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0037_A08.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0063_A03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
HTMT1_0083_D05.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0102_A06.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRT1_0075_F04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0036_A06.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0061_G12.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0011_E08.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
KDN01_0003_A10.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTTCTCGCTG
PST01_0085_F04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
PST01_0005_D11.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
ADR01_0084_E10.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGGAACCTTCTCGGCTG
OVRM1_0194_A03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0004_H06.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0196_H04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0056_A12.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0053_H08.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0085_E02.b : CAGGGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0062_C08.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0186_H09.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0129_E08.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SPL01_0074_C01.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SPL01_0102_C02.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
ADR01_0003_A08.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SPL01_0034_B08.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SPL01_0089_A03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SPL01_0003_G03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
UTR01_0088_C08.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SMG01_0038_D02.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
ITT01_0002_G08.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
ITT01_0097_G08.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRT1_0054_C01.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
PBL01_0065_D04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRT1_0094_F02.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVR01_0100_A01.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
ITT01_0081_C02.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVR01_0091_C02.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0040_B02.b : CAGAGCTGACTGGAAAATTTGAAAAATTGATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0004_H04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0016_B01.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0091_E02.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRT1_0069_F05.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0029_G12.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0026_C05.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0104_B09.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0105_B09.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTCTGATGAAACCTTCTCGGCTG
AMP01_0081_E01.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0065_H04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0092_G07.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0084_H11.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0081_C08.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SPL01_0060_F01.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGACTG
OVRT1_0017_H05.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0152_H06.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0192_A03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0018_F04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0215_H02.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0203_E02.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SPL01_0061_A03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0186_E11.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0126_A08.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVR01_0079_A04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
ADR01_0043_F12.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRT1_0097_A07.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
PCT01_0020_F06.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRT1_0134_F02.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SPL01_0002_H11.b : CAGAGCTGACTGGAAAATTTGAAAAGTTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRT1_0152_H12.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRT1_0102_G05.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
KDN01_0072_A05.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRT1_0116_A03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
ADR01_0066_E12.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
ITT01_0093_F08.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
ADR01_0088_D04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
KDN01_0067_D11.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
CLNT1_0112_G05.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
PCT01_0013_E03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0035_H04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
ADR01_0031_H08.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0055_F08.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SKNB1_0010_D02.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
BFLT1_0088_D11.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
ADR01_0054_C11.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0034_G08.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0115_F06.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0111_B10.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
PCT01_0001_B08.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
PST01_0073_H04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
PST01_0016_F01.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
PST01_0031_B05.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRT1_0053_H03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
TCH01_0079_G12.b : CAAAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0075_G02.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SKNB1_0064_A01.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0013_C11.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0183_C11.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
PBL01_0074_E03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
LNG01_0062_E09.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRT1_0050_D03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
PTG01_0063_A11.b : CAGAGCTGACTGGAAAATTTNGAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
ADR01_0015_C03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
BKFL1_0020_G05.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0100_D11.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0215_D06.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0051_C04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
KDN01_0042_H03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
LNG01_0031_H02.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
AMP01_0072_H01.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0033_A09.b : CAGAGCCGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0002_H03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0094_D09.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCCTCTCGGCTG
OVRM1_0206_F10.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SMG01_0103_H07.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
LNG01_0036_H08.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
LNG01_0070_G03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVR01_0020_G04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRM1_0210_F02.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SKNB1_0008_C07.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SKNB1_0037_B01.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0016_H09.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
OVRT1_0020_B04.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0037_C07.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0105_A03.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
DCI01_0078_G10.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
BKFL1_0035_A11.b : CAGAGCTGACTGGAAAATTTGAAAAATTAATCGTGG*CTTTGATGAAACCTTCTCGGCTG
SKNB1_0015_C04.b : nnnggattgctgtggctatggtATCGTGG*CTTTGATGAA*CCTTCTCGGCTG
ADR01_0021_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGTGG*CTTTGATGAAACCTTCTCGGCTG
TCH01_0091_A11.b : gactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0005_H01.b : tttttttttggcattgtgxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0038_B08.b :
SPLT1_0100_H02.b :
ILNT1_0067_G12.b :
20110601C-007088 : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
---------+---------+---------+---------+---------+---------+ 523
HTMT1_0032_G04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0030_F09.b : TACGATGCCTATGGACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGNAAATCCTG
SPLT1_0035_A03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
CBLT1_0022_A01.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0030_F06.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
SPL01_0075_B02.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
ITT01_0095_D03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
CBLT1_0072_B06.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
ADR01_0043_F01.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
SMG01_0075_G01.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
SPL01_0051_G12.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVR01_0009_B12.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0036_G01.b : TACGATGCCTATGAACTGGAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0112_H04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0020_A05.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0026_F11.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0046_C10.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
MLN01_0077_F11.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
ADR01_0062_D01.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0199_B09.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVR01_0062_D01.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
ITT01_0021_B12.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
UTR01_0095_F06.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
HTMT1_0001_E03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0095_E05.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0193_A03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRT1_0113_A10.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0126_C10.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
KDN01_0033_G12.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
LVRM1_0176_A04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0079_B03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
SPL01_0026_F05.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
CBLT1_0020_A02.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVR01_0095_C07.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRT1_0040_B12.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0040_C09.b : TACGATGCCCATGAACTGAAGCTTGCTCTTAAGGGCACCGAGACCCATGAGAAAATCCCG
BMWN1_0023_E06.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0082_H09.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0030_E04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCAG
DCI01_0038_B03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACTGATGAGAAAATCCTG
AMP01_0092_E11.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0042_H03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0096_A12.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0079_C06.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0041_C02.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0099_H08.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0094_E12.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0094_G04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0095_H05.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0084_G07.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0171_H11.b : TACGATGCCTATGAACAGAAACATGCTCTcaacagtactacggacagatgagagaacctt
AMP01_0040_G04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
LNG01_0023_G12.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
ITT01_0085_B11.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRT1_0144_H03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
SPL01_0058_E05.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
SPL01_0056_C04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0085_H04.b : TACGATGCCTATGAACTGAGGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0087_H02.b : TGCGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0109_B06.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0002_B11.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
SPL01_0014_E09.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0025_H04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0026_C12.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0004_G06.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0037_A08.b : TACGGTGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0063_A03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
HTMT1_0083_D05.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0102_A06.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRT1_0075_F04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0036_A06.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0061_G12.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0011_E08.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
KDN01_0003_A10.b : TACGATGCCCATGAACTGNAGCATGCTCTTNAGGGAGCTGGGACAGATGANAAAATCCTG
PST01_0085_F04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
PST01_0005_D11.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGTGCTGGGACAGATGAGAAAATCCTG
ADR01_0084_E10.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0194_A03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAATATCCTG
OVRM1_0004_H06.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0196_H04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0056_A12.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0053_H08.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0085_E02.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0062_C08.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0186_H09.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0129_E08.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
SPL01_0074_C01.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
SPL01_0102_C02.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
ADR01_0003_A08.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
SPL01_0034_B08.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
SPL01_0089_A03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
SPL01_0003_G03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
UTR01_0088_C08.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
SMG01_0038_D02.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
ITT01_0002_G08.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
ITT01_0097_G08.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRT1_0054_C01.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
PBL01_0065_D04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRT1_0094_F02.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVR01_0100_A01.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
ITT01_0081_C02.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVR01_0091_C02.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0040_B02.b : TACGATGCCTATGAANCTGAGCATGCTCTTAAGGGAGCTGGGACAGATGAAAAAATCCTG
AMP01_0004_H04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0016_B01.b : TACGATGCCTATGAACTGGAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0091_E02.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRT1_0069_F05.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0029_G12.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0026_C05.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0104_B09.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGNAAATCCTG
DCI01_0105_B09.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0081_E01.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0065_H04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0092_G07.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0084_H11.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0081_C08.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
SPL01_0060_F01.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRT1_0017_H05.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0152_H06.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0192_A03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0018_F04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0215_H02.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0203_E02.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
SPL01_0061_A03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0186_E11.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0126_A08.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVR01_0079_A04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
ADR01_0043_F12.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRT1_0097_A07.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
PCT01_0020_F06.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRT1_0134_F02.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
SPL01_0002_H11.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRT1_0152_H12.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRT1_0102_G05.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
KDN01_0072_A05.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRT1_0116_A03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
ADR01_0066_E12.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
ITT01_0093_F08.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
ADR01_0088_D04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
KDN01_0067_D11.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
CLNT1_0112_G05.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
PCT01_0013_E03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0035_H04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
ADR01_0031_H08.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0055_F08.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
SKNB1_0010_D02.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
BFLT1_0088_D11.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
ADR01_0054_C11.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0034_G08.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGGAAATCCTG
DCI01_0115_F06.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0111_B10.b : TACGATGCCTGTGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
PCT01_0001_B08.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
PST01_0073_H04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
PST01_0016_F01.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
PST01_0031_B05.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRT1_0053_H03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
TCH01_0079_G12.b : TACAATGCCTATGAACTGAGGCATGCTCTTAAGGGAGCTGGGACAGATGACAAAATCCTG
AMP01_0075_G02.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
SKNB1_0064_A01.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0013_C11.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0183_C11.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
PBL01_0074_E03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
LNG01_0062_E09.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRT1_0050_D03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
PTG01_0063_A11.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGNAGCTGGGACAGATGAAAAAATCCTG
ADR01_0015_C03.b : TACGATGCCTATGAACTGAAGTATGCTCTTAAGGGAGCTGGGACAGATGATAAAATCCTG
BKFL1_0020_G05.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0100_D11.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0215_D06.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0051_C04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
KDN01_0042_H03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
LNG01_0031_H02.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
AMP01_0072_H01.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0033_A09.b : CACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0002_H03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0094_D09.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAAATGAGAAAATCCTG
OVRM1_0206_F10.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
SMG01_0103_H07.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
LNG01_0036_H08.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
LNG01_0070_G03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVR01_0020_G04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
OVRM1_0210_F02.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
SKNB1_0008_C07.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
SKNB1_0037_B01.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0016_H09.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACGGATGAGAAAATCCTG
OVRT1_0020_B04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0037_C07.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0105_A03.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
DCI01_0078_G10.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
BKFL1_0035_A11.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
SKNB1_0015_C04.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
ADR01_0021_D09.b : TACGATGCCTATGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
TCH01_0091_A11.b : xxxxxxxxxxxTGAACTGAAGCATGCTCTTAAGGGAGCTGGGACAGATGAGAAAATCCTG
LNG01_0005_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATGAGAAAATCCTG
CBLT1_0038_B08.b :
SPLT1_0100_H02.b :
ILNT1_0067_G12.b :
20110601C-007088 : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
---------+---------+---------+---------+---------+---------+ 581
HTMT1_0032_G04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0030_F09.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGATTTAGGAGCCATAAAACA*GTTTA*TG
SPLT1_0035_A03.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
CBLT1_0022_A01.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0030_F06.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
SPL01_0075_B02.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
ITT01_0095_D03.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
CBLT1_0072_B06.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
ADR01_0043_F01.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
SMG01_0075_G01.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
SPL01_0051_G12.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVR01_0009_B12.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0036_G01.b : ACAGAAAT*ATTGCTTtcaggaacactgaagatttagagccataaaacaagttatgaaga
OVRM1_0112_H04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0020_A05.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0026_F11.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0046_C10.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
MLN01_0077_F11.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
ADR01_0062_D01.b : ACAGAAATTATTGCTTCNAGGACACCC*TGAGAATTNAGAGCCATANNNACAGTTTA*TG
OVRM1_0199_B09.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVR01_0062_D01.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
ITT01_0021_B12.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
UTR01_0095_F06.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
HTMT1_0001_E03.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0095_E05.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0193_A03.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRT1_0113_A10.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0126_C10.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
KDN01_0033_G12.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
LVRM1_0176_A04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0079_B03.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
SPL01_0026_F05.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
CBLT1_0020_A02.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVR01_0095_C07.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRT1_0040_B12.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0040_C09.b : ACCGAAATTATTGCctcccgggacccctgacaattaccacccacaccacactttatgaac
BMWN1_0023_E06.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0082_H09.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0030_E04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0038_B03.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0092_E11.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0042_H03.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0096_A12.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0079_C06.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0041_C02.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0099_H08.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0094_E12.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0094_G04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0095_H05.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0084_G07.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0171_H11.b : gaacgaacttattgataatacgagaaattaagaaattacagatagaaaaaaatcttcaaa
AMP01_0040_G04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
LNG01_0023_G12.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAACAGCCATAAAACAAGTTTA*TG
ITT01_0085_B11.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRT1_0144_H03.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
SPL01_0058_E05.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
SPL01_0056_C04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0085_H04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0087_H02.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0109_B06.b : ACAGAAATTATTGCTTCAAGGACACCC*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0002_B11.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
SPL01_0014_E09.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0025_H04.b : ACAGAAATTATTGCTTTCAAGACACCT*GANGAATTTAGAGCCATTAAACAAGTTTA*TG
DCI01_0026_C12.b : ACAGAAATTATTGCTTCAAGGACACCT*GAANGATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0004_G06.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0037_A08.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0063_A03.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
HTMT1_0083_D05.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0102_A06.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRT1_0075_F04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0036_A06.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0061_G12.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0011_E08.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
KDN01_0003_A10.b : ACAGAAATTAATGCTTCAAGGAAACCT*GAAGAATTTAGAGGCATAAAAACAGTTTA*TG
PST01_0085_F04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
PST01_0005_D11.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
ADR01_0084_E10.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0194_A03.b : ACAGAAATTATTGCTTCAAGGACACCTCGAGGATTTAAGAGCCATTAAACAAGTTTATGA
OVRM1_0004_H06.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGCTTA*TG
OVRM1_0196_H04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0056_A12.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0053_H08.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0085_E02.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0062_C08.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAANACAAGTTTA*TG
OVRM1_0186_H09.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0129_E08.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
SPL01_0074_C01.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
SPL01_0102_C02.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
ADR01_0003_A08.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
SPL01_0034_B08.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
SPL01_0089_A03.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
SPL01_0003_G03.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
UTR01_0088_C08.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
SMG01_0038_D02.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
ITT01_0002_G08.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
ITT01_0097_G08.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRT1_0054_C01.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
PBL01_0065_D04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRT1_0094_F02.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVR01_0100_A01.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
ITT01_0081_C02.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVR01_0091_C02.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0040_B02.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTNAGAGCCATAAAACAAGTTatgaa
AMP01_0004_H04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0016_B01.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0091_E02.b : ACAGAAATTACTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRT1_0069_F05.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0029_G12.b : ACAGAAATTATTGCTTNCAGGACACCT*GAAGA*TTAAAAGCCATAAAAC*AGTTTA*TG
DCI01_0026_C05.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0104_B09.b : ACAGAAA*TATTGCTTC*AGGACACCT*GAAGA*TTAAGAGCCATAAAAC*AGTTTA*TG
DCI01_0105_B09.b : ACAGAAATTATTGCTTNCAGGACACCT*GAAGAATTAAGAGCCATNNAAACAGTTTA*TG
AMP01_0081_E01.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0065_H04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0092_G07.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0084_H11.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0081_C08.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
SPL01_0060_F01.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAATAGCCATAAAACAAGTTTATTG
OVRT1_0017_H05.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACCAGTTTA*TG
OVRM1_0152_H06.b : ACAGAAATTACTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0192_A03.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0018_F04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0215_H02.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0203_E02.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
SPL01_0061_A03.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0186_E11.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0126_A08.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVR01_0079_A04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
ADR01_0043_F12.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRT1_0097_A07.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
PCT01_0020_F06.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRT1_0134_F02.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
SPL01_0002_H11.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRT1_0152_H12.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRT1_0102_G05.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
KDN01_0072_A05.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRT1_0116_A03.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
ADR01_0066_E12.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
ITT01_0093_F08.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
ADR01_0088_D04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
KDN01_0067_D11.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
CLNT1_0112_G05.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
PCT01_0013_E03.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0035_H04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
ADR01_0031_H08.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0055_F08.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
SKNB1_0010_D02.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
BFLT1_0088_D11.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
ADR01_0054_C11.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0034_G08.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0115_F06.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0111_B10.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
PCT01_0001_B08.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
PST01_0073_H04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
PST01_0016_F01.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
PST01_0031_B05.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRT1_0053_H03.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
TCH01_0079_G12.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0075_G02.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
SKNB1_0064_A01.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0013_C11.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0183_C11.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
PBL01_0074_E03.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
LNG01_0062_E09.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRT1_0050_D03.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
PTG01_0063_A11.b : ACAGAAATTATTGCTTTCAGGACACCC*TGAGAATTAAGAGCCATA*AACAAGTTTA*TG
ADR01_0015_C03.b : ACAGAAATTATTGCTTTCAGGACACCT*GAAGAATTAAGAGCCCATAAACCAGTTTTATG
BKFL1_0020_G05.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0100_D11.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0215_D06.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0051_C04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
KDN01_0042_H03.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
LNG01_0031_H02.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
AMP01_0072_H01.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0033_A09.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0002_H03.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0094_D09.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0206_F10.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
SMG01_0103_H07.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
LNG01_0036_H08.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
LNG01_0070_G03.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVR01_0020_G04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRM1_0210_F02.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
SKNB1_0008_C07.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
SKNB1_0037_B01.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0016_H09.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
OVRT1_0020_B04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0037_C07.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
DCI01_0105_A03.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTGAGAGCCATAAAACAAGTTTA*TG
DCI01_0078_G10.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTGAGAGCCATAAAACAAGTTTA*TG
BKFL1_0035_A11.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
SKNB1_0015_C04.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
ADR01_0021_D09.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
TCH01_0091_A11.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
LNG01_0005_H01.b : ACAGAAATTATTGCTTCAAGGACACCT*GAAGAATTAAGAGCCATAAAACAAGTTTA*TG
CBLT1_0038_B08.b :
SPLT1_0100_H02.b :
ILNT1_0067_G12.b :
20110601C-007088 : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
---------+---------+---------+---------+---------+---------+ 640
HTMT1_0032_G04.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0030_F09.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGNTGGG*AGATACATCAaggcactaa
SPLT1_0035_A03.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
CBLT1_0022_A01.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0030_F06.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
SPL01_0075_B02.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
ITT01_0095_D03.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
CBLT1_0072_B06.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
ADR01_0043_F01.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
SMG01_0075_G01.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
SPL01_0051_G12.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVR01_0009_B12.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0036_G01.b : agatatggctcagccctggagaagatgtggtgggagatacatcagggtactaccaaaaga
OVRM1_0112_H04.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0020_A05.b : AAGAAGAATATGGCTCAAGCCTGNAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
AMP01_0026_F11.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
AMP01_0046_C10.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
MLN01_0077_F11.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
ADR01_0062_D01.b : AAGAAAGATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0199_B09.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVR01_0062_D01.b : AAGAAGAATATGGCTTAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
ITT01_0021_B12.b : AAGAAGAATATGGCTCAAGCCTGGAGGATGATGTGGTGGG*AGATACATCAGGGTACTAC
UTR01_0095_F06.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
HTMT1_0001_E03.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
AMP01_0095_E05.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0193_A03.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRT1_0113_A10.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0126_C10.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
KDN01_0033_G12.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
LVRM1_0176_A04.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0079_B03.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
SPL01_0026_F05.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
CBLT1_0020_A02.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVR01_0095_C07.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCATGGTACTAC
OVRT1_0040_B12.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0040_C09.b : aaaaatatggccccaccccgaaccatgatcgtgggggagaaacctccggggaaccccccc
BMWN1_0023_E06.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
AMP01_0082_H09.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0030_E04.b : AAGAAGAATATGGCTCAAGCCTGNAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0038_B03.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
AMP01_0092_E11.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCACGGTACTAC
DCI01_0042_H03.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
AMP01_0096_A12.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGNTACTAC
AMP01_0079_C06.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
AMP01_0041_C02.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTGC
DCI01_0099_H08.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0094_E12.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
AMP01_0094_G04.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
AMP01_0095_H05.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCANGGTACTAC
DCI01_0084_G07.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0171_H11.b : agaaaaaataggaacaaacccggtaaaaccacgcgttagcaccatataccctaaacatac
AMP01_0040_G04.b : AAAAAAAATATGGCCTCAGCCCTGAAGATGATGTGGTGGA*AGATACATCAAGTTACTAC
LNG01_0023_G12.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
ITT01_0085_B11.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRT1_0144_H03.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
SPL01_0058_E05.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGCGGTGGG*AGATACATCAGGGTACTAC
SPL01_0056_C04.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0085_H04.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0087_H02.b : AAGAAGAATATGGCTCAAGTCTGGAAGATGATGTGGTGGG*AGATACATCANGGTACTAC
DCI01_0109_B06.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0002_B11.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
SPL01_0014_E09.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0025_H04.b : Agaagaatatgcctcaagcctgaagaataagtgttggaaaatcatcaggttactacacga
DCI01_0026_C12.b : AAGAAGAATATGGCTCAAGCCTGGAAAATGATGTGGTGGG*AGATACATCAGGGTACTAC
AMP01_0004_G06.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATNCAGGTACTAC
AMP01_0037_A08.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0063_A03.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
HTMT1_0083_D05.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
AMP01_0102_A06.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCANGGTACTAC
OVRT1_0075_F04.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
AMP01_0036_A06.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
AMP01_0061_G12.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0011_E08.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
KDN01_0003_A10.b : AAGAAGAATATGGCTCAAGCCTGGAAAAATAATTGGTGGG*AAATACTTCCGGGTACTAC
PST01_0085_F04.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
PST01_0005_D11.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
ADR01_0084_E10.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0194_A03.b : AAGAAGATTATGGCTCAAGCCTGGAAagatgatgtggtgggaagatacatcagggttcta
OVRM1_0004_H06.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0196_H04.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0056_A12.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0053_H08.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0085_E02.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0062_C08.b : AAGAAGAATATGGCTCNAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0186_H09.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0129_E08.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
SPL01_0074_C01.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
SPL01_0102_C02.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCACGGTACTAC
ADR01_0003_A08.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCANGGTACTAC
SPL01_0034_B08.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
SPL01_0089_A03.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
SPL01_0003_G03.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAAGGTACTAC
UTR01_0088_C08.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
SMG01_0038_D02.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
ITT01_0002_G08.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
ITT01_0097_G08.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRT1_0054_C01.b : AAGAAGAATATGGCTCAGGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
PBL01_0065_D04.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRT1_0094_F02.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVR01_0100_A01.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTGCTAC
ITT01_0081_C02.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVR01_0091_C02.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
AMP01_0040_B02.b : gaagaataatgctcaagccctggaggatgatgtggtggggagatacctcagggntactac
AMP01_0004_H04.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0016_B01.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0091_E02.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRT1_0069_F05.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0029_G12.b : AAGAAGAATATGGCTTCAGCCTGGAgatgatgtggtgggaatacatcaggntactaccaa
DCI01_0026_C05.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0104_B09.b : AAGAAGATATGGGCTC*AGCCTG*AAGATGATGTGGTGGG*AGA*ACATCAGGGTACTAC
DCI01_0105_B09.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTNGG*AGATACATCGGGGTACTGC
AMP01_0081_E01.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
AMP01_0065_H04.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGAG*AGATACATCAGGGTACTAC
AMP01_0092_G07.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
AMP01_0084_H11.b : AAGAGGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
AMP01_0081_C08.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
SPL01_0060_F01.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGGTAGATACATCATGGTACTAC
OVRT1_0017_H05.b : AAGAAGAATATGGCTCAAGCCTGTAAGATGATGTGGTGGG*AGATACATCAAGGTACTAC
OVRM1_0152_H06.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0192_A03.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0018_F04.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0215_H02.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0203_E02.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
SPL01_0061_A03.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0186_E11.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0126_A08.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVR01_0079_A04.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
ADR01_0043_F12.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRT1_0097_A07.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
PCT01_0020_F06.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRT1_0134_F02.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
SPL01_0002_H11.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRT1_0152_H12.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRT1_0102_G05.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
KDN01_0072_A05.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRT1_0116_A03.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
ADR01_0066_E12.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
ITT01_0093_F08.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
ADR01_0088_D04.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
KDN01_0067_D11.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
CLNT1_0112_G05.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACACCAGGGTACTAC
PCT01_0013_E03.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGACACATCANGGTACTAC
AMP01_0035_H04.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
ADR01_0031_H08.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
AMP01_0055_F08.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCANGGTACTAC
SKNB1_0010_D02.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
BFLT1_0088_D11.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
ADR01_0054_C11.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
AMP01_0034_G08.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCANGGTACTAC
DCI01_0115_F06.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0111_B10.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
PCT01_0001_B08.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
PST01_0073_H04.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
PST01_0016_F01.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
PST01_0031_B05.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRT1_0053_H03.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
TCH01_0079_G12.b : AACAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
AMP01_0075_G02.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGCGGG*AGATACATCAGGGTACTAC
SKNB1_0064_A01.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0013_C11.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0183_C11.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
PBL01_0074_E03.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
LNG01_0062_E09.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRT1_0050_D03.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
PTG01_0063_A11.b : AAAAAGAATAGGGCTCAGGCCTGGAAatgaagtggtggggaaatacttcgggtactacca
ADR01_0015_C03.b : AATAAGATTATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGAATCATCAGGGTACTAC
BKFL1_0020_G05.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0100_D11.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0215_D06.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
AMP01_0051_C04.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
KDN01_0042_H03.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
LNG01_0031_H02.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
AMP01_0072_H01.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0033_A09.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0002_H03.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0094_D09.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0206_F10.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
SMG01_0103_H07.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
LNG01_0036_H08.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
LNG01_0070_G03.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVR01_0020_G04.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
OVRM1_0210_F02.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
SKNB1_0008_C07.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
SKNB1_0037_B01.b : AAGAAGAATATGACTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0016_H09.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGGTGTGGTGGG*AGATACATCAGGGTACTAC
OVRT1_0020_B04.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0037_C07.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0105_A03.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
DCI01_0078_G10.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
BKFL1_0035_A11.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
SKNB1_0015_C04.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
ADR01_0021_D09.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
TCH01_0091_A11.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
LNG01_0005_H01.b : AAGAAGAATATGGCTCAAGCCTGGAAGATGATGTGGTGGG*AGATACATCAGGGTACTAC
CBLT1_0038_B08.b :
SPLT1_0100_H02.b :
ILNT1_0067_G12.b :
20110601C-007088 : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
---------+---------+---------+---------+---------+---------+ 698
HTMT1_0032_G04.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
DCI01_0030_F09.b : caaaagaatgctggtgttcttccttcagctattaaaaatctggatggtaaaattgatgaa
SPLT1_0035_A03.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAAGCTAATAGAGATCCTGATGGTAGAATTGATG
CBLT1_0022_A01.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0030_F06.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
SPL01_0075_B02.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
ITT01_0095_D03.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
CBLT1_0072_B06.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
ADR01_0043_F01.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
SMG01_0075_G01.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
SPL01_0051_G12.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVR01_0009_B12.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
DCI01_0036_G01.b : agctggtgttctcctttcagctaataaaattctgatggtaaattgatgagccccagttga
OVRM1_0112_H04.b : CAGAGGATGCT*GGTGGGCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
DCI01_0020_A05.b : CAGAGGATGCT*GGTGGTCCTCC*TCANGGCTA*TAGAGATCCTGATGGTAGAATTGATG
AMP01_0026_F11.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
AMP01_0046_C10.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANGCTAATAGAGATCCTGATGGTAGAATTGATG
MLN01_0077_F11.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
ADR01_0062_D01.b : CAGAGGATGCT*GGTGGTCCTCC*TTTCAGCTAtagaatcctgatggtagaatgatgaag
OVRM1_0199_B09.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVR01_0062_D01.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
ITT01_0021_B12.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
UTR01_0095_F06.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
HTMT1_0001_E03.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
AMP01_0095_E05.b : CAGAGGATGCT*GGTGGGTCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0193_A03.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRT1_0113_A10.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0126_C10.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
KDN01_0033_G12.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
LVRM1_0176_A04.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGCCT*ATACAGATCCTGATGGTANAATTGATG
OVRM1_0079_B03.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
SPL01_0026_F05.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
CBLT1_0020_A02.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVR01_0095_C07.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRT1_0040_B12.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
DCI01_0040_C09.b : aggaagccggtggctctccctcccgccaacagagatcctgacgcaacaatggacaaaccc
BMWN1_0023_E06.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
AMP01_0082_H09.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANGCTAATAGAGATCCTGATGGTAGAATTGATG
DCI01_0030_E04.b : CAGAAGATGCT*GGTGGTCCTCC*TTCANGCTGATAGAGATCCTGATGGTAGAATTGATG
DCI01_0038_B03.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANGCTAATAGAGATCCTGATGGTAGAATTGATG
AMP01_0092_E11.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
DCI01_0042_H03.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANNGCTATAGAGATCCTGATGGTAGAATTGATG
AMP01_0096_A12.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANNGCTATAGAGATCCTGATGGTAGAATTGATG
AMP01_0079_C06.b : CAGAGGATGCT*GGTGGTCCTCC*TTCACGCTAATAGAGATCCTGATGGTAGAATTGATG
AMP01_0041_C02.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
DCI01_0099_H08.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANGCTAATAGAGATCCTGATGGTAGAATTGATG
DCI01_0094_E12.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANGCTAATAGAGATCCTGATGGTAGAATTGATG
AMP01_0094_G04.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANGCTAATAGAGATCCTGATGGTAGAATTGATG
AMP01_0095_H05.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
DCI01_0084_G07.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0171_H11.b : attacatcacaattaacacaaaactcataaccccagaatataagtacccatgaacgcaca
AMP01_0040_G04.b : CCAGAGATGCTGGGTGGTCCTCC*TTCANGCTAATAaaagatcctgaaggtaaaaatgat
LNG01_0023_G12.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATTCTGATGGTATAATTGATG
ITT01_0085_B11.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRT1_0144_H03.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
SPL01_0058_E05.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
SPL01_0056_C04.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
DCI01_0085_H04.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
DCI01_0087_H02.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
DCI01_0109_B06.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
DCI01_0002_B11.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
SPL01_0014_E09.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
DCI01_0025_H04.b : ggatgctgttggtcttctttcagctataaaaatcctgagggtaaatttgatgaaccccag
DCI01_0026_C12.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAAAGATCCTGgagggtaaaatgatg
AMP01_0004_G06.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANGCTAATAGAGATCCTGATGGTAGAATTGATG
AMP01_0037_A08.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANGCTAATANAGATCCTGATGGTAGAATTGATG
DCI01_0063_A03.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
HTMT1_0083_D05.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
AMP01_0102_A06.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANNGCTATAGAGATCCTGATGGTAGAATTGATG
OVRT1_0075_F04.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
AMP01_0036_A06.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCGGATGGTAGAATTGATG
AMP01_0061_G12.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
DCI01_0011_E08.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANGCTAATAGAGATCCTGATGGTAGAATTGATG
KDN01_0003_A10.b : aaaaggaggtggggggcccccttcgggcaaaaaaaatcccgagggaaaaattgataaacc
PST01_0085_F04.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
PST01_0005_D11.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
ADR01_0084_E10.b : CAGAGGACGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0194_A03.b : cccagaggatgctggtgggccctctttccaggctaataaaagatccctgaggggagaaat
OVRM1_0004_H06.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGCAGAATTGATG
OVRM1_0196_H04.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0056_A12.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0053_H08.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0085_E02.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0062_C08.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0186_H09.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0129_E08.b : CAGAGGATGCT*GGTGGTCCTCC*TTCNAGCTAATAGAGATCCTGATGGTAGAATTGATG
SPL01_0074_C01.b : CAGAGGATGCT*GATGGTCCTCC*TTCANGCTAATAGAGATCCTGATGGTAGAATTGATG
SPL01_0102_C02.b : CAGAGGATGCT*GGTGGTCCTCC*TTCACGCTAATAGAGATCCTGATGGTAGAATTGATG
ADR01_0003_A08.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANGCTAATAGAGATCCTGATGGTAGAATTGATG
SPL01_0034_B08.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATANAGATCCTGATGGTAGAATTGATG
SPL01_0089_A03.b : CAGAGGATGCT*GGTGGTCCTCC*TTCATGCTAATAGAGATCCTGATGGTAGAATTGATG
SPL01_0003_G03.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
UTR01_0088_C08.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
SMG01_0038_D02.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
ITT01_0002_G08.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
ITT01_0097_G08.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRT1_0054_C01.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
PBL01_0065_D04.b : CAGAGGATGCT*GGTGGTCCTCC*TTCGGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRT1_0094_F02.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVR01_0100_A01.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
ITT01_0081_C02.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVR01_0091_C02.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
AMP01_0040_B02.b : ccaaaggatgctgggtggtcctcccttcaggctaatanagattcctgaaggtaaaatttg
AMP01_0004_H04.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAAAGATCCTGATGGTAGAATTGATG
DCI01_0016_B01.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANGGCTATAGAGATCCTGATGGTAGAATTGATG
DCI01_0091_E02.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRT1_0069_F05.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
DCI01_0029_G12.b : agatgctggtggcctccctcaggctaatagagatcctgaatgtaaaatgatgaagcccag
DCI01_0026_C05.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGA*TTGATG
DCI01_0104_B09.b : CAGAAGATGCT*GGTGGTCCTCC**TCAGGCTAATAGAGATCCTGATGGTA*AAATGATG
DCI01_0105_B09.b : CAGAAGATGCT*GGTGGTCCCTC*CTCANNGCTATAGAGATCCTGATGGTAGAATTGATG
AMP01_0081_E01.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANGCTAATAGAGATCCTGATGGTAGAATTGATG
AMP01_0065_H04.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANNGCTATAGAGATCCTGATGGTAGAATTGATG
AMP01_0092_G07.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
AMP01_0084_H11.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANGCTAATAGAGATCCTGATGGTAGAATTGATG
AMP01_0081_C08.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
SPL01_0060_F01.b : CAAAGGATGCT*GGGGGGCCTCC*TTTCAGGTTATAAAGATCCTGAatggtaaaattgat
OVRT1_0017_H05.b : CAAAGGATGCT*GGTGGTCCTCC*TTCAAGCTAAAAAAGATCCTGATGGTAAAATTGATG
OVRM1_0152_H06.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0192_A03.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0018_F04.b : CAGAGGATGCT*GGTGGTCCTCC*TTCNAGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0215_H02.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0203_E02.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
SPL01_0061_A03.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0186_E11.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0126_A08.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAAATGATG
OVR01_0079_A04.b : CAGAGGATGCT*GGTGGTCCTCC*TTCACGCTAATAGAGATCCTGATGGTAAAATTGATG
ADR01_0043_F12.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRT1_0097_A07.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
PCT01_0020_F06.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRT1_0134_F02.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
SPL01_0002_H11.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRT1_0152_H12.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRT1_0102_G05.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
KDN01_0072_A05.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRT1_0116_A03.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
ADR01_0066_E12.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
ITT01_0093_F08.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
ADR01_0088_D04.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
KDN01_0067_D11.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
CLNT1_0112_G05.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
PCT01_0013_E03.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
AMP01_0035_H04.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
ADR01_0031_H08.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
AMP01_0055_F08.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANGCTAATAGAGATCCTGATGGTAGAATTGATG
SKNB1_0010_D02.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
BFLT1_0088_D11.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
ADR01_0054_C11.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
AMP01_0034_G08.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANGCTAATAGAGATCCTGATGGTAGAATTGATG
DCI01_0115_F06.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANGCTAATAGAGATCCTGATGGTAGAATTGATG
DCI01_0111_B10.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
PCT01_0001_B08.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANGCTAATAGAGATCCTGATGGTAGAATTGATG
PST01_0073_H04.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
PST01_0016_F01.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
PST01_0031_B05.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRT1_0053_H03.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
TCH01_0079_G12.b : CAAACGATGCT*GGTGGTCCTCC*TTCACGCTAATAGAGATCCTGATGGTAGAATTGAAG
AMP01_0075_G02.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
SKNB1_0064_A01.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0013_C11.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0183_C11.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
PBL01_0074_E03.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
LNG01_0062_E09.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRT1_0050_D03.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
PTG01_0063_A11.b : aaagaagccggggtccccccttcagcaaataaaatccgaagggtaaaattgatgaaccca
ADR01_0015_C03.b : CAAAGGATGCT*GGTGGTCCCCCTTTCAGGCTAATTTAGATCCTGATGGTAAAATTGATG
BKFL1_0020_G05.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANNGCTATAGAGATCCTGATGGTAGAATTGATG
DCI01_0100_D11.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0215_D06.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
AMP01_0051_C04.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
KDN01_0042_H03.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
LNG01_0031_H02.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
AMP01_0072_H01.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0033_A09.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0002_H03.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0094_D09.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0206_F10.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
SMG01_0103_H07.b : CAGAGGATGCT*GGTGGTCCCCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
LNG01_0036_H08.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
LNG01_0070_G03.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVR01_0020_G04.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
OVRM1_0210_F02.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGTGATCCTGATGGTAGAATTGATG
SKNB1_0008_C07.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
SKNB1_0037_B01.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
DCI01_0016_H09.b : CAGAAGATGCT*GGTGGTCCTCC*TTCANNGCTATAGAGATCCTGATGGTAGAATTGATG
OVRT1_0020_B04.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
DCI01_0037_C07.b : CAGAGGATGCT*GGTGGTCCTCC*TTCANNGCTATAGAGATCCTGATGGTAGAATTGATG
DCI01_0105_A03.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
DCI01_0078_G10.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
BKFL1_0035_A11.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
SKNB1_0015_C04.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
ADR01_0021_D09.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
TCH01_0091_A11.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
LNG01_0005_H01.b : CAGAGGATGCT*GGTGGTCCTCC*TTCAGGCTAATAGAGATCCTGATGGTAGAATTGATG
CBLT1_0038_B08.b :
SPLT1_0100_H02.b :
ILNT1_0067_G12.b :
20110601C-007088 : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
---------+---------+---------+---------+---------+---------+ 756
HTMT1_0032_G04.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
DCI01_0030_F09.b : cccaagttgaaacaaaagctccagcattgttcccggctggaaaactaaatgtgggaacga
SPLT1_0035_A03.b : AAGCACAGGTTGAANCAAGATGCTCAGGCATTGTTTCAAGCTGGAGAAACTAAAATGGGG
CBLT1_0022_A01.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAAGCTGGAG*AACTTAAATGGGG
OVRM1_0030_F06.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAAGCTGGAG*AACTTAAATGGCG
SPL01_0075_B02.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
ITT01_0095_D03.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
CBLT1_0072_B06.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
ADR01_0043_F01.b : AAGCACAGGTTGAA*ACAGATGCTCAAGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
SMG01_0075_G01.b : AAGCACAGGTTGAA*ACAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
SPL01_0051_G12.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG**AACTTAATGGGG
OVR01_0009_B12.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
DCI01_0036_G01.b : acaaaatgctcaggcattgtttccgcttgaaaacttaatggggaaccaatgagaaaaatt
OVRM1_0112_H04.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCCTTGTTTTCAGGCTGGGATAACTTAATGGGG
DCI01_0020_A05.b : AAGCACAGGTTGAA*ACAGATGCTCAAGCATTGTTTCAGGCTGGAG*AAC*TAAATGGGG
AMP01_0026_F11.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
AMP01_0046_C10.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
MLN01_0077_F11.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
ADR01_0062_D01.b : cacaggtgaacaagatgc
OVRM1_0199_B09.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTATATGGGG
OVR01_0062_D01.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
ITT01_0021_B12.b : AAGCACAGGTTGAA*CAAGACGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
UTR01_0095_F06.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
HTMT1_0001_E03.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
AMP01_0095_E05.b : AAACACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAGGAACTAAAATGGGG
OVRM1_0193_A03.b : AAGCACAGGTTGAA*CAAGATGCTCAAGCATTGTTTCAGGCTGGGG*AACTTAAATGGGG
OVRT1_0113_A10.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRM1_0126_C10.b : AAGCACAGGTTGAA*ACAGATGCTCACGCATTGTTTCAGGCTGGAG*GAACTTAATGGGG
KDN01_0033_G12.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
LVRM1_0176_A04.b : AAGCACAGGTTGAA*CTAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTC*AATGGGG
OVRM1_0079_B03.b : AAGCACAGGTTGAA*CAAGATGCTCACGCATTGTTTCAGGCTGGAG*AACTT*AATGGGG
SPL01_0026_F05.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
CBLT1_0020_A02.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVR01_0095_C07.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCATGCTGGAG*AACTTAAATGGGG
OVRT1_0040_B12.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
DCI01_0040_C09.b : ccgcctaaccaaatgcccatgccttgtttcccgcccgaacaacctaatgggggacccaat
BMWN1_0023_E06.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
AMP01_0082_H09.b : AAGCACANGTTGAA*CAAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
DCI01_0030_E04.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
DCI01_0038_B03.b : AAGCACAGGTTTGA*ACAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTNAATGGNN
AMP01_0092_E11.b : AAGCACAGGTTGAA*ACAGATGCTCAGGCATTGTTTCANGCTGGAG*AACTTACATGGCG
DCI01_0042_H03.b : AAGCACAGGTTGAA*ACAGATGCTCAAGCATTGTTTCAGGCTGGAG*AAACTAAATGGGG
AMP01_0096_A12.b : AAGCACANGTTGAA*ACAGATGCTCANGCATTGTTTC*GGCTGGAG*AACTTAA*TGGGG
AMP01_0079_C06.b : AAGCACAGGTTGAA*CAAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTACATGGGG
AMP01_0041_C02.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
DCI01_0099_H08.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG**AACTTAATGGGG
DCI01_0094_E12.b : AAGCACAGGTTGAA*ACAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTAA*TGGGG
AMP01_0094_G04.b : AAGCACAGGTTGAA*CAAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
AMP01_0095_H05.b : AAGCACAGGTTGAA*CAAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
DCI01_0084_G07.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRM1_0171_H11.b : ctaacaggcggcaaataaccgcaaagtacgatgctaaaatgagaaaggcaatacgaccgc
AMP01_0040_G04.b : gaaaccccaggttgaaccaaatgccccggcttttgtttccgggctggaaactttaaatgg
LNG01_0023_G12.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAA*AACTTAAATGGGG
ITT01_0085_B11.b : AAACACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAAGCTGGAG*AACTTAAATGGGG
OVRT1_0144_H03.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAATGGGGG
SPL01_0058_E05.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
SPL01_0056_C04.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
DCI01_0085_H04.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AAACTTAATGGGG
DCI01_0087_H02.b : AAGCACAGGTTGAA*ACAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
DCI01_0109_B06.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AAACTTAATGGGG
DCI01_0002_B11.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
SPL01_0014_E09.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
DCI01_0025_H04.b : gtggaacaaaatgctcgggttttgtttcaggcggaaaccttaagggggaaccaatgaaaa
DCI01_0026_C12.b : aaagccaaggtggaacagatggctcaggcattgttttcagctggagaaactaattgggaa
AMP01_0004_G06.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAATTGGGG
AMP01_0037_A08.b : AAGCACAGGTTGAA*CCAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTT*AATGGGG
DCI01_0063_A03.b : AAGCACAGGTTGAA*ACAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
HTMT1_0083_D05.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
AMP01_0102_A06.b : AAGCACAGGTTGAA*ACAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRT1_0075_F04.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
AMP01_0036_A06.b : AAGCACAGGTTGAA*CAACATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
AMP01_0061_G12.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
DCI01_0011_E08.b : AAGCACANGTTGAA*ACAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
KDN01_0003_A10.b : ccaggttgaacaaaaatccccggcttttttttcggggggaaaatttaatggggaaacaaa
PST01_0085_F04.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
PST01_0005_D11.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
ADR01_0084_E10.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRM1_0194_A03.b : tgatgaaaccaccaggttgaaaaaaatgggccaaggcttttgtttccgggttgggaaaat
OVRM1_0004_H06.b : AAGCACAGGTTGAA*AAAGATGCTCAGGCATTGTTTCCAGTTGGAG*CACTTACATGGCG
OVRM1_0196_H04.b : AAGCACAGGTTGAA*CAAGATGCTCAAGCATTGTTTCAGGCTGGAG*AACTTTAATGGGG
OVRM1_0056_A12.b : AAGCACAGGTTGAA*CAAGATGCTCACGCATTGTTTCACGCTGGAG*AACTTACATGGCG
OVRM1_0053_H08.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRM1_0085_E02.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRM1_0062_C08.b : AAGCACAGGTTGAA*CAAGATGCTCANGCATTGTTTCAGGCTGGAG*AAACTTAATGGGG
OVRM1_0186_H09.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGTTGGAG*AACTTAAATGGGG
OVRM1_0129_E08.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
SPL01_0074_C01.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
SPL01_0102_C02.b : AAGCACAGGTTGAA*CAAGATGCTCAAGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
ADR01_0003_A08.b : AAGCACAGGTTGAA*CAAGATGCTCAAGCATTGTTTCAAGCTGGAN*GACTTAAATGGGG
SPL01_0034_B08.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAAGCTGGGA*GACTTTAATGGGG
SPL01_0089_A03.b : AATCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCANGCTGGAG*AACTTAGATGGGG
SPL01_0003_G03.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
UTR01_0088_C08.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
SMG01_0038_D02.b : AAGCACANGTTGAA*CAAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
ITT01_0002_G08.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
ITT01_0097_G08.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRT1_0054_C01.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
PBL01_0065_D04.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRT1_0094_F02.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVR01_0100_A01.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
ITT01_0081_C02.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVR01_0091_C02.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
AMP01_0040_B02.b : aatgaggcccagggtgaaacacaaaggcccaggctttggtttccggccgggaaaacctta
AMP01_0004_H04.b : AACCACAGGTTGAA*CAAGAAGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
DCI01_0016_B01.b : AAGCACAGGTTGAA*ACAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
DCI01_0091_E02.b : AAGCACAGGTTGAA*CAAGATGCTCANGCATTGTTTCAGGCTGGAG*AAACTTAATAGGG
OVRT1_0069_F05.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
DCI01_0029_G12.b : tggaccagatgctcagccttgtttcggctgaaaacttaatggggaacgaagaaaaaaatt
DCI01_0026_C05.b : AAGCACCAGTTGAA*CA*GATGCTCAGGCATTGTTNCAGGCTGAAA*AACTTAAATG*GG
DCI01_0104_B09.b : AACCACA*GTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAA*GAACTTAATGGGG
DCI01_0105_B09.b : AAGCACANGTTGAA*ACAGATGCTCAGGCATTGTTTCAGGCTGGAG*AAACTTAATGGGG
AMP01_0081_E01.b : AAGCACANGTTGAA*CAAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
AMP01_0065_H04.b : AAGCACAGGTTGAA*ACAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTTAATGGGG
AMP01_0092_G07.b : AAGCACAGGTTGAA*CAAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
AMP01_0084_H11.b : AAGCACAGGTTGAA*CAAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
AMP01_0081_C08.b : AAGCACAGGTTGAA*CAAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
SPL01_0060_F01.b : taagcacagggttgaacaaaatgctcaaggcattgttctaagcatgaaaaattttaatgg
OVRT1_0017_H05.b : AATCACAAGTTGAA*CATGATGCTCAGGCATTGTTTTATGCTGGTAAAACTTAtatgggc
OVRM1_0152_H06.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRM1_0192_A03.b : AAGCACAGGTTGAA*CAAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRM1_0018_F04.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRM1_0215_H02.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTACATGGGG
OVRM1_0203_E02.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
SPL01_0061_A03.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTT*AATGGGG
OVRM1_0186_E11.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AAACTTAATGGGG
OVRM1_0126_A08.b : AAGCACAGGTTGAA*CAAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTAAAGGGCG
OVR01_0079_A04.b : AAACACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCACGCTGGAG*AACTTAAATGGGG
ADR01_0043_F12.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRT1_0097_A07.b : AAGCACAGGTTGAA*CAAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
PCT01_0020_F06.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRT1_0134_F02.b : AAGCACAGGTTGAA*CAAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
SPL01_0002_H11.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRT1_0152_H12.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AAACTAAATGGGG
OVRT1_0102_G05.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
KDN01_0072_A05.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRT1_0116_A03.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
ADR01_0066_E12.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
ITT01_0093_F08.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
ADR01_0088_D04.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
KDN01_0067_D11.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
CLNT1_0112_G05.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTTAATGGGG
PCT01_0013_E03.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTNNAATGGG
AMP01_0035_H04.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
ADR01_0031_H08.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
AMP01_0055_F08.b : AAGCACAGGTTGAA*CAAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
SKNB1_0010_D02.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
BFLT1_0088_D11.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
ADR01_0054_C11.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
AMP01_0034_G08.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTGAATGGGG
DCI01_0115_F06.b : AAGCACAGGTTGAA*CAAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
DCI01_0111_B10.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
PCT01_0001_B08.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
PST01_0073_H04.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTCCAGGCTGGAG*AACTTAAATGGGG
PST01_0016_F01.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
PST01_0031_B05.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRT1_0053_H03.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
TCH01_0079_G12.b : AAGCACACGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
AMP01_0075_G02.b : AAGCACAGGTTGAA*CAAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
SKNB1_0064_A01.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRM1_0013_C11.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRM1_0183_C11.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
PBL01_0074_E03.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
LNG01_0062_E09.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRT1_0050_D03.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
PTG01_0063_A11.b : ggtttgaacaaaattccgggatttgtttcggggggaaactttaaatggggaaaaaaaaaa
ADR01_0015_C03.b : AACCACAGGTTGAA*CATGATGCTCCAGCATTGTTTCCAGCTGGTA*AAATTAAAGGGGG
BKFL1_0020_G05.b : AAGCACANGTTGAA*ACAGATGCTCGGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
DCI01_0100_D11.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRM1_0215_D06.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
AMP01_0051_C04.b : AAGCACAGGTTGAA*CAAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
KDN01_0042_H03.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
LNG01_0031_H02.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
AMP01_0072_H01.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACCTAAATGGGG
OVRM1_0033_A09.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRM1_0002_H03.b : AAGCACAGGTTGAA*CAAGATGCTCNAGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRM1_0094_D09.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRM1_0206_F10.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AAACTTAATGGGG
SMG01_0103_H07.b : AAGCACAGGTTGAA*CAAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
LNG01_0036_H08.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
LNG01_0070_G03.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVR01_0020_G04.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
OVRM1_0210_F02.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
SKNB1_0008_C07.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
SKNB1_0037_B01.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
DCI01_0016_H09.b : AAGCACAGGTTGAA*ACAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTAAAATGGGG
OVRT1_0020_B04.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
DCI01_0037_C07.b : AAGCACANGTTGAA*ACAGATGCTCANGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
DCI01_0105_A03.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
DCI01_0078_G10.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
BKFL1_0035_A11.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
SKNB1_0015_C04.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
ADR01_0021_D09.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
TCH01_0091_A11.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
LNG01_0005_H01.b : AAGCACAGGTTGAA*CAAGATGCTCAGGCATTGTTTCAGGCTGGAG*AACTTAAATGGGG
CBLT1_0038_B08.b :
SPLT1_0100_H02.b :
ILNT1_0067_G12.b :
20110601C-007088 : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
---------+---------+---------+---------+---------+---------+ 814
HTMT1_0032_G04.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
DCI01_0030_F09.b : tggaaaaaggtttatactttcttggaaccacaattgggccattttaaaagggggttgaaa
SPLT1_0035_A03.b : *AACAGATGAAGAAAAAGTTATTACTATCCTTTG*AAACACAAATGTGTCACATTTGAAA
CBLT1_0022_A01.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
OVRM1_0030_F06.b : *AACAGATGAAGATCAGTTCAATACTAATCTTGG*GACACGAAGTGTGTCcatttgagaa
SPL01_0075_B02.b : *AACAGATGAAGAGAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
ITT01_0095_D03.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
CBLT1_0072_B06.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
ADR01_0043_F01.b : *AACAGATGAAAAAAAATTTATTACTATCTTTGG*GACACGAAGTGTGTCCCATTTGAAA
SMG01_0075_G01.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
SPL01_0051_G12.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
OVR01_0009_B12.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
DCI01_0036_G01.b : ttatactttcttgggaaaccaaaatgtggtccattttaaaagggggtttgacaatacctg
OVRM1_0112_H04.b : *AACAGACGAAGAAAAGTTACTCA*TATCTTGGG*AACAGCAAGTGTGTCAattt
DCI01_0020_A05.b : *GACAGATGAAGAAAAGTT*ATTACTATCTTGGG*A*CACGAAGTGTGTCACATTgaaaa
AMP01_0026_F11.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAAA
AMP01_0046_C10.b : *GACAGATGAAGAAAAGTTTAT*ACTATCTTGGG*AACACCGAGTGTGTCCCATTTGAGA
MLN01_0077_F11.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
ADR01_0062_D01.b :
OVRM1_0199_B09.b : *AACAGATGAAGAAAAGTTTATTACTATCT
OVR01_0062_D01.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
ITT01_0021_B12.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
UTR01_0095_F06.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
HTMT1_0001_E03.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
AMP01_0095_E05.b : *GACAGATGAAGAAAAGT*TATTACTATCTTTGGGACACCGAATTGTGTCACATTTGAGA
OVRM1_0193_A03.b : *AACAGATGAA
OVRT1_0113_A10.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
OVRM1_0126_C10.b : *AACAGATGAAGAAA*GTTTATTACTATCTTTGG*A*CACGGAGTGTGTCACATTTGAGn
KDN01_0033_G12.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
LVRM1_0176_A04.b : *AACAa
OVRM1_0079_B03.b : *AACAGATGAAGACA*GTTTATTACTATCTTGGG*AACACGA*GTGTGTCACAT
SPL01_0026_F05.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
CBLT1_0020_A02.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*GACACGAAGTGTGTCACATTTGAGA
OVR01_0095_C07.b : *AACAGATGAAGAAAAGT*TATTACTATCTTGGG*AACACGAA*TGTGTCACATTTGAAA
OVRT1_0040_B12.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
DCI01_0040_C09.b : gaaaaaaccttaatcaccaccctggaaaccccaccgcccccctttgtaaaaacggggttg
BMWN1_0023_E06.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
AMP01_0082_H09.b : AAACAGATGA*GAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
DCI01_0030_E04.b : *ACCAGATGAAGAAAAGGTTATTACTATCTTGGG*AACCC*AAATGTGTCACATTTGAAA
DCI01_0038_B03.b : *GACAGATGANGAAAAAGTTATTACTATCTTGGG*AACAC*AAGTGTGTCACA*TTGAGA
AMP01_0092_E11.b : *AACAGATGAACGACAGTTTATTACTATCTTGCG*AACACGAAGTGTGTCACATTTGAGA
DCI01_0042_H03.b : *AACAGATGAAGAAA*GTTTTATACTATCTTGGG*AA*ACGAAATGTGTC*CATTTGAGA
AMP01_0096_A12.b : *GACAGATGAAGAAAAGTTTAT*ACTATCTTGGG*AA*ACGAAGTGTGTCACATTTGAGG
AMP01_0079_C06.b : *AACAGATGACGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
AMP01_0041_C02.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
DCI01_0099_H08.b : *AACAGATGAAG*AAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
DCI01_0094_E12.b : *AACAGATGAAGAAA*GTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
AMP01_0094_G04.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
AMP01_0095_H05.b : *AACAGATGAAGAAAAAGTTATTACTATCTTGGG*AAACACGAGTGTGTCACATTTGAGA
DCI01_0084_G07.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
OVRM1_0171_H11.b : tttatcacgcttccaactactcagcttacaaaaacacagaaccccggcaatataataata
AMP01_0040_G04.b : ggaaacgaaaaaaaaaaattttttttcttctttgggaacccgaatggggccccatttgag
LNG01_0023_G12.b : GAACAGATGAAAAAAATTTTTTTACTATCTTTGG*AAACACAAGTGTGTCACATTTCACA
ITT01_0085_B11.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
OVRT1_0144_H03.b : *ACCAGATGAAGAAAAGT*TATTACTATCTTTGG*AACACGAAATGTGTCACATTTGAGA
SPL01_0058_E05.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCGCATTTGAGA
SPL01_0056_C04.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
DCI01_0085_H04.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
DCI01_0087_H02.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
DCI01_0109_B06.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
DCI01_0002_B11.b : *AACAGATGAAGAATAGT*TATTACTATCTTGGG*AACACGGAGTGTGTCACATTTGAGA
SPL01_0014_E09.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
DCI01_0025_H04.b : aattttatacttttcttgaaacccaatgggtgcaattttaaaaagggtgttgaacaacct
DCI01_0026_C12.b : aaaatgaagaaaatttttttctattcttgggaaccaaattgtgtccattttgaaaaaggt
AMP01_0004_G06.b : *AACAGATGACCAAAAGTTTATTACTTTCTTGGG*GACACCAAGTtgtgcccatttgaaa
AMP01_0037_A08.b : *AACAGATGAAGAAAAGTT*ATTACTATCTTGGG*AAC*CGAAGTGTGTCCCATTGGAG*
DCI01_0063_A03.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*GACACGAAGTGTGTCACATTTGAGA
HTMT1_0083_D05.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
AMP01_0102_A06.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*GACACGAAGTGTGTCACATTTGAGA
OVRT1_0075_F04.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
AMP01_0036_A06.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
AMP01_0061_G12.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG**ACACGAAGTGTGTCACATTTGAGA
DCI01_0011_E08.b : *GACAGATGAAGAAAAGTTTTATACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
KDN01_0003_A10.b : aaaaaaaaatttttttcttctttggaaaacacaaaggtgtccctttttaaaaagggggtt
PST01_0085_F04.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
PST01_0005_D11.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
ADR01_0084_E10.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
OVRM1_0194_A03.b : ttt
OVRM1_0004_H06.b : *AACAGATGAAGAAAGTTTATTgacatcttgtgacaagaatgcgtcacacctgcaaaccg
OVRM1_0196_H04.b : *AACAGATGAAGAAAAGTTTATTACTATCTT
OVRM1_0056_A12.b : *AACAGATGAAGA*AAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCcacatttgag
OVRM1_0053_H08.b : *AACAGATGAAGAAAAG*TTATTACTATCTTGGG*GACACGCAATGTGTCCCATTTtgaa
OVRM1_0085_E02.b : *AACAGATGAAGAAAAGTT*ATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGn
OVRM1_0062_C08.b : *AACAGATGAAGA*AAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
OVRM1_0186_H09.b : *AACAGAATGAAGAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
OVRM1_0129_E08.b : *GACAGATGAAAGAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
SPL01_0074_C01.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAAA
SPL01_0102_C02.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*GACACGAAATGTGTCACATTTTAGA
ADR01_0003_A08.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACAAAGTGTGTCACATTTGAGA
SPL01_0034_B08.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAAG
SPL01_0089_A03.b : *AACATATGAAGACAAGTTTATTACTATCTTGGG*TACACGAAGTGTGTCACATTTGACA
SPL01_0003_G03.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
UTR01_0088_C08.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
SMG01_0038_D02.b : *GACAGATGAAGAAAAGTTTATTACTATCTTGGG*CACACGAAGTGTGTCACATTTGAGN
ITT01_0002_G08.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
ITT01_0097_G08.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
OVRT1_0054_C01.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
PBL01_0065_D04.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
OVRT1_0094_F02.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
OVR01_0100_A01.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
ITT01_0081_C02.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
OVR01_0091_C02.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
AMP01_0040_B02.b : aagggggaacaaaatgaaaaaaaatttttatcctttccttgggaaccccaaagtggtttc
AMP01_0004_H04.b : *AACAGAATGAGAAAAATTTTATACTATCTTGGG*AACACAAAGTGTGTCACATTTGGAA
DCI01_0016_B01.b : *GACAGATGAAG*AAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
DCI01_0091_E02.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
OVRT1_0069_F05.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
DCI01_0029_G12.b : tataacttctggggaacccaagggggccatttgaaaagggggttgaaaatcctggacaat
DCI01_0026_C05.b : *AACAGATGAGGAAAAGTT*ATTACTATCTTGGG*AACACGA*GTGCGTCCCATTTGAaa
DCI01_0104_B09.b : *GACAGATGAGGAAAAGGTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTGAGAA
DCI01_0105_B09.b : *GACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGA*GTGTGTCACATTTGAGA
AMP01_0081_E01.b : *AACAGATGAAGAAAAGTTTTATACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
AMP01_0065_H04.b : *GACAGATGAAGAAAAGTTTAT*ACTATCTTGGG*AACACGA*GTGTGTCACATTTGAGG
AMP01_0092_G07.b : *AACAGATGAAAGAAAG*TTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
AMP01_0084_H11.b : *AACAGATGAAGAAAA*TTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
AMP01_0081_C08.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
SPL01_0060_F01.b : gggaaaaataattaataaaaaatttttttcacaatcttttggaaaacataaagtggtggt
OVRT1_0017_H05.b : gacagatgactaaaagttttttactattcttggaaacaataagtgtgtctttttttaaaa
OVRM1_0152_H06.b : *GACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGA
OVRM1_0192_A03.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*GACACGAAGTGTGTCACATTTGAGA
OVRM1_0018_F04.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
OVRM1_0215_H02.b : *AACAGATGAGGAAGAGTTTATTACTATCTTTGG*AACACGACGTGTGTCACATTTGACA
OVRM1_0203_E02.b : *AACAGATGAAG*AAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
SPL01_0061_A03.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTtgag
OVRM1_0186_E11.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
OVRM1_0126_A08.b : *GACAGATGAAGCAAAGTTTATTACTATCTTTGG*AAACACGAGTGTGTCACATTTGAGA
OVR01_0079_A04.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACCAAATGTGTCTCCTTTTTAG
ADR01_0043_F12.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
OVRT1_0097_A07.b : *GACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAAA
PCT01_0020_F06.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
OVRT1_0134_F02.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
SPL01_0002_H11.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
OVRT1_0152_H12.b : *AACAGATGAAGAAAAAGTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
OVRT1_0102_G05.b : *AACAGATGAAGAANAGT*TATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
KDN01_0072_A05.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
OVRT1_0116_A03.b : *AACAGATGAAGAANAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
ADR01_0066_E12.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
ITT01_0093_F08.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
ADR01_0088_D04.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
KDN01_0067_D11.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
CLNT1_0112_G05.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
PCT01_0013_E03.b : *AACAGATGAAGAANAGTTTNATACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
AMP01_0035_H04.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
ADR01_0031_H08.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
AMP01_0055_F08.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
SKNB1_0010_D02.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
BFLT1_0088_D11.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
ADR01_0054_C11.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
AMP01_0034_G08.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AAACACGAGTGTGTCACATTTGAGG
DCI01_0115_F06.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
DCI01_0111_B10.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
PCT01_0001_B08.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
PST01_0073_H04.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
PST01_0016_F01.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
PST01_0031_B05.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
OVRT1_0053_H03.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
TCH01_0079_G12.b : *AACAGATGAAGAAGAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
AMP01_0075_G02.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
SKNB1_0064_A01.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
OVRM1_0013_C11.b : *AACAGATGAAGAANAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
OVRM1_0183_C11.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTATGTCACATTTGAGA
PBL01_0074_E03.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
LNG01_0062_E09.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
OVRT1_0050_D03.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
PTG01_0063_A11.b : aaaaatttattatcatttggggaaaccaaaagggtccattttaaaaaagggggttgaaaa
ADR01_0015_C03.b : acaatatggaaaaaattttattatctattcttggaacacgaattgtgtcccattttaaaa
BKFL1_0020_G05.b : *AACAGATGAAGAAAAGTTCATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
DCI01_0100_D11.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
OVRM1_0215_D06.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGG
AMP01_0051_C04.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGGGAACACGAAGTGTGTCACATTTGAGA
KDN01_0042_H03.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
LNG01_0031_H02.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
AMP01_0072_H01.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AAACACGAGTGTGTCACATTTGAGG
OVRM1_0033_A09.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AAAACGAAGTGTGTCACATTTGAGA
OVRM1_0002_H03.b : *AACAGATGAAG*AAAGTTTATTACTATCTTTGG*AACACGAAATGTGTCACATTTGANA
OVRM1_0094_D09.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
OVRM1_0206_F10.b : *AACAGATGAAGAA*AGTTTATTACTATCTTGGG*CACACGAAGTGTGTCACATTTGACG
SMG01_0103_H07.b : *AACAGATGAAGAANAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
LNG01_0036_H08.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
LNG01_0070_G03.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
OVR01_0020_G04.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
OVRM1_0210_F02.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
SKNB1_0008_C07.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
SKNB1_0037_B01.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
DCI01_0016_H09.b : *GACAGATGAAGAAAAGTTTATTACTATCTTGGG*GACACGAAGTGTGTCACATTTGAGA
OVRT1_0020_B04.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
DCI01_0037_C07.b : *AACAGATGAAGAANAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
DCI01_0105_A03.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
DCI01_0078_G10.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
BKFL1_0035_A11.b : *AACAGATGAAGAAAAGTTTATTACTATCTTGGG*AACACGAAGTGTGTCACATTTGAGA
SKNB1_0015_C04.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
ADR01_0021_D09.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
TCH01_0091_A11.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
LNG01_0005_H01.b : *AACAGATGAAGAAAAGTTTATTACTATCTTTGG*AACACGAAGTGTGTCACATTTGAGA
CBLT1_0038_B08.b :
SPLT1_0100_H02.b :
ILNT1_0067_G12.b :
20110601C-007088 : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
---------+---------+---------+---------+---------+---------+ 870
HTMT1_0032_G04.b : A*GGTTGTTTGAACAAT*ACATGACTATATCAGGATTTCCAATTTGAAGAAACATTTGA*
DCI01_0030_F09.b : aaacttggcttatccgggtttcaattggaaaaccctttaccggaaactttcgggaattgg
SPLT1_0035_A03.b : A*GGGGGTTTGACAAA**ACCTGACTAattcaggaatttcaatttgaaaaaccattgacc
CBLT1_0022_A01.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTTTCAAA*TGAAGAAACCATTGA*
OVRM1_0030_F06.b : tggtgtgtg
SPL01_0075_B02.b : A*AGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAACCATTTGA*
ITT01_0095_D03.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
CBLT1_0072_B06.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
ADR01_0043_F01.b : A*AGGTGTTTGGAAAAT*TCCTGACTTAATCCGGATTT**CAATTTGAAAAAACCTTGAC
SMG01_0075_G01.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT**CAAATTGAGAAACCATTGA*
SPL01_0051_G12.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGGATT*CAAATTGAAGAACCCTTGGA*
OVR01_0009_B12.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
DCI01_0036_G01.b : gcctattccggatttccaattgaaaaacctttggccgggaacttttgggaattttgaaca
OVRM1_0112_H04.b :
DCI01_0020_A05.b : aggtgtttgacaaatactgactatatcggattccaaattnagaaaccattgaccggaaac
AMP01_0026_F11.b : A*GGGTGTTTGACAAAT*ACCTGACTATATCCAGGTTTTCCAATTGAAGA*ACCATTGAC
AMP01_0046_C10.b : A*GGGTGTTTGACAAAT*ACTTGACTATATCAGGATTT*CAAATTGAAGAAACCTTGAA*
MLN01_0077_F11.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAA*CATTGA*
ADR01_0062_D01.b :
OVRM1_0199_B09.b :
OVR01_0062_D01.b : A*GGGTGTTTGACAAAT*ACCTGACTATATCAGGATTT*CAAATTGAAGAAACCATTGAC
ITT01_0021_B12.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
UTR01_0095_F06.b : A*GGGTGTTTGANCAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAA*CATTGA*
HTMT1_0001_E03.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
AMP01_0095_E05.b : AAGGTGTTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCAATGAC
OVRM1_0193_A03.b :
OVRT1_0113_A10.b : A*GGGGTGTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTTGAGAAAACATTGA*
OVRM1_0126_C10.b :
KDN01_0033_G12.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
LVRM1_0176_A04.b :
OVRM1_0079_B03.b :
SPL01_0026_F05.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATT
CBLT1_0020_A02.b : G*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAA*CCATTGA*
OVR01_0095_C07.b : A*GGGTGTTTGACAAAT*ACCTGACTATATCAGGATTT**CAATTGAAAAAACCATTGAC
OVRT1_0040_B12.b : A*GGGTGTTTGACNAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTTTG
DCI01_0040_C09.b : accacctccctgcccttatccggaattccctttcaaacaacctatgaccggcccaccccc
BMWN1_0023_E06.b : A*GGGTGTTTTGACAAT*ACATGACTATATCAGGATTTTCA*ATTGAAGAAACCATTGA*
AMP01_0082_H09.b : A*GGGNTGTTGACAAAT*ACATGACTATATCAGGATTT*CAATTTTGAGAAACATTTGA*
DCI01_0030_E04.b : A**GTTGTTTGACAAAT*ACCTGACTATTTCAGGATTT**CAAATTGAAAAACCATTGA*
DCI01_0038_B03.b : A*GGGNTGTTGACAAAT*ACATGACTATATCAGGATTT**CAATTGAAGAACCCATGACC
AMP01_0092_E11.b : A*AGGGGTGTTGACAAT*ACATGACTATATCAGGATTT**CAATTGAAGAAACATTTGAC
DCI01_0042_H03.b : A*GGNTGTTTGACAAAT*ACCTGACTATATCAGGATTT*CCAATTGAAGAACCCTTGAC*
AMP01_0096_A12.b : N*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTTCCAA**TGGAAAAACCATTGG*
AMP01_0079_C06.b : A*GGGGTGTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGNAGAAACCATTGG*
AMP01_0041_C02.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGNAGAAACCATTGA*
DCI01_0099_H08.b : A*GGGTGTTTGACNAAT*ACATGACTATATCAGGATTTTCAA**TTGAAGAAACATTGA*
DCI01_0094_E12.b : A*GGGTGTTTGACCAAT*ACATGACTATATCAGGATTTTC*AATTGAAGAAACCATTGA*
AMP01_0094_G04.b : A*GGTCGTTTGACAAAT*ACATGACTATATCAGGATTT**CAATTTGAAGAAACATTGA*
AMP01_0095_H05.b : A*GGGCGTTTGACAAAT*ACATGACTATATCANGATTT*CAAATTGGAGAAACCATTGA*
DCI01_0084_G07.b : A*GGGTGTTTGACNAAT*ACATGACTATATCAGGATTT**CAATTTTGAGAACCATTGA*
OVRM1_0171_H11.b : ataaagaatat
AMP01_0040_G04.b : aggggggtttgaaaaatccctgactttttccgggattttaaattaaaaaaaccctttgcc
LNG01_0023_G12.b : A*GGGGGTTTGAC*AAT*ACCTGGCTATATCAGGATTT*CAAATTGAAAAACCCTTTGC*
ITT01_0085_B11.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTTTCAAATTGAAAAACCCTTTGA*
OVRT1_0144_H03.b : A*AGGTGTTTGACCAAT*ACCTGACCATATCAGGATTC*CAAATTGAAAAAACCATTGA*
SPL01_0058_E05.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTTTC*AATTGAAGGAACCCTTGA*
SPL01_0056_C04.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT**CAATTGAAGAAACCATTGA*
DCI01_0085_H04.b : A*GGGGTGTTGACNAAT*ACATGACTATATCANGGATT*TCAATTGNAGAAACCATTGA*
DCI01_0087_H02.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAATTTTGAGAAACCATGA**
DCI01_0109_B06.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGNAGAAACCATTGAC
DCI01_0002_B11.b : A*GGGTG*TTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAAAAACCATTGA*
SPL01_0014_E09.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTTNC*AATTGAAGAAACCA
DCI01_0025_H04.b : ggacctattccggtttcaatttaaaaaccctttccggggaatttcgggaaattggaacct
DCI01_0026_C12.b : gtttgaaaaatacctggctttttcccgggtttcaaatttgaaaacccttgtccgggaaaa
AMP01_0004_G06.b : agggggtttgaaaaatcctgactttatcagtatttccaatttataaccccttgaccgggt
AMP01_0037_A08.b : A*GGGTGTTTGACAA*T*ACCTGACTATATCAGGATTTCAAAtgaagaaaccttgaacgg
DCI01_0063_A03.b : A*GGGNTGTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATGA**
HTMT1_0083_D05.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
AMP01_0102_A06.b : AGGGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATGGAAGAAACCATTGAA
OVRT1_0075_F04.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAG*AACCATTGA*
AMP01_0036_A06.b : A*GGGGTGTTGACAAAT*ACATGACTATATCAGGATTC*CAAATTTGAAATACCATTGA*
AMP01_0061_G12.b : A*GGGGTGTTGACAANT*ACATGACTATATCAGGATTTNC*AATTGNAGAAACCATTGA*
DCI01_0011_E08.b : A*GGGTGNNTTGACAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAAACATTGAA
KDN01_0003_A10.b : tgaaaaaacggggatttttcggggtttcaatttaaaaaaaccttttccgggaaatttttg
PST01_0085_F04.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
PST01_0005_D11.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CGAATTGAAGAAACCATTGA*
ADR01_0084_E10.b : A*GGGTGTTTGACAAAT*ACATGACTATATCANGATTT*CAAATTGAAGAAACCATTGA*
OVRM1_0194_A03.b :
OVRM1_0004_H06.b : tctttgact
OVRM1_0196_H04.b :
OVRM1_0056_A12.b : acggtgtttgacaatacatg
OVRM1_0053_H08.b : aggctggttgacca
OVRM1_0085_E02.b :
OVRM1_0062_C08.b : A*GGGTGTTTGACCAAT
OVRM1_0186_H09.b : A*GGGTGTTTGACNAAT*ACATGACTATnatcaga
OVRM1_0129_E08.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAG
SPL01_0074_C01.b : A*GGGTGTTTGACAAATTACATGACTATTTCAGGATTTTCAAATTGAAAAAACCATTGAC
SPL01_0102_C02.b : A*AGGTGGTTGACAAAT*ACCTGACTATATTCAGGATTTCCAATGGAAGAAACCATTGAC
ADR01_0003_A08.b : A*AGGTGTTTGAACAAT**CATGACTATATCAAGATTTTCAATTGGAGAAAACATTTGA*
SPL01_0034_B08.b : A*GGGTGTTTGACAA*T*ACATGACTATTTCAGGATTT**CAAATTGAAGAACCATTGAC
SPL01_0089_A03.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTTCACACTGAATAAAACCATTGA*
SPL01_0003_G03.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
UTR01_0088_C08.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAAGATTTTCAATTGAAGAAACCCATTGA*
SMG01_0038_D02.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAAGAAACATTGA*
ITT01_0002_G08.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGGTTT*CAAATTGAAGAAACCACTGA*
ITT01_0097_G08.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
OVRT1_0054_C01.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATGA**
PBL01_0065_D04.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTTG*
OVRT1_0094_F02.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*TCAATTGAAGAAACCATTGA*
OVR01_0100_A01.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGAC
ITT01_0081_C02.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
OVR01_0091_C02.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
AMP01_0040_B02.b : cattttgagagagggggtttgaaacaaaacctggaccttattcggggatttcaaaattaa
AMP01_0004_H04.b : A*AGGTGTTTGAAAAAT*ACTTGACTATATtcgggatttaaattgaaaaacccttgtacc
DCI01_0016_B01.b : A*GGGTGTTTTGACAAT*ACATGACTATATCAGGATTT**CAATTGAAGAAAACCTTGA*
DCI01_0091_E02.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT**CAAATTGAGAAACCATGA**
OVRT1_0069_F05.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
DCI01_0029_G12.b : tcggatttcaattggaaaaccttgacgggaaattctggaaatttgaacaaaggccctttc
DCI01_0026_C05.b : gggtgtttgacaaatactgactatttcaggattcccaattgaagaaaccatgaacgggaa
DCI01_0104_B09.b : A*GGGTGTTG**ACAAT*ACATGACTATATCAGGATTTCCAATgaagaaccatttgacgg
DCI01_0105_B09.b : **GGGTGTTNGAC*AAT*ACATGACTATATCAGGATTTTCAATTGAGA***AACATTGAC
AMP01_0081_E01.b : A*GGGTGTTTTGACAAT*ACATGACTATATCAGGATTT**CAATTTGAGAAACCATTGAC
AMP01_0065_H04.b : A*GGGTGTTTGAC*AAT*ACATGACTATATCAGGATTT*CAAATTGNNAGAAACATTGAC
AMP01_0092_G07.b : A*GGNTGTTTGACAAAT*ACATGACTATATCAGGATTTNCAATGNANNGAACCA***TGA
AMP01_0084_H11.b : A*GGGTGTTTGACGAAT*ACATGACTATATCAGGATTTTC*AATTGAGAAACCCATTGA*
AMP01_0081_C08.b : A*GGNTGTTTGACAAAT*ACATGACTATATCAGGATTTNC*AATTTGAGAAACCATTGA*
SPL01_0060_F01.b : ctatattgaaaaaagggtggtttttaaacaaaattcttgtaacattattccgggattttc
OVRT1_0017_H05.b : ggatgtttggacaatcactgccatatatccagatttcaaattgattgaaaccattgatcc
OVRM1_0152_H06.b :
OVRM1_0192_A03.b : A
OVRM1_0018_F04.b : A*GGGTG
OVRM1_0215_H02.b : A*AGGTGTTn
OVRM1_0203_E02.b : A*GGGTGTTTGACA
SPL01_0061_A03.b : aagggtgttttgacaaatacttgactatttcaggatttccaaattgaagaaaccatttga
OVRM1_0186_E11.b : A*GGGGTTGTTGACAAT*ACATGACTATATCAGGAn
OVRM1_0126_A08.b : A*GGGTGTTTGGACAAT*ACATGACTATATCAGGA
OVR01_0079_A04.b : AAGGGTGGTTGACCAAT*ACCTGACTATATCCGGGATTTCCATTGAAGAAAacctttgac
ADR01_0043_F12.b : A*GGGTGTTTTGACAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGAA
OVRT1_0097_A07.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
PCT01_0020_F06.b : A*AGGTGTTTGACAAAT*ACATGACTATATCANGATTT*CAAATTGAAGAAAACATTGA*
OVRT1_0134_F02.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTTGAAGAACCATTTGA
SPL01_0002_H11.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGAC
OVRT1_0152_H12.b : A*GGGGGTGTTGACAAT*ACATGACTATATCAGGATTT*CAAATTGAGGAAACCATTGA*
OVRT1_0102_G05.b : A*GGGGTGTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAAACATTTG*
KDN01_0072_A05.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
OVRT1_0116_A03.b : A*GGGGTGTTGACAAAT*ACATGACTATATCAGGATTTTCAATTNGAGAAAACATTTGA*
ADR01_0066_E12.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAAC*ATTGA*
ITT01_0093_F08.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTTTCAA**TTGAGAAACCATTGA*
ADR01_0088_D04.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTC*CAAATTGAAGAAACCATTGA*
KDN01_0067_D11.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
CLNT1_0112_G05.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAAGATTTCAAA***TGAAGAAACATTGA*
PCT01_0013_E03.b : A*GGGTGTTTGACAAAT*ACATGACTATATCANGATTT*CAAATTGAAGAAACCATTGA*
AMP01_0035_H04.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
ADR01_0031_H08.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
AMP01_0055_F08.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAGAAACCATTTGA*
SKNB1_0010_D02.b : A*GGGTGTTTGACAAAT*ACATGACTATATCANGATTT*CAAATTGAAGAAACCATTGA*
BFLT1_0088_D11.b : A*GGGTGTTTGACAAAT*ACATGACTATATCANGATTTTC*AATTGAAGAAACCATTGAC
ADR01_0054_C11.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
AMP01_0034_G08.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGA*GAAACCATTGA*
DCI01_0115_F06.b : A*GGGGTGTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAAACATTGA*
DCI01_0111_B10.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAAGATTT*CAANTTGAAGAAACCATTGA*
PCT01_0001_B08.b : A*AGGTGTTTGANCAAT*ACATGACTATATCAGGATTT*CAAATTTGAGAAACCATTGA*
PST01_0073_H04.b : A*GGGTGTTTGACAAAT*ACATGACTATATCCGGATTT*CCAATTGAAGAAACCATTTG*
PST01_0016_F01.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
PST01_0031_B05.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CNAATTGAAGAAACCATTGA*
OVRT1_0053_H03.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCCATGA*
TCH01_0079_G12.b : A*GGGTGTTTGACATAT*ACATGACTATATCAGGATTT*CACATTGAAGAAACCATTGA*
AMP01_0075_G02.b : AGGGGGTGTTGAC*AAT*ACATGACTATATCAGGATTT*CAAATTTGAGAAACCATGA**
SKNB1_0064_A01.b : A*GGGTGTTTGACAAAT*ACATGACTATATCANGATTT*CAAATTGGAGAAACCATTGA*
OVRM1_0013_C11.b : A*GGTTGTTTGAC*AAT*ACATGACTATATCAGGATTT*CAAATTGAGg
OVRM1_0183_C11.b : A*AGGTGTTTGACAAAT*ACATGACTATATCAAGATTT*CAAATTGAAGAAACCATTGAC
PBL01_0074_E03.b : A*GGGTGTTTGACAAAT*ACATGACTATATCANGATTT*CAAATTGAAGAAACCATTGA*
LNG01_0062_E09.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
OVRT1_0050_D03.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
PTG01_0063_A11.b : aaacggggattttcggggtttcaatttgaaaaaccttttgcgcggaaatttttgggattt
ADR01_0015_C03.b : gggttttggaaaaatcctgtattattccaggttttcaaattgaaaaacctttggaccggt
BKFL1_0020_G05.b : A*GGGTGTTTGAACAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
DCI01_0100_D11.b : AGGGGTGTTTGAC*AAT*ACATGACTATATCAGGATCT*CAAATTGAAGAAACCATTGA*
OVRM1_0215_D06.b : A*AGGTGTTTGACCAAT*ACATGACTATATCAGGATTTCAAATGTAGAA
AMP01_0051_C04.b : A*GGGTGTTTGACAAAT*ACCTGACTATATCAGGATTT**CAATTTGAGAAAACATTGA*
KDN01_0042_H03.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
LNG01_0031_H02.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
AMP01_0072_H01.b : A*GGGTGNTTTGACAAT*ACATGACTATATCAGGATTT*CAAATTTGAGAAACCATGA**
OVRM1_0033_A09.b : A*GGGTGTTTGACA*AT*ACATGACTATATTAGGATTT*CAAATTGAAaaan
OVRM1_0002_H03.b : A*GGGTGTTTGACCAAT*ACATGACTATATCAAGATTT*CAAATTGGAGAAACA
OVRM1_0094_D09.b : A*GGGTGTTTGACAAAT*ACATGACTATATCANGATTT**CAATTGAAGNAACCATTGAC
OVRM1_0206_F10.b : A*GGGTGTTTGTACAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAAACATTGAC
SMG01_0103_H07.b : A*GGGTGTTTGACAAAT*ACATGACTATATCANGATTT**CAATTGAAGAAA*CATTGA*
LNG01_0036_H08.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
LNG01_0070_G03.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
OVR01_0020_G04.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
OVRM1_0210_F02.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTTCAAATT
SKNB1_0008_C07.b : A*GGGTGTTTGGACAAT*ACCTGACTATATCAGGATTT*CCAATTGAAGAAACCATTGA*
SKNB1_0037_B01.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
DCI01_0016_H09.b : **GGGTGTTTGACNAAT*ACATGACTATATCGGATTT**CAAATTGAAGAAACCATTGA*
OVRT1_0020_B04.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
DCI01_0037_C07.b : A*GGGTGTTTGACNANT*ACATGACTATATCAGGATTT*CAAATTGAAGAAAC*ATTGAC
DCI01_0105_A03.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
DCI01_0078_G10.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
BKFL1_0035_A11.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
SKNB1_0015_C04.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
ADR01_0021_D09.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
TCH01_0091_A11.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
LNG01_0005_H01.b : A*GGGTGTTTGACAAAT*ACATGACTATATCAGGATTT*CAAATTGAAGAAACCATTGA*
CBLT1_0038_B08.b :
SPLT1_0100_H02.b :
ILNT1_0067_G12.b :
20110601C-007088 : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
---------+---------+---------+---------+---------+---------+ 926
HTMT1_0032_G04.b : CCGGGAGACT*TCTGGTAATTGGG*AAGCACTGCTCCCT*GCTGTTGTGAAATCTTA*TC
DCI01_0030_F09.b : aacaatgccccttgtgtttgaaacttttcgaaatcccggccaccttggaaaatcccctat
SPLT1_0035_A03.b : gggaaaacttcgggaattggaacaaacggctccttgcggtgggaaaatcaattcgaaata
CBLT1_0022_A01.b : CGGGGAAACT*CCTGGTAATTTGG*AACAACTGCCTCCT*TGCGGTTGGGAATCTAT*TC
OVRM1_0030_F06.b :
SPL01_0075_B02.b : CCGGGAGACTTTCTGGTATTTTGG*A*CAACTGCTCCTT*GCTGGTGTGgaaatctattt
ITT01_0095_D03.b : CCGGNAGACT*TCTGGTAATTTGG*AGCCACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
CBLT1_0072_B06.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
ADR01_0043_F01.b : CGGGAaaacttctggaatttggaacaactgctcctggcggttggaaaatctattcggaaa
SMG01_0075_G01.b : CCGGNAGACT*TCTGGTAATTTGG*AGC*ACTGCTCCTT*GCTGTTGTG*AATCTAT*TC
SPL01_0051_G12.b : *CGGGAGACT*TCGGGTAATTTGG*AGCAACTGCTCCTTTGCTGTTGTGAAATCAAT*TC
OVR01_0009_B12.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
DCI01_0036_G01.b : acgcgccctgcggttggaaactcttttcgaaatacccggcctacctggaaaaacctccta
OVRM1_0112_H04.b :
DCI01_0020_A05.b : ctctgtaaattggacaactgctcctgctgtgggaaatctatccgagtaccctgctacctg
AMP01_0026_F11.b : CGGGgaaacttctggtaatttgaacaactgctccttgctgttgggaaatccattccggaa
AMP01_0046_C10.b : *CGGAAGACT*TCTGGTAATTTGA*AGC*ACTGCTCCTT*GCGTGTGTGAAATCTAT*TC
MLN01_0077_F11.b : CCGGGAGACT*TCTGGTAATTGGA*AGC*ACTGCTCCTT*GCTGNTGTGAAGTCTAT*TC
ADR01_0062_D01.b :
OVRM1_0199_B09.b :
OVR01_0062_D01.b : CGGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
ITT01_0021_B12.b : CCGGGAGACT*TCTGGTAATTTGG*AGNCACTGCTCCTT*GCTNGTGTGAAATCTAT*TC
UTR01_0095_F06.b : CCGGGAGACT*TCTGGGTATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
HTMT1_0001_E03.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
AMP01_0095_E05.b : Ccgggaactttcgggtattttggagcacctgctccttgctgttggtgaatctttccggaa
OVRM1_0193_A03.b :
OVRT1_0113_A10.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCCT*GCTGTTGTGGAATCTAT*TC
OVRM1_0126_C10.b :
KDN01_0033_G12.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
LVRM1_0176_A04.b :
OVRM1_0079_B03.b :
SPL01_0026_F05.b :
CBLT1_0020_A02.b : CCGGGAGACT*TCTGTTAATTTGG*AGCAACTGCTCCTT*GCTGTggggaatctattcgg
OVR01_0095_C07.b : CCGGGAGACT*TCTGGTAATTTGG*AAGCACTGCTCCCTggcggttgggaaatcttattc
OVRT1_0040_B12.b : ACGGGAGACT*TCTGGTAATTTGG*AGC*ACTGCTCCTT*GCTGNTGTGAAATCTAT*TC
DCI01_0040_C09.b : gctaactggaacccacctcccccctcctggtgcaaacctcttcgcaaaacccctccccac
BMWN1_0023_E06.b : CCGGGAGACT*TCTGGT*ATTTGG*AGCAACTGCTCCTTTGCTGTGT**AAATCTAT*TC
AMP01_0082_H09.b : *CGGGAGACT*TCTGGGTATTTGG*AGC*ACTGCTCCNT*GCTGNTGTGAAATCTAT*TC
DCI01_0030_E04.b : *CGGGAAAACTTCTGGTAATTgaaacactgctccctgctgttgtaaatccattcggaata
DCI01_0038_B03.b : GGaaacttcgggtatttggagcactgctcttgctgttgtgaatctattcgagtatccctg
AMP01_0092_E11.b : CGGAGACT***TCTGGTATTNNGN*NAGCACTGCTCCNT*GCTGTgtgaaatctatcnga
DCI01_0042_H03.b : ***GGGGAGACTTCTGTAAATTGG*AGCAACTGCTCCTT*GCTGTTGTGAAtccattcgg
AMP01_0096_A12.b : ACGGGAAAAC*TCTGGGAATTTGG*ACCAACTGCCTCTT*GCTGTTGTGAAATCTAT*TC
AMP01_0079_C06.b : CCGGGAGACT*TCTGGTAAATTTG*GAGCACTGCTCCNTTGCTGTTGTGA*ATCTAT*TC
AMP01_0041_C02.b : CCGGGAGACT*TCTGGTATTNNG***AGCACTGCTCCNT*TGCTGTGTGAATCTNATCGA
DCI01_0099_H08.b : CCGGGAGACT*TCTGGTAATTNGA*AGC*ACTGCTCCTT*GCTNGTGTGAAATCTAT*TC
DCI01_0094_E12.b : CCGGGAGACT*TCTGGNTAATTGN*AGGCACTGCTCCTC*GCTGNTGGTGAATCTAT*TC
AMP01_0094_G04.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTTCTT*GCTGTTGTGAAATCTAT*TC
AMP01_0095_H05.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCCAT*TC
DCI01_0084_G07.b : CCGGGAGACT*TCTGGGTATTNGG*AGC*ACTGCTCCNT*TGCTGTGTGAAATCTAT*CN
OVRM1_0171_H11.b :
AMP01_0040_G04.b : cgggaaaattcttgggaatttggagcacccccccccttggggttgggaaaaccaatttgg
LNG01_0023_G12.b : CGGGGAAACTTCTGGGTAtttgggaacacctgctccttgctggttgggaaaccattccgg
ITT01_0085_B11.b : CGGGGAAACT*TCTGGTAATTTGG*AACAACTGCTCCCTTGCTGTTGTGAAATCTAT*TC
OVRT1_0144_H03.b : CCGGGAAACT*TCTGGTAATTTGG*ACCAACGGCTCCTT*GGCGGTGGGAAAACCAT*TC
SPL01_0058_E05.b : CCGGGAGACT*TCTGGTAATTTGG*AGCACCTGCTCCCT*GCTGTTGTGAAATCCTATTC
SPL01_0056_C04.b : *CGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
DCI01_0085_H04.b : CCGGGAGACT*TCTGGGTATTTGG*NAGCACTGCTCCTT*TGCTGTGTG*AATCTAN*TT
DCI01_0087_H02.b : CCGGGAGACT*TCTGGTAAATTGagcactgctcctgctgtgtgaatctatcggagtaccc
DCI01_0109_B06.b : CGGNNAGACT*CTGGGTATTTNG***AGCACTGCTCCNN*TGCTGTGTGAAATCTATcga
DCI01_0002_B11.b : *CGGGNAGACTTCCTGTAATTTGG*AGCACCTGCTCCCT*GCTGTTGTGAAATCAAT*TC
SPL01_0014_E09.b :
DCI01_0025_H04.b : ggccctttgctgtggaaactctttcggagtaccggccacctttggaaaactcctcatttc
DCI01_0026_C12.b : ttttgggtatttggaccaactgtcctttgctgtttgaaaaaaattccggaaaacccgccc
AMP01_0004_G06.b : caccttcttgatattgtaacactggttccttccgtgtagaaactatttcggctactcttc
AMP01_0037_A08.b : gaaacttctggtaattggaacccctcctcctggcggtgggaatctattcggagttcccgg
DCI01_0063_A03.b : CCGGGAGACT*TCTGGTA*TTTGG*AGCAACTGCTCCTgctngtgtgaatctaatcggat
HTMT1_0083_D05.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
AMP01_0102_A06.b : CCGGGAGACTTNCTG*TANTTTGG*AGCAACTGCTTCCTTGCTGTTGTGAAATCcatttc
OVRT1_0075_F04.b : CCGGGAGACT*TCTGGTAATTTGG*AAGCACTGCTCCTT*TGCTGTGTGAAATCTAT*TC
AMP01_0036_A06.b : CCGGGAGACT*TCTGGTAA*TTGG*AGCCACTGCTCCTT*TTGCTGTGTGAATCTAT*TT
AMP01_0061_G12.b : CCGGGAGACT*TCTGGTAATTTGG*AGC*ACTGCTCCTT*GCTGNNTGTGAATCTAT*TC
DCI01_0011_E08.b : CGGGNAGACT*TCTGGGTATTTGGAAGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
KDN01_0003_A10.b : ttttttttaaaacaccccccccccttgtgtggaaaaaatttcgggaaacccccccccccc
PST01_0085_F04.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
PST01_0005_D11.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
ADR01_0084_E10.b : CCGGGAGACT*TCTGGTAATTTGG*AGNCACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
OVRM1_0194_A03.b :
OVRM1_0004_H06.b :
OVRM1_0196_H04.b :
OVRM1_0056_A12.b :
OVRM1_0053_H08.b :
OVRM1_0085_E02.b :
OVRM1_0062_C08.b :
OVRM1_0186_H09.b :
OVRM1_0129_E08.b :
SPL01_0074_C01.b : cggggaaacttctgggtaatttggaacaactggctccttgcctgttgtgaaaacctattc
SPL01_0102_C02.b : Ccgggagacctcttgtaatttggaacaactgcctcctggtgttgtgaaaatacattcgga
ADR01_0003_A08.b : *CGGGAGACC*TCTGGGAATTTGG*AGCAACTGCTCCCT*GCTGGTGTGGAAACAAT*TC
SPL01_0034_B08.b : CCGGAAACC**TCTGGTAATTTGG*AGCAACTGCTCCTT*GC*GGTGTGAAATCCTA*TC
SPL01_0089_A03.b : CGGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGAGAAATCTAT*TC
SPL01_0003_G03.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
UTR01_0088_C08.b : CCGGGAGACT*TCTGGGTATTTGGGAGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
SMG01_0038_D02.b : CCCGGAGACC*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGCTGTGAAA*CTAA*TC
ITT01_0002_G08.b : CCGGGAGACT*TCTGGTAATTTGG*GAGCACTGCTCCTT*GNNCTGTGTGAATCTAT*TC
ITT01_0097_G08.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*TGCTGTGTGAAATCTAT*TC
OVRT1_0054_C01.b : CCGGGAGACT*TCTGGGTATTTGG*AGC*ACTGCTCCNT*TNGCTGTGTGAATCTAT**C
PBL01_0065_D04.b : ACGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
OVRT1_0094_F02.b : CCGGGAGACT*TCTGGGTATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAAATCTA*TC
OVR01_0100_A01.b : CGGGNAGACTTCTGGTAAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
ITT01_0081_C02.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*TGCTGTGTGAAATCTAT*TC
OVR01_0091_C02.b : CCGGGAGACT*TCTGGNTATTTGG*AGCAACTGCTCCTT*TGCTGTGTGAAATCTAT*TC
AMP01_0040_B02.b : aaaaacccctggacccggaaaaatttttgggatatttgggaacccctcctcccccttggg
AMP01_0004_H04.b : gaaaattctggtaatttggaacacctgctccttgaggttgtaaaactaatccgaggatcc
DCI01_0016_B01.b : CCGGGAAACT*TCTGGTATTTGGAacaccggctcctgctgtttgaaatctatccgagtaa
DCI01_0091_E02.b : CCGGGAGACT*TCTGGTAATTTGG*AGC*ACTGCTCCNT*TGCTGTGTGAAATCTAT*TT
OVRT1_0069_F05.b : CCGGGAGACT*TCTGGTAATTTNG*GAGCACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
DCI01_0029_G12.b : ggtttgaaaccctttcaaaatcccggctacctggaaaaactctcttagcatgaagggact
DCI01_0026_C05.b : acttctgtaatttgaacactgccccttgcggtggaaaatctatcggaatatccgcctaac
DCI01_0104_B09.b : gagactcctgtaatttggagcactgctcctgctgtgtgaatctatcggagtatccctgct
DCI01_0105_B09.b : CGGagacttctggtattnggagcactgctcctgctgtgtgaatctattcgagtatccctg
AMP01_0081_E01.b : CCGGAGACTT**CTGGTAATTNGG*AGC*ACTGCTCCTT*GCTGNTGTGAAtctnattcg
AMP01_0065_H04.b : CGGGAAGAC**TCTGGTATTTNGN*AGC*ACTGCTTCTT*GCTGNTGTGAAATCAAT*TT
AMP01_0092_G07.b : CCCGGAGACT*TCTGGTAATTNGG*AGC*ACTGCTCCTT*TGCTGTGTGAAATCTAT*CN
AMP01_0084_H11.b : *CGGGAGACT*TCTGGTAA*TTGG*AGCAACTGCTCCTT*GCTGNTGTGAAATCTAT*TC
AMP01_0081_C08.b : *CGGNAGACT*TCTGGGTATTNGN*AGC*ACTGCTCCTT*GCTGNTGTGAANTCTAT*TC
SPL01_0060_F01.b : taaattctgaataaacccttttttacccggggaaaattctctgggatattttgtgagaac
OVRT1_0017_H05.b : gtgataattctggaaatttcgaaccaattgctacctgacagttattaaaatctattaccg
OVRM1_0152_H06.b :
OVRM1_0192_A03.b :
OVRM1_0018_F04.b :
OVRM1_0215_H02.b :
OVRM1_0203_E02.b :
SPL01_0061_A03.b : ccgggagacttccgggtaatttggaagcaactgcccccttggtggttgtgaaaatcttat
OVRM1_0186_E11.b :
OVRM1_0126_A08.b :
OVR01_0079_A04.b : ccggaggacttctgggaattttggagccactggccccttgcctggtgggaaaacctattc
ADR01_0043_F12.b : CCGGGAGACTTTCTGGAAATTTGG*AGCAACTGCTCCCTTGCTGTTGGGAAATCTATTTC
OVRT1_0097_A07.b : CCGGAAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
PCT01_0020_F06.b : CCGGGAGACT*TCTGGTAATTTGG*GAGCACTGCTCCCT*TGCTGTGTGAAATCTAT*TT
OVRT1_0134_F02.b : CCGGGAGACT*TCTGGGTATTTGG*GAGCACTGCTCCTT*GCTNGTGGTGAATCTAT*TC
SPL01_0002_H11.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
OVRT1_0152_H12.b : CGGGNAGACT*TCTGGGTATTTGG*AGCAACTGCTCCTT*TGCTGTGTGAAATCTAT*CN
OVRT1_0102_G05.b : ACGGGAGACT*TTCTGGTATTTGG*AAGCACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
KDN01_0072_A05.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
OVRT1_0116_A03.b : CGGGGAGACT*TCTGGTATTTGGG*AGC*ACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
ADR01_0066_E12.b : CCGGGAGACT*TCTGGTAATTTGG*AGCACCTGCTCCNN*TGCTGTGTGAAATCTAT*TC
ITT01_0093_F08.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
ADR01_0088_D04.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*TGCTGTGTGAAANTCTA*TC
KDN01_0067_D11.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
CLNT1_0112_G05.b : CCGGGAGAC**TCTGGTAATTTGG*AGC*ACTGCTCCTgctgtttgaaattattcggagt
PCT01_0013_E03.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TT
AMP01_0035_H04.b : CCGGGAGACT*TCTGGTAATTNNG*GAGCACTGCTCCTT*GCTGNTGTGAAATCTAT*TC
ADR01_0031_H08.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCCT*TGCTGTGTGAAATCTNA*TC
AMP01_0055_F08.b : *CGGGAGACT*TCTGGTAATTTTG*AGC*ACTGCTCCTT*GCTGNTGTGAAAATCTA*TT
SKNB1_0010_D02.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
BFLT1_0088_D11.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
ADR01_0054_C11.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
AMP01_0034_G08.b : CCGGGAGACT*TCTGTAAATTTGA***GCACTGCTCCTT*GCTTGTGTGAATCTA***TC
DCI01_0115_F06.b : CCGGGAGACT*TCTGGNTATATTG*GAGCACTGCTCCNT*TGCTGTGTGAAATCTAT*TC
DCI01_0111_B10.b : CCCGGAGACT*TCTGGTA*TTTGG*AGCAACTGCTCCTT*GCTGGTGTGAAATCTAT*TC
PCT01_0001_B08.b : *CGGGAAGAC*TCTGGTA*TTTGG*AGCAACTGCTCCTT*GCTGTTGTGAA*TCTAT*TC
PST01_0073_H04.b : CCGGGAAACT*TCTGGTAATTTGG*AACAACTGCTCCTT*GCTGTTGTGAAATCTATTTC
PST01_0016_F01.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
PST01_0031_B05.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
OVRT1_0053_H03.b : CCGGNAGACT*TCTGGTATTTTGG*AGCAACTGCTCCNT*TGCTGTGTGAAATCTAC*TC
TCH01_0079_G12.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGNTGTGAAATCTAT*TC
AMP01_0075_G02.b : CCGGNAGACT*TCTGGTNAATTGA*G**CACTGCTCCNT*TGCTGTGTGAAATCTA**TC
SKNB1_0064_A01.b : CCGGGAGACT*TCTGGTAATTTGG*AGC*ACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
OVRM1_0013_C11.b :
OVRM1_0183_C11.b : CGGG
PBL01_0074_E03.b : CCGGGAGACT*TCTGGTAATTTGG*AGNCACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
LNG01_0062_E09.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
OVRT1_0050_D03.b : CCGGGAGACT*TCTGGTAATTTGG*AGC*ACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
PTG01_0063_A11.b : tgaaaaccccccctgtgttttgaaaaaaaatcgagaaaaacccgcccccctggaaaaaat
ADR01_0015_C03.b : aactttcgggttattggaacaaatggccccatgctgtcggaaaattatttcgattttcct
BKFL1_0020_G05.b : CCGGGAGACT*TCTGGGTATTTGG*GAGCACTGCTCCTT*GCTGTTGTGAATCNA***TC
DCI01_0100_D11.b : CGGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
OVRM1_0215_D06.b :
AMP01_0051_C04.b : CCGGGAGACT*TCTGGTATTTTGG*AGC*ACTGCTCCNT*GCTG*TGNGAAATCTAT*TC
KDN01_0042_H03.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
LNG01_0031_H02.b : CCGGGAGACT*TCTGGTAATTTGG*AACAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
AMP01_0072_H01.b : CCGGGAGACT*TCTGGTATTTTTG*AGC*ACTGCTCCNT*GCTGTgtgaatctattncga
OVRM1_0033_A09.b :
OVRM1_0002_H03.b :
OVRM1_0094_D09.b : C
OVRM1_0206_F10.b : CGG
SMG01_0103_H07.b : CCGGGAGACT*TCTGGTA*TTTGG*AGC*ACTGCNTCTT*GCTNGT*TGAAATCTAT*TC
LNG01_0036_H08.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
LNG01_0070_G03.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGGTGTGAAATCTAT*TC
OVR01_0020_G04.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
OVRM1_0210_F02.b :
SKNB1_0008_C07.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
SKNB1_0037_B01.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
DCI01_0016_H09.b : CCGGGAGACT*TCTGGTAAT*TGG*AGCAACTGCtccctgctggtggaaaatccatccga
OVRT1_0020_B04.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
DCI01_0037_C07.b : CGGGAAGACT**CTGGTAATTTGA*AGCAACTGCTCCCT*TGCTGTGTGAAATCTAT*TC
DCI01_0105_A03.b : CCGGGAGACT*TCTGGTAATTTGG*AGNCACTGCTCCTT*GCTNNGTGTGAATCTAT*TC
DCI01_0078_G10.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
BKFL1_0035_A11.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
SKNB1_0015_C04.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
ADR01_0021_D09.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
TCH01_0091_A11.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
LNG01_0005_H01.b : CCGGGAGACT*TCTGGTAATTTGG*AGCAACTGCTCCTT*GCTGTTGTGAAATCTAT*TC
CBLT1_0038_B08.b : ttttccgacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0100_H02.b :
ILNT1_0067_G12.b :
20110601C-007088 : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
---------+---------+---------+---------+---------+---------+ 983
HTMT1_0032_G04.b : GGAATATCCCGG*CCT*ACCTgcaaacctctctactatgcaatgaagggagctgggaaca
DCI01_0030_F09.b : agctttaagggccttgaaaaaaaattacccctccaaatcgggttctcaaaggaaattctg
SPLT1_0035_A03.b : ccccggccaacctggaaaaaatctctaaatttcaataaagggacccgggaaaaaaaatta
CBLT1_0022_A01.b : GGAGTATCCCCG*CTA*CCTTGCAA*AAACTCTCTACTAgcaaagaaagggagcgggaac
OVRM1_0030_F06.b :
SPL01_0075_B02.b : cgagtattccctgcctaccttgcaaaaactcctctactttgcaatgaagggaacctgggg
ITT01_0095_D03.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
CBLT1_0072_B06.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
ADR01_0043_F01.b : tccctggccaactttgaaaaaactccttattatgcaatgaaggggattgggacaaagaat
SMG01_0075_G01.b : GGAGTATCCCTG*Ctacctgcaaaactctctctatgcatgaaaggagctggaacgagatc
SPL01_0051_G12.b : GGAATAATCCTG*CCTACCTTGCAG*AAAactcttctactattccaaggaaagggacttg
OVR01_0009_B12.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
DCI01_0036_G01.b : tttcattgaaggggactgtggaaaaaaattaaccctcctaaaatcgggttcccgaaagga
OVRM1_0112_H04.b :
DCI01_0020_A05.b : cagaactcctactatgcatgaggnagctgggaggagatctacctcatcaatcatgttcca
AMP01_0026_F11.b : tatccccgcccaccttggaaaaactccctcttagccatgaaaggaactgggaccaatgat
AMP01_0046_C10.b : GGAATATCCCTG*CCTACttgcaaaactctctatttgcaatgaaaggagctggaaccaaa
MLN01_0077_F11.b : GGAGTATCCCTG*NCTACNTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
ADR01_0062_D01.b :
OVRM1_0199_B09.b :
OVR01_0062_D01.b : GGAGTATCCCTG*CCTAACTTGCAG*AAACTCTCTACTAAGCAATGAAAGGgactgggaa
ITT01_0021_B12.b : NGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
UTR01_0095_F06.b : GGAGTATCCCGG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*AAGCTGGGA
HTMT1_0001_E03.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
AMP01_0095_E05.b : gttccccgccctcccttgcagaaaccttcctacttttgcatgaaaaggaggctgggacaa
OVRM1_0193_A03.b :
OVRT1_0113_A10.b : NGAGTATCCCTG*CCTA*CTTGCAA*AAACTCTCTACAATGCCATGAAGG*GAGCTGGGA
OVRM1_0126_C10.b :
KDN01_0033_G12.b : GGAGTATCCCTG*CCNACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
LVRM1_0176_A04.b :
OVRM1_0079_B03.b :
SPL01_0026_F05.b :
CBLT1_0020_A02.b : agttccctgccaacctgcaaaacctctctctatgcatgaagggagctgggacaatgacct
OVR01_0095_C07.b : ggaatatccctggccaccttgccaaaaacttcctactatgccattgaaagggaactggga
OVRT1_0040_B12.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*NAGCTGGGA
DCI01_0040_C09.b : tttccaaacccccccctcatccacgcagagccccggccaccacacactcccccccctccc
BMWN1_0023_E06.b : GGAGTATCCCTG*CTTTACTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGAA
AMP01_0082_H09.b : NGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
DCI01_0030_E04.b : acctgcctactttgcaaacctctcactagccatgaaaggaactgggacaaatgattaacc
DCI01_0038_B03.b : ctacttgcagaacttccactagcaagaaggagctggaccaagaacaaccctctcaatcct
AMP01_0092_E11.b : gtatcccntgctacnttgcagaactctctactatgcatgaagggagctgggacgatgatc
DCI01_0042_H03.b : agtaccctgcctacttgcaaaaacttctactatgcattgaaggaactgggacagagatcc
AMP01_0096_A12.b : Gaattatcctgcctaccttggcgaaacctctctactattgcatgaagggacctgggaaca
AMP01_0079_C06.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTANTGCATGAAGG*AAGCTGGGA
AMP01_0041_C02.b : GTATCCTGCCTA*CCTGCAG*******AACTCTCTACtatgcatgaaggagctggacaat
DCI01_0099_H08.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
DCI01_0094_E12.b : GGAGTATCCCTG*CCTACCNTGCAG*AAACTCTCTACTATGCAATGAAAG*GAGCTGGGA
AMP01_0094_G04.b : GGAGTATCCCTG*CCTACCTTGCAA*AAACTCTCTACTATGCAATGAAGGGGAGCTGGGA
AMP01_0095_H05.b : CGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAAGGGAGCTGGGA
DCI01_0084_G07.b : G*AGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTANTGCATGAAGG*GAGCTGGGA
OVRM1_0171_H11.b :
AMP01_0040_G04.b : aatattccctccccccccttggaaaaaattttctatattattaagaaaaggggaccgggg
LNG01_0023_G12.b : agtatccccggccttccttgcaaaaacttcttaatttagccaattgaaggggaggcgggg
ITT01_0085_B11.b : GGAATATCCCTG*CCTACCTgcaaaaactctctaactatgcaatgaagggaacttggaca
OVRT1_0144_H03.b : GGAattatccctgcccaccttggcaaaactccctactagccaatgaagggacctggaaaa
SPL01_0058_E05.b : GGAGTATCCCGG*CCTACCTTGCAA*AAACTCTCTACTATGCAtgtaagggaccttggaa
SPL01_0056_C04.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAAGGgagctgggg
DCI01_0085_H04.b : CGAGTATCCCTG*CCTACCNTGCAG*AAACTCTCTACTANTGCATGAAAG*GAGCTGGGA
DCI01_0087_H02.b : tgcctacttgcagaactctctactatgcatgaggagctggnacgatgatctaccctctca
DCI01_0109_B06.b : gtatcctgcctacctgcagaactctctctatgcatgaaggnactgggacgatgatcatac
DCI01_0002_B11.b : GGAGTATCCCTG*C*TACTTTGCAA*AAACTCTCCTATTAGCAATGAAGG*GAGCTGGGA
SPL01_0014_E09.b :
DCI01_0025_H04.b : ataaaaggaccgggaaaaaaaaaaccccccccaaatcgggtttcgcgaggaaattttttt
DCI01_0026_C12.b : accttggaaaaatctcttctattcaataaaggaaccggggaacaaaaaaataaacccctc
AMP01_0004_G06.b : catactcttaaaaacctacaaactgcactgtgagaagcggggccactcattctctcccat
AMP01_0037_A08.b : ctaactgcaaaactctcactatgcatggagggactggaacaagatcctccctctcgagtc
DCI01_0063_A03.b : atcctgcctacctgcagaactctctatatgcatgaaggagctggacgatgatatanctca
HTMT1_0083_D05.b : CGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGTA
AMP01_0102_A06.b : ggagtatccctgccttacttgcagaaacccctctacttatgcatggagggggctgggaac
OVRT1_0075_F04.b : GGAGTATCCCTG*CCTAACTTGCAG*AAACTCTCTACTATGCAATTGAGGGGAGCTGGGA
AMP01_0036_A06.b : CGAGTATCCCTG*CCCTACCTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
AMP01_0061_G12.b : NGAGTATCCCTG*CCTACCNTGCAG*AAACTCTCTACTATGCCAATGAAG*GAGCTGGGA
DCI01_0011_E08.b : NGAAGTATCCCT*GCTACTTTGCAG*AAACTCTCTACTATTGCATGAAAG*GAGCTGGGA
KDN01_0003_A10.b : cttcaaaaaaaccccccttttagtaataaaaggggggggggaaaaaaaataaaccccccc
PST01_0085_F04.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
PST01_0005_D11.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAANG*GAGCTGGGA
ADR01_0084_E10.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
OVRM1_0194_A03.b :
OVRM1_0004_H06.b :
OVRM1_0196_H04.b :
OVRM1_0056_A12.b :
OVRM1_0053_H08.b :
OVRM1_0085_E02.b :
OVRM1_0062_C08.b :
OVRM1_0186_H09.b :
OVRM1_0129_E08.b :
SPL01_0074_C01.b : cggaattatccccgccctaactttgcaaaaaccctccttactatgccattgaaagggaac
SPL01_0102_C02.b : agaaccctggcctaccttgcaaaaaactttttttaatagcattgaagggagcggggaaaa
ADR01_0003_A08.b : CGAATATCCCcggcctacttgcaaaaacctctactattgcatgaagggaactgggaaaaa
SPL01_0034_B08.b : GGAATATCCCTG*CCTACCTTGCAaaactctcactaatgcatgaagggaacttggaaaaa
SPL01_0089_A03.b : GGAGTATCCCTGGCCTACCTTGCAG*AAACTCTCTACTATGCAATGAAAGGgaactggga
SPL01_0003_G03.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAAGGgagcttgga
UTR01_0088_C08.b : GGAGTATCCCTGGCTACCCTGGCAG*AAACTCTCTACTATGCAATGAAAGGgagctgggg
SMG01_0038_D02.b : GGAGTATCCCTG*GCTACCTTGCA**AAACTCTCTACTATGCAATGAAGG*GACCTGGGA
ITT01_0002_G08.b : NGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGNCATGAAGG*GAGCTGGGA
ITT01_0097_G08.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
OVRT1_0054_C01.b : GGAGTATCCCTG*CCTACNTTGCAG*AAACTCTCTACTATGNCATGAAGG*GAGCTGGGA
PBL01_0065_D04.b : GGAGTATCCCTG*CCCTACTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
OVRT1_0094_F02.b : NGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGNA
OVR01_0100_A01.b : NGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
ITT01_0081_C02.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
OVR01_0091_C02.b : NGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
AMP01_0040_B02.b : gtttgggaaatcctattgggaaattccctccccctccctttgaaaaaacctcctctaatt
AMP01_0004_H04.b : cgcccacccttcaaaaattttctattttcaatgtaaggactggccaaaataacacccccc
DCI01_0016_B01.b : tcctgcctacttgcaaaaactcctaccatgcaatgaagggacttggacaaataatccacc
DCI01_0091_E02.b : CGAGTCTCCCTG*C*TACCNTGCAG*AAACTCTCTACTATacatgaaggnagctgggacg
OVRT1_0069_F05.b : GGAGTATCCCTG*CCCTACTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGNA
DCI01_0029_G12.b : gggaaaaaaaattaacccccctcaaacgggtttccaaagggaatgaactttttactttgg
DCI01_0026_C05.b : ttgcaaatttccacaagcatgaaggaactggaaaaagatctaccctcacaaatcgggttc
DCI01_0104_B09.b : acctgcagaactctcactagcatgaaggagctggacaaagatctaccctctcaaatcatg
DCI01_0105_B09.b : ctacctgcagaactctctcatgcatgaaggnagctggacgatgatcatacctctcngatc
AMP01_0081_E01.b : agtaccctgcctacctgcagaactctctactatgcatgaaggnagctgggacgatgatca
AMP01_0065_H04.b : CGAGTATTNCTG*CCTACatgcaaaactctctactatgcagtgaagggactggaacgatg
AMP01_0092_G07.b : G*AGTATCCCTG*CCTACCTTGCAG*A*ACTCTCTACTATGCAtgaaggnagctggnacg
AMP01_0084_H11.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTTATGCATGAAGG*GAGCTGGGA
AMP01_0081_C08.b : NGAGTATCCCTG*CCTACCTTGCAG*A*ACTCTCTACTATGCAATGAAGG*NAGCTGGGA
SPL01_0060_F01.b : aaacaggcctcctttgttggatttttgaaaatcttatttctggaagtttatccccatggc
OVRT1_0017_H05.b : aataatccttgcatatcttggaaaaaacctgccacctatcaattaaatgggaacgggaac
OVRM1_0152_H06.b :
OVRM1_0192_A03.b :
OVRM1_0018_F04.b :
OVRM1_0215_H02.b :
OVRM1_0203_E02.b :
SPL01_0061_A03.b : tcggaagtttcccctgcctaacctttgccaaaaactcttctactatttgcaatgaaaagg
OVRM1_0186_E11.b :
OVRM1_0126_A08.b :
OVR01_0079_A04.b : cgaagtattcccggcccacccttggaaaaaactcccctacctatgccaatgaaggggggc
ADR01_0043_F12.b : GGAGTATCCCTG*CCTAacctggcaaaaactccctactatgccatgaaagggagctggga
OVRT1_0097_A07.b : CGAGTATCCCTG*CCTACCTTGGAA*AAACTCTCctactatgcatgaagggaacctggga
PCT01_0020_F06.b : CGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
OVRT1_0134_F02.b : NGAATATCCCTG*CCTACC*TGCAG*AAACTCTCTACTATGCATGAAAGG**AGCTGGGA
SPL01_0002_H11.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
OVRT1_0152_H12.b : G*AGTATCCCTG*CCTAACCTGCAA*AAACTCTCTACTATGCAATGAAAG*GAGCTGGGA
OVRT1_0102_G05.b : CGAGTATCCCTG*CCTACCCTGCAA*AAACTCTCTACTATGCAATGAAAG*GAGCTGGGA
KDN01_0072_A05.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGNCATGAAGG*GAGCTGGGA
OVRT1_0116_A03.b : CGAGTATCCCTG*CCTACCTTGCAA*AAACTCTCTACTATGCAATGAAAG*GAGCTGGAA
ADR01_0066_E12.b : GGAGTATCCCTG*CCTACCCTGCAG*AAACTCTCTACTATGCCATGAAAG*GAGCTGGGA
ITT01_0093_F08.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*NAGCTGGGA
ADR01_0088_D04.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
KDN01_0067_D11.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
CLNT1_0112_G05.b : atcctgcctacctgcaaaaatctctactatgcatgaaagaagctggacaatgatcatcct
PCT01_0013_E03.b : CGAGTATCCCTG*CCTACCTTGCAA*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
AMP01_0035_H04.b : GGAGTATCCCTG*CCTACCNTGCAA*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
ADR01_0031_H08.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*NAGCTGGGA
AMP01_0055_F08.b : CGAGTATCCCTG*CCTACCTTGCAGAAAACTCTCTACTATGCAtgaaggnagctggnacg
SKNB1_0010_D02.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATNGCATGAAGG*GAGCTGGGA
BFLT1_0088_D11.b : GGAGTATCCCTGCCTAACTTTGCAG*AAACTCTCTACTATGCAATGAAGGGAAGCTGGGG
ADR01_0054_C11.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCCATGAAAG*GAGCTGGGA
AMP01_0034_G08.b : NGAGTAT*CCTG*CCTACCTGC**A*AAACTCTCTACtatgcatgaaggagctgggacga
DCI01_0115_F06.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCCATGAAGG*GAGCTGGaa
DCI01_0111_B10.b : GGAGTATCCCTG*CCTACTTTGCA**AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
PCT01_0001_B08.b : GGAGTATCCCTG*CCTACttgcagaactctctactatgcatgagngggacctggaacaat
PST01_0073_H04.b : GGAGTATCCCTGGCCTACCTTGCAA*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
PST01_0016_F01.b : GGAGTATCCCCTGCCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
PST01_0031_B05.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCCCTACTATGCATTGAAAG*GAGCTGGGA
OVRT1_0053_H03.b : GGAGTATCCCTG*CCCTACCTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
TCH01_0079_G12.b : GGAGTATCCCTG*ACTACCTTGCAA*AAACTCTCTACTATGCAATGAAGGGGAGCTGGGA
AMP01_0075_G02.b : GGAGTATCCCTG*CCTACCTGC**A*GAACTCTCTACTATGCAtggaaggagctgggaca
SKNB1_0064_A01.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
OVRM1_0013_C11.b :
OVRM1_0183_C11.b :
PBL01_0074_E03.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGNCATGAAGG*GAGCTGGGA
LNG01_0062_E09.b : GGAATATCCCTG*CCTAACTTGGCA*AAACTCTCTACTATGCAAGGAAGG*GAACTGGGN
OVRT1_0050_D03.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGNCATGAAGG*GAGCTGGNA
PTG01_0063_A11.b : cccctatattataaggggaggggggaaaaaaaaaaccccccccaaaaaagggggttttca
ADR01_0015_C03.b : ctgccaaccttggaaaaaccttccactttgtaaagagagaacccgggacaaatatatttc
BKFL1_0020_G05.b : GGAGTATCCCTG*CCTACttgcaaaactcctactatgcatgaagggactgggaagatgat
DCI01_0100_D11.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGNCATGAAGGNAGCTTGGGA
OVRM1_0215_D06.b :
AMP01_0051_C04.b : G*AGTATCCCTG*CCTACCTgcaaanctctctactatgcaatgaggaagctggnacgatg
KDN01_0042_H03.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAAG*GAGCTGGGA
LNG01_0031_H02.b : GGAGTATCCCTG*CCTACCTTGCAA*AAACTCTCTACTATGCAATGAAAGGgagctggga
AMP01_0072_H01.b : tatccctgctacctgcagaactctcacatgcatggagggagctggacgatgatctaccct
OVRM1_0033_A09.b :
OVRM1_0002_H03.b :
OVRM1_0094_D09.b :
OVRM1_0206_F10.b :
SMG01_0103_H07.b : G*AGTATCCCTG*CCTACC*TGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
LNG01_0036_H08.b : GGAGTATCCCTG*CCTACCCTGCAA*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
LNG01_0070_G03.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
OVR01_0020_G04.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
OVRM1_0210_F02.b :
SKNB1_0008_C07.b : CGAGTATCCCTG*GCTACCTTGCAG*AAACTCTCTACTATGCAATGAAAG*GAGCTGGGA
SKNB1_0037_B01.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGNCATGAAGG*GAGCTGGGA
DCI01_0016_H09.b : gtatcctgcctacctggcaacctccctactatgcatgaaggagcttggacgatgatctac
OVRT1_0020_B04.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAAGGAAGCTGGGA
DCI01_0037_C07.b : GGAGTATCCCTG*CCTACCTTGC*G*AAACTCTCTACTATGCAATGAAAG*AAGCTGGGA
DCI01_0105_A03.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*NAGCTGGGA
DCI01_0078_G10.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGNCATGAAGG*GAGCTGGGA
BKFL1_0035_A11.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
SKNB1_0015_C04.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
ADR01_0021_D09.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
TCH01_0091_A11.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
LNG01_0005_H01.b : GGAGTATCCCTG*CCTACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
CBLT1_0038_B08.b : xxxxxxxxxxxxxxxxACCTTGCAG*AAACTCTCTACTATGCAATGAAGG*GAGCTGGGA
SPLT1_0100_H02.b :
ILNT1_0067_G12.b :
20110601C-007088 : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGGAGTGAGATTGATCTGTTTAAC
---------+---------+---------+---------+---------+---------+ 1042
HTMT1_0032_G04.b : atgatctaccctcctcaaatcctgggttccagaaggaaattgttcgtttaacattggaag
DCI01_0030_F09.b : tttacttttgaggatttggaaaattttcccctctttttcccgttaaggggaccctgggaa
SPLT1_0035_A03.b : accccctccaaaaatcagggttcccagaaagaaaatattttttttaaattagaagggttt
CBLT1_0022_A01.b : aatgatcctaccccatcaaattcaggtttccaggaatgaaatgatctgttaactttggaa
OVRM1_0030_F06.b :
SPL01_0075_B02.b : acaaatgattctatccctcctccaaagtcttggtttcccagggaatggaaattggaattg
ITT01_0095_D03.b : CAGATGATCATA*CCTCATCAGAGTCATGG*TTTC*AGGAGTGAGATTGATCTGTTTAca
CBLT1_0072_B06.b : CAGATGATCATACCCTCATCAGAGTCCTGG*TTTCCAGA*GTGAGATTGATCTGTTTAAC
ADR01_0043_F01.b : catacccctttcaaatcttggtttcccgaaatgaaattgtttgtttaactttggaaggga
SMG01_0075_G01.b : taccctctcaaatcatgggttccaggaggagatgatccgttaacattaggaggagtttag
SPL01_0051_G12.b : ggaaaaatgatttatacccttcttaat
OVR01_0009_B12.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCcaggaatggaaattgatctgttta
DCI01_0036_G01.b : aattttttgttaatttgggaagggtttgaaaaaattttccccccctctttttccgaaaaa
OVRM1_0112_H04.b :
DCI01_0020_A05.b : gagtgaatgatcgttaacttagaggatttagagaatttgccccctctatcctgatagggg
AMP01_0026_F11.b : ccacccctcctcaaaatctgggttcccggaaggagaatgttcggttttaatttggaaggg
AMP01_0046_C10.b : atcctccctctccaaatcctggtttcccgaagggaatgattcgttttacattgggaggag
MLN01_0077_F11.b : CGGATGATCATACCCTCATCCAAATCATGG*TTTCCAGGATTGAAATTGATCTGTTTAAC
ADR01_0062_D01.b :
OVRM1_0199_B09.b :
OVR01_0062_D01.b : ccaatgatcataccctcatccgagtctggttttcaggaggtgaaatgatctgttttaact
ITT01_0021_B12.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGGAATGAGATTGATCTGTTTNAA
UTR01_0095_F06.b : CAGATGATCCTACCCTCATCAAAATCATGG*TTTCCAGGAGTGAAAATGATCTGTTTAAC
HTMT1_0001_E03.b : CAGATGATCATACCCTCATCAAAGTCATGG*TTTCCAGGAGTGAAATTGATCTGTTTAAC
AMP01_0095_E05.b : atgaatatacccctcttccaaactctggtttttccgggaatgagaaattaattggtttaa
OVRM1_0193_A03.b :
OVRT1_0113_A10.b : CAAAAGATCATAaccctctccaaattccgggtttccaggagtggaaattgatctggttaa
OVRM1_0126_C10.b :
KDN01_0033_G12.b : CAGATGATCATACCCTCATCAGAGTCATGGTTTTCCAGGAGTGAGATTGATCTGGTTAAA
LVRM1_0176_A04.b :
OVRM1_0079_B03.b :
SPL01_0026_F05.b :
CBLT1_0020_A02.b : accctcctcaaatcctgtttccaggaatgaattgtctgtttactttggaaagatttagaa
OVR01_0095_C07.b : acaaattaatttaaccctcctcaaagtcatgggttttccgggagagacaaatggaattgt
OVRT1_0040_B12.b : CAGATGATCATACCCTCATCAAAGTCATGG*TTTCAAGGAGTGAAATTGATCTGTTTAAC
DCI01_0040_C09.b : aacctcccccccccccactgaacaatccctctacactccccacaactctcaaaattttct
BMWN1_0023_E06.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGGAATG*GATTGATCTGTTAAAC
AMP01_0082_H09.b : CAGATGATCAT*CCCTCATCAGAGTCATGG*TTTCAGGAATTGAAAT*GATCTGTTTAAC
DCI01_0030_E04.b : ttctccaattctggtttccagaatgaaatgatctgttaacttaggaggaatttagagatt
DCI01_0038_B03.b : ggttcccgagganttgatcgttaactttagaagaattagaaaatttgcccccccttatcc
AMP01_0092_E11.b : atacctcatcaaagtcatgtttccagaatgaaatgntctggttaactttggaaggantta
DCI01_0042_H03.b : taccccctccaaacctggttcccggattgaaattgttcgtttaactttggaaggatttag
AMP01_0096_A12.b : atgatcttaccctcatccaagtcctggtttccggaagggaaattgatccgtttacactta
AMP01_0079_C06.b : CAAATGATCATACCCTCATCAGAGTCtggtttcagggagtgaaatgatctgtttacatna
AMP01_0041_C02.b : gatcatacctctcgagtctggttccagagtgagatgatcgttnnacatagaggagtttag
DCI01_0099_H08.b : CAGATGATCATACCCTCATCCGAGTCATGG*TTTtcccggaatgaaatgatccggttaca
DCI01_0094_E12.b : CAGATGATCATACCTTCATCAGAATCATGG*TTTCCAGGAGTGAAATTGATCTGTTTAcc
AMP01_0094_G04.b : CGGATGATCATACCCTCcttcaaagtcatggttttccaggagtgagattgatctgtttaa
AMP01_0095_H05.b : AAGATGATCATTCCCTCCTCAAAATCATGT*TTTCCAGGATTGAAATTGATTTGTTTAAA
DCI01_0084_G07.b : acgagatcataccctcatcaaagtctggttccccgnattgagattgatcggtttaccttg
OVRM1_0171_H11.b :
AMP01_0040_G04.b : gaaaaaatatctccccccccccccaaaaccttgggtttcccggggggatatgtttctttt
LNG01_0023_G12.b : agaaaagaattaatcccctccattaaaaatccatgggtttccaagaaaataaaaattaga
ITT01_0085_B11.b : aaatgattctaccccccctcaaaatcatggtttcccagaaatgaaattgatcggtttaac
OVRT1_0144_H03.b : aaaattctaccccctcaaaatctggtttcccggatggaaatgtcctttttaacttaggaa
SPL01_0058_E05.b : caaataatcatacccccctccaaaatcatggtttcccggaatggagattggatcgtgttt
SPL01_0056_C04.b : acagatgatcctacccctcctcaaagccatgggtttcccggaatgagaatgatctgttta
DCI01_0085_H04.b : CAGATGATCATACCCTCATCAagtcatgggttccagaatgaaatgatcggttaacattag
DCI01_0087_H02.b : gatcatggttccagnatgaaatgatcgttnacnttagaaagatttagagaaatttgccct
DCI01_0109_B06.b : ctcatcaatcatgttccagnatgagatgatcgtttacttagaaggattaggagatttgca
DCI01_0002_B11.b : ACAATGATCCTACCCTCATCAGAGTCCTGG*TTTCCAGaaatgaaatggttctgttcacc
SPL01_0014_E09.b :
DCI01_0025_H04.b : ttaatttgaagggtttggaaaattttccccctcttttcctgaaaaggggccacttgggaa
DCI01_0026_C12.b : cacaaacagggttttcaggaaggaaaatgcttgtttctcattgggaagggtttttgaaga
AMP01_0004_G06.b : tctctacgttttcatatttttcattttactcctcatcttgctcaacactcaacgttcttt
AMP01_0037_A08.b : tgttttcagaatgagatgatcgttaacataggaggagttagaagatttgcccccccttat
DCI01_0063_A03.b : tcaagtctggttccangatgaaatgatctgttacatagaaggagttagaagattttgcac
HTMT1_0083_D05.b : CAAATGATCATACCCTCtccaaatcatggtttcaggaaggagattgatctggttaactta
AMP01_0102_A06.b : agatgatcataccctctttcgagtcatggtttccagaagtgaaattgatctggttaaatt
OVRT1_0075_F04.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCAAGAAATGAGATGGATCTGTTTAAC
AMP01_0036_A06.b : CAAATGATCATACCtcatcagagtctggtttcccagaatgaaattgattgtttaacattg
AMP01_0061_G12.b : CAAATGATCATACCCTCATCAAAGTCATGG*TTTCCAagaatggaaatggatctgtttac
DCI01_0011_E08.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGNAATGAGATTGATCTGNTTA*C
KDN01_0003_A10.b : cacaaaaaagggtttttcccaaaaaaaaaaattttctttttttttttctgagaggggggg
PST01_0085_F04.b : CAGATGATCATACCCTCATCAAAGTCATGG*TTTCCAGGAATGAGATTGATCTGTTTAAC
PST01_0005_D11.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGNAGTGAGATTGATCTGTTNNAC
ADR01_0084_E10.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGNAGTGAGATTGATCTNGTTTAC
OVRM1_0194_A03.b :
OVRM1_0004_H06.b :
OVRM1_0196_H04.b :
OVRM1_0056_A12.b :
OVRM1_0053_H08.b :
OVRM1_0085_E02.b :
OVRM1_0062_C08.b :
OVRM1_0186_H09.b :
OVRM1_0129_E08.b :
SPL01_0074_C01.b : ctgggaaacaaataaaccatacccctccctcaaaaattctgggtttttccagagaattga
SPL01_0102_C02.b : atgattcaaacctcatcaaaaacaggggttccaggagtggaaatggatctgtttaacatt
ADR01_0003_A08.b : tgatctacccccatcaaagtctggggttccagaatggaaatgttctgttaacatttggaa
SPL01_0034_B08.b : tgatataccctcctcaaaatcaggttttcaggaattagattgttggttaacttaagaagg
SPL01_0089_A03.b : acagatgatcttaccctcatcaaattcatggtttccagggattaaaattgatctgtttta
SPL01_0003_G03.b : acagatgatcattaccctcatcaaaatccatggttttcccagaatggaaattgattttgt
UTR01_0088_C08.b : accgatgatcataccctcctccaagccatgggtttcccagattgaaattgatctggttta
SMG01_0038_D02.b : AAAATGAACATACCCTtcccaattcagggttcccaggagtgaaatggtctggttaactta
ITT01_0002_G08.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCagnagtgagatttgatctgttacat
ITT01_0097_G08.b : CAGATGATCATACCCTCCTCAAAGTCATGG*TTTC*AGGAGTGAGATTGATCTGTTTAcc
OVRT1_0054_C01.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGGAtgaaattgatctgttaaaca
PBL01_0065_D04.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTCCNAGGAGTGAGATTGATCGG*TTAAC
OVRT1_0094_F02.b : CNGATGATCATACCCTCATCAGAATCATGG*TTTCAAGGAATGAGATTGATCTGTTTAAC
OVR01_0100_A01.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGGATTGAGATTGATCTGTTTAAC
ITT01_0081_C02.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGGAGTGAGATTGATCTGTTTA*C
OVR01_0091_C02.b : CAGATGATCATACCCTCATCAGAGTCATGT*TTCCAGGGAGTGAGATTGATCTGTTTAAC
AMP01_0040_B02.b : acaaagagagggancgctgggaaaaaataaatcccccccccccccaaaaatctgggtttc
AMP01_0004_H04.b : ccacagttatattttcagntttgcattcttcgctctaacttaaaaggggattattaaact
DCI01_0016_B01.b : ctccatcaaatcagggtttccagattgaaattgatctttttactttaggaggagttagga
DCI01_0091_E02.b : atgatcataccctcatcaagtcatggtttccagagtgagatgatctgtttaacttaggag
OVRT1_0069_F05.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTTCAGGAGTGAAATTGATCTGTTTAAC
DCI01_0029_G12.b : agggattttgaaaaaatttcccctctctttttccgaaaaagggggaacctctggggaaat
DCI01_0026_C05.b : aggaggaattgatctgttactttggaggagttaagagaatttgccctctcttatctgatt
DCI01_0104_B09.b : tttcaggntgagatgattgttgaccttagaggagttggagaatttgcccctccttttcct
DCI01_0105_B09.b : atggttccaggagtgaatgatctgtttacattagaggagttaggagattttgcaccttcc
AMP01_0081_E01.b : tacctcatcagagtctggtttccaggatgagatgatctgtttacctttagaaggagttta
AMP01_0065_H04.b : atctaccctatcagagtctggttccagggtgagattgatctgttacatagggaggattta
AMP01_0092_G07.b : atgatcatacctcatcaaagtcatggttccagnantgagatgatctgttnacattangag
AMP01_0084_H11.b : CAGATGATCATACCCTCATCAAAGTCATGG*TTccagaagtgagattgattctgttacca
AMP01_0081_C08.b : CAGATGATCATA*CCTCATCAGAGTCATGG*TTTCCcagatgagatgatctgttnacatt
SPL01_0060_F01.b : cattacttttggaataaaaaacttctcttattttttggcaatttataatgggtaaatccg
OVRT1_0017_H05.b : gaatgatacttcccctcttaataaatcatgattcacatgattaaaaaaaaaatctgttaa
OVRM1_0152_H06.b :
OVRM1_0192_A03.b :
OVRM1_0018_F04.b :
OVRM1_0215_H02.b :
OVRM1_0203_E02.b :
SPL01_0061_A03.b : gagcttgggaaacaaatgattcctacccccccctccacaaaatcctggggttttcccggg
OVRM1_0186_E11.b :
OVRM1_0126_A08.b :
OVR01_0079_A04.b : ttgggaaacaaaaaatcaaaccccccccccaaaaatctggggcttccccggaaggtgaaa
ADR01_0043_F12.b : aaaaatgatcataccctcctccaaaatcggggttcccaggggggaaattgttctggttta
OVRT1_0097_A07.b : caaatgatcctaccctcctcaaagtcaggtttccagaagggaaattgtctgttaaccttt
PCT01_0020_F06.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCaggagtgagaatgatttctgttact
OVRT1_0134_F02.b : CNGATGATCTTACCtcctcagagtcatgtttccanggatgaaatgatccgttaacatttg
SPL01_0002_H11.b : CAGATGATCATACC
OVRT1_0152_H12.b : CAAAAGATCATACCCTCCTCAAAGTCAgtggtttccggaatggaatttgttctgtttacc
OVRT1_0102_G05.b : CGGATGATCCTACCCTCATCAAAGTCCTGG*TTTCCAGaatgagatggatctgtttaaca
KDN01_0072_A05.b : CAGATGATCATACCCTCATCAGAGTCATGT*TTTCAGGGAGTAAGATTGATCTNGGTTAC
OVRT1_0116_A03.b : CAAATGATCCTACCCTCATCAAAGTCATGG*TTTCCAGAAGTGAAATTGATCTGTTTAct
ADR01_0066_E12.b : CAGATGATCATACCCTCATCAGAGTCATN**TTTCCAGNAATGAGATTGATCTGTTTAAC
ITT01_0093_F08.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGNAGTGAGATTGATCTGNTTTAC
ADR01_0088_D04.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGNAGTGAGATTGATCTGTTTNAC
KDN01_0067_D11.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTTCAGGAGTGAGATTGATCTGTTTAAC
CLNT1_0112_G05.b : cttcaaatcctggtttcagaatgaaatgatcggtaaccttgaagggagttaggagaattt
PCT01_0013_E03.b : ACAATGATCATACCCTCATtcaagtcctgttttcaggagtgaaatggattgtttacatta
AMP01_0035_H04.b : CAAATGATCATACCCTCATCAGAGTCATGG*TTTCCAGGAGTGAGATTGATCTGTTTAca
ADR01_0031_H08.b : CAGATGATCATACCCTCATCAAAGTCATGG*TTTCCAGGAGTGAGGATGATCTGTTTNAC
AMP01_0055_F08.b : atganncctacccctcatcaaagtcatggtttccaggantggaaatgattctgtttaaca
SKNB1_0010_D02.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGNAGTGAGATTGATCTGTTTTAC
BFLT1_0088_D11.b : CAGATGATCATACCCTCATCAGAGTCATGGGTTTCAAGAATTGAGATTGATCTGTTTTAC
ADR01_0054_C11.b : CAGATGATCATACCCTCATCAAAGTCATGG*TTTCC*GGAATGAGATTGATCTG*TTAAC
AMP01_0034_G08.b : gatctaccctctcaagtctggttccaggatgaattgtctgttacatggggaggatttaga
DCI01_0115_F06.b : agatgatcatacctcatcaaatcatggttccaggagtgaaatgatctgttaaattaggaa
DCI01_0111_B10.b : CAGATGATCCTACCCTCATCAAAGTCATGG*GTTCCAGGAtgtaattgatctgtttacat
PCT01_0001_B08.b : gatctaccctcatcaaagtcctggtttcaggatggaaatgatcgggtaactttggaggga
PST01_0073_H04.b : acaaatgatcttacccccttcaaattcttggtttcccggaatgaaattggtctgttttaa
PST01_0016_F01.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGGAGTGAGATTGATCTGNTTTAC
PST01_0031_B05.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTTCAGGAATGAGATTGATCGGTTTAcc
OVRT1_0053_H03.b : CAGATGATCATACCCTCATCAAAGTCATGG*TTTCAAGGAGTGAGAATGATTTGTTTAAa
TCH01_0079_G12.b : CAGATGATCATAGCCTCATCAGAATCATAG*TTTCCAGGAGTGACATTGATCTGCTTAAC
AMP01_0075_G02.b : atgatctaccctctcagagtcatggttcaggantgagatgatctgtttacattaggagga
SKNB1_0064_A01.b : CAGATGATCATACCCTCCTCAGAGTCATGG*TTTCCAGGAGTGAGATTGATCTGTTTAAC
OVRM1_0013_C11.b :
OVRM1_0183_C11.b :
PBL01_0074_E03.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGGAGTGAGATTGATCTGTTNANC
LNG01_0062_E09.b : ACAAAGATCATACCCTCATCCAAATCCTGG*TTTTCCGGAATGAAATTGATCTGTTTAAC
OVRT1_0050_D03.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCANGAGTGAGATTGATCTGTTTA*C
PTG01_0063_A11.b : aaagaaaaaattttttttttctttaaggaggtgttgaaaaattttccccccccccttttt
ADR01_0015_C03.b : ccctcccccatacttggtttcccggaagcagattgatctgttaaatcttgggagggatta
BKFL1_0020_G05.b : ctaccctctcaagtcatggtttccagattgaaatgatcgtttacattagaagggattagg
DCI01_0100_D11.b : CAGATGATCATACCCTCATCAAAATCATGG*TTTCCAGGAGTGAGAATGATCTNGTTTAC
OVRM1_0215_D06.b :
AMP01_0051_C04.b : atcatacctcatcagagtctggtttccagagtgagatgatctgtttacattaggaggagt
KDN01_0042_H03.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGGAGTGAGATTGATCTGTTTAAC
LNG01_0031_H02.b : acagatgatcatacccctcctcagaatcctggttttccagaattgaaaattgatctgttt
AMP01_0072_H01.b : ctccagtctggtttccggatgaaatgatctgttaccttaggagggtttagaagaatttcc
OVRM1_0033_A09.b :
OVRM1_0002_H03.b :
OVRM1_0094_D09.b :
OVRM1_0206_F10.b :
SMG01_0103_H07.b : CAGATGATCATACCCTCATCAGAGTCATGT*TTTCCAGGAATGAAATTGATCTGTTTTAC
LNG01_0036_H08.b : CAGATGATCCTACCCTCATCAGAGTCATGGTTTTCCAGGAATGAAATTGATCTGTTTtaa
LNG01_0070_G03.b : CAGATGATCATAACCTCATCAGAGTCATGG*TTTCAAGGAGTGAGATTGATCTGTTTAAC
OVR01_0020_G04.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGGAGTGAGATTGATCTNGTTAAC
OVRM1_0210_F02.b :
SKNB1_0008_C07.b : CCGATGATCCTACCCCTCCTCGAGTCTTGG*TTTTCAAGAATGAGATTGATCTGGTTAAC
SKNB1_0037_B01.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGGAGTGAGATTGATCTGTTNA*C
DCI01_0016_H09.b : cctctcaaaatcatgtttcaggagtgaatggatcgttaacctaggaggaattaggagatt
OVRT1_0020_B04.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTC*AGGAGTGAGATTGATCTGTTTA*C
DCI01_0037_C07.b : CNGATGATCATACCtcatcaaattcatggtttccagangtgaaatgatctgtttacctta
DCI01_0105_A03.b : CAGATGATCATACCCTCGTCAGAGTCATGG*TTTCCCAGAGTGAGATTGATCTGTTTNAC
DCI01_0078_G10.b : CAGATGATCATACCCTCGTCAGAGTCATGG*TTTCCAGGAGTGAGATTGATCTGTTTTAC
BKFL1_0035_A11.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGNAGTGAGATTGATCTGNTTTAC
SKNB1_0015_C04.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGGAGTGAGATTGATCTGTTTAAC
ADR01_0021_D09.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGGAGTGAGATTGATCTGTTTAAC
TCH01_0091_A11.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGGAGTGAGATTGATCTGTTTAAC
LNG01_0005_H01.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGGAGTGAGATTGATCTGTTTAAC
CBLT1_0038_B08.b : CAGATGATCATACCCTCATCAGAGTCATGG*TTTCCAGGAGTGAGATTGATCTGTTTAAC
SPLT1_0100_H02.b :
ILNT1_0067_G12.b :
20110601C-007088 : ATTA*GGAAGGAGTTTAGGAAGAATTTTGCCACCTC*TCTTTATTCCATGATTAAGGGTG
---------+---------+---------+---------+---------+---------+ 1100
HTMT1_0032_G04.b : gagtttaggaagattttgcccccctcttattcctgaataagggggaccatcgggggaatt
DCI01_0030_F09.b : taaaagacctccgtgtcttgaacaaaaattagggccgggaaaaccaccgtgccgggcccg
SPLT1_0035_A03.b : taaaaaaattttgccccctccctttttcccagaataaggggaaaaatctgggagaaaaaa
CBLT1_0022_A01.b : ggagttgggaaaaatttgccccctccctttttccggaaataggggaaccctcggggaata
OVRM1_0030_F06.b :
SPL01_0075_B02.b : gtt
ITT01_0095_D03.b : ttaggaaggagtttagaagaattttgcacctctcttatcgatgattagggtgaccatcgg
CBLT1_0072_B06.b : ATTA*Gaaggattttagaagattttgccactctctttattcatgattaaggtgacactct
ADR01_0043_F01.b : ttttgaaaaatttgcccccccttttttttcaaaaaaaggggggacctcctggggatttat
SMG01_0075_G01.b : aagaatttgcccccccttattaagaataaggtgaacttcgggaataaaagggccccgccg
SPL01_0051_G12.b :
OVR01_0009_B12.b : aacattaagaagggaattttagggaaaaatttttg
DCI01_0036_G01.b : gggggacctcggggaaataaaaagccctctttgtctctggaggaaaataaaaatagagtt
OVRM1_0112_H04.b :
DCI01_0020_A05.b : accttcggactaaaagcccctctccttgaggaaaaaatatggctggaaaccccttgcccg
AMP01_0026_F11.b : tttttgggaaattttgccccccctcccttttccagaataaggggaacccctcggggaata
AMP01_0046_C10.b : ttaggaagatttgcccccccccttatccagaataaggggacccttcgggaaaataaaagg
MLN01_0077_F11.b : CTTA*Gaaggaatttaggagaattttgccccctctctttatccaagaataaaggtgaacc
ADR01_0062_D01.b :
OVRM1_0199_B09.b :
OVR01_0062_D01.b : ttaggaagggatttatgaaaaaattttgccccctccctttttttcaagtaataaaggggg
ITT01_0021_B12.b : CATTAGGAAGGAGTTTAGGGAGAATTTTGgccacctctctttattcgatgaattagggtt
UTR01_0095_F06.b : TTTA*GAAAG*AATTTAGGAAAAATTTTGCCACCTC*TCTTTATTCCATGATAAAGGGgg
HTMT1_0001_E03.b : ATTA*GGAGGGAGTTAAGGAGAATTTTTGCC*CCTC*TCTTTATTCCATGATTAAGGGTG
AMP01_0095_E05.b : aacttaggaaagggattttagaaaaaaattttccccccctccttttttttccaagaatta
OVRM1_0193_A03.b :
OVRT1_0113_A10.b : catttaggaaggaattttaggagaaatttgccaccttcctttatttcatgattaagggtg
OVRM1_0126_C10.b :
KDN01_0033_G12.b : CATA*GGAAAGAGTTTAGGAAGAATTTTTGCGCTTC*TCTTTATTCAATGATTAAGGGTG
LVRM1_0176_A04.b :
OVRM1_0079_B03.b :
SPL01_0026_F05.b :
CBLT1_0020_A02.b : aaatttcccccctccttattcctgataaggggaacattcgggggcttaaaaggcccccct
OVR01_0095_C07.b : tttacattttaggaaggagttttaggaaaaatttttgcccaccctccctttattcccgag
OVRT1_0040_B12.b : ATTA*GGAAGGAGTTTAGGAAGAAATTTGCCACCTC*CCTTTATccatgataaggggtga
DCI01_0040_C09.b : cccccccctcattcccccacctgcgcaccccctcggcacaataagacgccctccttctct
BMWN1_0023_E06.b : TTTA*GGAAGGAGTTaagaggaatttgccacctcctttattcgatgatnaaggtgacctt
AMP01_0082_H09.b : ATTA*GGAAGGANTTTAGGAAGAATTTTGCCcctcccctaattcaatgaataagggggaa
DCI01_0030_E04.b : ttgcacctcctttatcatgataagccaacattcgggacttaaaaagccccctgcgtcttg
DCI01_0038_B03.b : ggatagggggacatctgggataaaaagcctcctgtgtcttggagcaaaaataagggtctg
AMP01_0092_E11.b : ggagaatttgccccccccttattcctgattagggggacctcttggaactaaaaaggcccc
DCI01_0042_H03.b : gaggaatttgccacctccctttttcctgataaaggggaactttggggaataaaaaaggcc
AMP01_0096_A12.b : aggaaggaatttagggaaaaattttccccccctctcttttttccatatattaagggggga
AMP01_0079_C06.b : gggaggagtttaagagaatttgcccctcctcttatctcaagataaggtgaacaatctggg
AMP01_0041_C02.b : agatttgcccctctcttatccagataggtgacctctgggacataaaagcctctgcgcctt
DCI01_0099_H08.b : ttagggagggatttaggaaaaatttgcccccctcccttttccctggattaggggtgacca
DCI01_0094_E12.b : ttaggaggaatttaggaagattttgcccccccccttattccaggattaaggggacccttc
AMP01_0094_G04.b : acttaaggaaggaatttaggaaaaatttttccccccttctcttttttcaataaataaggg
AMP01_0095_H05.b : TTTA*GGAAaggaatttaggaaaaagttttgcccccttctttttattccatgaataaagg
DCI01_0084_G07.b : ggaggggatttggaagattgngccccctccttattcacgaataaggtggccatcggggga
OVRM1_0171_H11.b :
AMP01_0040_G04.b : tttcccttgggggggggtgttaagaaaaaattctccccctccttcttttttcaaaaaaaa
LNG01_0023_G12.b : ccggtattaaatagtaaaaaaagcgaaatttaaaaaaaaaaaattttgctccccaccctt
ITT01_0085_B11.b : atttgggaagggatttaaggaaaaaattttgcccccctcttctttattccaaggattaaa
OVRT1_0144_H03.b : ggatttaggaaatttttccccctcccttatccccgaatagagggaacattgggggaaaat
SPL01_0058_E05.b : aaccttaggaaaggagttttgggaagaaatttttgccccctcccctttattccaa
SPL01_0056_C04.b : acatttaggaaggattttaggaagaattttgccccctccctttattcctgaataagattg
DCI01_0085_H04.b : gaaggagtttagagagattttgccactcccttattccatgattaaggggacccttcggga
DCI01_0087_H02.b : ttctttatcctgaataggtgccatctgggacttaaaagcctcctccgtccgtgaggcaaa
DCI01_0109_B06.b : ctcccttatcatgaataggggacatcggggacataaagcctctgctcttgaagcaaaaac
DCI01_0002_B11.b : ctagggaaggagtaagggaaaattttgccccctctccttttcccagaataagggcgaaca
SPL01_0014_E09.b :
DCI01_0025_H04.b : taaaaggcccccttcttttgagaaaaaaaaaagggttcgggaaacccacgggcccggccc
DCI01_0026_C12.b : aattttcccccctcttttttcccgaataagggggacccatggggggaaaaaaaaaccccc
AMP01_0004_G06.b : tctaaactcttcctatttaacgaacggttaaccaactctcaacttttcagaccttccttc
AMP01_0037_A08.b : tcagataagttacctctgggaataaaagccctctctccttggagaagatactattggtct
DCI01_0063_A03.b : tccttatccagattaggtgacctctgggactaaaagcctccgctctcttgaacaaataat
HTMT1_0083_D05.b : aggaagagtttagaaaaattttgccccctcctctttttcatggattagggggaccctccg
AMP01_0102_A06.b : taggaaggattttaagaaaaatttttgccccctccctttattcaaggaataagggtgaac
OVRT1_0075_F04.b : ATTA*Gaaagagtttaggaagattttgcacctcctcttattcatgattagggtgaccatc
AMP01_0036_A06.b : gaaggagttaaggagaattttgccccctctcttaatcaaggataagggtgaccatcctgg
AMP01_0061_G12.b : ctttgggaggaggttaggaagaatttggccccctcctttttccaagaataaggggaaact
DCI01_0011_E08.b : ATTA*GGAAGGAGTTTAGGAgaatttgccacttcctttattcctgataagggtgacctct
KDN01_0003_A10.b : ggaggaaaaaaattttcccccccccctttttttttaaaaaaaaaggggggagaccccccc
PST01_0085_F04.b : ATTA*GGAAGGAGTTTAG*AAAAATTTTGCCACCTC*TCTTTATTCAATGA*TAAGGGTG
PST01_0005_D11.b : ATTA*GGAAGGAGTTTNAGAAGAATTTTGNCCACTC*TCTTNATCCATGANT**AANGTG
ADR01_0084_E10.b : ATTA*GGAAGGAGTTTTAGAAGAATTTTTGCACCTC*TCTTNNATCCCATGATAAGGNTG
OVRM1_0194_A03.b :
OVRM1_0004_H06.b :
OVRM1_0196_H04.b :
OVRM1_0056_A12.b :
OVRM1_0053_H08.b :
OVRM1_0085_E02.b :
OVRM1_0062_C08.b :
OVRM1_0186_H09.b :
OVRM1_0129_E08.b :
SPL01_0074_C01.b : aaaatttaatctggtttaaacattaagagaaaggaattttctaggaaaaatt
SPL01_0102_C02.b : tgggaagaattttgggagaaatttgcccccctcctcttattccatgatttaagggggaaa
ADR01_0003_A08.b : gggtttaggaaaaattttcccccctccttttccaagataaaggggaaccctggggaaata
SPL01_0034_B08.b : gatttaggaaaattttgcccctctcctaatccatgattaaggggaccatcttggaattta
SPL01_0089_A03.b : cattaggaaaggattttaggtaacaattttgccccctt
SPL01_0003_G03.b : tttaacatttaaggaaggaattttaagaaaaaattttttgcccccct
UTR01_0088_C08.b : cctttggaaagaagtttaggaaagaatttggcccccctccccttttttcaagaattaagg
SMG01_0038_D02.b : ggggagggtttagaaaaattttgcaccttcctttatcaatgataaaggggaacatcgggg
ITT01_0002_G08.b : taggaaggagttaggaaagattttgcacctctctttatcgatgattaggntgancatctg
ITT01_0097_G08.b : ataagaagggagttaaggagaattttgcacctctctttatcgatgattagggtgaccctc
OVRT1_0054_C01.b : ttaagaggatttaagaagaatttgccacctcccttattcatgaataaggtgaccatctgg
PBL01_0065_D04.b : ATTA*GGAAGGAGTTTANGAAGAATTTTGCacctctcttattcgatgattaaggttgacc
OVRT1_0094_F02.b : CTTA*GGAAGGAGTTTAGagaattttgccactcttcttatccctgattaaggtgaccctc
OVR01_0100_A01.b : TTTA*GGGAGGgattttaggaagaatttttgcccccct
ITT01_0081_C02.b : ATTA*NGAAGGAGTTTAGGAAAGATTTTGCCACCTC*TCTTTATcgatgattanggtgac
OVR01_0091_C02.b : *TTA*GGAAGGAGTTTAGGAAGATTTTTGCCACCTC*TCTTTttccatgaataaggttga
AMP01_0040_B02.b : tccaaaaagaaaatgtttctcttttcccccctggggagggggttttgagaaaaatattct
AMP01_0004_H04.b : ttgcccccctcctctttttattatcgggcaattaactttacaatcaatgtcacaccattc
DCI01_0016_B01.b : agaatttgccccctctttttttccggattaggggaacattccggggacttaaaaagcccc
DCI01_0091_E02.b : gagttagaagaaatttgccaccttctttatccataattaaggtgacatctggggattaaa
OVRT1_0069_F05.b : ATTA*GGA*GGAGTTTAGGAAGAATTTgccacctccctttatccatgaatagggtgacca
DCI01_0029_G12.b : aaaaagcgcccttttctctttggagaaaaaaaataaaggggctgggaagaaaacaccttg
DCI01_0026_C05.b : aggggacctcggggacaaaaagcccccgctgccttggagcaaaaactaagggctgggaaa
DCI01_0104_B09.b : gataaggggaacatcggggataaaaaagcccctgccctctggaagcaaaaaaataagggt
DCI01_0105_B09.b : tattcctgataagggtgacatctggggcttaaaaggcctccccttcctgtgtagccaaaa
AMP01_0081_E01.b : gaagattttgccactcccttaatcgatgattaaggtgaacatctggggacttaaaaggcc
AMP01_0065_H04.b : gaagatttgcccctctcttatccatgatagggtaccttctggaactaaaaggcccctgtg
AMP01_0092_G07.b : gagttnnagagaatttgccacctccctttatcaatgataaaggtgaccttctggggattt
AMP01_0084_H11.b : tttngaagggatttagggagaattttgcccccttcctttattcgatgataaggggaacca
AMP01_0081_C08.b : angaaggatttaggagaanttttgcccctctcttattcnatgataagggtgaccatctgg
SPL01_0060_F01.b : tcgttccacaaaagtttatttttccctccctcttctagtaaatattactggggcttcccc
OVRT1_0017_H05.b : caatatagcatagaaatataagaaatatattccaaactcctctttatctcaaattaacgg
OVRM1_0152_H06.b :
OVRM1_0192_A03.b :
OVRM1_0018_F04.b :
OVRM1_0215_H02.b :
OVRM1_0203_E02.b :
SPL01_0061_A03.b : aagggtaaaaattggttcttggtttttaacttttagggaaagggaatttttggggaaaaa
OVRM1_0186_E11.b :
OVRM1_0126_A08.b :
OVR01_0079_A04.b : attgaatcctgtttaaccctttgggaagggggtttttggggaaagaattttggccccccc
ADR01_0043_F12.b : acttttaggaaggaatttaagaagaaattttgccccctcccttttttcccggattaaagg
OVRT1_0097_A07.b : gggaaggagtttaggaaaattttgcccccctccttttttcctgattaaaggggaaccctt
PCT01_0020_F06.b : tanggaagnagtttagaagaattttgcccctccctttatccatgattaaggtgaccatct
OVRT1_0134_F02.b : gaaggatttaggaaattttgcccctccttttttcctgattaggggaccatttgggaacat
SPL01_0002_H11.b :
OVRT1_0152_H12.b : tttggaagggattttggaaaaattttgcccccccctcccatctcccatattaagggggaa
OVRT1_0102_G05.b : tagggaaggagttaggaaaattttgccacctctctttttcatgataagggggaccatcgg
KDN01_0072_A05.b : ATTA*GGAAGGAGTTTAGGAAGAATTTgccacctctctttatcgatgattagggggaccc
OVRT1_0116_A03.b : ttaggagggatttaggagaaatttgcccctctctttattcctgaatagggtgaacattct
ADR01_0066_E12.b : ATTA*GGAggagttaaggaaaaatttgccactccccttatcccaggataagggtgaccct
ITT01_0093_F08.b : ATTA*NGAAGGAGTTTAGGAAGAATTTTGCCACtctctttatcgatgattaggntgacca
ADR01_0088_D04.b : ATTA*NGAAGGAGTTNAGGAAGAATTTTGCCnnactctcttatcccatgattagggtgaa
KDN01_0067_D11.b : ATTA*GGAAGGAGTTTAGGAAGAATTTTGCCCNACT*CTCTTTATCGATGATAAGGGGTG
CLNT1_0112_G05.b : gcacctctctttttcctgataaggggaaccccggggaataaaaaggcccccgctgcttgt
PCT01_0013_E03.b : gaaggaattaaggagaatttgccacctttcttattcatgaataaggggaccatctgggaa
AMP01_0035_H04.b : tagggaaggagttaagaagaattttgcccctctctttattcaaagaatagggttacccat
ADR01_0031_H08.b : ATTA*NGAAGGAGTTTANGGAGAATTTTGCCCACTCCTCTTTATTCGATGATAAAGGGTG
AMP01_0055_F08.b : tttgggaggagtttaggagaaattttgccccctcccttttttcnaggaaaaagggtgacc
SKNB1_0010_D02.b : ATTA*GGAAGGAGTTTAGGAAGAA*TTTGCCACCTC*TCTTNA*TCCATGNNATAAGGTG
BFLT1_0088_D11.b : ATTT*NGAAGGgagtttaggaagaatttttgccacttctctttattccatgattaggggt
ADR01_0054_C11.b : ATTA*NGAAGGATTTTAGAAAG*ATTTTGCCCACTC*TCTTTATTCCA*GATTAAGGGTG
AMP01_0034_G08.b : gaatttgcacttccttatcaagataaggggacttcgggaaataaaagccccctcttcttt
DCI01_0115_F06.b : ggattttagagaatttgccactctctttatcaggataagggggaacatttgggacataaa
DCI01_0111_B10.b : taggaaggattttaggaaaaattttgcccctcctttattcccggattaaggtgaccactc
PCT01_0001_B08.b : tttggaaaaattttcccccccctttaatccggattaagtgacccttcggggattaaaaaa
PST01_0073_H04.b : atttaggaaggagttttggaaaaatttttgcccccccccttttttcccttgattaggggg
PST01_0016_F01.b : ATTA*GGAAGGAGTTTAGGAAAGATTTTGCCcacctctcttattcgatgattangggtga
PST01_0031_B05.b : atagggaggagtttaggaagattttggcacctctcttttttcatgattaaggggaaccat
OVRT1_0053_H03.b : tttggaaagagtttaggagaaattggcacctctcttattcctgattaaggtgacaatcct
TCH01_0079_G12.b : ATgaagaaagactttacgaagattttgacacctctctttagtcatgattaagtagtagaa
AMP01_0075_G02.b : gttaggaagaatttgccccttctttttcaagattaggtgaccatctgggaaataaaaagc
SKNB1_0064_A01.b : ATTA*GAAAGGAGTTTAAGAAAAATTTTGCCACCTC*CTTTTATTCCATGAattaaggtg
OVRM1_0013_C11.b :
OVRM1_0183_C11.b :
PBL01_0074_E03.b : ATTA*NGAANGAGTTNAGGAAGAATTTTGCC*ACCT*CTCTTnnnatcgatgatanggnt
LNG01_0062_E09.b : TTTA*GGAAGGAATTTAGGAAAAATTTgccacctcccttattcctgattaaggtgaccct
OVRT1_0050_D03.b : ATTA*GGAAGGGAGTTAGGAAAGATTTTGCCACTTC*TCTTTATCCCATGATagggtgac
PTG01_0063_A11.b : ataaaaaaaggggaaacccccggggaaaaaaaaaacccccctctctcttttagaaaaaaa
ADR01_0015_C03.b : tgtaaatatttccccccccttttttcctggtataggggggacacctgggggatatttaaa
BKFL1_0020_G05.b : aagaatttgcccctcccttattcaaggatagggggaccatcggggactataaaaggcctc
DCI01_0100_D11.b : ATTA*GGAAGGAGTTTAnngaagaatttttgcccctcctcttaatccatgattaaggttg
OVRM1_0215_D06.b :
AMP01_0051_C04.b : ttagagattttgcccctcccttatcatgataaggtgaccctctgggactaaaaacgcctc
KDN01_0042_H03.b : ATTA*NGAAGGAGTTTAagagaaatttgccancctctcttatcgatgattagggntgaac
LNG01_0031_H02.b : tacatttaggaaaggaattttaggaaaaaatttttccccccttctctttttttccctgaa
AMP01_0072_H01.b : ccctcccttatccaggataaggggaaccttcggggataaaaaaggccccccccccccttg
OVRM1_0033_A09.b :
OVRM1_0002_H03.b :
OVRM1_0094_D09.b :
OVRM1_0206_F10.b :
SMG01_0103_H07.b : ttaggaagggagttaggaagattttggcacctctctttattccagaataaggttaaccat
LNG01_0036_H08.b : cataggaaaggaatttaggaagaaattttgccccccctctctttatttccatgatttaag
LNG01_0070_G03.b : ATTA*NGAAGGAtttaagaaagattttgccacctcccttattccatggataagggtgaac
OVR01_0020_G04.b : ATTAAGGAAGGAGTTTAAGAAGAATTTTGCCAacttctcttttattcgatgattaagggg
OVRM1_0210_F02.b :
SKNB1_0008_C07.b : tttggaaggaggttaaggaagaatttggcacctccccctattcatgaataagggtgaacc
SKNB1_0037_B01.b : ATTA*NGAAGGAGTTTAGGAAAGAATTTGCCACCCT*CTCTTATCCCATGATTA*GGGTG
DCI01_0016_H09.b : tgcccctctcttatcctgaataggggacccttgggactaaaaagccctctctctctggag
OVRT1_0020_B04.b : ATTA*GGAAGGAGTTTAGGAAGAATTTTGCCACCTC*TCTTTATTCCtgaattaggttga
DCI01_0037_C07.b : ggaagagntaaggaagattttgccccccctttatccatgattaaggtgaacctcggggac
DCI01_0105_A03.b : ATTA*NNGAAGAGTTTAGGAAAGATTTTGCCACCTC*TCTTTNATCCCATGATNAGGGTG
DCI01_0078_G10.b : ATTA*GGAAGGAGTTTAGGAAGAATTTTGCCACCTC*TCTTTATCCCATGATTA*GGNTG
BKFL1_0035_A11.b : ATTA*NGAANGGAGTTAGGAAGAAATTTGCCACCTC*TCTTNATCCCATGAT*AAGGNTG
SKNB1_0015_C04.b : ATTA*GGAAGGAGTTTAGGAAGAATTTTGCCACCTC*TCTTTATTCCATGATTAAGGGTG
ADR01_0021_D09.b : ATTA*NGAAGGAGTTTAGGAAGAATTTTGCCACCTC*TCTTTATTCCATGATTAAGGGTG
TCH01_0091_A11.b : ATTA*GGAAGGAGTTTAGGAAGAATTTTGCCACCTC*TCTTTATTCCATGATTAAGGGTG
LNG01_0005_H01.b : ATTA*GGAAGGAGTTTAGGAAGAATTTTGCCACCTC*TCTTTATTCCATGATTAAGGGTG
CBLT1_0038_B08.b : ATTA*GGAAGGAGTTTAGGAAGAATTTTGCCACCTC*TCTTTATTCCATGATTAAGGGTG
SPLT1_0100_H02.b : n
ILNT1_0067_G12.b :
20110601C-007088 : ACACATCTGGGGACTATAAGAAGGCCCTCCTGCTGCTCTGTGGAGGCGAAGATGACTGAT
---------+---------+---------+---------+---------+---------+ 1160
HTMT1_0032_G04.b : aaaaaggccccctctcctttgggaaggaaaaaatgatgggtcctggggaaaaacccacgt
DCI01_0030_F09.b : ggtttttaaaaattgggggtgtgaggggggggggtccaacaaggggaaaaaaatttttga
SPLT1_0035_A03.b : aagccccccttctttcttggagaaaaaaaaaaatagggtccggggaaaaaaccccttgtt
CBLT1_0022_A01.b : aaaagggccctctcctccctgtggggcaaaaaaaatgaggggtcctggaaaaaaccccgg
OVRM1_0030_F06.b :
SPL01_0075_B02.b :
ITT01_0095_D03.b : gggactaagaggccctctgctgctctgtgaggtatataatgaggggcctgggaaaaccca
CBLT1_0072_B06.b : gggacaataaaaaggctcctgctgctcgtggagcgaaaagactgaggggtccgggaagaa
ADR01_0043_F01.b : aaaggccctcccgcgctttgtgagagaaaaaaaatgtgtgggtttctgggaaaaaccccc
SMG01_0075_G01.b : ctctggaggaaaaaaagagggtcgggaaaaaccactttggccgggccccggctttttcaa
SPL01_0051_G12.b :
OVR01_0009_B12.b :
DCI01_0036_G01.b : cgggaaaaaaccccggttgtccaggccccggtttttttaaaaaattaaaggtttttaaga
OVRM1_0112_H04.b :
DCI01_0020_A05.b : gccaggtttttaaataagaggtgtaggggggggggcctcacacaggtggaaaaaaatttg
AMP01_0026_F11.b : aaaagt
AMP01_0046_C10.b : ccttctgtttcttgcgaaggaaaataacgtn
MLN01_0077_F11.b : ttcgggggactaaaaaaggccttcctgcttctcttgggagggaaaataaatgatgggttc
ADR01_0062_D01.b :
OVRM1_0199_B09.b :
OVR01_0062_D01.b : aaaattcgggggaattataaaaagg
ITT01_0021_B12.b : gaccatctggggactatatagaagcccctcctgcctgctcttggaaggttaaaatgactg
UTR01_0095_F06.b : accatctggggaatataaaaaggccttctggctgttctttgaaggccaaaaataatatag
HTMT1_0001_E03.b : ACCCTTCTGGGGAACATAAGAAGGCCCCCCTGCTGCCCTGGGAAGGCGAAAATGAATGAA
AMP01_0095_E05.b : aggggggaaacaattcggggggaaaataaaaaaaagggcccccccccgcctgccctccct
OVRM1_0193_A03.b :
OVRT1_0113_A10.b : caactcgggggaactaagaaaggcccccctgctgcctggggaaccaaaaataatgagggg
OVRM1_0126_C10.b :
KDN01_0033_G12.b : ACAATTCTGGGGAATAATAAAAGGCCTTCTTGCTGCTCTGTGGAGtgaaaaatgatgatg
LVRM1_0176_A04.b :
OVRM1_0079_B03.b :
SPL01_0026_F05.b :
CBLT1_0020_A02.b : ttctccgggagcaaaaaaattaggggtcgggggaaaacccagttggccaggccccgggtt
OVR01_0095_C07.b : taaataagggaggaaacaatctgggggaattatataaaagggcccccccctgctctcttc
OVRT1_0040_B12.b : ccatcttgggactataagaaggccctcctgcttctctgggaagcaaaaatactaaggggc
DCI01_0040_C09.b : cgatgagacaacaccccaacgactcctgaaaatcactctcccgtccggctcctcctaccc
BMWN1_0023_E06.b : cggggaatataagaagccctccggtccctgtggaggtaaaaatatgaatgggtccgggga
AMP01_0082_H09.b : catctgggaaattataaaagccctcctccggcctttggaaggtaaaaaaaaccagagggt
DCI01_0030_E04.b : tgagcaaataataagggcctgggaaaaaccccttgtgcctggccaggtttctttaattta
DCI01_0038_B03.b : ggaaacccactggcccgggccatgttctttaaatcaggagggttaccggtggtctgcccc
AMP01_0092_E11.b : ctctcccctggaaggaaaaaaactagggggctggggaaaactaacttggcacggccccac
DCI01_0042_H03.b : tccttttccttggaggcaaaaaataatagggccttgggaaaacccacgttggccaggccc
AMP01_0096_A12.b : aacaatttgggggaaaattaaaaaaggccccttcccgctcttccccttttgtgggggacg
AMP01_0079_C06.b : gactataaaagggcttccgctgcctctggaaggaaataactgatggggccggggaaaacc
AMP01_0041_C02.b : gaaggaaaaaatgatggtctgggaaaaccccctggccctgcccctgcttttaacattctg
DCI01_0099_H08.b : tctgggaaataaaaaaggccccccgtcttccctgggaagcaaaaaaaataatgggtccgg
DCI01_0094_E12.b : tgggactttaaaaggcccctcctcttctcttggagccaaaaaaatttatgggtctgggag
AMP01_0094_G04.b : gggaacccatctgggggaattataaaaaaggcccctcccgcctttctcttggggaaggga
AMP01_0095_H05.b : gggaaccctcttgggggaacttataaaaaggccctccctggtttcctctttggtgagggg
DCI01_0084_G07.b : cttaaaaagcctcctccgcctttgaggcaaaaaaactaggggcccgggggaaaaccccct
OVRM1_0171_H11.b :
AMP01_0040_G04.b : agggggcccacctggggaaaaataaaagacgccccctccttcctcttggaagaacaaata
LNG01_0023_G12.b : ctatttatacccaatggataaaaggggggagaacacacggctagggggaaaattttaaaa
ITT01_0085_B11.b : gggggaccctcttggggaaccataaaaaaggccccctcgcctgctcttgggaagggtaaa
OVRT1_0144_H03.b : aaaaggcccccccttcctttggaggaaaaaaaaagaggggcccgggaagaaaccacnttg
SPL01_0058_E05.b :
SPL01_0056_C04.b : cc
DCI01_0085_H04.b : attaaaaaagccttctcccgttctgggagcacaataacgtatgggtccggggaaaacccc
DCI01_0087_H02.b : aaactagggtctgggaaaaacccactggnccgggggcaggctcttagaaattaataaggt
DCI01_0109_B06.b : tatggtctgggagaaccanttggcacgcccctgctcttaaatataggtgttgtacggttg
DCI01_0002_B11.b : tctggggaataaaacaaggcccccctcctctcttggaaggcaaaaaaaataatggggtct
SPL01_0014_E09.b :
DCI01_0025_H04.b : cgcttttcttaataattagggttttagggggggggtgtcacaacagggggagaaaaaatt
DCI01_0026_C12.b : ctcctccctttggagggaaaaaaataaaaagggcctgggggaaaaaccaacaatgttccc
AMP01_0004_G06.b : ctctcatgttttttcctttctctcttttc
AMP01_0037_A08.b : ggaaaaccccct
DCI01_0063_A03.b : gagggtctggaaaacccactgggcacgggccagtctcttaaattaggaatgtgttacggt
HTMT1_0083_D05.b : gggaacataagaaggcctcctgctgcctttgggaagcaaaaaaaatgaatgggtcctggg
AMP01_0102_A06.b : catctggggaacataaaaaagcccccccctgcgtctccttggggagggggaaaaataaag
OVRT1_0075_F04.b : tggaaataaagaagccttccgctgctctgggaggcaaaagaataaggggtctgggaaaaa
AMP01_0036_A06.b : gaacaaaaaacgccctctgcctcctcgggaagtaaaaaaatgattgggtcggggaaaacc
AMP01_0061_G12.b : tctggggaaattaaaaagcccccctcctccctcttggaaggaaaaaaaataaagaggggt
DCI01_0011_E08.b : ggggacttaaaaaggcccctgctgctcgtgtaggcaaaaaattatggggtctgggaaaac
KDN01_0003_A10.b : gcggaaaaaaaaaaaaacccccccctcccctttcccctcggaaaaaaaaaaaaaaaaaag
PST01_0085_F04.b : AACCATCTGGGGACTAATAAAAGGCCCTCCTGCTGCTCTtgggaagcaaaataattgagg
PST01_0005_D11.b : ACACATCTGGGGACTATTAGAAGGCC*TCCTGCTGCTCTGTGGAGGCGAAAATAACTGAT
ADR01_0084_E10.b : ACCCATCTGGGGGATTATAGAAGGCCCNTCTGCTGCTCTGTGGAAGCGAAAATGACTGAT
OVRM1_0194_A03.b :
OVRM1_0004_H06.b :
OVRM1_0196_H04.b :
OVRM1_0056_A12.b :
OVRM1_0053_H08.b :
OVRM1_0085_E02.b :
OVRM1_0062_C08.b :
OVRM1_0186_H09.b :
OVRM1_0129_E08.b :
SPL01_0074_C01.b :
SPL01_0102_C02.b : aatctgggggacataaaaaggggccccctgctcctctttggaagcgaaaaaaaataatgg
ADR01_0003_A08.b : aaaaggccttctcctctccttgaagtaaaaaaaagatgggtccgggaaaaaacccctttg
SPL01_0034_B08.b : aaaaagccccccgtctctctggaagcaaaaatatgaggggtctggggaaaaccccacctt
SPL01_0089_A03.b :
SPL01_0003_G03.b :
UTR01_0088_C08.b : ggggaccattctgggggaacaaaaaaaagggcccccgtccaccctctttggagcccaaaa
SMG01_0038_D02.b : gactataaaaggcccccgctgtttttggagggaaaaaacggagggcccggggaaaaaccc
ITT01_0002_G08.b : gggactatagaaggccctctgctgctcgtgnagtgaaatgacgatggggtctgggnaaaa
ITT01_0097_G08.b : tggggacataaaaagccctcctgcgctccgtgaagtgaaaagacgaaggggcccgggaaa
OVRT1_0054_C01.b : gactataaaaggctccctgctctttgtgaagcaaataaataatgggcccgggaaaaaccc
PBL01_0065_D04.b : atctngggactaatagaagccttctgctgctctgtgaggcaaaatgatgatggggtccgg
OVRT1_0094_F02.b : tggggactaaagaagggcttccgctgccttttgaagcaaaataatgatgggtctggggaa
OVR01_0100_A01.b :
ITT01_0081_C02.b : catcgggggactaatagaagcccctctgctgctctgggagtgaatagaatgaggggtctt
OVR01_0091_C02.b : ccctctggggactataaaaggccctctgctgccttgtggaggcaaaattactgatggggt
AMP01_0040_B02.b : ccccccccctcttttttagagaaaaagggggccaccccctggggaaaaaaaaaaagcccc
AMP01_0004_H04.b : ttgngtttacctaatgctta
DCI01_0016_B01.b : ccgtgtcctttggaggcaaaaaaatgaggggtcggggaaaacaccactggggccaggccc
DCI01_0091_E02.b : aagcctcctgctgctcggtgagcaaaaaaattatgggtccggggaaaaccaacttggtcc
OVRT1_0069_F05.b : tctggggactatagaaggccttctgctgctctggaagcaaatatgatgaagggtcctggg
DCI01_0029_G12.b : ggcactgggccacgttttttttaaaattagtagggttttacagaggtgggaaggggtaac
DCI01_0026_C05.b : accaacttgcatggccatgcttttaaattatgaggttgacggggggagggctaccaaggt
DCI01_0104_B09.b : ccgggaaaacccaagtgggcatgggccggcgttccttaaatcaaaaccctgtaccggggg
DCI01_0105_B09.b : aatatgggtccgggaaaaacccccgggccctggcccctgctttttaaaattatggagttg
AMP01_0081_E01.b : ccctgctcccttgaaggtaaaaaactgagggtccgggggaaaaccc
AMP01_0065_H04.b : cccgggagtaaaaaatatgggctgggaaaaaccaattgccacggccccttttttttaaaa
AMP01_0092_G07.b : aaaaggccccctgctccctgtggagggaaaaaaataatgggcccggtgaaaaaacccact
AMP01_0084_H11.b : tctgggaactaaaaaaggcctcctcctccctctggagggaaaaaacacaaagggg
AMP01_0081_C08.b : ggacttaaaaagccctcctgcgccctttggaggaaaagactgaggggtcctgggaaaacc
SPL01_0060_F01.b : acgaggaatagtgaaaaactgtgataacctgtgctttctataaactat
OVRT1_0017_H05.b : gaaacccatactgtgtacatatacgaagatctccccatctatattctgagatgataacat
OVRM1_0152_H06.b :
OVRM1_0192_A03.b :
OVRM1_0018_F04.b :
OVRM1_0215_H02.b :
OVRM1_0203_E02.b :
SPL01_0061_A03.b : atattttt
OVRM1_0186_E11.b :
OVRM1_0126_A08.b :
OVR01_0079_A04.b : tcccctttttttccaagaaataaagggggggaacccattcttgggggaaaatttaataaa
ADR01_0043_F12.b : gtgaacctcctggggaattaaaaaaaaggccctcctgtctgttctgtggaaggcaaaata
OVRT1_0097_A07.b : tggggacattaaaaaggcccccctgccttcttgggaagcgaaaaataatgagggggcctg
PCT01_0020_F06.b : ggggacttagaaagccctctgctgttcgtgagccaaaagactgatggggtctgggaaaaa
OVRT1_0134_F02.b : aaaaggccccctcttctcttgaaagaaaaaaaaaggggcctgggagaaacccactgggcc
SPL01_0002_H11.b :
OVRT1_0152_H12.b : ccctctggggaactaaaaaaggccctcctccccctctttggaagcgaaaaataaaaatgg
OVRT1_0102_G05.b : ggacataaaaaggcctccgccgctttgggaggcaaaaaaatgaagggtccggggaaaaac
KDN01_0072_A05.b : tctggggactataagagggcctcctgctgctctgtgaaggcgaaaatactgaggggtcct
OVRT1_0116_A03.b : ggggacttaaaaaggccccctgctgcctttgaaggcaaaataatgatggggtccggggaa
ADR01_0066_E12.b : ctggggaactaaaaaagggccccctgcctctctttggaagccaaaataacggatgggtcc
ITT01_0093_F08.b : tctgggactatagaaggccctctgctgctctgtgagtgaaaataatgatgggtctgggga
ADR01_0088_D04.b : catctggggactataagaaggccctctgctgctcntgtggagcgaaaatgactgatgggg
KDN01_0067_D11.b : ACACATCTGGGGACTATAAGAA*GCCCTCCTGCTGCTCTGTGGAAGCGAAatgactgatg
CLNT1_0112_G05.b : gagaaaaaaaataagggcccggggaaaacccaggtgccctgggcaaggcttcttaaaaat
PCT01_0013_E03.b : ctaaaaaggccctccgctgtttttgaagccaaaatactgaggggtcctgggaaaaaccca
AMP01_0035_H04.b : ctggggaattaaaaacgcccctcttctgctttgtgaaggaa
ADR01_0031_H08.b : ACACTCTTGGGGACTATAAaaggccctcccgctgcccttggaagtgaaaattactaatgg
AMP01_0055_F08.b : attctggggacaaaaaaaggcccctcccgctgccttggaaagcaaaaaaa
SKNB1_0010_D02.b : ACACATCTGGGGACTATAAGAAGGCCCTCCTGCTGCTCTGTGNAGG
BFLT1_0088_D11.b : gaacatccggggaactataaaaaggccctctcgctggtctttggaggccaaataaactga
ADR01_0054_C11.b : AC*CATCTGGGGACTATAAGAAGGCCCTCTTGCTtgctctgtggaggccaaaatactgaa
AMP01_0034_G08.b : gaaggaaaataagagggtctgggaaaaacccccggcccgggccctgctttttaaattatt
DCI01_0115_F06.b : aagccctctgctgccttggagcaaaaaaatgataggtctgggaaaaaccaattggccatg
DCI01_0111_B10.b : ggggaacaaaaaaaggcctccgctgcccttgtgagccaaaataaatgagggtcctgggga
PCT01_0001_B08.b : gccccctgctgtctggtgagccaaaaaactaaggggcctgggaaaaaccccggtgtggcc
PST01_0073_H04.b : gaaccttccgggggacttaaaaaaggcccccctgcttccctggggaagggaaaataaatt
PST01_0016_F01.b : acatctgggggacataagaagcccttctgctgctctgtggagcgaaaagactgatggggt
PST01_0031_B05.b : ctggggactaaagaagggcctcctgctgctcggtgaggcaaaaagattgatggggcctgg
OVRT1_0053_H03.b : gggactataaaaggcctcggctgctcggggagccaaaattatgatgggtccctgggaaaa
TCH01_0079_G12.b : ctttctttaaatatgtttaaaatcccacacaaacaaatataacctgcaaaactgatgtaa
AMP01_0075_G02.b : ctctccttccttgaagcaaaaaataagggtctgggaaaaaccccggtgccaggcccgtcc
SKNB1_0064_A01.b : acacctcctgggaactataaaaaggccctccgcctgctccgtggaagccaaaataactta
OVRM1_0013_C11.b :
OVRM1_0183_C11.b :
PBL01_0074_E03.b : gacacatctgggactataagaggcccctctgctgctctgtgnagtgaaaagactgatggg
LNG01_0062_E09.b : tctgggactaaaaaaggcccccgctcctcttgaagcaaaaaaatgatgggtctgggaaaa
OVRT1_0050_D03.b : catctggggactaaagagggccctctgctcttctgggagccaaaagactgaggggtcctg
PTG01_0063_A11.b : aaaaatggtgcggggggaaaaacaaagggtgggccgcccccgcccttctttaaaaaaaag
ADR01_0015_C03.b : agccctcccccgtcctgtgtggataaaaaaacggtagtgttcgtggaaaaacccatttgt
BKFL1_0020_G05.b : tccgctccggagggaaaaaaacaaggggcctggggaaaacccccttggcccggccccagg
DCI01_0100_D11.b : acccatcttgggaactataaaaaggccctcctgctgcccttgggaagcaaaaataacgta
OVRM1_0215_D06.b :
AMP01_0051_C04.b : ctgccccttggaggaaaatnatgatgggtccgggaaaaaccccctgtgccctgccccctg
KDN01_0042_H03.b : atctggggactataagaaggccctctgctgctctgtgnaggtgaaatgactgatggggtc
LNG01_0031_H02.b : ttaaagggtgaccccttcctggggaacctataaaaaagggcccctcccggcctgcctttt
AMP01_0072_H01.b : gaagcaaaaaatgaaggggtctgggggaaaacccccttggcccgggcccccctttctttt
OVRM1_0033_A09.b :
OVRM1_0002_H03.b :
OVRM1_0094_D09.b :
OVRM1_0206_F10.b :
SMG01_0103_H07.b : ctgggaatataaaaggccctctgctgctctttgagtgaaaataagatgggttctggggaa
LNG01_0036_H08.b : gggtgaaacacttctgggggaattaaaaaaaaaaggcccctcccctccttgcctccttgg
LNG01_0070_G03.b : catccggggactataaaagggccctcttgctgctctgtgaagccaaaataatgaggggtc
OVR01_0020_G04.b : tgaacccttctgggggaactattaaaaaggcccctccctgcttgctctgggggaaggcaa
OVRM1_0210_F02.b :
SKNB1_0008_C07.b : catcggggaacttatagaaggcctcctgctgctctgtggagccaaaatgactgatggggt
SKNB1_0037_B01.b : ACACATCTGGGGACTATAAGAAG*CCCTCCTGCTGCTCTGTGGAGGCGAAAATGACTTGA
DCI01_0016_H09.b : caaaaaacgaggggtctggaaaacccactggtcctggcccaggtttctaaaaattatgat
OVRT1_0020_B04.b : cccatctggggacatataaaggcccttctgctctctgtggagccaaaattactgatgggg
DCI01_0037_C07.b : tataaaagccctctgctgcccgggagcaaaattatgaagggtctgggaaaaacccagggt
DCI01_0105_A03.b : ACACATCTGGGGACTANTAGAAGGCCNTCCTGCTGCTCTGTGNAGGCG*AGATGACTGAT
DCI01_0078_G10.b : ACACATCTGGGGACTATAAGAAGGCCCTCCTGCTGCTCTGTGNNAGCGAAGATGACTGAT
BKFL1_0035_A11.b : ACACATCTGGGGGACTATAGAAGGCCCTCCTGCTGCTCTGNTGNAGCNAAAATGACTGAT
SKNB1_0015_C04.b : ACACATCTGGGGACTATAAGAAGGCCCTCCTGCTGCTCTGTGGAGGCGAAGATGACTGAT
ADR01_0021_D09.b : ACACATCTGGGGACTATAAGAAAGGCCTCCTGCTGCTCTGTGGAGGCGAAGATGACTGAT
TCH01_0091_A11.b : ACACATCTGGGGACTATAAGAAGGCCCTCCTGCTGCTCTGTGGAGGCGAAGATGACTGAT
LNG01_0005_H01.b : ACACATCTGGGGACTATAAGAAGGCCCTCCTGCTGCTCTGTGGAGGCGAAGATGACTGAT
CBLT1_0038_B08.b : ACACATCTGGGGACTATAAGAAGGCCCTCCTGCTGCTCTGTGGAGGCGAAGATGACTGAT
SPLT1_0100_H02.b : nnnnggcgagtacacgcagtagtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
ILNT1_0067_G12.b :
20110601C-007088 : GGGGTCCTGGGGAGAGACCCCACGCTGTGCCCACTGCCGCCACTGCCTTCCTTCAGCACA
---------+---------+---------+---------+---------+---------+ 1220
HTMT1_0032_G04.b : tggcccggggcccatgctttcttaaaaatcaagggatggttgaacgggtggtgcatgctt
DCI01_0030_F09.b : aaaaaggcttccctcaattctttttgaaaaaaaataaaaa
SPLT1_0035_A03.b : tcagggccccaagcttttttaaaaaaataaaaaaatttttaaccgggtgtgaaagttcta
CBLT1_0022_A01.b : ttggccagggccccgggctttttgaaaaattaataaatttttaaacgggggtgcaaggcc
OVRM1_0030_F06.b :
SPL01_0075_B02.b :
ITT01_0095_D03.b : cctggccatgccccagggcttttacaattaatgatgttgtacgggttggaatggctaccc
CBLT1_0072_B06.b : cccaagctggccagtgccccattgcttcttaacaatttaatgaatggtggtaccggggtg
ADR01_0043_F01.b : tgtttggccattgcgcccggcttttttttaaacattataggtaatttttgaaagggggtg
SMG01_0075_G01.b : aattcatgatgttgaccggttggaaggcttaccccaatgggggggaaaattgtttgggaa
SPL01_0051_G12.b :
OVR01_0009_B12.b :
DCI01_0036_G01.b : gggggggtgttctcacacacatggttgggaaaaaa
OVRM1_0112_H04.b :
DCI01_0020_A05.b : aaaaaggggccccccaatttttttggggggggtaaaaaagatttttttgagggttttgtg
AMP01_0026_F11.b :
AMP01_0046_C10.b :
MLN01_0077_F11.b : tggggaagaacccaggtggtgccatggccgccatgcttttttcaaaaatttcaggaaggt
ADR01_0062_D01.b :
OVRM1_0199_B09.b :
OVR01_0062_D01.b :
ITT01_0021_B12.b : atggggtcctgggggaaaaaccccagctgtgtcccattggcccccatggcttttttttac
UTR01_0095_F06.b : gggtc
HTMT1_0001_E03.b : GGGGTCCCGGGGAGAAACCCCACctttgcccatggccgccctgtcttccttaaaatattt
AMP01_0095_E05.b : tgtggagggggaaagaaaaaaaaaaaaggagggggggggcccggggggggggaaagagaa
OVRM1_0193_A03.b :
OVRT1_0113_A10.b : gtccggggaaaaccccaggtgggcccaggtgccccatggctttcctaaaaatttcaggaa
OVRM1_0126_C10.b :
KDN01_0033_G12.b : gggtctgtgggaaaaaacccccctgggcccatgcccgccttgcttttccttcgaaatttt
LVRM1_0176_A04.b :
OVRM1_0079_B03.b :
SPL01_0026_F05.b :
CBLT1_0020_A02.b : ttttaaaattaagggaaggtttaaccgggtggcagggcttacccacaaggtgttagaaaa
OVR01_0095_C07.b : ttggggagagcaaaataaaatgaatgtgggctctctgggggagaa
OVRT1_0040_B12.b : cctggggaaaacccaagttttgcccttgggcccctgctttttttaaaaattaaatgaaat
DCI01_0040_C09.b : ccaccaccactaaccctaccccnccaacctgctactacctcaccccacacctctctactc
BMWN1_0023_E06.b : aaacaccaaggtggccatgggccccgggtttttataaaaatatagggagggtgggacagg
AMP01_0082_H09.b : cc
DCI01_0030_E04.b : ggatggtgagcgggtggcgggcctaacctaggggtgaaaaaatttttggaaaaagggttc
DCI01_0038_B03.b : ccaaagtgttaaaaaattttttgaaataggcctccacctaaattcttgtggagggttttt
AMP01_0092_E11.b : ggtttttttaatt
DCI01_0042_H03.b : ccgtcttttttaaaatctagggacggtgggccgg
AMP01_0096_A12.b : gaaaaaaaaaattgaaagggggggtggcctcggggggggagaaaaaaaccaccccccccc
AMP01_0079_C06.b : caccttgggccctgccccctgccttttttccaattcagtgggttggaacgggtgtggccc
AMP01_0041_C02.b : gtggtggccggttggc
DCI01_0099_H08.b : gggaaaaaccccagntttgtccaatgggccattggttttt
DCI01_0094_E12.b : aaacacccnggtggccatggccacttggttttttta
AMP01_0094_G04.b : aaaaaaaaaattgaagggggggtcccggggggggaaaaaaaaccccccccccccctgggt
AMP01_0095_H05.b : aaaaatgaaaaaagagagggggggccccgggggggggaaaaaaacccccccccccccctt
DCI01_0084_G07.b : gttgccaggcgccccgcttctttaaaaataaaaaaagttggacgggggtgctggcctccc
OVRM1_0171_H11.b :
AMP01_0040_G04.b : attattagtgggttgtggagaaaaaactcctcgttgtccctttcttcc
LNG01_0023_G12.b : aaaaggggagccgccccctgcggccggcgatctctcgggggagaagggatctcagaaaaa
ITT01_0085_B11.b : aaatatgtgaatgggttccggggggagaaaaccccccccttgtgccccactggcgcccct
OVRT1_0144_H03.b : ggccaagggccggggtttttttaaaaaattaataggttggaaagggggggggagggtcta
SPL01_0058_E05.b :
SPL01_0056_C04.b :
DCI01_0085_H04.b : cctgtgtcctggggccagccttctttaaatttaaggagtgtggaagggttgggaaggcct
DCI01_0087_H02.b : tgtaagggtggaaagcttacccaaatggggtggaaaaatttttggaaaaagggtc
DCI01_0109_B06.b : gaggctaaccaaggttggaaaatttttggaaagggtccttccaaatttctgtagaggttg
DCI01_0002_B11.b : gggaaaaaacccccgtggtcccctggcgccttgtttctttataaaatttttggtagtttg
SPL01_0014_E09.b :
DCI01_0025_H04.b : ttgaaaaaggggccctctcctaaatcttttgggaagagggttaaaaaaagtatttttttg
DCI01_0026_C12.b : gggggccaccgctcttcttttaaaattcatagacgctttataaaggggggtgggaaggct
AMP01_0004_G06.b :
AMP01_0037_A08.b :
DCI01_0063_A03.b : tggaaggcttacccaagtgggtgaaaaaatttttttgaaaaagggctctcttcaaaattt
HTMT1_0083_D05.b : gaaaaaccccgctgtgccacctgacccactggctttctttaaaaatacattggaatggtg
AMP01_0102_A06.b : gaagggggggctccgggggggaaaaacccccccccctttgggccccctcccgcgcccccc
OVRT1_0075_F04.b : cccactgggcccgtgcgcatggcttcttaaaaattatggatgtgttgtaccggttggaat
AMP01_0036_A06.b : tccccttggcccctgccccctttctt
AMP01_0061_G12.b : tgggaaaaaaccccccttgtgcccctggcccccttctttttttttaac
DCI01_0011_E08.b : ccaatttgccatggcgccggctttcttaaaattaagagaggttggacggggtggaaggcc
KDN01_0003_A10.b : ggggggggggaagaaacaaaaacaaagggggggccgccgccccccggtttttttttttta
PST01_0085_F04.b : ggtcctggggaagaaccccagctttgccaaatgcgccactgccttttttagaaattttaa
PST01_0005_D11.b : GGGtcctggggaaaaccccagctgtgggcaatgccgccactgccttccttaggaatttaa
ADR01_0084_E10.b : GGGGTCtgggggaaaacccangttggcccactggcgccattgcttccttagaaaatttaa
OVRM1_0194_A03.b :
OVRM1_0004_H06.b :
OVRM1_0196_H04.b :
OVRM1_0056_A12.b :
OVRM1_0053_H08.b :
OVRM1_0085_E02.b :
OVRM1_0062_C08.b :
OVRM1_0186_H09.b :
OVRM1_0129_E08.b :
SPL01_0074_C01.b :
SPL01_0102_C02.b : ggttcttggggaaaaaaaccacacctgtgcccactggccccccggc
ADR01_0003_A08.b : gccatgtgcccaggctttttaacaatttaaggaagttttaaccgggtgggaaggccttaa
SPL01_0034_B08.b : tcccctgccccatggcttttttnaaattttttttattttttaaacgggttttact
SPL01_0089_A03.b :
SPL01_0003_G03.b :
UTR01_0088_C08.b : aaaattgaagggggtcctggggagaaaaaccccaccccg
SMG01_0038_D02.b : agtggggcccgggcccatgcttttttaaaaatttaaggggtttgaaccggggtggacagg
ITT01_0002_G08.b : cccagctggcccatgcccactgctttcttacaatttaagtactgttgaccaggctggaca
ITT01_0097_G08.b : aacccccctgtgccattgccccatgcttttttaacaattcatgcatgtttgaaccggctg
OVRT1_0054_C01.b : agttgggccagtgcccaggctttttaaaatttaatgaaggtttaacggggttgaaatggc
PBL01_0065_D04.b : gaaaaacccagctgtgccatgccgcatgcttcctaanaaattcatgcatggtgtaccagg
OVRT1_0094_F02.b : aaacccaggtgtggcaggcccccttgcttccttagaattctattgatgttttaacagggg
OVR01_0100_A01.b :
ITT01_0081_C02.b : gggaaaaaccaagctgggccatgcggccatgctttcttaacaatttaatgcatggtgtaa
OVR01_0091_C02.b : ctggggaaaaacccccccgtg
AMP01_0040_B02.b : ccctctccttcttttagaaaaaaaaaaataaaatagtagggc
AMP01_0004_H04.b :
DCI01_0016_B01.b : acgccttcttttaaatttatgtaggttttaacaggttggaaaggcttaacactaagggtt
DCI01_0091_E02.b : atgggccatgcctctttaaattcatgaaggtttaacgggtgtggaaggccttaccaccaa
OVRT1_0069_F05.b : aaaaacccaggtgtgccagtgcgccaggcttcttaacaattcaggaaatgttggaccagg
DCI01_0029_G12.b : aacaaaga
DCI01_0026_C05.b : gtggaaaatgtttgagaaggggcccctccctattttctttggggagttttacaaaggttt
DCI01_0104_B09.b : gcaggctttccacaatggggtgagaaaaagtttttgtaaaaagaggt
DCI01_0105_B09.b : tacaggttggctggcttacactacggggtggaaaagtgtttgagaaaggggttctcaccc
AMP01_0081_E01.b :
AMP01_0065_H04.b : ttcgtgggtggtcggggggggtggcttccctcgggggggaaaaattggtggggaaattgg
AMP01_0092_G07.b : tggcccctgccccctgcttttttaaaattctcagaggtttgaacgggttgccagggccta
AMP01_0084_H11.b :
AMP01_0081_C08.b : caactgggcaatgccccctgcttttttccaattcaaggacagttgtaacaggtttgcaag
SPL01_0060_F01.b :
OVRT1_0017_H05.b : atttgcattggacccaggatataaatccacgatggtacttaggatagcacaggcatacat
OVRM1_0152_H06.b :
OVRM1_0192_A03.b :
OVRM1_0018_F04.b :
OVRM1_0215_H02.b :
OVRM1_0203_E02.b :
SPL01_0061_A03.b :
OVRM1_0186_E11.b :
OVRM1_0126_A08.b :
OVR01_0079_A04.b : aagcgccctctccgggcggggcctcggggggagaggccaa
ADR01_0043_F12.b : tactgatggggtccctgggaaaaaaaccccacctggggccatgggcgccctttgcttttt
OVRT1_0097_A07.b : gggaaaaaccccacgttgggcccatgggcccactgcctttctttaaaaatttcattgatt
PCT01_0020_F06.b : ccaagttggccaatggcgcatgtctccttaaaattctatggatgttttaaccggggttgg
OVRT1_0134_F02.b : cgggccccggttttttaaaatatattgggtttggaagggggtgaagggtttcacaaaggg
SPL01_0002_H11.b :
OVRT1_0152_H12.b : gccccgggggaagaaaccaacggttgggccaaggcgcccaaagtttttttttaaaaaatt
OVRT1_0102_G05.b : cccatttggcccaggcgccatggttcttataaatttagggagggtttaaccgggttggga
KDN01_0072_A05.b : ggggaaaaccccagctgggccactggcggcctggcttccttaaaaatttatggattgttg
OVRT1_0116_A03.b : aaacccacttgtgcccagggccccatggttctttaaaatattaagggagggttgtacggg
ADR01_0066_E12.b : ctgggggaaaaaccccacctggggcccatggccccccggctttcttaaaaattttaatgg
ITT01_0093_F08.b : aaacccacctggccagtgcgcactgctttctcacaattaatgtctgctggaacagggttg
ADR01_0088_D04.b : tctgggnaagaccccacgcttggccacgtcgccactgcttccttnaaaatttcatgaatg
KDN01_0067_D11.b : gggtccgggggaaaaacccagctgtggccaatggcgcactggcttctttaanaattttaa
CLNT1_0112_G05.b : tatgaattttatccgggttggcaggccttcccataggggggggagaaaagtttgtgagaa
PCT01_0013_E03.b : actgggccttgccccctgctttcttaaaaatttatggatgttttaccgggtttgcaatgg
AMP01_0035_H04.b :
ADR01_0031_H08.b : ttcctgggggaaaaacccccctttggccactgccgccctggctttttttaaaaatttaat
AMP01_0055_F08.b :
SKNB1_0010_D02.b :
BFLT1_0088_D11.b : aggggctctggggaaaaaaccccaggtgtggcccattggcgcactgccttcctttaaaaa
ADR01_0054_C11.b : ggggttctggggaaaaaaccccacgctgggcccactggccccccgggctttctttagaaa
AMP01_0034_G08.b : gggttgggggggggcagggctaacaattgggaaaaaaaat
DCI01_0115_F06.b : cccctgcttcttaaaaattaggagtgtggaggggttgcagggctaaccaaagtgtgtgaa
DCI01_0111_B10.b : aaaacccacttgtgccatgccccaggcttcttaaaaattttttttatgtttgtacagggg
PCT01_0001_B08.b : agggccccggtctttttaaaaaataatggatttttttaaagggttggcaagggtttcacc
PST01_0073_H04.b : aagggggcctggggaaaacacccccgctgtgcccactggccccatggcctttcttctgaa
PST01_0016_F01.b : cctggggaaagacccacctgtgcccctgccgccactgccttcttcagcaatctcatggac
PST01_0031_B05.b : ggagaacccccgctgggccatggcgcccgtgcttctttaaaatttcctgattgttgtacc
OVRT1_0053_H03.b : acccagttgtgccatgccgcatgctttctttaaatttaatgaatgttgatcagggtttga
TCH01_0079_G12.b : aaactcaccccgccttagtttaaattggggtttgataaagcttcgttccaaaaaaaaaaa
AMP01_0075_G02.b : ttcttaaaattaaggaggtggagggggtgggagggcttacccacgggggagaaaaattat
SKNB1_0064_A01.b : aggggtcctggggaaaaaacccacccttgggcccctgcccccctggctttcctttaaaaa
OVRM1_0013_C11.b :
OVRM1_0183_C11.b :
PBL01_0074_E03.b : gtctggggaaaacccccgctgtgccactgccccatggcttcttcancatctcatgcatgc
LNG01_0062_E09.b : acccacctgggccattgccccatgctttcttaaaaattcactcctgcttgtacaggcttg
OVRT1_0050_D03.b : gaagaaaccaggttggccaatgccgcagtgctcctttaaattcaatgatgtttgaacagg
PTG01_0063_A11.b : gaggtttttttgagggggggggggccctccccccacaacggtgggggaaaaaaaattttt
ADR01_0015_C03.b : tgcccaactcccacaacttctttataaattattctgtttgttttacaggcgttacaaagc
BKFL1_0020_G05.b : ctttttaaaattctgggggtggtgggggtgggagggcttacccaagtggggggaaaaatg
DCI01_0100_D11.b : aggggtctcggggaaaaaccccccccttggccccccgc
OVRM1_0215_D06.b :
AMP01_0051_C04.b : cttttttcaattcatgaagttttaccgggtgtgctggcctacccccgtggggttggacaa
KDN01_0042_H03.b : tgggagaaaccccagctgtgcccacggcggcaatgtctttcttcgcaaatttactgcctg
LNG01_0031_H02.b : gtgggaaaggccaaaaaaatgaacttgaaatggggggttccctggggggggaaaaaaaaa
AMP01_0072_H01.b : aaaattagtgaaccttgaaccgggggggcatggcttaacacaccg
OVRM1_0033_A09.b :
OVRM1_0002_H03.b :
OVRM1_0094_D09.b :
OVRM1_0206_F10.b :
SMG01_0103_H07.b : aaccaagttggcccatggcccctgctttcttagaaatttcatggatggttgtaccgggtt
LNG01_0036_H08.b : gggaaggcccaaaaaaaaagaaaattgaaaatggggggggttcccccttgggggggggga
LNG01_0070_G03.b : cctgggaaaaacccaagctgggccaatgccccactggcttcctttaaaaaatccatgaaa
OVR01_0020_G04.b : agaatgactggatggggggtccttgggggaaaaaaaccccccccccttggggcccccact
OVRM1_0210_F02.b :
SKNB1_0008_C07.b : cctgg
SKNB1_0037_B01.b : TGGGTCCTGGGGAGAaaccnacgctgtgcccagggcggcactgctttcttcancaattta
DCI01_0016_H09.b : gttgaacagggtggcaggcttaccctcagggttgaaaaattttttagaaaaagggcttct
OVRT1_0020_B04.b : tccgggggaaaaccccagctgtgccactggcgcccctgctttctttaaaaatttcaatgg
DCI01_0037_C07.b : gcccctgcgcacgctttcttaaaattcatgaagttgtaacaggttggcaggcctaacaca
DCI01_0105_A03.b : GGGGTCCTGGGGAGAGACCCacgctgtgccactggcgccactgctttncttcagacatct
DCI01_0078_G10.b : GGGGTCCTGGGGAGAGACCCCACGCTGTGCCCACTGGCGCCACTGCCTTCCTTCAGCACA
BKFL1_0035_A11.b : GGGGTCCTGGGGAGAAACCCacgctgtgccactgcggcactgccttcttcanaaacttat
SKNB1_0015_C04.b : GGGGTCCTGGGGAGAGACCCCACGCTGTGCCCACTGCCGCCACTGCCTTCCTTCAGCACA
ADR01_0021_D09.b : GGGGTCCTGGGGAGAGAC*CCACGCTGTGCCCACTGCCGCCACTGGCTTTCTTCANCACA
TCH01_0091_A11.b : GGGGTCCTGGGGAGAGACCCCACGCTGTGCCCACTGCCGCCACTGCCTTCCTTCAGCACA
LNG01_0005_H01.b : GGGGTCCTGGGGAGAGACCCCACGCTGTGCCCACTGCCGCCACTGCCTTCCTTCAGCACA
CBLT1_0038_B08.b : GGGGTCCTGGGGAGAGACCCCACGCTGTGCCCACTGCCGCCACTGCCTTCCTTCAGCACA
SPLT1_0100_H02.b : GGGGTCCTGGGGAGAGACCCCACGCTGTGCCCACTGCCGCCACTGCCTTCCTTCAGCACA
ILNT1_0067_G12.b :
20110601C-007088 : TCTCACTGCACTGCTTGTAGCCAGGGCTTGGCACATGGCCTTAACCACACTAGCATGCAT
---------+---------+---------+---------+---------+---------+ 1280
HTMT1_0032_G04.b : ataccaatagggtgtggaacaaatgtttttagaaaaaaggggtcccccaacacaaaattt
DCI01_0030_F09.b :
SPLT1_0035_A03.b : accaaaaaaggtgggtgaaaaaaaatttttttagaaaaaaatggcgtccccaaacaacca
CBLT1_0022_A01.b : ttaaccacaaaggtgggtggaaaaaattatttttgaaaaaaagggggcctcccaccccaa
OVRM1_0030_F06.b :
SPL01_0075_B02.b :
ITT01_0095_D03.b : caacgctgtagaaaaaattcttgaagaagaggggctccccgacccaaattccttgtgacg
CBLT1_0072_B06.b : gaacatgcctaaccccatcttgttgttgaaccaaaattacttttagaaaaatagggggcc
ADR01_0043_F01.b : gatctatcttttacacacaaattgtgtggtaacaaaatttatttttaaaaaaaagagggc
SMG01_0075_G01.b : aaggggcccccacccaaaattctttttggggggggggttttaaaaaaagggttttttttt
SPL01_0051_G12.b :
OVR01_0009_B12.b :
DCI01_0036_G01.b :
OVRM1_0112_H04.b :
DCI01_0020_A05.b : ttttaattttaccccccccggggggnnccactgtgttttttgttttgctgttgt
AMP01_0026_F11.b :
AMP01_0046_C10.b :
MLN01_0077_F11.b : ttgtaccggggttggcattggcctttaccacctatggtggttggacacaaatgttgtttt
ADR01_0062_D01.b :
OVRM1_0199_B09.b :
OVR01_0062_D01.b :
ITT01_0021_B12.b : caaatttaggggaggg
UTR01_0095_F06.b :
HTMT1_0001_E03.b : aatggatgtttgtaaccggggttggacatggccttaccccctaatgggtggtagaacaaa
AMP01_0095_E05.b : aacccccccccccctcgtgtgtc
OVRM1_0193_A03.b :
OVRT1_0113_A10.b : atgttttttcccgggggtggaaagtgccttaaaccacttatggtggggggaaaaaaaatt
OVRM1_0126_C10.b :
KDN01_0033_G12.b : cagtgaatgtttgtacccaggcctgcccaagtgccttaaaccccttacttgcttgttgga
LVRM1_0176_A04.b :
OVRM1_0079_B03.b :
SPL01_0026_F05.b :
CBLT1_0020_A02.b : aaatttttttaaaaaaggggggcccccaacccaaaaatatcctgtggagggaggggtttg
OVR01_0095_C07.b :
OVRT1_0040_B12.b : ttgtacccggttggcaatggcctaaaccaatagggtgggtggaaaaaaatgttggttgaa
DCI01_0040_C09.b : aanatccgtccacaacaaaagtcactctgctatctccttctcttcg
BMWN1_0023_E06.b : gtggcaggggcttacccaatggttggtgaagcaaaagtttgtgtagaaaaagggggctcc
AMP01_0082_H09.b :
DCI01_0030_E04.b : caccaaattttttgttagaggatttaaaaaagtttttttcacaagctcttttttttatta
DCI01_0038_B03.b : aaaaacgttttttttgggaggttttttttttt
AMP01_0092_E11.b :
DCI01_0042_H03.b :
AMP01_0096_A12.b : ccccccg
AMP01_0079_C06.b : ccctaaccctttgtgggagacaaaaattt
AMP01_0041_C02.b :
DCI01_0099_H08.b :
DCI01_0094_E12.b :
AMP01_0094_G04.b : tccccaatcttgcctccccctccccctcgcc
AMP01_0095_H05.b : gggtgccctccctccccgccccccccccc
DCI01_0084_G07.b : ccccacctgggggaaaaaaaatttggagaagaaggtctcttccttctcctttt
OVRM1_0171_H11.b :
AMP01_0040_G04.b :
LNG01_0023_G12.b : aaaaaaacactgaaaaagaggatgggggcagccgatcgggggggggagggaaaaaaaaaa
ITT01_0085_B11.b : tggtctgtctttcaacaaatattacaggtacatgtatttaaaccgggactttgggaccat
OVRT1_0144_H03.b : accccaaggggggggagaaaaaaatttttttaaaaaaagggggccccctcccaaaaatat
SPL01_0058_E05.b :
SPL01_0056_C04.b :
DCI01_0085_H04.b : acacacaaggggggagaaaaaaattttttggaaaaaagggtctccataccaaaattccct
DCI01_0087_H02.b :
DCI01_0109_B06.b : agaaacgtatttctgggcgttcttacttataaatccccccaagccnnnttccnnnnaaag
DCI01_0002_B11.b : gagaggggtgtgccacggcctccaaccctgaggtgtgatagaaaaa
SPL01_0014_E09.b :
DCI01_0025_H04.b : agagggcttttctttttattaattttcccccacccggtgtgtgttacaaattttatatt
DCI01_0026_C12.b : cctaaaa
AMP01_0004_G06.b :
AMP01_0037_A08.b :
DCI01_0063_A03.b : ttt
HTMT1_0083_D05.b : taacgggggtgggaacaggcttatacccacatatggcggtgagacaaacatttcttttta
AMP01_0102_A06.b : cccgcccccttctctttcttttcaaaccccctcccccttcttccccggcgtgggc
OVRT1_0075_F04.b : gccttaacacctggtggggttgacaaaaatttttttaggaaaagggggtctccaaccaaa
AMP01_0036_A06.b :
AMP01_0061_G12.b :
DCI01_0011_E08.b : taccccaaaggggtggacaaattattttggaaaaaggggctccctctctaaattcttttt
KDN01_0003_A10.b : aaaaaaaaaaaaaaattttatnnaaaggggggggggggttatcccgccccccccccccac
PST01_0085_F04.b : tgaatggttgtacccgggtttggcaatggcttaaaccccatactgcttggtggaacaaat
PST01_0005_D11.b : tgaaggtttgtaacagggttgggcatggcctaaccccctaaagggtggttagacaaaaat
ADR01_0084_E10.b : tgaaatgtttgaaacagggttggccatgcctttacccactagctgcgtgttggacaaaat
OVRM1_0194_A03.b :
OVRM1_0004_H06.b :
OVRM1_0196_H04.b :
OVRM1_0056_A12.b :
OVRM1_0053_H08.b :
OVRM1_0085_E02.b :
OVRM1_0062_C08.b :
OVRM1_0186_H09.b :
OVRM1_0129_E08.b :
SPL01_0074_C01.b :
SPL01_0102_C02.b :
ADR01_0003_A08.b : caccaaaggggtgggaacaaaaattatttttaaaaaaagaggcttccccaattccaaaaa
SPL01_0034_B08.b :
SPL01_0089_A03.b :
SPL01_0003_G03.b :
UTR01_0088_C08.b :
SMG01_0038_D02.b : gctaaccctataggtggggagcaaaattttttttttaaaaaaagggggttccccaaccct
ITT01_0002_G08.b : tgccttaccccctactctgctgaccaaatttattttagaaaaaagggcgtccccaatccc
ITT01_0097_G08.b : ccaagggcttaacacctaatggtgctggaaaaaattgtttttagaaaaaaggggcctcct
OVRT1_0054_C01.b : tacaccaagtgggttgacaaaatatgttttaaaaaaggggcccctcaacccaaaaatcct
PBL01_0065_D04.b : gttggccatncttaacccctacatgcggcaggccaaaatttcttgtagaaaaaaagggct
OVRT1_0094_F02.b : ttgccagggcttaaccccaggtgttgtttgaacaatttttcttgtaaaaaaaagggggtt
OVR01_0100_A01.b :
ITT01_0081_C02.b : ccgggctggcaatggcctaacccctaaagctggtagaacaaaattttttttagaaaaaag
OVR01_0091_C02.b :
AMP01_0040_B02.b :
AMP01_0004_H04.b :
DCI01_0016_B01.b : taaaaaaaattttttgagaaaagagggccccccatacaaaaacctcctttgttcggaagt
DCI01_0091_E02.b : gggttaggcaaaaatatttttgaaaaaagggctccccacccaaaaaattctttgaaggaa
OVRT1_0069_F05.b : tttggcaggtcttaccactaattgggttagaacaaattgttttgaagaaaaggggccccc
DCI01_0029_G12.b :
DCI01_0026_C05.b : tttttagaggtcctttttttttagaactccccccacgcgggtgttnnnnggnnnnggatt
DCI01_0104_B09.b :
DCI01_0105_B09.b : aaaatctctttgggaggggttttaaaaaagttatttttaaggacgtctttattttt
AMP01_0081_E01.b :
AMP01_0065_H04.b : cctcttttttaattttttttt
AMP01_0092_G07.b :
AMP01_0084_H11.b :
AMP01_0081_C08.b : gc
SPL01_0060_F01.b :
OVRT1_0017_H05.b : aataaattctatgatcagagttttacatatatttgtctgatcatccttacattaacatga
OVRM1_0152_H06.b :
OVRM1_0192_A03.b :
OVRM1_0018_F04.b :
OVRM1_0215_H02.b :
OVRM1_0203_E02.b :
SPL01_0061_A03.b :
OVRM1_0186_E11.b :
OVRM1_0126_A08.b :
OVR01_0079_A04.b :
ADR01_0043_F12.b : tttacaaaatttactggatgtttgtaatacaagggtttggccaagggccttttacccact
OVRT1_0097_A07.b : gtttgtgacaaggggttgtgaaatggccttaacaccatagggtgggggtggaccaaaata
PCT01_0020_F06.b : actgccttaccccttaggttggtagacaaaatttattttagaaaaaaggggttccccaac
OVRT1_0134_F02.b : tgtggaaaaatattttttaaaaaaaggggccccccccccaaaaatttttgggaaagaagg
SPL01_0002_H11.b :
OVRT1_0152_H12.b : tagagaaaattttttacacggggttgggaaaaggttttacacacacaaaggggtgggtgg
OVRT1_0102_G05.b : tggcttacccacaggggtgttgagaaaaatgttttttggaaaaaagggggccccccaacc
KDN01_0072_A05.b : gaacaggcctggcctggcctaaccaactagctgctgctagacaaaacttcctttaggaaa
OVRT1_0116_A03.b : gtggacagtgcttacccccatagggtgtggaaaaaaatttttttggaaaaaagggggccc
ADR01_0066_E12.b : atgttttgtacccggggtgggactgggccctaaccccccaggggggggggggccaaaaat
ITT01_0093_F08.b : gacaggcttacccctaaatgctgctgaacaaatgtattttaggaaaaaggggctccccta
ADR01_0088_D04.b : nttgttaacggggttgcaattgccctaacccctagatgatggtagaccaaaatttctttt
KDN01_0067_D11.b : tgcaatgctcgaaccacggcttgcacaggtcctttaccacctaaaggtctgtatggacca
CLNT1_0112_G05.b : aaagggccccccaccaccaaatctcttgtgagaaagggttttttaaaaaaagggtatttt
PCT01_0013_E03.b : ctacccataaggggtttgagaaaaatttttttttaaaaaaagggcttccccaacccaaaa
AMP01_0035_H04.b :
ADR01_0031_H08.b : tgaggtttttaacaggggttggcaaatgccttaccacacaagtgggtgttggacaaaaat
AMP01_0055_F08.b :
SKNB1_0010_D02.b :
BFLT1_0088_D11.b : ttacgtggaatgtttgtaaccagggttgtgcaaggccttaaccccctaaggggggttggc
ADR01_0054_C11.b : atttaattgactggttgtaacccgggtttggcaaatggccttaactaactagctaggtgt
AMP01_0034_G08.b :
DCI01_0115_F06.b : caatgtttgtaagaaaagggcctctaactaaatcttttttgggagtgtttaaaaaaaggt
DCI01_0111_B10.b : tgtcaagtcttatccacagagggtgttaacaaaaattttttagaaaaaagggccctctcc
PCT01_0001_B08.b : cctaggggggtgagaacaaaaatgttttttaaaaaaaagggggtccccaaacccaaaaaa
PST01_0073_H04.b : catttcatatatattgtttgtacccaggcgttgtgacatggcccttatacaccctaactt
PST01_0016_F01.b : tgtttgtaccagggctggccatgggcttacccccctactggttgttagcacaaaatttac
PST01_0031_B05.b : gggttgggccaggcctacccacttacggtggtggacaaaattgcttttagaaaaaaaggg
OVRT1_0053_H03.b : aagggtttccccatgaggggtgagaaaaaattgtcttgttgaaaaaaggggctccccaac
TCH01_0079_G12.b : aaaaaggccccttttccaaattgagtccggcccctttaa
AMP01_0075_G02.b : tggaaaaaagggccccccccaaatttttttttgagggttaaaaaaaat
SKNB1_0064_A01.b : ttttatgtaatggttttaacccgggcttgcccatggcctta
OVRM1_0013_C11.b :
OVRM1_0183_C11.b :
PBL01_0074_E03.b : tgtaacagggctggcactggctaaccactacctgctgtagacaaaatgtactgtaggaaa
LNG01_0062_E09.b : acatgccttcacacaaatttcttctgaaaaaaattactttagaaaaaaaagggccttcca
OVRT1_0050_D03.b : tttggcatggcttacccctaggtttttagaacaaattttttgaaaaaaaaggggttcccc
PTG01_0063_A11.b : tgaaaaaaaagggcgcccctcccacaaaaaaatattttttgggggggggggggtgtgtaa
ADR01_0015_C03.b : tttacatctcattttttgcgtgaatataatattctattgaaaaatatggggtccttccat
BKFL1_0020_G05.b : tttgagaaaaagggctccccaccaaatttcttgtaggaggttgttaaaaaagttattttt
DCI01_0100_D11.b :
OVRM1_0215_D06.b :
AMP01_0051_C04.b : attattttggaaaaagggtctccctctcttcattt
KDN01_0042_H03.b : gntgtacccaggcttgcacatggctttaccccctanctgcttgctaggaccaaacattac
LNG01_0031_H02.b : acccccccccccccccttttttggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
AMP01_0072_H01.b :
OVRM1_0033_A09.b :
OVRM1_0002_H03.b :
OVRM1_0094_D09.b :
OVRM1_0206_F10.b :
SMG01_0103_H07.b : tgaaatggcttaccacataatggggttagaccaaaatgtatttaaggaaaaaaaaggccc
LNG01_0036_H08.b : aaaaaaaaaaaaccccccccc
LNG01_0070_G03.b : tgttttaaccagggttttccattgccctaaccccctaacaggtggtaggaccaaaatttc
OVR01_0020_G04.b : ggccccccccccttggcccttttccttttacccccacattttttttcctttttccctctc
OVRM1_0210_F02.b :
SKNB1_0008_C07.b :
SKNB1_0037_B01.b : atgcactgttgttaccgggcttggccaatggctaaccacctagctgcttgctggacccaa
DCI01_0016_H09.b : acccaaaatcccttttgggggggtttttaaaaaagggtttttttcagaggagttccctta
OVRT1_0020_B04.b : atggtttgaacagggttgggcctggccttaaccactaacgtgctgttagacaaaattgta
DCI01_0037_C07.b : aagggggttaaaaaaatttttttagaaaaagggcctcccaaccccaaattccttttgggc
DCI01_0105_A03.b : caatgaactgttgtaccagggctggccctggccttaccccctaactgcatgctgaaccaa
DCI01_0078_G10.b : TCTCACTGCACTGCTTGTAACCAGGCCTTGGCACATGGgccttaaccccctaccttggat
BKFL1_0035_A11.b : tgcatggttgtacccgggttgccacatgccttaccacttaacgtgctgctagaacaaaat
SKNB1_0015_C04.b : TCTCACTGCACTGCTTGTAGCCAGGGCTTGGCACATGGCCTTAACCACACTAGCATGCAT
ADR01_0021_D09.b : TCTCACTGCACTGCTTGTAGCCAGGGCTTGGCACATGGCCTTAACCACACTAGCATGCAT
TCH01_0091_A11.b : TCTCACTGCACTGCTTGTAGCCAGGGCTTGGCACATGGCCTTTACCACACTAGCATGCAT
LNG01_0005_H01.b : TCTCACTGCACTGCTTGTAGCCAGGGCTTGGCACATGGCCTTAACCACACTAGCATGCAT
CBLT1_0038_B08.b : TCTCACTGCACTGCTTGTAGCCAGGGCTTGGCACATGGCCTTAACCACACTAGCATGCAT
SPLT1_0100_H02.b : TCTCACTGCACTGCTTGTAGCCAGGGCTTGGCACATGGCCTTAACCACACTAGCATGCAT
ILNT1_0067_G12.b :
20110601C-007088 : GCTAGGACCAAAACATGTACGTTGTAGGAGAAAGTAGTGGTGCTTCTCTCTGATCTCCAT
---------+---------+---------+---------+---------+---------+ 1340
HTMT1_0032_G04.b : tttgggagagagggtctgttcaaaaacgtgtattttttttagggaaggtctcttatactt
DCI01_0030_F09.b :
SPLT1_0035_A03.b : aaaaatctttttgaagaaagaagaaaattaa
CBLT1_0022_A01.b : aaaacttttttgtgtgacagagggtctttttaaaaaaagagggtttttttcttgaaa
OVRM1_0030_F06.b :
SPL01_0075_B02.b :
ITT01_0095_D03.b : gaggtttgttaaaactcgtttattcttaagcagctttctttaactcttttaaaccctcca
CBLT1_0072_B06.b : tcccgaatcaaaaaatctccttttgtgaacgaaggtccttggtcaaaaaaaacggaattt
ADR01_0043_F01.b : cctccacataccacaaatatttctttgtggtagaaggcttcttgttataac
SMG01_0075_G01.b : aggaacgtttcctaattttttataacctcccggccccatttcgtgtttttt
SPL01_0051_G12.b :
OVR01_0009_B12.b :
DCI01_0036_G01.b :
OVRM1_0112_H04.b :
DCI01_0020_A05.b :
AMP01_0026_F11.b :
AMP01_0046_C10.b :
MLN01_0077_F11.b : aa
ADR01_0062_D01.b :
OVRM1_0199_B09.b :
OVR01_0062_D01.b :
ITT01_0021_B12.b :
UTR01_0095_F06.b :
HTMT1_0001_E03.b : aatttctttttagaaaaaaagggggcctcccgaaacccaaaaattttccttgtggaacgg
AMP01_0095_E05.b :
OVRM1_0193_A03.b :
OVRT1_0113_A10.b : tttttaaaaaaaaagggggcccccccaacacacaaaaaattctctggttggggagaggat
OVRM1_0126_C10.b :
KDN01_0033_G12.b : ccaaaaatgtccctttaagaaaaaattagggggcttcccctaacc
LVRM1_0176_A04.b :
OVRM1_0079_B03.b :
SPL01_0026_F05.b :
CBLT1_0020_A02.b : ttaaaaaaagcgggtttttttttagaaaaacgtttctcttaaaccttta
OVR01_0095_C07.b :
OVRT1_0040_B12.b : aaaaagggg
DCI01_0040_C09.b :
BMWN1_0023_E06.b : caaaccaaaaaatttcttgggggggggggttttaaaaaaaacggttttttttttgagggg
AMP01_0082_H09.b :
DCI01_0030_E04.b : attctccccacaccggtgtttctccaaaattaaaatt
DCI01_0038_B03.b :
AMP01_0092_E11.b :
DCI01_0042_H03.b :
AMP01_0096_A12.b :
AMP01_0079_C06.b :
AMP01_0041_C02.b :
DCI01_0099_H08.b :
DCI01_0094_E12.b :
AMP01_0094_G04.b :
AMP01_0095_H05.b :
DCI01_0084_G07.b :
OVRM1_0171_H11.b :
AMP01_0040_G04.b :
LNG01_0023_G12.b : a
ITT01_0085_B11.b : ggcccttataacaaccaaaatggttgtgcctgaaacacaaacatgttcttgtgtggacga
OVRT1_0144_H03.b : tctttgtgggaaggggtttttaataaaaaaagattttttctaggaaagagcgctaac
SPL01_0058_E05.b :
SPL01_0056_C04.b :
DCI01_0085_H04.b : tgtgaagag
DCI01_0087_H02.b :
DCI01_0109_B06.b : attaaacgactggagtgcagaccannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnna
DCI01_0002_B11.b :
SPL01_0014_E09.b :
DCI01_0025_H04.b :
DCI01_0026_C12.b :
AMP01_0004_G06.b :
AMP01_0037_A08.b :
DCI01_0063_A03.b :
HTMT1_0083_D05.b : gaaaaaagaggggcttctctcaaaccccaaaatattcttctgtggngcccagaggatctt
AMP01_0102_A06.b :
OVRT1_0075_F04.b : aattcctttgggacagggtgtttttcaaaaaaccgtatttttcttaaggacactccccta
AMP01_0036_A06.b :
AMP01_0061_G12.b :
DCI01_0011_E08.b : gtgggggttgtttaaaaaagtattatttttttagaggctttttttttttttatatttcct
KDN01_0003_A10.b : ccggggtgggggaagaaaaaaaatatactttaagaaaaaaagagggcgctttgtttttct
PST01_0085_F04.b : tgtacttttaaaaaaaaaggggctctctccgaacccattaaatttcctttgtggacacga
PST01_0005_D11.b : taatttttaaaaaaaaaggggggctcctctaatcactaaaaatttcctttgtgtgaagga
ADR01_0084_E10.b : gtacttttagagaaaaaggggctttcctcaaaccacaaaatttccttttgggaacggaag
OVRM1_0194_A03.b :
OVRM1_0004_H06.b :
OVRM1_0196_H04.b :
OVRM1_0056_A12.b :
OVRM1_0053_H08.b :
OVRM1_0085_E02.b :
OVRM1_0062_C08.b :
OVRM1_0186_H09.b :
OVRM1_0129_E08.b :
SPL01_0074_C01.b :
SPL01_0102_C02.b :
ADR01_0003_A08.b : ttcttttttggggaggtcttttctcaaaaaaagggctatttttctttagggcagctgtcc
SPL01_0034_B08.b :
SPL01_0089_A03.b :
SPL01_0003_G03.b :
UTR01_0088_C08.b :
SMG01_0038_D02.b : aaaattttcctctggggacgggtgttttgttaaaaaaaactggatttttttttttaaaga
ITT01_0002_G08.b : aaaactttcttttgtgacgaaggcttttttaaaaaaactggtttttttccttaagggagg
ITT01_0097_G08.b : cgatcccaaaatttctctggggaccagaggtcttgtcaaacaaaccgattttatttttta
OVRT1_0054_C01.b : tttgaaagggggttgtttaaaaaaagggtttttttttagaaaagttctttaattttttta
PBL01_0065_D04.b : tcctcactcccaaaatttcctttggaaacgagggcttgttctaaaaagctgttattaatt
OVRT1_0094_F02.b : ccccgaccccaaaaatttctctttgagagagaggttttttcaaaaaacgggatttatttt
OVR01_0100_A01.b :
ITT01_0081_C02.b : gggctcccccaccccaaaacttcctttgagaacgagggtttttttaaacaaaacggtttt
OVR01_0091_C02.b :
AMP01_0040_B02.b :
AMP01_0004_H04.b :
DCI01_0016_B01.b : ttttttacaaaaccgtgtattttt
DCI01_0091_E02.b : aatatataaaaa
OVRT1_0069_F05.b : tgaaccacaaatttccttttggaagaggagcttttacaaaaaacggtattttttctaaag
DCI01_0029_G12.b :
DCI01_0026_C05.b : caaaacccttggccaggacaatc
DCI01_0104_B09.b :
DCI01_0105_B09.b :
AMP01_0081_E01.b :
AMP01_0065_H04.b :
AMP01_0092_G07.b :
AMP01_0084_H11.b :
AMP01_0081_C08.b :
SPL01_0060_F01.b :
OVRT1_0017_H05.b : taactactatatgcattctatatatagaacattgatgtactcttgtaacattgaaacatt
OVRM1_0152_H06.b :
OVRM1_0192_A03.b :
OVRM1_0018_F04.b :
OVRM1_0215_H02.b :
OVRM1_0203_E02.b :
SPL01_0061_A03.b :
OVRM1_0186_E11.b :
OVRM1_0126_A08.b :
OVR01_0079_A04.b :
ADR01_0043_F12.b : aaatgtggtgctaaaaa
OVRT1_0097_A07.b : tttcttgtgaaaaaaa
PCT01_0020_F06.b : tccaaaaatttcctgtgggaacagagggttttttaaaaaaaacgggtttttttctttaaa
OVRT1_0134_F02.b : gtgtaaaaaaaaggtttttttttttggaagggggctcctcttttttataaatcagcgcca
SPL01_0002_H11.b :
OVRT1_0152_H12.b : gaaaaaaaatttttttttggagaaaaa
OVRT1_0102_G05.b : caaaactttcttttggaggaaggggttgttaaaaaaagcggattttttcttagagagacg
KDN01_0072_A05.b : aaggggcctccccgaacccctaaaattcccttgggaaacgaaggcttgttcaaaaacaac
OVRT1_0116_A03.b : ccaacacccaaaaatctcctgtgagaaggaggtgtgttaaaaaaaagggtttattttctc
ADR01_0066_E12.b : gttgctttta
ITT01_0093_F08.b : cccataaatttcctttgaaagcggggctttgttaaaaaaccggtttattctttaagggac
ADR01_0088_D04.b : agaaaaaaggggcttccccaacccaaaaaatttcttttgtgggcgaggccttggttacaa
KDN01_0067_D11.b : aaaattttcttgtaaaaaaaaaaaggggcgttccctgaaaccccaaaaatcttccctttg
CLNT1_0112_G05.b : tttaaagaaggttcttttaacttttatagaaactcgggggcccaatgccgggttgttcca
PCT01_0013_E03.b : attctcttgtgaaagggggttttttaaaaaaaaggtttttttttttaaagaaagctttcc
AMP01_0035_H04.b :
ADR01_0031_H08.b : taatttatagaaaaaagggggtctccccaactcctaaaaaattcctttgtggggggaggg
AMP01_0055_F08.b :
SKNB1_0010_D02.b :
BFLT1_0088_D11.b : aaaaaatttcttttgtagaaaaaaaaggggcctccccacaccccctaaaaatttcctttt
ADR01_0054_C11.b : ctgagacaaaaaattttattttttaagaaaaatatgtgtgttctt
AMP01_0034_G08.b :
DCI01_0115_F06.b : tttttttgggagttttttaattttttattactcccccccaccccggggtttcccnnnnnn
DCI01_0111_B10.b : acccaaaaaattcttgggaaggaagaatttt
PCT01_0001_B08.b : ttttttttgggaggagggggtttttttaaaaaaaacgtgttttttttttttaaaacaggc
PST01_0073_H04.b : ggggtgtggagcaaaaaatttattttgtagagaaaaaaaaggggcttctccttaatcccc
PST01_0016_F01.b : tttatggaaaaaagggggctctctcgatccattaaatttcctttgtttaacggagggctt
PST01_0031_B05.b : gtccccgaaccctaaatttccctgtggaacggagggcttttacaaaaacacgggtttttt
OVRT1_0053_H03.b : caaaaaattcttttgttggaggagggtttttaaaaaaaggggtttttttttttaaggaag
TCH01_0079_G12.b :
AMP01_0075_G02.b :
SKNB1_0064_A01.b :
OVRM1_0013_C11.b :
OVRM1_0183_C11.b :
PBL01_0074_E03.b : aaggggctccccgatcccttaaatttcctggtgtaacgaagccttgttctaacaaacgga
LNG01_0062_E09.b : aaccaaaaaatttttttgtgaagaaagctcttgtttaacaaaacgattatattttctaaa
OVRT1_0050_D03.b : gaacccaaaatttcctttgggacggggcttttccaaaaattgatttttttttaaggagcc
PTG01_0063_A11.b : aaaaaaaaaagattttttttttttgaaaggggcgcgccccaaacntttttattaaaaaac
ADR01_0015_C03.b : cccataaaacttttctgtggtcagcgggtgtatgttctcacaaataacttatcctcttcc
BKFL1_0020_G05.b : gggagttcttttctttataattctcccccccccgggnnncccnnnnnnnnnntttaaaaa
DCI01_0100_D11.b :
OVRM1_0215_D06.b :
AMP01_0051_C04.b :
KDN01_0042_H03.b : cttgtagaaaaagaaggggcctccccgaaatccataaaactttcctttgttgaaacggaa
LNG01_0031_H02.b : nnnnnnnnnnnnnnn
AMP01_0072_H01.b :
OVRM1_0033_A09.b :
OVRM1_0002_H03.b :
OVRM1_0094_D09.b :
OVRM1_0206_F10.b :
SMG01_0103_H07.b : ccgcaccccaaaaatttcctttgtagacgggggcctttttcaaaaaaactgttttttttt
LNG01_0036_H08.b :
LNG01_0070_G03.b : ttttaagaaaaaaggggtcttccctaaccccataaaatctccctttgtgaaacggagggg
OVR01_0020_G04.b : ggttcttttttttaaaaccccccggggggggccttttttg
OVRM1_0210_F02.b :
SKNB1_0008_C07.b :
SKNB1_0037_B01.b : aatttacttgtaagaaaaaaagggggctccccctaatcccctaaaa
DCI01_0016_H09.b : acttttttaaaaccccccccccctcgt
OVRT1_0020_B04.b : tttttagaaaagtagggggctctcttaatcccaaaaaacttccttgtggtgacgcagggt
DCI01_0037_C07.b : ggaggttttttaacaaacgcgtttttttcttaagaaagttccctttacctttaatgaaac
DCI01_0105_A03.b : actttacttttggaaaaaanggggcctcccctcaatccctaaaacttccttttggggacc
DCI01_0078_G10.b : gctaggacaaaaacttgtccttttaggagaaaagaagggggccttcctccgactccccat
BKFL1_0035_A11.b : tgtacttttaagaaaaaaagggggcctccccgatccccaaaaactttccttggtgggaac
SKNB1_0015_C04.b : GCTANGACCCAAACATGTACGTTGTANGAGAAAGTAGTGGTGCTTCTCTCTGATCTCCAT
ADR01_0021_D09.b : GCTANNGACCAAACATGTACGTTtgtagaaaaagtatggtgcctctccctgatctcattt
TCH01_0091_A11.b : GCTAGGACCAAAACATGTACGTTGTAGGAGAAAGTAGTGGTGCTTCTCTCTGATCTCCAT
LNG01_0005_H01.b : GCTAGGACCAAAACATGTACGTTGTAGGAGAAAGTAGTGGTGCTTCTCTCTGATCTCCAT
CBLT1_0038_B08.b : GCTAGGACCAAAACATGTACGTTGTAGGAGAAAGTAGTGGTGCTTCTCTCTGATCTCCAT
SPLT1_0100_H02.b : GCTAGGACCAAAACATGTACGTTGTAGGAGAAAGTAGTGGTGCTTCTCTCTGATCTCCAT
ILNT1_0067_G12.b :
20110601C-007088 : TAAGATCTTTCTCTTTGTTGTAGTACTGAAGTGTACTTATGTTACTAAGATTAAAATCTG
---------+---------+---------+---------+---------+---------+ 1400
HTMT1_0032_G04.b : ttttaagcaattcgcgagccccagtccggggttttgtctaa
DCI01_0030_F09.b :
SPLT1_0035_A03.b :
CBLT1_0022_A01.b :
OVRM1_0030_F06.b :
SPL01_0075_B02.b :
ITT01_0095_D03.b : cgcccagaccgggtttttctcaccaaaggtttggagaacttctaaaaannggcnnnnggc
CBLT1_0072_B06.b : tttttcttaaagagaacgtttccctttataacccttttatttgaacctatctcttcgcac
ADR01_0043_F01.b :
SMG01_0075_G01.b :
SPL01_0051_G12.b :
OVR01_0009_B12.b :
DCI01_0036_G01.b :
OVRM1_0112_H04.b :
DCI01_0020_A05.b :
AMP01_0026_F11.b :
AMP01_0046_C10.b :
MLN01_0077_F11.b :
ADR01_0062_D01.b :
OVRM1_0199_B09.b :
OVR01_0062_D01.b :
ITT01_0021_B12.b :
UTR01_0095_F06.b :
HTMT1_0001_E03.b : agggctctttgtccaaaaaacccggaattttttctcttaagagaaggctctccctttaaa
AMP01_0095_E05.b :
OVRM1_0193_A03.b :
OVRT1_0113_A10.b : gtgtttaaaaaaaaaggggaatttttcttagaaagagagttcttttttt
OVRM1_0126_C10.b :
KDN01_0033_G12.b :
LVRM1_0176_A04.b :
OVRM1_0079_B03.b :
SPL01_0026_F05.b :
CBLT1_0020_A02.b :
OVR01_0095_C07.b :
OVRT1_0040_B12.b :
DCI01_0040_C09.b :
BMWN1_0023_E06.b : gcgttctttaaccttttataaaactctctgaggcccaagacgcggggtttgtctcacngg
AMP01_0082_H09.b :
DCI01_0030_E04.b :
DCI01_0038_B03.b :
AMP01_0092_E11.b :
DCI01_0042_H03.b :
AMP01_0096_A12.b :
AMP01_0079_C06.b :
AMP01_0041_C02.b :
DCI01_0099_H08.b :
DCI01_0094_E12.b :
AMP01_0094_G04.b :
AMP01_0095_H05.b :
DCI01_0084_G07.b :
OVRM1_0171_H11.b :
AMP01_0040_G04.b :
LNG01_0023_G12.b :
ITT01_0085_B11.b : aaaatattcg
OVRT1_0144_H03.b :
SPL01_0058_E05.b :
SPL01_0056_C04.b :
DCI01_0085_H04.b :
DCI01_0087_H02.b :
DCI01_0109_B06.b :
DCI01_0002_B11.b :
SPL01_0014_E09.b :
DCI01_0025_H04.b :
DCI01_0026_C12.b :
AMP01_0004_G06.b :
AMP01_0037_A08.b :
DCI01_0063_A03.b :
HTMT1_0083_D05.b : tgttcacaataaacgcggcctatattttctttaagagaagagttcttccctataaactct
AMP01_0102_A06.b :
OVRT1_0075_F04.b : acccttttatgaaaactctacaagccccaggccggggtttttccacagaaggttctaaga
AMP01_0036_A06.b :
AMP01_0061_G12.b :
DCI01_0011_E08.b : ccccca
KDN01_0003_A10.b : ccttctttttttatttt
PST01_0085_F04.b : agggactttttcaaaacaaaccggaatttatattctcttaagcacaacggtttccctttt
PST01_0005_D11.b : gggcttttgttctaaaaaaaacgggcttttttttctttaagggaaagttt
ADR01_0084_E10.b : gtcttgttaaaacaaacgggatttttttttctaaaggcaacgctttctt
OVRM1_0194_A03.b :
OVRM1_0004_H06.b :
OVRM1_0196_H04.b :
OVRM1_0056_A12.b :
OVRM1_0053_H08.b :
OVRM1_0085_E02.b :
OVRM1_0062_C08.b :
OVRM1_0186_H09.b :
OVRM1_0129_E08.b :
SPL01_0074_C01.b :
SPL01_0102_C02.b :
ADR01_0003_A08.b : cttaacctttttatatagacaatccttgaccgccccatgtgtcg
SPL01_0034_B08.b :
SPL01_0089_A03.b :
SPL01_0003_G03.b :
UTR01_0088_C08.b :
SMG01_0038_D02.b : aggggtttcccttaaaaccttttttt
ITT01_0002_G08.b : ttttctttaaattttttt
ITT01_0097_G08.b : aaggaacctttccttataaccctcttattaacacttctcgggccggcccgtgtc
OVRT1_0054_C01.b : t
PBL01_0065_D04.b : tcttaagccacgtttccctttaactctttaagtgacacatcttcgacacccccaagtccc
OVRT1_0094_F02.b : cttaaggaaggtttccttttaacctttaaagaacatccttggccggcccat
OVR01_0100_A01.b :
ITT01_0081_C02.b : atttcttagaggaagcgttcccttaaaccttttttataaaatcctttcaccgcccatgtc
OVR01_0091_C02.b :
AMP01_0040_B02.b :
AMP01_0004_H04.b :
DCI01_0016_B01.b :
DCI01_0091_E02.b :
OVRT1_0069_F05.b : aaggttccctttaccttttaataaactctcttcacccccaatggccggggttgtgtccac
DCI01_0029_G12.b :
DCI01_0026_C05.b :
DCI01_0104_B09.b :
DCI01_0105_B09.b :
AMP01_0081_E01.b :
AMP01_0065_H04.b :
AMP01_0092_G07.b :
AMP01_0084_H11.b :
AMP01_0081_C08.b :
SPL01_0060_F01.b :
OVRT1_0017_H05.b : atgtatttgtatgcagtagaatagcttaatcatcacgttacctttattctctcatagcta
OVRM1_0152_H06.b :
OVRM1_0192_A03.b :
OVRM1_0018_F04.b :
OVRM1_0215_H02.b :
OVRM1_0203_E02.b :
SPL01_0061_A03.b :
OVRM1_0186_E11.b :
OVRM1_0126_A08.b :
OVR01_0079_A04.b :
ADR01_0043_F12.b :
OVRT1_0097_A07.b :
PCT01_0020_F06.b : aaagctttcctttaagctcttttataaaaacctctccccccaccccaattgcccgggtgg
OVRT1_0134_F02.b : accccgggttgtttaaagttaagaagaaaaataaaaaac
SPL01_0002_H11.b :
OVRT1_0152_H12.b :
OVRT1_0102_G05.b : cttctcttaatctcttatttacaacctccccacgcccaagcggggggttgttccacaaaa
KDN01_0072_A05.b : gggtatttatttccttaaggcaagcgtttccttttaacctcttttatggaccttccttgg
OVRT1_0116_A03.b : tagggaagtgttcctttaacccttttattagaaactcctcccccccccatgcgcggggtt
ADR01_0066_E12.b :
ITT01_0093_F08.b : ggtgcctttaaccctttatatagacactctcggccggccattatcccgtgtttttttcca
ADR01_0088_D04.b : aaaacgggttttattttccttaagcaggttttccttttaacttt
KDN01_0067_D11.b : ttaaaacgaagggccttgttcc
CLNT1_0112_G05.b : acaaaaggttgggggttttttaaaaaaaactctgccccccacccccctt
PCT01_0013_E03.b : tttagcccttttattacacatttttgcaaccccccaatacccgggggttttttctcaat
AMP01_0035_H04.b :
ADR01_0031_H08.b : gcttgttttaaaaaaacgggaattattttcttaagcaaggcttcctctttaatccttttt
AMP01_0055_F08.b :
SKNB1_0010_D02.b :
BFLT1_0088_D11.b : ttgaacagagaggcttttttcaaaaaaaaacgggcaattttttc
ADR01_0054_C11.b :
AMP01_0034_G08.b :
DCI01_0115_F06.b : nnnaaattaaaaaaccccttggggaacttagacgtacactacnnnt
DCI01_0111_B10.b :
PCT01_0001_B08.b : gtccctttaaaacttttataaaaaaaactcctccacacgcccaaaaggccggggtgtttt
PST01_0073_H04.b : atagaaattttcccttttttgtgaacaggaggattctgtgttccaaaatataacccggac
PST01_0016_F01.b : tttttaaaacaaatggaatttttttttcttaaaggcaggccttgcccttaaaccctttta
PST01_0031_B05.b : ttcttagggcagggtttgcctttagatttttataattgaccttctcttggaccgcccaaa
OVRT1_0053_H03.b : cttttccctttaccctttttatagccacttccccgt
TCH01_0079_G12.b :
AMP01_0075_G02.b :
SKNB1_0064_A01.b :
OVRM1_0013_C11.b :
OVRM1_0183_C11.b :
PBL01_0074_E03.b : tcttatttctttaagcagcctttccttaacctcttttattgacctttcttccacccccat
LNG01_0062_E09.b : ggacagtttgcctatatttctttatagtaacatctccccct
OVRT1_0050_D03.b : gttcctttgccttttttataatctctcgccccccaagagcggggttttttcccaaaatgg
PTG01_0063_A11.b : cccccctcgcccccgt
ADR01_0015_C03.b : ttanatcaagctattcttttatcattttttaatgtactatattctcacctccttaatctt
BKFL1_0020_G05.b : agctttcgggttgtacagatcgannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0100_D11.b :
OVRM1_0215_D06.b :
AMP01_0051_C04.b :
KDN01_0042_H03.b : ggtacttgtttcaaacaaaaccgggattttattttctttaagagccacgcgtttcccttt
LNG01_0031_H02.b :
AMP01_0072_H01.b :
OVRM1_0033_A09.b :
OVRM1_0002_H03.b :
OVRM1_0094_D09.b :
OVRM1_0206_F10.b :
SMG01_0103_H07.b : cctagagaacaggttccctttaaacttttttaagtacacttcctcgcccccccaatgacc
LNG01_0036_H08.b :
LNG01_0070_G03.b : ctttttttaaaaaaaaccggcttttattttctttaaagcgaaagcctttcccttttaact
OVR01_0020_G04.b :
OVRM1_0210_F02.b :
SKNB1_0008_C07.b :
SKNB1_0037_B01.b :
DCI01_0016_H09.b :
OVRT1_0020_B04.b : ctttgttcaaaaaaaaccgggcttatttcccttaagagcacgtgtttccctttaactctt
DCI01_0037_C07.b : cctggccggccatggcct
DCI01_0105_A03.b : gagggcttttttttaaacaaaaccggttttatttccctttagggcaagcgttccctttaa
DCI01_0078_G10.b : aaaactttctccttgtgtgaaacggaagggacttgtgtcacaaaacaaaaccgggaccat
BKFL1_0035_A11.b : ggaggggctttgtttcaaaaaaaatcgggacttttttttcctttaaggcgaagggttgcc
SKNB1_0015_C04.b : TAAGATCTTTCTCTTTGTTGTAGTACTGAAGTGTACTTATGTTTACTAGACTAAAACCGG
ADR01_0021_D09.b : agatctttccctttgttgaatactgaaaggtacttatttaactaaaattaaaatccggat
TCH01_0091_A11.b : TAAGATCTTTCTCTTTGTTGTAGTACTGAAGTGTACTTATGTTACTAAGACTAAAATCTG
LNG01_0005_H01.b : TAAGATCTTTCTCTTTTGTGTAGTACTGAAGTGTACTTATGTTACTAAGACTNAAATCTG
CBLT1_0038_B08.b : TAAGATCTTTCTCTTTGTTGTAGTACTGAAGTGTACTTATGTTACTAAGATTAAAATCTG
SPLT1_0100_H02.b : TAAGATCTTTCTCTTTGTTGTAGTACTGAAGTGTACTTATGTTACTAAGATTAAAATCTG
ILNT1_0067_G12.b : nnnaagacggtacgagg
20110601C-007088 : GATCATTTATATTTTCCTTTAAGAGGTCAGACTGCTTTTAGCCTATTTTAAAAGCTTCAT
---------+---------+---------+---------+---------+---------+ 1460
HTMT1_0032_G04.b :
DCI01_0030_F09.b :
SPLT1_0035_A03.b :
CBLT1_0022_A01.b :
OVRM1_0030_F06.b :
SPL01_0075_B02.b :
ITT01_0095_D03.b : ccctagtaacccggggaggtttta
CBLT1_0072_B06.b : cccccattggcccggggttgttttttccacaaacgatggtgtctcaaagg
ADR01_0043_F01.b :
SMG01_0075_G01.b :
SPL01_0051_G12.b :
OVR01_0009_B12.b :
DCI01_0036_G01.b :
OVRM1_0112_H04.b :
DCI01_0020_A05.b :
AMP01_0026_F11.b :
AMP01_0046_C10.b :
MLN01_0077_F11.b :
ADR01_0062_D01.b :
OVRM1_0199_B09.b :
OVR01_0062_D01.b :
ITT01_0021_B12.b :
UTR01_0095_F06.b :
HTMT1_0001_E03.b : cttttttaaagggacatttcttcgcgagcgccctatgtc
AMP01_0095_E05.b :
OVRM1_0193_A03.b :
OVRT1_0113_A10.b :
OVRM1_0126_C10.b :
KDN01_0033_G12.b :
LVRM1_0176_A04.b :
OVRM1_0079_B03.b :
SPL01_0026_F05.b :
CBLT1_0020_A02.b :
OVR01_0095_C07.b :
OVRT1_0040_B12.b :
DCI01_0040_C09.b :
BMWN1_0023_E06.b : ttgtttttgggtctcttaaaaaaaaaaaaggggtggttgtgttggtgtgttgtggtgg
AMP01_0082_H09.b :
DCI01_0030_E04.b :
DCI01_0038_B03.b :
AMP01_0092_E11.b :
DCI01_0042_H03.b :
AMP01_0096_A12.b :
AMP01_0079_C06.b :
AMP01_0041_C02.b :
DCI01_0099_H08.b :
DCI01_0094_E12.b :
AMP01_0094_G04.b :
AMP01_0095_H05.b :
DCI01_0084_G07.b :
OVRM1_0171_H11.b :
AMP01_0040_G04.b :
LNG01_0023_G12.b :
ITT01_0085_B11.b :
OVRT1_0144_H03.b :
SPL01_0058_E05.b :
SPL01_0056_C04.b :
DCI01_0085_H04.b :
DCI01_0087_H02.b :
DCI01_0109_B06.b :
DCI01_0002_B11.b :
SPL01_0014_E09.b :
DCI01_0025_H04.b :
DCI01_0026_C12.b :
AMP01_0004_G06.b :
AMP01_0037_A08.b :
DCI01_0063_A03.b :
HTMT1_0083_D05.b : tattataaataaaaccttcn
AMP01_0102_A06.b :
OVRT1_0075_F04.b : atttccaaagaacctgcccgccta
AMP01_0036_A06.b :
AMP01_0061_G12.b :
DCI01_0011_E08.b :
KDN01_0003_A10.b :
PST01_0085_F04.b : gacgcttttttatatgaacaattcttttggaccgccccaattggccctgg
PST01_0005_D11.b :
ADR01_0084_E10.b :
OVRM1_0194_A03.b :
OVRM1_0004_H06.b :
OVRM1_0196_H04.b :
OVRM1_0056_A12.b :
OVRM1_0053_H08.b :
OVRM1_0085_E02.b :
OVRM1_0062_C08.b :
OVRM1_0186_H09.b :
OVRM1_0129_E08.b :
SPL01_0074_C01.b :
SPL01_0102_C02.b :
ADR01_0003_A08.b :
SPL01_0034_B08.b :
SPL01_0089_A03.b :
SPL01_0003_G03.b :
UTR01_0088_C08.b :
SMG01_0038_D02.b :
ITT01_0002_G08.b :
ITT01_0097_G08.b :
OVRT1_0054_C01.b :
PBL01_0065_D04.b : ggattgtattgctcacaaaaaaagggtcaaaaggaaaatttttaaaaagagcctggggcc
OVRT1_0094_F02.b :
OVR01_0100_A01.b :
ITT01_0081_C02.b : ccgggttttttt
OVR01_0091_C02.b :
AMP01_0040_B02.b :
AMP01_0004_H04.b :
DCI01_0016_B01.b :
DCI01_0091_E02.b :
OVRT1_0069_F05.b : agaagggttaagagattttataaaaaanctcccggggccaaacagaaagaaaaagaaa
DCI01_0029_G12.b :
DCI01_0026_C05.b :
DCI01_0104_B09.b :
DCI01_0105_B09.b :
AMP01_0081_E01.b :
AMP01_0065_H04.b :
AMP01_0092_G07.b :
AMP01_0084_H11.b :
AMP01_0081_C08.b :
SPL01_0060_F01.b :
OVRT1_0017_H05.b : ataatattctatgtctgatatcatattata
OVRM1_0152_H06.b :
OVRM1_0192_A03.b :
OVRM1_0018_F04.b :
OVRM1_0215_H02.b :
OVRM1_0203_E02.b :
SPL01_0061_A03.b :
OVRM1_0186_E11.b :
OVRM1_0126_A08.b :
OVR01_0079_A04.b :
ADR01_0043_F12.b :
OVRT1_0097_A07.b :
PCT01_0020_F06.b : ttttctccaccacaaaaggtttaaaggagatttcctaaaaaaaggggggggaaaccnnng
OVRT1_0134_F02.b :
SPL01_0002_H11.b :
OVRT1_0152_H12.b :
OVRT1_0102_G05.b : ggtgtaaagaatctccaaac
KDN01_0072_A05.b : caccgcccaattacccggggtttctttctccaaccgcaatggtgtcaaatggg
OVRT1_0116_A03.b : gtttccaacaaaggtgtctaggaat
ADR01_0066_E12.b :
ITT01_0093_F08.b : aaccaaggggttaaaaggattctctcaaaaaaccgcccccccccccccnnnnnnnnnnnn
ADR01_0088_D04.b :
KDN01_0067_D11.b :
CLNT1_0112_G05.b :
PCT01_0013_E03.b :
AMP01_0035_H04.b :
ADR01_0031_H08.b : ttt
AMP01_0055_F08.b :
SKNB1_0010_D02.b :
BFLT1_0088_D11.b :
ADR01_0054_C11.b :
AMP01_0034_G08.b :
DCI01_0115_F06.b :
DCI01_0111_B10.b :
PCT01_0001_B08.b : ctcacaaaagagtgtggttaaggaaatatttcaaaaaaagaagggggggggacccccccn
PST01_0073_H04.b : cttttttctttctttggagg
PST01_0016_F01.b : atggtaattttcttcaccgccccaatgtaccggggtgtgttttctcaacg
PST01_0031_B05.b : tgaccggggttggttttcccaaccggataggcgttaaatggaaaactctcccaaaaacgg
OVRT1_0053_H03.b :
TCH01_0079_G12.b :
AMP01_0075_G02.b :
SKNB1_0064_A01.b :
OVRM1_0013_C11.b :
OVRM1_0183_C11.b :
PBL01_0074_E03.b : tgaccccggttttttgtcccaccgcaagggttcacagggaaattcctcaaaaaaagactc
LNG01_0062_E09.b :
OVRT1_0050_D03.b : ttagtgaacccccaaacacaccgggccc
PTG01_0063_A11.b :
ADR01_0015_C03.b : cttgtgtgtatttgctaccattagatacattactctcatgcttg
BKFL1_0020_G05.b : nnnnnnnnnnnnnnnn
DCI01_0100_D11.b :
OVRM1_0215_D06.b :
AMP01_0051_C04.b :
KDN01_0042_H03.b : aaaccttttattatatgaacctttcttttgaagcggcccaatggcaccgcgaggttgcac
LNG01_0031_H02.b :
AMP01_0072_H01.b :
OVRM1_0033_A09.b :
OVRM1_0002_H03.b :
OVRM1_0094_D09.b :
OVRM1_0206_F10.b :
SMG01_0103_H07.b : cgggtttttttttcccaaaagaaaagttt
LNG01_0036_H08.b :
LNG01_0070_G03.b : cttttttattgaaacatatcttttcaacccccccaaatgacccgagggttgcatttttcc
OVR01_0020_G04.b :
OVRM1_0210_F02.b :
SKNB1_0008_C07.b :
SKNB1_0037_B01.b :
DCI01_0016_H09.b :
OVRT1_0020_B04.b : tttatatgaacaatctcttacacacgccccaatgtaccgcgagttctctttgccaatacc
DCI01_0037_C07.b :
DCI01_0105_A03.b : acctcttttaaatgaacctttcttatcgacggcccaattaaccccgggtggatttgtcca
DCI01_0078_G10.b : tattttcccttaagaggcacagccctttgccctttaaagctccctttttaaatgtaaccc
BKFL1_0035_A11.b : cttttaagccccttttttaatgaaacctttctttccgaacgcccccatttgaaccgggag
SKNB1_0015_C04.b : GATCATTTAAATTTTCCTTTAAGAGGTCAGACTGCTTTTTACCTATTTTAAAAGCTTCTT
ADR01_0021_D09.b : catttaaattttccttaaaaaggtccaactgcttttacctattttaaagcctcctttaat
TCH01_0091_A11.b : GATCATTTAAATTTTCCTTTagaagggcaactgccttttacctattttaaagcttcatta
LNG01_0005_H01.b : GATCATTTATATTTTCCTTTNAGAGGTCAGACTGCTTTTAGCCTATTTTTAAAGCTTCAT
CBLT1_0038_B08.b : GATCATTTATATTTTCCTTTAAGAGGTCAGACTGCTTTTAGCCTATTTTAAAAGCTTCAT
SPLT1_0100_H02.b : GATCATTTATATTTTCCTTTAAGAGGTCAGACTGCTTTTAGCCTATTTTAAAAGCTTCAT
ILNT1_0067_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATTTTAAAAGCTTCAT
20110601C-007088 : TTATATTAAATTGATAA*CCATATTACCTTAATCGGAACCTGAGCCTCAGAATTGTGAAC
---------+---------+---------+---------+---------+---------+ 1519
HTMT1_0032_G04.b :
DCI01_0030_F09.b :
SPLT1_0035_A03.b :
CBLT1_0022_A01.b :
OVRM1_0030_F06.b :
SPL01_0075_B02.b :
ITT01_0095_D03.b :
CBLT1_0072_B06.b :
ADR01_0043_F01.b :
SMG01_0075_G01.b :
SPL01_0051_G12.b :
OVR01_0009_B12.b :
DCI01_0036_G01.b :
OVRM1_0112_H04.b :
DCI01_0020_A05.b :
AMP01_0026_F11.b :
AMP01_0046_C10.b :
MLN01_0077_F11.b :
ADR01_0062_D01.b :
OVRM1_0199_B09.b :
OVR01_0062_D01.b :
ITT01_0021_B12.b :
UTR01_0095_F06.b :
HTMT1_0001_E03.b :
AMP01_0095_E05.b :
OVRM1_0193_A03.b :
OVRT1_0113_A10.b :
OVRM1_0126_C10.b :
KDN01_0033_G12.b :
LVRM1_0176_A04.b :
OVRM1_0079_B03.b :
SPL01_0026_F05.b :
CBLT1_0020_A02.b :
OVR01_0095_C07.b :
OVRT1_0040_B12.b :
DCI01_0040_C09.b :
BMWN1_0023_E06.b :
AMP01_0082_H09.b :
DCI01_0030_E04.b :
DCI01_0038_B03.b :
AMP01_0092_E11.b :
DCI01_0042_H03.b :
AMP01_0096_A12.b :
AMP01_0079_C06.b :
AMP01_0041_C02.b :
DCI01_0099_H08.b :
DCI01_0094_E12.b :
AMP01_0094_G04.b :
AMP01_0095_H05.b :
DCI01_0084_G07.b :
OVRM1_0171_H11.b :
AMP01_0040_G04.b :
LNG01_0023_G12.b :
ITT01_0085_B11.b :
OVRT1_0144_H03.b :
SPL01_0058_E05.b :
SPL01_0056_C04.b :
DCI01_0085_H04.b :
DCI01_0087_H02.b :
DCI01_0109_B06.b :
DCI01_0002_B11.b :
SPL01_0014_E09.b :
DCI01_0025_H04.b :
DCI01_0026_C12.b :
AMP01_0004_G06.b :
AMP01_0037_A08.b :
DCI01_0063_A03.b :
HTMT1_0083_D05.b :
AMP01_0102_A06.b :
OVRT1_0075_F04.b :
AMP01_0036_A06.b :
AMP01_0061_G12.b :
DCI01_0011_E08.b :
KDN01_0003_A10.b :
PST01_0085_F04.b :
PST01_0005_D11.b :
ADR01_0084_E10.b :
OVRM1_0194_A03.b :
OVRM1_0004_H06.b :
OVRM1_0196_H04.b :
OVRM1_0056_A12.b :
OVRM1_0053_H08.b :
OVRM1_0085_E02.b :
OVRM1_0062_C08.b :
OVRM1_0186_H09.b :
OVRM1_0129_E08.b :
SPL01_0074_C01.b :
SPL01_0102_C02.b :
ADR01_0003_A08.b :
SPL01_0034_B08.b :
SPL01_0089_A03.b :
SPL01_0003_G03.b :
UTR01_0088_C08.b :
SMG01_0038_D02.b :
ITT01_0002_G08.b :
ITT01_0097_G08.b :
OVRT1_0054_C01.b :
PBL01_0065_D04.b : ctcgcggctccctttttgagtatgctcttt
OVRT1_0094_F02.b :
OVR01_0100_A01.b :
ITT01_0081_C02.b :
OVR01_0091_C02.b :
AMP01_0040_B02.b :
AMP01_0004_H04.b :
DCI01_0016_B01.b :
DCI01_0091_E02.b :
OVRT1_0069_F05.b :
DCI01_0029_G12.b :
DCI01_0026_C05.b :
DCI01_0104_B09.b :
DCI01_0105_B09.b :
AMP01_0081_E01.b :
AMP01_0065_H04.b :
AMP01_0092_G07.b :
AMP01_0084_H11.b :
AMP01_0081_C08.b :
SPL01_0060_F01.b :
OVRT1_0017_H05.b :
OVRM1_0152_H06.b :
OVRM1_0192_A03.b :
OVRM1_0018_F04.b :
OVRM1_0215_H02.b :
OVRM1_0203_E02.b :
SPL01_0061_A03.b :
OVRM1_0186_E11.b :
OVRM1_0126_A08.b :
OVR01_0079_A04.b :
ADR01_0043_F12.b :
OVRT1_0097_A07.b :
PCT01_0020_F06.b : nnttctccgcctaaaataannnntnnnnntntttnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRT1_0134_F02.b :
SPL01_0002_H11.b :
OVRT1_0152_H12.b :
OVRT1_0102_G05.b :
KDN01_0072_A05.b :
OVRT1_0116_A03.b :
ADR01_0066_E12.b :
ITT01_0093_F08.b : ncgccngggggaagagtcaagctcaat
ADR01_0088_D04.b :
KDN01_0067_D11.b :
CLNT1_0112_G05.b :
PCT01_0013_E03.b :
AMP01_0035_H04.b :
ADR01_0031_H08.b :
AMP01_0055_F08.b :
SKNB1_0010_D02.b :
BFLT1_0088_D11.b :
ADR01_0054_C11.b :
AMP01_0034_G08.b :
DCI01_0115_F06.b :
DCI01_0111_B10.b :
PCT01_0001_B08.b : nttttttccgccatcattaacaccgcgct
PST01_0073_H04.b :
PST01_0016_F01.b :
PST01_0031_B05.b : ggtgtgcggggcaaaaacccc
OVRT1_0053_H03.b :
TCH01_0079_G12.b :
AMP01_0075_G02.b :
SKNB1_0064_A01.b :
OVRM1_0013_C11.b :
OVRM1_0183_C11.b :
PBL01_0074_E03.b : ccggcccctccggccccccctggcnaaanncctcggagtgacgacacatgcgtacgttcc
LNG01_0062_E09.b :
OVRT1_0050_D03.b :
PTG01_0063_A11.b :
ADR01_0015_C03.b :
BKFL1_0020_G05.b :
DCI01_0100_D11.b :
OVRM1_0215_D06.b :
AMP01_0051_C04.b :
KDN01_0042_H03.b : ttcccccaaaa
LNG01_0031_H02.b :
AMP01_0072_H01.b :
OVRM1_0033_A09.b :
OVRM1_0002_H03.b :
OVRM1_0094_D09.b :
OVRM1_0206_F10.b :
SMG01_0103_H07.b :
LNG01_0036_H08.b :
LNG01_0070_G03.b : aat
OVR01_0020_G04.b :
OVRM1_0210_F02.b :
SKNB1_0008_C07.b :
SKNB1_0037_B01.b :
DCI01_0016_H09.b :
OVRT1_0020_B04.b : agattgttttnnaaanggaaacctctcaaaaagagagttgggcggcgaaaaaaac
DCI01_0037_C07.b :
DCI01_0105_A03.b : acccaaatgggtttaaaagggaatttcccaaaaaaaaaaaaaaaaaagccccccactctt
DCI01_0078_G10.b :
BKFL1_0035_A11.b : tttgttctttccacaaaccaaaatggggtttcaaaaaaggggaaattttccccaaaaaaa
SKNB1_0015_C04.b : TTATttaaatttggataccaaattaccttaatcggaacctgaacctcagaattgtaaact
ADR01_0021_D09.b : taaattgaaaacccattaacttaaacggaacctgggcccccgaaattggaaccccgggaa
TCH01_0091_A11.b : tattaattgataccatattactttaccggaaccggagctcgaaatgtgaactcctggaag
LNG01_0005_H01.b : TTATATTAAATTGATAACCCATATTACCTTAATCGGAAACTGAGCCTCAGAATTGTGAAC
CBLT1_0038_B08.b : TTATATTAAATTGATAA*CCATATTACCTTAATCGGAACCTGAGCCTCAGAATTGTGAAC
SPLT1_0100_H02.b : TTATATTAAATTGATAA*CCATATTACCTTAATCGGAACCTGAGCCTCAGAATTGTGAAC
ILNT1_0067_G12.b : TTATATTAAATTGATAA*CCATATTACCTTAATCGGAACCTGAGCCTCAGAATTGTGAAC
20110601C-007088 : TCCTGGAAGTGTTACTGATCTAGTTTGCTACCAAATTAAACCTGGAAAATTATGGTAGTT
---------+---------+---------+---------+---------+---------+ 1579
HTMT1_0032_G04.b :
DCI01_0030_F09.b :
SPLT1_0035_A03.b :
CBLT1_0022_A01.b :
OVRM1_0030_F06.b :
SPL01_0075_B02.b :
ITT01_0095_D03.b :
CBLT1_0072_B06.b :
ADR01_0043_F01.b :
SMG01_0075_G01.b :
SPL01_0051_G12.b :
OVR01_0009_B12.b :
DCI01_0036_G01.b :
OVRM1_0112_H04.b :
DCI01_0020_A05.b :
AMP01_0026_F11.b :
AMP01_0046_C10.b :
MLN01_0077_F11.b :
ADR01_0062_D01.b :
OVRM1_0199_B09.b :
OVR01_0062_D01.b :
ITT01_0021_B12.b :
UTR01_0095_F06.b :
HTMT1_0001_E03.b :
AMP01_0095_E05.b :
OVRM1_0193_A03.b :
OVRT1_0113_A10.b :
OVRM1_0126_C10.b :
KDN01_0033_G12.b :
LVRM1_0176_A04.b :
OVRM1_0079_B03.b :
SPL01_0026_F05.b :
CBLT1_0020_A02.b :
OVR01_0095_C07.b :
OVRT1_0040_B12.b :
DCI01_0040_C09.b :
BMWN1_0023_E06.b :
AMP01_0082_H09.b :
DCI01_0030_E04.b :
DCI01_0038_B03.b :
AMP01_0092_E11.b :
DCI01_0042_H03.b :
AMP01_0096_A12.b :
AMP01_0079_C06.b :
AMP01_0041_C02.b :
DCI01_0099_H08.b :
DCI01_0094_E12.b :
AMP01_0094_G04.b :
AMP01_0095_H05.b :
DCI01_0084_G07.b :
OVRM1_0171_H11.b :
AMP01_0040_G04.b :
LNG01_0023_G12.b :
ITT01_0085_B11.b :
OVRT1_0144_H03.b :
SPL01_0058_E05.b :
SPL01_0056_C04.b :
DCI01_0085_H04.b :
DCI01_0087_H02.b :
DCI01_0109_B06.b :
DCI01_0002_B11.b :
SPL01_0014_E09.b :
DCI01_0025_H04.b :
DCI01_0026_C12.b :
AMP01_0004_G06.b :
AMP01_0037_A08.b :
DCI01_0063_A03.b :
HTMT1_0083_D05.b :
AMP01_0102_A06.b :
OVRT1_0075_F04.b :
AMP01_0036_A06.b :
AMP01_0061_G12.b :
DCI01_0011_E08.b :
KDN01_0003_A10.b :
PST01_0085_F04.b :
PST01_0005_D11.b :
ADR01_0084_E10.b :
OVRM1_0194_A03.b :
OVRM1_0004_H06.b :
OVRM1_0196_H04.b :
OVRM1_0056_A12.b :
OVRM1_0053_H08.b :
OVRM1_0085_E02.b :
OVRM1_0062_C08.b :
OVRM1_0186_H09.b :
OVRM1_0129_E08.b :
SPL01_0074_C01.b :
SPL01_0102_C02.b :
ADR01_0003_A08.b :
SPL01_0034_B08.b :
SPL01_0089_A03.b :
SPL01_0003_G03.b :
UTR01_0088_C08.b :
SMG01_0038_D02.b :
ITT01_0002_G08.b :
ITT01_0097_G08.b :
OVRT1_0054_C01.b :
PBL01_0065_D04.b :
OVRT1_0094_F02.b :
OVR01_0100_A01.b :
ITT01_0081_C02.b :
OVR01_0091_C02.b :
AMP01_0040_B02.b :
AMP01_0004_H04.b :
DCI01_0016_B01.b :
DCI01_0091_E02.b :
OVRT1_0069_F05.b :
DCI01_0029_G12.b :
DCI01_0026_C05.b :
DCI01_0104_B09.b :
DCI01_0105_B09.b :
AMP01_0081_E01.b :
AMP01_0065_H04.b :
AMP01_0092_G07.b :
AMP01_0084_H11.b :
AMP01_0081_C08.b :
SPL01_0060_F01.b :
OVRT1_0017_H05.b :
OVRM1_0152_H06.b :
OVRM1_0192_A03.b :
OVRM1_0018_F04.b :
OVRM1_0215_H02.b :
OVRM1_0203_E02.b :
SPL01_0061_A03.b :
OVRM1_0186_E11.b :
OVRM1_0126_A08.b :
OVR01_0079_A04.b :
ADR01_0043_F12.b :
OVRT1_0097_A07.b :
PCT01_0020_F06.b : nnnnnnnnnnnnnnn
OVRT1_0134_F02.b :
SPL01_0002_H11.b :
OVRT1_0152_H12.b :
OVRT1_0102_G05.b :
KDN01_0072_A05.b :
OVRT1_0116_A03.b :
ADR01_0066_E12.b :
ITT01_0093_F08.b :
ADR01_0088_D04.b :
KDN01_0067_D11.b :
CLNT1_0112_G05.b :
PCT01_0013_E03.b :
AMP01_0035_H04.b :
ADR01_0031_H08.b :
AMP01_0055_F08.b :
SKNB1_0010_D02.b :
BFLT1_0088_D11.b :
ADR01_0054_C11.b :
AMP01_0034_G08.b :
DCI01_0115_F06.b :
DCI01_0111_B10.b :
PCT01_0001_B08.b :
PST01_0073_H04.b :
PST01_0016_F01.b :
PST01_0031_B05.b :
OVRT1_0053_H03.b :
TCH01_0079_G12.b :
AMP01_0075_G02.b :
SKNB1_0064_A01.b :
OVRM1_0013_C11.b :
OVRM1_0183_C11.b :
PBL01_0074_E03.b : ttnnt
LNG01_0062_E09.b :
OVRT1_0050_D03.b :
PTG01_0063_A11.b :
ADR01_0015_C03.b :
BKFL1_0020_G05.b :
DCI01_0100_D11.b :
OVRM1_0215_D06.b :
AMP01_0051_C04.b :
KDN01_0042_H03.b :
LNG01_0031_H02.b :
AMP01_0072_H01.b :
OVRM1_0033_A09.b :
OVRM1_0002_H03.b :
OVRM1_0094_D09.b :
OVRM1_0206_F10.b :
SMG01_0103_H07.b :
LNG01_0036_H08.b :
LNG01_0070_G03.b :
OVR01_0020_G04.b :
OVRM1_0210_F02.b :
SKNB1_0008_C07.b :
SKNB1_0037_B01.b :
DCI01_0016_H09.b :
OVRT1_0020_B04.b :
DCI01_0037_C07.b :
DCI01_0105_A03.b : ggccgcaagaattttcacttctcac
DCI01_0078_G10.b :
BKFL1_0035_A11.b : aaaaaagcccccccaattattttggcgcgggtttttttttgttttaaccctaaatggtat
SKNB1_0015_C04.b : cctggaaaggtttcctga
ADR01_0021_D09.b : tggtacggattaatttgctaccaataaaccgggaaattaggaagtgattccaaaataagg
TCH01_0091_A11.b : ggtaacggactagtttggcaccaatttaaccgggaaaattaggtagtgccttcaaagaat
LNG01_0005_H01.b : TCCTGGgaggtgttactggatctagttttgctaccaaaattaa
CBLT1_0038_B08.b : TCCTGGAAGTGTTACTGATCTAGTTTGCTACCAAATTAAACCTGGAAAATTATGGTAGTT
SPLT1_0100_H02.b : TCCTGGAAGTGTTACTGATCTAGTTTGCTACCAAATTAAACCTGGAAAATTATGGTAGTT
ILNT1_0067_G12.b : TCCTGGAAGTGTTACTGATCTAGTTTGCTACCAAATTAAACCTGGAAAATTATGGTAGTT
20110601C-007088 : GCATTCAAAAGATTAGTGGGTAATAAACATTTCCTTTCTCCTGAAAAAAAAAAAAAAAAA
---------+---------+---------+---------+---------+---------+ 1639
HTMT1_0032_G04.b :
DCI01_0030_F09.b :
SPLT1_0035_A03.b :
CBLT1_0022_A01.b :
OVRM1_0030_F06.b :
SPL01_0075_B02.b :
ITT01_0095_D03.b :
CBLT1_0072_B06.b :
ADR01_0043_F01.b :
SMG01_0075_G01.b :
SPL01_0051_G12.b :
OVR01_0009_B12.b :
DCI01_0036_G01.b :
OVRM1_0112_H04.b :
DCI01_0020_A05.b :
AMP01_0026_F11.b :
AMP01_0046_C10.b :
MLN01_0077_F11.b :
ADR01_0062_D01.b :
OVRM1_0199_B09.b :
OVR01_0062_D01.b :
ITT01_0021_B12.b :
UTR01_0095_F06.b :
HTMT1_0001_E03.b :
AMP01_0095_E05.b :
OVRM1_0193_A03.b :
OVRT1_0113_A10.b :
OVRM1_0126_C10.b :
KDN01_0033_G12.b :
LVRM1_0176_A04.b :
OVRM1_0079_B03.b :
SPL01_0026_F05.b :
CBLT1_0020_A02.b :
OVR01_0095_C07.b :
OVRT1_0040_B12.b :
DCI01_0040_C09.b :
BMWN1_0023_E06.b :
AMP01_0082_H09.b :
DCI01_0030_E04.b :
DCI01_0038_B03.b :
AMP01_0092_E11.b :
DCI01_0042_H03.b :
AMP01_0096_A12.b :
AMP01_0079_C06.b :
AMP01_0041_C02.b :
DCI01_0099_H08.b :
DCI01_0094_E12.b :
AMP01_0094_G04.b :
AMP01_0095_H05.b :
DCI01_0084_G07.b :
OVRM1_0171_H11.b :
AMP01_0040_G04.b :
LNG01_0023_G12.b :
ITT01_0085_B11.b :
OVRT1_0144_H03.b :
SPL01_0058_E05.b :
SPL01_0056_C04.b :
DCI01_0085_H04.b :
DCI01_0087_H02.b :
DCI01_0109_B06.b :
DCI01_0002_B11.b :
SPL01_0014_E09.b :
DCI01_0025_H04.b :
DCI01_0026_C12.b :
AMP01_0004_G06.b :
AMP01_0037_A08.b :
DCI01_0063_A03.b :
HTMT1_0083_D05.b :
AMP01_0102_A06.b :
OVRT1_0075_F04.b :
AMP01_0036_A06.b :
AMP01_0061_G12.b :
DCI01_0011_E08.b :
KDN01_0003_A10.b :
PST01_0085_F04.b :
PST01_0005_D11.b :
ADR01_0084_E10.b :
OVRM1_0194_A03.b :
OVRM1_0004_H06.b :
OVRM1_0196_H04.b :
OVRM1_0056_A12.b :
OVRM1_0053_H08.b :
OVRM1_0085_E02.b :
OVRM1_0062_C08.b :
OVRM1_0186_H09.b :
OVRM1_0129_E08.b :
SPL01_0074_C01.b :
SPL01_0102_C02.b :
ADR01_0003_A08.b :
SPL01_0034_B08.b :
SPL01_0089_A03.b :
SPL01_0003_G03.b :
UTR01_0088_C08.b :
SMG01_0038_D02.b :
ITT01_0002_G08.b :
ITT01_0097_G08.b :
OVRT1_0054_C01.b :
PBL01_0065_D04.b :
OVRT1_0094_F02.b :
OVR01_0100_A01.b :
ITT01_0081_C02.b :
OVR01_0091_C02.b :
AMP01_0040_B02.b :
AMP01_0004_H04.b :
DCI01_0016_B01.b :
DCI01_0091_E02.b :
OVRT1_0069_F05.b :
DCI01_0029_G12.b :
DCI01_0026_C05.b :
DCI01_0104_B09.b :
DCI01_0105_B09.b :
AMP01_0081_E01.b :
AMP01_0065_H04.b :
AMP01_0092_G07.b :
AMP01_0084_H11.b :
AMP01_0081_C08.b :
SPL01_0060_F01.b :
OVRT1_0017_H05.b :
OVRM1_0152_H06.b :
OVRM1_0192_A03.b :
OVRM1_0018_F04.b :
OVRM1_0215_H02.b :
OVRM1_0203_E02.b :
SPL01_0061_A03.b :
OVRM1_0186_E11.b :
OVRM1_0126_A08.b :
OVR01_0079_A04.b :
ADR01_0043_F12.b :
OVRT1_0097_A07.b :
PCT01_0020_F06.b :
OVRT1_0134_F02.b :
SPL01_0002_H11.b :
OVRT1_0152_H12.b :
OVRT1_0102_G05.b :
KDN01_0072_A05.b :
OVRT1_0116_A03.b :
ADR01_0066_E12.b :
ITT01_0093_F08.b :
ADR01_0088_D04.b :
KDN01_0067_D11.b :
CLNT1_0112_G05.b :
PCT01_0013_E03.b :
AMP01_0035_H04.b :
ADR01_0031_H08.b :
AMP01_0055_F08.b :
SKNB1_0010_D02.b :
BFLT1_0088_D11.b :
ADR01_0054_C11.b :
AMP01_0034_G08.b :
DCI01_0115_F06.b :
DCI01_0111_B10.b :
PCT01_0001_B08.b :
PST01_0073_H04.b :
PST01_0016_F01.b :
PST01_0031_B05.b :
OVRT1_0053_H03.b :
TCH01_0079_G12.b :
AMP01_0075_G02.b :
SKNB1_0064_A01.b :
OVRM1_0013_C11.b :
OVRM1_0183_C11.b :
PBL01_0074_E03.b :
LNG01_0062_E09.b :
OVRT1_0050_D03.b :
PTG01_0063_A11.b :
ADR01_0015_C03.b :
BKFL1_0020_G05.b :
DCI01_0100_D11.b :
OVRM1_0215_D06.b :
AMP01_0051_C04.b :
KDN01_0042_H03.b :
LNG01_0031_H02.b :
AMP01_0072_H01.b :
OVRM1_0033_A09.b :
OVRM1_0002_H03.b :
OVRM1_0094_D09.b :
OVRM1_0206_F10.b :
SMG01_0103_H07.b :
LNG01_0036_H08.b :
LNG01_0070_G03.b :
OVR01_0020_G04.b :
OVRM1_0210_F02.b :
SKNB1_0008_C07.b :
SKNB1_0037_B01.b :
DCI01_0016_H09.b :
OVRT1_0020_B04.b :
DCI01_0037_C07.b :
DCI01_0105_A03.b :
DCI01_0078_G10.b :
BKFL1_0035_A11.b : at
SKNB1_0015_C04.b :
ADR01_0021_D09.b : ggaataaattttcctttccggaaaaaaaaaaaaggccatggttcagctccagtcggcccc
TCH01_0091_A11.b : agggggtaaacattcccttccccgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LNG01_0005_H01.b :
CBLT1_0038_B08.b : GCATTCAAAAGATTAGTGGGTAATAAACATTTCCTTTCTCCTGAAAAxxxxxxxxxxxxx
SPLT1_0100_H02.b : GCATTCAAAAGATTAGTGGGTAATAAACATTTCCTTTCTCCTGaaaaaaaaaaaaaaaaa
ILNT1_0067_G12.b : GCATTCAAAAGATTAGTGGGTAATAAACATTTCCTTTCTCCTGAAAAAAAAAAAAAAAAA
20110601C-007088 : AA..........................................................
---------+---------+---------+---------+---------+---------+ 1641
HTMT1_0032_G04.b :
DCI01_0030_F09.b :
SPLT1_0035_A03.b :
CBLT1_0022_A01.b :
OVRM1_0030_F06.b :
SPL01_0075_B02.b :
ITT01_0095_D03.b :
CBLT1_0072_B06.b :
ADR01_0043_F01.b :
SMG01_0075_G01.b :
SPL01_0051_G12.b :
OVR01_0009_B12.b :
DCI01_0036_G01.b :
OVRM1_0112_H04.b :
DCI01_0020_A05.b :
AMP01_0026_F11.b :
AMP01_0046_C10.b :
MLN01_0077_F11.b :
ADR01_0062_D01.b :
OVRM1_0199_B09.b :
OVR01_0062_D01.b :
ITT01_0021_B12.b :
UTR01_0095_F06.b :
HTMT1_0001_E03.b :
AMP01_0095_E05.b :
OVRM1_0193_A03.b :
OVRT1_0113_A10.b :
OVRM1_0126_C10.b :
KDN01_0033_G12.b :
LVRM1_0176_A04.b :
OVRM1_0079_B03.b :
SPL01_0026_F05.b :
CBLT1_0020_A02.b :
OVR01_0095_C07.b :
OVRT1_0040_B12.b :
DCI01_0040_C09.b :
BMWN1_0023_E06.b :
AMP01_0082_H09.b :
DCI01_0030_E04.b :
DCI01_0038_B03.b :
AMP01_0092_E11.b :
DCI01_0042_H03.b :
AMP01_0096_A12.b :
AMP01_0079_C06.b :
AMP01_0041_C02.b :
DCI01_0099_H08.b :
DCI01_0094_E12.b :
AMP01_0094_G04.b :
AMP01_0095_H05.b :
DCI01_0084_G07.b :
OVRM1_0171_H11.b :
AMP01_0040_G04.b :
LNG01_0023_G12.b :
ITT01_0085_B11.b :
OVRT1_0144_H03.b :
SPL01_0058_E05.b :
SPL01_0056_C04.b :
DCI01_0085_H04.b :
DCI01_0087_H02.b :
DCI01_0109_B06.b :
DCI01_0002_B11.b :
SPL01_0014_E09.b :
DCI01_0025_H04.b :
DCI01_0026_C12.b :
AMP01_0004_G06.b :
AMP01_0037_A08.b :
DCI01_0063_A03.b :
HTMT1_0083_D05.b :
AMP01_0102_A06.b :
OVRT1_0075_F04.b :
AMP01_0036_A06.b :
AMP01_0061_G12.b :
DCI01_0011_E08.b :
KDN01_0003_A10.b :
PST01_0085_F04.b :
PST01_0005_D11.b :
ADR01_0084_E10.b :
OVRM1_0194_A03.b :
OVRM1_0004_H06.b :
OVRM1_0196_H04.b :
OVRM1_0056_A12.b :
OVRM1_0053_H08.b :
OVRM1_0085_E02.b :
OVRM1_0062_C08.b :
OVRM1_0186_H09.b :
OVRM1_0129_E08.b :
SPL01_0074_C01.b :
SPL01_0102_C02.b :
ADR01_0003_A08.b :
SPL01_0034_B08.b :
SPL01_0089_A03.b :
SPL01_0003_G03.b :
UTR01_0088_C08.b :
SMG01_0038_D02.b :
ITT01_0002_G08.b :
ITT01_0097_G08.b :
OVRT1_0054_C01.b :
PBL01_0065_D04.b :
OVRT1_0094_F02.b :
OVR01_0100_A01.b :
ITT01_0081_C02.b :
OVR01_0091_C02.b :
AMP01_0040_B02.b :
AMP01_0004_H04.b :
DCI01_0016_B01.b :
DCI01_0091_E02.b :
OVRT1_0069_F05.b :
DCI01_0029_G12.b :
DCI01_0026_C05.b :
DCI01_0104_B09.b :
DCI01_0105_B09.b :
AMP01_0081_E01.b :
AMP01_0065_H04.b :
AMP01_0092_G07.b :
AMP01_0084_H11.b :
AMP01_0081_C08.b :
SPL01_0060_F01.b :
OVRT1_0017_H05.b :
OVRM1_0152_H06.b :
OVRM1_0192_A03.b :
OVRM1_0018_F04.b :
OVRM1_0215_H02.b :
OVRM1_0203_E02.b :
SPL01_0061_A03.b :
OVRM1_0186_E11.b :
OVRM1_0126_A08.b :
OVR01_0079_A04.b :
ADR01_0043_F12.b :
OVRT1_0097_A07.b :
PCT01_0020_F06.b :
OVRT1_0134_F02.b :
SPL01_0002_H11.b :
OVRT1_0152_H12.b :
OVRT1_0102_G05.b :
KDN01_0072_A05.b :
OVRT1_0116_A03.b :
ADR01_0066_E12.b :
ITT01_0093_F08.b :
ADR01_0088_D04.b :
KDN01_0067_D11.b :
CLNT1_0112_G05.b :
PCT01_0013_E03.b :
AMP01_0035_H04.b :
ADR01_0031_H08.b :
AMP01_0055_F08.b :
SKNB1_0010_D02.b :
BFLT1_0088_D11.b :
ADR01_0054_C11.b :
AMP01_0034_G08.b :
DCI01_0115_F06.b :
DCI01_0111_B10.b :
PCT01_0001_B08.b :
PST01_0073_H04.b :
PST01_0016_F01.b :
PST01_0031_B05.b :
OVRT1_0053_H03.b :
TCH01_0079_G12.b :
AMP01_0075_G02.b :
SKNB1_0064_A01.b :
OVRM1_0013_C11.b :
OVRM1_0183_C11.b :
PBL01_0074_E03.b :
LNG01_0062_E09.b :
OVRT1_0050_D03.b :
PTG01_0063_A11.b :
ADR01_0015_C03.b :
BKFL1_0020_G05.b :
DCI01_0100_D11.b :
OVRM1_0215_D06.b :
AMP01_0051_C04.b :
KDN01_0042_H03.b :
LNG01_0031_H02.b :
AMP01_0072_H01.b :
OVRM1_0033_A09.b :
OVRM1_0002_H03.b :
OVRM1_0094_D09.b :
OVRM1_0206_F10.b :
SMG01_0103_H07.b :
LNG01_0036_H08.b :
LNG01_0070_G03.b :
OVR01_0020_G04.b :
OVRM1_0210_F02.b :
SKNB1_0008_C07.b :
SKNB1_0037_B01.b :
DCI01_0016_H09.b :
OVRT1_0020_B04.b :
DCI01_0037_C07.b :
DCI01_0105_A03.b :
DCI01_0078_G10.b :
BKFL1_0035_A11.b :
SKNB1_0015_C04.b :
ADR01_0021_D09.b : caaatatcctgaggccaacttaacacccccttttgtaaaggcgcaaaggagcaaaaaaag
TCH01_0091_A11.b : nnnnnn
LNG01_0005_H01.b :
CBLT1_0038_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0100_H02.b : aaa
ILNT1_0067_G12.b : AA
20110601C-007088 : ............................................................
---------+---------+---------+---------+---------+---------+ 1641
HTMT1_0032_G04.b :
DCI01_0030_F09.b :
SPLT1_0035_A03.b :
CBLT1_0022_A01.b :
OVRM1_0030_F06.b :
SPL01_0075_B02.b :
ITT01_0095_D03.b :
CBLT1_0072_B06.b :
ADR01_0043_F01.b :
SMG01_0075_G01.b :
SPL01_0051_G12.b :
OVR01_0009_B12.b :
DCI01_0036_G01.b :
OVRM1_0112_H04.b :
DCI01_0020_A05.b :
AMP01_0026_F11.b :
AMP01_0046_C10.b :
MLN01_0077_F11.b :
ADR01_0062_D01.b :
OVRM1_0199_B09.b :
OVR01_0062_D01.b :
ITT01_0021_B12.b :
UTR01_0095_F06.b :
HTMT1_0001_E03.b :
AMP01_0095_E05.b :
OVRM1_0193_A03.b :
OVRT1_0113_A10.b :
OVRM1_0126_C10.b :
KDN01_0033_G12.b :
LVRM1_0176_A04.b :
OVRM1_0079_B03.b :
SPL01_0026_F05.b :
CBLT1_0020_A02.b :
OVR01_0095_C07.b :
OVRT1_0040_B12.b :
DCI01_0040_C09.b :
BMWN1_0023_E06.b :
AMP01_0082_H09.b :
DCI01_0030_E04.b :
DCI01_0038_B03.b :
AMP01_0092_E11.b :
DCI01_0042_H03.b :
AMP01_0096_A12.b :
AMP01_0079_C06.b :
AMP01_0041_C02.b :
DCI01_0099_H08.b :
DCI01_0094_E12.b :
AMP01_0094_G04.b :
AMP01_0095_H05.b :
DCI01_0084_G07.b :
OVRM1_0171_H11.b :
AMP01_0040_G04.b :
LNG01_0023_G12.b :
ITT01_0085_B11.b :
OVRT1_0144_H03.b :
SPL01_0058_E05.b :
SPL01_0056_C04.b :
DCI01_0085_H04.b :
DCI01_0087_H02.b :
DCI01_0109_B06.b :
DCI01_0002_B11.b :
SPL01_0014_E09.b :
DCI01_0025_H04.b :
DCI01_0026_C12.b :
AMP01_0004_G06.b :
AMP01_0037_A08.b :
DCI01_0063_A03.b :
HTMT1_0083_D05.b :
AMP01_0102_A06.b :
OVRT1_0075_F04.b :
AMP01_0036_A06.b :
AMP01_0061_G12.b :
DCI01_0011_E08.b :
KDN01_0003_A10.b :
PST01_0085_F04.b :
PST01_0005_D11.b :
ADR01_0084_E10.b :
OVRM1_0194_A03.b :
OVRM1_0004_H06.b :
OVRM1_0196_H04.b :
OVRM1_0056_A12.b :
OVRM1_0053_H08.b :
OVRM1_0085_E02.b :
OVRM1_0062_C08.b :
OVRM1_0186_H09.b :
OVRM1_0129_E08.b :
SPL01_0074_C01.b :
SPL01_0102_C02.b :
ADR01_0003_A08.b :
SPL01_0034_B08.b :
SPL01_0089_A03.b :
SPL01_0003_G03.b :
UTR01_0088_C08.b :
SMG01_0038_D02.b :
ITT01_0002_G08.b :
ITT01_0097_G08.b :
OVRT1_0054_C01.b :
PBL01_0065_D04.b :
OVRT1_0094_F02.b :
OVR01_0100_A01.b :
ITT01_0081_C02.b :
OVR01_0091_C02.b :
AMP01_0040_B02.b :
AMP01_0004_H04.b :
DCI01_0016_B01.b :
DCI01_0091_E02.b :
OVRT1_0069_F05.b :
DCI01_0029_G12.b :
DCI01_0026_C05.b :
DCI01_0104_B09.b :
DCI01_0105_B09.b :
AMP01_0081_E01.b :
AMP01_0065_H04.b :
AMP01_0092_G07.b :
AMP01_0084_H11.b :
AMP01_0081_C08.b :
SPL01_0060_F01.b :
OVRT1_0017_H05.b :
OVRM1_0152_H06.b :
OVRM1_0192_A03.b :
OVRM1_0018_F04.b :
OVRM1_0215_H02.b :
OVRM1_0203_E02.b :
SPL01_0061_A03.b :
OVRM1_0186_E11.b :
OVRM1_0126_A08.b :
OVR01_0079_A04.b :
ADR01_0043_F12.b :
OVRT1_0097_A07.b :
PCT01_0020_F06.b :
OVRT1_0134_F02.b :
SPL01_0002_H11.b :
OVRT1_0152_H12.b :
OVRT1_0102_G05.b :
KDN01_0072_A05.b :
OVRT1_0116_A03.b :
ADR01_0066_E12.b :
ITT01_0093_F08.b :
ADR01_0088_D04.b :
KDN01_0067_D11.b :
CLNT1_0112_G05.b :
PCT01_0013_E03.b :
AMP01_0035_H04.b :
ADR01_0031_H08.b :
AMP01_0055_F08.b :
SKNB1_0010_D02.b :
BFLT1_0088_D11.b :
ADR01_0054_C11.b :
AMP01_0034_G08.b :
DCI01_0115_F06.b :
DCI01_0111_B10.b :
PCT01_0001_B08.b :
PST01_0073_H04.b :
PST01_0016_F01.b :
PST01_0031_B05.b :
OVRT1_0053_H03.b :
TCH01_0079_G12.b :
AMP01_0075_G02.b :
SKNB1_0064_A01.b :
OVRM1_0013_C11.b :
OVRM1_0183_C11.b :
PBL01_0074_E03.b :
LNG01_0062_E09.b :
OVRT1_0050_D03.b :
PTG01_0063_A11.b :
ADR01_0015_C03.b :
BKFL1_0020_G05.b :
DCI01_0100_D11.b :
OVRM1_0215_D06.b :
AMP01_0051_C04.b :
KDN01_0042_H03.b :
LNG01_0031_H02.b :
AMP01_0072_H01.b :
OVRM1_0033_A09.b :
OVRM1_0002_H03.b :
OVRM1_0094_D09.b :
OVRM1_0206_F10.b :
SMG01_0103_H07.b :
LNG01_0036_H08.b :
LNG01_0070_G03.b :
OVR01_0020_G04.b :
OVRM1_0210_F02.b :
SKNB1_0008_C07.b :
SKNB1_0037_B01.b :
DCI01_0016_H09.b :
OVRT1_0020_B04.b :
DCI01_0037_C07.b :
DCI01_0105_A03.b :
DCI01_0078_G10.b :
BKFL1_0035_A11.b :
SKNB1_0015_C04.b :
ADR01_0021_D09.b : ggggggccttttaacccggggaaaagcctggattttgaaaattttttggggaatggaacc
TCH01_0091_A11.b :
LNG01_0005_H01.b :
CBLT1_0038_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0100_H02.b :
ILNT1_0067_G12.b :
20110601C-007088 : ............................................................
---------+---------+---------+---------+---------+---------+ 1641
HTMT1_0032_G04.b :
DCI01_0030_F09.b :
SPLT1_0035_A03.b :
CBLT1_0022_A01.b :
OVRM1_0030_F06.b :
SPL01_0075_B02.b :
ITT01_0095_D03.b :
CBLT1_0072_B06.b :
ADR01_0043_F01.b :
SMG01_0075_G01.b :
SPL01_0051_G12.b :
OVR01_0009_B12.b :
DCI01_0036_G01.b :
OVRM1_0112_H04.b :
DCI01_0020_A05.b :
AMP01_0026_F11.b :
AMP01_0046_C10.b :
MLN01_0077_F11.b :
ADR01_0062_D01