[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-007152

Length: 1,055

Sequence [FASTA format sequence]
GCGATACTTG CGAGCCTCCA TCTTGCTTCT GCCCCCGACA GGTTCTCCTG TCCGGGTCAC
TGGGACGCCA AGACCGTTCT GTGGACGCCA GTTGACAATG CTGTCCCGGG TGGTACTTTC
TGCCGCCGCC GCAGCAGCCC CCTCCCTGAA GAACGCAGCC CTCCTCGGTC CGGGGGTACT
GCAGGCAACA AGGATCTTTC ACACAGGGCA GCCAAGCCTT GCCCCTGTAC CACCTCTTCC
TGAACATGGA GGAAAAGTTC GTTTGGGGCT GATCCCTGAG GAATTCTTCC AGTTCCTTTA
TCCTAAAACT GGAGTGACAG GACCCTATGT GCTTGGAACT GGGCTTATCT TATATTTACT
TTCCAAAGAG ATATATGTGA TAACTGCAGA GACCTTCTCC GCCATATCAA CAATAGGTGT
ACTTGTCTAT ATAGTTAAAA AATATGGTGC CTCTATTGGG GCATTTGCTG ATAAACTCAA
TGAGCAAAAA ATTGCCCAAC TGGAAGAAGT GAAACAGGCT TCCATCAAAC AAATCCAGGA
TGCAATTGAT CTGGAGAAAT CACAGCAGGC ACTGGTTCAA AAGCGCCATT ACCTTTTTGA
TGTCCAGAGG AATAACATTG CTATGGCCTT GGAGGTTACT TACCGGGAAC GGCTGCATAG
AGTGTACAAG GAGATAAAGA ATCGCCTGGA CTATCACATC TCTGTACAGA ATATGATGCG
TCAGAAGGAA CAAGAGCACA TGATAAGATG GGTGGAGAAG CACGTGGTGC AGAGCATCTC
TGCACAGCAG GAGAAGGAGA CAATTGCCAA GTGCATTGCA GATCTAAAGC TGCTCGCAAA
GAAGGCTCAA GCACAGCCAG TTCTGTAATT GCATCCAGCC CAGTTGAGAT AGCTAGAAAC
ATTTGACTGA CTAAATGGAA ACTAGTCTGT GAGACAAAAT CTTTCTGTAT TGCTATCTAC
TGAAGTTAAG TTTATCTTTC TAAAAAAAAA AAAATGAAGT TTTTGTTTCA TATAATGAGA
GAATTAAAAC AGTCTATTGG CCAGTAAGAT GTTTT


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinATP5F1ATP synthase subunit b, mitochondrial precursor [Homo sapiens]. 388e-108O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinAtp5f1ATP synthase subunit b, mitochondrial precursor [Mus musculus]. 391e-109O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC479901PREDICTED: similar to ATP synthase B chain, mitochondrial precursor [Canis familiaris]. 412e-115O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinATP5F1ATP synthase subunit b, mitochondrial precursor [Bos taurus]. 421e-118O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100620636PREDICTED: ATP synthase subunit b, mitochondrial-like [Sus scrofa]. 437e-123O
Contig/Assembly ProteinATP5F1PREDICTED: ATP synthase subunit b, mitochondrial [Sus scrofa]. 437e-123O


Assembly Members: 73      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010006B12ADR01_0006_B12.bDB782033 
ADR010025F09ADR01_0025_F09.bDB783723 
ADR010059H05ADR01_0059_H05.bDB786799 
ADR010064D08ADR01_0064_D08.bDB787203 
ADR010069G09ADR01_0069_G09.bDB787666 AK398781
ADR010072E08ADR01_0072_E08.bDB787906 
ADR010102A02ADR01_0102_A02.bDB790524 
AMP010034B06AMP01_0034_B06.bBW957419 
AMP010045F07AMP01_0045_F07.bBW958193 
AMP010069A11AMP01_0069_A11.bBW959980 
BKFL10011D03BKFL1_0011_D03.bFS648668 
BKFL10028H12BKFL1_0028_H12.bFS649786 
BMWN10007C12BMWN1_0007_C12.bHX206006 
BMWN10024B02BMWN1_0024_B02.bHX207007 
BMWN10037D03BMWN1_0037_D03.bHX207862 
CBLT10082D10CBLT1_0082_D10.bHX217671 
CLNT10042B04CLNT1_0042_B04.bFS660335 
CLNT10059A03CLNT1_0059_A03.bFS661677 
DCI010023C08DCI01_0023_C08.bDB792340 
DCI010046C12DCI01_0046_C12.bDB794281 
HTMT10005G11HTMT1_0005_G11.bFS664655 
ILNT10073D04ILNT1_0073_D04.bHX232568 
ILNT10091F06ILNT1_0091_F06.bHX234040 
ITT010005F02ITT01_0005_F02.bBW976460 
ITT010009H03ITT01_0009_H03.bBW976850 
ITT010017A03ITT01_0017_A03.bBW977494 
ITT010017G07ITT01_0017_G07.bBW977563 
ITT010021A06ITT01_0021_A06.bBW977854 
ITT010021D03ITT01_0021_D03.bBW977885 
ITT010023E09ITT01_0023_E09.bBW978089 
ITT010029E10ITT01_0029_E10.bBW978627 
ITT010031D05ITT01_0031_D05.bBW978785 
ITT010031F05ITT01_0031_F05.bBW978809 
ITT010042G11ITT01_0042_G11.bBW979821 
ITT010060H06ITT01_0060_H06.bBW981381 
ITT010061E12ITT01_0061_E12.bBW981437 
ITT010094A06ITT01_0094_A06.bBW984313 
LVRM10146E04LVRM1_0146_E04.bBP451632 
MLN010018G06MLN01_0018_G06.bCJ009018 
MLN010051A07MLN01_0051_A07.bCJ011578 
MLN010056C07MLN01_0056_C07.bCJ012035 
MLTL10017G08MLTL1_0017_G08.bFS679898 
OVR010002A01OVR01_0002_A01.bBP141239 
OVR010020A06OVR01_0020_A06.bBP141450 
OVR010076A12OVR01_0076_A12.bBW966350 
OVRM10023B10OVRM1_0023_B10.bBP456300 
OVRM10058B04OVRM1_0058_B04.bBP146480 
OVRM10064A03OVRM1_0064_A03.bBP145078 
OVRM10080C10OVRM1_0080_C10.bBP148374 
OVRM10150A08OVRM1_0150_A08.bBP455204 
OVRM10199C11OVRM1_0199_C11.bBP457378 
OVRM10209H08OVRM1_0209_H08.bBP461967 
OVRT10033D01OVRT1_0033_D01.bFS689070 
PBL010017E07PBL01_0017_E07.bBW969527 
PBL010022G11PBL01_0022_G11.bBW969877 
PBL010025F07PBL01_0025_F07.bBP156098 
PBL010031D01PBL01_0031_D01.bBP155662 
PST010019F09PST01_0019_F09.bFS698491 
SKNB10015C05SKNB1_0015_C05.bDB800800 
SMG010005C12SMG01_0005_C12.bFS713859 
SMG010051C08SMG01_0051_C08.bFS717704 
SMG010053D07SMG01_0053_D07.bFS717879 
SPL010075G05SPL01_0075_G05.bCJ019796 
TCH010010H02TCH01_0010_H02.bCJ023222 
THY010007F10THY01_0007_F10.bBP166518 
THY010015C05THY01_0015_C05.bBP162260 
THY010053H09THY01_0053_H09.bBP168999 
THY010203H12THY01_0203_H12.bBP169361 
THY010206A11THY01_0206_A11.bBP462502 
UTR010026E07UTR01_0026_E07.bBP171785 
UTR010069E03UTR01_0069_E03.bBP463892 
UTR010101F05UTR01_0101_F05.bCJ039253 
UTR010104C07UTR01_0104_C07.bCJ039496 

  

SNPs: 4      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
208A2300.315WSGGA/G
G4280.685GGG/G
280A500.071WSGAA/E
G5870.929GAG/E
664A2120.383OSGTA/V
G3430.617GTG/V
781C1000.333WSTCC/S
T2000.667TCT/S


Alignment:      TOP

20110601C-007152 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRM1_0199_C11.b :
ADR01_0069_G09.b :
ITT01_0017_A03.b :
OVR01_0020_A06.b :
MLTL1_0017_G08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxx
OVRM1_0023_B10.b :
ITT01_0017_G07.b :
LVRM1_0146_E04.b :
ITT01_0042_G11.b :
PST01_0019_F09.b :
SMG01_0051_C08.b :
ILNT1_0073_D04.b :
BMWN1_0007_C12.b :
TCH01_0010_H02.b :
AMP01_0045_F07.b : ccctttagcgaatcttxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0046_C12.b : nnntaacgaatcttxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0031_D01.b :
SMG01_0053_D07.b :
ITT01_0060_H06.b :
ITT01_0029_E10.b :
ITT01_0021_D03.b :
UTR01_0101_F05.b :
ADR01_0072_E08.b :
ADR01_0025_F09.b :
UTR01_0069_E03.b :
OVRM1_0150_A08.b :
OVR01_0076_A12.b :
OVRM1_0064_A03.b :
OVRM1_0080_C10.b :
SMG01_0005_C12.b :
MLN01_0018_G06.b :
PBL01_0025_F07.b :
ITT01_0031_F05.b :
ITT01_0094_A06.b :
CLNT1_0059_A03.b :
PBL01_0017_E07.b :
MLN01_0056_C07.b :
UTR01_0104_C07.b :
CLNT1_0042_B04.b :
ITT01_0031_D05.b :
ITT01_0005_F02.b :
THY01_0053_H09.b :
OVR01_0002_A01.b :
OVRT1_0033_D01.b :
ITT01_0009_H03.b :
BMWN1_0024_B02.b :
ADR01_0006_B12.b :
ADR01_0102_A02.b :
ADR01_0059_H05.b :
OVRM1_0209_H08.b :
CBLT1_0082_D10.b :
ITT01_0021_A06.b :
THY01_0206_A11.b :
SPL01_0075_G05.b :
SKNB1_0015_C05.b :
THY01_0015_C05.b :
BMWN1_0037_D03.b :
DCI01_0023_C08.b : nnnaa
ITT01_0061_E12.b :
ILNT1_0091_F06.b :
THY01_0203_H12.b :
AMP01_0034_B06.b : nnnggcgatatnntttat
AMP01_0069_A11.b : nnnnnnnnnnn
BKFL1_0028_H12.b : nnnncccgttaatanttaccg
ADR01_0064_D08.b :
MLN01_0051_A07.b :
BKFL1_0011_D03.b : nnnnnnnnn
THY01_0007_F10.b :
OVRM1_0058_B04.b :
ITT01_0023_E09.b :
UTR01_0026_E07.b :
PBL01_0022_G11.b :
HTMT1_0005_G11.b :
20110601C-007152 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRM1_0199_C11.b : nagttgtcat
ADR01_0069_G09.b : nnnnngg
ITT01_0017_A03.b : nngga
OVR01_0020_A06.b : tgggggggxxxxxxxxxxxxxxxxxxxxxxxx
MLTL1_0017_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0023_B10.b : cagttgtc
ITT01_0017_G07.b : nnn
LVRM1_0146_E04.b : tagttgtac
ITT01_0042_G11.b :
PST01_0019_F09.b :
SMG01_0051_C08.b : ncctttttt
ILNT1_0073_D04.b :
BMWN1_0007_C12.b : n
TCH01_0010_H02.b : nnnttgctagtactatna
AMP01_0045_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0046_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0031_D01.b :
SMG01_0053_D07.b :
ITT01_0060_H06.b :
ITT01_0029_E10.b :
ITT01_0021_D03.b :
UTR01_0101_F05.b : nnnnggctag
ADR01_0072_E08.b :
ADR01_0025_F09.b :
UTR01_0069_E03.b : gtctagtgxxxx
OVRM1_0150_A08.b :
OVR01_0076_A12.b : cxxxxxxxxxxxx
OVRM1_0064_A03.b :
OVRM1_0080_C10.b :
SMG01_0005_C12.b :
MLN01_0018_G06.b : nttc
PBL01_0025_F07.b :
ITT01_0031_F05.b :
ITT01_0094_A06.b :
CLNT1_0059_A03.b : n
PBL01_0017_E07.b :
MLN01_0056_C07.b : cttgga
UTR01_0104_C07.b : nnnggctagg
CLNT1_0042_B04.b : a
ITT01_0031_D05.b :
ITT01_0005_F02.b :
THY01_0053_H09.b : ctxxxxxxxxxxxxxx
OVR01_0002_A01.b : tgtttacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0033_D01.b : ttcaggagggggggnnnnnnnnnnnnnnnnnnnnntttt
ITT01_0009_H03.b :
BMWN1_0024_B02.b : t
ADR01_0006_B12.b :
ADR01_0102_A02.b :
ADR01_0059_H05.b :
OVRM1_0209_H08.b :
CBLT1_0082_D10.b :
ITT01_0021_A06.b :
THY01_0206_A11.b : gcxxxxxxxxx
SPL01_0075_G05.b : nnnggg
SKNB1_0015_C05.b :
THY01_0015_C05.b :
BMWN1_0037_D03.b :
DCI01_0023_C08.b : cgatacaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0061_E12.b :
ILNT1_0091_F06.b :
THY01_0203_H12.b :
AMP01_0034_B06.b : aagatacttgggctgctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_A11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0028_H12.b : aacccttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0064_D08.b :
MLN01_0051_A07.b :
BKFL1_0011_D03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxx
THY01_0007_F10.b :
OVRM1_0058_B04.b :
ITT01_0023_E09.b :
UTR01_0026_E07.b :
PBL01_0022_G11.b :
HTMT1_0005_G11.b :
20110601C-007152 : ..................................................GCGATACTTG
---------+---------+---------+---------+---------+---------+ 10
OVRM1_0199_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGATACTTG
ADR01_0069_G09.b : ataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGATACTTG
ITT01_0017_A03.b : tgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGATACTTG
OVR01_0020_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGATACTTG
MLTL1_0017_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGATACTTG
OVRM1_0023_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATACTTG
ITT01_0017_G07.b : ggtgaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATACTTG
LVRM1_0146_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTACTTG
ITT01_0042_G11.b : nnnggatgaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggACTTG
PST01_0019_F09.b : ggtggctatgggatCTTG
SMG01_0051_C08.b : nnnnggagtaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTTG
ILNT1_0073_D04.b : ngactagtacgaggccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0007_C12.b : tttttgcaggtaagaggccgtagtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0010_H02.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxact
AMP01_0045_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0046_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0031_D01.b : natgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0053_D07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ITT01_0060_H06.b : nnnaatgaaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0029_E10.b : nnaaatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0021_D03.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0101_F05.b : gactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0072_E08.b : nnggctttnnnnnnggactaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0025_F09.b : aaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0069_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0150_A08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0076_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0064_A03.b : cagtgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0080_C10.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0005_C12.b : nnggcttttnntnttagactaacagcggnaxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0018_G06.b : tggacttnaagtttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0025_F07.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0031_F05.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0094_A06.b : nnttgtgaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0059_A03.b : nnnccgtctgctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0017_E07.b : nnnggatgaagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0056_C07.b : ctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0104_C07.b : actatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0042_B04.b : atccgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0031_D05.b : nnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0005_F02.b : ntttgatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0053_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0002_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0033_D01.b : nnnnnnnccatcgcgtacgagtgtcttcgctctxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0009_H03.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0024_B02.b : tttccgacggtagacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0006_B12.b : nntttgataacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0102_A02.b : nnnttgatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0059_H05.b : nnnnggataaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0209_H08.b : agttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0082_D10.b : tttttggacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0021_A06.b : nnnggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0206_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0075_G05.b : ctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0015_C05.b : nnnaactcgctgtggctcacttctcttctcgcgatacttg
THY01_0015_C05.b : tagcatttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BMWN1_0037_D03.b : ttttacgaggttagacgxxxxxxxxx
DCI01_0023_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0061_E12.b : nnnttgatgaacaxxxxxxxxxxxx
ILNT1_0091_F06.b : nnnnggcaggtagaxxxxxxxxxxxxxxx
THY01_0203_H12.b : gcatttaggntgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0034_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
AMP01_0069_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0028_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0064_D08.b : nnnnnggatgaacaxxxxxxxx
MLN01_0051_A07.b : nnnngggtagtactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0011_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0007_F10.b :
OVRM1_0058_B04.b : agttgacxxx
ITT01_0023_E09.b : nnnggat
UTR01_0026_E07.b : gggggacxxxxxxxxxxxxxx
PBL01_0022_G11.b :
HTMT1_0005_G11.b :
20110601C-007152 : CGAGCCTCCATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
---------+---------+---------+---------+---------+---------+ 70
OVRM1_0199_C11.b : CGAGCCTCCATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
ADR01_0069_G09.b : CGAGCCTCCATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
ITT01_0017_A03.b : CGAGCCTCCATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
OVR01_0020_A06.b : CGAGCCTCCATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
MLTL1_0017_G08.b : CGAGCCTCCATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
OVRM1_0023_B10.b : CGAGCCTCCATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
ITT01_0017_G07.b : CGAGCCTCCATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
LVRM1_0146_E04.b : CGAGCCTCCATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
ITT01_0042_G11.b : CGAGCCTCCATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
PST01_0019_F09.b : CGAGCCTCCATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
SMG01_0051_C08.b : CGAGCCTCCATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
ILNT1_0073_D04.b : GGAGCCTCCATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
BMWN1_0007_C12.b : GGAGCCTCCATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
TCH01_0010_H02.b : aGAGCCTCCATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
AMP01_0045_F07.b : xxAGCCTCCATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
DCI01_0046_C12.b : xxAGCCTCCATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
PBL01_0031_D01.b : xxxGCCTCCATCTTGCTTCTGCCCCCGACAGGTTCTCCGGTCCGGGTCACTGGGACGCCA
SMG01_0053_D07.b : xxxxxxxxCATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
ITT01_0060_H06.b : xxxxxxxxCATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
ITT01_0029_E10.b : xxxxxxxcTATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
ITT01_0021_D03.b : xxxxxxxtTATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
UTR01_0101_F05.b : xxxxxxxgGATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
ADR01_0072_E08.b : xxxxxxxaGATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
ADR01_0025_F09.b : xxxxxxxxxATCTTGCTTCTGCCCCCGACAGGTTCTCCGGTCCGGGTCACTGGGACGCCA
UTR01_0069_E03.b : xxxxxxxxxATCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
OVRM1_0150_A08.b : xxxxxxxxxxTCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
OVR01_0076_A12.b : xxxxxxxxxxTCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
OVRM1_0064_A03.b : xxxxxxxxxxTCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCN
OVRM1_0080_C10.b : xxxxxxxxxxTCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
SMG01_0005_C12.b : xxxxxxxxxxTCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
MLN01_0018_G06.b : xxxxxxxxxxTCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
PBL01_0025_F07.b : xxxxxxxxxxTCTTGCTTCTGCCCCCGACAGGTTCTCCGGTCCGGGTCACTGGGACGCCA
ITT01_0031_F05.b : xxxxxxxxxxTCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
ITT01_0094_A06.b : xxxxxxxxxxTCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
CLNT1_0059_A03.b : xxxxxxxxxxTCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
PBL01_0017_E07.b : xxxxxxxxxxTCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
MLN01_0056_C07.b : xxxxxxxxxxTCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
UTR01_0104_C07.b : xxxxxxxxxxTCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
CLNT1_0042_B04.b : xxxxxxxxxxTCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
ITT01_0031_D05.b : xxxxxxxxxxTCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
ITT01_0005_F02.b : xxxxxxxxxxTCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
THY01_0053_H09.b : xxxxxxxxxxTCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
OVR01_0002_A01.b : xxxxxxxxxxTCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
OVRT1_0033_D01.b : xxxxxxxxxxTCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
ITT01_0009_H03.b : xxxxxxxxxxTCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
BMWN1_0024_B02.b : xxxxxxxxxxgCTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
ADR01_0006_B12.b : xxxxxxxxxxxxTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
ADR01_0102_A02.b : xxxxxxxxxxxxTTGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
ADR01_0059_H05.b : xxxxxxxxxxxxTTGCTTCTGCCCCCGACAGGTTCTCCGGTCCGGGTCACTGGGACGCCA
OVRM1_0209_H08.b : xxxxxxxxxxxxxxGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
CBLT1_0082_D10.b : xxxxxxxxxxxxxgGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
ITT01_0021_A06.b : xxxxxxxxxxxxxxGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
THY01_0206_A11.b : xxxxxxxxxxxxxxGCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
SPL01_0075_G05.b : xxxxxxxxxxxxxxxCTTCTGCCCCCGACAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
SKNB1_0015_C05.b : cgagcctccatcttgcttctgcccccgaCAGGTTCTCCTGTCCGGGTCACTGGGACGCCA
THY01_0015_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGTTCTCCTGTCCGGGTCACTGGGGCGCCA
BMWN1_0037_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTCCTGTCCGGGTCACTGGGACGCCA
DCI01_0023_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCCTGTCCGGGTCACTGGGACGCCA
ITT01_0061_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGCTCCTGTCCGGGTCACTGGGACGCCA
ILNT1_0091_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTCTCCTGTCCGGGTCACTGGGACGCCA
THY01_0203_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctgGCTCCTGTCCGGGTCACTGGGACGCCA
AMP01_0034_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCCTGTCCGGGTCACTGGGACGCCA
AMP01_0069_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCCTGTCCGGGTCACTGGGACGCCA
BKFL1_0028_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCCTGTCCGGGTCACTGGGACGCCA
ADR01_0064_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCCGGTCCGGGTCACTGGGACGCCA
MLN01_0051_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCCTGTCCGGGTCACTGGGACGCCA
BKFL1_0011_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCACTGGGACGCCA
THY01_0007_F10.b : gatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGGACGCCA
OVRM1_0058_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGGACGCCA
ITT01_0023_E09.b : aaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGGGACGCCA
UTR01_0026_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0022_G11.b : nggatgaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0005_G11.b : nnnnggcatacta
20110601C-007152 : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
---------+---------+---------+---------+---------+---------+ 130
OVRM1_0199_C11.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTCCTGCCGCCGCC
ADR01_0069_G09.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
ITT01_0017_A03.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
OVR01_0020_A06.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
MLTL1_0017_G08.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
OVRM1_0023_B10.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
ITT01_0017_G07.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
LVRM1_0146_E04.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
ITT01_0042_G11.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
PST01_0019_F09.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
SMG01_0051_C08.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
ILNT1_0073_D04.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
BMWN1_0007_C12.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
TCH01_0010_H02.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
AMP01_0045_F07.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
DCI01_0046_C12.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
PBL01_0031_D01.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
SMG01_0053_D07.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
ITT01_0060_H06.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
ITT01_0029_E10.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
ITT01_0021_D03.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
UTR01_0101_F05.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
ADR01_0072_E08.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
ADR01_0025_F09.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
UTR01_0069_E03.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
OVRM1_0150_A08.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
OVR01_0076_A12.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
OVRM1_0064_A03.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
OVRM1_0080_C10.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
SMG01_0005_C12.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
MLN01_0018_G06.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
PBL01_0025_F07.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
ITT01_0031_F05.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
ITT01_0094_A06.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
CLNT1_0059_A03.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
PBL01_0017_E07.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
MLN01_0056_C07.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
UTR01_0104_C07.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
CLNT1_0042_B04.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
ITT01_0031_D05.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
ITT01_0005_F02.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
THY01_0053_H09.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
OVR01_0002_A01.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
OVRT1_0033_D01.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
ITT01_0009_H03.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
BMWN1_0024_B02.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
ADR01_0006_B12.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
ADR01_0102_A02.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
ADR01_0059_H05.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
OVRM1_0209_H08.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
CBLT1_0082_D10.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
ITT01_0021_A06.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
THY01_0206_A11.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
SPL01_0075_G05.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
SKNB1_0015_C05.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
THY01_0015_C05.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
BMWN1_0037_D03.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
DCI01_0023_C08.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
ITT01_0061_E12.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
ILNT1_0091_F06.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
THY01_0203_H12.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
AMP01_0034_B06.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
AMP01_0069_A11.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
BKFL1_0028_H12.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
ADR01_0064_D08.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
MLN01_0051_A07.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
BKFL1_0011_D03.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
THY01_0007_F10.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
OVRM1_0058_B04.b : *GACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
ITT01_0023_E09.b : AGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
UTR01_0026_E07.b : xGACCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
PBL01_0022_G11.b : xxxxCGTTCTGTGGACGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCGCC
HTMT1_0005_G11.b : aggatttaatgaattgGCCAGTTGACAATGCTGTCCCGGGTGGTACTTTCTGCCGCCTCC
20110601C-007152 : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
---------+---------+---------+---------+---------+---------+ 190
OVRM1_0199_C11.b : GCAGCAGCCCCCTCCCTGAGGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ADR01_0069_G09.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ITT01_0017_A03.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
OVR01_0020_A06.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
MLTL1_0017_G08.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
OVRM1_0023_B10.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ITT01_0017_G07.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
LVRM1_0146_E04.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ITT01_0042_G11.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
PST01_0019_F09.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
SMG01_0051_C08.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ILNT1_0073_D04.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
BMWN1_0007_C12.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
TCH01_0010_H02.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
AMP01_0045_F07.b : GCAGCAGCCCCCTCCCTGAAGAACGCACCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
DCI01_0046_C12.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
PBL01_0031_D01.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
SMG01_0053_D07.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ITT01_0060_H06.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ITT01_0029_E10.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ITT01_0021_D03.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
UTR01_0101_F05.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ADR01_0072_E08.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ADR01_0025_F09.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
UTR01_0069_E03.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
OVRM1_0150_A08.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
OVR01_0076_A12.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
OVRM1_0064_A03.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
OVRM1_0080_C10.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
SMG01_0005_C12.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
MLN01_0018_G06.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
PBL01_0025_F07.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ITT01_0031_F05.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ITT01_0094_A06.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
CLNT1_0059_A03.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
PBL01_0017_E07.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
MLN01_0056_C07.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
UTR01_0104_C07.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
CLNT1_0042_B04.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ITT01_0031_D05.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ITT01_0005_F02.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
THY01_0053_H09.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
OVR01_0002_A01.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
OVRT1_0033_D01.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ITT01_0009_H03.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
BMWN1_0024_B02.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ADR01_0006_B12.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ADR01_0102_A02.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ADR01_0059_H05.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
OVRM1_0209_H08.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
CBLT1_0082_D10.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ITT01_0021_A06.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
THY01_0206_A11.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
SPL01_0075_G05.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
SKNB1_0015_C05.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
THY01_0015_C05.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
BMWN1_0037_D03.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
DCI01_0023_C08.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ITT01_0061_E12.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ILNT1_0091_F06.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
THY01_0203_H12.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
AMP01_0034_B06.b : GCAGCAGCCCCCTCCCTGAAGAACGCACCCCCCCTCGGTCCGGGGGTACTGCAGGCAACA
AMP01_0069_A11.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
BKFL1_0028_H12.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ADR01_0064_D08.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
MLN01_0051_A07.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
BKFL1_0011_D03.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
THY01_0007_F10.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
OVRM1_0058_B04.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
ITT01_0023_E09.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
UTR01_0026_E07.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
PBL01_0022_G11.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
HTMT1_0005_G11.b : GCAGCAGCCCCCTCCCTGAAGAACGCAGCCCTCCTCGGTCCGGGGGTACTGCAGGCAACA
20110601C-007152 : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
---------+---------+---------+---------+---------+---------+ 250
OVRM1_0199_C11.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ADR01_0069_G09.b : AGGATCTTTCACACAGGACAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ITT01_0017_A03.b : AGGATCTTTCACACAGGACGGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
OVR01_0020_A06.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
MLTL1_0017_G08.b : AGGATCTTTCACACAGGACAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
OVRM1_0023_B10.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ITT01_0017_G07.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
LVRM1_0146_E04.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ITT01_0042_G11.b : AGGATCTTTCACACAGGACAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
PST01_0019_F09.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
SMG01_0051_C08.b : GGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ILNT1_0073_D04.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
BMWN1_0007_C12.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
TCH01_0010_H02.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
AMP01_0045_F07.b : AGGATCTTTCACACAGGACAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
DCI01_0046_C12.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
PBL01_0031_D01.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
SMG01_0053_D07.b : AGGATCTTTCACACAGGACAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ITT01_0060_H06.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ITT01_0029_E10.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ITT01_0021_D03.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
UTR01_0101_F05.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ADR01_0072_E08.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ADR01_0025_F09.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
UTR01_0069_E03.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
OVRM1_0150_A08.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
OVR01_0076_A12.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
OVRM1_0064_A03.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
OVRM1_0080_C10.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
SMG01_0005_C12.b : AGGATCTTTCACACAGGACAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
MLN01_0018_G06.b : GGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
PBL01_0025_F07.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ITT01_0031_F05.b : AGGATCTTTCACACAGGACAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ITT01_0094_A06.b : AGGATCTTTCACACAGGACAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
CLNT1_0059_A03.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
PBL01_0017_E07.b : AGGATCTTTCACACAGGACAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
MLN01_0056_C07.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
UTR01_0104_C07.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
CLNT1_0042_B04.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ITT01_0031_D05.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ITT01_0005_F02.b : AGGATCTTTCACACAGGACAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
THY01_0053_H09.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
OVR01_0002_A01.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
OVRT1_0033_D01.b : AGGATCTTTCACACAGGACAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ITT01_0009_H03.b : AGGATCTTTCACACAGGACAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
BMWN1_0024_B02.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ADR01_0006_B12.b : AGGATCTTTCACACAGGACAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ADR01_0102_A02.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ADR01_0059_H05.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
OVRM1_0209_H08.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
CBLT1_0082_D10.b : AGGATCTTTCACACAGGACAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ITT01_0021_A06.b : AGGATCTTTCACACAGGACAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
THY01_0206_A11.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
SPL01_0075_G05.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
SKNB1_0015_C05.b : AGGATCTTTCACACAGGACAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
THY01_0015_C05.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
BMWN1_0037_D03.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
DCI01_0023_C08.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ITT01_0061_E12.b : AGGATCTTTCACACAGGACAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ILNT1_0091_F06.b : AGGATCTTTCACACAGGACAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
THY01_0203_H12.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
AMP01_0034_B06.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
AMP01_0069_A11.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
BKFL1_0028_H12.b : AGGATCTTTCACACAGGACAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ADR01_0064_D08.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
MLN01_0051_A07.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
BKFL1_0011_D03.b : AGGATCTTTCACACAGGACAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
THY01_0007_F10.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
OVRM1_0058_B04.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
ITT01_0023_E09.b : AGGATCTTTCACACAGGACAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
UTR01_0026_E07.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
PBL01_0022_G11.b : AGGATCTTTCACACAGGACAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
HTMT1_0005_G11.b : AGGATCTTTCACACAGGGCAGCCAAGCCTTGCCCCTGTACCACCTCTTCCTGAACATGGA
20110601C-007152 : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
---------+---------+---------+---------+---------+---------+ 310
OVRM1_0199_C11.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
ADR01_0069_G09.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
ITT01_0017_A03.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
OVR01_0020_A06.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
MLTL1_0017_G08.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
OVRM1_0023_B10.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
ITT01_0017_G07.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
LVRM1_0146_E04.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
ITT01_0042_G11.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
PST01_0019_F09.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
SMG01_0051_C08.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
ILNT1_0073_D04.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
BMWN1_0007_C12.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
TCH01_0010_H02.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
AMP01_0045_F07.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
DCI01_0046_C12.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
PBL01_0031_D01.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAAGAATTCTTCCAGTTCCTTTATCCTAAAACT
SMG01_0053_D07.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
ITT01_0060_H06.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
ITT01_0029_E10.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
ITT01_0021_D03.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
UTR01_0101_F05.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
ADR01_0072_E08.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
ADR01_0025_F09.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAAGAATTCTTCCAGTTCCTTTATCCTAAAACT
UTR01_0069_E03.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
OVRM1_0150_A08.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
OVR01_0076_A12.b : GGAAAAGTCCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
OVRM1_0064_A03.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
OVRM1_0080_C10.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
SMG01_0005_C12.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
MLN01_0018_G06.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
PBL01_0025_F07.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAAGAATTCTTCCAGTTCCTTTATCCTAAAACT
ITT01_0031_F05.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
ITT01_0094_A06.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
CLNT1_0059_A03.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
PBL01_0017_E07.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
MLN01_0056_C07.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
UTR01_0104_C07.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
CLNT1_0042_B04.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
ITT01_0031_D05.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
ITT01_0005_F02.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
THY01_0053_H09.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
OVR01_0002_A01.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
OVRT1_0033_D01.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
ITT01_0009_H03.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
BMWN1_0024_B02.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
ADR01_0006_B12.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
ADR01_0102_A02.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
ADR01_0059_H05.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAAGAATTCTTCCAGTTCCTTTATCCTAAAACT
OVRM1_0209_H08.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
CBLT1_0082_D10.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
ITT01_0021_A06.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
THY01_0206_A11.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
SPL01_0075_G05.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
SKNB1_0015_C05.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
THY01_0015_C05.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
BMWN1_0037_D03.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
DCI01_0023_C08.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTATATCCTAAAACT
ITT01_0061_E12.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
ILNT1_0091_F06.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
THY01_0203_H12.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
AMP01_0034_B06.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
AMP01_0069_A11.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
BKFL1_0028_H12.b : GGAAAGGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
ADR01_0064_D08.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAAGAATTCTTCCAGTTCCTTTATCCTAAAACT
MLN01_0051_A07.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
BKFL1_0011_D03.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
THY01_0007_F10.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
OVRM1_0058_B04.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
ITT01_0023_E09.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
UTR01_0026_E07.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
PBL01_0022_G11.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
HTMT1_0005_G11.b : GGAAAAGTTCGTTTGGGGCTGATCCCTGAGGAATTCTTCCAGTTCCTTTATCCTAAAACT
20110601C-007152 : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
---------+---------+---------+---------+---------+---------+ 370
OVRM1_0199_C11.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ADR01_0069_G09.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ITT01_0017_A03.b : GGGGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
OVR01_0020_A06.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
MLTL1_0017_G08.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
OVRM1_0023_B10.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ITT01_0017_G07.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
LVRM1_0146_E04.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ITT01_0042_G11.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
PST01_0019_F09.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
SMG01_0051_C08.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ILNT1_0073_D04.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
BMWN1_0007_C12.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
TCH01_0010_H02.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
AMP01_0045_F07.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
DCI01_0046_C12.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
PBL01_0031_D01.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
SMG01_0053_D07.b : GGAGTGACAGGACTCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ITT01_0060_H06.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ITT01_0029_E10.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ITT01_0021_D03.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
UTR01_0101_F05.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ADR01_0072_E08.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ADR01_0025_F09.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
UTR01_0069_E03.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
OVRM1_0150_A08.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
OVR01_0076_A12.b : GGAGTGACAGGACCCTATGTGCCTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
OVRM1_0064_A03.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
OVRM1_0080_C10.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
SMG01_0005_C12.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
MLN01_0018_G06.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTCTCCAAAGAG
PBL01_0025_F07.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ITT01_0031_F05.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ITT01_0094_A06.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
CLNT1_0059_A03.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
PBL01_0017_E07.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
MLN01_0056_C07.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
UTR01_0104_C07.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
CLNT1_0042_B04.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ITT01_0031_D05.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ITT01_0005_F02.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
THY01_0053_H09.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
OVR01_0002_A01.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
OVRT1_0033_D01.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ITT01_0009_H03.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
BMWN1_0024_B02.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ADR01_0006_B12.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ADR01_0102_A02.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ADR01_0059_H05.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
OVRM1_0209_H08.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
CBLT1_0082_D10.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ITT01_0021_A06.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
THY01_0206_A11.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
SPL01_0075_G05.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
SKNB1_0015_C05.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
THY01_0015_C05.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
BMWN1_0037_D03.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
DCI01_0023_C08.b : GGAGTGACAGGACCCTATGTGCTTGAAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ITT01_0061_E12.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ILNT1_0091_F06.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
THY01_0203_H12.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
AMP01_0034_B06.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
AMP01_0069_A11.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
BKFL1_0028_H12.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ADR01_0064_D08.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
MLN01_0051_A07.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
BKFL1_0011_D03.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
THY01_0007_F10.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
OVRM1_0058_B04.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
ITT01_0023_E09.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
UTR01_0026_E07.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
PBL01_0022_G11.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
HTMT1_0005_G11.b : GGAGTGACAGGACCCTATGTGCTTGGAACTGGGCTTATCTTATATTTACTTTCCAAAGAG
20110601C-007152 : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
---------+---------+---------+---------+---------+---------+ 430
OVRM1_0199_C11.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ADR01_0069_G09.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ITT01_0017_A03.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
OVR01_0020_A06.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
MLTL1_0017_G08.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
OVRM1_0023_B10.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ITT01_0017_G07.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
LVRM1_0146_E04.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ITT01_0042_G11.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
PST01_0019_F09.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
SMG01_0051_C08.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ILNT1_0073_D04.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
BMWN1_0007_C12.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
TCH01_0010_H02.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
AMP01_0045_F07.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
DCI01_0046_C12.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
PBL01_0031_D01.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
SMG01_0053_D07.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ITT01_0060_H06.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ITT01_0029_E10.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ITT01_0021_D03.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
UTR01_0101_F05.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ADR01_0072_E08.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ADR01_0025_F09.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
UTR01_0069_E03.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
OVRM1_0150_A08.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
OVR01_0076_A12.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
OVRM1_0064_A03.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
OVRM1_0080_C10.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGCACTTGTCTAT
SMG01_0005_C12.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACCTGTCTAT
MLN01_0018_G06.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
PBL01_0025_F07.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ITT01_0031_F05.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ITT01_0094_A06.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
CLNT1_0059_A03.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
PBL01_0017_E07.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
MLN01_0056_C07.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
UTR01_0104_C07.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
CLNT1_0042_B04.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ITT01_0031_D05.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ITT01_0005_F02.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
THY01_0053_H09.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
OVR01_0002_A01.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
OVRT1_0033_D01.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ITT01_0009_H03.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
BMWN1_0024_B02.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ADR01_0006_B12.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ADR01_0102_A02.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ADR01_0059_H05.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
OVRM1_0209_H08.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
CBLT1_0082_D10.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ITT01_0021_A06.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
THY01_0206_A11.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
SPL01_0075_G05.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
SKNB1_0015_C05.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
THY01_0015_C05.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
BMWN1_0037_D03.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
DCI01_0023_C08.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ITT01_0061_E12.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ILNT1_0091_F06.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
THY01_0203_H12.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
AMP01_0034_B06.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
AMP01_0069_A11.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
BKFL1_0028_H12.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ADR01_0064_D08.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
MLN01_0051_A07.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
BKFL1_0011_D03.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
THY01_0007_F10.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
OVRM1_0058_B04.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
ITT01_0023_E09.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
UTR01_0026_E07.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
PBL01_0022_G11.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
HTMT1_0005_G11.b : ATATATGTGATAACTGCAGAGACCTTCTCCGCCATATCAACAATAGGTGTACTTGTCTAT
20110601C-007152 : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
---------+---------+---------+---------+---------+---------+ 489
OVRM1_0199_C11.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
ADR01_0069_G09.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
ITT01_0017_A03.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
OVR01_0020_A06.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
MLTL1_0017_G08.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
OVRM1_0023_B10.b : ATAGTTAAAAAATATGGTGCCTCTATTGNGGCATTTGCTGATAAACTCAATGAGC*AAAA
ITT01_0017_G07.b : ATAGTTAAAAAATATGGTGCCTCTATTGAGGCATTTGCTGATAAACTCAATGAGC*AAAA
LVRM1_0146_E04.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
ITT01_0042_G11.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
PST01_0019_F09.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
SMG01_0051_C08.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
ILNT1_0073_D04.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
BMWN1_0007_C12.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
TCH01_0010_H02.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
AMP01_0045_F07.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
DCI01_0046_C12.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
PBL01_0031_D01.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
SMG01_0053_D07.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
ITT01_0060_H06.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
ITT01_0029_E10.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
ITT01_0021_D03.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
UTR01_0101_F05.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
ADR01_0072_E08.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
ADR01_0025_F09.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
UTR01_0069_E03.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
OVRM1_0150_A08.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
OVR01_0076_A12.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
OVRM1_0064_A03.b : ATAGTTAAAAAATATGGTGCCTCTATTGAGGCATTTGCTGATAAACTCAATGAGC*AAAA
OVRM1_0080_C10.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
SMG01_0005_C12.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
MLN01_0018_G06.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
PBL01_0025_F07.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
ITT01_0031_F05.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
ITT01_0094_A06.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
CLNT1_0059_A03.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
PBL01_0017_E07.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
MLN01_0056_C07.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
UTR01_0104_C07.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
CLNT1_0042_B04.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
ITT01_0031_D05.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
ITT01_0005_F02.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
THY01_0053_H09.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
OVR01_0002_A01.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
OVRT1_0033_D01.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
ITT01_0009_H03.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
BMWN1_0024_B02.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
ADR01_0006_B12.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
ADR01_0102_A02.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGCAAAAA
ADR01_0059_H05.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
OVRM1_0209_H08.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
CBLT1_0082_D10.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
ITT01_0021_A06.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
THY01_0206_A11.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
SPL01_0075_G05.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
SKNB1_0015_C05.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
THY01_0015_C05.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
BMWN1_0037_D03.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
DCI01_0023_C08.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
ITT01_0061_E12.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
ILNT1_0091_F06.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
THY01_0203_H12.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
AMP01_0034_B06.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
AMP01_0069_A11.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
BKFL1_0028_H12.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
ADR01_0064_D08.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
MLN01_0051_A07.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
BKFL1_0011_D03.b : ATAGTCAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
THY01_0007_F10.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
OVRM1_0058_B04.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATCTGCTGATAAACTCAATGAGC*AAAA
ITT01_0023_E09.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
UTR01_0026_E07.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
PBL01_0022_G11.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
HTMT1_0005_G11.b : ATAGTTAAAAAATATGGTGCCTCTATTGGGGCATTTGCTGATAAACTCAATGAGC*AAAA
20110601C-007152 : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
---------+---------+---------+---------+---------+---------+ 548
OVRM1_0199_C11.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
ADR01_0069_G09.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
ITT01_0017_A03.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
OVR01_0020_A06.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
MLTL1_0017_G08.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
OVRM1_0023_B10.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
ITT01_0017_G07.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
LVRM1_0146_E04.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
ITT01_0042_G11.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
PST01_0019_F09.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
SMG01_0051_C08.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCCTCCATCAAACAAATCCAGGATGCAATTG
ILNT1_0073_D04.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
BMWN1_0007_C12.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
TCH01_0010_H02.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
AMP01_0045_F07.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
DCI01_0046_C12.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
PBL01_0031_D01.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
SMG01_0053_D07.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
ITT01_0060_H06.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
ITT01_0029_E10.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
ITT01_0021_D03.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
UTR01_0101_F05.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
ADR01_0072_E08.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
ADR01_0025_F09.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
UTR01_0069_E03.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
OVRM1_0150_A08.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
OVR01_0076_A12.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
OVRM1_0064_A03.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAGACAAATCCCGGATGGCATTG
OVRM1_0080_C10.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
SMG01_0005_C12.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
MLN01_0018_G06.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
PBL01_0025_F07.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
ITT01_0031_F05.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
ITT01_0094_A06.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
CLNT1_0059_A03.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
PBL01_0017_E07.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
MLN01_0056_C07.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
UTR01_0104_C07.b : AATTGC*CCAACTAGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
CLNT1_0042_B04.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
ITT01_0031_D05.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
ITT01_0005_F02.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
THY01_0053_H09.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
OVR01_0002_A01.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
OVRT1_0033_D01.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
ITT01_0009_H03.b : AACTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
BMWN1_0024_B02.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
ADR01_0006_B12.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
ADR01_0102_A02.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
ADR01_0059_H05.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
OVRM1_0209_H08.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
CBLT1_0082_D10.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
ITT01_0021_A06.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
THY01_0206_A11.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
SPL01_0075_G05.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
SKNB1_0015_C05.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
THY01_0015_C05.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
BMWN1_0037_D03.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
DCI01_0023_C08.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
ITT01_0061_E12.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
ILNT1_0091_F06.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
THY01_0203_H12.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
AMP01_0034_B06.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
AMP01_0069_A11.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
BKFL1_0028_H12.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
ADR01_0064_D08.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
MLN01_0051_A07.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
BKFL1_0011_D03.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
THY01_0007_F10.b : AATTGCCCCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
OVRM1_0058_B04.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCCTCCATCANACAAATCCAGGATGCAATTG
ITT01_0023_E09.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
UTR01_0026_E07.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
PBL01_0022_G11.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
HTMT1_0005_G11.b : AATTGC*CCAACTGGAAGAAGTGAAACAGGCTTCCATCAAACAAATCCAGGATGCAATTG
20110601C-007152 : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
---------+---------+---------+---------+---------+---------+ 608
OVRM1_0199_C11.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
ADR01_0069_G09.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
ITT01_0017_A03.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
OVR01_0020_A06.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
MLTL1_0017_G08.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
OVRM1_0023_B10.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
ITT01_0017_G07.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
LVRM1_0146_E04.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCTAAAGCGCCATTACCTTTTTGATGTCCAGA
ITT01_0042_G11.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
PST01_0019_F09.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
SMG01_0051_C08.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCANAAGCGCCATTACCTTTTTGATGTCCAGG
ILNT1_0073_D04.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
BMWN1_0007_C12.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
TCH01_0010_H02.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
AMP01_0045_F07.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCCAAAGCGCCATTACCTTTTTGATGTCCAGA
DCI01_0046_C12.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
PBL01_0031_D01.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
SMG01_0053_D07.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
ITT01_0060_H06.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
ITT01_0029_E10.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
ITT01_0021_D03.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
UTR01_0101_F05.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
ADR01_0072_E08.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
ADR01_0025_F09.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
UTR01_0069_E03.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
OVRM1_0150_A08.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
OVR01_0076_A12.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
OVRM1_0064_A03.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCCAAAGCGCCATTACCTTTTTGATGTCCAGA
OVRM1_0080_C10.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
SMG01_0005_C12.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
MLN01_0018_G06.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
PBL01_0025_F07.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
ITT01_0031_F05.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
ITT01_0094_A06.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
CLNT1_0059_A03.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
PBL01_0017_E07.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
MLN01_0056_C07.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
UTR01_0104_C07.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
CLNT1_0042_B04.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
ITT01_0031_D05.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
ITT01_0005_F02.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
THY01_0053_H09.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
OVR01_0002_A01.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
OVRT1_0033_D01.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
ITT01_0009_H03.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
BMWN1_0024_B02.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
ADR01_0006_B12.b : ATCTGGAGAAATCACAGCATGCACTGGTTCGAAAGCGCCATTACCTTTTTGATGTCCAGA
ADR01_0102_A02.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
ADR01_0059_H05.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
OVRM1_0209_H08.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
CBLT1_0082_D10.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
ITT01_0021_A06.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
THY01_0206_A11.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
SPL01_0075_G05.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
SKNB1_0015_C05.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
THY01_0015_C05.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
BMWN1_0037_D03.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
DCI01_0023_C08.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCNAAAGCGCCATTACCTTTTTGATGTCCAGA
ITT01_0061_E12.b : ATCTGGAGAAATCACAGCTGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
ILNT1_0091_F06.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
THY01_0203_H12.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
AMP01_0034_B06.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
AMP01_0069_A11.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
BKFL1_0028_H12.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
ADR01_0064_D08.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
MLN01_0051_A07.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
BKFL1_0011_D03.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
THY01_0007_F10.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
OVRM1_0058_B04.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
ITT01_0023_E09.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
UTR01_0026_E07.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
PBL01_0022_G11.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
HTMT1_0005_G11.b : ATCTGGAGAAATCACAGCAGGCACTGGTTCAAAAGCGCCATTACCTTTTTGATGTCCAGA
20110601C-007152 : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
---------+---------+---------+---------+---------+---------+ 668
OVRM1_0199_C11.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACN
ADR01_0069_G09.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACA
ITT01_0017_A03.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACA
OVR01_0020_A06.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
MLTL1_0017_G08.b : GGAATAACATTGCTATGGCCTTTGGAGTTACTTACCGGGAACGGCTGCNTAGAGTATACA
OVRM1_0023_B10.b : GGAATAACATTGCTATGGCCTTGGAGGGTACTTACCGGGAACGGCTGCATAGAGTGTACN
ITT01_0017_G07.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
LVRM1_0146_E04.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACN
ITT01_0042_G11.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACA
PST01_0019_F09.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
SMG01_0051_C08.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
ILNT1_0073_D04.b : AGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTAAC
BMWN1_0007_C12.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
TCH01_0010_H02.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
AMP01_0045_F07.b : GG*ATAACATTGCTATGGGCTTGGAGGTTACTTACCGGGAACCGCTGCTTAAAGTATACA
DCI01_0046_C12.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
PBL01_0031_D01.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACA
SMG01_0053_D07.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCCGGGACGGCTGCATAGAGTATACA
ITT01_0060_H06.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
ITT01_0029_E10.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
ITT01_0021_D03.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
UTR01_0101_F05.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
ADR01_0072_E08.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
ADR01_0025_F09.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGGACGGCTGCATAGAGTATACA
UTR01_0069_E03.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
OVRM1_0150_A08.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACA
OVR01_0076_A12.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
OVRM1_0064_A03.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCCTAGAGTGTACC
OVRM1_0080_C10.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACC
SMG01_0005_C12.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGGACGGCTGCATAGAGTATACA
MLN01_0018_G06.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
PBL01_0025_F07.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACA
ITT01_0031_F05.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACA
ITT01_0094_A06.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACA
CLNT1_0059_A03.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
PBL01_0017_E07.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACA
MLN01_0056_C07.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
UTR01_0104_C07.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
CLNT1_0042_B04.b : GGAATAACATTGCTATGGCCTTGAAGGTTACTTACCGGGGACGGCTGCATAGAGTGTACA
ITT01_0031_D05.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
ITT01_0005_F02.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACA
THY01_0053_H09.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
OVR01_0002_A01.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGAGAACGGCTGCATAGAGTGTACA
OVRT1_0033_D01.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACA
ITT01_0009_H03.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACA
BMWN1_0024_B02.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
ADR01_0006_B12.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACT
ADR01_0102_A02.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
ADR01_0059_H05.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACA
OVRM1_0209_H08.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
CBLT1_0082_D10.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACA
ITT01_0021_A06.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACA
THY01_0206_A11.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
SPL01_0075_G05.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
SKNB1_0015_C05.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACA
THY01_0015_C05.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
BMWN1_0037_D03.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
DCI01_0023_C08.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
ITT01_0061_E12.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACA
ILNT1_0091_F06.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACA
THY01_0203_H12.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
AMP01_0034_B06.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
AMP01_0069_A11.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
BKFL1_0028_H12.b : GGAATAACATTGCTAAGGCCTTGGANGTTACTTACCGGGAACGGCTGCATAGAGTATACA
ADR01_0064_D08.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACA
MLN01_0051_A07.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
BKFL1_0011_D03.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACA
THY01_0007_F10.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACC
OVRM1_0058_B04.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACN
ITT01_0023_E09.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACA
UTR01_0026_E07.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
PBL01_0022_G11.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTATACA
HTMT1_0005_G11.b : GGAATAACATTGCTATGGCCTTGGAGGTTACTTACCGGGAACGGCTGCATAGAGTGTACA
20110601C-007152 : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
---------+---------+---------+---------+---------+---------+ 728
OVRM1_0199_C11.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
ADR01_0069_G09.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
ITT01_0017_A03.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
OVR01_0020_A06.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
MLTL1_0017_G08.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
OVRM1_0023_B10.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
ITT01_0017_G07.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
LVRM1_0146_E04.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
ITT01_0042_G11.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
PST01_0019_F09.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
SMG01_0051_C08.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
ILNT1_0073_D04.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCTGAAGG
BMWN1_0007_C12.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
TCH01_0010_H02.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
AMP01_0045_F07.b : AGGAGATAAAAATCGCCCTGAACTATCCCATCTCTGTACAGAATATGATGCCTCGAAAGG
DCI01_0046_C12.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
PBL01_0031_D01.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
SMG01_0053_D07.b : AAGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAGGG
ITT01_0060_H06.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
ITT01_0029_E10.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
ITT01_0021_D03.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
UTR01_0101_F05.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
ADR01_0072_E08.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
ADR01_0025_F09.b : AGGAGATAAAGAATCGCCTGAACTATCACATCTCTGTACAGAATATGATGCGTCCGAAGG
UTR01_0069_E03.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
OVRM1_0150_A08.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
OVR01_0076_A12.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
OVRM1_0064_A03.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
OVRM1_0080_C10.b : AGGGAGATAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
SMG01_0005_C12.b : AGGAGAATAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
MLN01_0018_G06.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCCTCCGAAGG
PBL01_0025_F07.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
ITT01_0031_F05.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
ITT01_0094_A06.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
CLNT1_0059_A03.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
PBL01_0017_E07.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
MLN01_0056_C07.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
UTR01_0104_C07.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAAG
CLNT1_0042_B04.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
ITT01_0031_D05.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
ITT01_0005_F02.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
THY01_0053_H09.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
OVR01_0002_A01.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
OVRT1_0033_D01.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACGGAATATGATGCGTCAGAAGG
ITT01_0009_H03.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
BMWN1_0024_B02.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
ADR01_0006_B12.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAAG
ADR01_0102_A02.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
ADR01_0059_H05.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
OVRM1_0209_H08.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
CBLT1_0082_D10.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
ITT01_0021_A06.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
THY01_0206_A11.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
SPL01_0075_G05.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
SKNB1_0015_C05.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
THY01_0015_C05.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
BMWN1_0037_D03.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAANG
DCI01_0023_C08.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAAG
ITT01_0061_E12.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
ILNT1_0091_F06.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
THY01_0203_H12.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
AMP01_0034_B06.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
AMP01_0069_A11.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
BKFL1_0028_H12.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
ADR01_0064_D08.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
MLN01_0051_A07.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
BKFL1_0011_D03.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
THY01_0007_F10.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
OVRM1_0058_B04.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
ITT01_0023_E09.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
UTR01_0026_E07.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
PBL01_0022_G11.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
HTMT1_0005_G11.b : AGGAGATAAAGAATCGCCTGGACTATCACATCTCTGTACAGAATATGATGCGTCAGAAGG
20110601C-007152 : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
---------+---------+---------+---------+---------+---------+ 787
OVRM1_0199_C11.b : AACAAGAGCACAT
ADR01_0069_G09.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCCGCACAG
ITT01_0017_A03.b : AANCAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCCGCACAG
OVR01_0020_A06.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
MLTL1_0017_G08.b : AAACAGAGCACATGATAAGATGGGTGGGAG*AGCACGTGGTGCAAAGCATCTTCGCACAG
OVRM1_0023_B10.b : AACA*GAGCACATGATAAGATGGGGTGGAGAAGCACGTGGTGCAAAGCA
ITT01_0017_G07.b : AANCAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
LVRM1_0146_E04.b : AACAAGAGCACATGATAAGATGGGTGG
ITT01_0042_G11.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCCGCACAG
PST01_0019_F09.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
SMG01_0051_C08.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
ILNT1_0073_D04.b : GAACAGAGCACATGATAAGATGGGTG*GAAAAACACGTGGTGCAAAGCTTCTCTGC*CAG
BMWN1_0007_C12.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAAAGCATCTCTGCACAG
TCH01_0010_H02.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
AMP01_0045_F07.b : AACAAGAGCccttgataaatgggtggaaagcccctggtacaaaccttctccccccacaag
DCI01_0046_C12.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
PBL01_0031_D01.b : AAACAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCCGCACAG
SMG01_0053_D07.b : AACAAGAGCACATGATAAGATGGGTGGGAGAAGCACGTGGTGCAAAGCATCTCCGCACAG
ITT01_0060_H06.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
ITT01_0029_E10.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
ITT01_0021_D03.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
UTR01_0101_F05.b : AAACAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
ADR01_0072_E08.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
ADR01_0025_F09.b : AACAGGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAAAGCATCTCCGCACAG
UTR01_0069_E03.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
OVRM1_0150_A08.b : AACAAGAGCACATGATTAGATGGGTG
OVR01_0076_A12.b : AAACAGAGCACATGATAAGA
OVRM1_0064_A03.b : AACAAGAGCACATGATAAGATGGGTG*CAGAAGCACGTGGTGCAGAGCATCTC
OVRM1_0080_C10.b : AAC*AGAGCACATGATAAGATGGGTG*GAGAAGCACATGGTGCAGAGCATTTCCGCGCAC
SMG01_0005_C12.b : AACAAGAGCACATGATAAGATGGGTGGGAGAA*CACGTGTTGCAGAGCATCTCCGCACAG
MLN01_0018_G06.b : AACCAGAGCCCATGATAAGATGGGTG*GAGAAGCACGTGGTGCACAGCATCTCTGCACAA
PBL01_0025_F07.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCCGCACAG
ITT01_0031_F05.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCCGCACAG
ITT01_0094_A06.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCCGCACAG
CLNT1_0059_A03.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
PBL01_0017_E07.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCCGCACAG
MLN01_0056_C07.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
UTR01_0104_C07.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
CLNT1_0042_B04.b : AANCAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
ITT01_0031_D05.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
ITT01_0005_F02.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCCGCACAG
THY01_0053_H09.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
OVR01_0002_A01.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
OVRT1_0033_D01.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCCGCACAG
ITT01_0009_H03.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCCGCACAG
BMWN1_0024_B02.b : AAACAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
ADR01_0006_B12.b : AACAAGAGCACATGATAAGATGGGTG*GGGAAGCACGTGGTGCAAAGCATCTCCGCACAA
ADR01_0102_A02.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
ADR01_0059_H05.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCCGCACAG
OVRM1_0209_H08.b : AACAAGAGCACATGATNAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
CBLT1_0082_D10.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCCGCACAG
ITT01_0021_A06.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCCGCACAG
THY01_0206_A11.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
SPL01_0075_G05.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
SKNB1_0015_C05.b : AACAAGAGCACATGATAAGATGGGTG*GAGATGCACGTGGTGCAGAGCATCTCCGCACAG
THY01_0015_C05.b : AACAAGAGCACCTGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
BMWN1_0037_D03.b : GAACAGAGCACATGATAAGATGGGTGGGAGA*GCACGTGGTGCAGAGCATCTCTGCACAG
DCI01_0023_C08.b : AAACAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAAAGCATCTCTGCACAG
ITT01_0061_E12.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCCGCACAG
ILNT1_0091_F06.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCCGCACAG
THY01_0203_H12.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
AMP01_0034_B06.b : AAACAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAAANCATCTCTGCACAG
AMP01_0069_A11.b : AACAAGAGCACATNGATAGATGGGTG*GAGAAGCACGTGGTGCAAAGCATCTCTGCACAG
BKFL1_0028_H12.b : AAACAGAGCACATNGATAGATGGGT**GGAGAGCACGTGGTGCAAAGCATCTCCGC*CAG
ADR01_0064_D08.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCCGCACAG
MLN01_0051_A07.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
BKFL1_0011_D03.b : AAACAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAAAGCATCTCCGCACAG
THY01_0007_F10.b : AACA*GAGCACCTGATAAGATTGGTGCAGAAGacgtggtgccagcatctctgcacagcag
OVRM1_0058_B04.b : AACNAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATTTCCGCACAG
ITT01_0023_E09.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCCGCACAG
UTR01_0026_E07.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
PBL01_0022_G11.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCCGCACAG
HTMT1_0005_G11.b : AACAAGAGCACATGATAAGATGGGTG*GAGAAGCACGTGGTGCAGAGCATCTCTGCACAG
20110601C-007152 : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
---------+---------+---------+---------+---------+---------+ 845
OVRM1_0199_C11.b :
ADR01_0069_G09.b : CAGGAGAA*AGGAGACATTGCCNAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAANG
ITT01_0017_A03.b : CAGGAGAA*GGGAGACATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCCAAGAAGG
OVR01_0020_A06.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
MLTL1_0017_G08.b : CCAGAGAA*GGAAACAATTGCCAGGTGCATTGCAAATCTAAAGCTGC*TCGCAAGGAA*G
OVRM1_0023_B10.b :
ITT01_0017_G07.b : CAGGAGAA*GGAGANNCATTGCCAGTGCATTGCAGATCTAAAGCTGC*TCGCAA*GAAGG
LVRM1_0146_E04.b :
ITT01_0042_G11.b : CAGGAGAA*GGAGNACATTTGCCAGTGCATTGCAGATCTAAAGCTGC*TCGNCAAGAAGG
PST01_0019_F09.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAAG
SMG01_0051_C08.b : CAGGAGAA*GGAGAACATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
ILNT1_0073_D04.b : CAGGAAAA*GGAAACAATTGCCAAGTGCATTGGCAATTTAAAGCTGgtccgcaaaaaagg
BMWN1_0007_C12.b : CAGGAGAA*GGAGACNATTGCNA*GTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAA*G
TCH01_0010_H02.b : CAGGAGAA*GGAGAACATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
AMP01_0045_F07.b : agaaggaaacattggccagtgcatttcaaatttaacctgccccaaaaaagctccagccca
DCI01_0046_C12.b : CAGGAGAA*AGAGACAATTGCCCAGTGCATTGCAGATCTNAAGCTGC*TCGCNAAGAAGG
PBL01_0031_D01.b : CAGGAGAA*GGAGACAATTTGCCAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAAG
SMG01_0053_D07.b : CAGGAGAA*AGAAAACAATGCCCAGTGCATTGCAGATCTAAGCCTGC*TCCCAAAAAGGG
ITT01_0060_H06.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAANG
ITT01_0029_E10.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCNAAGAANG
ITT01_0021_D03.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
UTR01_0101_F05.b : CAGGAGAA*GGAGAACATTTGCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAAG
ADR01_0072_E08.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
ADR01_0025_F09.b : CCAGAAAA*AGAAGAAATTTGCCAGTGCAattgcaatctaaagctgctccgcaagaaagg
UTR01_0069_E03.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCNAAGAAGG
OVRM1_0150_A08.b :
OVR01_0076_A12.b :
OVRM1_0064_A03.b :
OVRM1_0080_C10.b : CAGGAGAggagancattgcaagtgc
SMG01_0005_C12.b : CAAGAAGA*AGAGGCCATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAAG
MLN01_0018_G06.b : CAGGAGAAAGGAGACAATTGCCAAGTGCATTGCCGATCTAAAGCTGCCTCGCAAAGAGGG
PBL01_0025_F07.b : CAGGAGAA*AGGAGACATTTGCCAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAANG
ITT01_0031_F05.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
ITT01_0094_A06.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
CLNT1_0059_A03.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAA*G
PBL01_0017_E07.b : CAGGAGAA*GGAGACCATTGCC*AGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAAG
MLN01_0056_C07.b : CAGGAGAA*AGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCCGCAAGAAAG
UTR01_0104_C07.b : CAGGAGAA*AGGAGACATTGCCAAGTGCATTGCAGATCCTAAGCTGC*TCGCAA*GAAAG
CLNT1_0042_B04.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
ITT01_0031_D05.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
ITT01_0005_F02.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGNCAAGAANG
THY01_0053_H09.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAAG
OVR01_0002_A01.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAANG
OVRT1_0033_D01.b : CAGGAGAA*GGAGAACATTGCCAAGTGCATTGCAGAATCTAAGCTGC*TCGCAAAGAAAG
ITT01_0009_H03.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
BMWN1_0024_B02.b : CAGGAGAA*GGAGANCATTTGCCAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
ADR01_0006_B12.b : CAGGAGAA*AGAGACAATTGCCCAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
ADR01_0102_A02.b : CAGGAGAA*GGGAGACATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
ADR01_0059_H05.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGNCAAGAANG
OVRM1_0209_H08.b : CATGAGA
CBLT1_0082_D10.b : CAGGAGAA*GGAGACNNATTGCCAGTGCATTGCAGATCTAAAGCTGC*TCGNCAAGAAAG
ITT01_0021_A06.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCNTAAGCTGC*TCGCAAAGAAAG
THY01_0206_A11.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
SPL01_0075_G05.b : CAGGAGAA*GGAGACAATTGCCCAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
SKNB1_0015_C05.b : CANGAGAA*AGGAGACATTGTNCAGTGCATTGCAGATCTAAAGCTGN*CTCGCAAGAANG
THY01_0015_C05.b : CAGGAGAA*GGAGACCATTGCCCAGTGCA*TGCAGATCTAAAGCTGC*TCGCCAAG*AGG
BMWN1_0037_D03.b : CAGGAGAA*GGAAGACATTGCCAAGTGCATTGCAAATCTAAAGCTGC*TCGCAAAGGAAG
DCI01_0023_C08.b : CAGGAGAA*GGAGAACAATGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAGAAGGC
ITT01_0061_E12.b : CAGGAGAA*GGAGACAATTGTCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
ILNT1_0091_F06.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
THY01_0203_H12.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
AMP01_0034_B06.b : CAGGAGAA*AGGAGACATTGCCNAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
AMP01_0069_A11.b : CAGGAGAA*GGAGACGATTGCCNAGTGCATTGCAGATCTAAAGCTGC*TCGCAAGAAAGG
BKFL1_0028_H12.b : CAGGAGAA*GGAGAACATTGCAAA*TGCATTGCAGATCTAAgctgctcgcaaaaaggctc
ADR01_0064_D08.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGC*AAGAAGG
MLN01_0051_A07.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
BKFL1_0011_D03.b : CAGGAGAA*GGAGAACATTGCCCAGTGCATTGCAGATCTAANGCTGC*TCGCNAAGAAAG
THY01_0007_F10.b : gagaagagacaattgccagtgctttgagatctaaaatgctccgcaagacgttaaggacag
OVRM1_0058_B04.b : CAGGAGAA*GGAGACAttgccaagtg
ITT01_0023_E09.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
UTR01_0026_E07.b : CAAGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
PBL01_0022_G11.b : CAGGAGAA*GGAGATCATTGCCNAGTGCATTGCAGATCNTAAGCTGC*TCGCAAAGAAAG
HTMT1_0005_G11.b : CAGGAGAA*GGAGACAATTGCCAAGTGCATTGCAGATCTAAAGCTGC*TCGCAAAGAAGG
20110601C-007152 : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
---------+---------+---------+---------+---------+---------+ 904
OVRM1_0199_C11.b :
ADR01_0069_G09.b : GCTCAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
ITT01_0017_A03.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
OVR01_0020_A06.b : GCTCAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
MLTL1_0017_G08.b : GCTCAGCCCAGCCCAGTCTGTAATTGCATCCAGCCCAGTTGAAtagctagaaacattgac
OVRM1_0023_B10.b :
ITT01_0017_G07.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCNAGCCAGTTGAGATAGCTAGAAACA*TTT
LVRM1_0146_E04.b :
ITT01_0042_G11.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
PST01_0019_F09.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
SMG01_0051_C08.b : CTCAAGCACAGCCAGGTCTGTAATTGCATCCGGCCCAGTTGAGATAACTAGAAACA*TTT
ILNT1_0073_D04.b : tcaagctcagccttttttgtatttgctccagcccaattaaaaagctagaaactttgaact
BMWN1_0007_C12.b : CTCAAGCACAGCCAGTTCTGTAAT*GCATCC*GCCCAGTTGAGATAGCTAGAAACA*TTT
TCH01_0010_H02.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
AMP01_0045_F07.b : cccgttcccttattgcccccgcccagttgaaaaacctaaaacctttactgaccaaatgga
DCI01_0046_C12.b : CTCNAGCACAGCCAGTTCTGTAATTGCATCCAGCCCA*TTGAGATAGCTAGAAACA*TTT
PBL01_0031_D01.b : GCTCAGCACAGCCAGTTCTGTAAATGCATCCAGCCCAGT*GAGATAGCTAGAAACA*ATT
SMG01_0053_D07.b : TCAAccccaccacgtctgtaaatgcatccggcccattggaaatgctaaaaacctttgact
ITT01_0060_H06.b : GCTCAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
ITT01_0029_E10.b : GCTCAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
ITT01_0021_D03.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
UTR01_0101_F05.b : GCTCAGCACAGCCAGTTCTGTAATTGCATCCAAGCCAGTTGAGATAGCTAGAAACA*TTT
ADR01_0072_E08.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
ADR01_0025_F09.b : ttcagcccaacccgttctgtaattgctcccacccaatttaaaaagcctaaaacttttgac
UTR01_0069_E03.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
OVRM1_0150_A08.b :
OVR01_0076_A12.b :
OVRM1_0064_A03.b :
OVRM1_0080_C10.b :
SMG01_0005_C12.b : CTCAAGCACAGCCAGTTCTGTAATgcatccacccagttgaaaaagcttaaaacttttgac
MLN01_0018_G06.b : CTCAAGCACAGCCAGTTCTGTAATTGCtccccccccatttaagatgccaagaacttttga
PBL01_0025_F07.b : GCTCAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
ITT01_0031_F05.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACATTTT
ITT01_0094_A06.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
CLNT1_0059_A03.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCAAGCCCAGTTGAGATAGCTAGAAACA*TTT
PBL01_0017_E07.b : GCTCAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
MLN01_0056_C07.b : CTCAAGCACAGCCAGTTCTGTAATTGC*TTCAACCCATTTGAGATACCTAGAAACA*TTT
UTR01_0104_C07.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
CLNT1_0042_B04.b : CTCAAGCACAGCCAGTTCTGTAAATGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
ITT01_0031_D05.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
ITT01_0005_F02.b : GCTCAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
THY01_0053_H09.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAAGAACA*TTT
OVR01_0002_A01.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
OVRT1_0033_D01.b : GCTCAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
ITT01_0009_H03.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
BMWN1_0024_B02.b : CTCANGCACAGCCAGTTCTGTATTTGCATCCAGCCCAGTTGAGATAACTAGAAACA*TTT
ADR01_0006_B12.b : CTCAAGCACACCCAGTTCTGTAATTGCATCCCACCCAATTGAGATAGCTAAAAACA*TTG
ADR01_0102_A02.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
ADR01_0059_H05.b : GCTCAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
OVRM1_0209_H08.b :
CBLT1_0082_D10.b : GCTCAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
ITT01_0021_A06.b : GCTCAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
THY01_0206_A11.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
SPL01_0075_G05.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
SKNB1_0015_C05.b : CTCNAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
THY01_0015_C05.b : CTCCAGCACAGACAGTTCTGTAATTGCATCagcccagttg
BMWN1_0037_D03.b : CTCAAGCACACCCAGTTCTGTA*TTGCATCCGGCCCAATTGAAATAGCTA*AAACA*TTT
DCI01_0023_C08.b : TCAgcacagccagttctgtattgcttccgcccagtgagaatactagaaacattgactgac
ITT01_0061_E12.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
ILNT1_0091_F06.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
THY01_0203_H12.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
AMP01_0034_B06.b : GCTCAGCACAGCCCAGTTCTGTATTGCATCCNGCCCAGTTGAGATAGCTAGAAACA*TTT
AMP01_0069_A11.b : CTCAGCCA**GCCAGTTCTGTAATTGCATCCCGCCCAGTTGAGATAGCTAGAAACA*TTT
BKFL1_0028_H12.b : aagcacggccattctgtaatgcatccagccagttgaaataactaaaacatttgctgacta
ADR01_0064_D08.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
MLN01_0051_A07.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
BKFL1_0011_D03.b : GCTCAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGAATAGCTAGAACA*TTT
THY01_0007_F10.b : ccagttctgtattgcctccgaccagttgaaaagccaccacacttgactgactaatggaac
OVRM1_0058_B04.b :
ITT01_0023_E09.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
UTR01_0026_E07.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
PBL01_0022_G11.b : GCTCAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
HTMT1_0005_G11.b : CTCAAGCACAGCCAGTTCTGTAATTGCATCCAGCCCAGTTGAGATAGCTAGAAACA*TTT
20110601C-007152 : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTG*
---------+---------+---------+---------+---------+---------+ 962
OVRM1_0199_C11.b :
ADR01_0069_G09.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTG*
ITT01_0017_A03.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTG*
OVR01_0020_A06.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTG*
MLTL1_0017_G08.b : tgactaatgggaactagtctgtgaaacaaatctttccgtatgctatccccgaagtaattt
OVRM1_0023_B10.b :
ITT01_0017_G07.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTG*
LVRM1_0146_E04.b :
ITT01_0042_G11.b : GACTGACTAAATG*GGAACTAGTCTGTGAGACAAAATCTTTCTGGTATGCTATCTACTG*
PST01_0019_F09.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTG*
SMG01_0051_C08.b : GACTGACTAAATG*AAAACTAGTCTGTGAAACAAAATCTTTCTGTATTGCTATCTACGG*
ILNT1_0073_D04.b : ggataaagtgaaccaatctggtgaaaaaaacttttcgggatggaatccacggaaattaag
BMWN1_0007_C12.b : GACTGACTAA*TG*GAAACTAGTCTGTGAGAC*AAATCTTTCTGTNATGCTATCTACTG*
TCH01_0010_H02.b : GACTGGACTAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTG*
AMP01_0045_F07.b : acctatccgggaaacaaaatctttcgttttgcctcccccgaaattaagtttccctttaaa
DCI01_0046_C12.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATC*TTCTGTATTGCTATCTACTG*
PBL01_0031_D01.b : GACTGACTTAATG*GAAACTAGTCTGTGAGACAAAATNCTTCTGTATTGCTATCTACTG*
SMG01_0053_D07.b : gaataaatggaaacaactcgggaaaacaaaccttgggatggccatccaggaaataagtta
ITT01_0060_H06.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTG*
ITT01_0029_E10.b : GACTGACTAAATG*AAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTG*
ITT01_0021_D03.b : GACTGACTAAATG*GAAACTAGTCTGTGAGAACAAATCTTTCTGTATTGCTATCTACTG*
UTR01_0101_F05.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTG*
ADR01_0072_E08.b : GACTNGACTAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTG*
ADR01_0025_F09.b : tgactaaatggaaactagctcggaaaaaaaacctttcggaatggcaaccacgggaattaa
UTR01_0069_E03.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCCACTG*
OVRM1_0150_A08.b :
OVR01_0076_A12.b :
OVRM1_0064_A03.b :
OVRM1_0080_C10.b :
SMG01_0005_C12.b : tgactaattggaactaatcttgtgaaaaaaactttcggaaatgctatctactgaaattaa
MLN01_0018_G06.b : ctgactaatggaaactagtccgtgaaacaaatctttccggattgcatccaccgaagttaa
PBL01_0025_F07.b : GACTGACTAAATG*GAAACTAGTCTGTGAGA*ACAATCTTTCTGTATTGCTATCTACTG*
ITT01_0031_F05.b : GACTGACTAA*TG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTG*
ITT01_0094_A06.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAATNC*TTCTGTNATGCTATCTACTG*
CLNT1_0059_A03.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTG*
PBL01_0017_E07.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCCACTG*
MLN01_0056_C07.b : GACTGACTAAATG*GAAACTAGTCTGTGAAACAAAATCTTTCTGAATGGCTATCTACGG*
UTR01_0104_C07.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCCTTCTGTATTGCTATCTACTG*
CLNT1_0042_B04.b : GACTGACTAAATG**AAACTAATCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTG*
ITT01_0031_D05.b : GACTGACTAAAAT*GGAACTAGTCTGTGAGAACAAATCTTTCTGTATTGCTATCTACTG*
ITT01_0005_F02.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGCATTGCTATCTACTG*
THY01_0053_H09.b : GACTGACTAAATGGGAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTG*
OVR01_0002_A01.b : GACTGACTAAATG*GAAACTAGTCTGTGAAACAAAATCTTTCTGAATTGCTATCTACTGG
OVRT1_0033_D01.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACCAAATCTTTCTGTAATGCTATCTACTG*
ITT01_0009_H03.b : GACTGACNTAATG*GGAACTAGTCTGTGAGANCAAATCTTTCTGTATTGCTATCTACTG*
BMWN1_0024_B02.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAATTCTTTCTGTAT*GCTATCTACTG*
ADR01_0006_B12.b : GACTGACTAAATG**AAACTAATCGGTGAAACAAAA*CTTTCTGTATtgctatcaacgaa
ADR01_0102_A02.b : GACTGACTAAATG*GNAACTAGTCTGTGAGAC*AAATCTTTCTGTATTGCTATCTACTG*
ADR01_0059_H05.b : GACTGACTNAATG*GNAACTAGTCTGTGAGAACAAATCTTTCTGTATTGCTATCTACTG*
OVRM1_0209_H08.b :
CBLT1_0082_D10.b : GACTGACTAAATG*GGAACTAGTCTGTGAGAACAAATCTTTCTGTATTGCTATCTACTG*
ITT01_0021_A06.b : GACTGACTAAATG*GAAACTAGTCTGTGAGAACAAATCTTTCTGTATTGCTATCTACTG*
THY01_0206_A11.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTG*
SPL01_0075_G05.b : GACTGACTTAATG*GAAACTAGTCTGTGAGAACAAATCTTTCTGGATTGCTATCTACTG*
SKNB1_0015_C05.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTG*
THY01_0015_C05.b :
BMWN1_0037_D03.b : GACTGACTAAATG*GAAACTAGTCggtaaacaaatcctttcggattgctcccaccgaatt
DCI01_0023_C08.b : aaatggaaataatctgtaaacaaatctttcgtatgccatcacggaagtaagttatcttct
ITT01_0061_E12.b : GACTGACTAAATG*GGAACTAGTCTGTGAGAC*AAATCTTTCTGTAT*GCTATCTACTG*
ILNT1_0091_F06.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTG*
THY01_0203_H12.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTGA
AMP01_0034_B06.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTG*
AMP01_0069_A11.b : GACTGACTAAATG*GAAACTAGTCTGTGAGAACAAATCTTTCTGGATTGCTATCTACTG*
BKFL1_0028_H12.b : aatgaaactattcgggaaacaaactttcggaatgctaccaccgaaagtaatttatcttca
ADR01_0064_D08.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTGA
MLN01_0051_A07.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTG*
BKFL1_0011_D03.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTAT*GCTATCTACTG*
THY01_0007_F10.b : tagtctggaaacaan
OVRM1_0058_B04.b :
ITT01_0023_E09.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTG*
UTR01_0026_E07.b : GAC
PBL01_0022_G11.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAAATCTTCTGTATTGCTATCTACTG*
HTMT1_0005_G11.b : GACTGACTAAATG*GAAACTAGTCTGTGAGACAAAATCTTTCTGTATTGCTATCTACTG*
20110601C-007152 : AAGTTAAGTTTATCTTTCTAAAA*AAAAAAAAATGAAGTTTTTGTTTCATATAATGAGAG
---------+---------+---------+---------+---------+---------+ 1021
OVRM1_0199_C11.b :
ADR01_0069_G09.b : AAAGTAAGTTTATCTTTCTAAAA*GAAAAAAAAAatgaagtgttngnttcataatatgag
ITT01_0017_A03.b : AAGTTTANTTTATCTTTCCTAAA*GAAAAAAAAATGAGTGTTTGTTTcctataatgaaaa
OVR01_0020_A06.b : AAGTTAAAGTTTATCTTTCTAAA*AGAAAAAAAATGAAagttttggttccatataatgag
MLTL1_0017_G08.b : atctttccaaaaaaaaaaaaaaaaaaaaaaaacagttgggcccctcgcccagaaaatttt
OVRM1_0023_B10.b :
ITT01_0017_G07.b : AAAGTAAGTTTATCTTTTCTAAA*GAAAAAAATGAAAGTTTTTGTTCATAATA*TGAGAG
LVRM1_0146_E04.b :
ITT01_0042_G11.b : AAGTAAAGTTTATCTTTCT*AAA*GAAAAAAAATGAAATGTTTGTTTCATATAATGAGAG
PST01_0019_F09.b : AAGTTAAGTTTATCTTTCTAAA**GAAAAAAAATGAAGTTTTTGTTTCTTATAatgaaag
SMG01_0051_C08.b : AAATTAAGTTTACCTTTCCTAAA*AAAAAAAAATGAAGTTTTGGTTTCTAATA*TGAAAG
ILNT1_0073_D04.b : ttatccttcaaaaaaaaaaaaaaagattttgttttatatagagaaaaatttaaaacgtct
BMWN1_0007_C12.b : AAGTTAAGTTTATCTTTCT*AAA*GAAAAAAAATGAAGTTTTTTGTTCATATAaggaaaa
TCH01_0010_H02.b : AAGTTAAGTTTATCTTTCTAAAA*GAAAAAAAATGAAGTTTTTGTTTCCTATAATgagag
AMP01_0045_F07.b : aaaaaaaaaaagaatggtttttttcaaaaggaaaaaatatacacgtcctttggcccaaaa
DCI01_0046_C12.b : AAGTTTAGTTAATCTTTTCTAAA*GAAAAAAAATGAAGTTTTgttttnttatatgagaga
PBL01_0031_D01.b : AAGTTTAGTTAACCTTTCTTAAA*GAAAAAAAATGAAGTTTTttgttcnttaatggaaaa
SMG01_0053_D07.b : ccttccaaaaaaaaaaaataaagggttgtttcctaaggggaaattacacatcttttgccc
ITT01_0060_H06.b : AAGTTAAGTTTATCTTTCTAAAG*AAAAAAAATGAAGTTTTgttncatantatgagagaa
ITT01_0029_E10.b : AAAGTAAGTTTATCTTTCTAAAG*AAAAAAAATGAAGTTTTTtgttttcatatatgagag
ITT01_0021_D03.b : AAGTTAAGTTTATCTTTTCTAAG*GAAAAAAAATGAAAGTTTTTGTTtctataatgagag
UTR01_0101_F05.b : AAAGTAAGGTTATCTTTCTAAAA*AAAAAAAAATGAAGTTTTTGTTTCATTTA*TGAGAG
ADR01_0072_E08.b : AAAGTAAGTTTATCTTTCTAAAA*GA*AAAAAATGAAGTTTTTGTTTNCATATATGAGAG
ADR01_0025_F09.b : atttaactttctcaaaaaaaaaaaaggaatttttgtttcttaaagggaaaatttaaaacg
UTR01_0069_E03.b : AAGTTTAGTTTTATCTTTCTAAA*AAAAAAAAATGAAATTTTTtgttttctataatgaaa
OVRM1_0150_A08.b :
OVR01_0076_A12.b :
OVRM1_0064_A03.b :
OVRM1_0080_C10.b :
SMG01_0005_C12.b : ttttaccttttaaaaaaaaaaaaaaggaatggtttgttcttttaagggaaaatttcaacc
MLN01_0018_G06.b : atttcctttcaaaaaaaaaaaatgaagttttgtttctatcagggaaaattaaaacgtcct
PBL01_0025_F07.b : AAGTAAGTTTATNNCTTCTAAGA*AAAAAAAtgaagttttgnttcatatatgagagatta
ITT01_0031_F05.b : AAAGTAAAGTTATCTTTTCTAAA*GAAAAAAAAAatgaagtggtttgttcatataatgag
ITT01_0094_A06.b : AAGTTAAGTTTATCTTTCTAAAA*GAAAAAAAATGAAGTGgtttgttcatantatgggag
CLNT1_0059_A03.b : AAAGTTAGTTTATCTTTCCTAAA*AAAAAAAATGAgtttttggttcctttatgagaaatt
PBL01_0017_E07.b : GAAGTAAGTTTATCCTTCCAAAA*AAAAAAAAATGAAGTGTTTGTTTCCTATAatgaaaa
MLN01_0056_C07.b : AAGTTAATTTAACCTTTCAAAAA*AAAAAAAATGAAaatttttgtttcctataatggaaa
UTR01_0104_C07.b : AAGTTAAAGTTAATCTTTTCAAA*AAAAAAAAAAatgaaattttttggttcctataagtg
CLNT1_0042_B04.b : AAGTTTAGTTTATCTTTCTAAAA*AAAAAAAAA*GAAGTTTTGGTTTCATATtatgaaag
ITT01_0031_D05.b : AAGTTAAAGTTATCTTTCTAAAN*G*AAAAAAATGAAGTTTTTGTTTCATATA*TGAGAG
ITT01_0005_F02.b : AAGTTAAGTTTATCTTTCTAAAA*GAAAAAAAATGAAGTGGTTGTTTCATATAATGAGAG
THY01_0053_H09.b : AAGTTAAGTTTATCTTTCTAAAA*AAAAAAAAATGAAGTTTTTGTTTCATATAATgagaa
OVR01_0002_A01.b : AAGTTAGGTTTATCCTTCTAAAA*GAAAAAAAATTGAAgtttttgtttcattataatgaa
OVRT1_0033_D01.b : AAATTAAGTTTATCCTTCTAAAA*GAAAAAAAAATGAAgtgtttgtttcatattatggaa
ITT01_0009_H03.b : AAAGTTAGTTTATCTTTCTAAAA*GAAAAAAAATGAAGTGTTTGTTTTCATATATGAGAG
BMWN1_0024_B02.b : AAGTTAAGTTTATCTTTC*AAAA*AAAAAAAAATGAAGTTTTGGTTcataaatgagagaa
ADR01_0006_B12.b : attaaataaaccttccaaaagaaaaaaaaagaaatgtttgtttcaaaaatgaaaaaaatt
ADR01_0102_A02.b : AAAGTAAAGTTATCTTTCTAAAG*AAAAAAAATGAgtttttgttcatatatgagagaata
ADR01_0059_H05.b : AAGTTAAGTTTATCTTTCTAAAA*GAAAAAAAATGAAGTTTTTGTTTCATANTATGAGAG
OVRM1_0209_H08.b :
CBLT1_0082_D10.b : AGGTTAAGTTTATCTTTCTAAAG*AAAAAAAAATGAAATGTTTGTTCCATATAaggaaag
ITT01_0021_A06.b : AAGTTAAGTTTATCTTTCTAAAAGAAAAAAAAATGAAGTGTTTGTTNCATANTATGAGAG
THY01_0206_A11.b : AAGTTAAGTTTATCTTTCTAAAA*GA*AAAAAATGGAGTTTTTGGTTCATATAATGAGAG
SPL01_0075_G05.b : AAGTTAAATTTAACTTTCTAAAA*GAAAAAAAATGAAGTTTTTGTTTCCTATAATGAGAA
SKNB1_0015_C05.b : AAAGTAAGTTNATCTTTTCTAAA*GAAAAAAAATGAAGTGTTTGTTTTCTATAATGAGAG
THY01_0015_C05.b :
BMWN1_0037_D03.b : tagtttacctttcaaaaaaaaaaaatgaattttttgttccaaaaggaaaaaattaaccct
DCI01_0023_C08.b : aaagaaaaaaatgagttttgttcatataggaagataaacatcattggcagaagagttttc
ITT01_0061_E12.b : AAGTCAGTTTA**TCTTCCTAAA*AGNAAAAAATGAAGTGTTTGTTcatagtatgagaga
ILNT1_0091_F06.b : AAGTTAAGTTTATCCTTCTAAAA*GAAAAAAAAATGAGTGTTTGTTTcatataatgaaaa
THY01_0203_H12.b : AAGTAAAGTTTATCTTTCTAAAAGAAAAAAAAATGAAGTTTTTGTTTCATATAATGAGAG
AMP01_0034_B06.b : AAGTTAAGTTCATCCTTCaaaaa*aaaaaaaaaaaaaaaaaaaaaaacttgtcgcccgct
AMP01_0069_A11.b : AAGTTAAGCTTATCCCTTCAAAA*AAAAAAAAATGAGTTTTTGTTTCAaataaggagaga
BKFL1_0028_H12.b : aaaaaaaaaaaaaaaaaaaaaaaaatgtcggcccctcgcccccgaaactttttaaccttt
ADR01_0064_D08.b : AAGTAAAGTTTATCTTCTAAAAG*AAAAAAAAATGAGGTTTTgttncatatatgagagaa
MLN01_0051_A07.b : AAGTTAAGTTTTATCTTTCTAAA*GAAAAAAAATGAAGTTTTTGTTTCATATA*TGAGAG
BKFL1_0011_D03.b : AAGTTAggttaactttctaaagaaaaaaaatgaagtgttgtttcattaatgagaaatacc
THY01_0007_F10.b :
OVRM1_0058_B04.b :
ITT01_0023_E09.b : AAGTTAAGTTTATCTTTCTAAAA*GAAANNAAATGAAAGTGTTGTTTCAATATATGAGAG
UTR01_0026_E07.b :
PBL01_0022_G11.b : AAGTTAAGTTTATCTTTNCTAAA*GAAAAAAAATGAAGTGTTTGTTTTCATATATGAGAG
HTMT1_0005_G11.b : AAAGTAAGTTTATCTTTCTAAAA*GA*AAAAAATGAAGTTTTTGTTTCATATAATGAGAG
20110601C-007152 : AATTAAAACAGTCTATTGGCCAGTAAGATGTTTT..........................
---------+---------+---------+---------+---------+---------+ 1055
OVRM1_0199_C11.b :
ADR01_0069_G09.b : agaattacacagtctattggccanaagaagtttttcccatccttcttgccggcaatttga
ITT01_0017_A03.b : attacaacagtccattgggccataagaggttttcccaccttctgcctcgcatttgaattg
OVR01_0020_A06.b : agaattaaaacagtctaattggccaagtaagatgttttttctcttcctttcttgctctgc
MLTL1_0017_G08.b : aaacattttttgggccggcccaaagaagagaaatgttaactttttccaaaaacgggcgaa
OVRM1_0023_B10.b :
ITT01_0017_G07.b : AATTAAAACggtctattggccataagaagtttttcccatccttctgctctgcatttggaa
LVRM1_0146_E04.b :
ITT01_0042_G11.b : AATTACAACAGTCtattgccaagtagaggtttttcccatcttcctgcttcgcattttgaa
PST01_0019_F09.b : aataaaacagtctattggccagtaggagtttttctcatcccttctgctctgcattttgaa
SMG01_0051_C08.b : AATTAAAACAGTCtattggccagaaaaaaggttttcccacccttctggcctggaatttgg
ILNT1_0073_D04.b : tttggccacaaaaaagtttttcctccctttatgtgcagcaatttaaatagtccaaaaccc
BMWN1_0007_C12.b : aattaaaacgtctattggccaaaaagaagtttttcccacccttcctggccgccttttgaa
TCH01_0010_H02.b : aattaaacagtctattggccataaaaagttttcccatcctcttgcctcgcatttgaattg
AMP01_0045_F07.b : aagtttttccccccccccgccctcgattttaaagggccccgaaaaatttgaaaagcgttt
DCI01_0046_C12.b : attaaaccgtcctattggccagaaaaagtttttcccaaccttcttgcccccgctttgaat
PBL01_0031_D01.b : attaaacagtcaattgcccaaaaaaaggttttcccaccttctgccccgcattttgaatgt
SMG01_0053_D07.b : aaaaaagtttccccccctcttgcgccccttttaattgccccggaaaattttaaaaaccgt
ITT01_0060_H06.b : ttaaacagtctattggcccagtagatgtttttctcatcctcttgctctgcattttgaaat
ITT01_0029_E10.b : aataaaaacgtctattggccaagtagatgttttctcatcctcntgccgcattttgattgt
ITT01_0021_D03.b : aattaaaacagtctattggccagtaagatgtttttcccatccctcntgctctgcattttt
UTR01_0101_F05.b : AATTAaaaccgtctattgggccagaaaaaggtttttcccaccttcctgcccggcatttga
ADR01_0072_E08.b : AATTAAAACAGTCTATTGGCcagnaagatgttttcctcatcctcntgctctgcattttga
ADR01_0025_F09.b : ttttttggcccaaaaaaagttttttcccccttctggcccgcatttaaatgttccggaaaa
UTR01_0069_E03.b : agaattaaaacaagtctattggcccattaaaaagtttttcctcttcccttccttcctcct
OVRM1_0150_A08.b :
OVR01_0076_A12.b :
OVRM1_0064_A03.b :
OVRM1_0080_C10.b :
SMG01_0005_C12.b : gcctatggccaaaaaaaagttttcccacccttcttgcccgcattttaaattgtcccagaa
MLN01_0018_G06.b : tgggcccaaaaggttttccccccttcggccccgctttgaattgcccagaaccttttgaaa
PBL01_0025_F07.b : aacagtctatgggcagtaagatgtttctcatctccntgctcgcatttgaaatgtcatgag
ITT01_0031_F05.b : agaattacaacagtctattggccagnaggatgttttctcatccctctgctctgcattttg
ITT01_0094_A06.b : aattacacagtctattggcagtagatgttttctcatccttctgtctgcattttgatttgt
CLNT1_0059_A03.b : aaaacggtctattggccagaaagagtttttcccaaccttttggccgggatttgaaatgtt
PBL01_0017_E07.b : gattacaacagtcttatggccagtagatgtttttcccacccctctgccctgcattttgaa
MLN01_0056_C07.b : aatttaaaacagtcttattgggccgtaaaaaaaaataaaaaaaaaaggcccccttttttt
UTR01_0104_C07.b : ggagaaattaaacccgtccttttggcccataaaaaaagtttttctcccaccttcctgccc
CLNT1_0042_B04.b : atttaaacagtctattggccaataagaagtttttcccatcttcctggcccgcattttgaa
ITT01_0031_D05.b : AATTAAAcagtctattggcagtaagagtttttctcatccntctgctctgcaattgaannt
ITT01_0005_F02.b : GATTACAACAGTCTATTGGCcagtaaaatgtttttcccatccttctgctctgcatttgga
THY01_0053_H09.b : aattaaaacagtccatttgcccaataaaaatgttttttcttcacccttcttggttctgca
OVR01_0002_A01.b : aagaattaaaaacagtctattgggcccagtaaaaaagtttttttctcatttctttcctgg
OVRT1_0033_D01.b : agatttacacagcctattggcccagtaaaagtttttcccaaccttcttgcccgcatttgg
ITT01_0009_H03.b : AAATACAACAGTCTATTGGCCAGAAAGATGTTTTtctcatccttcntgctctgcattttg
BMWN1_0024_B02.b : ttaaaacgtctatgggccgttnanaaanaaananaaaaaaaaanannnngggtcgcggcc
ADR01_0006_B12.b : tcaccgtctattggccaataaaagtttttcccaccccttctggcccgcattttgattgtt
ADR01_0102_A02.b : aaacagtctatggccagtaagagtttttccatccttctgctctgcattttgaatgntcca
ADR01_0059_H05.b : AATTAAAACAGTCTATTGGCccagtagatgtttttctcatcctcctgctctgcattttga
OVRM1_0209_H08.b :
CBLT1_0082_D10.b : aattacaccagtctattggccataaaaagtttttcccaacctctggcccgcattttgaat
ITT01_0021_A06.b : AATTTACACAGTCTATTGGCcagnaangatgttttctcatccttcntgctctgcattttg
THY01_0206_A11.b : AATTAAAACAGTCtattggcccagtaagatgttttttctcattccttccttgctccgcat
SPL01_0075_G05.b : AATTaaaacagcctatgggccagtaaaaagtttttcccatccttcttggcccgcg
SKNB1_0015_C05.b : AATacaacagtctattggccagtaagaagtttttctcctccctcctgctctgccttttgg
THY01_0015_C05.b :
BMWN1_0037_D03.b : caattgccaaaaaaaggttttcccaccctcctgccccgcttttaaatgttccggaaccct
DCI01_0023_C08.b : caacctctggccgcattgatgttcagaaactttgataacattgcttaacaaccggccgcc
ITT01_0061_E12.b : atacacagtctatggccagtaagatgtttctcaaccttctgctcgcatttgaatgttcca
ILNT1_0091_F06.b : attacaacagtctattggcccataagatgtttttctcatccttcttgctctgcattttga
THY01_0203_H12.b : AATTAAAACAGTCtattgggccagtaagatgttttttctcattccttcttgctcttgcat
AMP01_0034_B06.b : cgggcaccaaaagctttactaaacattcgtttggccccggggcccaaaagaaagtgaaca
AMP01_0069_A11.b : ataaaaccgtctattggccanaagaagttttcccatccctccccccctgcatttgaaatg
BKFL1_0028_H12.b : ttttggccccggcccagggaaagaaaaggccaaccttcccaaaaaaccggccaaaaaggt
ADR01_0064_D08.b : ttaaacagtctattggccagtagagtttttcccatcctctgctctgcatttgaattgttc
MLN01_0051_A07.b : AATTAAAACAGTCTATTGGCcagtaagaagtttttctcatccctcttgctctgcattttg
BKFL1_0011_D03.b : aacagtctatggccagaagaagttttccaactttctgcccgcatttgatggtccggaaac
THY01_0007_F10.b :
OVRM1_0058_B04.b :
ITT01_0023_E09.b : AAATTACACAGTCTATTGGCcagnaagatgnttttctcatccttcntgctctgcattttg
UTR01_0026_E07.b :
PBL01_0022_G11.b : AATTTACACAGTCTATTGGccaaaagaagttttctcatccntctgctctgcatttngaat
HTMT1_0005_G11.b : AAATAAAACAGTCTATTGGCCAGTAAGATGTTTTcccatccttcctgctctgcatttgaa
20110601C-007152 : ............................................................
---------+---------+---------+---------+---------+---------+ 1055
OVRM1_0199_C11.b :
ADR01_0069_G09.b : aatgtccagaaaactttgaaaaagcagttgcattaaaacaactggtactggctaaaattt
ITT01_0017_A03.b : gtccagaagacttttgaatagcagttgcatttaaacatcgggacctggctaagagttccc
OVR01_0020_A06.b : attttttgaaatggttcccatgaaccacctttttaaaataagccaagttttgcattttta
MLTL1_0017_G08.b : aagggtggatctcccaaaaaacgcggggaacagggttaaaaacagggtttgggttttggt
OVRM1_0023_B10.b :
ITT01_0017_G07.b : tggtccatgacccctttgaaaagcagttgcattaaaacatctggtactggctaagagtat
LVRM1_0146_E04.b :
ITT01_0042_G11.b : ttgttccagaaaactttgaataagccagttgcatttaatacaatctggtacctggctaaa
PST01_0019_F09.b : tggtccaatgaccacttttgataaaccagttgcatttaatacatctggtacctggctaag
SMG01_0051_C08.b : aatggtccaggaaacctttaaaaaacccattgaatttaacacattcgggccccggctaaa
ILNT1_0073_D04.b : ttatgaataaaagcgtggatattaacgancgggacatgtccttagaattaccggaatctt
BMWN1_0007_C12.b : ttgttccaggaaaccttttaaaaaaaacgttggctttaaaaaaaccggggcccggggcaa
TCH01_0010_H02.b : gtccagaaccctttgaataacatttgcattaaacaatctgnaactggctaaaatttccgg
AMP01_0045_F07.b : gtatatataacaccgggcccggggaaaaggttcgggaaaatttaaatttgtaaaacctcc
DCI01_0046_C12.b : tgtcccaggaacctttttaa
PBL01_0031_D01.b : cccaggaaacttttgataagcatttgctttaaacaactggtactggctaagattatcagg
SMG01_0053_D07.b : gggttttaaaacacggggccgcggaaaaatttcggggtttttttaattttatatttcccc
ITT01_0060_H06.b : gtccatgacacttnntgatanncagttgcattnataccacctggtactggctaaganttt
ITT01_0029_E10.b : tccatgaacacttttgataagcaatttgcattaatacaatctgtacctggctaaaagtta
ITT01_0021_D03.b : gaatgttccatgaacacttttgataancagtttgcattaatacaacctggtactggctaa
UTR01_0101_F05.b : attgtccatgaaccctttttgataagcagtttgcatttaaacaacctgggacccggctaa
ADR01_0072_E08.b : atgttccatgaacactttgataagcagtttgcattaaaacaacctggactggctaaagag
ADR01_0025_F09.b : ttttaaaaaccatttgtttttaaacaacgggaccggcaaaaaattccgggataaaattat
UTR01_0069_E03.b : gctttttgaaattgtttccctgaaaaccttttttgaaaaaaccagtttttgccttttaaa
OVRM1_0150_A08.b :
OVR01_0076_A12.b :
OVRM1_0064_A03.b :
OVRM1_0080_C10.b :
SMG01_0005_C12.b : aattttaaaaaacaatttggattaaaaaaccgggacccggcaaaaagattccggttaaag
MLN01_0018_G06.b : acctttgctttaacaaccgggccggtaaaaattcccggaaagttaaattgaattatcccc
PBL01_0025_F07.b : actttgatagcagttgcattaaacatcggtactgnctaagagtacaggtaagttaaattg
ITT01_0031_F05.b : aattgtccatgagacttttgaataacagtttgcatttaatacatctggtactggctaaga
ITT01_0094_A06.b : catgaagactttgaatagcagttgcatttatacatctggtactgcctaggagtacaggta
CLNT1_0059_A03.b : cccggaaccttttgaaaagcgatgttgatttaaaaaatcgggaacttggtaaagaatttc
PBL01_0017_E07.b : tgttccatgagaacttgaaatagcatttgcattaatacaatcggtacctgccaaagagtt
MLN01_0056_C07.b : ctaaacttcaggttccggccccccctaaaattccccccaggggcccacagtttacgcgta
UTR01_0104_C07.b : ccggcattttgaaattggtccaggaaacaccttttgaaattagcacgtttggcatttaat
CLNT1_0042_B04.b : ttgttcatgaaaccttttaataagcagttgcatttaaacaaccggtacctggctaaagag
ITT01_0031_D05.b : gtccatgaacactttgaatagcagttgcatttaaacatctggtactggctaagagtatca
ITT01_0005_F02.b : atgttccagaagaacttttgaatagcagttgcattaaataaatctggtaactggctagga
THY01_0053_H09.b : tttttaaaatggtttccttgaaaacttttttaaaaa
OVR01_0002_A01.b : ttcttgcatttttgaaattgtttcccatgaaaacacttttttgaaaataaagcaagattt
OVRT1_0033_D01.b : attgtcccagaaaaactttgaaaaacagtttgcatataacaatctggacctggcaaaaag
ITT01_0009_H03.b : aattgntcccatgagactttggaataacaggttgcatttataacatcctggtactggcta
BMWN1_0024_B02.b : ccgattccccttgggggttattgatccaaaggaaaaaactttatgattgggcacccccct
ADR01_0006_B12.b : ccagaaaactttgaaaaaccatttgcatttaaaaaaacgggtacctggcaaagattacca
ADR01_0102_A02.b : tgacccttttgaatagcagttgcatttaaaacatctggtactggctaaagttatcaggaa
ADR01_0059_H05.b : atgntccatgaggacttttgaatagcagttggcattnataacatctggtactggctaaga
OVRM1_0209_H08.b :
CBLT1_0082_D10.b : gttccaggaaaacttggaaaaaccgtttgcattaaaacaaccggaaccgggtaagaagtt
ITT01_0021_A06.b : aatgttccatgaagacttttgaataagcagtttgcatttaatacaatctggacctggcta
THY01_0206_A11.b : ttttgaaattgtt
SPL01_0075_G05.b :
SKNB1_0015_C05.b : aatggtccctgaagacttttgaaaaacactttgt
THY01_0015_C05.b :
BMWN1_0037_D03.b : tttaaaaacctttggattaaaaaatcgggaccggcaaaagtttcgggaaattttaatttt
DCI01_0023_C08.b : taagattccgataattaatgtatattcccccacaaaaggccgcaaaaaaaaaaaaaaaaa
ITT01_0061_E12.b : tgagactttgaataccagttgcataatacaatcggtactggccaaaagtaccggttaaat
ILNT1_0091_F06.b : attgtccctgaagacttttaaatacccatttggattaaataaatccggtacctgcctaaa
THY01_0203_H12.b : ttttgaattggtcccttgaaaccttttttaaaaaaacccattttgtcattttaaaaaaaa
AMP01_0034_B06.b : tggccttactgtttaccaggaaaccgggaaggatagggctggatccccacaaaaaaaggc
AMP01_0069_A11.b : gtcacgaacactttgaaaaggcagttgcattaaacaaactgggtcctggctaagagtttc
BKFL1_0028_H12.b : ggattccccaaaaaaacccgggggaacaaggttaaaaaccaaagggttggggttttggtt
ADR01_0064_D08.b : catgagactttgaatagcagttgccattataacatctgtactgnctaggagtatcaggta
MLN01_0051_A07.b : aattgttccatgaacacttttgaaataccattttgcatttaaaacaaccggtactcggct
BKFL1_0011_D03.b : tttgaaaaacgttgctttaaaaactcggcccggcaaaagttccggttatttaattttttt
THY01_0007_F10.b :
OVRM1_0058_B04.b :
ITT01_0023_E09.b : aatgntccatgaagacnttttgaatagccattggcattttatacatctggtaactggcta
UTR01_0026_E07.b :
PBL01_0022_G11.b : gntcccatgagacttttgaatagcagtttgcattaataacatctggtacctggctaagga
HTMT1_0005_G11.b : atggtccatgaacactttttgaatagcaggttgcattaaatacaatcgggtacctggcaa
20110601C-007152 : ............................................................
---------+---------+---------+---------+---------+---------+ 1055
OVRM1_0199_C11.b :
ADR01_0069_G09.b : tcaggtaaantttatttggattaatcaccccttaacaaaaggggacgttaaacaaaaaaa
ITT01_0017_A03.b : ggtaaagttaaatttgaaatatccacccccaacaataagggaagttaaaccaaaaaaaaa
OVR01_0020_A06.b : aataacaatttcttggggtacccctgggggtttaaaaaaaaatttttttttaaggggaaa
MLTL1_0017_G08.b : tttcagggcggcccttataatcccccccccccccgggtttataattccggaaccacaaaa
OVRM1_0023_B10.b :
ITT01_0017_G07.b : cagaaaagtttaattggataattcacatctacataagtggcgttaaacaaaaaaaaaaaa
LVRM1_0146_E04.b :
ITT01_0042_G11.b : aattatccggttaagtttaaattggaaattattcaccttctaacattaaggtgcaggtaa
PST01_0019_F09.b : agagtaccagaaatagtttaattggtaataatccaccccctaccaataagggcagttaaa
SMG01_0051_C08.b : agatttcgggaaaaagtttaattggaaatatatcccccctccaataaaggggccgttaaa
ILNT1_0073_D04.b : ataagttgtagatttctccaacgcagaaggaaggaggtgtttaggattatgaagaagaga
BMWN1_0007_C12.b : aaatttcgggaaaatttttattttgtgttatattccccccccccaaaaggggcggttttt
TCH01_0010_H02.b : aatagtttaatttggattaattcacct
AMP01_0045_F07.b : cccctcaaaaaagggg
DCI01_0046_C12.b :
PBL01_0031_D01.b : taaatttatttggattaatcacccctaaaaaagggaacgtaaacaaaaaaaaaaaagcca
SMG01_0053_D07.b : cttcaaaaaagggggggtaaaaaaaaaaaaaaaaaaaaaaaagctttgttttcatgtggg
ITT01_0060_H06.b : tcggaataagttaaatttgaattantcaacccctacaaaaggtgccgtaaacaaaaaaaa
ITT01_0029_E10.b : ccgggaaagtttaatttgtaattatttcacatccaacaatagtgacggttaaacaaaaaa
ITT01_0021_D03.b : agagttatcagaataagttaaaattgtattaaatccccatccaacataagtgacgttaaa
UTR01_0101_F05.b : ggatttccgggaaatagttaatttggaattatttccc
ADR01_0072_E08.b : ttaccggaaaaagtttaaattgnaaataatccccccctcaaaaaaagggccagtttcccc
ADR01_0025_F09.b : ttggaaatttccccccccaacaaaaggggcgttcaaaaaaaaaaantaataantattaaa
UTR01_0069_E03.b : aacaaattcggggtaccccctggcctaaaaaaagttttttttcggggaataaaaagtttt
OVRM1_0150_A08.b :
OVR01_0076_A12.b :
OVRM1_0064_A03.b :
OVRM1_0080_C10.b :
SMG01_0005_C12.b : ttaaattggaataattccccctttaaaaaaagatgcctttaaaaaggtttttaaaaaaaa
MLN01_0018_G06.b : ccccaacaaacgcacgttaaaaaaaaaaaaaaaaaaaaaaggccttgtccgactcggccg
PBL01_0025_F07.b : gaatatcacctcaaaaaaagacgttaaacaaaaaaaaaaaaggcattgctcactgagtcg
ITT01_0031_F05.b : atatcaagttaaaggttaatttggaataatccaccntcaaccataaaggacgttaaacaa
ITT01_0094_A06.b : aatttaaattgattaatcaccttcagcaataatgacgttaacaaaaaaaaaaaagccctg
CLNT1_0059_A03.b : cggaaaaattttaatttagattattccccccctaaattaaggggccgtaaacacaaaaaa
PBL01_0017_E07.b : ccgggtaaaatttaaattggaataattcccccccaacataaaaggccgttaaaccaaaaa
MLN01_0056_C07.b : cccgcttttctggtaaaagggggcctctaagggagcctatataaaaccagggcctgggcc
UTR01_0104_C07.b : aaaatctgggaaccctggcttaaagaattttcaaa
CLNT1_0042_B04.b : tttcgggaataatttaatttggaattatcccccccctaacataaagggacgtttaaaaaa
ITT01_0031_D05.b : gaaaaagttaaattgtattatccacccctaacataagtggcgttacccnnnnaaaannaa
ITT01_0005_F02.b : gttaccaggtaaattaaatttgaaattaatcaccctccaacaataaggtgacgttaacaa
THY01_0053_H09.b :
OVR01_0002_A01.b : ttgcattttttaaataaacacaatcttggggtatacccct
OVRT1_0033_D01.b : ttccgggttaaattaaaattgaaataatccaccctctacaaaaggggcctttaacaaaaa
ITT01_0009_H03.b : aaggagtaccaggttaagtttaatttgtaattnattcaccatcccacaataagggcacgt
BMWN1_0024_B02.b : aaaggcggaaaaagctttttggaattgggggcttcttttttaaccataagcgaaaaaatt
ADR01_0006_B12.b : gggttaaatttaaatgtgaattattcaccctccaacaaaaagtgacggtttccccnnnaa
ADR01_0102_A02.b : aagttaaatttgtattattccacatctaacaataaggacgttaaacaaaaaaaaaaaaaa
ADR01_0059_H05.b : attttcagggtatatttaatttggaataattccccctcaacactaagtgcaggttaacaa
OVRM1_0209_H08.b :
CBLT1_0082_D10.b : ccgggaaaatttaatttgaaataatccaccctcaaaataaggtggcgttaacccnngaaa
ITT01_0021_A06.b : aagaagtatcaggttatagttaaattgaaattaatcaccctccaaaaaaaagtgacgtta
THY01_0206_A11.b :
SPL01_0075_G05.b :
SKNB1_0015_C05.b :
THY01_0015_C05.b :
BMWN1_0037_D03.b : tattatctcccctctaacaaaggggcctttaaaaaaanaaagaaaagaataaaagcnann
DCI01_0023_C08.b : ggtgccccgccctaaatttaatttttggcggcccaagaaagaaaaattttaaacagggaa
ITT01_0061_E12.b : taaattggaataatccccctcgacaaaagggcggtaaacaaaaaaaaaaaagccctgggt
ILNT1_0091_F06.b : aagtaacgggttaaagttaaatttgaatttattcaacctctaaacaaaagtgacggtttc
THY01_0203_H12.b : tcgggggtcccggggcaaa
AMP01_0034_B06.b : ccgggggcaccggaggtttaaaaaaccaaggggtgttggagtgttttggtttttaaaggg
AMP01_0069_A11.b : cgaaaatttaaatttgtattc
BKFL1_0028_H12.b : tatacaaagcccccgccctattattccccccccgccccccgagtggtttataaatcttgc
ADR01_0064_D08.b : agttaaattggaaatatcaccatcaacataaaggacgtaaacaaaaaaaaaaaaagccac
MLN01_0051_A07.b : aaaagttatcgggaatagtttaatttggaattaattaccctcctaaataaagtgaagtta
BKFL1_0011_D03.b : ttccccctcacaaaggggcggtcccccccnnnaaaaannaaaaannnnnaaaaaaaaaaa
THY01_0007_F10.b :
OVRM1_0058_B04.b :
ITT01_0023_E09.b : aagagtactcaggtaaagtttaaattggaaataatccacctccaacaataagggacgttt
UTR01_0026_E07.b :
PBL01_0022_G11.b : gtatcaggtataattaaatttngtantanntcacatctacaataagtgacagtaaaacaa
HTMT1_0005_G11.b : agaagtatcaggaaaagtttaaatttgtaataaatcaaccatctaacaataagtgacagt
20110601C-007152 : ............................................................
---------+---------+---------+---------+---------+---------+ 1055
OVRM1_0199_C11.b :
ADR01_0069_G09.b : aaaaaaaaaggccctttgctaaacttagggcggcccccttaaatccccgggggccaaata
ITT01_0017_A03.b : aaaggccattggcccaacgggggccggccccttaagatccctcgggggcccaattaacga
OVR01_0020_A06.b : aaattattaatttttttt
MLTL1_0017_G08.b : aaacccgcccttcctttttttggggggagggggttggccggaaaaaagagncnnnnnnnn
OVRM1_0023_B10.b :
ITT01_0017_G07.b : aaggcccagtgctcaactgaggcgcgcctcttaattcctcaggggccaacttacgacccc
LVRM1_0146_E04.b :
ITT01_0042_G11.b : acaaaaaaaaaaaaaaaagggccatgtgttcaagcttaggttcggccgcccttaaaatcc
PST01_0019_F09.b : aaaaaaaaaaaaaaaggccattggtccaattgagtcggggcccttatattttgaaaacac
SMG01_0051_C08.b : caaaaaaaaaaaaaaaggcccttttttccagagtgagtgcgcgcccctttaatatcctta
ILNT1_0073_D04.b : agataacaaaataaaactaataaacgaccactcagatagcgcctatcagtgagctgcgcc
BMWN1_0007_C12.b : nnnnaanannananaaaannanaaaannnnnnannnannnnnnannnnnnnnnnnnaaaa
TCH01_0010_H02.b :
AMP01_0045_F07.b :
DCI01_0046_C12.b :
PBL01_0031_D01.b : atggccaactgaagtcggccctcaaattccccgaggccaatttacaacccttttttaaag
SMG01_0053_D07.b : gggcccttaaattccccggggggcaaacaccccccttttttaaggggccccaaggattat
ITT01_0060_H06.b : aaaaaagccactggctccactaggtccggcgctctaaaccccaggggccactacccacac
ITT01_0029_E10.b : aaaaaaaaaaaaaaaggcccagtgctctaactggggtccggcccctaagaattccttagg
ITT01_0021_D03.b : ccaaaaaaaaaaaaaaggccattggcccaactgcggtccggcccctttagatatcctcgg
UTR01_0101_F05.b :
ADR01_0072_E08.b : nnaaaaaaaaaaaannnnnnnnnnnnnnnanaanaannnnnnnggggccttggtccaaat
ADR01_0025_F09.b : ataaaaggcccttggctctaatgagggcgccccccaaattcctcggggccaattataaaa
UTR01_0069_E03.b : tattaaaatttttgttaaaattttaaatttttctaacccccccccttctcttaataaa
OVRM1_0150_A08.b :
OVR01_0076_A12.b :
OVRM1_0064_A03.b :
OVRM1_0080_C10.b :
SMG01_0005_C12.b : aaaaaaaaaaaaaggccactggttttaagttaggcgcgccccttttaaaatacctggggg
MLN01_0018_G06.b : gccccccaatacctcgggcccactaccccccttttataaaggtcccagggagttaaaaca
PBL01_0025_F07.b : gcctctaaatctcagggccagtaagaacacttttaaaggcccagggggtaaaaagccgcc
ITT01_0031_F05.b : aaaaaaaaaaaagcccatgggctagctgcgggcgggcccctcaaaaacctcagaggccaa
ITT01_0094_A06.b : gcccacctcggtccggccctcaaaatcttcggggcacttaccaacccttttgaaagaggc
CLNT1_0059_A03.b : aaaaaagggccgtgggccaattgaggtgggccctaaaaatcttaaaaaaaaccccacccc
PBL01_0017_E07.b : aaaaaaaaaaagcccttgggcccacctgaggtccggccccctaaataccccggggggcaa
MLN01_0056_C07.b : ctcttttataacacc
UTR01_0104_C07.b :
CLNT1_0042_B04.b : aaaaaaaaaaaggccactgttcccacttagggccggcccttaatattttaaaaaaacccc
ITT01_0031_D05.b : aaaaaaananaaaaaaaaaaaannnnnaaaaaggccttgtctaccccgggggcccctaaa
ITT01_0005_F02.b : ggaaaaaaaaaaaaaaagggcccttgggctcactgcaggcccggcccttaaaatccctga
THY01_0053_H09.b :
OVR01_0002_A01.b :
OVRT1_0033_D01.b : aaaaaaaaaaaaaaaaaaaaaggcccattgtcaaattgggggcgcccataaattttaaaa
ITT01_0009_H03.b : aaaccaaaaaaaaaaaaaggccctttggccaattgcagtccggccccctcaaataccctt
BMWN1_0024_B02.b : aaacattttttttttttgtgggggggggggggtttttctataaaccacccgggggggggt
ADR01_0006_B12.b : aaaannaanaaaaanaaaaaaataaaaaaaaaaggccaattttctaacgcaggtcggccc
ADR01_0102_A02.b : aaggccatgtgttcactgggggcgggcccctaaattctctggggccaactaggcaccact
ADR01_0059_H05.b : aaaaaaaaaaaaaaagggccatgtggctaactgggtcgggccccttaaattccccgaggc
OVRM1_0209_H08.b :
CBLT1_0082_D10.b : nanaaaaaaaaaaaaaaannaaaaacgcgcccaaccaccccnnnnggaaaaaccaccccc
ITT01_0021_A06.b : aaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaagagcccattggctcaatcgggtcg
THY01_0206_A11.b :
SPL01_0075_G05.b :
SKNB1_0015_C05.b :
THY01_0015_C05.b :
BMWN1_0037_D03.b : tagnngaannnnnnnnnnnnnaaaaagcgccgccccccttctttgggggtttgtctcaaa
DCI01_0023_C08.b : ggtgttccaaaaccggcgggttaaaaagtgttgtttttaaagaccaataccccccccatt
ITT01_0061_E12.b : ctagtggggtcgcgcccttaataatctcagggccaactaccgtaccccttttgtaaaggg
ILNT1_0091_F06.b : cccnnnnanaaangannaaaaaaaannaanaaaaananangaaaaagaaanaannnccnn
THY01_0203_H12.b :
AMP01_0034_B06.b : gccacggagcttataaatccccccccccccccccgggattttttaatttacatctgccag
AMP01_0069_A11.b :
BKFL1_0028_H12.b : acaacac
ADR01_0064_D08.b : tgggctcactgcggccggccctcctaaacctccggggccagataacgaccccttttgaga
MLN01_0051_A07.b : aaacaaaaaaaaaaaaaagccctttcttcaactcgagtcggcgccccaaaaatcctgagg
BKFL1_0011_D03.b : aaaggggggaaaaaaaaaaaatgggcgccccccaattaaaatttggggcggaagaaggtt
THY01_0007_F10.b :
OVRM1_0058_B04.b :
ITT01_0023_E09.b : aaacaaaaaaaaaaaaaaggcaatgggcccaaactcaagtcgggcccctcaaaaatcctg
UTR01_0026_E07.b :
PBL01_0022_G11.b : aaaaaaaaaaaggccattgcctcgactgcagttcggcccctcaaattactcaaggggaag
HTMT1_0005_G11.b : aaaaccnnnnannnnnnanannnnnaaaaannaaannnnnnnnnngtccgcggcccaatc
20110601C-007152 : ............................................................
---------+---------+---------+---------+---------+---------+ 1055
OVRM1_0199_C11.b :
ADR01_0069_G09.b : taccacccattttgttaaggg
ITT01_0017_A03.b : acccttttggtaaagggccccaaggacatataaaaagacggggcttttacaccgtgggaa
OVR01_0020_A06.b :
MLTL1_0017_G08.b : nnnnnngnccccctctcggattggttgttttttant
OVRM1_0023_B10.b :
ITT01_0017_G07.b : cttttgttaaaggcccaaaagagcaataaacaagacggcgctttaaacccgtgggaaaac
LVRM1_0146_E04.b :
ITT01_0042_G11.b : ctcgaggggccaactttaactaaccacttttttgtaaaaggggcccctagggagcgataa
PST01_0019_F09.b : cccccccccccgaacgcaacaaaagaagcagtgtgtgtactgttttggccttagggtcaa
SMG01_0051_C08.b : aggccaaaatatacgcaaccttttttgtaaagggcccttaggaggaaaataaaacagcgc
ILNT1_0073_D04.b : cgtctgttatatggtatagatcctcatagaagtcaaatagactgatcaacgagaaagcaa
BMWN1_0007_C12.b : aaaaacgcgcccctctcttctctgtggtgtgtgtcccccaaaaaaaaatattgtgggccc
TCH01_0010_H02.b :
AMP01_0045_F07.b :
DCI01_0046_C12.b :
PBL01_0031_D01.b : gcccaaaggggcataaacaagccggcccttaacccttatggaatcattggattttgaact
SMG01_0053_D07.b : aaaaggggcgtctttttctcggggaaaacacgtgttttaaaaaaatcggggggggccacc
ITT01_0060_H06.b : ctcttgaagaggcccaaaggacgatataaagccgggcctttaccctcgggaaccactgtg
ITT01_0029_E10.b : ggccagttatacgaaccctttttgtaaaagggcccaaaggagcaatataaacagcagcgc
ITT01_0021_D03.b : gggccaacttaacgaaaccctttttggaagagggccatagggacaaataagaggccgggg
UTR01_0101_F05.b :
ADR01_0072_E08.b : ggggcggccccttaaaatacccgggggccacctaccaccccttttttaaaggggcccata
ADR01_0025_F09.b : ccttttgttaaaggcctcagggataataaaacgcgcggccttttatactaggaaaaaact
UTR01_0069_E03.b :
OVRM1_0150_A08.b :
OVR01_0076_A12.b :
OVRM1_0064_A03.b :
OVRM1_0080_C10.b :
SMG01_0005_C12.b : cgcaatataacaaccaccttttttaaaggggcccctatagggctaatataaagacgcgc
MLN01_0018_G06.b : cctgccccttccccctggggaaccaccgtctttgaatccttctggcggtccacccccatt
PBL01_0025_F07.b : cttttaccgtggaaatccttgtttagaacttggggaatgaaccccaaaacggaaaatttt
ITT01_0031_F05.b : cttaggaacccctttttgtaaaggggcccaaagggctaataaaaagccggcgcgctttat
ITT01_0094_A06.b : caagggggatataaggccgggctttcacccgggggaaaacatgtggtttgaaacattttg
CLNT1_0059_A03.b : cccggacaaaaaaaaaagaggattgtggtcattgttttggcctttgggcaaaaaaacaac
PBL01_0017_E07.b : ttttcccacccccttttgttaaggggccccaaagggcgtaataa
MLN01_0056_C07.b :
UTR01_0104_C07.b :
CLNT1_0042_B04.b : cccctccccgaacggaaaaaagaggcattgttgtgttttttttccctatagggaaaaaaa
ITT01_0031_D05.b : atcctgggccgactacaaccccttttaagggcctcagggggtataacagcggggccttta
ITT01_0005_F02.b : gggccaaattaacgtaccagtttttgaaaaggggcccaaagaggctataaaacaggaggg
THY01_0053_H09.b :
OVR01_0002_A01.b :
OVRT1_0033_D01.b : aaccccccccccccgaacaaaaaaaaaaaagttttgtgtacttttttcccttggggcaaa
ITT01_0009_H03.b : aggggccagcttacggtccaccttttggaaaaagggcccctagaggcgcatttaacagga
BMWN1_0024_B02.b : gttggccccctcccaaaccgcgggggggggggggccctcgggggttccatgagaaaaaaa
ADR01_0006_B12.b : cttaaattccctggggccaactatacacaccccttttttaaagagtcctaaaagt
ADR01_0102_A02.b : tttggaagggccctagggacattaagcagagcggccctttaccaccgtgggaaactcttg
ADR01_0059_H05.b : ccaaatatccaccccttttttgtaaagggcgccaaa
OVRM1_0209_H08.b :
CBLT1_0082_D10.b : tcccccccccccctccttgagggtgttgctcacaaaaaaaatgttggtggaaaccccccg
ITT01_0021_A06.b : gccctctaaattctctgggggcaaattaacgaacacctttttgaaaagggccccaggggc
THY01_0206_A11.b :
SPL01_0075_G05.b :
SKNB1_0015_C05.b :
THY01_0015_C05.b :
BMWN1_0037_D03.b : aaaaactgtttggggcacccccaggcggaaaaccttttggagtgggtgtttttaacaaag
DCI01_0023_C08.b : tat
ITT01_0061_E12.b : cccaagagacattaaaagagcgggcgcctttaaccggacggaaaacacttgtatttaaaa
ILNT1_0091_F06.b : nnannnngtaaaggcccggccgcccactctccttgggggggtttcgcccacaaaaaaaaa
THY01_0203_H12.b :
AMP01_0034_B06.b : cgacccacc
AMP01_0069_A11.b :
BKFL1_0028_H12.b :
ADR01_0064_D08.b : agggcccaaggggcaataagaggcgcggcctttaaccccgcggaactcctctggatcttg
MLN01_0051_A07.b : ggcagcttccctacccttttttgaaagggccctagagtcaataaaagaaggcggctttaa
BKFL1_0011_D03.b : ttttaatttttaggtttaaaccgcccgaaagggttgtttgagaaaacccccnnnnnnnnn
THY01_0007_F10.b :
OVRM1_0058_B04.b :
ITT01_0023_E09.b : gagggccagttatccaacccattttttgaaaaggtcccaaaaggaccatattaaaagggg
UTR01_0026_E07.b :
PBL01_0022_G11.b : ctaccgaacaactttttgaaaaggccccatggagcaataaaacagccggcgccctttaat
HTMT1_0005_G11.b : cccttgggggggttttcgccccaccgaaaaaaattggaattcgaaaccacacacaggggg
20110601C-007152 : ............................................................
---------+---------+---------+---------+---------+---------+ 1055
OVRM1_0199_C11.b :
ADR01_0069_G09.b :
ITT01_0017_A03.b : aatccttgtgtttttaaac
OVR01_0020_A06.b :
MLTL1_0017_G08.b :
OVRM1_0023_B10.b :
ITT01_0017_G07.b : tcttggttttgtaaac
LVRM1_0146_E04.b :
ITT01_0042_G11.b : aaaagggcggggcgcgttttacccggcgggg
PST01_0019_F09.b : aaaaaacctccaattcaaaaagttttttcgactcgggggtggaacacaggatttattggg
SMG01_0051_C08.b : ggccccttttaacccgggggaaaaaccttttgtatttgaaaaaactattgggggaaataa
ILNT1_0073_D04.b : aacttaattggttagtacgtctaagtatcgacaaacggacagacagaaattgatattgta
BMWN1_0007_C12.b : aca
TCH01_0010_H02.b :
AMP01_0045_F07.b :
DCI01_0046_C12.b :
PBL01_0031_D01.b : ctctggggcttggaaacccaataaccgggaaaattttgaggtgacccgctgcgccgtctt
SMG01_0053_D07.b : ccaaacggcgaaataatttttgccaaccgcggggcgtgaaaaaaaacatgttt
ITT01_0060_H06.b : tttgtagaaactctggggaagggcacccacaaaaccggaaaaattttgttgtcccccgcg
ITT01_0029_E10.b : gctct
ITT01_0021_D03.b : gccttttcacctcggcggaaaacccttggtacttgagagccttctcggtggaattgaaac
UTR01_0101_F05.b :
ADR01_0072_E08.b : gggataataaccgggg
ADR01_0025_F09.b : tgtattttgaaaatcttgtggg
UTR01_0069_E03.b :
OVRM1_0150_A08.b :
OVR01_0076_A12.b :
OVRM1_0064_A03.b :
OVRM1_0080_C10.b :
SMG01_0005_C12.b :
MLN01_0018_G06.b : cgctgaatactccctgtcacccgctcgccgatttccataacaacacaccgattgtgtatc
PBL01_0025_F07.b : ggttaccggcgggttcgatataacaaatttttaaacagccccccccacntttcccccatg
ITT01_0031_F05.b : caccgagggaaatctcctgtattttagaacctttttgggggaatggaaaccccaaatagc
ITT01_0094_A06.b : tgaatgacaccccataaccgaaaaatttgtgggaccccgcgcgtttctattaaaaaaaac
CLNT1_0059_A03.b : cccttttaaaaaaattttttcggttg
PBL01_0017_E07.b :
MLN01_0056_C07.b :
UTR01_0104_C07.b :
CLNT1_0042_B04.b : aaaccccattctcaaatcttttctttttttggg
ITT01_0031_D05.b : aaccggaaactcctgtttttaaactttgggggatgaaacccaattccggaaattttgg
ITT01_0005_F02.b : gcgcttttaagcgggagga
THY01_0053_H09.b :
OVR01_0002_A01.b :
OVRT1_0033_D01.b : aaaaaccccctttcaaat
ITT01_0009_H03.b : ccggccgttttaacacccgtgggaaaaactccgtgggtttttgagaaacctttcggggga
BMWN1_0024_B02.b : aaaaaaaaaggttttttccccccccgaagaaaaactttcctcttcttctctcgtcctt
ADR01_0006_B12.b :
ADR01_0102_A02.b : gttttttaaactctcgtggtaa
ADR01_0059_H05.b :
OVRM1_0209_H08.b :
CBLT1_0082_D10.b : gggaaaaaattttttaattgtgtttttttttatataacaaaagaaaaaatttttttttgt
ITT01_0021_A06.b : gcttaaagaggcgggcgcctttttacccctgggaaaaatctgtggttttt
THY01_0206_A11.b :
SPL01_0075_G05.b :
SKNB1_0015_C05.b :
THY01_0015_C05.b :
BMWN1_0037_D03.b : aaaaaaacaccagtt
DCI01_0023_C08.b :
ITT01_0061_E12.b : ccctctggtggcatggacacccaatattctcaga
ILNT1_0091_F06.b : tttttgttggtggacacccactgaggggaagaaagtgttttgtgagaaggtggtcgtttt
THY01_0203_H12.b :
AMP01_0034_B06.b :
AMP01_0069_A11.b :
BKFL1_0028_H12.b :
ADR01_0064_D08.b : aaaccttctggggcattggccacccaataacccggaaaaattggggggcaccccacccgc
MLN01_0051_A07.b : cctgacgaaagc
BKFL1_0011_D03.b : accccccccnnnnngaagatatattgttgtagant
THY01_0007_F10.b :
OVRM1_0058_B04.b :
ITT01_0023_E09.b : gggcgttttaacccggggggaaaattccctggattttgaagaacatttttgggggaattg
UTR01_0026_E07.b :
PBL01_0022_G11.b : ctgatggaacagcattggaatttgaaaacttttttgggggaatggacacccccaataagc
HTMT1_0005_G11.b : aaaaagctttttggaaagggagatttttttttaccttaggccgaaaataaacacaaaggt
20110601C-007152 : ............................................................
---------+---------+---------+---------+---------+---------+ 1055
OVRM1_0199_C11.b :
ADR01_0069_G09.b :
ITT01_0017_A03.b :
OVR01_0020_A06.b :
MLTL1_0017_G08.b :
OVRM1_0023_B10.b :
ITT01_0017_G07.b :
LVRM1_0146_E04.b :
ITT01_0042_G11.b :
PST01_0019_F09.b : ccggcgagacaatattttctctccatagaggggcgtggggggagaa
SMG01_0051_C08.b : aaaacaccaaatataccggt
ILNT1_0073_D04.b : gcgtgaggtgctgatcatacaaactataatctacaacgtatagtatag
BMWN1_0007_C12.b :
TCH01_0010_H02.b :
AMP01_0045_F07.b :
DCI01_0046_C12.b :
PBL01_0031_D01.b : ttaataaaaaacaaattgtttcacaccccccccccccct
SMG01_0053_D07.b :
ITT01_0060_H06.b : ccttcttgtaataaaacacaagttttgtttacccgccccccccnnnccttgttcccagag
ITT01_0029_E10.b :
ITT01_0021_D03.b : ac
UTR01_0101_F05.b :
ADR01_0072_E08.b :
ADR01_0025_F09.b :
UTR01_0069_E03.b :
OVRM1_0150_A08.b :
OVR01_0076_A12.b :
OVRM1_0064_A03.b :
OVRM1_0080_C10.b :
SMG01_0005_C12.b :
MLN01_0018_G06.b : ccctgtccccctccgatcctgattacacccacaagttgttaacacaattccttccgctag
PBL01_0025_F07.b : ttataatctctgctccnnnnnnnnnnnnnnnnnnnnnnnnc
ITT01_0031_F05.b : ccga
ITT01_0094_A06.b : aattttttcccccccccccccccacc
CLNT1_0059_A03.b :
PBL01_0017_E07.b :
MLN01_0056_C07.b :
UTR01_0104_C07.b :
CLNT1_0042_B04.b :
ITT01_0031_D05.b :
ITT01_0005_F02.b :
THY01_0053_H09.b :
OVR01_0002_A01.b :
OVRT1_0033_D01.b :
ITT01_0009_H03.b : aaaaa
BMWN1_0024_B02.b :
ADR01_0006_B12.b :
ADR01_0102_A02.b :
ADR01_0059_H05.b :
OVRM1_0209_H08.b :
CBLT1_0082_D10.b : ggggggggggg
ITT01_0021_A06.b :
THY01_0206_A11.b :
SPL01_0075_G05.b :
SKNB1_0015_C05.b :
THY01_0015_C05.b :
BMWN1_0037_D03.b :
DCI01_0023_C08.b :
ITT01_0061_E12.b :
ILNT1_0091_F06.b : tttcacacacacccacaaaatataccactttcttttttttgttgggggggggggggtgtt
THY01_0203_H12.b :
AMP01_0034_B06.b :
AMP01_0069_A11.b :
BKFL1_0028_H12.b :
ADR01_0064_D08.b : gc
MLN01_0051_A07.b :
BKFL1_0011_D03.b :
THY01_0007_F10.b :
OVRM1_0058_B04.b :
ITT01_0023_E09.b : aaaccccagatataccgggaa
UTR01_0026_E07.b :
PBL01_0022_G11.b : ccggaaaaatttgtatggtaaccgcgctcggggatttccgaatttaataacccgctcttg
HTMT1_0005_G11.b : ttttttttctcgggggtgttgtgtttccggaaaacacacgaaaaaatgtggggcctcctt
20110601C-007152 : ............................................................
---------+---------+---------+---------+---------+---------+ 1055
OVRM1_0199_C11.b :
ADR01_0069_G09.b :
ITT01_0017_A03.b :
OVR01_0020_A06.b :
MLTL1_0017_G08.b :
OVRM1_0023_B10.b :
ITT01_0017_G07.b :
LVRM1_0146_E04.b :
ITT01_0042_G11.b :
PST01_0019_F09.b :
SMG01_0051_C08.b :
ILNT1_0073_D04.b :
BMWN1_0007_C12.b :
TCH01_0010_H02.b :
AMP01_0045_F07.b :
DCI01_0046_C12.b :
PBL01_0031_D01.b :
SMG01_0053_D07.b :
ITT01_0060_H06.b : tttgaatattgcctgggccgcccnnnnnnnnnnnnnnnnnnnnnnn
ITT01_0029_E10.b :
ITT01_0021_D03.b :
UTR01_0101_F05.b :
ADR01_0072_E08.b :
ADR01_0025_F09.b :
UTR01_0069_E03.b :
OVRM1_0150_A08.b :
OVR01_0076_A12.b :
OVRM1_0064_A03.b :
OVRM1_0080_C10.b :
SMG01_0005_C12.b :
MLN01_0018_G06.b : gcgacccgtagccccgatccccgcctgtagggccttcgtgtctctctgctgcgaccactt
PBL01_0025_F07.b :
ITT01_0031_F05.b :
ITT01_0094_A06.b :
CLNT1_0059_A03.b :
PBL01_0017_E07.b :
MLN01_0056_C07.b :
UTR01_0104_C07.b :
CLNT1_0042_B04.b :
ITT01_0031_D05.b :
ITT01_0005_F02.b :
THY01_0053_H09.b :
OVR01_0002_A01.b :
OVRT1_0033_D01.b :
ITT01_0009_H03.b :
BMWN1_0024_B02.b :
ADR01_0006_B12.b :
ADR01_0102_A02.b :
ADR01_0059_H05.b :
OVRM1_0209_H08.b :
CBLT1_0082_D10.b :
ITT01_0021_A06.b :
THY01_0206_A11.b :
SPL01_0075_G05.b :
SKNB1_0015_C05.b :
THY01_0015_C05.b :
BMWN1_0037_D03.b :
DCI01_0023_C08.b :
ITT01_0061_E12.b :
ILNT1_0091_F06.b : ttttctaaacccc
THY01_0203_H12.b :
AMP01_0034_B06.b :
AMP01_0069_A11.b :
BKFL1_0028_H12.b :
ADR01_0064_D08.b :
MLN01_0051_A07.b :
BKFL1_0011_D03.b :
THY01_0007_F10.b :
OVRM1_0058_B04.b :
ITT01_0023_E09.b :
UTR01_0026_E07.b :
PBL01_0022_G11.b : tgtttatcct
HTMT1_0005_G11.b : tcctcctccctctggcgggtgtcaggaaaaacaagaaat
20110601C-007152 : ............................................................
---------+---------+---------+---------+---------+---------+ 1055
OVRM1_0199_C11.b :
ADR01_0069_G09.b :
ITT01_0017_A03.b :
OVR01_0020_A06.b :
MLTL1_0017_G08.b :
OVRM1_0023_B10.b :
ITT01_0017_G07.b :
LVRM1_0146_E04.b :
ITT01_0042_G11.b :
PST01_0019_F09.b :
SMG01_0051_C08.b :
ILNT1_0073_D04.b :
BMWN1_0007_C12.b :
TCH01_0010_H02.b :
AMP01_0045_F07.b :
DCI01_0046_C12.b :
PBL01_0031_D01.b :
SMG01_0053_D07.b :
ITT01_0060_H06.b :
ITT01_0029_E10.b :
ITT01_0021_D03.b :
UTR01_0101_F05.b :
ADR01_0072_E08.b :
ADR01_0025_F09.b :
UTR01_0069_E03.b :
OVRM1_0150_A08.b :
OVR01_0076_A12.b :
OVRM1_0064_A03.b :
OVRM1_0080_C10.b :
SMG01_0005_C12.b :
MLN01_0018_G06.b : ctaattttccaacctccattctctgccccctctcctcttcatccctcccgcttcgctcca
PBL01_0025_F07.b :
ITT01_0031_F05.b :
ITT01_0094_A06.b :
CLNT1_0059_A03.b :
PBL01_0017_E07.b :
MLN01_0056_C07.b :
UTR01_0104_C07.b :
CLNT1_0042_B04.b :
ITT01_0031_D05.b :
ITT01_0005_F02.b :
THY01_0053_H09.b :
OVR01_0002_A01.b :
OVRT1_0033_D01.b :
ITT01_0009_H03.b :
BMWN1_0024_B02.b :
ADR01_0006_B12.b :
ADR01_0102_A02.b :
ADR01_0059_H05.b :
OVRM1_0209_H08.b :
CBLT1_0082_D10.b :
ITT01_0021_A06.b :
THY01_0206_A11.b :
SPL01_0075_G05.b :
SKNB1_0015_C05.b :
THY01_0015_C05.b :
BMWN1_0037_D03.b :
DCI01_0023_C08.b :
ITT01_0061_E12.b :
ILNT1_0091_F06.b :
THY01_0203_H12.b :
AMP01_0034_B06.b :
AMP01_0069_A11.b :
BKFL1_0028_H12.b :
ADR01_0064_D08.b :
MLN01_0051_A07.b :
BKFL1_0011_D03.b :
THY01_0007_F10.b :
OVRM1_0058_B04.b :
ITT01_0023_E09.b :
UTR01_0026_E07.b :
PBL01_0022_G11.b :
HTMT1_0005_G11.b :
20110601C-007152 : ............................................................
---------+---------+---------+---------+---------+---------+ 1055
OVRM1_0199_C11.b :
ADR01_0069_G09.b :
ITT01_0017_A03.b :
OVR01_0020_A06.b :
MLTL1_0017_G08.b :
OVRM1_0023_B10.b :
ITT01_0017_G07.b :
LVRM1_0146_E04.b :
ITT01_0042_G11.b :
PST01_0019_F09.b :
SMG01_0051_C08.b :
ILNT1_0073_D04.b :
BMWN1_0007_C12.b :
TCH01_0010_H02.b :
AMP01_0045_F07.b :
DCI01_0046_C12.b :
PBL01_0031_D01.b :
SMG01_0053_D07.b :
ITT01_0060_H06.b :
ITT01_0029_E10.b :
ITT01_0021_D03.b :
UTR01_0101_F05.b :
ADR01_0072_E08.b :
ADR01_0025_F09.b :
UTR01_0069_E03.b :
OVRM1_0150_A08.b :
OVR01_0076_A12.b :
OVRM1_0064_A03.b :
OVRM1_0080_C10.b :
SMG01_0005_C12.b :
MLN01_0018_G06.b : ccacccctacctattcccaccagaccctactccctcttcttcatcgtcgcttacaca
PBL01_0025_F07.b :
ITT01_0031_F05.b :
ITT01_0094_A06.b :
CLNT1_0059_A03.b :
PBL01_0017_E07.b :
MLN01_0056_C07.b :
UTR01_0104_C07.b :
CLNT1_0042_B04.b :
ITT01_0031_D05.b :
ITT01_0005_F02.b :
THY01_0053_H09.b :
OVR01_0002_A01.b :
OVRT1_0033_D01.b :
ITT01_0009_H03.b :
BMWN1_0024_B02.b :
ADR01_0006_B12.b :
ADR01_0102_A02.b :
ADR01_0059_H05.b :
OVRM1_0209_H08.b :
CBLT1_0082_D10.b :
ITT01_0021_A06.b :
THY01_0206_A11.b :
SPL01_0075_G05.b :
SKNB1_0015_C05.b :
THY01_0015_C05.b :
BMWN1_0037_D03.b :
DCI01_0023_C08.b :
ITT01_0061_E12.b :
ILNT1_0091_F06.b :
THY01_0203_H12.b :
AMP01_0034_B06.b :
AMP01_0069_A11.b :
BKFL1_0028_H12.b :
ADR01_0064_D08.b :
MLN01_0051_A07.b :
BKFL1_0011_D03.b :
THY01_0007_F10.b :
OVRM1_0058_B04.b :
ITT01_0023_E09.b :
UTR01_0026_E07.b :
PBL01_0022_G11.b :
HTMT1_0005_G11.b :