[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-007204

Length: 1,357

Sequence [FASTA format sequence]
TACTGCAGTG AAAGCCGAGG CAGCGGGCAG GCGAGCAGGG GGCGGGCGGA CATCTTGGGA
TCCGGAGAGT GGCCGGCCCG GCAGAGCAGG CGGCCTCGGA CACCAGGTCT GTTCTCAGAG
CGATGGGCTG CCAGGACTGA GCTGCCGCCA TGATTGGAGG CTTATTCATC TATAATCACA
AGGGGGAGGT GCTCATCTCC CGGGTCTACC GAGATGACAT CGGGAGGAAC GCAGTGGACG
CCTTTCGGGT CAATGTTATC CACGCCCGGC AGCAGGTGCG CAGCCCCGTC ACCAACATCG
CTCGCACCAG TTTCTTCCAT GTTAAGCGGT CCAACATCTG GCTGGCAGCT GTCACCAAGC
AGAATGTCAA TGCTGCCATG GTCTTCGAAT TCCTCTATAA GATGTGTGAC GTAATGGCTG
CCTACTTTGG GAAGATCAGC GAAGAGAACA TCAAGAACAA TTTTGTGCTC ATATATGAGT
TGCTTGATGA GATCCTGGAC TTTGGCTACC CGCAGAACTC AGAGACGGGC GCGCTAAAAA
CCTTCATCAC CCAGCAGGGC ATCAAAAGCC AGACGAAAGA AGAGCAGTCC CAAATCACCA
GCCAGGTGAC AGGGCAGATT GGCTGGCGGC GGGAAGGCAT CAAGTATCGC CGAAACGAGC
TCTTCCTGGA TGTGCTGGAG AGTGTGAACC TCCTCATGTC CCCACAGGGG CAGGTGCTGA
GCGCCCATGT GTCCGGCCGA GTGGTGATGA AGAGCTACCT GAGTGGCATG CCTGAGTGCA
AGTTTGGGAT GAATGACAAG ATTGTCATTG AGAAGCAGGG CAAAGGCACA GCCGATGAAA
CAAGCAAGAG CGGGAAGCAA TCAATTGCCA TTGATGACTG CACCTTCCAC CAGTGTGTTC
GACTCAGCAA GTTTGACTCT GAACGCAGCA TCAGCTTCAT CCCACCAGAT GGAGAATTTG
AGCTCATGAG GTATCGCACC ACCAAGGACA TCATCCTTCC CTTCCGAGTG ATCCCGCTAG
TTCGGGAAGT GGGGCGCACC AAGCTGGAGG TCAAGGTGGT CATTAAGTCC AACTTCAAGC
CCTCACTACT GGCTCAGAAG ATTGAGGTGA GGATCCCAAC CCCACTGAAC ACCAGCGGGG
TGCAGGTGAT CTGCATGAAG GGGAAGGCTA AGTACAAGGC CAGCGAGAAC GCCATCGTGT
GGAAGATCAA GCGCATGGCA GGCATGAAGG AATCACAGAT CAGCGCTGAG ATTGAGCTTC
TGCCCACCAA TGACAAGAAG AAATGGGCTC GACCCCCCAT TTCGATGACC TTTGAGGTGC
CATTCGCGCC TTCTGGCCTC AAGGTGCGCT ACTTGAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinAP2M1AP-2 complex subunit mu isoform b [Homo sapiens]. 7930.0O
Contig/Assembly ProteinAP2M1AP-2 complex subunit mu isoform a [Homo sapiens]. 7880.0O
Contig/Assembly ProteinAP1M2AP-1 complex subunit mu-2 [Homo sapiens]. 3141e-85O
Contig/Assembly ProteinAP1M1AP-1 complex subunit mu-1 isoform 2 [Homo sapiens]. 3117e-85O
Contig/Assembly ProteinAP1M1AP-1 complex subunit mu-1 isoform 1 [Homo sapiens]. 3033e-82O
Contig/Assembly ProteinAP4M1AP-4 complex subunit mu-1 [Homo sapiens]. 1703e-42O
Contig/Assembly ProteinAP3M1AP-3 complex subunit mu-1 [Homo sapiens]. 1525e-37O
Contig/Assembly ProteinAP3M1AP-3 complex subunit mu-1 [Homo sapiens]. 1525e-37O
Contig/Assembly ProteinAP3M2AP-3 complex subunit mu-2 [Homo sapiens]. 1496e-36O
Contig/Assembly ProteinAP3M2AP-3 complex subunit mu-2 [Homo sapiens]. 1496e-36O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinAp2m1AP-2 complex subunit mu [Mus musculus]. 7880.0O
Contig/Assembly ProteinAp1m2AP-1 complex subunit mu-2 isoform 1 [Mus musculus]. 3194e-87O
Contig/Assembly ProteinAp1m2AP-1 complex subunit mu-2 isoform 2 [Mus musculus]. 3185e-87O
Contig/Assembly ProteinAp1m1AP-1 complex subunit mu-1 [Mus musculus]. 3101e-84O
Contig/Assembly ProteinAp4m1AP-4 complex subunit mu-1 [Mus musculus]. 1758e-44O
Contig/Assembly ProteinAp3m1AP-3 complex subunit mu-1 [Mus musculus]. 1526e-37O
Contig/Assembly ProteinAp3m2AP-3 complex subunit mu-2 [Mus musculus]. 1472e-35O
Contig/Assembly ProteinAp3m2AP-3 complex subunit mu-2 [Mus musculus]. 1472e-35O
Contig/Assembly ProteinSton2stonin-2 [Mus musculus]. 74.32e-13
Contig/Assembly ProteinSton1stonin-1 [Mus musculus]. 68.98e-12


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC607139PREDICTED: similar to adaptor-related protein complex 2, mu 1 subunit isoform b isoform 21 [Canis familiaris]. 7930.0O
Contig/Assembly ProteinLOC607139PREDICTED: similar to adaptor-related protein complex 2, mu 1 subunit isoform b isoform 8 [Canis familiaris]. 7930.0O
Contig/Assembly ProteinLOC607139PREDICTED: similar to adaptor-related protein complex 2, mu 1 subunit isoform 1 [Canis familiaris]. 7880.0O
Contig/Assembly ProteinLOC607139PREDICTED: similar to adaptor-related protein complex 2, mu 1 subunit isoform 19 [Canis familiaris]. 7880.0O
Contig/Assembly ProteinLOC607139PREDICTED: similar to adaptor-related protein complex 2, mu 1 subunit isoform b isoform 20 [Canis familiaris]. 7860.0O
Contig/Assembly ProteinLOC607139PREDICTED: similar to adaptor-related protein complex 2, mu 1 subunit isoform 16 [Canis familiaris]. 7830.0O
Contig/Assembly ProteinLOC607139PREDICTED: similar to adaptor-related protein complex 2, mu 1 subunit isoform b isoform 18 [Canis familiaris]. 7800.0O
Contig/Assembly ProteinLOC607139PREDICTED: similar to adaptor-related protein complex 2, mu 1 subunit isoform 14 [Canis familiaris]. 7800.0O
Contig/Assembly ProteinLOC607139PREDICTED: similar to adaptor-related protein complex 2, mu 1 subunit isoform b isoform 17 [Canis familiaris]. 7660.0O
Contig/Assembly ProteinLOC607139PREDICTED: similar to adaptor-related protein complex 2, mu 1 subunit isoform 25 [Canis familiaris]. 7630.0O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinAP2M1AP-2 complex subunit mu [Bos taurus]. 7880.0O
Contig/Assembly ProteinAP1M2AP-1 complex subunit mu-2 [Bos taurus]. 3185e-87O
Contig/Assembly ProteinAP1M1AP-1 complex subunit mu-1 [Bos taurus]. 3117e-85O
Contig/Assembly ProteinAP4M1AP-4 complex subunit mu-1 [Bos taurus]. 1726e-43O
Contig/Assembly ProteinAP3M1AP-3 complex subunit mu-1 [Bos taurus]. 1558e-38O
Contig/Assembly ProteinAP3M2AP-3 complex subunit mu-2 [Bos taurus]. 1496e-36O
Contig/Assembly ProteinAP3M2PREDICTED: adaptor-related protein complex 3, mu 2 subunit [Bos taurus]. 1496e-36O
Contig/Assembly ProteinSTON2stonin-2 [Bos taurus]. 75.51e-13
Contig/Assembly ProteinSTON2PREDICTED: stonin 2 [Bos taurus]. 75.51e-13
Contig/Assembly ProteinSTON1stonin-1 [Bos taurus]. 57.82e-08


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinAP2M1adaptor-related protein complex 2, mu 1 subunit [Sus scrofa]. 7840.0O
Contig/Assembly ProteinAP1M1adaptor-related protein complex 1, mu 1 subunit [Sus scrofa]. 3114e-85O
Contig/Assembly ProteinLOC100154867PREDICTED: AP-3 complex subunit mu-1-like [Sus scrofa]. 1524e-37O
Contig/Assembly ProteinAP3M1adaptor-related protein complex 3, mu 1 subunit [Sus scrofa]. 1524e-37O
Contig/Assembly ProteinAP3M2PREDICTED: AP-3 complex subunit mu-2 [Sus scrofa]. 1417e-34O
Contig/Assembly ProteinLOC100157426PREDICTED: LOW QUALITY PROTEIN: stonin-2-like [Sus scrofa]. 76.34e-14


Assembly Members: 10      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010057H09ADR01_0057_H09.bDB786617 
DCI010043C01DCI01_0043_C01.bDB794003 
DCI010079C07DCI01_0079_C07.bDB796570 
DCI010095C05DCI01_0095_C05.bDB797986 
DCI010112G05DCI01_0112_G05.bDB799522 
OVRM10089E02OVRM1_0089_E02.bBP150062 
OVRM10191A04OVRM1_0191_A04.bBP454927 
PST010028B06PST01_0028_B06.bFS699170 
SPL010055H06SPL01_0055_H06.bCJ018010 
SPL010088F05SPL01_0088_F05.bCJ020963 AK397798

  

SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
410C700.778BSGAC/D
T020.222GAT/D


Alignment:      TOP

20110601C-007204 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
SPL01_0088_F05.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0028_B06.b :
DCI01_0043_C01.b : a
DCI01_0095_C05.b :
DCI01_0079_C07.b :
OVRM1_0089_E02.b :
OVRM1_0191_A04.b :
DCI01_0112_G05.b :
ADR01_0057_H09.b :
SPL01_0055_H06.b :
20110601C-007204 : ....................TACTGCAGTGAAAGCCGAGGCAGCGGGCAGGCGAGCAGGG
---------+---------+---------+---------+---------+---------+ 40
SPL01_0088_F05.b : xxxxxxxxxxxxxxxxxxxxTACTGCAGTGAAAGCCGAGGCAGCGGGCAGGCGAGCAGGG
PST01_0028_B06.b : tttttngctgc
DCI01_0043_C01.b : gtaactatagggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0095_C05.b : nnnaaagatactatag
DCI01_0079_C07.b : nccgcaccnnnnnccgatatctaag
OVRM1_0089_E02.b :
OVRM1_0191_A04.b :
DCI01_0112_G05.b :
ADR01_0057_H09.b :
SPL01_0055_H06.b :
20110601C-007204 : GGCGGGCGGACATCTTGGGATCCGGAGAGTGGCCGGCCCGGCAGAGCAGGCGGCCTCGGA
---------+---------+---------+---------+---------+---------+ 100
SPL01_0088_F05.b : GGCGGGCGGACATCTTGGGATCCGGAGAGTGGCCGGCCCGGCAGAGCAGGCGGCCTCGGA
PST01_0028_B06.b : gttggctatggaatcttgggaCCGGAGAGTGGCCGGCCCGGCAGAGCAGGCGGCCTCGGA
DCI01_0043_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0095_C05.b : ggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0079_C07.b : ggctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0089_E02.b :
OVRM1_0191_A04.b : atcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0112_G05.b : nnncccgattatnnattgatactaaxxxxxxxxxxxxxxxxx
ADR01_0057_H09.b :
SPL01_0055_H06.b :
20110601C-007204 : CACCAGGTCTGTTCTCAGAGCGATGGGCTGCCAGGACTGAGCTGCCGCCATGATTGGAGG
---------+---------+---------+---------+---------+---------+ 160
SPL01_0088_F05.b : CACCAGGTCTGTTCTCAGAGCGATGGGCTGCCAGGACTGAGCTGCCGCCATGATTGGAGG
PST01_0028_B06.b : CACCAGGTCTGTTCTCAGGGCGATGGGCTGCCAGGACTGAGCTGCCGCCATGATTGGAGG
DCI01_0043_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTGAGCTGCCGCCATGATTGGAGG
DCI01_0095_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0079_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0089_E02.b : caattgtcxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0191_A04.b : xxxxxxxxxxxxxxxxxxxgggcagtgaaagccgaggcagcgggcaggcgagcagggggc
DCI01_0112_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0057_H09.b :
SPL01_0055_H06.b :
20110601C-007204 : CTTATTCATCTATAATCACAAGGGGGAGGTGCTCATCTCCCGGGTCTACCGAGATGACAT
---------+---------+---------+---------+---------+---------+ 220
SPL01_0088_F05.b : CTTATTCATCTATAATCACAAGGGGGAGGTGCTCATCTCCCGGGTCTACCGAGATGACAT
PST01_0028_B06.b : CTTATTCATCTATAATCACAAGGGGGAGGTGCTCATCTCCCGGGTCTACCGAGATGACAT
DCI01_0043_C01.b : CTTATTCATCTATAATCACAAGGGGGAGGTGCTCATCTCCCGGGTCTACCGAGATGACAT
DCI01_0095_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxAGGTGCTCATCTCCCGGGTCTACCGAGATGACAT
DCI01_0079_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxAGGTGCTCATCTCCCGGGTCTACCGAGATGACAT
OVRM1_0089_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGCTCATCTCCCGGGTCTACCGAGATGACAT
OVRM1_0191_A04.b : gggcggacatcttgggatccggagagtggccggcccggcagagcaggcggcctcgGACAC
DCI01_0112_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0057_H09.b :
SPL01_0055_H06.b :
20110601C-007204 : CGGGAGGAACGCAGTGGACGCCTTTCGGGTCAATGTTATCCACGCCCGGCAGCAGGTGCG
---------+---------+---------+---------+---------+---------+ 280
SPL01_0088_F05.b : CGGGAGGAACGCAGTGGACGCCTTTCGGGTCAATGTTATCCACGCCCGGCAGCAGGTGCG
PST01_0028_B06.b : CGGGAGGAACGCAGTGGACGCCTTTCGGGTCAATGTTATCCACGCCCGGCAGCAGGTGCG
DCI01_0043_C01.b : CGGGAGGAACGCAGTGGACGCCTTTCGGGTCAATGTTATCCACGCCCGGCAGCAGGTGCG
DCI01_0095_C05.b : CGGGAGGAACGCAGTGGACGCCTTTCGGGTCAATGTTATCCACGCCCGGCAGCAGGTGCG
DCI01_0079_C07.b : CGGGAGGAACGCAGTGGACGCCTTTCGGGTCAATGTTATCCACGCCCGGCAGCAGGTGCG
OVRM1_0089_E02.b : CGGGAGGAACGCAGTGGACGCCTTTCGGGTCAATGTTATCCACGCCCGGCAGCAGGTGCG
OVRM1_0191_A04.b : CAGGAGGAACGCAGTGGACGCCTTTCGGGTCAATGTTATCCACGCCCGGCAGCAGGTGCG
DCI01_0112_G05.b : xxxxxxxAACGCAGTGGACGCCTTTCGGGTCAATGTTATCCACGCCCGGCAGCAGGTGCG
ADR01_0057_H09.b :
SPL01_0055_H06.b :
20110601C-007204 : CAGCCCCGTCACCAACATCGCTCGCACCAGTTTCTTCCATGTTAAGCGGTCCAACATCTG
---------+---------+---------+---------+---------+---------+ 340
SPL01_0088_F05.b : CAGCCCCGTCACCAACATCGCTCGCACCAGTTTCTTCCATGTTAAGCGGTCCAACATCTG
PST01_0028_B06.b : CAGCCCCGTCACCAACATCGCTCGCACCAGTTTCTTCCATGTTAAGCGGTCCAACATCTG
DCI01_0043_C01.b : CAGCCCCGTCACCAACATCGCTCGCACCAGTTTCTTCCATGTTAAGCGGTCCAACATCTG
DCI01_0095_C05.b : CAGCCCCGTCACCAACATCGCTCGCACCAGTTTCTTCCATGTTAAGCGGTCCAACATCTG
DCI01_0079_C07.b : CAGCCCCGTCACCAACATCGCTCGCACCAGTTTCTTCCATGTTAAGCGGTCCAACATCTG
OVRM1_0089_E02.b : CAGCCCCGTCACCAACATCGCTCGCACCAGTTTCTTCCATGTTAAGCGGTCCAACATCTG
OVRM1_0191_A04.b : CAGCCCCGTCACCAACATCGCTCGCACCAGTTTCTTCCATGTTAAGCGGTCCAACATCTG
DCI01_0112_G05.b : CAGCCCCGTCACCAACATCGCTCGCACCAGTTTCTTCCATGTTAAGCGGTCCAACGTCTG
ADR01_0057_H09.b : nnnnnggtgxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0055_H06.b :
20110601C-007204 : GCTGGCAGCTGTCACCAAGCAGAATGTCAATGCTGCCATGGTCTTCGAATTCCTCTATAA
---------+---------+---------+---------+---------+---------+ 400
SPL01_0088_F05.b : GCTGGCAGCTGCCACCAAGCAGAATGTCAATGCTGCCATGGTCTTCGAATTCCTCTATAA
PST01_0028_B06.b : GCTGGCAGCTGTCACCAAGCAGAATGTCAATGCTGCCATGGTCTTCGAATTCCTCTATAA
DCI01_0043_C01.b : GCTGGCAGCTGTCACCAAGCAGAATGTCAATGCTGCCATGGTCTTCGAATTCCTCTATAA
DCI01_0095_C05.b : GCTGGCAGCTGTCACCAAGCAGAATGTCAATGCTGCCATGGTCTTCGAATTCCTCTATAA
DCI01_0079_C07.b : GCTGGCAGCTGTCACCAAGCAGAATGTCAATGCTGCCATGGTCTTCGAATTCCTCTATAA
OVRM1_0089_E02.b : GCTGGCAGCTGTCACCAAGCAGAATGTCAATGCTGCCATGGTCTTCGAATTCCTCTATAA
OVRM1_0191_A04.b : GCTGGCAGCTGTCACCAAGCAGAATGTCAATGCTGCCATGGTCTTCGAATTCCTCTATAA
DCI01_0112_G05.b : GCTGGCAGCTGTCACCAAGCAGAATGTCAATGCTGCCATGGTCTTCGAATTCCTCTATAA
ADR01_0057_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxTGTCAATGCTGCCATGGTCTTCGAATTCCTCTATAA
SPL01_0055_H06.b :
20110601C-007204 : GATGTGTGACGTAATGGCTGCCTACTTTGGGAAGATCAGCGAAGAGAACATCAAGAACAA
---------+---------+---------+---------+---------+---------+ 460
SPL01_0088_F05.b : GATGTGTGACGTAATGGCTGCCTACTTTGGGAAGATCAGCGAAGAGAACATCAAGAACAA
PST01_0028_B06.b : GATGTGTGACGTAATGGCTGCCTACTTTGGGAAGATCAGCGAAGAGAACATCAAGAACAA
DCI01_0043_C01.b : GATGTGTGACGTAATGGCTGCCTACTTTGGGAAGATCAGCGAAGAGAACATCAAGAACAA
DCI01_0095_C05.b : GATGTGTGACGTAATGGCTGCCTACTTTGGGAAGATCAGCGAAGAGAACATCAAGAACAA
DCI01_0079_C07.b : GATGTGTGACGTAATGGCTGCCTACTTTGGGAAGATCAGCGAAGAGAACATCAAGAACAA
OVRM1_0089_E02.b : GATGTGTGATGTAATGGCTGCCTACTTTGGGAAGATCAGCGAAGAGAACATCAAGAACAA
OVRM1_0191_A04.b : GATGTGTGATGTAATGGCTGCCTACTTTGGGAAGATCAGCGAAGAGAACATCAAGAACAA
DCI01_0112_G05.b : GATGTGTGACGTAATGGCTGCCTACTTTGGGAAGATCAGCGAAGAGAACATCAAGAACAA
ADR01_0057_H09.b : GATGTGTGACGTAATGGCTGCCTACTTTGGGAAGATCAGCGAAGAGAACATCAAGAACAA
SPL01_0055_H06.b : nnnggattggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-007204 : TTTTGTGCTCATATATGAGTTGCTTGATGAGATCCTGGACTTTGGCTACCCGCAGAACTC
---------+---------+---------+---------+---------+---------+ 520
SPL01_0088_F05.b : TTTTGTGCTCATATATGAGTTGCTTGATGAGATCCTGGACTTTGGCTACCCGCAGAACTC
PST01_0028_B06.b : TTTTGTGCTCATATATGAGTTGCTTGATGAGATCCTGGACTTTGGCTACCCGCAGAACTC
DCI01_0043_C01.b : TTTTGTGCTCATATATGAGTTGCTTGATGAGATCCTGGACTTTGGCTACCCGCAGAACTC
DCI01_0095_C05.b : TTTTGTGCTCATATATGAGTTGCTTGATGAGATCCTGGACTTTGGCTACCCGCAGAACTC
DCI01_0079_C07.b : TTTTGTGCTCATATATGAGTTGCTTGATGAGATCCTGGACTTTGGCTACCCGCAGAACTC
OVRM1_0089_E02.b : TTTTGTGCTCATATATGAGTTGCTTGATGAGATCCTGGACTTTGGCTACCCGCAGAACTC
OVRM1_0191_A04.b : TTTTGTGCTCATATATGAGTTGCTTGATGAGATCCTGGACTTTGGCTACCCGCAGAACTC
DCI01_0112_G05.b : TTTTGTGCTCATATATGAGTTGCTTGATGAGATCCTGGACTTTGGCTACCCGCAGAACTC
ADR01_0057_H09.b : TTTTGTGCTCATATATGAGTTGCTTGATGAGATCCTGGACTTTGGCTACCCGCAGAACTC
SPL01_0055_H06.b : xxxxxxxxxxxxxxxxxxxxxxCTTGATGAGATCCTGGACTTTGGCTACCCGCAGAACTC
20110601C-007204 : AGAGACGGGCGCGCTAAAAACCTTCATCACCCAGCAGGGCATCAAAAGCCAGACGAAAGA
---------+---------+---------+---------+---------+---------+ 580
SPL01_0088_F05.b : AGAGACGGGCGCGCTAAAAACCTTCATCACCCAGCAGGGCATCAAAAGCCAGACGAAAGA
PST01_0028_B06.b : AGAGACGGGCGCGCTAAAAACCTTCATCACCCAGCAGGGCATCAAAAGCCAGACGAAAGA
DCI01_0043_C01.b : AGAGACGGGCGCGCTAAAAACCTTCATCACCCAGCAGGGCATCAAAAGCCAGACGAAAGA
DCI01_0095_C05.b : AGAGACGGGCGCGCTAAAAACCTTCATCACCCAGCAGGGCATCAAAAGCCAGACGAAAGA
DCI01_0079_C07.b : AGAGACGGGCGCGCTAAAAACCTTCATCACCCAGCAGGGCATCAAAAGCCAGACGAAAGA
OVRM1_0089_E02.b : AGAGACAGGCGCGCTAAAAACCTTCATCACCCAGCAGGGCATCAAAAGCCAGACGAAAGA
OVRM1_0191_A04.b : AGAGACAGGCGCGCTAAAAACCTTCATCACCCAGCAGGGCATCAAAAGCCAGACGAAAGA
DCI01_0112_G05.b : AGAGACGGGCGCGCTAAAAACCTTCATCACCCAGCAGGGCACCAAAAGCCAGACGAAAGT
ADR01_0057_H09.b : AGAGACGGGCGCGCTAAAAACCTTCATCACCCAGCAGGGCATCAAAAGCCAGACGAAAGA
SPL01_0055_H06.b : AGAGACGGGCGCGCTAAAAACCTTCATCACCCAGCAGGGCATCAAAAGCCAGACGAAAGA
20110601C-007204 : AGAGCAGTCCCAAATCACCAGCCAGGTGACAGGGCAGATTGGCTGGCGGCGGGAAGGCAT
---------+---------+---------+---------+---------+---------+ 640
SPL01_0088_F05.b : AGAGCAGTCCCAAATCACCAGCCAGGTGACAGGGCAGATTGGCTGGCGGCGGGAAGGCAT
PST01_0028_B06.b : AGAGCAGTCCCAAATCACCAGCCAGGTGACAGGGCAGATTGGCTGGCGGCGGGAAGGCAT
DCI01_0043_C01.b : AGAGCAGTCCCAAATCACCAGCCAGGTGACAGGGCAGATTGGCTGGCGGCGGGAGGGCAT
DCI01_0095_C05.b : AGAGCAGTCCCAAATCACCAGCCAGGTGACAGGGCAGATTGGCTGGCGGCGGGAAGGCAT
DCI01_0079_C07.b : AGAGCAGTCCCAAATCACCAGCCAGGTGACAGGGCAGATTGGCTGGCGGCGGGAAGGCAT
OVRM1_0089_E02.b : AGAGCAGTCCCAAATCACCAGCCAGGTGACAGGGCAGATTGGCTGGCGGCGGGAAGGCAT
OVRM1_0191_A04.b : AGAGCAGTCCCAAATCACCAGCCAGGTGACAGGGCAGATTGGCTGGCGGCGGGAAGGCAT
DCI01_0112_G05.b : AGAGCAGTCCCAAATCACCAGCCAGGTGACAGGGCAGATTGGCTGGCGGCGGGAAGGCAT
ADR01_0057_H09.b : AGAGCAGTCCCAAATCACCAGCCAGGTGACAGGGCAGATTGGCTGGCGGCGGGAAGGCAT
SPL01_0055_H06.b : AGAGCAGTCCCAAATCACCAGCCAGGTGACAGGGCAGATTGGCTGGCGGCGGGAAGGCAT
20110601C-007204 : CAAGTATCGCCGAAACGAGCTCTTCCTGGATGTGCTGGAGAGTGTGAACCTCCTCATGTC
---------+---------+---------+---------+---------+---------+ 700
SPL01_0088_F05.b : CAAGTATCGCCGAAACGAGCTCTTCCTGGATGTGCTGGAGAGTGTGAACCTCCTCATGTC
PST01_0028_B06.b : CAAGTATCGCCGAAACGAGCTCTTCCTGGATGTGCTGGAGAGTGTGAACCTCCTCATGTC
DCI01_0043_C01.b : CAAGTATCGCCGAAACGAGCTCTTCCTGGATGTGCTGGAGAGTGTGAACCTCCTCATGTC
DCI01_0095_C05.b : CAAGTATCGCCGAAACGAGCTCTTCCTGGATGTGCTGGAGAGTGTGAACCTCCTCATGTC
DCI01_0079_C07.b : CAAGTATCGCCGAAACGAGCTCTTCCTGGATGTGCTGGAGAGTGTGAACCTCCTCATGTC
OVRM1_0089_E02.b : CAAGTATCGCCGAAACGAGCTCTTCCTGGATGTGCTGGAGAGTGTGAACCTCCTCATGTC
OVRM1_0191_A04.b : CAAGTATCGCCGAAACGAGCTCTTCCTGGATGTGCTGGAGAGTGTGAACCTCCTCATGTC
DCI01_0112_G05.b : CAAGTATCGCCGAAACGAGCTCTTCCTGGATGTGCTGGAGAGTGTGAACCTCCTCATGTC
ADR01_0057_H09.b : CAAGTGTCGCCGAAACGAGCTCTTCCTGGATGTGCTGGAGAGTGTGAACCTCCTCATGTC
SPL01_0055_H06.b : CAAGTATCGCCGAAACGAGCTCTTCCTGGATGTGCTGGAGAGTGTGAACCTCCTCATGTC
20110601C-007204 : CCCACAGGGGCAGGTGCTGAGCGCCCATGTGTCCGGCCGAGTGGTGATGAAGAGCTACCT
---------+---------+---------+---------+---------+---------+ 760
SPL01_0088_F05.b : CCCACAGGGGCAGGTGCTGAGCGCCCATGTGTCCGGCCGAGTGGTGATGAAGAGCTACCT
PST01_0028_B06.b : CCCACAGGGGCAGGTGCTGAGCGCCCATGTGTCCGGCCGAGTGGTGATGAAGAGCTACCT
DCI01_0043_C01.b : CCCACAGGGGCAGGTGCTGAGCGCCCTTGTGTCCGGGCGAGTGGTGATGAAGAGCTACCT
DCI01_0095_C05.b : CCCACAGGGGCAGGTGCTGAGCGCCCATGTGTCCGGCCGAGTGGTGATGAAGAGCTACCT
DCI01_0079_C07.b : CCCACAGGGGCAGGTGCTGAGCGCCCATGTGTCCGGCCGAGTGGTGATGAAGAGCTACCT
OVRM1_0089_E02.b : CCCACAGGGGCAGGTGCTGAGCGCCCATGTGTCCGGCCGAGTGGTGATGAAGAGCTACCT
OVRM1_0191_A04.b : CCCACAGGGGCAGGTGCTGAGCGCCCATGTGTCCGGCCGAGTGGTGATGAAAAGCTACCT
DCI01_0112_G05.b : CCCACAGGGGCAGGTGCTGAGCGCCCATGTGTCCGGCCGAGTGGTGATGAAGAGCTACCT
ADR01_0057_H09.b : CCCACAGGGGCAGGTGCTGAGCGCCCATGTGTCCGGCCGAGTGGTGATGAAGAGCTACCT
SPL01_0055_H06.b : CCCACAGGGGCAGGTGCTGAGCGCCCATGTGTCCGGCCGAGTGGTGATGAAGAGCTACCT
20110601C-007204 : GAGTGGCATGCCTGAGTGCAAGTTTGGGATGAATGACAAGATTGTCATTGAGAAGCAGGG
---------+---------+---------+---------+---------+---------+ 820
SPL01_0088_F05.b : GAGTGGCATGCCTGAGTGCAAGTTTGGGATGAATGACAAGATTGTCATTGAGGAGCAGGG
PST01_0028_B06.b : GAGTGGCATGCCTGAGTGCAAGTTTGGGATGAATGACAAGATTGTCATTGAGAAGCAGGG
DCI01_0043_C01.b : GAGTGGCTTGCCTGAATGCAAGTTTGGGATGATTGACAAGAATGTCATTGAAAAGCAGGG
DCI01_0095_C05.b : GAGTGGCATGCCTGAGTGCAAGTTTGGGATGAATGACAAGATTGTCATTGAGAAGCAGGG
DCI01_0079_C07.b : GAGTGGCATGCCTGAGTGCAAGTTTGGGATGAATGACAAGATTGTCATTGAGAAGCAGGG
OVRM1_0089_E02.b : GAGTGGCATGCCTGAGTGCAAGTTTGGGATGAATGACAAGATTGTCATTGAGAAGCAGGG
OVRM1_0191_A04.b : GAGTGGCATGCCTGAGTGCAAGTTGGGGATGAATGACA*GATTGTCATTGAaaacaaggc
DCI01_0112_G05.b : GAGTGGCATGCCTGAGTGCAAGTTTGGGATGAATGACAAGATTGTCATTGAGAAGCAGGG
ADR01_0057_H09.b : GAGTGGCATGCCTGAGTGCAAGTTTGGGATGAATGACAAGATTGTCATTGAGAAGCAGGG
SPL01_0055_H06.b : GAGTGGCATGCCTGAGTGCAAGTTTGGGATGAATGACAAGATTGTCATTGAGAAGCAGGG
20110601C-007204 : CAAA*GGCACAGCCGATGAAACAAGCAAGAGCGGGAAGCAATCAATTGCCATTGATGACT
---------+---------+---------+---------+---------+---------+ 879
SPL01_0088_F05.b : CCAA*GGCACAGCCGATGAAACNAGGCAGAGCGGGGAAGCATCAATTGCCCTTGATGACT
PST01_0028_B06.b : CAAA*GGCACAGCCGATGAAANCAGCAAGAGCGGGAAGCAATNCATTGCCATTGATGACT
DCI01_0043_C01.b : CAAAAGGCACAGCCGATGAAACAAGCAAGACCGGAAAGCATCAATTgcccttgaagactg
DCI01_0095_C05.b : CAAA*GGCACAGCCGATGAAACAAGCAAGAGCGGGAAGCAATCAATTGCCATTGATGACT
DCI01_0079_C07.b : CAAA*GGCACAGCCGATGAAACAAGCAAGAGCGGGAAGCAATCAATTGCCATTGATGACT
OVRM1_0089_E02.b : CAAA*GGCACAGCCGATGAAACAAGCAAGAGCGGGAAGCAATCAATTGCCATTGATGACT
OVRM1_0191_A04.b : acaggcactgcgatgaaacaagcagagcgggaacaatc
DCI01_0112_G05.b : CAAA*GGCACAGCCGATGAAACAAGCAAGAGCGGGAAGCAATCAATTGCCATTGATGACT
ADR01_0057_H09.b : CAAA*GGCACAGCCGATGAAACAAGCAAGAGCGGGAAGCAATCAATTGCCATTGATGACT
SPL01_0055_H06.b : CAAA*GGCACAGCCGATGAAACAAGCAAGAGCGGGAAGCAATCAATTGCCATTGATGACT
20110601C-007204 : GCACCTTCCACCAGTGTGTTCGACTCAGCAAGTTTGACTCTGAACGCAGCATCAGCTTCA
---------+---------+---------+---------+---------+---------+ 939
SPL01_0088_F05.b : GCCCTTTCCACCATTGCGTTCGAATCAGCAAGTTTTGATTCTGACGCAGCATCAGCTTCC
PST01_0028_B06.b : GCACCTTCCACCAGTGTGTTTCGACTCAGCAGTTTGACTCTGAACGCAGCATCAGCTTCA
DCI01_0043_C01.b : ccccctcccacaatgtggttcaatcacaagtttgaatctgaacgcagcattcacttcttc
DCI01_0095_C05.b : GCACCTTCCACCAGTGTGTTCGACTCANGCAGTTTGACTCTGAACGCAGCATCAGCTTCA
DCI01_0079_C07.b : GCACCTTCCA*CAGTGTGTTCGACTCAGCAAGTTTGACTCTGAACGCAGCATCAGCTTCA
OVRM1_0089_E02.b : GCACCTTCCACCAGTGTGTTCGACTCAGCAAGTTTGACTCTGAACGCAGCATCAGCTTCA
OVRM1_0191_A04.b :
DCI01_0112_G05.b : GCACCTTCCACCAGTGTGTTCGACTCAGCAAGTTTGACTCTGAACGCAGCATCAGCTTCA
ADR01_0057_H09.b : GCACCTTCCACCAGTGTGTTCGACTCAGCAAGTTTGACTCTGAACGCAGCATCAGCTTCA
SPL01_0055_H06.b : GCACCTTCCACCAGTGTGTTCGACTCAGCAAGTTTGACTCTGAACGCAGCATCAGCTTCA
20110601C-007204 : TCCCACCAGATGGAGAATTTGAGCTCATGAGGTATCGCACCACCAAGGACATCATCCTTC
---------+---------+---------+---------+---------+---------+ 999
SPL01_0088_F05.b : TCCCACCAGAaggaaaaatttgagctcttgaggtatcccacccacaagggaaatcatcct
PST01_0028_B06.b : TCCCACCAGATGGAGAATTTGAGCTCATGANGTATCGCACCACCAAGGACATCATCCTTC
DCI01_0043_C01.b : ccccaaaaggaaaaattgaacctctgagggttccaccccccaaggaatttttccttccct
DCI01_0095_C05.b : TCCCACCAGATGGAGAATTTGAGCTCATGAGGTATCGCACCACCAAGGACATCATGCTTC
DCI01_0079_C07.b : TCCCACCAGATGGAGAATTTGAGCTCATGAGGTATCGCACCACCNAGGACATCATGCTTC
OVRM1_0089_E02.b : TCCCACn
OVRM1_0191_A04.b :
DCI01_0112_G05.b : TCCCACCAGATGGAGAATTTGAGCTCATGAGGTATCGCACCACCAAGGACATCATCCTTC
ADR01_0057_H09.b : TCCCACCAGATGGAGAATTTGAGCTCATGAGGTATCGCACCACCAAGGACATCATCCTTC
SPL01_0055_H06.b : TCCCACCAGATGGAGAATTTGAGCTCATGAGGTATCGCACCACCAAGGACATCATCCTTC
20110601C-007204 : CCTTCCGAGTGATCCCGCTAGTTCGGGAAGTGGGGCGCACCAAGCTGGAGGTCAAGGTGG
---------+---------+---------+---------+---------+---------+ 1059
SPL01_0088_F05.b : ttcccttcgaagggatcccccctagttcgggaagtgggggggccccaaacctggaggtca
PST01_0028_B06.b : CCTTNCGAGTGATCCCGCTAGTTCGGGAAGTGGGGCGCACCNAGCTGGNAGTCAAGGTGG
DCI01_0043_C01.b : tcaaagggaccccctaattcgggaaggggggcccacccacctggaggcaagggggcttta
DCI01_0095_C05.b : CCTTCCGAGTGATCCCGCTAGTTCGGGAAGTGGGGCGCACCAAGCTGGGGAGTCAGGTGG
DCI01_0079_C07.b : CCTTCCGAGTGATCCNGCTAGTTCGGNAAGTGGGGCGCACCCAGCTGGANGGTCAGGTGG
OVRM1_0089_E02.b :
OVRM1_0191_A04.b :
DCI01_0112_G05.b : CTTCCCGAGTGATCC*GCTAGTTCGGGAAGTGGGGCGCACCAgctggaagtcgaggtggt
ADR01_0057_H09.b : CCTTCCGAGTGATCCCGCTAGTTCGGGAAGTGGGGCGCACCAAGCTGGAGGTCAAGGTGG
SPL01_0055_H06.b : CCTTCCGAGTGATCCCGCTAGTTCGGGAAGTGGGGCGCACCAAGCTGGAGGTCAAGGTGG
20110601C-007204 : TCATTAAGTCCAACTTCAAGCCCTCACTACTGGCTCAGAAGATTGAGGTGAGGATCCCAA
---------+---------+---------+---------+---------+---------+ 1119
SPL01_0088_F05.b : agggtgggtcattaaatccaaatttcagacccttcc
PST01_0028_B06.b : TCATTNAGTCNNACTTCNAGCCCTCACTACTGGCTCAGAAGATTTGAGTGAGGATCCNAA
DCI01_0043_C01.b : attcaaattcaaccccccctatgggtcaaaaaaatggggggggatcccacccccctaacc
DCI01_0095_C05.b : TCATTAAGTCCAACTT*CAGCCCTCACTACTGGCTCAGAAGATgaggtgaggatcccnac
DCI01_0079_C07.b : TCATTNAGTCCNACTTTCAGCCCTCACTACTGGCTCAGAAGATTGnnagtgagatccnna
OVRM1_0089_E02.b :
OVRM1_0191_A04.b :
DCI01_0112_G05.b : cataagttcaacttcgaccctcactactggctcagagaatgaggtgaggatccaacccac
ADR01_0057_H09.b : TCATTAAGTCCAACTTCAAGCCCTCACTACTGGCTCAGAAGATTGAGGTGAGGATCCCAA
SPL01_0055_H06.b : TCATTAAGTCCAACTTCAAGCCCTCACTACTGGCTCAGAAGATTGAGGTGAGGATCCCAA
20110601C-007204 : CCCCACTGAACACCAGCGGGGTGCAGGTGATCTGCATGAAGGGGAAGGCTAAGTACAAGG
---------+---------+---------+---------+---------+---------+ 1179
SPL01_0088_F05.b :
PST01_0028_B06.b : CCCCACTGAACACCNNCGGGNTGCAGGTGATCTGCATGAAGGGGAggctnantacaagcc
DCI01_0043_C01.b : ccacgggggtgcgggttttcctatagggaaagtaatataagggcccgaaaaccccttggg
DCI01_0095_C05.b : ccaactgacacagcggggtgacagtgatctgcatgaaggnaaagctanntacaggnccag
DCI01_0079_C07.b : cccacttgacacaancggggtgccagtgatctgcatgaaaggaaaggctaattacaaggc
OVRM1_0089_E02.b :
OVRM1_0191_A04.b :
DCI01_0112_G05.b : tgaacacagcggggtgcagtgatctcatgaagggaaagctaatacaagccaccagaaccc
ADR01_0057_H09.b : CCCCACTGAACACCAGCGGGGTGCAGGTGATCTGCATGAAGGGGAAGGCTAAGTACAAGG
SPL01_0055_H06.b : CCCCACTGAACACCAGCGGGGTGCAGGTGATCTGCATGAAGGGGAAGGCTAAGTACAAGG
20110601C-007204 : CCAGCGAGAACGCCATCGTGTGGAAGATCAAGCGCATGGCAGGCATGAAGGAATCACAGA
---------+---------+---------+---------+---------+---------+ 1239
SPL01_0088_F05.b :
PST01_0028_B06.b : cgcgagacgccatcttgtggaaatccacccatggcaggctgagagaatcaaaataggctg
DCI01_0043_C01.b : aaaaaaaccccggggggcggaaagaaccaatacgccagaagacttctcccacaaaaaaaa
DCI01_0095_C05.b : cgaaaccgcatcctgtgaaaaatcaacccatgccaggctgaggaatccaaatccaccctt
DCI01_0079_C07.b : cgcgaagaccccatcctgtgtgaaatcaaccccatggcaggctgaaggaatcccaaataa
OVRM1_0089_E02.b :
OVRM1_0191_A04.b :
DCI01_0112_G05.b : atcttgtgaaaatcaacccatgcaggctgaaggatccgatcaccctaaatgacctctgcc
ADR01_0057_H09.b : CCAGCGAGAACGCCATCGTGTGGAAGATCAAGCGCATGGCAGGCATGAAGGAATCACAGA
SPL01_0055_H06.b : CCAGCGAGAACGCCATCGTGTGGAAGATCAAGCGCATGGCAGGCATGAAGGAATCACAGA
20110601C-007204 : TCAGCGCTGAGATTGAGCTTCTGCCCACCAATGACAAGAAGAAATGGGCTCGACCCCCCA
---------+---------+---------+---------+---------+---------+ 1299
SPL01_0088_F05.b :
PST01_0028_B06.b : aaatgaactctgcccccatgaaaaaaaaatggcctgacccattcaagaatttgaggggct
DCI01_0043_C01.b : aaggcgccacccctcttaaaatttgggcctccccctccgccgggccctctgagtgttaca
DCI01_0095_C05.b : aaatgaactttgccccccatgaaaaaaaatgggccccccccccatccagaaacttgaggg
DCI01_0079_C07.b : ccctctagttgatctttgcccccatgacaaaaaaaatggccccaacccccattcaaaaaa
OVRM1_0089_E02.b :
OVRM1_0191_A04.b :
DCI01_0112_G05.b : acatgacaaagaatgggccgacccctttcaaaactttaggtccttccgcctcggcccagg
ADR01_0057_H09.b : TCAGCGCTGAGATTG*GCTTCTGCCCACCNATGACAgagaaatgggctcgacccccattt
SPL01_0055_H06.b : TCAGCGCTGAGATTGAGCTTCTGCCCACCAATGACAAGAAGAAATGGGCTCGACCCCCCA
20110601C-007204 : TTTCGATGACCTTTGAGGTGCCATTCGCGCCTTCTGGCCTCAAGGTGCGCTACTTGAA..
---------+---------+---------+---------+---------+---------+ 1357
SPL01_0088_F05.b :
PST01_0028_B06.b : tcggccttggcccaaggggccttgaagggtgaaccacgaaattaggcccaggctcagggg
DCI01_0043_C01.b : aaaaatcccaccatcttggggccctttgggggttttaaaccttccataaaaccccccccc
DCI01_0095_C05.b : cctttccgcctctggcccagggcgcccttagggtttaacccacttaaaccccccccattc
DCI01_0079_C07.b : ttttgggggcatctccgccttcggccccggggccccttttaaagggtttaccaaccgtaa
OVRM1_0089_E02.b :
OVRM1_0191_A04.b :
DCI01_0112_G05.b : gcccacctgaggtttgaacaacgaaacacgcccaattccaagggggccattgcgcgggca
ADR01_0057_H09.b : cgaggaaacttgaggtgccatcgcgcctctggctcaagtgcgctacttgaaggtgttgaa
SPL01_0055_H06.b : TTTCGATGACCTTTGAGGTGCCATTCGCGCCTTCTGGCCTCAAGGTGCGCTACTTGAAag
20110601C-007204 : ............................................................
---------+---------+---------+---------+---------+---------+ 1357
SPL01_0088_F05.b :
PST01_0028_B06.b : ggccttggcccgggtttataaaccgtttctctggataccgtcccccccctcagggggtgg
DCI01_0043_C01.b : cttgtgggggcccccaattcctt
DCI01_0095_C05.b : tcaaggggcgccttggcccggggatttaaaccgcttgtcctgggaaacaccccccccctc
DCI01_0079_C07.b : actcccccccagttttaagggggcccctttgcccgggttttttaacccccctctcctcaa
OVRM1_0089_E02.b :
OVRM1_0191_A04.b :
DCI01_0112_G05.b : taaaaccctgttgcatgaaaaaaccttccccccctctagggggggcccccacaagttcct
ADR01_0057_H09.b : cgaanctgaactacgcgaccacatgtttcaaagggtgcctacttggccgcatgcattatg
SPL01_0055_H06.b : gtgtttgaaccgaaagctgaccttacggcgaccacgaagttcttcaaatggggtgcgcct
20110601C-007204 : ............................................................
---------+---------+---------+---------+---------+---------+ 1357
SPL01_0088_F05.b :
PST01_0028_B06.b : cacaaagtccccttgttttttacaatataaaaagaggggaaaaaccgcgggg
DCI01_0043_C01.b :
DCI01_0095_C05.b :
DCI01_0079_C07.b : acc
OVRM1_0089_E02.b :
OVRM1_0191_A04.b :
DCI01_0112_G05.b : ctttgctcttctcccaatataaaaatagagggagacccccggggtgtgtccccctccccc
ADR01_0057_H09.b : aaaccgttgcacctgccaggaaaaataccggttcccaccacctttccaaggtgggtgcct
SPL01_0055_H06.b : acattgggcccccgttggccattttatgagaacccgccgtgctaactgcccctagtgaaa
20110601C-007204 : ............................................................
---------+---------+---------+---------+---------+---------+ 1357
SPL01_0088_F05.b :
PST01_0028_B06.b :
DCI01_0043_C01.b :
DCI01_0095_C05.b :
DCI01_0079_C07.b :
OVRM1_0089_E02.b :
OVRM1_0191_A04.b :
DCI01_0112_G05.b : cgggnnnngccccccccttgtgtgtggtcccccctttgtttataataggcctgagtttan
ADR01_0057_H09.b : ggcacccaaacaggccccccccggcttgcggctcccttgccaccctgatcaggtggacac
SPL01_0055_H06.b : agctaggccgggttttccccaacccaaccctttttttcaaaaggggcttggggtggccct
20110601C-007204 : ............................................................
---------+---------+---------+---------+---------+---------+ 1357
SPL01_0088_F05.b :
PST01_0028_B06.b :
DCI01_0043_C01.b :
DCI01_0095_C05.b :
DCI01_0079_C07.b :
OVRM1_0089_E02.b :
OVRM1_0191_A04.b :
DCI01_0112_G05.b : nnnt
ADR01_0057_H09.b : ctgtttaaggggaggggaaaacctggctctcgcggggggtttgaacccccttcccctcgc
SPL01_0055_H06.b : cccg