[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-007362

Length: 1,036

Sequence [FASTA format sequence]
TGGGCCATTC GCTTCCGGCA CCGGGGAGCC AGGCTGGGGT CGCTGAGGGG TGAGGTCGGG
GCTTCGGGGG CATTGACCTT TCCTGTCTGT CCGCCGTGCA GTCCTTGACC GTAGAGCCGA
TCGGCCGGAA CTGGCGCACA GGCCCCGGCG CCCTCTGGCT GCGCCATGGT CCAGCTCACT
ACTGTTCTGT GCAGGGCCTA CCGTGGAGGC CATTTAACCA TCCGCCTTGC CCTGGGTGGC
TGTACCAACC GGCCTTTCTA CCGCATCGTG GCTGCTCACA GCAAGTGTCC CAGGGATGGC
CGTTTTGTAG AGCAGCTGGG CTCCTATGAT CCGCTGCCCA ACAGTCATGG AGAGAAACTC
GTAGCTCTCA ACTTCGACCG GATCAGACAT TGGATTGGCT GTGGGGCCCA CCTCTCTAAG
CCTGTGGAAA AGCTCCTGGG TCTTTCTGGC TTTTACCCTC TGCATCCCAT GATGATCACA
AATGCTGAGA GACTGCGACG GAAACGGGCA CGAGAAGTCC TCTTAGCGTC TCAGAAAACA
GATACAGAGG CTACAGAAAC AAAAGCGAGC TGACTTAAAT GAGTGTAGCA GTGGAAATAA
GTTTAAGTCC AATTAAAACA TTTGTGCAGA ACTCTTAGTT TTATTAGACT TAGAGGTTAA
TAAATGTAGT TTTTAAAGTC ACCCATGCTT TTCTGGCCTG AACAGGGCTC AGGGAAGGTT
TGTTCTTGAT TGACGTAAAG CTGGTATAGG TACTAATTAG CTTTTTCAGC CTTCATCTGG
GGAAAACAGT GGTTGTGGGG TGGGTTGGAT TCTGCCTCTA TTGGACAACT TTTTAGCCTG
CTGCCTTCCA AGACTTCCCT GTTTCAAAGC TGCCAACCAG AATGTTCATG GCCTATCCAA
GTAATTCTTC CTGTAATCAT TTGCGATCAT CCCACCAACT CAAGAACACA GTTACCTCCC
AGGTAGGTTT GTTATGAGCT TTTAGGCTAC TTTTTAAAAA TGAATAGCTG AAAGAAAGAT
AATGTTGTAA AGTACC


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMRPS1628S ribosomal protein S16, mitochondrial precursor [Homo sapiens]. 2616e-70O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMrps1628S ribosomal protein S16, mitochondrial precursor [Mus musculus]. 2587e-69O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC609906PREDICTED: similar to mitochondrial ribosomal protein S16 [Canis familiaris]. 2801e-75


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMRPS1628S ribosomal protein S16, mitochondrial precursor [Bos taurus]. 2656e-71O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100516466PREDICTED: 28S ribosomal protein S16, mitochondrial-like [Sus scrofa]. 2792e-75O


Assembly Members: 73      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010084H11ADR01_0084_H11.bDB789011 
BFLT10080G09BFLT1_0080_G09.bFS646347 
BFLT10100E10BFLT1_0100_E10.bFS647992 
BFLT10125H08BFLT1_0125_H08.bHX203838 
BFLT10148G02BFLT1_0148_G02.bHX205357 
CBLT10002E06CBLT1_0002_E06.bHX211879 
CBLT10011B09CBLT1_0011_B09.bHX212560 
CLNT10012C07CLNT1_0012_C07.bFS658002 
CLNT10067D08CLNT1_0067_D08.bFS662340 
CLNT10082E12CLNT1_0082_E12.b  
DCI010034D03DCI01_0034_D03.bDB793320 
ITT010069E08ITT01_0069_E08.bBW982158 
KDN010009D04KDN01_0009_D04.bFS671868 
KDN010009D05KDN01_0009_D05.bFS671869 
KDN010013D11KDN01_0013_D11.bFS672175 
KDN010014D11KDN01_0014_D11.bFS672255 
KDN010083C01KDN01_0083_C01.bFS677009 
LVR010012C12LVR01_0012_C12.bBP443610 
LVR010014A04LVR01_0014_A04.bBP441185 AK232293
LVR010088A08LVR01_0088_A08.bCJ000426 
LVR010099G09LVR01_0099_G09.bBP446971 
LVR010101A02LVR01_0101_A02.bBP441089 
LVRM10185H03LVRM1_0185_H03.bCJ005903 
OVR010066B11OVR01_0066_B11.bBW965476 
OVR010076H06OVR01_0076_H06.bBW966424 
OVR010077C01OVR01_0077_C01.bBW966451 
OVR010101G04OVR01_0101_G04.bBW968254 
OVR010102D12OVR01_0102_D12.bBW968313 
OVRM10031F07OVRM1_0031_F07.bBP151767 
OVRM10036H02OVRM1_0036_H02.bBP153795 
OVRM10043F06OVRM1_0043_F06.bBP459831 
OVRM10054B09OVRM1_0054_B09.bBP147006 
OVRM10068F01OVRM1_0068_F01.bBP151177 
OVRM10088H08OVRM1_0088_H08.bBP154508 
OVRM10090C12OVRM1_0090_C12.bBP148609 
OVRM10098F11OVRM1_0098_F11.bBP152243 
OVRM10109D09OVRM1_0109_D09.bBP149569 
OVRM10137H08OVRM1_0137_H08.bBP154554 
OVRM10150B05OVRM1_0150_B05.bBP455896 
OVRM10172C02OVRM1_0172_C02.bBP456640 
OVRM10197G06OVRM1_0197_G06.bBP460868 
OVRM10217E05OVRM1_0217_E05.bBP458842 
OVRT10013D08OVRT1_0013_D08.bFS687457 
OVRT10017E09OVRT1_0017_E09.bFS687800 
OVRT10037D05OVRT1_0037_D05.bFS689409 
OVRT10038A07OVRT1_0038_A07.bFS689468 
OVRT10050C01OVRT1_0050_C01.bFS690476 
OVRT10052B04OVRT1_0052_B04.bFS690630 
OVRT10061H08OVRT1_0061_H08.bFS691433 
OVRT10089B09OVRT1_0089_B09.bFS693637 
OVRT10093C03OVRT1_0093_C03.bFS693968 
OVRT10111F07OVRT1_0111_F07.bHX235712 
OVRT10140A01OVRT1_0140_A01.bHX237989 
OVRT10151B06OVRT1_0151_B06.bHX238918 
OVRT10152D02OVRT1_0152_D02.bHX239016 
PBL010057B12PBL01_0057_B12.bBW971440 
PTG010041A05PTG01_0041_A05.bFS707990 
SMG010015E12SMG01_0015_E12.bFS714571 
SMG010038C09SMG01_0038_C09.bFS716596 
SMG010062C07SMG01_0062_C07.bFS718614 
SMG010081F02SMG01_0081_F02.bFS720286 
SMG010099F02SMG01_0099_F02.bFS721798 
SPL010067G01SPL01_0067_G01.bCJ019071 
SPL010090H10SPL01_0090_H10.bCJ021166 
SPL010095H08SPL01_0095_H08.bCJ021614 
SPL010100D12SPL01_0100_D12.bCJ022011 
TCH010042H07TCH01_0042_H07.bBW975763 
TCH010051F06TCH01_0051_F06.bCJ026266 
TCH010097E06TCH01_0097_E06.bCJ029536 
THY010039A10THY01_0039_A10.bBP160301 
THY010051F06THY01_0051_F06.bBP166149 
THY010057B07THY01_0057_B07.bBP161247 
THY010070F07THY01_0070_F07.bBP166270 

  

SNPs: 5      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
121A060.092MNACG/T
T5360.908TCG/S
267C31140.634WSATC/I
T2600.366ATT/I
322C020.028MNCCC/P
T58120.972TCC/S
492A30140.657WSAGA/R
G2300.343AGG/R
787C1300.722W-
T500.278


Alignment:      TOP

20110601C-007362 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRM1_0043_F06.b : xxxxxxxxxxxxxxxxxxxxxxx
PTG01_0041_A05.b : taaatnnggataaacaxxxxxxxxxxxxxxxxx
SMG01_0081_F02.b : nnccctttttnnnnggagtaaagcagcxxxxxxxxxxxxxxxx
LVR01_0014_A04.b : gcttttggttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0080_G09.b : gaatacgtcagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0082_E12.b : nnntttttnnnnactcttcgcgtcgaggttxxxxxxxxxxxxxxxxxxxxxx
OVR01_0066_B11.b : ntggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0031_F07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0051_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0012_C07.b : ggaaccgtttgctgacgxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0061_H08.b : ntttcgtctgcgnacgxxxxxxxxxxxxxxxxxxxxx
ITT01_0069_E08.b : nnnggatgaacxxxxxxxxxxx
OVRT1_0038_A07.b : nnntttctactgcgcacgagtgxxxxxxxxxxxxxxxxx
OVRM1_0109_D09.b : cagttgtcxxxxxxxxxxxxxxxxx
OVRT1_0151_B06.b : nnccccctatagctgtangagtgxxxxxxxxxxxxxxxxx
SMG01_0099_F02.b : nggcgttatnnnnnggactaaagcagcxxxxxxxx
OVRT1_0093_C03.b : nntttttttnnnnnnccgtttgcgttcgxxxxxxxxxxxxxxxxxxxx
KDN01_0083_C01.b :
BFLT1_0100_E10.b : ggaatcctacagcgnacgxxxxxxxxxxxxxxxxxxxx
TCH01_0097_E06.b : nnnggctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0036_H02.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0054_B09.b : cgtttgaccxxxxxxxxxxxxxxxx
OVRM1_0172_C02.b : tagttgtcxxxxxxxxxxxxxxxxxx
OVRM1_0137_H08.b : tagttgtcxxxxxxxxxxxxxxxxxx
OVRM1_0150_B05.b : nagtttgtcxxxxxxxxxxxxxxxxxx
OVRM1_0197_G06.b : gagttgtcatxxxxxxxxxxxxxxxx
OVRM1_0217_E05.b : nagttgtcxxxxxxxxxxxxxxxxxx
OVRM1_0068_F01.b : xxxxxxxxxxxxx
OVRM1_0088_H08.b : nagttgtcxxxxxxxxxxxxxxxxxxx
OVRM1_0090_C12.b : agttgtcxxxxxxxxxxxxxxxxxx
BFLT1_0148_G02.b : nnnccccgtcagcgnaggxxxxxxxxxxxxxxxxxxxx
OVR01_0077_C01.b : nnnttggcttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0070_F07.b : ctttatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0015_E12.b : nnggtattnnnnnggataaagcagcxxxxxx
SPL01_0100_D12.b : nttttgcttggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0101_G04.b : nnccgctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0152_D02.b : nnnnccgttaggcgtangagtgxxxxxxxxxxxxxxxx
OVRT1_0111_F07.b : nnnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxx
SMG01_0062_C07.b : nggcgcttttnnnggactaaagcagcxxxxx
OVRT1_0017_E09.b : nnnccttctgctgtagagtgxxxxxxxxxxxxxxxx
OVRT1_0037_D05.b : nnnnnccgtcagcgnacgxxxxxxxxxxxxxxxxxxxx
CLNT1_0067_D08.b : ntttccgttttgctgtcngxxxxxxxxxxxxxxxxxxxx
PBL01_0057_B12.b : ntttgtgxxxxxxxxxxxxxxx
OVRT1_0140_A01.b : nnaaaacttacnnnnnnnccgtttgcgttcgxxxxxxxxxxxxxxxxxxxxx
TCH01_0051_F06.b : ngcttgtgctatgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0052_B04.b : nnccgtttnnnngnnnccgttcgcgnacgxxxxxxxxxxxxxxxxxxxx
OVRT1_0050_C01.b : nnnccgttttnnngggancccgtttgcgnacgxxxxxxxxxxxxxxxxxxxx
LVR01_0099_G09.b : gggcattggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0057_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0090_H10.b : nnnttgctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0042_H07.b : nnnccccttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0039_A10.b : ttgggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_A02.b : gagggctctggtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0038_C09.b : nnnggcggtttnnttagagtaagcagcggnax
KDN01_0009_D05.b :
KDN01_0013_D11.b :
KDN01_0009_D04.b :
BFLT1_0125_H08.b : nnntttcgttagctgtcgxxxxxxxxxxxx
OVRM1_0098_F11.b : cagttgtcxxxxx
OVRT1_0089_B09.b : nnnccgttagcgnacgxxxxxxx
CBLT1_0011_B09.b : ttttgcgac
CBLT1_0002_E06.b : ttttaagcagg
OVR01_0102_D12.b : tttcgcttggxxxxxxxxxxxxxxxxxx
KDN01_0014_D11.b :
SPL01_0067_G01.b : nnnnggataggacttanacxxxxx
OVR01_0076_H06.b : xxxxxxx
LVRM1_0185_H03.b :
SPL01_0095_H08.b :
ADR01_0084_H11.b :
OVRT1_0013_D08.b :
LVR01_0088_A08.b :
LVR01_0012_C12.b :
DCI01_0034_D03.b :
20110601C-007362 : ............................TGGGCCATTCGCTTCCGGCACCGGGGAGCCAG
---------+---------+---------+---------+---------+---------+ 32
OVRM1_0043_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGGCCATTCGCTTCCGGCACCGGGGAGCCAG
PTG01_0041_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGGCCATTCGCTTCCGGCACCGGGGAGCCAG
SMG01_0081_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGGCCATTCGCTTCCGGCACCGGGGAGCCAG
LVR01_0014_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGGCCATTCGCTTCCGGCACCGGGGAGCCAG
BFLT1_0080_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxTGGGCCATTCGCTTCCGGCACCGGGGAGCCAG
CLNT1_0082_E12.b : xxxxxxxxxxxxxxxxxxccctaccatagGGGCCATTCGCTTCCGGCACCGGGGAGCCAG
OVR01_0066_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxattCATTCGCTTCCGGCACCGGGGAGCCAG
OVRM1_0031_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTCGCTTCCGGCACCGGGGAGCCAG
THY01_0051_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTCGCTTCCGGCACCGGGGAGCCAG
CLNT1_0012_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttCATTCGCTTCCGGCACCGGGGAGCCAG
OVRT1_0061_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCATTCGCTTCCGGCACCGGGGAGCCAG
ITT01_0069_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTCGCTTCCGGCACCGGGGAGCCAG
OVRT1_0038_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATTCGCTTCCGGCACCGGGGAGCCAG
OVRM1_0109_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATTCGCTTCCGGCACCGGGGAGCCAG
OVRT1_0151_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCGCTTCCGGCACCGGGGAGCCAG
SMG01_0099_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCGCTTCCGGCACCGGGGAGCCAG
OVRT1_0093_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCGCTTCCGGCACCGGGGAGCCAG
KDN01_0083_C01.b : nnnaactgcggtggcactggATTCGCTTCCGGCAC*GGGGAGCCAG
BFLT1_0100_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTCGCTTCCGGCACCGGGGAGCCAG
TCH01_0097_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATTCGCTTCCGGCACCGGGGAGCCAG
OVRM1_0036_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTTCGGCACCGGGGAGCCAG
OVRM1_0054_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
OVRM1_0172_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
OVRM1_0137_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCCG
OVRM1_0150_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
OVRM1_0197_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
OVRM1_0217_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
OVRM1_0068_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
OVRM1_0088_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
OVRM1_0090_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
BFLT1_0148_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
OVR01_0077_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
THY01_0070_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
SMG01_0015_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
SPL01_0100_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
OVR01_0101_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
OVRT1_0152_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
OVRT1_0111_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
SMG01_0062_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
OVRT1_0017_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
OVRT1_0037_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
CLNT1_0067_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
PBL01_0057_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
OVRT1_0140_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
TCH01_0051_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
OVRT1_0052_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
OVRT1_0050_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
LVR01_0099_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
THY01_0057_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
SPL01_0090_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
TCH01_0042_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
THY01_0039_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
LVR01_0101_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCTTCCGGCACCGGGGAGCCAG
SMG01_0038_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgTCGCTTCCGGCACCGGGGAGCCAG
KDN01_0009_D05.b : ncttttnnnnncctgcgttggctcggcattcCTTCCGGC*CCGGGGAGCCAG
KDN01_0013_D11.b : ncctatttnnnncctgcgttggctcggattcCTTCCGGC*CCGGGGAGCCAG
KDN01_0009_D04.b : nnccttttnnnnnncctgcgttgcctcggcattcCTTCCGGC*CCGGGGAGCCAG
BFLT1_0125_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCCGGCACCGGGGAGCCAG
OVRM1_0098_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCGGGGAGCCAG
OVRT1_0089_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCGGGGAGCCAG
CBLT1_0011_B09.b : ataagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGAGCCAG
CBLT1_0002_E06.b : tagaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGGAGCCAG
OVR01_0102_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGCCAG
KDN01_0014_D11.b : ttttttcctacgtttgcacggattccttccgcccggggagCAG
SPL01_0067_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxG
OVR01_0076_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0185_H03.b : cgttgtcxxxxxxxxxxxxx
SPL01_0095_H08.b : nttgctaggactataacxxxxxxxxxxxxxxxxxxxxxx
ADR01_0084_H11.b : nnnnnttgactaacaxxxx
OVRT1_0013_D08.b : nnn
LVR01_0088_A08.b : gcatttttxxxxxx
LVR01_0012_C12.b : gggttta
DCI01_0034_D03.b : nnnnaagatacttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-007362 : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
---------+---------+---------+---------+---------+---------+ 92
OVRM1_0043_F06.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
PTG01_0041_A05.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
SMG01_0081_F02.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
LVR01_0014_A04.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
BFLT1_0080_G09.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
CLNT1_0082_E12.b : CCTTGGATCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVR01_0066_B11.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRM1_0031_F07.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
THY01_0051_F06.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
CLNT1_0012_C07.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRT1_0061_H08.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
ITT01_0069_E08.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRT1_0038_A07.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRM1_0109_D09.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRT1_0151_B06.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
SMG01_0099_F02.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRT1_0093_C03.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
KDN01_0083_C01.b : GCTGGGGTCGCTGAGGGGTGGGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
BFLT1_0100_E10.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
TCH01_0097_E06.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRM1_0036_H02.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRM1_0054_B09.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRM1_0172_C02.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRM1_0137_H08.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRM1_0150_B05.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRM1_0197_G06.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRM1_0217_E05.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRM1_0068_F01.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRM1_0088_H08.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRM1_0090_C12.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
BFLT1_0148_G02.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVR01_0077_C01.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
THY01_0070_F07.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
SMG01_0015_E12.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
SPL01_0100_D12.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVR01_0101_G04.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRT1_0152_D02.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRT1_0111_F07.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACTTTTCCTGTCTGTCC
SMG01_0062_C07.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRT1_0017_E09.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRT1_0037_D05.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
CLNT1_0067_D08.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
PBL01_0057_B12.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRT1_0140_A01.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
TCH01_0051_F06.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRT1_0052_B04.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRT1_0050_C01.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
LVR01_0099_G09.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
THY01_0057_B07.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
SPL01_0090_H10.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
TCH01_0042_H07.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
THY01_0039_A10.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
LVR01_0101_A02.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
SMG01_0038_C09.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
KDN01_0009_D05.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
KDN01_0013_D11.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
KDN01_0009_D04.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
BFLT1_0125_H08.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRM1_0098_F11.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVRT1_0089_B09.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
CBLT1_0011_B09.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
CBLT1_0002_E06.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVR01_0102_D12.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
KDN01_0014_D11.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
SPL01_0067_G01.b : GCTGGGGTCGCTGAGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
OVR01_0076_H06.b : xxxxxxxxxxxxxxGGGGTGAGGTCGGGGCTTCGGGGGCATTGACCTTTCCTGTCTGTCC
LVRM1_0185_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGACCTTTCCTGTCTGTCC
SPL01_0095_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGACCTTTCCTGTCTGTCC
ADR01_0084_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGACCTTTCCTGTCTGTCC
OVRT1_0013_D08.b : nccgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_C12.b : ggctttgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0034_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-007362 : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
---------+---------+---------+---------+---------+---------+ 152
OVRM1_0043_F06.b : GCCGTGCAGTCCTTGACCGTAGAGCCGAACGGCCGGAACTGGCGCACAGGCCCCGGCGCC
PTG01_0041_A05.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
SMG01_0081_F02.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
LVR01_0014_A04.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
BFLT1_0080_G09.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
CLNT1_0082_E12.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVR01_0066_B11.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRM1_0031_F07.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
THY01_0051_F06.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
CLNT1_0012_C07.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRT1_0061_H08.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
ITT01_0069_E08.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRT1_0038_A07.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRM1_0109_D09.b : GCCGTGCAGTCCTTGACCGTAGAGCCGAACGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRT1_0151_B06.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
SMG01_0099_F02.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRT1_0093_C03.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
KDN01_0083_C01.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
BFLT1_0100_E10.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
TCH01_0097_E06.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRM1_0036_H02.b : GCCGTGCAGTCCTTGACCGTAGAGCCGAACGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRM1_0054_B09.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRM1_0172_C02.b : GCCGTGCAGTCCTTGACCGTAGAGCCGAACGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRM1_0137_H08.b : GCCGTGCAGTCCTTGACCGCAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRM1_0150_B05.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRM1_0197_G06.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRM1_0217_E05.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRM1_0068_F01.b : GCCGTGCAGTCCTTGACCGTAGAGCCGAACGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRM1_0088_H08.b : GCCGTGCAGTCCTTGACCGTAGAGCCGAACGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRM1_0090_C12.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
BFLT1_0148_G02.b : GCCGTGCAGTCCTTGACCGTATAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVR01_0077_C01.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
THY01_0070_F07.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
SMG01_0015_E12.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
SPL01_0100_D12.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVR01_0101_G04.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRT1_0152_D02.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRT1_0111_F07.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
SMG01_0062_C07.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRT1_0017_E09.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRT1_0037_D05.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
CLNT1_0067_D08.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
PBL01_0057_B12.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRT1_0140_A01.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
TCH01_0051_F06.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRT1_0052_B04.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRT1_0050_C01.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
LVR01_0099_G09.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
THY01_0057_B07.b : GCCGTGCAGTCCTTGACCGTAGAGCCGACCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
SPL01_0090_H10.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
TCH01_0042_H07.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
THY01_0039_A10.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
LVR01_0101_A02.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
SMG01_0038_C09.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
KDN01_0009_D05.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
KDN01_0013_D11.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
KDN01_0009_D04.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
BFLT1_0125_H08.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRM1_0098_F11.b : GCCGTGCAGTCCTTGACCGTAGAGCCGAACGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRT1_0089_B09.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
CBLT1_0011_B09.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
CBLT1_0002_E06.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVR01_0102_D12.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
KDN01_0014_D11.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
SPL01_0067_G01.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVR01_0076_H06.b : GCCGTGCAGTCCTTGACCGTAAAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
LVRM1_0185_H03.b : GCCGTGCAGTCCTTGACCGTAGAGCCGAACGGCCGGAACTGGCGCACAGGCCCCGGCGCC
SPL01_0095_H08.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
ADR01_0084_H11.b : GCCGTGCAGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
OVRT1_0013_D08.b : xxxxxggtGTCCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
LVR01_0088_A08.b : xxxxxxxxxxxCTTGACCGTAGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
LVR01_0012_C12.b : xxxxxxxxxxxxxxxxxxxxxGAGCCGATCGGCCGGAACTGGCGCACAGGCCCCGGCGCC
DCI01_0034_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxattcgcttccggcaccg
20110601C-007362 : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
---------+---------+---------+---------+---------+---------+ 212
OVRM1_0043_F06.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
PTG01_0041_A05.b : CTCTGGCTGCGCCATAGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
SMG01_0081_F02.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
LVR01_0014_A04.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
BFLT1_0080_G09.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
CLNT1_0082_E12.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVR01_0066_B11.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRM1_0031_F07.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
THY01_0051_F06.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
CLNT1_0012_C07.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRT1_0061_H08.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
ITT01_0069_E08.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRT1_0038_A07.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGCTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRM1_0109_D09.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRT1_0151_B06.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
SMG01_0099_F02.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRT1_0093_C03.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
KDN01_0083_C01.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
BFLT1_0100_E10.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
TCH01_0097_E06.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRM1_0036_H02.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGAGGAGGCCA
OVRM1_0054_B09.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRM1_0172_C02.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRM1_0137_H08.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRM1_0150_B05.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRM1_0197_G06.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRM1_0217_E05.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRM1_0068_F01.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRM1_0088_H08.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRM1_0090_C12.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
BFLT1_0148_G02.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVR01_0077_C01.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
THY01_0070_F07.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
SMG01_0015_E12.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
SPL01_0100_D12.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVR01_0101_G04.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRT1_0152_D02.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCTA
OVRT1_0111_F07.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
SMG01_0062_C07.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRT1_0017_E09.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRT1_0037_D05.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
CLNT1_0067_D08.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
PBL01_0057_B12.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRT1_0140_A01.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
TCH01_0051_F06.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRT1_0052_B04.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRT1_0050_C01.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
LVR01_0099_G09.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
THY01_0057_B07.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
SPL01_0090_H10.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
TCH01_0042_H07.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
THY01_0039_A10.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
LVR01_0101_A02.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCTA
SMG01_0038_C09.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
KDN01_0009_D05.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
KDN01_0013_D11.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
KDN01_0009_D04.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
BFLT1_0125_H08.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRM1_0098_F11.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRT1_0089_B09.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
CBLT1_0011_B09.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
CBLT1_0002_E06.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVR01_0102_D12.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
KDN01_0014_D11.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
SPL01_0067_G01.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVR01_0076_H06.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
LVRM1_0185_H03.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
SPL01_0095_H08.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
ADR01_0084_H11.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
OVRT1_0013_D08.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
LVR01_0088_A08.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
LVR01_0012_C12.b : CTCTGGCTGCGCCATGGTCCAGCTCACTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
DCI01_0034_D03.b : gggagccaggctggggtcgctgagggCTACTGTTCTGTGCAGGGCCTACCGTGGAGGCCA
20110601C-007362 : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
---------+---------+---------+---------+---------+---------+ 271
OVRM1_0043_F06.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
PTG01_0041_A05.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
SMG01_0081_F02.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
LVR01_0014_A04.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
BFLT1_0080_G09.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
CLNT1_0082_E12.b : TTTGACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
OVR01_0066_B11.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
OVRM1_0031_F07.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
THY01_0051_F06.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
CLNT1_0012_C07.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
OVRT1_0061_H08.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
ITT01_0069_E08.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
OVRT1_0038_A07.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
OVRM1_0109_D09.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
OVRT1_0151_B06.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
SMG01_0099_F02.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
OVRT1_0093_C03.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
KDN01_0083_C01.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
BFLT1_0100_E10.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
TCH01_0097_E06.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
OVRM1_0036_H02.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTTAGCTACCGCATCGTGG
OVRM1_0054_B09.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
OVRM1_0172_C02.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
OVRM1_0137_H08.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
OVRM1_0150_B05.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
OVRM1_0197_G06.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
OVRM1_0217_E05.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
OVRM1_0068_F01.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
OVRM1_0088_H08.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTATCGCATCGTGG
OVRM1_0090_C12.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
BFLT1_0148_G02.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
OVR01_0077_C01.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
THY01_0070_F07.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
SMG01_0015_E12.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
SPL01_0100_D12.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
OVR01_0101_G04.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
OVRT1_0152_D02.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
OVRT1_0111_F07.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
SMG01_0062_C07.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
OVRT1_0017_E09.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
OVRT1_0037_D05.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
CLNT1_0067_D08.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
PBL01_0057_B12.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
OVRT1_0140_A01.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
TCH01_0051_F06.b : TTTAACCATCCGCCTCGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
OVRT1_0052_B04.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
OVRT1_0050_C01.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
LVR01_0099_G09.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
THY01_0057_B07.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
SPL01_0090_H10.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
TCH01_0042_H07.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
THY01_0039_A10.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
LVR01_0101_A02.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
SMG01_0038_C09.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
KDN01_0009_D05.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
KDN01_0013_D11.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
KDN01_0009_D04.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
BFLT1_0125_H08.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
OVRM1_0098_F11.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
OVRT1_0089_B09.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
CBLT1_0011_B09.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
CBLT1_0002_E06.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
OVR01_0102_D12.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
KDN01_0014_D11.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
SPL01_0067_G01.b : TTTAACCATCCGCCTTACCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
OVR01_0076_H06.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
LVRM1_0185_H03.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
SPL01_0095_H08.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
ADR01_0084_H11.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATTGTGG
OVRT1_0013_D08.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
LVR01_0088_A08.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
LVR01_0012_C12.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
DCI01_0034_D03.b : TTTAACCATCCGCCTTGCCCTGGGTGGCTGTACCAACCGGCCTT*TCTACCGCATCGTGG
20110601C-007362 : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
---------+---------+---------+---------+---------+---------+ 331
OVRM1_0043_F06.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
PTG01_0041_A05.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAAAGCAGCTGGGCTCCTATGATC
SMG01_0081_F02.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
LVR01_0014_A04.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
BFLT1_0080_G09.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
CLNT1_0082_E12.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVR01_0066_B11.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVRM1_0031_F07.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
THY01_0051_F06.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
CLNT1_0012_C07.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVRT1_0061_H08.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
ITT01_0069_E08.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVRT1_0038_A07.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVRM1_0109_D09.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVRT1_0151_B06.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCGGCTGGGCTCCTATGATC
SMG01_0099_F02.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVRT1_0093_C03.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
KDN01_0083_C01.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
BFLT1_0100_E10.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
TCH01_0097_E06.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVRM1_0036_H02.b : CTGCTCACAGCAAGAGACCCAGGGATGGCCGTTATGTAGAGCATCTGGGCTCCTATGATC
OVRM1_0054_B09.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVRM1_0172_C02.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAAAGCAGCTGGGCTCCTATGATC
OVRM1_0137_H08.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVRM1_0150_B05.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVRM1_0197_G06.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCCCCTATGATC
OVRM1_0217_E05.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCCCCTATGATC
OVRM1_0068_F01.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVRM1_0088_H08.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVRM1_0090_C12.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
BFLT1_0148_G02.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVR01_0077_C01.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
THY01_0070_F07.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGCAGAGCAGCTGGGCTCCTATGATC
SMG01_0015_E12.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
SPL01_0100_D12.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVR01_0101_G04.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVRT1_0152_D02.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVRT1_0111_F07.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
SMG01_0062_C07.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVRT1_0017_E09.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVRT1_0037_D05.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
CLNT1_0067_D08.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
PBL01_0057_B12.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVRT1_0140_A01.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
TCH01_0051_F06.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVRT1_0052_B04.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVRT1_0050_C01.b : CTGTTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
LVR01_0099_G09.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
THY01_0057_B07.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
SPL01_0090_H10.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
TCH01_0042_H07.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
THY01_0039_A10.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
LVR01_0101_A02.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
SMG01_0038_C09.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
KDN01_0009_D05.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
KDN01_0013_D11.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
KDN01_0009_D04.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
BFLT1_0125_H08.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVRM1_0098_F11.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVRT1_0089_B09.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
CBLT1_0011_B09.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
CBLT1_0002_E06.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVR01_0102_D12.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
KDN01_0014_D11.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
SPL01_0067_G01.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVR01_0076_H06.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
LVRM1_0185_H03.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTAGTAGAGCAGCTGGGCTCCTATGATC
SPL01_0095_H08.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
ADR01_0084_H11.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
OVRT1_0013_D08.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
LVR01_0088_A08.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
LVR01_0012_C12.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
DCI01_0034_D03.b : CTGCTCACAGCAAGTGTCCCAGGGATGGCCGTTTTGTAGAGCAGCTGGGCTCCTATGATC
20110601C-007362 : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
---------+---------+---------+---------+---------+---------+ 391
OVRM1_0043_F06.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
PTG01_0041_A05.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
SMG01_0081_F02.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
LVR01_0014_A04.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
BFLT1_0080_G09.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
CLNT1_0082_E12.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVR01_0066_B11.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRM1_0031_F07.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
THY01_0051_F06.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
CLNT1_0012_C07.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRT1_0061_H08.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
ITT01_0069_E08.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRT1_0038_A07.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRM1_0109_D09.b : CGCTGCCCAACAGTCATAGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRT1_0151_B06.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
SMG01_0099_F02.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRT1_0093_C03.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
KDN01_0083_C01.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
BFLT1_0100_E10.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
TCH01_0097_E06.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRM1_0036_H02.b : CGCTGCCCAACAGACATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRM1_0054_B09.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRM1_0172_C02.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRM1_0137_H08.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRM1_0150_B05.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRM1_0197_G06.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRM1_0217_E05.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRM1_0068_F01.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRM1_0088_H08.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRM1_0090_C12.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
BFLT1_0148_G02.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVR01_0077_C01.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
THY01_0070_F07.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
SMG01_0015_E12.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
SPL01_0100_D12.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVR01_0101_G04.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRT1_0152_D02.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACCTCGACCGGATCAGACATT
OVRT1_0111_F07.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
SMG01_0062_C07.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRT1_0017_E09.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRT1_0037_D05.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
CLNT1_0067_D08.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
PBL01_0057_B12.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRT1_0140_A01.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
TCH01_0051_F06.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRT1_0052_B04.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRT1_0050_C01.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
LVR01_0099_G09.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
THY01_0057_B07.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
SPL01_0090_H10.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
TCH01_0042_H07.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
THY01_0039_A10.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
LVR01_0101_A02.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
SMG01_0038_C09.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
KDN01_0009_D05.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
KDN01_0013_D11.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
KDN01_0009_D04.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
BFLT1_0125_H08.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRM1_0098_F11.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRT1_0089_B09.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
CBLT1_0011_B09.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
CBLT1_0002_E06.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVR01_0102_D12.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
KDN01_0014_D11.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
SPL01_0067_G01.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVR01_0076_H06.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
LVRM1_0185_H03.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
SPL01_0095_H08.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
ADR01_0084_H11.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
OVRT1_0013_D08.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
LVR01_0088_A08.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
LVR01_0012_C12.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
DCI01_0034_D03.b : CGCTGCCCAACAGTCATGGAGAGAAACTCGTAGCTCTCAACTTCGACCGGATCAGACATT
20110601C-007362 : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
---------+---------+---------+---------+---------+---------+ 451
OVRM1_0043_F06.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
PTG01_0041_A05.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
SMG01_0081_F02.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
LVR01_0014_A04.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
BFLT1_0080_G09.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
CLNT1_0082_E12.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVR01_0066_B11.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRM1_0031_F07.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
THY01_0051_F06.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
CLNT1_0012_C07.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRT1_0061_H08.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
ITT01_0069_E08.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRT1_0038_A07.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRM1_0109_D09.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRT1_0151_B06.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
SMG01_0099_F02.b : GGATTGGCTGTGGGGTCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRT1_0093_C03.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
KDN01_0083_C01.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
BFLT1_0100_E10.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
TCH01_0097_E06.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRM1_0036_H02.b : GGATGGGCTGTGGGGCCCACCTATATAAGCCTGCGGAAAAGCTACTGGGCCTTTCTGGCT
OVRM1_0054_B09.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRM1_0172_C02.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRM1_0137_H08.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRM1_0150_B05.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRM1_0197_G06.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRM1_0217_E05.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRM1_0068_F01.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRM1_0088_H08.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRM1_0090_C12.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
BFLT1_0148_G02.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVR01_0077_C01.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
THY01_0070_F07.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
SMG01_0015_E12.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
SPL01_0100_D12.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTCCTGGCT
OVR01_0101_G04.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRT1_0152_D02.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRT1_0111_F07.b : GGGTTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
SMG01_0062_C07.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRT1_0017_E09.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRT1_0037_D05.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
CLNT1_0067_D08.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
PBL01_0057_B12.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRT1_0140_A01.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
TCH01_0051_F06.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRT1_0052_B04.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRT1_0050_C01.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
LVR01_0099_G09.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
THY01_0057_B07.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
SPL01_0090_H10.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTAGGTCTTTCTGGCT
TCH01_0042_H07.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
THY01_0039_A10.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
LVR01_0101_A02.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
SMG01_0038_C09.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
KDN01_0009_D05.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
KDN01_0013_D11.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
KDN01_0009_D04.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
BFLT1_0125_H08.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRM1_0098_F11.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRT1_0089_B09.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
CBLT1_0011_B09.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
CBLT1_0002_E06.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVR01_0102_D12.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
KDN01_0014_D11.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
SPL01_0067_G01.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVR01_0076_H06.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
LVRM1_0185_H03.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
SPL01_0095_H08.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
ADR01_0084_H11.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
OVRT1_0013_D08.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
LVR01_0088_A08.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
LVR01_0012_C12.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
DCI01_0034_D03.b : GGATTGGCTGTGGGGCCCACCTCTCTAAGCCTGTGGAAAAGCTCCTGGGTCTTTCTGGCT
20110601C-007362 : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
---------+---------+---------+---------+---------+---------+ 511
OVRM1_0043_F06.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
PTG01_0041_A05.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
SMG01_0081_F02.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGANACGGGCAC
LVR01_0014_A04.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
BFLT1_0080_G09.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
CLNT1_0082_E12.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
OVR01_0066_B11.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
OVRM1_0031_F07.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
THY01_0051_F06.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
CLNT1_0012_C07.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
OVRT1_0061_H08.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
ITT01_0069_E08.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
OVRT1_0038_A07.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
OVRM1_0109_D09.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
OVRT1_0151_B06.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
SMG01_0099_F02.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
OVRT1_0093_C03.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
KDN01_0083_C01.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGGCGGAAACGGGCAC
BFLT1_0100_E10.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
TCH01_0097_E06.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
OVRM1_0036_H02.b : ATCACCCTCTGCATCCCATGATGATCACAAGTGCTGAGAGACTGCGACTGAGACGGGCAC
OVRM1_0054_B09.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGANACGGGCAC
OVRM1_0172_C02.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACAGAAACGGGCAC
OVRM1_0137_H08.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
OVRM1_0150_B05.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
OVRM1_0197_G06.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
OVRM1_0217_E05.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
OVRM1_0068_F01.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
OVRM1_0088_H08.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
OVRM1_0090_C12.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
BFLT1_0148_G02.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGANACGGGCAC
OVR01_0077_C01.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
THY01_0070_F07.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
SMG01_0015_E12.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGANACGGGCAC
SPL01_0100_D12.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
OVR01_0101_G04.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGANACGGGCAC
OVRT1_0152_D02.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
OVRT1_0111_F07.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
SMG01_0062_C07.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
OVRT1_0017_E09.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
OVRT1_0037_D05.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
CLNT1_0067_D08.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
PBL01_0057_B12.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
OVRT1_0140_A01.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
TCH01_0051_F06.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
OVRT1_0052_B04.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
OVRT1_0050_C01.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
LVR01_0099_G09.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
THY01_0057_B07.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
SPL01_0090_H10.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
TCH01_0042_H07.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
THY01_0039_A10.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
LVR01_0101_A02.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
SMG01_0038_C09.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
KDN01_0009_D05.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
KDN01_0013_D11.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
KDN01_0009_D04.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
BFLT1_0125_H08.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
OVRM1_0098_F11.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
OVRT1_0089_B09.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
CBLT1_0011_B09.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
CBLT1_0002_E06.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
OVR01_0102_D12.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
KDN01_0014_D11.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
SPL01_0067_G01.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
OVR01_0076_H06.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
LVRM1_0185_H03.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
SPL01_0095_H08.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
ADR01_0084_H11.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
OVRT1_0013_D08.b : TTTACCCTCAGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
LVR01_0088_A08.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
LVR01_0012_C12.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGACTGCGACGGAAACGGGCAC
DCI01_0034_D03.b : TTTACCCTCTGCATCCCATGATGATCACAAATGCTGAGAGGCTGCGACGGAAACGGGCAC
20110601C-007362 : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
---------+---------+---------+---------+---------+---------+ 571
OVRM1_0043_F06.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
PTG01_0041_A05.b : GAGAAGTCCTCTTAGCGTCTCACAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
SMG01_0081_F02.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
LVR01_0014_A04.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
BFLT1_0080_G09.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
CLNT1_0082_E12.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVR01_0066_B11.b : CAGAAGTCCTCTTAGCGTCTCCGAAAACCGATACCGAGGCTACCGAAACCAAAGCGAGCT
OVRM1_0031_F07.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
THY01_0051_F06.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
CLNT1_0012_C07.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVRT1_0061_H08.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
ITT01_0069_E08.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVRT1_0038_A07.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVRM1_0109_D09.b : GAGAAGTCCTCTTAGCGTCTCAGAGAACCGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVRT1_0151_B06.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
SMG01_0099_F02.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVRT1_0093_C03.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
KDN01_0083_C01.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
BFLT1_0100_E10.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
TCH01_0097_E06.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVRM1_0036_H02.b : CAGACGTCTTCTTAACGGTTCAAAAAACAGATTCGGAGGCTTCAGAAACAAGAGCGAGCT
OVRM1_0054_B09.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVRM1_0172_C02.b : GAGAACTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCCAGCT
OVRM1_0137_H08.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVRM1_0150_B05.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVRM1_0197_G06.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVRM1_0217_E05.b : GAGAAGTCCTCTTAGCGTCTCATAAAACAGATACCGAGGCTACAGAAACAAAAGCGAGCT
OVRM1_0068_F01.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVRM1_0088_H08.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVRM1_0090_C12.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
BFLT1_0148_G02.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVR01_0077_C01.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACTAAAGCGAGCT
THY01_0070_F07.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
SMG01_0015_E12.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
SPL01_0100_D12.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVR01_0101_G04.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVRT1_0152_D02.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVRT1_0111_F07.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
SMG01_0062_C07.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVRT1_0017_E09.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVRT1_0037_D05.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
CLNT1_0067_D08.b : GAGGAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGGGCT
PBL01_0057_B12.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVRT1_0140_A01.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
TCH01_0051_F06.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVRT1_0052_B04.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVRT1_0050_C01.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
LVR01_0099_G09.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
THY01_0057_B07.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
SPL01_0090_H10.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
TCH01_0042_H07.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
THY01_0039_A10.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
LVR01_0101_A02.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
SMG01_0038_C09.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACCGAGGCTACAGAAACAAA*GCGAGCT
KDN01_0009_D05.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
KDN01_0013_D11.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
KDN01_0009_D04.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
BFLT1_0125_H08.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVRM1_0098_F11.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVRT1_0089_B09.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
CBLT1_0011_B09.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
CBLT1_0002_E06.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVR01_0102_D12.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
KDN01_0014_D11.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
SPL01_0067_G01.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVR01_0076_H06.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
LVRM1_0185_H03.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
SPL01_0095_H08.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
ADR01_0084_H11.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
OVRT1_0013_D08.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
LVR01_0088_A08.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTGCAGAAACAAAAGCGAGCT
LVR01_0012_C12.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGATACAGAGGCTACAGAAACAAAAGCGAGCT
DCI01_0034_D03.b : GAGAAGTCCTCTTAGCGTCTCAGAAAACAGA******GGCTACAGAAACAAAAGCGAGCT
20110601C-007362 : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
---------+---------+---------+---------+---------+---------+ 631
OVRM1_0043_F06.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
PTG01_0041_A05.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTTAAACATTTGTGCAGAA
SMG01_0081_F02.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
LVR01_0014_A04.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
BFLT1_0080_G09.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
CLNT1_0082_E12.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
OVR01_0066_B11.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAGCATTTGTGCAGAA
OVRM1_0031_F07.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
THY01_0051_F06.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
CLNT1_0012_C07.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
OVRT1_0061_H08.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
ITT01_0069_E08.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
OVRT1_0038_A07.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
OVRM1_0109_D09.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCTATTCAAACATTTGTGCAGAA
OVRT1_0151_B06.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
SMG01_0099_F02.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
OVRT1_0093_C03.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
KDN01_0083_C01.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
BFLT1_0100_E10.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTACAGAA
TCH01_0097_E06.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
OVRM1_0036_H02.b : GCATTAAAGGAGTGTAccagtacaactaatgctatgaacacgcaaaacaattggtgcana
OVRM1_0054_B09.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
OVRM1_0172_C02.b : GACTTAAATGAGTGTAGCAATGGAAATAANTTTAACTCC*ATTCAAACATTTGTGCAGAG
OVRM1_0137_H08.b : GACTTAAATGAGTGTAGCAGTGGAAATTAGTTTAAGTCCAATTTAAACATTTGTGCAGAA
OVRM1_0150_B05.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
OVRM1_0197_G06.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
OVRM1_0217_E05.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAACTCCAATTAAAACATTTGTGCAGAA
OVRM1_0068_F01.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCACAA
OVRM1_0088_H08.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
OVRM1_0090_C12.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
BFLT1_0148_G02.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATT*AAACATTTGTGCAGAA
OVR01_0077_C01.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCTATTAAAACATTTGTGCAGAA
THY01_0070_F07.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
SMG01_0015_E12.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
SPL01_0100_D12.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
OVR01_0101_G04.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
OVRT1_0152_D02.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
OVRT1_0111_F07.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
SMG01_0062_C07.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
OVRT1_0017_E09.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
OVRT1_0037_D05.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
CLNT1_0067_D08.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
PBL01_0057_B12.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
OVRT1_0140_A01.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
TCH01_0051_F06.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
OVRT1_0052_B04.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
OVRT1_0050_C01.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
LVR01_0099_G09.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
THY01_0057_B07.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
SPL01_0090_H10.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
TCH01_0042_H07.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
THY01_0039_A10.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
LVR01_0101_A02.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
SMG01_0038_C09.b : GACTT*AATGAGTGTAGCAGTGGAAATAAGTTTAAGT*CAATTAAAACATTTGTGCAGAA
KDN01_0009_D05.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
KDN01_0013_D11.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
KDN01_0009_D04.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
BFLT1_0125_H08.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
OVRM1_0098_F11.b : GACTTAAATGAGTGTAGCAGTGGAAATCAGTTTAAGTCCAATTCAAACATTTGTGCAGAA
OVRT1_0089_B09.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
CBLT1_0011_B09.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
CBLT1_0002_E06.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
OVR01_0102_D12.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
KDN01_0014_D11.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
SPL01_0067_G01.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
OVR01_0076_H06.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
LVRM1_0185_H03.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
SPL01_0095_H08.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
ADR01_0084_H11.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
OVRT1_0013_D08.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
LVR01_0088_A08.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
LVR01_0012_C12.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
DCI01_0034_D03.b : GACTTAAATGAGTGTAGCAGTGGAAATAAGTTTAAGTCCAATTAAAACATTTGTGCAGAA
20110601C-007362 : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
---------+---------+---------+---------+---------+---------+ 689
OVRM1_0043_F06.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTTAAGTCACCCATGC*T
PTG01_0041_A05.b : *CTCTTAATTTTATTAGACTTAGAGGGTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
SMG01_0081_F02.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
LVR01_0014_A04.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
BFLT1_0080_G09.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
CLNT1_0082_E12.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
OVR01_0066_B11.b : *CTCTTAATTTTATTAGACTTAGAGGTTAATAAATGGAGTTTTTAAAGTCACCCCTGC*T
OVRM1_0031_F07.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTANGTTTTAAAGTCACCCATGC*T
THY01_0051_F06.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
CLNT1_0012_C07.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
OVRT1_0061_H08.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
ITT01_0069_E08.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
OVRT1_0038_A07.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
OVRM1_0109_D09.b : *CTCTTAGTTTTATTAGACTTAGAGGTTA*TAAATGTAGTTCTTAAAGTCACCCATGC*T
OVRT1_0151_B06.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
SMG01_0099_F02.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
OVRT1_0093_C03.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
KDN01_0083_C01.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
BFLT1_0100_E10.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
TCH01_0097_E06.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
OVRM1_0036_H02.b : actcctagatttatgggaattcgatggttaaaaagcgaatgcttataaatcaccgatgtt
OVRM1_0054_B09.b : gaaaaaaaaaaaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0172_C02.b : *CTCctattttcttagacttagagggagtaaatgganttttaaaatcgccatgatttacg
OVRM1_0137_H08.b : *CTCTTAGTTTTATTAGACCTAGACGTTAATAAATGTAGTTTTTTAAGTCACCCATGC*T
OVRM1_0150_B05.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTTAAGTCACCCATGC*T
OVRM1_0197_G06.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
OVRM1_0217_E05.b : *CTCTTAGTCTTATTAGACTTAGAGGTTAATAAATGTATTTTTTAAAGTCACCCATGC*T
OVRM1_0068_F01.b : *CTCTTAGTTTTATTAGACTTAGAGGCTAATAAATGTAGCTTTTCAAGTCACCCATGC*T
OVRM1_0088_H08.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
OVRM1_0090_C12.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
BFLT1_0148_G02.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTATTTTTTAAAGTCACCCATGC*T
OVR01_0077_C01.b : NCTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGCTT
THY01_0070_F07.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
SMG01_0015_E12.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
SPL01_0100_D12.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
OVR01_0101_G04.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
OVRT1_0152_D02.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
OVRT1_0111_F07.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
SMG01_0062_C07.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
OVRT1_0017_E09.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCCTGC*T
OVRT1_0037_D05.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
CLNT1_0067_D08.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
PBL01_0057_B12.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
OVRT1_0140_A01.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
TCH01_0051_F06.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
OVRT1_0052_B04.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
OVRT1_0050_C01.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
LVR01_0099_G09.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
THY01_0057_B07.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
SPL01_0090_H10.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
TCH01_0042_H07.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
THY01_0039_A10.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
LVR01_0101_A02.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
SMG01_0038_C09.b : *CTCTTAGT*TTATTAGACTTAAAGGGTAATAAATGTAGTTTTTTAAGTCAACCATGC*T
KDN01_0009_D05.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
KDN01_0013_D11.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
KDN01_0009_D04.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
BFLT1_0125_H08.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
OVRM1_0098_F11.b : *CTCTTAGTTTTATTACACTTAGAGGTTAATACATGCAGTTTTTTAAGTCACCCATGC*T
OVRT1_0089_B09.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
CBLT1_0011_B09.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCAaaaaa
CBLT1_0002_E06.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCA
OVR01_0102_D12.b : *CTCTTAGTTTTATTAGACTTAAAGGTTAATAAATGTAGTTTTTTAAGTCACCCCTGC*T
KDN01_0014_D11.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
SPL01_0067_G01.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
OVR01_0076_H06.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
LVRM1_0185_H03.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
SPL01_0095_H08.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
ADR01_0084_H11.b : *CTCTTAGTCTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
OVRT1_0013_D08.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
LVR01_0088_A08.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
LVR01_0012_C12.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
DCI01_0034_D03.b : *CTCTTAGTTTTATTAGACTTAGAGGTTAATAAATGTAGTTTTTAAAGTCACCCATGC*T
20110601C-007362 : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
---------+---------+---------+---------+---------+---------+ 747
OVRM1_0043_F06.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
PTG01_0041_A05.b : TTTCTGGCCTGAAAAGGCTCAA**GGAAAGGTTGTTCCTGATTGACGTAAA*CTGG*TAT
SMG01_0081_F02.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAAGTTTGTTTCTGATTGACGTAAAGCTGG*TAT
LVR01_0014_A04.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
BFLT1_0080_G09.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
CLNT1_0082_E12.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
OVR01_0066_B11.b : TTTCTTGCCTGAACAGGGTTCACGGGAAGGTTGGTTCTTGAtgaccgtaaagctgggata
OVRM1_0031_F07.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGGTTGTTCTTGATTGACGTAAAGCTGG*TAT
THY01_0051_F06.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
CLNT1_0012_C07.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
OVRT1_0061_H08.b : TTTCTGGCCTGAACAGGGCTCA*AGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
ITT01_0069_E08.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
OVRT1_0038_A07.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
OVRM1_0109_D09.b : TTTCTGGTCTGGACATGGCTCAGGGACAGCTTGTTTCTTGATTGACGTAAAGCCGG*TAT
OVRT1_0151_B06.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
SMG01_0099_F02.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
OVRT1_0093_C03.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
KDN01_0083_C01.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
BFLT1_0100_E10.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTANAGCTGG*TAT
TCH01_0097_E06.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
OVRM1_0036_H02.b : tctcggggcctcacaaggttctaacaagagttcgtcgggatcgaccatacctcc
OVRM1_0054_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0172_C02.b : ggctcaacacgttcaggcaggggcggacaggggtggaatagatggacgagagacgcg
OVRM1_0137_H08.b : TTTCTGGCCTGAACAGGGCTCCAGGGAAGG*TTGTTCTTGACTGACGgtaagc
OVRM1_0150_B05.b : TTTCTGGCCTGAACAGGGCTCA*AGGAAGGTTTGTTCTTGATTGACGT
OVRM1_0197_G06.b : TTTCTGACCTGAACAGGGCTCAGGGAAGGTTTGGTTCTTGATTGACGT*AAGCTGG*TAa
OVRM1_0217_E05.b : TTTCTGGCCTGATCAGGGCTCAGGGACAGGT*TGTTCTTGATTGACGTAAAGCTGG*GAT
OVRM1_0068_F01.b : TTTCTGGCCTTGACAGGGCTCA*CGGAAGGTTTGTTCTTGACTGACGTAAAGCTGG*CAT
OVRM1_0088_H08.b : TTTCTGGCCTGAACAGGGCTCNAGGGAAGGTTGTTCTTGNATTGACGTAA*GCTGG*TAT
OVRM1_0090_C12.b : TTTCTGGCCTGAACAGGGCTCA*GGNAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
BFLT1_0148_G02.b : TTTCTGGCCTGAACAGGGCTCCAGGGAGGGTTGTTTCTGGATTGACTAAAAGCTG**TAA
OVR01_0077_C01.b : TTTCTGGCCTGAACAGGGCTCA*GGGGAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
THY01_0070_F07.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
SMG01_0015_E12.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
SPL01_0100_D12.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
OVR01_0101_G04.b : TTTCTGGCCTGAACAGGGCTCA*NGGAAAGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
OVRT1_0152_D02.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGGGTTGTCTTGATTGACGTAAAGCTGG*TAT
OVRT1_0111_F07.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
SMG01_0062_C07.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
OVRT1_0017_E09.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
OVRT1_0037_D05.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
CLNT1_0067_D08.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
PBL01_0057_B12.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
OVRT1_0140_A01.b : TTTCTGGGCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAGGCTGG*TAT
TCH01_0051_F06.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
OVRT1_0052_B04.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
OVRT1_0050_C01.b : TTTCTGGCCTGAACAGGGCTCA*NGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
LVR01_0099_G09.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
THY01_0057_B07.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
SPL01_0090_H10.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCCGG*TAT
TCH01_0042_H07.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
THY01_0039_A10.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
LVR01_0101_A02.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
SMG01_0038_C09.b : TTTCTGGNCTGAAacagggctccagggaagtttggtcttgaatgacntaaaactgggaat
KDN01_0009_D05.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
KDN01_0013_D11.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTANAGCTGG*TAT
KDN01_0009_D04.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTANAGCTGG*TAT
BFLT1_0125_H08.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
OVRM1_0098_F11.b : TTTttgtcctgtacctgtcccagggcaagtttgctccctcatgatttatacctgcctcgc
OVRT1_0089_B09.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
CBLT1_0011_B09.b :
CBLT1_0002_E06.b :
OVR01_0102_D12.b : TTTCTGGCCTGAACAGGGCTCAGGGAAAGGTTTGTTCTTGATTGACCTAAAGCTGGGTAT
KDN01_0014_D11.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
SPL01_0067_G01.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
OVR01_0076_H06.b : TTTCTGGCCCTGACAGGGCTCA*NGGTAGGTTTGTTCTTGATTGACGTAAAc
LVRM1_0185_H03.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAAGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
SPL01_0095_H08.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
ADR01_0084_H11.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
OVRT1_0013_D08.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
LVR01_0088_A08.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
LVR01_0012_C12.b : TTTCTGGCCTGAACAGGGCTCA*GGGAAGGTTTGTTCTTGATTGACGTAAAGCTGG*TAT
DCI01_0034_D03.b : TTTCTGGCCTGAACAGGGCTCA**GGGAAGGTTGTTCTTGATTGACGTAAAGCTGG*TAT
20110601C-007362 : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTGGTT*GTGGGG*TGGGT
---------+---------+---------+---------+---------+---------+ 805
OVRM1_0043_F06.b : AGGTA
PTG01_0041_A05.b : AAGTACAAATTAGCTTTTccaccctccaccggggaaaaaaggggtgtggggggggttgga
SMG01_0081_F02.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTGGTT**GTGGGGTGGGT
LVR01_0014_A04.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTGGTT*GTGGGG*GGGGT
BFLT1_0080_G09.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGGAAATAGTGGTT*GTGGGG*TGGGT
CLNT1_0082_E12.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAA*TAGTGGT**GTGGGGTGGGGG
OVR01_0066_B11.b : aggtacctaattaccttttttcagcccttcacctgggggaaaacaaatggtttttggggg
OVRM1_0031_F07.b : AGGTACTAATTAGCTTTTTagccttcatctggggan
THY01_0051_F06.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTGGTT*GTGGGG*TGGGT
CLNT1_0012_C07.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGTT*GTGGGG*TGGGT
OVRT1_0061_H08.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGTT*GTGGGGGGGGTT
ITT01_0069_E08.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTGGTT*GTGGGG*TGGGT
OVRT1_0038_A07.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGTT*GTGGGG*TGGGT
OVRM1_0109_D09.b : AGGTACTCATTAGCTTTTTCAGCCCTCATCTGcggtaa
OVRT1_0151_B06.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGTT*GTGGGG*TGGGT
SMG01_0099_F02.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTGGTT*GTGGGGTTGGGT
OVRT1_0093_C03.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGTT*GTGGGG*TGGGT
KDN01_0083_C01.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTGGTT*GTGGGG*TGGGT
BFLT1_0100_E10.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGTT*GTGGGG*TGGGT
TCH01_0097_E06.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTGGTT*GTGGGG*TGGGT
OVRM1_0036_H02.b :
OVRM1_0054_B09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0172_C02.b :
OVRM1_0137_H08.b :
OVRM1_0150_B05.b :
OVRM1_0197_G06.b :
OVRM1_0217_E05.b : AGGTctaattagct
OVRM1_0068_F01.b : AGGTACTAATTAGCCTTTTCCGCCTT
OVRM1_0088_H08.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCT
OVRM1_0090_C12.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGTn
BFLT1_0148_G02.b : AGGGACTAATTAACTTTTTCACCCTTCATCTGGGGgaaaataatggttgtgggggtgggt
OVR01_0077_C01.b : TAGTACTAATTAGCTTTTTCAGCCTTCATCCTGGGGAAAcgggggtttgggggtggggtt
THY01_0070_F07.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTG
SMG01_0015_E12.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTGGTT*GTGGGGTGGGGT
SPL01_0100_D12.b : AGGTACTAATTAGCTTTTTCAGCCTTTCTCTGGGGAAAATAATGGTTTGTGGGGTGGGTT
OVR01_0101_G04.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTGGTT*GTGGGGTGGGTT
OVRT1_0152_D02.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGTT*GTGGGGGTGGGT
OVRT1_0111_F07.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGGT*GTGGGG*CGGGT
SMG01_0062_C07.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTGGTT*GTGGGG*TGGGT
OVRT1_0017_E09.b : AGGTACTAATTAACTTTTTCAGCCTTCATCTGGGGAAAATAATGGTT*GTGGGG*TGGGT
OVRT1_0037_D05.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGTT*GTGGGG*TGGGT
CLNT1_0067_D08.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGTT*GTGGGGTGGGGT
PBL01_0057_B12.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGTT*GTGGGG*TGGGT
OVRT1_0140_A01.b : TAGTACTAATTAGCTTTTTCCACCTTCATCTGGGGAAAATAATGGTT*GTGGGG*TGGGT
TCH01_0051_F06.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTGGTT*GTGGGG*TGGGN
OVRT1_0052_B04.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGTT*GTGGGG*TGGGT
OVRT1_0050_C01.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGTT*GTGGGG*TGGGT
LVR01_0099_G09.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGTT*GTGGGG*TGGGT
THY01_0057_B07.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTGGTT*GTGGGG*TGGGT
SPL01_0090_H10.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGTT*GTGGGG*TGGGT
TCH01_0042_H07.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTGGTT*GTGGGG*TGGGT
THY01_0039_A10.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTGGTT*GTGGGG*TGGGT
LVR01_0101_A02.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTGGTT*GTGGGG*TGGGT
SMG01_0038_C09.b : aggtaccaattaacttttttcacccttcctctgggggaaaacaaggggtttggggggggg
KDN01_0009_D05.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTGGTT*GTGGGG*TGGGT
KDN01_0013_D11.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTGGTT*GTGGGGTGGGGT
KDN01_0009_D04.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTGGTT*GTGGGGTGGGGT
BFLT1_0125_H08.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGTT*GTGGGG*TGGGT
OVRM1_0098_F11.b : tactaattaccctttccactttcctctgggccacaacatcggttgga
OVRT1_0089_B09.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGTT*GTGGGG*TGGGT
CBLT1_0011_B09.b :
CBLT1_0002_E06.b :
OVR01_0102_D12.b : AGGTACTAATTAGCTTTTTtcaacccttcattctgggaaaaaacattgggtttgtggggt
KDN01_0014_D11.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTGGTT*GTGGGG*TGGGT
SPL01_0067_G01.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGTT*GTGGGG*TGGGT
OVR01_0076_H06.b :
LVRM1_0185_H03.b : AGGTACTAATTAACTTTTTCA*CCTTCATCTGGGGAAAATAGTGGTT*GTGGGGGTGGG
SPL01_0095_H08.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGTT*GTGGGG*TGGGT
ADR01_0084_H11.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTGGTT*GTGGGG*TGGGT
OVRT1_0013_D08.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGTT*GTGGGG*TGGGT
LVR01_0088_A08.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGTT*GTGGGG*TGGGT
LVR01_0012_C12.b : AGGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAATAGTGGTT*GTGGGGGTGGGT
DCI01_0034_D03.b : ANGTACTAATTAGCTTTTTCAGCCTTCATCTGGGGAAAACAGTGGTT*GTGGGG*TGGGT
20110601C-007362 : TGGATTCTGCCTCTATTGGACAACTTTTTAGCCTGCTGCCTTCCAAGACTTCCCTGTTTC
---------+---------+---------+---------+---------+---------+ 865
OVRM1_0043_F06.b :
PTG01_0041_A05.b : tccggctccattggaacactttttaccggcggcctcccaaaaatcccggttcaaaactgc
SMG01_0081_F02.b : TGGATTCTGCCTCTATTGGACACTTTTTTAGCtgctggctccaagactccctgtttcaaa
LVR01_0014_A04.b : TGGATTCTGCCTCTATTGGACAACTTTTAACCCTGCTGCCTTCCAAGACTTCCCTGTTTC
BFLT1_0080_G09.b : TGGATTCTGCCTCTAATGGACAACTTTTTAGCCTGCTTGCTTTCCAGACTTCCCTGTTTC
CLNT1_0082_E12.b : TGGATTCTGCCTCTATTTGGACACTTTTTAGCCTGCTGCCTTCC*AGACTTNCCTGGNTT
OVR01_0066_B11.b : gggggttgggatttccgccctccattgggaaaaacctttttaacccgggtgggcctttcc
OVRM1_0031_F07.b :
THY01_0051_F06.b : TGGATTCTGCCTCTATTGGACAACTTTTTAGCC
CLNT1_0012_C07.b : TGGATTCTGCCTCTATTGGACAACTTTT*AGCCTGCTGCCTTCC*AGACTTCCCTGTTTC
OVRT1_0061_H08.b : GGATTCTGCCCTCTATTGGACAACTTTTTAAGCTGCTGCCTTTCAAGAACTTCCTGGTTT
ITT01_0069_E08.b : TGGATTCTGCCTCTATTGNACAACTTTTTAGCCTGCTGCCTTCCCAGACTTCCCTGTTTC
OVRT1_0038_A07.b : TGGATTCTGCCTCTATTGNNACACTTTTTAGCCTGCTGCCTTCCNAGACTTCCCTGTTTC
OVRM1_0109_D09.b :
OVRT1_0151_B06.b : TGGATTCTGCCTCTATTGGAC*ACTTTTTAGCCTGCTGCTTTCAAGACTccctggttcaa
SMG01_0099_F02.b : TGGAATCTGCCTCTATTGGACAACTTTTTAGCCTGCTGCCTT*CCAGACTCCCCTGTTTC
OVRT1_0093_C03.b : TGGATTCTGCCTCTATTGGACAACTTTTTAGCCTGCTGCCCTTCAAGACTTCCCTGTTTC
KDN01_0083_C01.b : TGGATTCTGCCTCTATTGGACAACTTTTTAGCCTGCTGCCTTCCAAGACTTCCCTGTTTT
BFLT1_0100_E10.b : TGGATTCTGCCTCTATTGGNACACTTTTTAGCCTGCTGCCTTCCAAGACTTCCCTGTTTC
TCH01_0097_E06.b : TGGATTCTGCCTCTATTGGACAACTTTTTAGC*TGCTGCCTTCCAAGACTTCCCTGTTTC
OVRM1_0036_H02.b :
OVRM1_0054_B09.b :
OVRM1_0172_C02.b :
OVRM1_0137_H08.b :
OVRM1_0150_B05.b :
OVRM1_0197_G06.b :
OVRM1_0217_E05.b :
OVRM1_0068_F01.b :
OVRM1_0088_H08.b :
OVRM1_0090_C12.b :
BFLT1_0148_G02.b : tggaatctgccccctttggaaaaattttttaaccggtggccttccaaaaattccccggtt
OVR01_0077_C01.b : tgattccgccctctattggacacttttttagcctggcggccttccagaattccccggttt
THY01_0070_F07.b :
SMG01_0015_E12.b : TGGAattcggcctccatgggacaattttttgcctgctggctttcaagacttcccggtttc
SPL01_0100_D12.b : TGGATTCTGCCctctatttgaacaacttttttagcctgctgcctttccaagactttccct
OVR01_0101_G04.b : GGGATTCTGCCTCTATTGGGACAacttttttagcctggctgccttccaagactttcctgg
OVRT1_0152_D02.b : TGGATTCTGCCTCTATTGGACACTTTTTTACCTGCTGCttcccagacttcctggttcaaa
OVRT1_0111_F07.b : TGGATTCTGCCCTCTATGGACAACTTTTTAGCCTGCTGCTTTCCCAaactccctgttcaa
SMG01_0062_C07.b : TGGATTCTGCCTCTATTGAAC*ACTTTTTAGCCTGCTGCCTTCCAGGACT*CCCTGTTTC
OVRT1_0017_E09.b : TGGATTCTGCCCCTAT*GGACAACTTTTTAGCCTGCTGCCTTCCAGACTTCCCTTGTTCA
OVRT1_0037_D05.b : TGGGATCTGCCTCTATTGNACACTTTTTTAGC*TGCTGCCTTCC*AGACTTTCCTGTTTC
CLNT1_0067_D08.b : TGGATTCTGCCTCTATTGGNACACTTTTTAGCCTGCTGCCTTCCNAGACTTTCCTGTTTC
PBL01_0057_B12.b : TGGATTCTGCCTCTATTGGGACACTTTTTAGCCTGCTGCCTCCCNAGACTTCCCTGTTTC
OVRT1_0140_A01.b : TTGGATCGCCCTCTATGGAACAATTTTTTAGCTGGCGGCCTTCCAAAACTTCCTTGTTTT
TCH01_0051_F06.b : TGGATTCTGCCTCTATTGGACAACTTTTTAGCCTGCTGCCTTCCAAGACTTCCCTGTTTC
OVRT1_0052_B04.b : TGGATTCTGCCTCTATTTGGACACTTTTTAGCCTGCTGCCTTCCNAGACTTCCCTGTTNC
OVRT1_0050_C01.b : TGGATTCTGCCTCTATTGGACAACTTTTTAGCCTGCTGCCTTCCNAGACTTCCCTGTT*C
LVR01_0099_G09.b : TGGATTCTGCCTCTATTGGACAACTTTTTAGCCTGCTGCCTTCAAAGACTTCCCTGTTTC
THY01_0057_B07.b : TGGATTCTGCCTCTATTGGACAACTTTTTAGCCTGCTGCCCTTCCAGACTTCCCTGTTTC
SPL01_0090_H10.b : TGGATTCTGCCTCTATTGGACAACTTTTTAGCCTGCTGCCTTTCCAGACTTCCCTGTTTC
TCH01_0042_H07.b : TGGATTCTGCCTCTATTGGACNACTTTTTAGCCTGCTGCCTTCCAAGACTTCCCTGTTTC
THY01_0039_A10.b : TGGATTCTGCCTCTATTGGACAACTTTTTAGCCTGCTGCCTTCCAAGACTTCCCTGTTTC
LVR01_0101_A02.b : TGGATTCTGCCTCTATTGGACAACTTTTTAGCCTGCTGCCTTTCAAGACTTCCCTGTTTC
SMG01_0038_C09.b : ttggaatctgcccccattgggaaaatttttttacccgggggccttccaaaaattccccgg
KDN01_0009_D05.b : TGGATTCTGCCTCTATTGGACAACTTTTTAGCCTGCTGCCTTCCCAGACTTCCCTGTTTC
KDN01_0013_D11.b : TGGATTCTGCCTCTATTGGACAACTTTTTAGCCTGCTGCCTTCCCAGACTTCCCTGTTTC
KDN01_0009_D04.b : TGGATTCTGCCTCTATTGGACAACTTTTTAGCCTGCTGCCTTCCAAGACTTCCCTGTTTT
BFLT1_0125_H08.b : TGGATTCTGCCTCTATTGGGACACTTTTTAGCCTGCTGCCTT*CAAGACTCCCCTGTTTC
OVRM1_0098_F11.b :
OVRT1_0089_B09.b : TGGATTCTGCCTCTATTGGACAACTTTTTAGCCTGCTGCCTTCCAAGACTTCCCTGTTTC
CBLT1_0011_B09.b :
CBLT1_0002_E06.b :
OVR01_0102_D12.b : ggggttgggaattctgccccctattgggacaaactttttttagcctggcttgcccttccc
KDN01_0014_D11.b : TGGATTCTGCCTCTATTGGACAACTTTTTAGCCTGCTGCCTTCCAAGACTTCCCTGGTTC
SPL01_0067_G01.b : TGGATTCTGCCTCTATTGGACAACTTTTTAGCCTGCTGCCTTTCCAGACTTTCCTGTTTC
OVR01_0076_H06.b :
LVRM1_0185_H03.b :
SPL01_0095_H08.b : TGGATTCTGCCTCTATTGGACAACTTTTTAGCCTGCTGCCTTCCAAGACTTCCCCTGTTC
ADR01_0084_H11.b : TGGATTCTGCCTCTATTGGACAACTTTTTAGCCTGCTGCCTTCCAAGACTTCCCTGTTTC
OVRT1_0013_D08.b : TGGATTCTGCCTCTATTGGACAACTTTTTAGCCTGCTGCCTTCCAAGACTTCCCTGTTTC
LVR01_0088_A08.b : TGGATTCTGCCTCTATTGGACAACTTTTTAGCCTGCTGCCTTCCAAGACTTCCCTGTTTC
LVR01_0012_C12.b : TGGATTCTGCCTCTATTGGACAACTTTTTAGCCTGCTGCCTTCCAAGACTTCCCTGTTTC
DCI01_0034_D03.b : TGGATTCTGCCTCTATTGNNACACTTTT*AGCCTGCTGCCTTC*AAGACTTCCCTGTTTC
20110601C-007362 : A*AAGCTGCC*AACCAGAATGTTCATGGCCTAT*CCAAGTAATTCTTCCTGTAATCATTT
---------+---------+---------+---------+---------+---------+ 922
OVRM1_0043_F06.b :
PTG01_0041_A05.b : cacccaaaggtcttggcctatcaaaaaatcttccgggaacctttgggaactcccccccac
SMG01_0081_F02.b : ctgccaaccaaatgttcatgggccatcccaatattcttccgggaaacttttgcgacttcc
LVR01_0014_A04.b : A*AAGCTGCC*AACCcaaaatgttcatgggcctatccaagtaattccttcctgtaatctt
BFLT1_0080_G09.b : C*AAGCTGCC**ACCAGAATGTTCATGGCCAAC*CCAA*GTAttcttcttggtaacattt
CLNT1_0082_E12.b : C*AAGCTGCC*NACCAGA*TGGTCATGGCCTAT*Caagnaattcttcctgaatcaatttg
OVR01_0066_B11.b : aaaaaattcccctggtttttcaaaggcttgcccacccccaaaaagtttcctgggggcctt
OVRM1_0031_F07.b :
THY01_0051_F06.b :
CLNT1_0012_C07.b : **AAGCTGC**AACCAGAATGTTCATGGGCTAT*CCAgtaattcttctgtaatcattgcg
OVRT1_0061_H08.b : C*AAGCTGCC*CACCAAAATGTTCTGGGCCTAT*CCAAGTAATTCTcccggaatcctttt
ITT01_0069_E08.b : **AAGCTGCC*AACCAGAATGGTCATGGCCTAT*CCAG*TAATTCTTC*TGTAATCATTT
OVRT1_0038_A07.b : A*AAGCTGCC*AACCAGAATG*TCATGGCCTAT*CCAAGTAATTCTT*CTGTAATCATTT
OVRM1_0109_D09.b :
OVRT1_0151_B06.b : aactgccaccagatgttcatggctatccagtaatcttccggtatcatttgcaatctccca
SMG01_0099_F02.b : A*AAGCTGCC*AACCCAAATGTTCATGGCCTAC*CCAAtaatccttccggaatcctttgc
OVRT1_0093_C03.b : A*AAGCTGCC*AACCAGAATGGTCATGGCCTAT*CCAAGTAATTCTcctgtatcctttgc
KDN01_0083_C01.b : C*AAGCTGCC*AACCAGAATGTTCATGGCCTAT*CCAAGTAATTCTTCCTGTAATCATTT
BFLT1_0100_E10.b : A*AAGCTGCC*AACCAGAATGGTCATGGGCTAT*CCNAGTAATTCT*CCTGTAATCATTT
TCH01_0097_E06.b : **AAGCTGCC*ANCCAGAATGGTCATGGCCTAT*CCAAGTAATTCTTCTTGTTATCATTT
OVRM1_0036_H02.b :
OVRM1_0054_B09.b :
OVRM1_0172_C02.b :
OVRM1_0137_H08.b :
OVRM1_0150_B05.b :
OVRM1_0197_G06.b :
OVRM1_0217_E05.b :
OVRM1_0068_F01.b :
OVRM1_0088_H08.b :
OVRM1_0090_C12.b :
BFLT1_0148_G02.b : tcaagcctcgcaccagaaatggttcagggcccacccaaaaaattcctccggggaaacttt
OVR01_0077_C01.b : ccaagctgccaacccgaaaggttccagggcctaacccaggtaattccttccgggaatcat
THY01_0070_F07.b :
SMG01_0015_E12.b : aaagctcccacccgaaagttcatggcccatccaagaaatcctccgggaacctttgcaatc
SPL01_0100_D12.b : gtttccaaaactgcccaacccagaatggttcatgggcctattccaagtaattccttccgg
OVR01_0101_G04.b : tttcaaagcttgccaacccgaaatgttccttggcctaatccaaagaaatttcttcctgga
OVRT1_0152_D02.b : gctgccaacagaatgttcatgcctatcaagtaatcctcctgaatcattgggatcaccccc
OVRT1_0111_F07.b : agctgccaaccaaatgttcatggcctatcccattaattcttcccgaatcatttgcgatca
SMG01_0062_C07.b : A*AActgcaaccagattgtcatggcctaccaagtaattctcctggaatcattgcgatcat
OVRT1_0017_E09.b : Agctgcccaacagaatgtttctggcctatccataattcttcccgtatctttgcgcactcc
OVRT1_0037_D05.b : **AAGCTGCC*AACAAGA*TGGTCATGGGCTAT*CCA*GTAATTCTTCctgtatctttgc
CLNT1_0067_D08.b : **AAGCTGCC*AACCAGAATGGTCATGGCCTAT*C*AAGTAATTCTTCCTGT*ATCATTT
PBL01_0057_B12.b : A*AAGCTGCC*A*CCAGAATGGTCATGGCCTAT*CCAAGTAAATCTTCCTGTAATCATTT
OVRT1_0140_A01.b : C*AAGCTGCC*AACCAGAATGTTCGGGGGCTAT*CCAAGTAATTCTTCCGGGAATCATTT
TCH01_0051_F06.b : **AAGCTGCC*AACCAGAATGTTCATGGCCTAT*CCAAGTAATTCTTTCTGTAACCATTT
OVRT1_0052_B04.b : A*AAGCTGCC*NACCAGAATGGTCATGGGNCTA*TCCAGTNANTNNCTCCTGTATCATTT
OVRT1_0050_C01.b : A*AAGCTGCC*NACCAGATTG*TCATGGCCTAT*CCAAGTAATTTCTCCCTGTATCATTT
LVR01_0099_G09.b : A*AAGCTGCC*CACCAGAATGTTCATGGCCTAT*CCAAGTAATTCTTCCCTGTATCATTT
THY01_0057_B07.b : N*AAGCTGCC*AACCAGAATGTTCATGGCCTAT*CCAAGTAATTCTTCCCTGTATCATTT
SPL01_0090_H10.b : A*AAGCTGCCCAACCAGAATGTTCATGGCCTAT*CCCAGTAATTCCTCTTGTAATCATTT
TCH01_0042_H07.b : A*GAGCTGCC*CACCAGAATGTTCATGGCCTAT*CCCAGTAAATCCTCCTGTAATCATTT
THY01_0039_A10.b : A*AAGCTGCC*AACCAGAATGTTCATGGCCTAT*CCAAGTAATTCTTCCTGTAATCATTT
LVR01_0101_A02.b : AAAAGCTGCC*AACCAGAATGTTCATGGCCTAT*CCAAGTAATTCTTCCTGTAATCATTT
SMG01_0038_C09.b : gtttaaaagggcccaaccaaaaggttccgggggctaaccaaaaaaattcttccggaaacc
KDN01_0009_D05.b : A*AAGCTGCC*NACCAGAATGTTCATGGCCTAT*CCNAGTAATTCTTCCCTGTATCATTT
KDN01_0013_D11.b : A*AAGCTGCC*A*CCAGAATGTTCATGGGCTAT*CCNAGTAATTCTTCCTGTAATCATTT
KDN01_0009_D04.b : C*AAGCTGCC*CACCAGAATGTTCATGGCCTAT*CCAAGTAATTCTTCCCTGTATCATTT
BFLT1_0125_H08.b : **AAGCTGCA*AACCAGAtgttcagggcctatccaagtaatcttccggtatcatttgcga
OVRM1_0098_F11.b :
OVRT1_0089_B09.b : A*AAGCTGCC*ACCAAAAATGTTCATGGCCTAT*CCAAGTAATTCTTCCggaatcatttg
CBLT1_0011_B09.b :
CBLT1_0002_E06.b :
OVR01_0102_D12.b : aagaaactttcccctggtttttcaaaagccttcccaaccccaaaaatggtttccatgggc
KDN01_0014_D11.b : A*AAGCTGCC*AACCAGAATGTTCATGGCCTAT*CCCAGTAAATCTTCCTGTAATCATTT
SPL01_0067_G01.b : A*AAGCTTGC*CAACAGAATGTTCATGGCCTATTCCCAGTATTCCTTCCTGTAATCATTT
OVR01_0076_H06.b :
LVRM1_0185_H03.b :
SPL01_0095_H08.b : A*AAGCTGCC*AACCAGAATGTTCATGGCCTAT*TCAAGTAATTCTTCCTGGAATCATTT
ADR01_0084_H11.b : A*AAGCTGCC*AACCAGAATGTTCATGGCCTAT*CCAAGTAATTCTTCCCTGTATCATTT
OVRT1_0013_D08.b : A*AAGCTGCC*AACCAGAATGTTCATGGCCTAT*CCAAGTAATTTCTCCCTGTATCATTT
LVR01_0088_A08.b : A*AAGCTGCC*AACCAGAATGTTCATGGCCTAT*CCAAGTAATTCTTCCTGTAATCATTT
LVR01_0012_C12.b : A*AAGCTGCC*AACCAGAATGTTCATGGCCTAT*CCAAGTAATTCTTCCTGTAATCATTT
DCI01_0034_D03.b : A*AAGCTGCC*AACCAGAATGTTCATGGGCTAT*CCAAGTAATTCTTCCTGTAtcaattg
20110601C-007362 : GCGATCATCCCACCAACTCAAGAACACAGTTACCTCCCAGGTA*GGTTTGTTATGAGCTT
---------+---------+---------+---------+---------+---------+ 981
OVRM1_0043_F06.b :
PTG01_0041_A05.b : ctcaaaaacgttcccccccgggggggttgtttaagactttttggccctttttaaaaaaga
SMG01_0081_F02.b : acccactccaagaaacatttccctccagggaggtttgtttgaccttttaggcatttttaa
LVR01_0014_A04.b : ttggcgatcatccccaccactccaagaacacagttacctcccaaggtaaggtttgttatg
BFLT1_0080_G09.b : gcgattatccccccaacttcaaaacacgttaccttccaggtagggttgttatgacctttt
CLNT1_0082_E12.b : gatcatcccaccaatccagacccagtttcttcccgggaagggttggtttttacttttagg
OVR01_0066_B11.b : tcccaagaaaaattccttccccgtggaaaacttttttgggagaaatttcccccccccaac
OVRM1_0031_F07.b :
THY01_0051_F06.b :
CLNT1_0012_C07.b : atcatcccacaactcaagaacacgttacttcaaggtaggtttgtatgagcttttagctac
OVRT1_0061_H08.b : gcgatctccccaccactccagaacacgattacttccaggaagggttggttttggactttt
ITT01_0069_E08.b : GCGATCATCCCACCActcaagacacagttacctccaaggatggggaggggacatgcctgc
OVRT1_0038_A07.b : GCGATCATCCCACCAtttcagacacagttacttccaagggtagttggtatgaacttttag
OVRM1_0109_D09.b :
OVRT1_0151_B06.b : caactcaagaaccagtttcttcagggaggtttggttatacttttaggctccttttaaaat
SMG01_0099_F02.b : gaatctcccaccaatcaaaaaaacagttacctccagggtagtttgttatgaacttttagg
OVRT1_0093_C03.b : gatcttcccacaactcaagacccagttacttccaggaaggttgttagagcttttaggctc
KDN01_0083_C01.b : GCGATCATCCCACCAACTCAAGAACACAGTTACCTCCAAGGTA*GGTTTGTTATGAGCTT
BFLT1_0100_E10.b : GCGATCATCCACCAA*CTCAAGAACACAGTTAACTTCCAGGGA*GGTTTGTTATGAGCTT
TCH01_0097_E06.b : GCGATCATCCCACCAACTCAGGAACACGGTTACCTCCCAGGTA**GGTTGTTATGAGCTT
OVRM1_0036_H02.b :
OVRM1_0054_B09.b :
OVRM1_0172_C02.b :
OVRM1_0137_H08.b :
OVRM1_0150_B05.b :
OVRM1_0197_G06.b :
OVRM1_0217_E05.b :
OVRM1_0068_F01.b :
OVRM1_0088_H08.b :
OVRM1_0090_C12.b :
BFLT1_0148_G02.b : ggggattctccccccacctcagaaaaacaagtttctttccgaggggggggttgttaagac
OVR01_0077_C01.b : ttgggaaaccttccaccccacctccaggaaacccagtttcccccccaggggtagggttgg
THY01_0070_F07.b :
SMG01_0015_E12.b : tcccaccaatctagaaaccgtttcctcccaggaaggtttgtttaacctttaggccccttt
SPL01_0100_D12.b : taaaccattttggcaaccttcccccccaactctagaaaacacggttttctttccaaaggg
OVR01_0101_G04.b : aatcattttggcaaatcatcccccccaacttcaagaaaaccagttttcctttccaggggt
OVRT1_0152_D02.b : cactcagaaccaggtacttccaggggtttgttggacttttgggcatttttaaatgaaacc
OVRT1_0111_F07.b : tcccacaactcaagacccatttccttccagggaaggtggttagaacttttaggctacttt
SMG01_0062_C07.b : ccaccaactcaggaaacagttacctcaagggaagtttgttatgaccttttagctactttt
OVRT1_0017_E09.b : caccaatcaaaaaacagttccttccaggaggtttgtttgaactttaggctccttttaaaa
OVRT1_0037_D05.b : gatcatcccacaactcaagaacacattacttccaggtaggtttggtatgagctttaggct
CLNT1_0067_D08.b : GCGATCATCCCcacactccagacacagttacttccaagtaagttngttatgagcttttag
PBL01_0057_B12.b : GCGATCATCCCCACCACTCAAGAACACAGTTACtttcaaggggatggaaggggacgtgcc
OVRT1_0140_A01.b : GCGAatctccccccaaccaagaaccactttacttccagggggggtttgatagagcttttc
TCH01_0051_F06.b : GCGATTCTCCCCCCAACTtcagaaacacgtttccctccagggaggtttggttataaactt
OVRT1_0052_B04.b : GCGATCATCCCACCActcaagaacacagtacttcccagggtagtttgttatgagctttan
OVRT1_0050_C01.b : GCGATCATCCCACaacttcagaaccaagtactcccaggtaagtttgtattgacttttagc
LVR01_0099_G09.b : GCGATCATCCCACCCACTtcaagaacacagttactttccagggtaggtttgtttatgaac
THY01_0057_B07.b : GCGATCATCCCACCAACTCAAGAACACAGTTtacctccaaggagggggacatgcctgcag
SPL01_0090_H10.b : GCGATCTCCCCACAACCTCAAGAACACCGTTACTTTCCAGGAA*GGTTTGTTATGAagct
TCH01_0042_H07.b : GCGATCATCCCACCAGCTCAAGAACACAGTTA*CTCCCAGGTT*AGGTTGGTATGAGCTT
THY01_0039_A10.b : GCGATCATCCCACCAACTCAAAAACACAGTTACCCTCCAGGGAAGGTTTGTTATGAGCTT
LVR01_0101_A02.b : GCGATCATCCCACCAACTCAAGAACACAGTTACCTCCAAGGTA*GGTTTTGTATGAGCTT
SMG01_0038_C09.b : ttgtggaaaatcccccccacccccaaaaaaacgtttcccccccggggggagtttttttag
KDN01_0009_D05.b : GCGATCATCCCACCAACTCAAGAACACAGTTACCTCCNAGGGT*AGTTTNGTATGAGCTT
KDN01_0013_D11.b : GCGATCATCCCACCAACTCAAGAACACAGTTACCTCCCAGGTA*GGTTTGTTATGAGCTT
KDN01_0009_D04.b : GCGATCATCCCACCNACTCAAGA*CACAGTTACCTCCAAGGTA*GGTTTTGTATGAGCTT
BFLT1_0125_H08.b : tcatccccccacttcagaacacattttcttccagggaggtttgttagaaactttaaggct
OVRM1_0098_F11.b :
OVRT1_0089_B09.b : cgatctcccaccaactcaaaacacagttacttccaaggaaggttggtataaacttttggc
CBLT1_0011_B09.b :
CBLT1_0002_E06.b :
OVR01_0102_D12.b : ccctattctcaaaagataaatttccttccccgggagaaaatcactttttggcggaattaa
KDN01_0014_D11.b : GCGATCATCCCACCAACTCAAGAACACCGTTACCTCCCAGGGA*AGTTTGTTATGAGCTT
SPL01_0067_G01.b : GCGATCATCCCACCcaactcaaaaacacagttaacttcaagggtaggtttggtattgaac
OVR01_0076_H06.b :
LVRM1_0185_H03.b :
SPL01_0095_H08.b : GCGATCATCCCcaccaactcaagaacaccgtttactttccagggtaggtttgtttatgaa
ADR01_0084_H11.b : GCGATCATCCCACCAACTCNAGAACACAGTTACCTCCNAAGTA*NGTTTGTTATGAGCTT
OVRT1_0013_D08.b : GCGATCATCCCACCAACTCAGGACCACAGTTACTTCCCAAGTA*GGTTTGGTATGAGCTT
LVR01_0088_A08.b : GCGATCATCCCACCAACTCAAGAACACAGTTACTTCCAAGGTA*GGTTTGTTATGAGCTT
LVR01_0012_C12.b : GCGATCATCCCACCAACTCAAGAACACAGTTTACTTCCAGGTA*GGTTTGTTATGAGCTT
DCI01_0034_D03.b : cgatcatcccaaccactcaaaacaccagttacttcaaagtaggtttgtttataactttta
20110601C-007362 : TTAGGCTACTTTTTAAAAATGAATAGCTGAAAGAAAGATAATGTTGTAAAGTACC.....
---------+---------+---------+---------+---------+---------+ 1036
OVRM1_0043_F06.b :
PTG01_0041_A05.b : aaattaaaaaaaaaaagttttaaaaaccaaaaatttttgggcttttccgggaaatttttt
SMG01_0081_F02.b : aaatgaaaattgaaaaaaaataatggtgtaaaaacacaaaaaatttcaaggcttttccgg
LVR01_0014_A04.b : aacctttttagggctatttttttaaaaaagaaaaagtttaaaaaaaaaaaaaaatgtttt
BFLT1_0080_G09.b : aggctactttttaaaatggatacctgaaaaaaaaaatgttgtaaggacctacatacttcc
CLNT1_0082_E12.b : cacatttttaaaaggaaaactgaaaaaaaaaaagttttaaggaccccaataatttcaggg
OVR01_0066_B11.b : ttcccagaaaaacacccggtttccccctcccagggggaaaggttttgttatattaaaacc
OVRM1_0031_F07.b :
THY01_0051_F06.b :
CLNT1_0012_C07.b : ttttaaaatgaatactgaaaaaagataggtgtaagtactactacttctaggctttcctgc
OVRT1_0061_H08.b : aaggctctttttaagaaggaaaaccgaaaaaaaaaaaaggttgaaaaaacctaaattact
ITT01_0069_E08.b : cncctatggaattacaaggcagagaagaacccggaccaaagcatgcatgagctgctgcaa
OVRT1_0038_A07.b : gctactttttaaaatgaataactgaaaaaaaaataagttgaaagtcctactacatttcag
OVRM1_0109_D09.b :
OVRT1_0151_B06.b : gatacctgaaaaaaaataagttttaaatacctacataatccaggcttttcaagcaaaatt
SMG01_0099_F02.b : ctcttttttaaaaggaaaatttaaaaaaaaaaaaagttgaaagtcccaaataatttcaag
OVRT1_0093_C03.b : tttttaaatgaatactgaaaaaaaatatgttgaaagtcctactacattcaggcctttcct
KDN01_0083_C01.b : TTAGGCTACTTTTTAgaatgaaatattgaaagaaaaataatgttgtaaagtactacatac
BFLT1_0100_E10.b : TTAGGCTACTTTTTAGAATGAatagctgaaagaagaataatgttgtaaggaactacttac
TCH01_0097_E06.b : TTAGGCTACTTTTTAAaatgaatatttgaaaaaagataatggtgnaaagtaccttcatac
OVRM1_0036_H02.b :
OVRM1_0054_B09.b :
OVRM1_0172_C02.b :
OVRM1_0137_H08.b :
OVRM1_0150_B05.b :
OVRM1_0197_G06.b :
OVRM1_0217_E05.b :
OVRM1_0068_F01.b :
OVRM1_0088_H08.b :
OVRM1_0090_C12.b :
BFLT1_0148_G02.b : cctttgggccattttttaaaagagaaaagcccaaaaaaaaaataaggtttaaaaaacacc
OVR01_0077_C01.b : tttt
THY01_0070_F07.b :
SMG01_0015_E12.b : taaaaagaaaattttaaaaaaaaaaaggtgtaaaaaacccaaaacatttaggccctttcc
SPL01_0100_D12.b : aaaggtttggtaataagactttttttgggcttcctttttttaaaaattaaaataccttaa
OVR01_0101_G04.b : agggttttgtttattgaaacctttttagggctaccttttttttaagaaatgaaaaaattt
OVRT1_0152_D02.b : aaaaaaaaaaaggtggaaataccaaatatttcaggcttttccgggaaattttttgaaaac
OVRT1_0111_F07.b : ttagaatgaaaacctaaaaaaaaataaggtttaaagaactaacatattccagggcctttc
SMG01_0062_C07.b : aaaatggaaattgaaaaaaagataaggttaaagacccacttaattccaggcttttcctgg
OVRT1_0017_E09.b : tggaaagctgaaaaaaatataggttgaaagtcctacatatttctggccctttccgggaaa
OVRT1_0037_D05.b : acttttaaaatgatagctgaaagaggaaaatgtgaaagtactactactttaagcctttcc
CLNT1_0067_D08.b : ctacttttaaaatgaatactgaaagaaaaaatttggtaagtacctactcattctaggctt
PBL01_0057_B12.b : ctccncatatggaattacaagcccgaaaaaaaaccggaccaaaacattgactgaactgct
OVRT1_0140_A01.b : gctcttttttaaaataaaaccgaaaaaaaaaatagtgttaagtccccaaaatttctggct
TCH01_0051_F06.b : ttaggcccctttttaaaaatgaataatttaaaaaaaaataaatgttgaaaatacctcctt
OVRT1_0052_B04.b : gctacttttaagatgatagctgaagaagataatgtgtaaagtactactacatcnagggct
OVRT1_0050_C01.b : tactttttagaatgatagctgaaaaagaatatgtgtaaatacctactccttctaggcttt
LVR01_0099_G09.b : ttttaggctacttttttaaaaaatgaattacctgaaaaaaaagaaatatggttgtaaaag
THY01_0057_B07.b : catatgggaataccaaaggcagagaaagaacctggaccagaacagtgacctgagctgctg
SPL01_0090_H10.b : tttaggctacttttttaagaatgaataacttgaaaaaaaa
TCH01_0042_H07.b : TTAGGCTACCTTTTtaagatgaatagttgaaagaaaatgaaggtggtaaggtcctactta
THY01_0039_A10.b : TTAAGCTACTTTTtaagaaatgaatagttgaaaaaaaaaaaatggttgtaaaggacccta
LVR01_0101_A02.b : TTAGGCTACTTTTTtaaaaatgaatagtttaaaaaaaagataatggttgttaaagtacct
SMG01_0038_C09.b : aaaccttttgggcccttttttaaaaaaaaaaattttaaaaaaaaaaaaggtttgaaagaa
KDN01_0009_D05.b : TTAGGCTACTTTTTAgaaaatgataggtgaagaaggatatgttgtaagtacctantacat
KDN01_0013_D11.b : TTAGGCTACTTTTTAagattgantagttgaaaagaaagatatgtttgtaagtacctacat
KDN01_0009_D04.b : TTAGGCTACTTTTTAgaatgaatnagtgaaagaaagatatggtgtaagtactacatacat
BFLT1_0125_H08.b : ctttttaaaaggaaacccgaaaaaaaaaatggtgtaaattaccacaatcattctgggctt
OVRM1_0098_F11.b :
OVRT1_0089_B09.b : tacttttaaaatgaattcctgaaaaaaaaaaatgttgaaagtaccaaattcttttaggcc
CBLT1_0011_B09.b :
CBLT1_0002_E06.b :
OVR01_0102_D12.b : tattcccccccccaacttttttgagaaaaacacccaagatgttatacctcttccccaaga
KDN01_0014_D11.b : TTAGGCTACTTTTTAgaaagaatagttgaaagaaaagatatggttgtaaagtactacata
SPL01_0067_G01.b : ttttaggctaccttttaagaaag
OVR01_0076_H06.b :
LVRM1_0185_H03.b :
SPL01_0095_H08.b : ctttttaggcttctttttttaagaaagaaatagcctgaaaaaaaaaaataaatgttgtaa
ADR01_0084_H11.b : TTANGCTACTTTTTAagaatgaatagttgaaaagaagataatgtttgtaagtacctacat
OVRT1_0013_D08.b : TTAGGCTACTTTTTAagaatgaataactgaaaaaaagattatgttgtaaagtaactacat
LVR01_0088_A08.b : TTANGCTACTTTTTAAGAATGAATAGCTGAAAGAAAGATAATGTTGTAAAGTACCtaaat
LVR01_0012_C12.b : TTAGGCTACTTTTTAaaaatgaatagctgaaaagaaagataatgttgtaaagtacctaca
DCI01_0034_D03.b : ggctactttttagaatggataatttaaagaaagataaggtgttaagtacctaaatctttc
20110601C-007362 : ............................................................
---------+---------+---------+---------+---------+---------+ 1036
OVRM1_0043_F06.b :
PTG01_0041_A05.b : taaaaatacagtgccggggattggggggggttccccttttatggggagagcgggggtgga
SMG01_0081_F02.b : caaatttttttaaaaataaggggttcgggatttgggggggtttccccattttagggagaa
LVR01_0014_A04.b : gaaaaagtaccctccttaacttttctttgggccctttttttccttggcaaaaaatttttt
BFLT1_0080_G09.b : aagccttttcctggaaaatttttttgaaaattacggtttcttgaatttgggggggttttc
CLNT1_0082_E12.b : ctttcctggggatatttttttaattcaagggctccgatttggtnggggtttcccatttat
OVR01_0066_B11.b : ccttcttttagggggcctctctttttttataaaaaaatgaaaaattattttgttaaaaac
OVRM1_0031_F07.b :
THY01_0051_F06.b :
CLNT1_0012_C07.b : agattttttgaaatacaggatctgagtaggagggttctccattttaggggaacctaggtt
OVRT1_0061_H08.b : tttagggcctttctcatgcaaaaatttttttgaaatttacaggtttcctgaatttggggg
ITT01_0069_E08.b : tgaaatgctggatcttaactgctgcacacaaagaactccccaagctgggttttataggag
OVRT1_0038_A07.b : gcttttcctggaagatattttgaaaattcaggttactgaagtgggaggttatcccattta
OVRM1_0109_D09.b :
OVRT1_0151_B06.b : ttttgaaaattcaggtacagaaattgggggggttccccatttaaagggggaaccaagttt
SMG01_0099_F02.b : ccttttccaggaaaattatttttgaaattcagggtatccgaagttgggggggtttctcca
OVRT1_0093_C03.b : gcaaatattttgaaattcaaggatctgatttggagggttctcccaataagggggaaacta
KDN01_0083_C01.b : attctaagccttttccatgcaaatatttttgagaaatacaaggtatcctgaattaggtag
BFLT1_0100_E10.b : atcctaggccttccatggcagattatttttgaaaattccagggtcctggaattaggtagg
TCH01_0097_E06.b : tttctaggctttttccttgcagattattttgaaaattacaggattctgaagtagtagggt
OVRM1_0036_H02.b :
OVRM1_0054_B09.b :
OVRM1_0172_C02.b :
OVRM1_0137_H08.b :
OVRM1_0150_B05.b :
OVRM1_0197_G06.b :
OVRM1_0217_E05.b :
OVRM1_0068_F01.b :
OVRM1_0088_H08.b :
OVRM1_0090_C12.b :
BFLT1_0148_G02.b : aaaaatttttgggcgcttttcccggaaaaaatttttttaaaattcaagggggccctagaa
OVR01_0077_C01.b :
THY01_0070_F07.b :
SMG01_0015_E12.b : tggaaaaaattttttgaaattccgggtcccgagaatttggggggttcccccctttatggg
SPL01_0100_D12.b : aaaaaaaaaaataatgtttgtgaaaaagacaccttcccactcct
OVR01_0101_G04.b : ttaaaagaaaaaaaatn
OVRT1_0152_D02.b : cagggtccgaggtggggggttccccctttagggggggacggaggtggaaaagccccattt
OVRT1_0111_F07.b : agggaaaataatttttgaaattacagggacccggaatttgggggggtttcccatttaaag
SMG01_0062_C07.b : agattattttgaaatttcaggatccgaaattgggagggttcccactttatatgaagaact
OVRT1_0017_E09.b : aattttttaaactccagggttccggatttgggtgggtttcccatttatggtggaaactta
OVRT1_0037_D05.b : agcaaaatatttttgaaattcagggatctgaatttagtagggtttccccattttaagggg
CLNT1_0067_D08.b : ttctgcaaaatatttggaaaatcacagtacctgaagttgggagggtatcccactttatgg
PBL01_0057_B12.b : gcctgaaaaggctggatccttacctgctgcacacaaaaaactcccccaaactggggttta
OVRT1_0140_A01.b : tttcccggaaaatttttgaaaatacaggggacccggagtgggggggtttccccactttag
TCH01_0051_F06.b : acattttaggccttttcctggcaaaatttttttgaaaatttccagggtatctggaatttg
OVRT1_0052_B04.b : tttcatgcaaattattttgaaaataacagtatcgtgaagttggtaggtttcttccatttt
OVRT1_0050_C01.b : cccggaaaattttttgaaattcaagtacatgaattaggagggttccccaatttagggggg
LVR01_0099_G09.b : taccctaccataccttttctaagggccttttttccctggcaaaaaatttatttttttgaa
THY01_0057_B07.b : cagtgacaatgcttggatccttaccctgctgccccccaaagaaaactcccccccaaagct
SPL01_0090_H10.b :
TCH01_0042_H07.b : cattctaggccttttccatgcagaatattttgaaaatttcaggtttcctgaaatttggta
THY01_0039_A10.b : cattaatttctagggcctttttcccttgcaaaaattattn
LVR01_0101_A02.b : aacattcctttctaggcccttttttccttgcaaaaaatattttttttaaaaaatttacca
SMG01_0038_C09.b : acccaaaaattttttgggcttttttcggggaaaatttttttttaaaaaaccagcggtccc
KDN01_0009_D05.b : tctagcttttcatggcagatattttgagaatacaggtatcatgagttagtagggtatctc
KDN01_0013_D11.b : acattctaaggcttttccatgcaagattatttttggaattaacaagtatcaggaggtttg
KDN01_0009_D04.b : tctagccttttcatgcnnagatattttgagantacaaggatcagaatttggtagggttcc
BFLT1_0125_H08.b : ttcctgcagaatttttttgaaataacaggttcaggaattagggggggtcccccattttag
OVRM1_0098_F11.b :
OVRT1_0089_B09.b : tttttcagcgaaatttttttaaaattcaaggtttcagaaattaggggggtatcccccttt
CBLT1_0011_B09.b :
CBLT1_0002_E06.b :
OVR01_0102_D12.b : gggtaagggggtttttgtgttttaatagaaacccttttttatatggggcacaacacttct
KDN01_0014_D11.b : cattccagggcttttcctggcagattattttgaagattacaaggtatcctgaatttggga
SPL01_0067_G01.b :
OVR01_0076_H06.b :
LVRM1_0185_H03.b :
SPL01_0095_H08.b : aagttccctaccctaacatttcttaggcccctttttcccaggccagaa
ADR01_0084_H11.b : acattctagcctttttcatggcagattattttgagaattaccaggtatctggagttaggt
OVRT1_0013_D08.b : actttctaggctttttcatgccagattatttttaagattacaagtatcttgaaataggta
LVR01_0088_A08.b : acattctaagccctttcccttgcaaaaattatttttgaaaaataacaaggtattcatgaa
LVR01_0012_C12.b : tacatttctaagcctttttccatgcaaaattattttttgaaaaattccaaggtatcattg
DCI01_0034_D03.b : aagccttttcctgcagaatttttttgaaaatttcagggtccggaatttggggggtttcct
20110601C-007362 : ............................................................
---------+---------+---------+---------+---------+---------+ 1036
OVRM1_0043_F06.b :
PTG01_0041_A05.b : gaggcccttttttatagggggaaaaaaaagcaccccggggccccggggattttttcaatt
SMG01_0081_F02.b : accgaggttgtaaaagccccatattttttatggggggaaaaaaaaacccccccgggggcc
LVR01_0014_A04.b : tttttaaaaaaaattttacagggggtttttccttgaaaaattttggggggtagggggggt
BFLT1_0080_G09.b : ccattttagggtgggaaccaagtttgaaaaggcccctattttataaggggcaaattaaaa
CLNT1_0082_E12.b : tgggggaaccaaaattttaaaaaccccctcttttttatgggggggaaaaaaacccccggg
OVR01_0066_B11.b : aaaaaaa
OVRM1_0031_F07.b :
THY01_0051_F06.b :
CLNT1_0012_C07.b : aaaaagcccctttttaaatgggcgagtaaaacacctcgggcccccgggaccttccacgta
OVRT1_0061_H08.b : ggtttccccaatttatggggggggaaaccagagttggaaaaagcccccatatttttatat
ITT01_0069_E08.b : atgttggattaattatcccccaagtggaagactgtaagtgaaaagaatgattcgtataaa
OVRT1_0038_A07.b : aggtgggaacctagttgaaaaagcccatatttaaatggggaaaaaaaacaccccgggggc
OVRM1_0109_D09.b :
OVRT1_0151_B06.b : taaaaagccctattttttaagggggaaaaaaaaccccccggggccccggggcttttcaat
SMG01_0099_F02.b : ttttaaggggggaaccgaagttttgaaaagcccattttttaaaaggggaaaataaaatcc
OVRT1_0093_C03.b : gtttgaaaggcccatttttaaagggcaaactaaataccccagggcaccggatccttccag
KDN01_0083_C01.b : gttatctccatttataggtaagaaacttaagtttggaattaggccactaattttataagg
BFLT1_0100_E10.b : gtacccccatttatgggggggaccctaattttgaaaaaggcccccatttttaatatgggc
TCH01_0097_E06.b : tatcccaattttaggtaagaaactaaagttggaatagcccctttttttaaagggccaagc
OVRM1_0036_H02.b :
OVRM1_0054_B09.b :
OVRM1_0172_C02.b :
OVRM1_0137_H08.b :
OVRM1_0150_B05.b :
OVRM1_0197_G06.b :
OVRM1_0217_E05.b :
OVRM1_0068_F01.b :
OVRM1_0088_H08.b :
OVRM1_0090_C12.b :
BFLT1_0148_G02.b : ttggggggggtttctcccatattttggggggggaacccgagttgttataaaacccctttt
OVR01_0077_C01.b :
THY01_0070_F07.b :
SMG01_0015_E12.b : gaaaccctagttttgaaaaccccccatttttaaaagggcgaaaaaaaaccccccctgggg
SPL01_0100_D12.b :
OVR01_0101_G04.b :
OVRT1_0152_D02.b : ttatgggggggaaaaaaaccccgggggcgcggggtttttttatttatattggggggagaa
OVRT1_0111_F07.b : gtgggaaactaggtttggaaaaacgccctttttaaaagggggaaaaaaaaaacacccctg
SMG01_0062_C07.b : aaggttgaaaagcccatattttaaagggcaagtaaaaaacccccggcccacggaaccttt
OVRT1_0017_E09.b : atttttaaaagcccactctttaatgtgggaagcaaaaataccctctgtgtgcctccgggg
OVRT1_0037_D05.b : ggaacctaggttgaaaaaggccctagttttaaatgggcaagctaaaacaaccccaggggc
CLNT1_0067_D08.b : ggggaaccaaggtttgaaaagccccattttttaaaggggaaaataaaacaccccccgggg
PBL01_0057_B12.b : attagataattgtggattaattactcccccaaatggaggaccgttaaggaaatagaagat
OVRT1_0140_A01.b : gggggaacatgtttttaaaagcccccttttttattggggaaaaaaaaaaacccccgggtc
TCH01_0051_F06.b : ggaggggtttccccacttttaaggtagagaaactaaggttgtaaaagcgcccccttcttt
OVRT1_0052_B04.b : aagggggaaaccgaggttgaaaaaggccctaattttaaagggggaaacaaaaaacccccc
OVRT1_0050_C01.b : aaactagtttgaaaaaggcccttttttaaagggcaagctaaatacccccggggcaccgga
LVR01_0099_G09.b : aaaattttaaaaggggttattcaatttaaaaattttttaggggtttaggggggttttttt
THY01_0057_B07.b : tgggttttttttttaaaaaggaattgtttgg
SPL01_0090_H10.b :
TCH01_0042_H07.b : gggtttcctccatttataggtgagaaactaaggttggaatatgccccatattttattatg
THY01_0039_A10.b :
LVR01_0101_A02.b : agggttttcaagggaaatttttggggtaaggggtttttttcttccccaattttttattta
SMG01_0038_C09.b : aaaaattttgggggggttctctccccttttttggggagaaaaacaaatttttttaaaaac
KDN01_0009_D05.b : aattaatagtgaggaactgagttggaaatagcccctaatttataagggcaactaaaacca
KDN01_0013_D11.b : gtagggttatctcccatttaaggtaaggaaactgaggtttggaataagcccataatttta
KDN01_0009_D04.b : tccattttggtgaggaactgagtttgaattagcccatattttaaatgggggactaaaaca
BFLT1_0125_H08.b : gggggaacccaagtttggaaaagcccatattttaaagggggaacaaaaaccccccggggg
OVRM1_0098_F11.b :
OVRT1_0089_B09.b : aagggggaaaccaagtttgaaaaggccccttttttaaaagggcaaataaaaacaccccgg
CBLT1_0011_B09.b :
CBLT1_0002_E06.b :
OVR01_0102_D12.b : tttttta
KDN01_0014_D11.b : aggttacctccatttataggttaggaacctgagggttggaattaggcccatagttttaat
SPL01_0067_G01.b :
OVR01_0076_H06.b :
LVRM1_0185_H03.b :
SPL01_0095_H08.b :
ADR01_0084_H11.b : agggttacttcaaataataggtgaggaaacttaaggtttgaattagccccactaatttaa
OVRT1_0013_D08.b : gggtaatctccatttaaagtggggaaaccaaggttggaaaaagccccatatttttaatat
LVR01_0088_A08.b : attagggaaggggtttcctcccaattttataggttgggggaaaccttaaaggttttggaa
LVR01_0012_C12.b : aaattaagggtaagggttatcttccaattttatagggtggggaaaacctaaaggttttgg
DCI01_0034_D03.b : catttaaaggtagaaaccaaagtttgaatagcccctaattttatatgggcaaaccaaaac
20110601C-007362 : ............................................................
---------+---------+---------+---------+---------+---------+ 1036
OVRM1_0043_F06.b :
PTG01_0041_A05.b : tttttggcggggaaaaaaaaaaagggggtttaacccccaaaaacgaaaacacgttttatt
SMG01_0081_F02.b : ccggggcctttctcaagtattttgcgggggggaaattaaaaaaaggggttttaaaacccc
LVR01_0014_A04.b : ttttttctccccccatattttttttttatggggggtggaaaggggaaaaaagcccttgta
BFLT1_0080_G09.b : taccctcagggcccccggatcctttcaaattttatgtcggggggaaattgaaaaaagggg
CLNT1_0082_E12.b : gggccggggacctttcacatttatttttggggggggaggagcaaaaagggggttaaaccc
OVR01_0066_B11.b :
OVRM1_0031_F07.b :
THY01_0051_F06.b :
CLNT1_0012_C07.b : attgccggggggaataaaaaaaggggttcaaacccctaagacggaaaacggttgatcaat
OVRT1_0061_H08.b : ggtggaaaataaaaaccacccccgggtggccacccggggatcttttccaatggtttattg
ITT01_0069_E08.b : gtcaatctaaactccgaataaaaagttttaaaaaaaaaaaaaaaaaggcccttgtccaca
OVRT1_0038_A07.b : cccgaacctttccaggtaatttcgggggagattaaaaaagggggtttaaaccccttaaag
OVRM1_0109_D09.b :
OVRT1_0151_B06.b : ttatttgccgggggaaatgcaaaagggcgcttcaacccccaaacacagaaaagggtgtta
SMG01_0099_F02.b : cccccaggggccccgggaacctttccaccattttttccggggggaaacctttagggaaaa
OVRT1_0093_C03.b : tttaatgcggggggaatcaaaaggggttcaaacccttaaacgggaaacgttggctttttg
KDN01_0083_C01.b : ggcaaactaaaatcaacccccatggccctcctgaatcctttccaaatgtttaatgtcatg
BFLT1_0100_E10.b : gaactaaaaacacccccgggggcccccggggacctttccaattttattttccggggggga
TCH01_0097_E06.b : taaagcaaccctcgggcccccgggagtctttccactgtattgtcggggggaagaattaca
OVRM1_0036_H02.b :
OVRM1_0054_B09.b :
OVRM1_0172_C02.b :
OVRM1_0137_H08.b :
OVRM1_0150_B05.b :
OVRM1_0197_G06.b :
OVRM1_0217_E05.b :
OVRM1_0068_F01.b :
OVRM1_0088_H08.b :
OVRM1_0090_C12.b :
BFLT1_0148_G02.b : tttttattggggggaaaaataaaatacaccccgggtcgccacgggagtcttctccaattt
OVR01_0077_C01.b :
THY01_0070_F07.b :
SMG01_0015_E12.b : cccccgggcgctcttcccaggtattttgcgcgggggaaaatacaaaaagggggttctaaa
SPL01_0100_D12.b :
OVR01_0101_G04.b :
OVRT1_0152_D02.b : aaaaaaagggggtaaccccccaaacanaaaaacgttgattttttagaaaacatccccaaa
OVRT1_0111_F07.b : tggcccgagagcctttccatattttttgtgggggagaaaaacaaaagagggtcaaaccct
SMG01_0062_C07.b : catggtaattgcggggaaaaatgacaaaggggcttaaacccttaaaacgggaaacaggtg
OVRT1_0017_E09.b : cttttcacatttatttccgggggagaattaaaaaggggttgtaaacccccaaatacgatt
OVRT1_0037_D05.b : caccggaccttttaacagttatttgcgggggggaatggaaaaagggggttttaaaccttt
CLNT1_0067_D08.b : ccccgggccttttcccagtattattgcggggggagaaaaaaaaaagggggttcaaaccct
PBL01_0057_B12.b : tcgtaaaaaggcaatccaaatctcaaataaaatttttaaaaaaaaaaaaaaaaaggccct
OVRT1_0140_A01.b : cccgaggaatcttcaaaaatttttttggggggaaaaaaaaaaaaggggcttctccccccc
TCH01_0051_F06.b : ttataggggcaaactaaaaatcaccccccgtgggccactggggacctcttccacagtttt
OVRT1_0052_B04.b : gggggccccgggaactttcaaatgtaaattgcgggggggaattaccaaaaggggttctaa
OVRT1_0050_C01.b : cccttccaagtttatgcggggggaaaaaacaaaaggggtctcacccctcaaaacgaaaac
LVR01_0099_G09.b : tcccccccccaaaatttttttttttaaaagaggggggggggg
THY01_0057_B07.b :
SPL01_0090_H10.b :
TCH01_0042_H07.b : ggccgagctagaatcacccccctgtgcccac
THY01_0039_A10.b :
LVR01_0101_A02.b : gggggtggagaggaaaaacccctttaaaaggggtttttttttgggaaaaaaa
SMG01_0038_C09.b : ccccccttttttttttattggggggggagaaaaaaaaacccccccgggggggcccccggg
KDN01_0009_D05.b : actcagggctactgagcctttcacagttatggcggggggggatgacaaaggaggcttaaa
KDN01_0013_D11.b : aaaatggcaaactaaaatccaccccaagggggcccaccggagccctttctaaagtttaat
KDN01_0009_D04.b : ccccctgggcaccggagccttcccggttatgtcggggggggattggcaaagaggggttaa
BFLT1_0125_H08.b : cccccggatctttccacggtttttggcggggggaagtggaaaagagggctttaacctcct
OVRM1_0098_F11.b :
OVRT1_0089_B09.b : gggccccgggccctttcaacgtttgttcgcggggggaaattaacaaataaggtttacaaa
CBLT1_0011_B09.b :
CBLT1_0002_E06.b :
OVR01_0102_D12.b :
KDN01_0014_D11.b : aggggaaaactaaaatcaccctcaggggccaccgggagccctttcccaatgtttattttg
SPL01_0067_G01.b :
OVR01_0076_H06.b :
LVRM1_0185_H03.b :
SPL01_0095_H08.b :
ADR01_0084_H11.b : aaatgggcaaagctaaaatcaaccctcagggtgctacctggaatccctttccaaatttta
OVRT1_0013_D08.b : gggcaaactaaaatccaccccaggggcctaccggaactctttccaatgttaaattgcagg
LVR01_0088_A08.b : aaaaagggccccccttaatttttttaaaaaaatgggggcaaaaaaccttaaaaaaatccc
LVR01_0012_C12.b : aaagaaaggggccccataaattttttaaataattggggccaaaaaacctaaaaaaattta
DCI01_0034_D03.b : acccccagggccccctggaacccttccacaggttattgccggggggagaattacaaataa
20110601C-007362 : ............................................................
---------+---------+---------+---------+---------+---------+ 1036
OVRM1_0043_F06.b :
PTG01_0041_A05.b : ttgttgaagaaaatgcccacaaaaaaaaaagggttgtggggggggcccgataacgcggga
SMG01_0081_F02.b : ttaaaacgggaaaaacgtgttacaacgttggaaaaaaaaattttgcaaaaaaaaaaaaaa
LVR01_0014_A04.b : taagggggttttgtgttgg
BFLT1_0080_G09.b : gtttaaaccctctaaaacgggaaaaccggtggaccactttgtaaaaagaacttcccaaaa
CLNT1_0082_E12.b : ctccaacgggggaa
OVR01_0066_B11.b :
OVRM1_0031_F07.b :
THY01_0051_F06.b :
CLNT1_0012_C07.b : gttggaaaacattgcaaaaaaaaaccggtcgtgggggggccaaataaaaaaccccccccc
OVRT1_0061_H08.b : tggcgtgcggaa
ITT01_0069_E08.b : cgggttcgcccctctaaatccctgggggccattaccgacccctttttaaagggcccatgg
OVRT1_0038_A07.b : cggaaaaacgttgacaattttgaaaaaccatggcgaaaaaaaaaaaaagagttgtgggtg
OVRM1_0109_D09.b :
OVRT1_0151_B06.b : cctttgtaaaaaaacttgccaaaaaaaagaggcgtgcggcgggcgcgcaaaataaaaacc
SMG01_0099_F02.b : aaatatcttaaaatgcaacccaccccccaaaaaaatttttaaaaaannaaanaaaaaaaa
OVRT1_0093_C03.b : tgaaaaatttttaaaaaaaaaaagactggtaccgggcggccaataaaaacccccccaaaa
KDN01_0083_C01.b : ggggagaatgtaaaaataagggctttaaagccccttaaaacccggaaaaaccggtaagtc
BFLT1_0100_E10.b : aaattacaaagaggggggtttcaagaccct
TCH01_0097_E06.b : aatgagggttttaaacccctaaaaaccggaaaaacggttggactgaatgtagaaaacaat
OVRM1_0036_H02.b :
OVRM1_0054_B09.b :
OVRM1_0172_C02.b :
OVRM1_0137_H08.b :
OVRM1_0150_B05.b :
OVRM1_0197_G06.b :
OVRM1_0217_E05.b :
OVRM1_0068_F01.b :
OVRM1_0088_H08.b :
OVRM1_0090_C12.b :
BFLT1_0148_G02.b : atatttccgggggagaaaataataaaaagagggcgctctaaacccctaaaaacgagtgaa
OVR01_0077_C01.b :
THY01_0070_F07.b :
SMG01_0015_E12.b : ccccttcaaaacgggaaaacctgtttttctttttttttt
SPL01_0100_D12.b :
OVR01_0101_G04.b :
OVRT1_0152_D02.b : aaaaaaagagggtggggcggcgccggaaaccccccccaaaaatgtttttgtgaaaaaaaa
OVRT1_0111_F07.b : caaaacgtaaaacgtgtggtctttttggaaaaaccttccccaaaaaaaaaagccggcgcg
SMG01_0062_C07.b : tccgattggagaaaaaattccacaaaaaaaaaggagtgttagtggggccctaatccgggc
OVRT1_0017_E09.b : aaacgtgtacatcattgtaacaaacacttgccacaaaaaaagaaggtgtgctctaggggg
OVRT1_0037_D05.b : aaaaacggaaaacgggttgttccattgttgaaacaacctggcaaaaaaaaaaaaagcggt
CLNT1_0067_D08.b : taaaacggaaaaaacttgtttcttgtttgaaaaaaatggcgaaaaaaaaaagggtgtttg
PBL01_0057_B12.b : tggtcaacctgggtccggccccaaaaacccgagggccaattaccaacacttt
OVRT1_0140_A01.b : taagggagaaaatggtgtttatgtttatgtaaaatcccaccaaaaaaaaaaaggggttgg
TCH01_0051_F06.b : attttctccgggggaaaattaaacaaata
OVRT1_0052_B04.b : accctaaaaacgggaaacggtgtttactatttgaaaaaaactgccacaaaaaaaaaaagg
OVRT1_0050_C01.b : agggtttcctattgggaaaaaattcccaaaaaaaaaaaaaagttttgcgggggccccaat
LVR01_0099_G09.b :
THY01_0057_B07.b :
SPL01_0090_H10.b :
TCH01_0042_H07.b :
THY01_0039_A10.b :
LVR01_0101_A02.b :
SMG01_0038_C09.b : ggtttttcttaacaaaattaatttgggggggggggagaaaaaaaaaaaaaagggtgtctt
KDN01_0009_D05.b : cccctaacccggaaaacaggtggtcaattgaggaaaaatggcaacaaaaaaaggaagtcg
KDN01_0013_D11.b : tgcggggggggaagaattaaacaaaagagggcgtttaaagcccctctaaaaaccgggaaa
KDN01_0009_D04.b : agcccttaaaccgaaaaaggttggtcgattggaggaaaaaatgcccacaaaaaaaagaag
BFLT1_0125_H08.b : taaaccggaaaaccgttgtcatcatttgtataaaaacatttgcccaaaaaaaaagagacg
OVRM1_0098_F11.b :
OVRT1_0089_B09.b : cccttaaagcgggaaaccggttgatctatttttagaaagaaattgccaaacaaaaaaaag
CBLT1_0011_B09.b :
CBLT1_0002_E06.b :
OVR01_0102_D12.b :
KDN01_0014_D11.b : cggggggagaattaaccaaaatggagggtttcaaaagccctaaaaacccggaaaaaccgg
SPL01_0067_G01.b :
OVR01_0076_H06.b :
LVRM1_0185_H03.b :
SPL01_0095_H08.b :
ADR01_0084_H11.b : atattttcaggggggaagaatttaacaaaaataaggggttttaaaaatcccccttaaaga
OVRT1_0013_D08.b : ggggaaataaacaaaagaaggcttttaaagtcccttaaaacccggaaaaccggttaggac
LVR01_0088_A08.b : aaccccccccccagtttgtggcccccctcccccttgggggaaagttcccctctttttttt
LVR01_0012_C12.b : caaccccccttcaaggtgggggccctaaacccttgggggaaatttccctttttttttccc
DCI01_0034_D03.b : agggctttaaaacccctaaaaccggaaaaaacgtttggatcgattgtgaagaaaacaatg
20110601C-007362 : ............................................................
---------+---------+---------+---------+---------+---------+ 1036
OVRM1_0043_F06.b :
PTG01_0041_A05.b : gccccccttttgaagtaataaataaacccctatcccaaacttttattctgttat
SMG01_0081_F02.b : ccacattttttcccacaaggagagatttgtgata
LVR01_0014_A04.b :
BFLT1_0080_G09.b : aaaaaaaagctgtgg
CLNT1_0082_E12.b :
OVR01_0066_B11.b :
OVRM1_0031_F07.b :
THY01_0051_F06.b :
CLNT1_0012_C07.b : caaaaaagggttttttttt
OVRT1_0061_H08.b :
ITT01_0069_E08.b : ggcatataaacggaggcggctttaacccgcgggaacaccctgtgttttaaacccttctgg
OVRT1_0038_A07.b : ggcgcctataaaaaaacccccccctaaaaagaa
OVRM1_0109_D09.b :
OVRT1_0151_B06.b : cccccacaaaaaaggttgtgttgtataataaaaaaacaaaaattgtttggtggcggt
SMG01_0099_F02.b : aaaaaanaaannnnaagaaaaaaaaaggggggggtgttgggtggggcgcctatattccgg
OVRT1_0093_C03.b : aaaagttgtttttgttatagaaaaaacaaattttgttggggaacgcgaa
KDN01_0083_C01.b : cgaatggaaggaaacaaatggcccaacaaaaaaaaaaaaggccttgttccatggtcgccc
BFLT1_0100_E10.b :
TCH01_0097_E06.b : ttgccaaaaaaaaaaaggcccggtc
OVRM1_0036_H02.b :
OVRM1_0054_B09.b :
OVRM1_0172_C02.b :
OVRM1_0137_H08.b :
OVRM1_0150_B05.b :
OVRM1_0197_G06.b :
OVRM1_0217_E05.b :
OVRM1_0068_F01.b :
OVRM1_0088_H08.b :
OVRM1_0090_C12.b :
BFLT1_0148_G02.b : cagcgttgttgtcctattgtgtgaagaaacaccctc
OVR01_0077_C01.b :
THY01_0070_F07.b :
SMG01_0015_E12.b :
SPL01_0100_D12.b :
OVR01_0101_G04.b :
OVRT1_0152_D02.b : ttttttttggt
OVRT1_0111_F07.b : cggcgccggaaaaaaaaccccccccccaaaaagttttttttttgttgaaaaaaaaaannn
SMG01_0062_C07.b : acacccccttttgagccatgtatttccggccttcccggaacgtgtggacctggggaccac
OVRT1_0017_E09.b : cgcgaatataaaaccctcc
OVRT1_0037_D05.b : ttcctggttggccccaaaataaaacccccccccacaaaaaaaaggttgtttttttatata
CLNT1_0067_D08.b : ggggcgcgccaaaaaaccaccccccccaaaaaaggtgttttttttn
PBL01_0057_B12.b :
OVRT1_0140_A01.b : gggcgccggcctttataacccccccaaaaagtttttttgtttctaacaca
TCH01_0051_F06.b :
OVRT1_0052_B04.b : cggtcgccgggggccccaataaaaaccccccccaaaaaaaagtttttttttgtaaaaaac
OVRT1_0050_C01.b : taaaaaacccccccgaaaaaatttt
LVR01_0099_G09.b :
THY01_0057_B07.b :
SPL01_0090_H10.b :
TCH01_0042_H07.b :
THY01_0039_A10.b :
LVR01_0101_A02.b :
SMG01_0038_C09.b : ttcccccccctcataaaaannnaaaaaattttgttttttttttttttttttt
KDN01_0009_D05.b : gtggggcgcgaaagaaacccccccccaaaagaggtgtttttggaaaaaaaaatataattt
KDN01_0013_D11.b : aaaggtttggttcgaattggaagaaaaaaaatttgcccaaaaaaaaaaaaaaaaatatgt
KDN01_0009_D04.b : gtggtggggggcgggcggaacccccccccccaagaggtgttgttgtaagataaatttnnn
BFLT1_0125_H08.b : gtgcgcggggccccccaataaaaaaacccccccccaaaaaaaaattttttttttttttat
OVRM1_0098_F11.b :
OVRT1_0089_B09.b : cctgtttcttagggggcctaaaaa
CBLT1_0011_B09.b :
CBLT1_0002_E06.b :
OVR01_0102_D12.b :
KDN01_0014_D11.b : tttgagtcagaattggaaggaaaaacacatggccaaaaaaaaaaaaaaggaacttgtttt
SPL01_0067_G01.b :
OVR01_0076_H06.b :
LVRM1_0185_H03.b :
SPL01_0095_H08.b :
ADR01_0084_H11.b : ccgggaaaaaacccggttagacaacgaatttgaaaggaaaaaacaatgttccaacaaaaa
OVRT1_0013_D08.b : cgaatttgaagaaaaacattgccaaaacaaaaaaaaaaaagccatttctattcggggccc
LVR01_0088_A08.b : tcccacacaaaaaaatttgtgt
LVR01_0012_C12.b : aaacaaaatgggttttttaataatttttttttttttc
DCI01_0034_D03.b : gccacaaaaaaaaaaaaaaccccaatttttttcccaaagtgggggatattgggaaaaaaa
20110601C-007362 : ............................................................
---------+---------+---------+---------+---------+---------+ 1036
OVRM1_0043_F06.b :
PTG01_0041_A05.b :
SMG01_0081_F02.b :
LVR01_0014_A04.b :
BFLT1_0080_G09.b :
CLNT1_0082_E12.b :
OVR01_0066_B11.b :
OVRM1_0031_F07.b :
THY01_0051_F06.b :
CLNT1_0012_C07.b :
OVRT1_0061_H08.b :
ITT01_0069_E08.b : ggaatggacacccacataccccggaaattttttgggtaccgc
OVRT1_0038_A07.b :
OVRM1_0109_D09.b :
OVRT1_0151_B06.b :
SMG01_0099_F02.b : ggccaaaacccctttttgaagccatagaatataaagggcctttttcggggaagggttt
OVRT1_0093_C03.b :
KDN01_0083_C01.b : ttaataattaaaaaccccccccc
BFLT1_0100_E10.b :
TCH01_0097_E06.b :
OVRM1_0036_H02.b :
OVRM1_0054_B09.b :
OVRM1_0172_C02.b :
OVRM1_0137_H08.b :
OVRM1_0150_B05.b :
OVRM1_0197_G06.b :
OVRM1_0217_E05.b :
OVRM1_0068_F01.b :
OVRM1_0088_H08.b :
OVRM1_0090_C12.b :
BFLT1_0148_G02.b :
OVR01_0077_C01.b :
THY01_0070_F07.b :
SMG01_0015_E12.b :
SPL01_0100_D12.b :
OVR01_0101_G04.b :
OVRT1_0152_D02.b :
OVRT1_0111_F07.b : nttttttttttgtgtagggataaaagcccccctaccatgtt
SMG01_0062_C07.b : accaaaaagaannnnnttaataaacttttccccctatcaatcgnnn
OVRT1_0017_E09.b :
OVRT1_0037_D05.b : taaaaacaaaaaaaatttcgtgtgtgtcgct
CLNT1_0067_D08.b :
PBL01_0057_B12.b :
OVRT1_0140_A01.b :
TCH01_0051_F06.b :
OVRT1_0052_B04.b : aaatt
OVRT1_0050_C01.b :
LVR01_0099_G09.b :
THY01_0057_B07.b :
SPL01_0090_H10.b :
TCH01_0042_H07.b :
THY01_0039_A10.b :
LVR01_0101_A02.b :
SMG01_0038_C09.b :
KDN01_0009_D05.b : ttttttttnnnnnnnnccctcccctttnnnnnnnnnngaagagaaagcgctccnnnnnnn
KDN01_0013_D11.b : tttttggtcgcgccctaaataaaaaaacacccacccctct
KDN01_0009_D04.b : nnnnnnnnnnnnnntttccgtcctcattttttnnnnnnnnnannaagagaaagcctgctt
BFLT1_0125_H08.b : taaaaaaaacaaaatttttgggtggggccaccggcg
OVRM1_0098_F11.b :
OVRT1_0089_B09.b :
CBLT1_0011_B09.b :
CBLT1_0002_E06.b :
OVR01_0102_D12.b :
KDN01_0014_D11.b : acttgtgggcgcgtataa
SPL01_0067_G01.b :
OVR01_0076_H06.b :
LVRM1_0185_H03.b :
SPL01_0095_H08.b :
ADR01_0084_H11.b : aa
OVRT1_0013_D08.b : ctcaatttaaaaaaccccccccccgacaaaaaaaaagattgtttccttttttccttggaa
LVR01_0088_A08.b :
LVR01_0012_C12.b :
DCI01_0034_D03.b : aaaatagaagacccccctggacactttttgggtttttgagaaaccccaacgggaacccgg
20110601C-007362 : ............................................................
---------+---------+---------+---------+---------+---------+ 1036
OVRM1_0043_F06.b :
PTG01_0041_A05.b :
SMG01_0081_F02.b :
LVR01_0014_A04.b :
BFLT1_0080_G09.b :
CLNT1_0082_E12.b :
OVR01_0066_B11.b :
OVRM1_0031_F07.b :
THY01_0051_F06.b :
CLNT1_0012_C07.b :
OVRT1_0061_H08.b :
ITT01_0069_E08.b :
OVRT1_0038_A07.b :
OVRM1_0109_D09.b :
OVRT1_0151_B06.b :
SMG01_0099_F02.b :
OVRT1_0093_C03.b :
KDN01_0083_C01.b :
BFLT1_0100_E10.b :
TCH01_0097_E06.b :
OVRM1_0036_H02.b :
OVRM1_0054_B09.b :
OVRM1_0172_C02.b :
OVRM1_0137_H08.b :
OVRM1_0150_B05.b :
OVRM1_0197_G06.b :
OVRM1_0217_E05.b :
OVRM1_0068_F01.b :
OVRM1_0088_H08.b :
OVRM1_0090_C12.b :
BFLT1_0148_G02.b :
OVR01_0077_C01.b :
THY01_0070_F07.b :
SMG01_0015_E12.b :
SPL01_0100_D12.b :
OVR01_0101_G04.b :
OVRT1_0152_D02.b :
OVRT1_0111_F07.b :
SMG01_0062_C07.b :
OVRT1_0017_E09.b :
OVRT1_0037_D05.b :
CLNT1_0067_D08.b :
PBL01_0057_B12.b :
OVRT1_0140_A01.b :
TCH01_0051_F06.b :
OVRT1_0052_B04.b :
OVRT1_0050_C01.b :
LVR01_0099_G09.b :
THY01_0057_B07.b :
SPL01_0090_H10.b :
TCH01_0042_H07.b :
THY01_0039_A10.b :
LVR01_0101_A02.b :
SMG01_0038_C09.b :
KDN01_0009_D05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
KDN01_0013_D11.b :
KDN01_0009_D04.b : cagcctccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BFLT1_0125_H08.b :
OVRM1_0098_F11.b :
OVRT1_0089_B09.b :
CBLT1_0011_B09.b :
CBLT1_0002_E06.b :
OVR01_0102_D12.b :
KDN01_0014_D11.b :
SPL01_0067_G01.b :
OVR01_0076_H06.b :
LVRM1_0185_H03.b :
SPL01_0095_H08.b :
ADR01_0084_H11.b :
OVRT1_0013_D08.b : aaaaaacacataaaaattttctctttgggacaaattatatgggggaggaattttcccaca
LVR01_0088_A08.b :
LVR01_0012_C12.b :
DCI01_0034_D03.b : gtgttcctcctataaaaagacaaaaaattt
20110601C-007362 : ............................................................
---------+---------+---------+---------+---------+---------+ 1036
OVRM1_0043_F06.b :
PTG01_0041_A05.b :
SMG01_0081_F02.b :
LVR01_0014_A04.b :
BFLT1_0080_G09.b :
CLNT1_0082_E12.b :
OVR01_0066_B11.b :
OVRM1_0031_F07.b :
THY01_0051_F06.b :
CLNT1_0012_C07.b :
OVRT1_0061_H08.b :
ITT01_0069_E08.b :
OVRT1_0038_A07.b :
OVRM1_0109_D09.b :
OVRT1_0151_B06.b :
SMG01_0099_F02.b :
OVRT1_0093_C03.b :
KDN01_0083_C01.b :
BFLT1_0100_E10.b :
TCH01_0097_E06.b :
OVRM1_0036_H02.b :
OVRM1_0054_B09.b :
OVRM1_0172_C02.b :
OVRM1_0137_H08.b :
OVRM1_0150_B05.b :
OVRM1_0197_G06.b :
OVRM1_0217_E05.b :
OVRM1_0068_F01.b :
OVRM1_0088_H08.b :
OVRM1_0090_C12.b :
BFLT1_0148_G02.b :
OVR01_0077_C01.b :
THY01_0070_F07.b :
SMG01_0015_E12.b :
SPL01_0100_D12.b :
OVR01_0101_G04.b :
OVRT1_0152_D02.b :
OVRT1_0111_F07.b :
SMG01_0062_C07.b :
OVRT1_0017_E09.b :
OVRT1_0037_D05.b :
CLNT1_0067_D08.b :
PBL01_0057_B12.b :
OVRT1_0140_A01.b :
TCH01_0051_F06.b :
OVRT1_0052_B04.b :
OVRT1_0050_C01.b :
LVR01_0099_G09.b :
THY01_0057_B07.b :
SPL01_0090_H10.b :
TCH01_0042_H07.b :
THY01_0039_A10.b :
LVR01_0101_A02.b :
SMG01_0038_C09.b :
KDN01_0009_D05.b : nnnnnnnnnnnnnnnnnn
KDN01_0013_D11.b :
KDN01_0009_D04.b : nnnnnnnnnnnnnnn
BFLT1_0125_H08.b :
OVRM1_0098_F11.b :
OVRT1_0089_B09.b :
CBLT1_0011_B09.b :
CBLT1_0002_E06.b :
OVR01_0102_D12.b :
KDN01_0014_D11.b :
SPL01_0067_G01.b :
OVR01_0076_H06.b :
LVRM1_0185_H03.b :
SPL01_0095_H08.b :
ADR01_0084_H11.b :
OVRT1_0013_D08.b : cgcgcggggaaatataataaa
LVR01_0088_A08.b :
LVR01_0012_C12.b :
DCI01_0034_D03.b :