[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-007463

Length: 1,728

Sequence [FASTA format sequence]
GGACCCACCT CCTTCGCCCG CCTGCCTGCG CCCGCGCCGA AGAGGTGCGC GAGCCTCGGC
CGCCCGCACA GCGCACACTG TCCGGCGCCC GCTCCCCGAG AAACGGCGCG ATGACCGCCG
AAGAGACTAA GACCGCCGAG AATGGGGCGC AGTCGGCGCC GCTGCCCCTC GAGGGGGTGG
ACATCAGCCC CAAGCAGGAT GAAGGCGTGC TTAAGGTCAT CAAGCGAGAG GGCACAGGCA
CAGAGATGCC CATGATCGGG GACCGAGTCT CTGTCCACTA CACAGGCTGG CTACTAGATG
GCACCAAGTT TGACTCCAGC CTGGACCGCA AGGACAAATT CTCCTTCGAC CTGGGGAAAG
GAGAGGTCAT CAAGGCTTGG GATATTGCTG TAGCAACCAT GAAAGTGGGG GAAGTGTGCC
ACATCACCTG CAAACCAGAA TATGCCTACG GTTCAGCCGG CAGTCCTCCC AAGATTCCTC
CCAATGCCAC GCTTGTGTTT GAGGTGGAGT TGTTCGAGTT CAAGGGAGAG GACCTGACAG
AAGAGGAAGA CGGTGGGATC ATCAGGAGAA TACAGACCCG GGGGGAAGGC TATGCCAGGC
CCAACGATGG TGCCATTGTG GAGGTTGCCC TGGAAGGGTA CTACAAGGAC CAGATCTTTG
ACCGGCGGGA GATCCGCTTT GAGGTCGGCG AAGGGGAGAC TATGGACTTG CCTTGTGGGC
TGGAGAAAGC CATTCAGCGC ATGGAAAAAG GAGAGCATTC CATTGTGTAC CTCAAACCCA
GCTATGCGTT CGGCAGTGCT GGGAAGGAAA AGTTCCACAT CCCACCTAAT GCTGAGTTGA
AGTATGAAGT ACACCTCAAG AGTTTTGAGA AGGCCAAGGA GTCGTGGGAG ATGAGCTCAG
AGGAGAAGCT GGAGCAGAGC ACCATTGTGA AGGAGCGGGG CACTGTATAC TTCAAGGAAG
GCAAGTACAA GCAAGCTCTG GTGCAGTACA AGAAGATTGT GTCCTGGCTA GAATATGAGT
CGAGTTTCTC TAACGAGGAC GCACAGAAGG CACAGGCTCT TCGGCTGGCC TCCCACCTCA
ACCTAGCCAT GTGTTATCTG AAACTACAGT CCTTCTCGGC TGCCATTGAA AACTGTAACA
AGGCCCTGGA GCTGGACAGC AACAACGAGA AGGGCCTTTT CCGCCGGGGA GAGGCCCACC
TGGCAGTGAA TGACTTTGAC TTGGCTCGAG CTGACTTCCA GAAGGTCCTG CAGCTCTATC
CCAGCAACAA AGCCGCCAAG GCCCAGTTGG CGCTCTGCCA GCAGCGGATC CGTAAGCAGC
TTGCGCGGGA GAAGAAGCTC TATGCCAACA TGTTTGAGAG GCTGGCAGAG GAGGAGAGCA
AGGCCAAGGT GTCAGGAGAC CAGCAGGCAG ACACAGAGAT GAAGGAGGAG CAGAAGAATG
ATGTGGCAGG GCGCCAGCCT CAGGTGGAGG CGGAAGCATA GCCTCTCCCC AGCCCTGCTC
CTGCAGCTGC CTGCCTCCCC TGCTCCCCTA CCTACTCCAC CCTGTTAGTT TTGTAAAAAC
TGAAGAATTT TGAGTGAATT AGACTTTATT TTCTATCTGG TGGATGGTTG CTTTGGGGGA
AGGGGGGGAG GAGCAGGCTG GGGATTGAGT GGGGGGGGTG GTCTTTTCAG GTGTGGCACC
CCCTCTTCCT TCCCCCTTTA ACGCAACTCA TCAAAAGGTA ATTATTTG


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFKBP4peptidyl-prolyl cis-trans isomerase FKBP4 [Homo sapiens]. 8040.0O
Contig/Assembly ProteinFKBP5peptidyl-prolyl cis-trans isomerase FKBP5 isoform 1 [Homo sapiens]. 497e-140O
Contig/Assembly ProteinFKBP5peptidyl-prolyl cis-trans isomerase FKBP5 isoform 1 [Homo sapiens]. 497e-140O
Contig/Assembly ProteinFKBP5peptidyl-prolyl cis-trans isomerase FKBP5 isoform 1 [Homo sapiens]. 497e-140O
Contig/Assembly ProteinFKBP5peptidyl-prolyl cis-trans isomerase FKBP5 isoform 2 [Homo sapiens]. 2664e-71O
Contig/Assembly ProteinFKBP1Apeptidyl-prolyl cis-trans isomerase FKBP1A isoform a [Homo sapiens]. 1042e-22O
Contig/Assembly ProteinFKBP1Apeptidyl-prolyl cis-trans isomerase FKBP1A isoform a [Homo sapiens]. 1042e-22O
Contig/Assembly ProteinFKBP1Bpeptidyl-prolyl cis-trans isomerase FKBP1B isoform a [Homo sapiens]. 99.49e-21O
Contig/Assembly ProteinFKBP6peptidyl-prolyl cis-trans isomerase FKBP6 isoform a [Homo sapiens]. 91.72e-18O
Contig/Assembly ProteinFKBP6peptidyl-prolyl cis-trans isomerase FKBP6 isoform b [Homo sapiens]. 91.72e-18O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFkbp4peptidyl-prolyl cis-trans isomerase FKBP4 [Mus musculus]. 7710.0O
Contig/Assembly ProteinFkbp5peptidyl-prolyl cis-trans isomerase FKBP5 [Mus musculus]. 484e-137O
Contig/Assembly ProteinLOC100048743PREDICTED: peptidyl-prolyl cis-trans isomerase FKBP4-like [Mus musculus]. 1643e-40O
Contig/Assembly ProteinFkbp1apeptidyl-prolyl cis-trans isomerase FKBP1A [Mus musculus]. 1005e-21O
Contig/Assembly ProteinFkbp1bpeptidyl-prolyl cis-trans isomerase FKBP1B [Mus musculus]. 98.61e-20O
Contig/Assembly ProteinFkbp6peptidyl-prolyl cis-trans isomerase FKBP6 [Mus musculus]. 91.72e-18O
Contig/Assembly ProteinFkbp2peptidyl-prolyl cis-trans isomerase FKBP2 precursor [Mus musculus]. 91.32e-18O
Contig/Assembly ProteinFkbp2peptidyl-prolyl cis-trans isomerase FKBP2 precursor [Mus musculus]. 91.32e-18O
Contig/Assembly ProteinFkbp3peptidyl-prolyl cis-trans isomerase FKBP3 [Mus musculus]. 89.48e-18
Contig/Assembly ProteinFkbp8peptidyl-prolyl cis-trans isomerase FKBP8 isoform a [Mus musculus]. 88.61e-17O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC477726PREDICTED: similar to FK506-binding protein 4 (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (p59 protein) (HSP binding immunophilin) (HBI) (FKBP52 protein) (52 kDa FK506 binding protein) (FKBP59) [Canis familiaris]. 8200.0O
Contig/Assembly ProteinLOC481759PREDICTED: similar to FK506-binding protein 5 (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (51 kDa FK506-binding protein) (FKBP-51) (54 kDa progesterone receptor-associated immunophilin) (FKBP54) (P54) (FF1 antigen) (HSP90-binding immunophilin) (... [Canis familiaris]. 493e-139O
Contig/Assembly ProteinLOC608169PREDICTED: similar to FK506-binding protein 1A [Canis familiaris]. 1066e-23O
Contig/Assembly ProteinLOC612965PREDICTED: similar to FK506-binding protein 1B isoform a [Canis familiaris]. 99.41e-20O
Contig/Assembly ProteinLOC489810PREDICTED: similar to FK506-binding protein 6 (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (36 kDa FK506 binding protein) (FKBP-36) (Immunophilin FKBP36) [Canis familiaris]. 91.72e-18O
Contig/Assembly ProteinLOC480306PREDICTED: similar to FK506-binding protein 3 (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (25 kDa FKBP) (FKBP-25) (Rapamycin-selective 25 kDa immunophilin) isoform 1 [Canis familiaris]. 91.33e-18
Contig/Assembly ProteinLOC483764PREDICTED: similar to FK506-binding protein 2 precursor (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (13 kDa FKBP) (FKBP-13) isoform 4 [Canis familiaris]. 91.33e-18O
Contig/Assembly ProteinLOC483764PREDICTED: similar to FK506-binding protein 2 precursor (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (13 kDa FKBP) (FKBP-13) isoform 1 [Canis familiaris]. 91.33e-18O
Contig/Assembly ProteinLOC483764PREDICTED: similar to FK506-binding protein 2 precursor (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (13 kDa FKBP) (FKBP-13) isoform 3 [Canis familiaris]. 91.33e-18O
Contig/Assembly ProteinLOC483764PREDICTED: similar to FK506-binding protein 2 precursor (Peptidyl-prolyl cis-trans isomerase) (PPIase) (Rotamase) (13 kDa FKBP) (FKBP-13) isoform 2 [Canis familiaris]. 91.33e-18O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFKBP4peptidyl-prolyl cis-trans isomerase FKBP4 [Bos taurus]. 8120.0O
Contig/Assembly ProteinFKBP5peptidyl-prolyl cis-trans isomerase FKBP5 [Bos taurus]. 493e-139O
Contig/Assembly ProteinFKBP5PREDICTED: FK506 binding protein 5 [Bos taurus]. 493e-139O
Contig/Assembly ProteinFKBP1Apeptidyl-prolyl cis-trans isomerase FKBP1A [Bos taurus]. 1067e-23O
Contig/Assembly ProteinLOC526524FK506-binding protein 1A-like [Bos taurus]. 1042e-22O
Contig/Assembly ProteinFKBP1APREDICTED: FKBP1A protein-like [Bos taurus]. 1035e-22O
Contig/Assembly ProteinFKBP1APREDICTED: FKBP1A protein-like [Bos taurus]. 1035e-22O
Contig/Assembly ProteinFKBP1Bpeptidyl-prolyl cis-trans isomerase FKBP1B [Bos taurus]. 99.49e-21O
Contig/Assembly ProteinFKBP2peptidyl-prolyl cis-trans isomerase FKBP2 isoform 2 [Bos taurus]. 91.32e-18O
Contig/Assembly ProteinFKBP3peptidyl-prolyl cis-trans isomerase FKBP3 [Bos taurus]. 91.32e-18


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFKBP4peptidyl-prolyl cis-trans isomerase FKBP4 [Sus scrofa]. 8730.0O
Contig/Assembly ProteinLOC100624775PREDICTED: peptidyl-prolyl cis-trans isomerase FKBP5-like, partial [Sus scrofa]. 466e-131O
Contig/Assembly ProteinFKBP5PREDICTED: peptidyl-prolyl cis-trans isomerase FKBP5, partial [Sus scrofa]. 2195e-57O
Contig/Assembly ProteinLOC654323FKBP1A-like [Sus scrofa]. 1064e-23O
Contig/Assembly ProteinLOC100522131PREDICTED: peptidyl-prolyl cis-trans isomerase FKBP1B-like isoform 1 [Sus scrofa]. 99.46e-21O
Contig/Assembly ProteinLOC100152728PREDICTED: peptidyl-prolyl cis-trans isomerase FKBP3 [Sus scrofa]. 91.32e-18
Contig/Assembly ProteinLOC100522180PREDICTED: peptidyl-prolyl cis-trans isomerase FKBP2-like isoform 1 [Sus scrofa]. 91.32e-18O
Contig/Assembly ProteinLOC100522180PREDICTED: peptidyl-prolyl cis-trans isomerase FKBP2-like isoform 3 [Sus scrofa]. 91.32e-18O
Contig/Assembly ProteinLOC100522180PREDICTED: peptidyl-prolyl cis-trans isomerase FKBP2-like isoform 2 [Sus scrofa]. 91.32e-18O
Contig/Assembly ProteinLOC100522180PREDICTED: peptidyl-prolyl cis-trans isomerase FKBP2-like isoform 4 [Sus scrofa]. 91.32e-18O


Assembly Members: 57      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010007E05ADR01_0007_E05.bDB782148 
ADR010077A04ADR01_0077_A04.bDB788303 
ADR010097F07ADR01_0097_F07.bDB790144 
BFLT10052C03BFLT1_0052_C03.bFS644094 
BFLT10143C02BFLT1_0143_C02.bHX205052 
CBLT10002C08CBLT1_0002_C08.bHX211860 
CBLT10004D12CBLT1_0004_D12.bHX212022 
CBLT10012H07CBLT1_0012_H07.bHX212689 
CBLT10049H09CBLT1_0049_H09.bHX215128 
CBLT10059H05CBLT1_0059_H05.bHX215871 
CBLT10097C02CBLT1_0097_C02.bHX218877 
ILNT10073B12ILNT1_0073_B12.bHX232555 
KDN010088A02KDN01_0088_A02.bFS677384 
KDN010089D02KDN01_0089_D02.bFS677499 
LVR010031G02LVR01_0031_G02.bBP446407 
LVR010043C08LVR01_0043_C08.bBP443332 
LVRM10041F07LVRM1_0041_F07.bCJ001931 
LVRM10051B09LVRM1_0051_B09.bBP449474 
LVRM10105A06LVRM1_0105_A06.bBP448471 
LVRM10138E07LVRM1_0138_E07.bBP451829 
LVRM10192F01LVRM1_0192_F01.bCJ006375 
OVR010021A09OVR01_0021_A09.bBP141557 
OVR010026E05OVR01_0026_E05.bBP143203 
OVR010075F12OVR01_0075_F12.bBW966320 
OVR010101C05OVR01_0101_C05.bBW968211 
OVRM10018G10OVRM1_0018_G10.bBP461127 
OVRM10028D08OVRM1_0028_D08.bBP149393 
OVRM10041F12OVRM1_0041_F12.bBP460331 
OVRM10071E10OVRM1_0071_E10.bBP150857 
OVRM10074B02OVRM1_0074_B02.bBP146285 
OVRM10105G07OVRM1_0105_G07.bBP153066 
OVRM10138H12OVRM1_0138_H12.bBP154995 
OVRM10153D10OVRM1_0153_D10.bBP458223 AK236114
OVRM10187B11OVRM1_0187_B11.bBP456420 
OVRM10191B10OVRM1_0191_B10.bBP456338 
OVRM10223D03OVRM1_0223_D03.bBP457713 AK236736
OVRT10118G01OVRT1_0118_G01.bHX236306 
PBL010001A09PBL01_0001_A09.bBP155162 AK395996
PBL010024G12PBL01_0024_G12.bBP156399 
PBL010051C08PBL01_0051_C08.bBW971098 
PBL010071F02PBL01_0071_F02.bBW972496 
PTG010022C07PTG01_0022_C07.bFS706319 
PTG010105A05PTG01_0105_A05.bFS712901 
PTG010108E11PTG01_0108_E11.bFS713156 
SKNB10046F06SKNB1_0046_F06.bDB802637 
SMG010045A04SMG01_0045_A04.bFS717158 
SPL010055A07SPL01_0055_A07.bCJ017929 
SPL010063C11SPL01_0063_C11.bCJ018680 
TCH010044F04TCH01_0044_F04.bCJ025749 
TES010056G07TES01_0056_G07.bCJ033595 
THY010041D09THY01_0041_D09.bBP163933 
THY010090A05THY01_0090_A05.bBP159834 
UTR010016D10UTR01_0016_D10.bBP171381 
UTR010043A02UTR01_0043_A02.bBP169437 
UTR010047B04UTR01_0047_B04.bBP170059 
UTR010069G07UTR01_0069_G07.bBP464558 
UTR010075H09UTR01_0075_H09.bBP464902 

  

SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
122A26160.955WSGAA/E
G200.045GAG/E
476A11160.529WSATA/I
T2400.471ATT/I
664A410.119ONCAG/Q
G3070.881CGG/R


Alignment:      TOP

20110601C-007463 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CBLT1_0059_H05.b : ttttacgcaggtagacgxxxxxxxxxxxxxxxxxxx
OVR01_0026_E05.b : ggggctttatggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0074_B02.b : atxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0001_A09.b : nggctgnnntaggatacacaxxxxxx
ILNT1_0073_B12.b : nnag
OVR01_0075_F12.b : cxxxxxxxxxxxxxxxxxxx
OVRM1_0153_D10.b :
SPL01_0063_C11.b : ntttgcttggactatgacxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0118_G01.b : nnnnccgttctg
PBL01_0071_F02.b :
BFLT1_0052_C03.b : ntttccgtc
OVRM1_0041_F12.b :
CBLT1_0012_H07.b :
CBLT1_0097_C02.b :
THY01_0090_A05.b : catxxxxxxxxxxxxxxxxxxx
OVRM1_0223_D03.b :
LVRM1_0051_B09.b :
OVR01_0101_C05.b : nttgcttgtgacttg
OVR01_0021_A09.b : tgggggggacxxxxxxxx
BFLT1_0143_C02.b : nnnncgt
LVRM1_0192_F01.b :
OVRM1_0138_H12.b :
PBL01_0024_G12.b :
PBL01_0051_C08.b :
CBLT1_0049_H09.b :
KDN01_0088_A02.b :
OVRM1_0071_E10.b :
LVRM1_0041_F07.b :
CBLT1_0004_D12.b :
LVRM1_0138_E07.b :
SKNB1_0046_F06.b :
SMG01_0045_A04.b :
TES01_0056_G07.b :
OVRM1_0187_B11.b :
UTR01_0043_A02.b :
OVRM1_0191_B10.b :
CBLT1_0002_C08.b :
OVRM1_0018_G10.b :
OVRM1_0105_G07.b :
OVRM1_0028_D08.b :
PTG01_0105_A05.b :
LVR01_0043_C08.b :
LVR01_0031_G02.b :
LVRM1_0105_A06.b :
PTG01_0108_E11.b :
ADR01_0007_E05.b :
PTG01_0022_C07.b :
UTR01_0047_B04.b :
UTR01_0075_H09.b :
UTR01_0069_G07.b :
KDN01_0089_D02.b :
TCH01_0044_F04.b :
SPL01_0055_A07.b :
ADR01_0097_F07.b :
UTR01_0016_D10.b :
THY01_0041_D09.b :
ADR01_0077_A04.b :
20110601C-007463 : ........................GGACCCACCTCCTTCGCCCGCCTGCCTGCGCCCGCG
---------+---------+---------+---------+---------+---------+ 36
CBLT1_0059_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxGGACCCACCTCCTTCTCCCGCCTGCCTGCGCCCGCG
OVR01_0026_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxCCCACCTCCTTCGCCCGCCTGCCTGCGCCCGCG
OVRM1_0074_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCGCCCGCCTGCCTGCGCCCGCG
PBL01_0001_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcTTCGCCCGCCTGCCTGCGCCCGCG
ILNT1_0073_B12.b : ggctggtacgaggccgtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGCG
OVR01_0075_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0153_D10.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0063_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgagccgccttgttggcctact
OVRT1_0118_G01.b : cgntacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0071_F02.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0052_C03.b : tgctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0041_F12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0012_H07.b : ttttacgacggtagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0097_C02.b : ttccgctgtgagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0090_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0223_D03.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0051_B09.b : nagttgtcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0101_C05.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0021_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0143_C02.b : tcgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0192_F01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0138_H12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0024_G12.b : naagtgaaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PBL01_0051_C08.b : nnnggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0049_H09.b : ntttatcaggaacgcggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0088_A02.b : nnnggctgcgttgg
OVRM1_0071_E10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0041_F07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0004_D12.b : ttttaagacggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0138_E07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0046_F06.b : nnnnnttaact
SMG01_0045_A04.b : nncggctttatnnnnggctaaagcagcxxxxxxxxxxxx
TES01_0056_G07.b :
OVRM1_0187_B11.b : nagtttgtcxxxxxxxxxxxxxxxx
UTR01_0043_A02.b : ttttggctggcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0191_B10.b : xxxxxxxxxxxx
CBLT1_0002_C08.b : tttttccaggtacgaxxxxxxxxxx
OVRM1_0018_G10.b : agttgtcxxxxxxxxxxxxxx
OVRM1_0105_G07.b : nagttgtcxxxxxxxxxxxxxx
OVRM1_0028_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0105_A05.b : nccgattaaaannnnnggggtaaagcagcggnt
LVR01_0043_C08.b : ggggcnggggcttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_G02.b : gtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0105_A06.b : naatgtcxxxxxxxxxxxxxxxx
PTG01_0108_E11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ADR01_0007_E05.b : nnnnnaatgaac
PTG01_0022_C07.b : ngcgga
UTR01_0047_B04.b :
UTR01_0075_H09.b :
UTR01_0069_G07.b :
KDN01_0089_D02.b :
TCH01_0044_F04.b :
SPL01_0055_A07.b :
ADR01_0097_F07.b :
UTR01_0016_D10.b :
THY01_0041_D09.b :
ADR01_0077_A04.b :
20110601C-007463 : CCGAAGAGGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
---------+---------+---------+---------+---------+---------+ 96
CBLT1_0059_H05.b : CCGAAGAGGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
OVR01_0026_E05.b : CCGAAGAGGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
OVRM1_0074_B02.b : CCGAAGAGGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
PBL01_0001_A09.b : CCGAAGAGGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
ILNT1_0073_B12.b : CCGAAGAGGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
OVR01_0075_F12.b : xxGAAGAGGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
OVRM1_0153_D10.b : xxGAAGAGGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
SPL01_0063_C11.b : ggGAAGAGGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
OVRT1_0118_G01.b : xxGAAGAGGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
PBL01_0071_F02.b : xxGAAGAGGTGCGCGAGCCTCGGCCGCCAGCACAGCGCACACTGTCCGGCGCCCGCTCCC
BFLT1_0052_C03.b : xxGAAGAGGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
OVRM1_0041_F12.b : xxxtAGAGGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
CBLT1_0012_H07.b : xxxgAGAGGTGCGCGCGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
CBLT1_0097_C02.b : xxxgAGAGGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
THY01_0090_A05.b : xtggAGAGGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
OVRM1_0223_D03.b : xxxxxGAGGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
LVRM1_0051_B09.b : xxxxxGAGGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
OVR01_0101_C05.b : xxxxxGAGGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
OVR01_0021_A09.b : xxxxxGAGGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
BFLT1_0143_C02.b : xxccatAGGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
LVRM1_0192_F01.b : xxxxxxxGGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
OVRM1_0138_H12.b : xxxxxxxxGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
PBL01_0024_G12.b : xxxxxxxxGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
PBL01_0051_C08.b : xxxxxxxxGTGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
CBLT1_0049_H09.b : xxxxxxxxxxGCGCGAGCCTCGGCCTTCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
KDN01_0088_A02.b : ctatggaaggGCGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
OVRM1_0071_E10.b : xxxxxxxxxxxxGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
LVRM1_0041_F07.b : xxxxxxxxxxxxGCGAGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
CBLT1_0004_D12.b : xxxxxxxxxxxgGCGAGCCTCGGCCGCCTGCACAGCGCACACTGTCCGGCGCCCGCTCCC
LVRM1_0138_E07.b : xxxxxxxxxxxxxxxxGCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
SKNB1_0046_F06.b : gttgctatgggtggcgaCCTCGGCCGCCCGCACAGCGCACACTGTCCGGCGCCCGCTCCC
SMG01_0045_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACAGCGCACACTGTCCGGCGCCCGCTCCC
TES01_0056_G07.b : tttctgcgttggctctggaAGCGCACACTGTCCGGCGCCCGCTCCC
OVRM1_0187_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACACTGTCCGGCGCCCGCTCCC
UTR01_0043_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACACTGTCCGGCGCCCGCTCCC
OVRM1_0191_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctggACACTGTCCGGCGCCCGCTCCC
CBLT1_0002_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgACACTGTCCGGCGCCCGCTCCC
OVRM1_0018_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACTGTCCGGCGCCCGCTCCC
OVRM1_0105_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACTGTCCGGCGCCCGCTCCC
OVRM1_0028_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACTGTCCGGCGCCCGCTCCC
PTG01_0105_A05.b : cggntccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcCACGGTCCGGCGCCCGCTCCC
LVR01_0043_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCACTGTCCGGCGCCCGCTCCC
LVR01_0031_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACTGTCCGGCGCCCGCTCCC
LVRM1_0105_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgngaACTGTCCGGCGCCCGCTCCC
PTG01_0108_E11.b : nnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxCTGTCCGGCGCCCGCTCCC
ADR01_0007_E05.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCCGGCGCCCGCTCCC
PTG01_0022_C07.b : aattttnggactaaagcagcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0047_B04.b : cttttggag
UTR01_0075_H09.b :
UTR01_0069_G07.b :
KDN01_0089_D02.b :
TCH01_0044_F04.b :
SPL01_0055_A07.b :
ADR01_0097_F07.b :
UTR01_0016_D10.b :
THY01_0041_D09.b :
ADR01_0077_A04.b :
20110601C-007463 : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
---------+---------+---------+---------+---------+---------+ 156
CBLT1_0059_H05.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
OVR01_0026_E05.b : CGAGAAACGGCGCGATGACCGCCGAGGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
OVRM1_0074_B02.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
PBL01_0001_A09.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
ILNT1_0073_B12.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
OVR01_0075_F12.b : CGAGAAACGGCGCGATGACCGCCGAGGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
OVRM1_0153_D10.b : CGAGAAACGGCGCAATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
SPL01_0063_C11.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
OVRT1_0118_G01.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
PBL01_0071_F02.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
BFLT1_0052_C03.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
OVRM1_0041_F12.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
CBLT1_0012_H07.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
CBLT1_0097_C02.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
THY01_0090_A05.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
OVRM1_0223_D03.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
LVRM1_0051_B09.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
OVR01_0101_C05.b : CGAGAAACGGCGCGATGACCGCCGAGGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
OVR01_0021_A09.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
BFLT1_0143_C02.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
LVRM1_0192_F01.b : CGAGAAACGGCGCGGTGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
OVRM1_0138_H12.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
PBL01_0024_G12.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
PBL01_0051_C08.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
CBLT1_0049_H09.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
KDN01_0088_A02.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
OVRM1_0071_E10.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
LVRM1_0041_F07.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
CBLT1_0004_D12.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
LVRM1_0138_E07.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
SKNB1_0046_F06.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
SMG01_0045_A04.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
TES01_0056_G07.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
OVRM1_0187_B11.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
UTR01_0043_A02.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
OVRM1_0191_B10.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
CBLT1_0002_C08.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
OVRM1_0018_G10.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
OVRM1_0105_G07.b : CGAAAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
OVRM1_0028_D08.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
PTG01_0105_A05.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
LVR01_0043_C08.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
LVR01_0031_G02.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
LVRM1_0105_A06.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
PTG01_0108_E11.b : CGAGAAACGGCGCGATGACCGCCGAGGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
ADR01_0007_E05.b : CGAGAAACGGCGCGATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
PTG01_0022_C07.b : xGAGAAACGGCGCTATGACCGCCGAAGAGACTAAGACCGCCGAGAATGGGGCGCAGTCGG
UTR01_0047_B04.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0075_H09.b :
UTR01_0069_G07.b :
KDN01_0089_D02.b :
TCH01_0044_F04.b :
SPL01_0055_A07.b :
ADR01_0097_F07.b :
UTR01_0016_D10.b :
THY01_0041_D09.b :
ADR01_0077_A04.b :
20110601C-007463 : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
---------+---------+---------+---------+---------+---------+ 216
CBLT1_0059_H05.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
OVR01_0026_E05.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
OVRM1_0074_B02.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
PBL01_0001_A09.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
ILNT1_0073_B12.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
OVR01_0075_F12.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
OVRM1_0153_D10.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
SPL01_0063_C11.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
OVRT1_0118_G01.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
PBL01_0071_F02.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
BFLT1_0052_C03.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
OVRM1_0041_F12.b : CGCCGCAGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
CBLT1_0012_H07.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
CBLT1_0097_C02.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
THY01_0090_A05.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
OVRM1_0223_D03.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
LVRM1_0051_B09.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
OVR01_0101_C05.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
OVR01_0021_A09.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
BFLT1_0143_C02.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
LVRM1_0192_F01.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
OVRM1_0138_H12.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGCGCTTAAGG
PBL01_0024_G12.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
PBL01_0051_C08.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
CBLT1_0049_H09.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
KDN01_0088_A02.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
OVRM1_0071_E10.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
LVRM1_0041_F07.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
CBLT1_0004_D12.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
LVRM1_0138_E07.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
SKNB1_0046_F06.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
SMG01_0045_A04.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
TES01_0056_G07.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
OVRM1_0187_B11.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
UTR01_0043_A02.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
OVRM1_0191_B10.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
CBLT1_0002_C08.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
OVRM1_0018_G10.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
OVRM1_0105_G07.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
OVRM1_0028_D08.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
PTG01_0105_A05.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
LVR01_0043_C08.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
LVR01_0031_G02.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
LVRM1_0105_A06.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
PTG01_0108_E11.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
ADR01_0007_E05.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
PTG01_0022_C07.b : CGCCGCTGCCCCTCGAGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
UTR01_0047_B04.b : xxxxxxxxxxxxxxxxGGGGGTGGACATCAGCCCCAAGCAGGATGAAGGCGTGCTTAAGG
UTR01_0075_H09.b :
UTR01_0069_G07.b :
KDN01_0089_D02.b :
TCH01_0044_F04.b :
SPL01_0055_A07.b :
ADR01_0097_F07.b :
UTR01_0016_D10.b :
THY01_0041_D09.b :
ADR01_0077_A04.b :
20110601C-007463 : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
---------+---------+---------+---------+---------+---------+ 276
CBLT1_0059_H05.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
OVR01_0026_E05.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
OVRM1_0074_B02.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
PBL01_0001_A09.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
ILNT1_0073_B12.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
OVR01_0075_F12.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
OVRM1_0153_D10.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
SPL01_0063_C11.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
OVRT1_0118_G01.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
PBL01_0071_F02.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
BFLT1_0052_C03.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
OVRM1_0041_F12.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
CBLT1_0012_H07.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
CBLT1_0097_C02.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
THY01_0090_A05.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
OVRM1_0223_D03.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
LVRM1_0051_B09.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
OVR01_0101_C05.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
OVR01_0021_A09.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
BFLT1_0143_C02.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
LVRM1_0192_F01.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
OVRM1_0138_H12.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
PBL01_0024_G12.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
PBL01_0051_C08.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
CBLT1_0049_H09.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
KDN01_0088_A02.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
OVRM1_0071_E10.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
LVRM1_0041_F07.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
CBLT1_0004_D12.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
LVRM1_0138_E07.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
SKNB1_0046_F06.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
SMG01_0045_A04.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
TES01_0056_G07.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
OVRM1_0187_B11.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
UTR01_0043_A02.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
OVRM1_0191_B10.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
CBLT1_0002_C08.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
OVRM1_0018_G10.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
OVRM1_0105_G07.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
OVRM1_0028_D08.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
PTG01_0105_A05.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
LVR01_0043_C08.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
LVR01_0031_G02.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
LVRM1_0105_A06.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
PTG01_0108_E11.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
ADR01_0007_E05.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
PTG01_0022_C07.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
UTR01_0047_B04.b : TCATCAAGCGAGAGGGCACAGGCACAGAGATGCCCATGATCGGGGACCGAGTCTCTGTCC
UTR01_0075_H09.b : txxxxxxxxxxxxxxxxxxxxx
UTR01_0069_G07.b :
KDN01_0089_D02.b :
TCH01_0044_F04.b :
SPL01_0055_A07.b :
ADR01_0097_F07.b :
UTR01_0016_D10.b :
THY01_0041_D09.b :
ADR01_0077_A04.b :
20110601C-007463 : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
---------+---------+---------+---------+---------+---------+ 336
CBLT1_0059_H05.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
OVR01_0026_E05.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
OVRM1_0074_B02.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
PBL01_0001_A09.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
ILNT1_0073_B12.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
OVR01_0075_F12.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
OVRM1_0153_D10.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
SPL01_0063_C11.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
OVRT1_0118_G01.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
PBL01_0071_F02.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
BFLT1_0052_C03.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
OVRM1_0041_F12.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
CBLT1_0012_H07.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
CBLT1_0097_C02.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
THY01_0090_A05.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
OVRM1_0223_D03.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
LVRM1_0051_B09.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
OVR01_0101_C05.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
OVR01_0021_A09.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
BFLT1_0143_C02.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
LVRM1_0192_F01.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
OVRM1_0138_H12.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
PBL01_0024_G12.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
PBL01_0051_C08.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
CBLT1_0049_H09.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
KDN01_0088_A02.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
OVRM1_0071_E10.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
LVRM1_0041_F07.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
CBLT1_0004_D12.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
LVRM1_0138_E07.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
SKNB1_0046_F06.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
SMG01_0045_A04.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
TES01_0056_G07.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
OVRM1_0187_B11.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
UTR01_0043_A02.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
OVRM1_0191_B10.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
CBLT1_0002_C08.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
OVRM1_0018_G10.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
OVRM1_0105_G07.b : ACTACACAGGCTAGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
OVRM1_0028_D08.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
PTG01_0105_A05.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
LVR01_0043_C08.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
LVR01_0031_G02.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
LVRM1_0105_A06.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
PTG01_0108_E11.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
ADR01_0007_E05.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
PTG01_0022_C07.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
UTR01_0047_B04.b : ACTACACAGGCTGGCTACTAGATGGCACCAAGTTTGACTCCAGCCTGGACCGCAAGGACA
UTR01_0075_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0069_G07.b : ggttxxxxxxxxxx
KDN01_0089_D02.b :
TCH01_0044_F04.b :
SPL01_0055_A07.b :
ADR01_0097_F07.b :
UTR01_0016_D10.b :
THY01_0041_D09.b :
ADR01_0077_A04.b :
20110601C-007463 : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
---------+---------+---------+---------+---------+---------+ 396
CBLT1_0059_H05.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
OVR01_0026_E05.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
OVRM1_0074_B02.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
PBL01_0001_A09.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
ILNT1_0073_B12.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
OVR01_0075_F12.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
OVRM1_0153_D10.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
SPL01_0063_C11.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
OVRT1_0118_G01.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
PBL01_0071_F02.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
BFLT1_0052_C03.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
OVRM1_0041_F12.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
CBLT1_0012_H07.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
CBLT1_0097_C02.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
THY01_0090_A05.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
OVRM1_0223_D03.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
LVRM1_0051_B09.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
OVR01_0101_C05.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
OVR01_0021_A09.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
BFLT1_0143_C02.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
LVRM1_0192_F01.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
OVRM1_0138_H12.b : AATTCTCCT*CGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAC
PBL01_0024_G12.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCGTCAAGGCTTGGGATATTGCTGTAGCAA
PBL01_0051_C08.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
CBLT1_0049_H09.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
KDN01_0088_A02.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
OVRM1_0071_E10.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
LVRM1_0041_F07.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
CBLT1_0004_D12.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
LVRM1_0138_E07.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
SKNB1_0046_F06.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
SMG01_0045_A04.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
TES01_0056_G07.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
OVRM1_0187_B11.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
UTR01_0043_A02.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
OVRM1_0191_B10.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
CBLT1_0002_C08.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
OVRM1_0018_G10.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
OVRM1_0105_G07.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
OVRM1_0028_D08.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
PTG01_0105_A05.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
LVR01_0043_C08.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
LVR01_0031_G02.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
LVRM1_0105_A06.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
PTG01_0108_E11.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
ADR01_0007_E05.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
PTG01_0022_C07.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
UTR01_0047_B04.b : AATTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
UTR01_0075_H09.b : xxTTCTCCTTCGACCTGGGGAAAGGAGAGGTCATCAAGGCTTGGGATATTGCTGTAGCAA
UTR01_0069_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0089_D02.b :
TCH01_0044_F04.b : nnnnnggctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0055_A07.b :
ADR01_0097_F07.b :
UTR01_0016_D10.b :
THY01_0041_D09.b :
ADR01_0077_A04.b :
20110601C-007463 : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
---------+---------+---------+---------+---------+---------+ 456
CBLT1_0059_H05.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
OVR01_0026_E05.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
OVRM1_0074_B02.b : CCATGAAAGTGGGGGAAGTGTGCCTCATCACCTGCAAACCAGAATATGCCTACGGTTCAG
PBL01_0001_A09.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
ILNT1_0073_B12.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
OVR01_0075_F12.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
OVRM1_0153_D10.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
SPL01_0063_C11.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
OVRT1_0118_G01.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
PBL01_0071_F02.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
BFLT1_0052_C03.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
OVRM1_0041_F12.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
CBLT1_0012_H07.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
CBLT1_0097_C02.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
THY01_0090_A05.b : CCATAAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
OVRM1_0223_D03.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAN
LVRM1_0051_B09.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
OVR01_0101_C05.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
OVR01_0021_A09.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
BFLT1_0143_C02.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
LVRM1_0192_F01.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
OVRM1_0138_H12.b : CAT**GAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACCGTTCAG
PBL01_0024_G12.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
PBL01_0051_C08.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
CBLT1_0049_H09.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
KDN01_0088_A02.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
OVRM1_0071_E10.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
LVRM1_0041_F07.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
CBLT1_0004_D12.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
LVRM1_0138_E07.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
SKNB1_0046_F06.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
SMG01_0045_A04.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
TES01_0056_G07.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
OVRM1_0187_B11.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
UTR01_0043_A02.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
OVRM1_0191_B10.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
CBLT1_0002_C08.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
OVRM1_0018_G10.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
OVRM1_0105_G07.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
OVRM1_0028_D08.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
PTG01_0105_A05.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
LVR01_0043_C08.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
LVR01_0031_G02.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
LVRM1_0105_A06.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
PTG01_0108_E11.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
ADR01_0007_E05.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
PTG01_0022_C07.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
UTR01_0047_B04.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
UTR01_0075_H09.b : CCATGAAAGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
UTR01_0069_G07.b : xxxxxxxxGTGGGGGAAGTGTGCCACATCACCTGCAAACCAGAATATGCCTACGGTTCAG
KDN01_0089_D02.b : nctacgttggctctggtgcCATCACCTGCA*ACCAGAATATGCCTACGGTTCAG
TCH01_0044_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCTGCAAACCAGAATATGCCTACGGTTCAG
SPL01_0055_A07.b : nnnnggcttgtgacttgacxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0097_F07.b : nnncccggannannaggtaacaxxxx
UTR01_0016_D10.b :
THY01_0041_D09.b :
ADR01_0077_A04.b :
20110601C-007463 : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
---------+---------+---------+---------+---------+---------+ 516
CBLT1_0059_H05.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
OVR01_0026_E05.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
OVRM1_0074_B02.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
PBL01_0001_A09.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAAGTGGAGTTGTTCG
ILNT1_0073_B12.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
OVR01_0075_F12.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
OVRM1_0153_D10.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
SPL01_0063_C11.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
OVRT1_0118_G01.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
PBL01_0071_F02.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
BFLT1_0052_C03.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
OVRM1_0041_F12.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
CBLT1_0012_H07.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
CBLT1_0097_C02.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
THY01_0090_A05.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
OVRM1_0223_D03.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGACGTGGAGTTGTTCG
LVRM1_0051_B09.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCCCGCTTGTGTTTGAGGTGGAGTTGTTCG
OVR01_0101_C05.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
OVR01_0021_A09.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
BFLT1_0143_C02.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
LVRM1_0192_F01.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
OVRM1_0138_H12.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
PBL01_0024_G12.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
PBL01_0051_C08.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
CBLT1_0049_H09.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
KDN01_0088_A02.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
OVRM1_0071_E10.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
LVRM1_0041_F07.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
CBLT1_0004_D12.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
LVRM1_0138_E07.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
SKNB1_0046_F06.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
SMG01_0045_A04.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
TES01_0056_G07.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
OVRM1_0187_B11.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
UTR01_0043_A02.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
OVRM1_0191_B10.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
CBLT1_0002_C08.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
OVRM1_0018_G10.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
OVRM1_0105_G07.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
OVRM1_0028_D08.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
PTG01_0105_A05.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
LVR01_0043_C08.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
LVR01_0031_G02.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
LVRM1_0105_A06.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
PTG01_0108_E11.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
ADR01_0007_E05.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
PTG01_0022_C07.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
UTR01_0047_B04.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
UTR01_0075_H09.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
UTR01_0069_G07.b : CCGGCAGTCCTCCCAAGATACCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
KDN01_0089_D02.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
TCH01_0044_F04.b : CCGGCAGTCCTCCCAAGATTCCTCCCAATGCCACGCTTGTGTTTGAGGTGGAGTTGTTCG
SPL01_0055_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGTTTGAGGTGGAGTTGTTCG
ADR01_0097_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGTTTGAGGTGGAGTTGTTCG
UTR01_0016_D10.b :
THY01_0041_D09.b :
ADR01_0077_A04.b :
20110601C-007463 : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
---------+---------+---------+---------+---------+---------+ 575
CBLT1_0059_H05.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
OVR01_0026_E05.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
OVRM1_0074_B02.b : AGTTCAAGGGAGAGGACCTGACATAAGAGGAAGACTGTGGGATCATTAGGAGAA*TACAG
PBL01_0001_A09.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCANGAGAA*TACAG
ILNT1_0073_B12.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
OVR01_0075_F12.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
OVRM1_0153_D10.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
SPL01_0063_C11.b : AGTTCAAGGGTGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
OVRT1_0118_G01.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
PBL01_0071_F02.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
BFLT1_0052_C03.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
OVRM1_0041_F12.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
CBLT1_0012_H07.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
CBLT1_0097_C02.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
THY01_0090_A05.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
OVRM1_0223_D03.b : AGTTCAAGGGAGAGGACCTGACCGAAtacgattacggtggtatcgttcggtgatttctca
LVRM1_0051_B09.b : AGTTCCAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
OVR01_0101_C05.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCATGAGAA*TACAG
OVR01_0021_A09.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
BFLT1_0143_C02.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
LVRM1_0192_F01.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
OVRM1_0138_H12.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCACGAGAT*ACAGA
PBL01_0024_G12.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
PBL01_0051_C08.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
CBLT1_0049_H09.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
KDN01_0088_A02.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
OVRM1_0071_E10.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
LVRM1_0041_F07.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAAATACAG
CBLT1_0004_D12.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
LVRM1_0138_E07.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
SKNB1_0046_F06.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
SMG01_0045_A04.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
TES01_0056_G07.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
OVRM1_0187_B11.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
UTR01_0043_A02.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGCGGGATCATCAGGAGAA*TACAG
OVRM1_0191_B10.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
CBLT1_0002_C08.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
OVRM1_0018_G10.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
OVRM1_0105_G07.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
OVRM1_0028_D08.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
PTG01_0105_A05.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
LVR01_0043_C08.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
LVR01_0031_G02.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
LVRM1_0105_A06.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
PTG01_0108_E11.b : AGTTNCAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCANGAGAA*TACAG
ADR01_0007_E05.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
PTG01_0022_C07.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
UTR01_0047_B04.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
UTR01_0075_H09.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
UTR01_0069_G07.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
KDN01_0089_D02.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
TCH01_0044_F04.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
SPL01_0055_A07.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
ADR01_0097_F07.b : AGTTCAAGGGAGAGGACCTGACAGAAGAGGAAGACGGTGGGATCATCAGGAGAA*TACAG
UTR01_0016_D10.b : ggttgacctatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0041_D09.b : ctttgggggcactactagxxxxxxx
ADR01_0077_A04.b :
20110601C-007463 : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
---------+---------+---------+---------+---------+---------+ 633
CBLT1_0059_H05.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
OVR01_0026_E05.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
OVRM1_0074_B02.b : ACCC**GGGGGGATGGCTATGCacggaccaccgagggccgcattgtggaagatgccccga
PBL01_0001_A09.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCCACGATGGTGCCATTGTGGAGGTTGCCCTGG
ILNT1_0073_B12.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCCTG
OVR01_0075_F12.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
OVRM1_0153_D10.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
SPL01_0063_C11.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
OVRT1_0118_G01.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
PBL01_0071_F02.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
BFLT1_0052_C03.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
OVRM1_0041_F12.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
CBLT1_0012_H07.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
CBLT1_0097_C02.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
THY01_0090_A05.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
OVRM1_0223_D03.b : cgttgggggaagantaggtggcgactactctgtcacctctgtgtagttctaagctgatgt
LVRM1_0051_B09.b : ACCC**CGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCCTTGTGGAGGTTGCCCTGG
OVR01_0101_C05.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
OVR01_0021_A09.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
BFLT1_0143_C02.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
LVRM1_0192_F01.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
OVRM1_0138_H12.b : CCCG**GGTGGGAAGGCTATGCCAGGCCCAACCATGGTGTCATTGTtggaggttgccctt
PBL01_0024_G12.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
PBL01_0051_C08.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGACGGTGCCATTGTGGAGGTTGCCCTGG
CBLT1_0049_H09.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
KDN01_0088_A02.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
OVRM1_0071_E10.b : ACCC**GGGGGGAAGGCTATGCCAGGCACAACGATGGTGCCATTGTGGAGGTTGCCCTGG
LVRM1_0041_F07.b : ACCCGGGGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
CBLT1_0004_D12.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
LVRM1_0138_E07.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
SKNB1_0046_F06.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
SMG01_0045_A04.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
TES01_0056_G07.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
OVRM1_0187_B11.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
UTR01_0043_A02.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
OVRM1_0191_B10.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
CBLT1_0002_C08.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
OVRM1_0018_G10.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
OVRM1_0105_G07.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
OVRM1_0028_D08.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
PTG01_0105_A05.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
LVR01_0043_C08.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
LVR01_0031_G02.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
LVRM1_0105_A06.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
PTG01_0108_E11.b : ACCC**GGGGGGAAGGCTATTGCAGGCCCCACGATGGTGGCATTGTGGAGGTTGCCCTGA
ADR01_0007_E05.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
PTG01_0022_C07.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
UTR01_0047_B04.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
UTR01_0075_H09.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
UTR01_0069_G07.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
KDN01_0089_D02.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
TCH01_0044_F04.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
SPL01_0055_A07.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
ADR01_0097_F07.b : ACCC**GGGGGGAAGGCTATGCCAGGCCCAACGATGGTGCCATTGTGGAGGTTGCCCTGG
UTR01_0016_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATGGTGCCATTGTGGAGGTTGCCCTGG
THY01_0041_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGG
ADR01_0077_A04.b : nnnnttgataaacaxxxxx
20110601C-007463 : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
---------+---------+---------+---------+---------+---------+ 691
CBLT1_0059_H05.b : AAGGGTACTACAAGGACCAGATCTTTGACCAGCGGG*AGATCCGCTTTGAGGTCGGC*GA
OVR01_0026_E05.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
OVRM1_0074_B02.b : cacgtgacctagggcgaccattcgtttgatcagcgggaggtccactgtggcgcccgcgga
PBL01_0001_A09.b : AAGGGTACTACAAGGACCAGATCTTTGANCGGCGGG*AGATCCGCTTTGAGGTCCGC*GA
ILNT1_0073_B12.b : GAAGGTACTACNAGGACCAGATCTTTGACCAGCGGG*AGATCCGCTTTGAGGTCGGCCGA
OVR01_0075_F12.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
OVRM1_0153_D10.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
SPL01_0063_C11.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
OVRT1_0118_G01.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
PBL01_0071_F02.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
BFLT1_0052_C03.b : AAGGGTACTACAAGGACCAGATCTTTGACCAGCGGG*AGATCCGCTTTGAGGTCGGC*GA
OVRM1_0041_F12.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCNGC*GA
CBLT1_0012_H07.b : AAGGGTACTACAAGGACCAGATCTTTGACCAGCGGG*AGATCCGCTTTGAGGTCGGC*GA
CBLT1_0097_C02.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
THY01_0090_A05.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
OVRM1_0223_D03.b : tttgctctggatcatgtttttgcgcctagtgttgccctcttctggtcacttcgcgagcgt
LVRM1_0051_B09.b : AAAGGTACTACCAGGACCAGATCTTTTGACGGGCGGGAAATCCGCTTTGAGGTCGGCCGA
OVR01_0101_C05.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
OVR01_0021_A09.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
BFLT1_0143_C02.b : AAGGGTACTACAAGGACCAGATCCTTGACCGGGCGGGAGATCCGCTTTGAGGTCGGC*GA
LVRM1_0192_F01.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
OVRM1_0138_H12.b : gggagggtactgccaaggaccacatctttgaccggccgggagatccccttttgaggtcgc
PBL01_0024_G12.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
PBL01_0051_C08.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
CBLT1_0049_H09.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
KDN01_0088_A02.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
OVRM1_0071_E10.b : AAGGGT*CTACAAGGACCAGATCTTTGACCA*CGGG*AGATCCGCTTTGAGGTCGGC*GA
LVRM1_0041_F07.b : AAGGGTACTACAAGGACCAGATCTTTGACCAGCGGGGAGATCCGCTTTGAGGTCCGC*GA
CBLT1_0004_D12.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
LVRM1_0138_E07.b : AAGGGTACTACAAGGACCAGATCTTTGACCAGCGGG*AGATCCGCTTTGAGGTCGGC*GA
SKNB1_0046_F06.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
SMG01_0045_A04.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
TES01_0056_G07.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
OVRM1_0187_B11.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
UTR01_0043_A02.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
OVRM1_0191_B10.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
CBLT1_0002_C08.b : AAGGGTACTACAAGGACCAGATCTTTGACCAGCGGG*AGATCCGCTTTGAGGTCGGC*GA
OVRM1_0018_G10.b : AAGGGTACTACAAGGACCAGATCTTTGACCAGCGGG*AGATCCGCTTTGAGGTCGGC*GA
OVRM1_0105_G07.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
OVRM1_0028_D08.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
PTG01_0105_A05.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
LVR01_0043_C08.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
LVR01_0031_G02.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
LVRM1_0105_A06.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
PTG01_0108_E11.b : AAGGGTACTACANGGACCAGATCTTTGACGGGCGGG*AGATCCGCTTGGAGGTCGGC*GA
ADR01_0007_E05.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
PTG01_0022_C07.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
UTR01_0047_B04.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
UTR01_0075_H09.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
UTR01_0069_G07.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
KDN01_0089_D02.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
TCH01_0044_F04.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
SPL01_0055_A07.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
ADR01_0097_F07.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
UTR01_0016_D10.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
THY01_0041_D09.b : AAGGGTACTACAAGGACCAGATCTTTGACCGGCGGG*AGATCCGCTTTGAGGTCGGC*GA
ADR01_0077_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGATCCGCTTTGAGGTCGGC*GA
20110601C-007463 : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
---------+---------+---------+---------+---------+---------+ 748
CBLT1_0059_H05.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
OVR01_0026_E05.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGAAAAGCCATTCAGCGCATGGAAAA
OVRM1_0074_B02.b : ggggagacttaggacttgatatgggggctggataatggctcca
PBL01_0001_A09.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCCGCGCCTGGAAAA
ILNT1_0073_B12.b : AGGGGAGACTATGGAACTTGCCTTGGTGGGCTGGAGA*AAGCCATTCCGCGCATGGAAAA
OVR01_0075_F12.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGG*GAGAAGCCATGCACCGCATGGAATA
OVRM1_0153_D10.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGNAAA
SPL01_0063_C11.b : AAGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
OVRT1_0118_G01.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
PBL01_0071_F02.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
BFLT1_0052_C03.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
OVRM1_0041_F12.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
CBLT1_0012_H07.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
CBLT1_0097_C02.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAAA*AAGCCATTCAGCGCATGGAAAA
THY01_0090_A05.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
OVRM1_0223_D03.b : ccgctattattctcatatgttccctcggcgtgggtctgcgttggtgccgtgacctctatt
LVRM1_0051_B09.b : AGGCGAGACTATGGA*CTTTCCCT*GTTGGCTGGAGA*AACCTATTCCTCGCTTGGTGAA
OVR01_0101_C05.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
OVR01_0021_A09.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
BFLT1_0143_C02.b : GGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAAGAAACCCATTCAGCGCATGGAAAA
LVRM1_0192_F01.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGNAAA
OVRM1_0138_H12.b : gcaaaggggaaacctatggacttgccttggggtgctgggagaaaggcccttcaccgcctg
PBL01_0024_G12.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
PBL01_0051_C08.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
CBLT1_0049_H09.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
KDN01_0088_A02.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
OVRM1_0071_E10.b : AGGGagacttttgacttgccttggggctggagaaagcatttacggattggaaaagagagc
LVRM1_0041_F07.b : AAGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCCACGCATGGAAAA
CBLT1_0004_D12.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
LVRM1_0138_E07.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGNAAA
SKNB1_0046_F06.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
SMG01_0045_A04.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
TES01_0056_G07.b : AAGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
OVRM1_0187_B11.b : AGGGGAGACTATGGA*CCTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGGAAA
UTR01_0043_A02.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
OVRM1_0191_B10.b : AAGGGA*ACTATGGA*CTTGCCTT*GTGGGCTGGAGA**AACCATTCAGCGCAGGTAAAA
CBLT1_0002_C08.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
OVRM1_0018_G10.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGGAAA
OVRM1_0105_G07.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
OVRM1_0028_D08.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
PTG01_0105_A05.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
LVR01_0043_C08.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
LVR01_0031_G02.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
LVRM1_0105_A06.b : AAGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
PTG01_0108_E11.b : AGGGAAGACTATTGCACTGGCTTT*GGGGGCTGGAAA*AAGCCTTTCACCGCATGGAAAA
ADR01_0007_E05.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
PTG01_0022_C07.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
UTR01_0047_B04.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
UTR01_0075_H09.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
UTR01_0069_G07.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
KDN01_0089_D02.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
TCH01_0044_F04.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
SPL01_0055_A07.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
ADR01_0097_F07.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
UTR01_0016_D10.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
THY01_0041_D09.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
ADR01_0077_A04.b : AGGGGAGACTATGGA*CTTGCCTT*GTGGGCTGGAGA*AAGCCATTCAGCGCATGGAAAA
20110601C-007463 : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
---------+---------+---------+---------+---------+---------+ 805
CBLT1_0059_H05.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*GA
OVR01_0026_E05.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
OVRM1_0074_B02.b :
PBL01_0001_A09.b : AGGAGAGCATTCC*CTTGTGGTACTCAAACCCAGCTATG*CTTTCGGCAGTGCTGGG*AA
ILNT1_0073_B12.b : Aaggaaagcctttccattggggtcctcaaacccagctattccttttggcaatggctggga
OVR01_0075_F12.b : AGGAGAGCATTC
OVRM1_0153_D10.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGC
SPL01_0063_C11.b : AGGAGAGCATTCCCATTGTGTACCTCCTACCCAGCTATGCCTTTCGGCAGTGCTGGG*AA
OVRT1_0118_G01.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGGGAG
PBL01_0071_F02.b : AGGAGAGCATTCC*ATTGTGTACCTCANACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
BFLT1_0052_C03.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
OVRM1_0041_F12.b : AGGAGAGCATTCC*ATTGTGNTACCTCAACCCAGCTATG*CGTTCNGCAGTGCTGGG*AA
CBLT1_0012_H07.b : AGGAGAGCATTCC*ATTGTGTACCTCNAACCCAGCTATG*CGTTCTGCAGTGCTGGG*AA
CBLT1_0097_C02.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGGGAA
THY01_0090_A05.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
OVRM1_0223_D03.b : aattgctcgctgccaatgtgtatgagattg
LVRM1_0051_B09.b : AGCGAAGAATTCC*ATTGTGTACCTCAAACCCcctcttgtgttcgggaatggtgtg
OVR01_0101_C05.b : AGGAGAGCATTCC*ATTGTGTACCTCCAACCCAGCTATT*CGTTCcgccgttgctgggga
OVR01_0021_A09.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
BFLT1_0143_C02.b : AGGGAAGCTTTCC*TTTGGGTACCACAACCCCACCTTTG*CTTCGGGCATTGCTGGG*AA
LVRM1_0192_F01.b : AGGAGAGCATTCC*ATTGTGTACCTCAA
OVRM1_0138_H12.b : ggaaaaagggagagcatt
PBL01_0024_G12.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
PBL01_0051_C08.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
CBLT1_0049_H09.b : AGGAGAGCATTCC*ATTGTGTACCTCANACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
KDN01_0088_A02.b : AGGAGAGCATTCC*ATTGTGTACCTCANACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
OVRM1_0071_E10.b : atttcattgggaccttaaaccagctttccttcggaatgcttggaaggaaaattctcactc
LVRM1_0041_F07.b : AGGAGAGCCTTCC*ATTGTGTACCTCAAcccagctatgcg
CBLT1_0004_D12.b : AGGAGAGCATTCC*ATTGTGTACCTCACACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
LVRM1_0138_E07.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
SKNB1_0046_F06.b : AGGAGAGCATTCC*ATTGTGTACCTCANACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
SMG01_0045_A04.b : AGGAGAGCATTCC*ATTGTGTACCTCANACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
TES01_0056_G07.b : AGGAGAGCATCCCATTTGTGTACCTCAAACCCCGCTATG*CGTTCGGCCGTGCTGGG*AA
OVRM1_0187_B11.b : AGGAGAGCATTCC*ATTGTGTACCTC*AACCCAGCTATG*CGTTCGGCAGTGCTGGG*GA
UTR01_0043_A02.b : AGGAGAGCATTCC*ATTGTGTACCTCANACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
OVRM1_0191_B10.b : GAGAGAGCATTCC*ATTGTGGAGACTCAAACCAGCTATG*CGTTCGGgcagtgtgggaag
CBLT1_0002_C08.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
OVRM1_0018_G10.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*GA
OVRM1_0105_G07.b : AGGAGAGCATTCC*ATTGTGTACCTCTAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
OVRM1_0028_D08.b : AGGAGAGCATTCC*ATTGTGTACCTCAGACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
PTG01_0105_A05.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
LVR01_0043_C08.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
LVR01_0031_G02.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
LVRM1_0105_A06.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
PTG01_0108_E11.b : Aaggaaagcattccctttgggttactcaaacccgcttatgctttcggcaatgcttggaaa
ADR01_0007_E05.b : AGGAGAGCATTCC*ATTGTGTNNA*CTCAACCAGCTATG*CGTTCGGCAGTGCTGGG*AG
PTG01_0022_C07.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
UTR01_0047_B04.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
UTR01_0075_H09.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
UTR01_0069_G07.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
KDN01_0089_D02.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
TCH01_0044_F04.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
SPL01_0055_A07.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
ADR01_0097_F07.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
UTR01_0016_D10.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
THY01_0041_D09.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
ADR01_0077_A04.b : AGGAGAGCATTCC*ATTGTGTACCTCAAACCCAGCTATG*CGTTCGGCAGTGCTGGG*AA
20110601C-007463 : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
---------+---------+---------+---------+---------+---------+ 863
CBLT1_0059_H05.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
OVR01_0026_E05.b : GGAAAAGTTCCACATCCCACCTAATGGCTGAGTTGAAAGTATGAAGTACACCTCACGAGT
OVRM1_0074_B02.b :
PBL01_0001_A09.b : GGAAAAattcacctcccccctatggtgagtggagtatggagtacccctccagatttttga
ILNT1_0073_B12.b : aaggaaaatttccccatccccccctaaggctgaagttgaattttgaattacccccttcag
OVR01_0075_F12.b :
OVRM1_0153_D10.b :
SPL01_0063_C11.b : GGGAAAatttccacatccccacctaatgcctgaattgaaagtatggaagtacccccttca
OVRT1_0118_G01.b : AGAAAAGTCCCACTTCCCACCTA*TG*CTGAGTTG*AATTATGAAGTACCCCTCAAGAGT
PBL01_0071_F02.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
BFLT1_0052_C03.b : GG*AAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
OVRM1_0041_F12.b : AGGAAAGT*CCACATCCCAt
CBLT1_0012_H07.b : GGAAAAGTTCCACATTCCACCTAATG*CTGAGTTG*AAATATGAAGTACACCTCAAGATT
CBLT1_0097_C02.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AGGTATGAAGTACCCCTCAGAAGT
THY01_0090_A05.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
OVRM1_0223_D03.b :
LVRM1_0051_B09.b :
OVR01_0101_C05.b : aggaaaaattccccctccccccctaatgcctgaatttgaaatttgaaagacaccctccag
OVR01_0021_A09.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
BFLT1_0143_C02.b : GGAAAtttccactcccccctattggctgattgaattttgaagtaccccctcagatttttt
LVRM1_0192_F01.b :
OVRM1_0138_H12.b :
PBL01_0024_G12.b : GGAAAAGTTC*ACATCCCACCTA*TG*CTGAGTTG*A*GTATGAAGTACACCTCAAGAGT
PBL01_0051_C08.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
CBLT1_0049_H09.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
KDN01_0088_A02.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
OVRM1_0071_E10.b : caataagctgggtg
LVRM1_0041_F07.b :
CBLT1_0004_D12.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTTCAGAGT
LVRM1_0138_E07.b : GGGAAAGTTC*ACATCCCACn
SKNB1_0046_F06.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
SMG01_0045_A04.b : GGAAAAGT*CCACATCCCACCTAATG*CTGAGTTT*GAGTATGAAGTACACCTCAGGAGT
TES01_0056_G07.b : GGGAAAGTATCACATCCCACCAAATG*CTGAGTTG*AAATATGAAGTACACCctcagatt
OVRM1_0187_B11.b : AGGAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAn
UTR01_0043_A02.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
OVRM1_0191_B10.b : ggaaaattccactcccacctaaggct
CBLT1_0002_C08.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
OVRM1_0018_G10.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*GAGTATGAAngtacacctcagag
OVRM1_0105_G07.b : GGAAAAGTTCCACATCCCACCTTATG*CTGAGTTG*TAATATGAGGTACACCTCAAGAGT
OVRM1_0028_D08.b : GGAAAAGTTCCACATCCTACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
PTG01_0105_A05.b : AGGAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAGGAGT
LVR01_0043_C08.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
LVR01_0031_G02.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
LVRM1_0105_A06.b : GGGAAAG
PTG01_0108_E11.b : ggaaaattcccccttccccccctaatggctgaatttaatttggaaaataccccccaaaaa
ADR01_0007_E05.b : GGAAAAGT*CCACATCCCACCTA*TG*CTGAGTTG*AAGTATGAAGTACACCTTCAGAGT
PTG01_0022_C07.b : GGAAAAGT*CCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
UTR01_0047_B04.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
UTR01_0075_H09.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
UTR01_0069_G07.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
KDN01_0089_D02.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
TCH01_0044_F04.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
SPL01_0055_A07.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
ADR01_0097_F07.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
UTR01_0016_D10.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
THY01_0041_D09.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
ADR01_0077_A04.b : GGAAAAGTTCCACATCCCACCTAATG*CTGAGTTG*AAGTATGAAGTACACCTCAAGAGT
20110601C-007463 : TTTGAGAAGG**CCAAGGAGTCGT*GGGAGATGAGCTCAGAGGAGAAGCTGGAG*CAGAG
---------+---------+---------+---------+---------+---------+ 919
CBLT1_0059_H05.b : TTTGAGAAAG**C*CAGGAGTCGT*GGGAGATGAGCTCAAAGGAAAA*CTGGAG*CAGAG
OVR01_0026_E05.b : TTTGAGAAAGGCCCAAGGAGTCGTGGGGAAATAAGCTCAAAGGAGAAGCTGGAG*CAAAG
OVRM1_0074_B02.b :
PBL01_0001_A09.b : aaaggccagggattctggggaaatgaactccaaggaaaaactggaaccaacccacattgg
ILNT1_0073_B12.b : aattttttaaaaggcccagggatttcgggggaataaaccttcaaaggaaaactgggaccc
OVR01_0075_F12.b :
OVRM1_0153_D10.b :
SPL01_0063_C11.b : gaaagttttgaaaaaggccccaaggatccctggggaaaatgaacccccaaaggaaaaagc
OVRT1_0118_G01.b : TTTGAGAAGG**GCAAGGAGTCGG*GGGAAATGAcctccaaaggaaaactggagcagacc
PBL01_0071_F02.b : TTTGAGAAGG**CCCATGAGTCGT*GGGAGATGAGCTCATAGGAGAAGCTGGAG*CAGAG
BFLT1_0052_C03.b : TTTGAGAAGG**CCAAGGAGTCGT*GGGAGATGAGCTCAGAGGAGAAGCTGGAG**CAGA
OVRM1_0041_F12.b :
CBLT1_0012_H07.b : TTTGAGAAGG**CCAAGGAGTtcgtgggagattgactcaaaaggaaaacttggacaaacc
CBLT1_0097_C02.b : TTTGAGAAGG**CCCAAGAGTCCT*GGGAAATGAACTCAGAGTAGAAGCTGGAGCAAAGC
THY01_0090_A05.b : TTTGAGAAGG**CCCAGGAGTCGT*GGGAGATGAGCTCAGAGGAGAAGCTGGAG*CAAAG
OVRM1_0223_D03.b :
LVRM1_0051_B09.b :
OVR01_0101_C05.b : aggtttttgaaaaaggccaaaggattcttggggagaataaactcccaaagaaaaaaactt
OVR01_0021_A09.b : TTTGAGAAGG**CCAAGGAGTCGT*GGGAGATGAGCTCAGAGGAGAAGCTGGAG*CAGAG
BFLT1_0143_C02.b : aaagggccaggattctggggaaatgaactcaaaagaaaacctgaaccaaaccccctttgg
LVRM1_0192_F01.b :
OVRM1_0138_H12.b :
PBL01_0024_G12.b : TTTGAGAAGG**C*CAGGAGTCGT*GGGAGATGAGCTCAGAGGAGAAGCTGGAG**CAGA
PBL01_0051_C08.b : TTTGAGAAGG**CCANG*AGTCGT*GGGAGATGAGCTCAGAGGAGAAGCTGGAG**CAGA
CBLT1_0049_H09.b : TTTGAGAAGG**CAAAGGAGTCGT*GGGAGATGAGCTCAGAGGAG*AGCTGGAG*CAGAG
KDN01_0088_A02.b : TTTGAGAAGG**CCAAGGAGTCGT*GGGAGATGAGCTCAGAGGAGAAGCTGGAG*CAGAG
OVRM1_0071_E10.b :
LVRM1_0041_F07.b :
CBLT1_0004_D12.b : TTTGAGAAAG**C*CAGGAGTCGT*GGGAGATGAACTCAGAGGAAAAGCTGGAGCCAAAG
LVRM1_0138_E07.b :
SKNB1_0046_F06.b : TTTGAGAANG**CCAAAGAGTCGT*GGGAGATGAGCTCAGAGGAGAAGCTGGAG*CAGAG
SMG01_0045_A04.b : TTTGAG*AGG**CCCAAGAGTCGT*GGGAGATGAGCTCAAAGGAGAAGCTGGG**ACAGA
TES01_0056_G07.b : ttggaaaagggcaagaatcctgggaaaataactcaaggaaaaaccgggacaaaacccctt
OVRM1_0187_B11.b :
UTR01_0043_A02.b : TTTGAGAAGG**CCAAGGAGTCGT*GGGAGATGAGCTCAGAGGAGAAGCTGGAG*CAGAG
OVRM1_0191_B10.b :
CBLT1_0002_C08.b : TTTGAGAAGG**CCAAGGAGTCGT*GGGAGATGAGCTCAGAGGAGAAGCTGGAG*CAGAG
OVRM1_0018_G10.b :
OVRM1_0105_G07.b : TT
OVRM1_0028_D08.b : NTTGAGACGG**CCAg
PTG01_0105_A05.b : TTTGAGAAAG**CCAAGGgagtcttgggaaatgaactcaaaagagaagctggaccaaacc
LVR01_0043_C08.b : TTTGAGAAGG**CCAAGGAGTCGT*GGGAGATGAGCTCAGAGGAGAAGTTGGAG*CAGAG
LVR01_0031_G02.b : TTTGAGAAGG**CCCAGGAGTCGT*GGGAGATGAGCTCAGAGGAGAAGCTGGAG*CAAAG
LVRM1_0105_A06.b :
PTG01_0108_E11.b : tttttaaaaaagccccaggaatcctggggaaaattaaccccaaagaaaaaacttgggaca
ADR01_0007_E05.b : TTTGAGAAngcnangagtcgtgggagatgactcagaggagagctggagcagagcaccatg
PTG01_0022_C07.b : TTTGAGAAAN**GCCAAGAGTCGT*GGGAGATGAGCTCAGAAGAGAAGCTGGAG*CAGAG
UTR01_0047_B04.b : TTTGAGAAGG**CCAAGGAGTCGT*GGGAGATGAGCTCAGAGGAGAAGCTGGAG*CAGAG
UTR01_0075_H09.b : TTTGAGAAGG**CCAAGGAGTCGT*GGGAGATGAGCTCAGAGGAGAAGCTGGAG*CAGAG
UTR01_0069_G07.b : TTTGAGAAGG**CCAAGGAGTCGT*GGGAGATGAGCTCAGAGGAGAAGCTGGAG*CAGAG
KDN01_0089_D02.b : TTTGAGAAGG**CCAAGGAGTCGT*GGGAGATGAGCTCAGAGGAGAAGCTGGAG*CAGAG
TCH01_0044_F04.b : TTTGAGAAGG**CCAAGGAGTCGT*GGGAGATGAGCTCAGAGGAGAAGCTGGAG*CAGAG
SPL01_0055_A07.b : TTTGAGAAGG**CCAAGGAGTCGT*GGGAGATGAGCTCAGAGGAGAAGCTGGAG*CAGAG
ADR01_0097_F07.b : TTTGAGAAGG**CCAAGGAGTCGT*GGGAGATGAGCTCAGAGGAGAAGCTGGAG*CAGAG
UTR01_0016_D10.b : TTTGAGAAGG**CCAAGGAGTCGT*GGGAGATGAGCTCAGAGGAGAAGCTGGAG*CAGAG
THY01_0041_D09.b : TTTGAGAAGG**CCAAGGAGTCGT*GGGAGATGAGCTCAGAGGAGAAGCTGGAG*CAGAG
ADR01_0077_A04.b : TTTGAGAAGG**CCAAGGAGTCGT*GGGAGATGAGCTCAGAGGAGAAGCTGGAG*CAGAG
20110601C-007463 : CACCATTGTGAAGGAGCGGGGCACTGTATACTTC*AAGGAAGGCAAGTACAAGCAAGCTC
---------+---------+---------+---------+---------+---------+ 978
CBLT1_0059_H05.b : CAGCATTGTGAAAGAGCGGGGCACTGTATACTTC*AGGAAAGGCA*GTACAAGCAAGCTC
OVR01_0026_E05.b : CACCTTTGTGAAGGACCGGGGGACTGTATACTTC*AAGGAAGGCAAGTACAAGCAAGCTC
OVRM1_0074_B02.b :
PBL01_0001_A09.b : taaaggaccggggccctgtataccttcagggaaggcaggtacaacccagctcgggtgcca
ILNT1_0073_B12.b : aaaaccccttttgtaaggaaccgggggctttttttttctttcgaggaagggggagttcca
OVR01_0075_F12.b :
OVRM1_0153_D10.b :
SPL01_0063_C11.b : ctggggaacctagtcaccatttgtggaaaagaacggggggcacctttattaattttcagg
OVRT1_0118_G01.b : cccttggggagggacgggggcatgtttactttcaggaaggggaatacaagcaagtttggg
PBL01_0071_F02.b : CACATTTGTGAG*GAGCGGGGCACTGTATACTTC*AGGGAAGGCAgtacagcaagctctg
BFLT1_0052_C03.b : GCGCATTGTGAAGGAGCGGGGCACTGTATACTTC*A*GGAAGGCAAGTACAAGCAAGCTC
OVRM1_0041_F12.b :
CBLT1_0012_H07.b : accatgttgaaggagcggggcactgtttactttcaagagaggcagttcaaacaagctttg
CBLT1_0097_C02.b : CCC**TTGTGAAGGACCGGGGCACTGTATACTTC*Aggaaagcgaggtaaaaccagctct
THY01_0090_A05.b : CACCATTGTGAAGGAGCGGGGCACTGTATACTTC*ANGGAGGGCAAGTACAAGCAAGCTC
OVRM1_0223_D03.b :
LVRM1_0051_B09.b :
OVR01_0101_C05.b : ggggccaaaccccctttttttaaagggaccggggcccctgtgttttctttctgggagggg
OVR01_0021_A09.b : CACCATTGTGAAGGAGCGGGGCACTGTATACTTC*A*GGAAGGCAAGTACAAGCAAGCTC
BFLT1_0143_C02.b : aagggccggggcctgttatcttcagggaggggaggtcaaaccaagccggggggatataaa
LVRM1_0192_F01.b :
OVRM1_0138_H12.b :
PBL01_0024_G12.b : GCACATTGTGAAAGAGCGGGGCACTGTATACTTC*AAGGAAGGGCAGTACAgcagctctg
PBL01_0051_C08.b : GCACATTGTGAAGGAGCGGGGCACTGTATACTTC*AGGAANGGCA*GTACNNAGCAGCTC
CBLT1_0049_H09.b : CACCAT*GTGAAGGAGCGGGGCctgtatacttcaggaagggcagtcnagcaagctctggg
KDN01_0088_A02.b : CACCATTGTGAAGGAGCGGGGCACTGTATACTTT*CAGGAANGGCAGTACAAGCAAGCTC
OVRM1_0071_E10.b :
LVRM1_0041_F07.b :
CBLT1_0004_D12.b : CCCCTTTGTGAAGGAGCGGGGGCCTGTATACTTC*AGGGAAGGCA*AGTtacaagcagct
LVRM1_0138_E07.b :
SKNB1_0046_F06.b : CACCATTGTGAAGGAGCGGGGCACTGTATACTTC*AAGGAAAGCAAGTACAAGCAAGCTC
SMG01_0045_A04.b : GCACATTGTGGAGGAGCGGGGCCCTGTATACTTT*CAGGAAGGCAgtacaagcaagctcg
TES01_0056_G07.b : gttgaaggaccgggccctgtttacttcagggaaggaagtacaagcaagctctggggccat
OVRM1_0187_B11.b :
UTR01_0043_A02.b : CACCATTGTGAAGGAGCGGGGCACTGTATACTTCAAGGGAAGGCAAGTACAAGCAAagct
OVRM1_0191_B10.b :
CBLT1_0002_C08.b : CAGCATTGTGAAGGAGCGGGGCACTGTATACTTC*AAGGAAAGCAAGTACAAGCAAGCTC
OVRM1_0018_G10.b :
OVRM1_0105_G07.b :
OVRM1_0028_D08.b :
PTG01_0105_A05.b : ccctttgtgaaggacggggccttgtttcttcaggaaagcaagtcaaccagctcggtgcat
LVR01_0043_C08.b : CACCATTGTGAAAGAGCGGGGCACTGTATACTTC*AGGGAAGGCAAGTAACAGCAAGCTC
LVR01_0031_G02.b : CACCATTGTGAAGGAGCGGGGCACTGTATACTTC*CAGGAAGGCAAGTACAAGCAAGCTC
LVRM1_0105_A06.b :
PTG01_0108_E11.b : aaaacccctttttgaaaggaaggggggccttttatttttcaaggaaaggaaattacaaaa
ADR01_0007_E05.b : tgaaggacggggcactgtatacttcaggaanggcaggtacagcagctctggtgcagtaca
PTG01_0022_C07.b : CACCATTTGTGAAGAGCGGGGCACTGTATACTTC*AAGAAAGCAA*GTACAAGCAAGCTC
UTR01_0047_B04.b : CACCATTGTGAAGGAGCGGGGCACTGTATACTTC*AAGGAAGGCAAGTACAAGCAAGCTC
UTR01_0075_H09.b : CACCATTGTGAAGGAGCGGGGCACTGTATACTTC*AAGGAAGGCAAGTACAAGCAAGCTC
UTR01_0069_G07.b : CACCATTGTGAAGGAGCGGGGCACTGTATACTTC*AAGGAAGGCAAGTACAAGCAAGCTC
KDN01_0089_D02.b : CACCATTGTGAAGGAGCGGGGCACTGTATACTTC*AAGGAAGGCAAGTACAAGCAAGCTC
TCH01_0044_F04.b : CACCATTGTGAAGGAGCGGGGCACTGTATACTTC*AAGGAAGGCAAGTACAAGCAAGCTC
SPL01_0055_A07.b : CACCATTGTGAAGGAGCGGGGCACTGTATACTTC*AAGGAAGGCAAGTACAAGCAAGCTC
ADR01_0097_F07.b : CACCATTGTGAAGGAGCGGGGCACTGTATACTTC*AAGGAAGGCAAGTACAAGCAAGCTC
UTR01_0016_D10.b : CACCATTGTGAAGGAGCGGGGCACTGTATACTTC*AAGGAAGGCAAGTACAAGCAAGCTC
THY01_0041_D09.b : CACCATTGTGAAGGAGCGGGGCACTGTATACTTC*AAGGAAGGCAAGTACAAGCAAGCTC
ADR01_0077_A04.b : CACCATTGTGAAGGAGCGGGGCACTGTATACTTC*AAGGAAGGCAAGTACAAGCAAGCTC
20110601C-007463 : TGGTGCAGTACAAGAAGATTG*TGTCCTGGCTAGAATATGA*GTCGAGTTTCTCTAACGA
---------+---------+---------+---------+---------+---------+ 1036
CBLT1_0059_H05.b : TGGTGCAATACAAAAAGATTG*TGTCCGGCCTAGAAatgattcgagttctctaaccagat
OVR01_0026_E05.b : TGGTGgaataacaaaaaattggggtcctggttagaaaataagttgaggttttttttaaca
OVRM1_0074_B02.b :
PBL01_0001_A09.b : taaaaaaaaaatggggcccggcctaaaaatgattccagttcccctaacgaggacccacca
ILNT1_0073_B12.b : accaccgtttggggggcataaaaagaaaaaatgggtcctcgggccaaaaataagagtcga
OVR01_0075_F12.b :
OVRM1_0153_D10.b :
SPL01_0063_C11.b : ggaaaggcaattttcaatgccatacccttttgggggccatttcacaagataaaatttggg
OVRT1_0118_G01.b : ggcattaaaaaaaaattgtgcctggcaaaaaatgaatcgagttttcttacagggacccca
PBL01_0071_F02.b : gtgcagtacagaagaatgtgtcctggctagatatgagtcgagttctctaacgaggacgcc
BFLT1_0052_C03.b : TGGTGCATTACAAGAAGATTG*TGgctggctaaaattgagtccagttctctcacgaggag
OVRM1_0041_F12.b :
CBLT1_0012_H07.b : gtgcattaaaggaaaatgtgtcccggcagaataagagtggggttctccaccgaggatgac
CBLT1_0097_C02.b : gggtgcattacaagaatattatgtccggctaaaatatggttcgatttctctacgaggatg
THY01_0090_A05.b : TGGTGCAGTACAAGAGGATTG*TGTCCTGGCTAGAATATGA*GTCGAGTTTCTCTAAacg
OVRM1_0223_D03.b :
LVRM1_0051_B09.b :
OVR01_0101_C05.b : cgagttttcaacccaggcctcttggtgggcaataacaaaaaaaattgggggtcccctgcc
OVR01_0021_A09.b : TGGTGCAGTACAAGAAGATTG*TGTCCTGGCTAGGATATGA*GTCGAGTTTCTCTTACGA
BFLT1_0143_C02.b : aaaaaatgggtccgggctaaataggaaccgagttttccaaaggggacccaaaaagggagg
LVRM1_0192_F01.b :
OVRM1_0138_H12.b :
PBL01_0024_G12.b : gtgcagtacagaaagatgtgtcctggctagatatgagtcgagtttctctacgagagcaca
PBL01_0051_C08.b : TGGGTGCAGTACAGAAGATTG*TGTCCTGGCTAGAATATGA*GTCGAGTTTCTCNTACGA
CBLT1_0049_H09.b : cagtacaagaagatgtggtctggctaaatatgagtcgagttccctacgaggaccccagaa
KDN01_0088_A02.b : TGGTGCAGTACAAGAAGAATG*TGTCCTGGCTAGAATATGA*GTCGAGTTTCTCTAACGA
OVRM1_0071_E10.b :
LVRM1_0041_F07.b :
CBLT1_0004_D12.b : ctggtgcagtaacaaaaaattgtgccctggctaaaaaagattcgagtttccctaacgagg
LVRM1_0138_E07.b :
SKNB1_0046_F06.b : TGGTGCAGTACAAGAAGAATGGTGTCCTGGCTAGAATATGAAGTCCAGTTTCTCTAACGA
SMG01_0045_A04.b : gtgcagttacaaaaaattgggtcctggctgaaattgagtcgagtttctctaacgaggacc
TES01_0056_G07.b : aaaaaaaaaattggtcccgggcaaaaaataatccaagttttcccaaacaggaaccacaaa
OVRM1_0187_B11.b :
UTR01_0043_A02.b : ctggntgcagtacangaaagattgtgtccaggctccgcctcaagtttctgtggcttgagg
OVRM1_0191_B10.b :
CBLT1_0002_C08.b : TGGTGCAATACAAGAAGATTG*TGTCCTGGCTAGAATATGA*GTCCAGTTTCTCTAACGA
OVRM1_0018_G10.b :
OVRM1_0105_G07.b :
OVRM1_0028_D08.b :
PTG01_0105_A05.b : tacaaaaattggtcctggctaaaattgatccagttttcctacgagaacccaaagggccgg
LVR01_0043_C08.b : TGGTGCAGTACAAGAAGATTG*TGTCCTGGgcttgaatatgattcgaagtttctctaacg
LVR01_0031_G02.b : TTGGTGCAGTACAAAAGAATG*TGTCCTGGCTAGAATATGA*GTCCAGTTTCTCTAAACA
LVRM1_0105_A06.b :
PTG01_0108_E11.b : aaatttttggggaaaataaaaaaaaagggtcccggggcaaaaaaatagaccaattttttc
ADR01_0007_E05.b : agagatgtgtctgnctagatatgagtcgagttctctaacgagacgccagaggcacagctc
PTG01_0022_C07.b : TGGTGCAGTACAgaagattgtggtctggctagatatgattcgagtttcccaacgaagacc
UTR01_0047_B04.b : TGGTGCAGTACAAGAAGATTG*TGTCCTGNCTAGAATATGA*GTCGAGTTTCTCTAACGA
UTR01_0075_H09.b : TGGTGCAGTACAAGAAGATTG*TGTCCTGGCTAGAATATGA*GTCGAGTTTCTCTAACGA
UTR01_0069_G07.b : TGGTGCAGTACAAGAAGATTG*TGTCCTGGCTAGAATATGA*GTCGAGTTTCTCTAACGA
KDN01_0089_D02.b : TGGTGCAGTACAAGAAGATTG*TGTCCTGGCTAGAATATGA*GTCGAGTTTCTCTAACGA
TCH01_0044_F04.b : TGGTGCAGTACAAGAAGATTG*TGTCCTGGCTAGAATATGA*GTCGAGTTTCTCTAACGA
SPL01_0055_A07.b : TGGTGCAGTACAAGAAGATTG*TGTCCTGGCTAGAATATGA*GTCGAGTTTCTCTAACGA
ADR01_0097_F07.b : TGGTGCAGTACAAGAAGATTG*TGTCCTGGCTAGAATATGA*GTCGAGTTTCTCTAACGA
UTR01_0016_D10.b : TGGTGCAGTACAAGAAGATTG*TGTCCTGGCTAGAATATGA*GTCGAGTTTCTCTAACGA
THY01_0041_D09.b : TGGTGCAGTACAAGAAGATTG*TGTCCTGGCTAGAATATGA*GTCGAGTTTCTCTAACGA
ADR01_0077_A04.b : TGGTGCAGTACAAGAAGATTG*TGTCCTGGCTAGAATATGA*GTCGAGTTTCTCTAACGA
20110601C-007463 : GGACGCACAGAAGGCACAGG*CTCTTCGGCTGGCCTCCCACCTCAACCTAGCCATGTGTT
---------+---------+---------+---------+---------+---------+ 1095
CBLT1_0059_H05.b : gcccgaagggccaggctcttcggttggctccaccttaactaaccttgttttctgaaatta
OVR01_0026_E05.b : aggaaccccaaaaaggggacagggttctttcgggtggggcctccccccccctcaccctta
OVRM1_0074_B02.b :
PBL01_0001_A09.b : aaggcaagggctctttcgggtggcttccccctccacctagccctggtgtatttgaaacac
ILNT1_0073_B12.b : gtttttcttcacgagggagttctccaaaagggggaggggcctctttgtgggggggctccc
OVR01_0075_F12.b :
OVRM1_0153_D10.b :
SPL01_0063_C11.b : ttcccggtgcccttaaaattttagaatttcgaa
OVRT1_0118_G01.b : aagggccaggccctttgggggccccccccttaacctacccggggttttctgaaaaacatc
PBL01_0071_F02.b : agaaggcacagctcttcgctggctcccactcacctagcctgtgttatcgaactacgtcct
BFLT1_0052_C03.b : gcccgaaaggccgggctctcgggtggctcccccctcacttaccggggttacggaactaaa
OVRM1_0041_F12.b :
CBLT1_0012_H07.b : aaaaggtcaggctcttgggggggcctccccttaacctttccggtgttattgaaaaaacgt
CBLT1_0097_C02.b : cccagaaggccggggttttcagcttgccccccactccacttagctgtgtgttgtggaaat
THY01_0090_A05.b : aggacccccagaagggcacaggctcctccgcctgggctccccccctcaaacttaaccctt
OVRM1_0223_D03.b :
LVRM1_0051_B09.b :
OVR01_0101_C05.b : cttcaaaaatttaaaattcggggttttcttctttaccgaggggaccccccctaaagaggc
OVR01_0021_A09.b : GGACcccccaaaggcaccagctccttcggctgggcctccccccctcaaccctacccttgg
BFLT1_0143_C02.b : ggttctgggggggcctccccccaaacgagccgggttttttagaaaaaaagcccttctggg
LVRM1_0192_F01.b :
OVRM1_0138_H12.b :
PBL01_0024_G12.b : gaagcacagctcttcgctggnnctccactcactagcatgtgtatcgaactacatcttctc
PBL01_0051_C08.b : GGACGCACAGAGGGCACAGctcttcggctgggctccnnactcanctagcatgtgtatctg
CBLT1_0049_H09.b : ggacaggctcttcggctggctccacctcaactagcaggtgttacggaactacgtccttct
KDN01_0088_A02.b : GGACGCACAGAAAGCACAGG*CTCTTCGGCTGGgcctccactcaaattagccatgtgtta
OVRM1_0071_E10.b :
LVRM1_0041_F07.b :
CBLT1_0004_D12.b : accccaataagggacaggttctttggctgggcttccacttccaactaaccctggttttac
LVRM1_0138_E07.b :
SKNB1_0046_F06.b : GGACGCCCAGAAGGCACAGGGCTCTTCGGCTGGGCTCCCACCTCCACCTAACCCTGTGTT
SMG01_0045_A04.b : cccaaagggaagggttctcggctggcctccccctcaactaacctggggtatcgaacctac
TES01_0056_G07.b : gggcaagggcctttgggtgggccccccccctaaccaaaccatgggtttttgaaaaataat
OVRM1_0187_B11.b :
UTR01_0043_A02.b : caataaaattgggaaacaaaaaaaaaaaaaaaaaaaaggcccccatggtgctcccagcct
OVRM1_0191_B10.b :
CBLT1_0002_C08.b : GGATGCACAGAAAGCACAGG*CTCTTCGGCTGGCCTCCCCACTCAACCTAACCCTGTGTT
OVRM1_0018_G10.b :
OVRM1_0105_G07.b :
OVRM1_0028_D08.b :
PTG01_0105_A05.b : gttttggtgggccccccctaaccctacctggttttctaaaataatccttttgggggcctt
LVR01_0043_C08.b : aggaacccccagaagggaccaggctctttcggctgggctccccccttcaaccttacccct
LVR01_0031_G02.b : GGACGCACAGAAGGggaccgggttcttcggcttgccctcccacctccacccaacccctgg
LVRM1_0105_A06.b :
PTG01_0108_E11.b : cccagggggcccccaaaaggggaaggggttttcggtggggtcccccccccacccaaaacg
ADR01_0007_E05.b : ttcgctgcctccccactcactagcatgtgtatctgaactacgtcttctcgctgcattgaa
PTG01_0022_C07.b : cccaaaaggcacagggtctttcggtggcctccaacctaaacttaccaggtgttatctgaa
UTR01_0047_B04.b : GGACGCACAGAAGGCACAGG*CTCTTCGGCTGGCCTCCCA*CTCCACCTACCCATGTGTT
UTR01_0075_H09.b : GGACGCACAGAAGGCACAGG*CTCTTCGGCTGGCCTCCCACCTCAACCTAGCCATGTGTT
UTR01_0069_G07.b : GGACGCACAGAAGGCACAGG*CTCTTCGGCTGGCCTCCCACCTCAACCTAGCCATGTGTT
KDN01_0089_D02.b : GGACGCACAGAAGGCACAGG*CTCTTCGGCTGGCCTCCCACCTCAACCTAGCCATGTGTT
TCH01_0044_F04.b : GGACGCACAGAAGGCACAGG*CTCTTCGGCTGGCCTCCCACCTCAACCTAGCCATGTGTT
SPL01_0055_A07.b : GGACGCACAGAAGGCACAGG*CTCTTCGGCTGGCCTCCCACCTCAACCTAGCCATGTGTT
ADR01_0097_F07.b : GGACGCACAGAAGGCACAGG*CTCTTCGGCTGGCCTCCCACCTCAACCTAGCCATGTGTT
UTR01_0016_D10.b : GGACGCACAGAAGGCACAGG*CTCTTCGGCTGGCCTCCCACCTCAACCTAGCCATGTGTT
THY01_0041_D09.b : GGACGCACAGAAGGCACAGG*CTCTTCGGCTGGCCTCCCACCTCAACCTAGCCATGTGTT
ADR01_0077_A04.b : GGACGCACAGAAGGCACAGG*CTCTTCGGCTGGCCTCCCACCTCAACCTAGCCATGTGTT
20110601C-007463 : ATCTGAAACTACAGTCCTTC*TCGGCTGCCATTGAAAACTGTAACAAGGCCCTGGAGCTG
---------+---------+---------+---------+---------+---------+ 1154
CBLT1_0059_H05.b : cgtcttttccggcggccttaaaccgtaacaggccctggacctggacacacaacagaaggg
OVR01_0026_E05.b : cccctgggttgttttttttaaaaaacaaccacgtccccttttcccggcgggggtcctttt
OVRM1_0074_B02.b :
PBL01_0001_A09.b : cgttctttccgctggccattgaaactgtacacggcccgggagctggacgcaacacgaaag
ILNT1_0073_B12.b : cccttcacaccaaaatgggttgtgttttttgaaaaaaaaaaaccctttctctgggggcgc
OVR01_0075_F12.b :
OVRM1_0153_D10.b :
SPL01_0063_C11.b :
OVRT1_0118_G01.b : ccttccggcgcccctaaaaatggtaaagggccggggtgggggaacaaaaagaaaggggtt
PBL01_0071_F02.b : ctcggtggcatgaaactgtacaagacctggactgaacgcacaccagaaggctttcccccg
BFLT1_0052_C03.b : ttcttccgggtggctttgaaatgtaacaggcctggaactgaacacaacacgaaaaggccc
OVRM1_0041_F12.b :
CBLT1_0012_H07.b : cctctccgcgggcattgaaaatttacagggccgtgagccggaacacacagagaaagggct
CBLT1_0097_C02.b : ccaatccttttgggctgcattggaacgttaacaaggcccggaagctgacgccgcacgaaa
THY01_0090_A05.b : ggtgttttcctgaaacctaccggtccctttctccggcttgcccattttaaaaactggtaa
OVRM1_0223_D03.b :
LVRM1_0051_B09.b :
OVR01_0101_C05.b : ggcagggggcttctttcgggcggggggcgtctcctcccctccaaacactaag
OVR01_0021_A09.b : ggttattctggaaacttccggtcccttttcccgggcttgcccctttgaaaa
BFLT1_0143_C02.b : ggccttttaaaatgttaaaagggctgtgggtgggaacaaacaagagaggggctttcttcc
LVRM1_0192_F01.b :
OVRM1_0138_H12.b :
PBL01_0024_G12.b : gctgcattgaactgtacaagccctgactgacgcacancaaagggctttcgtcggnaaagc
PBL01_0051_C08.b : aaactacagtccttctcgctgccatgaaanctgtacaggncctgagctggacgcacacna
CBLT1_0049_H09.b : ggctgccatgaaatggacaaggcctgaactgaaacaacaacaaaaggcttttccccggga
KDN01_0088_A02.b : tctgaaacacagtccttctcgcttgcattgaaaatggtacaaggccctggaactggacaa
OVRM1_0071_E10.b :
LVRM1_0041_F07.b :
CBLT1_0004_D12.b : ttaaaacataagtccttttctggctgcctttgaaaaactggtaaaaggcccctggaattg
LVRM1_0138_E07.b :
SKNB1_0046_F06.b : ATCTGAAAactacgtcctttccggctggcattgaaaactgaaacaggccctggacctgga
SMG01_0045_A04.b : gtccttccggtgcctttaaaatgaacagggcttggactggaaagaacaacaaaaggcttt
TES01_0056_G07.b : ctcttctggcgggcctttaaaacggtaaaaggccctggaacgggaaacaacacaaaaaag
OVRM1_0187_B11.b :
UTR01_0043_A02.b : tccaaggttccccggcggccctcttaaaatttttccccttccaaggggggccccaaaacc
OVRM1_0191_B10.b :
CBLT1_0002_C08.b : ATCTGAAACTACAGTCCTTTCTCG*CTGCCATTGAAAACTTAACCAAGGCCCTGGAacct
OVRM1_0018_G10.b :
OVRM1_0105_G07.b :
OVRM1_0028_D08.b :
PTG01_0105_A05.b : aaaaattaaaaggcctgggtggaaccaaaaagaaaggccttttcccgggaaggcccccgg
LVR01_0043_C08.b : gtttttattctgaaaacaacagtccctttctccggctggccttttaaaaacttttaacaa
LVR01_0031_G02.b : gtttatccggaacctaccagtccctttctcggcttggccttttgaaaaactggtaaaaca
LVRM1_0105_A06.b :
PTG01_0108_E11.b : gtggttttaaaaaaaaaaacccctcctccgggcccttaaaaaaaataaaaaagccgcggg
ADR01_0007_E05.b : ctgtacnaggccctgattgacgcacacgaaagggctttcgcgggnaagccactggcatga
PTG01_0022_C07.b : attaaggtctttctcggttgccatggaaactgtaaaaggccctggagctggacaccaaca
UTR01_0047_B04.b : ATCTGAAACTACCGTCCTTCTTCGGCTGCCATTGAAAACTGTAACAAagggcctggaagc
UTR01_0075_H09.b : ATCTGAAACTACAGTCCTTC*TCGGCTGCCATTGAAAACTGTAACAAGGCCCTGGAGCTG
UTR01_0069_G07.b : ATCTGAAACTACAGTCCTTC*TCGGCTGCCATTGAAAACTGTAACAAGGCCCTGGAGCTG
KDN01_0089_D02.b : ATCTGAAACTACAGTCCTTC*TCGGCTGCCATTGAAAACTGTAACAAGGCCCTGGAGCTG
TCH01_0044_F04.b : ATCTGAAACTACAGTCCTTC*TCGGCTGCCATTGAAAACTGTAACAAGGCCCTGGAGCTG
SPL01_0055_A07.b : ATCTGAAACTACAGTCCTTC*TCGGCTGCCATTGAAAACTGTAACAAGGCCCTGGAGCTG
ADR01_0097_F07.b : ATCTGAAACTACAGTCCTTC*TCGGCTGCCATTGAAAACTGTAACAAGGCCCTGGAGCTG
UTR01_0016_D10.b : ATCTGAAACTACAGTCCTTC*TCGGCTGCCATTGAAAACTGTAACAAGGCCCTGGAGCTG
THY01_0041_D09.b : ATCTGAAACTACAGTCCTTC*TCGGCTGCCATTGAAAACTGTAACAAGGCCCTGGAGCTG
ADR01_0077_A04.b : ATCTGAAACTACAGTCCTTC*TCGGCTGCCATTGAAAACTGTAACAAGGCCCTGGAGCTG
20110601C-007463 : GACAGCAACAACGAGAAGGGCCTTTTCCGCCGGGGAGAGGCCCACCTGGCAGTGAATGAC
---------+---------+---------+---------+---------+---------+ 1214
CBLT1_0059_H05.b : cctttccccgggggaagcccacgggcgtgaatgatttactggcctggctgattcaaaggg
OVR01_0026_E05.b : ttagaaaaaaactgtataaaaaaaaggggggccccccgtgggagagactggtggggaaca
OVRM1_0074_B02.b :
PBL01_0001_A09.b : aggcccctttccccggggagagccccctgcccaggaaagatttgaacttggctcgggcat
ILNT1_0073_B12.b : cttttagaaatgtttttaaaggcgcctctcttgtggttggacctaccaaatcagagagag
OVR01_0075_F12.b :
OVRM1_0153_D10.b :
SPL01_0063_C11.b :
OVRT1_0118_G01.b : ttcgcgggggagggccccccgggggggaaatattttattgtgcccggatcattaaaggag
PBL01_0071_F02.b : ggaagcccaccggcttgatgattgactgcctcagcgattccaaggtctggattcttccaa
BFLT1_0052_C03.b : ttccgcggggaggcccccggcgggaaagatttaatggccgagtgatttcaaaggttgggg
OVRM1_0041_F12.b :
CBLT1_0012_H07.b : ttcctccgaggagggccccctgcggcttaatatttacgtgtgttttgtaaatctaaaagt
CBLT1_0097_C02.b : agggcctttcgccggagaagccccccctgccgtcaagaattttagtgggcgaatgtagtc
THY01_0090_A05.b : cc
OVRM1_0223_D03.b :
LVRM1_0051_B09.b :
OVR01_0101_C05.b :
OVR01_0021_A09.b :
BFLT1_0143_C02.b : gggggaagcccccgggcgaggggtaaattatttgggccgggcgatactcaaaggggcggc
LVRM1_0192_F01.b :
OVRM1_0138_H12.b :
PBL01_0024_G12.b : cacctgcagagacttgactgctcagtgattcaaagtcggcgctttcagaaaaaccccagg
PBL01_0051_C08.b : gaaggcctttcgccggnaagcccactgcatgaagacttgactgttcggctgatcaaaagt
CBLT1_0049_H09.b : aggcccccggcaggaagatttaatggccagctaatcaaaaggtcgggctttccccaaaaa
KDN01_0088_A02.b : caacacgaaaagggctttctcgcggggaaaggcacctgncatggaagactttactgggct
OVRM1_0071_E10.b :
LVRM1_0041_F07.b :
CBLT1_0004_D12.b : ggacccctcaatacataaagggcctttttccccggggaagagagccccctgggaatgaat
LVRM1_0138_E07.b :
SKNB1_0046_F06.b : caccaacaccaaaaggccttttcccccgggaaaggcccccctgccagaaagactttgact
SMG01_0045_A04.b : tcccggggaaggcccccggaagaaaaatttaattggcgagtgattcaaaggccgggtttt
TES01_0056_G07.b : ggcttttccccccgggaaagaccccccgggggaaaaaaattttaagtggcccagagggat
OVRM1_0187_B11.b :
UTR01_0043_A02.b : cttttcccccctttcccccccacccctttttcttttttttaaccaaaaagtggggtttcc
OVRM1_0191_B10.b :
CBLT1_0002_C08.b : gaaagcaaaaacaaaaaaggcctctctccgccggggaaagcccaactgggcaatgaatga
OVRM1_0018_G10.b :
OVRM1_0105_G07.b :
OVRM1_0028_D08.b :
PTG01_0105_A05.b : agagaaaatttaattgtcgagtgatttaaagggtggggttttcccaaaaaaccccgggcc
LVR01_0043_C08.b : agggcccccggggacctggggaacagcaaaccaacccgaaaaaaagggggcccctttttt
LVR01_0031_G02.b : aggcccctgggaaacctgggaaacgccaacaacccaaaaaaagggggcccttttttcctc
LVRM1_0105_A06.b :
PTG01_0108_E11.b : tggggggaaaaaaaaaaaaaaggggttctcctcccggggaaaagccccccccggggaaaa
ADR01_0007_E05.b : gactgactgctcgacgattcaaagtctgagttttcacaaaaacccaatccatgggcttca
PTG01_0022_C07.b : caaaaaggcctttcccccgggagaagcccaccggccaagaatgattttaattggctcgat
UTR01_0047_B04.b : ctgggaagcaacaaccaaaaggggcctttttccgccgggggaaaaggcccaccctggcca
UTR01_0075_H09.b : GACAGCAACAACGAGAAGGGCCTCTTCCGCCGGGGAGAGGCCCACCTGGCAATGAATGAC
UTR01_0069_G07.b : GACAGCAACAACGAGAAGGGCCTCTTCCGCCGGGGAGAGGCCCACCTGGCAGTGAATGAC
KDN01_0089_D02.b : GACAGCAACAACGAGAAGGGCCTTTTCCGCCGGGGAGAGGCCCACCTGGCAGTGAATGAC
TCH01_0044_F04.b : GACAGCAACAACGAGAAGGGCCTTTTCCGCCGGGGAGAGGCCCACCTGGCAGTGAATGAC
SPL01_0055_A07.b : GACAGCAACAACGAGAAGGGCCTTTTCCGCCGGGGAGAGGCCCACCTGGCAGTGAATGAC
ADR01_0097_F07.b : GACAGCAACAACGAGAAGGGCCTCTTCCGCCGGGGAGAGGCCCACCTGGCAGTGAATGAC
UTR01_0016_D10.b : GACAGCAACAACGAGAAGGGCCTCTTCCGCCGGGGAGAGGCCCACCTGGCAGTGAATGAC
THY01_0041_D09.b : GACAGCAACAACGAGAAGGGCCTTTTCCGCCGGGGAGAGGCCCACCTGGCAGTGAATGAC
ADR01_0077_A04.b : GACAGCAACAACGAGAAGGGCCTTTTCCGCCGGGGAGAGGCCCACCTGGCAGTGAATGAC
20110601C-007463 : TTTGACTTGGCTCGAGCTGACTTCCAGAAGGTCCTGCAGCTCTATCCCAGCAACAAAGCC
---------+---------+---------+---------+---------+---------+ 1274
CBLT1_0059_H05.b : tttggcttttcccaacaaacccccaggcttttgcccttccccccgatataaaccttgcgg
OVR01_0026_E05.b : cagaaacaacaacaacaaca
OVRM1_0074_B02.b :
PBL01_0001_A09.b : tccaaaaggttgtcggcttttccccaccaaaaccccagggccatgtggtctctcccaccg
ILNT1_0073_B12.b : gagggtctcttttcctccggcgggaagagccgcgctctctgttgtat
OVR01_0075_F12.b :
OVRM1_0153_D10.b :
SPL01_0063_C11.b :
OVRT1_0118_G01.b : gggggcttcttttccaaaaaaacccaggcgcttttggtcctccccccgtgattaaaactt
PBL01_0071_F02.b : aaaaccccaggccattggcccttcacacgaatcctaaccttgccggaaaacttcttccat
BFLT1_0052_C03.b : tctttcccaaaaaaccccacggcccttggcctctcccacggaacttaaactttggggaga
OVRM1_0041_F12.b :
CBLT1_0012_H07.b : ttggacttactagtgaaatctccgagggcatgtaggcccccgcttaggttcatgaacctc
CBLT1_0097_C02.b : aaagggcctgagagtttaccatgaaagaccgccagcgatgtggccgttcatagaggattg
THY01_0090_A05.b :
OVRM1_0223_D03.b :
LVRM1_0051_B09.b :
OVR01_0101_C05.b :
OVR01_0021_A09.b :
BFLT1_0143_C02.b : gcttcttcactcataaccctcaagggatgtggggtctcctccccggtatattaatgttgg
LVRM1_0192_F01.b :
OVRM1_0138_H12.b :
PBL01_0024_G12.b : cattggctttcccaggatctaaacttgcggaaaaattttcactttaaggtgaaaaaaaaa
PBL01_0051_C08.b : ctgccctttccacacaacccccagccattggccttccacggatctaaacctgggggaaaa
CBLT1_0049_H09.b : ccccaggccatttggcctccccacggttcatacctttggggaaaaaacttccccttttta
KDN01_0088_A02.b : gagctaattccaaaaggctggagctctatcaaaaaaaaccccaagcccattggcctttcc
OVRM1_0071_E10.b :
LVRM1_0041_F07.b :
CBLT1_0004_D12.b : gaaatttaaattggctccgccctaattctcaaaagggttgttactttatttcctaataaa
LVRM1_0138_E07.b :
SKNB1_0046_F06.b : ggcccaactaacttccgaaggcctgccctttccc
SMG01_0045_A04.b : cccaaaaaaccccaggcctttggtcttgccacggtactaaattggcgggaaaactctccc
TES01_0056_G07.b : tctcaaagggcggggcttttttcccaaaaaaaacccccagggcctttgtgtcttctcccc
OVRM1_0187_B11.b :
UTR01_0043_A02.b : cccccttatttatgggtggggaggtttccctttaaattttttaataataaaaaccccctt
OVRM1_0191_B10.b :
CBLT1_0002_C08.b : ctttaactttggtccagctaacttcaaaggttttgcagctttatcaaaaaaaaacccccc
OVRM1_0018_G10.b :
OVRM1_0105_G07.b :
OVRM1_0028_D08.b :
PTG01_0105_A05.b : tttgccttttcccaaggttttaaacttttgggaaaaaactttcccctttttagaggcaaa
LVR01_0043_C08.b : tcccccccccgggggggaaaaaaggggccccccccccccctggggggccacggtgttaga
LVR01_0031_G02.b : ccccggggggaaaaagagggcccccccccgcggggacaagggggaaaaaaagaaactttt
LVRM1_0105_A06.b :
PTG01_0108_E11.b : aaattttattttgtcgcgccaacttccaaaaaagattggtgcttttccccaaaaaaaaac
ADR01_0007_E05.b : cacgatctaacctttggggaaaactctccattttaagtcaaaaaaaagccgtttgacccg
PTG01_0022_C07.b : tgatttcaaaaggtcggggtttttccaaaaaaaacccccaagccatttggcccttcccaa
UTR01_0047_B04.b : atgaaatgaactttttaatttgggctccgaagctta
UTR01_0075_H09.b : TTTGACTTGGCTCGAGCTGACTTCCAGAAGGTCTTTGCGCTCTATCCCAGCCACCAAACC
UTR01_0069_G07.b : TTTGACTTGGCTCGAGCTGACTTCCAGAAGGTCTTGCAGCTCTATCCCCAGCACAAAGCC
KDN01_0089_D02.b : TTTGACTTGGCTCGAGCTGACTTCCAGAAGGTCCTGCAGCTCTATCCCAGCAACAAAGCC
TCH01_0044_F04.b : TTTGACTTGGCTCGAGCTGACTTCCAGAAAGGTCTGCAGCTCTATCCCAGCAACAAAGCC
SPL01_0055_A07.b : TTTGACTTGGCTCGAGCTGACTTCCAGAAGGTCCTGCAGCTCTATCCCAGNCACAAAGCC
ADR01_0097_F07.b : TTTGACTTGGCTCGAGCTGACTTCCAGAAGGTCTTGCAGCTCTATCCCAGCAACAAAGCC
UTR01_0016_D10.b : TTTGACTTGGCTCGAGCTGACTTCCAGAAGGTCTTGCAGCTCTATCCCAGCAACAAAGCC
THY01_0041_D09.b : TTTGACTTtggctccagctgaccttcccaaaggtcctgcagctctatcccaaccacaaag
ADR01_0077_A04.b : TTTGACTTGGCTCGAGCTGACTTCCAGAAGGTCCTGCAGCTCTATCCCAGCAACAAAGCC
20110601C-007463 : GCCAAGGCCCA*GTTGGCGCTCTGCCAGCAGCGG*ATCCGTAAGCAGCTTGCGCGGGAGA
---------+---------+---------+---------+---------+---------+ 1332
CBLT1_0059_H05.b : ggaaaaacctttcccatttttagcggcaaaaggaaaagccgggttgacaccccccacaaa
OVR01_0026_E05.b :
OVRM1_0074_B02.b :
PBL01_0001_A09.b : atctctaactctttgtgggggaaaatctcttccctttttagagcgggagagc
ILNT1_0073_B12.b :
OVR01_0075_F12.b :
OVRM1_0153_D10.b :
SPL01_0063_C11.b :
OVRT1_0118_G01.b : ttgggggaaaacccttccccttgttgaagggggag
PBL01_0071_F02.b : tttaagggcaaaaagacagcccggttgcacacccccacccatagaggaaaaaagtggggg
BFLT1_0052_C03.b : aaactctccaccttttaagggggaaagaaaaaaagccggtgtgaacccccgccacaaaaa
OVRM1_0041_F12.b :
CBLT1_0012_H07.b : ttttgataaagaagctctgtattattttgggtgtcggaatgaatgagggcgttgttggac
CBLT1_0097_C02.b : atggcatctggcagggtaaatttattgcacctttatggcgttatattagtaaaatctgtg
THY01_0090_A05.b :
OVRM1_0223_D03.b :
LVRM1_0051_B09.b :
OVR01_0101_C05.b :
OVR01_0021_A09.b :
BFLT1_0143_C02.b : gggggaaaaactctctcctttttttgagtggaaaagaaaatagctgtgtttttatccctg
LVRM1_0192_F01.b :
OVRM1_0138_H12.b :
PBL01_0024_G12.b : gccgttgaaccccgcaccaaaaagga
PBL01_0051_C08.b : cttttccattttaaggtcaagagaaaagcccgtcggaccccccacaaaaaagggaaaatg
CBLT1_0049_H09.b : aggcccaaagaaaaagtgagggggggacattaaggggaaaagtttttcttttgttcctga
KDN01_0088_A02.b : aaaacgtatccaaaaacttgccggaaaaaaacttgccccattttttagctggcaaaaaaa
OVRM1_0071_E10.b :
LVRM1_0041_F07.b :
CBLT1_0004_D12.b : aaccccataggccattttgcggctcttcaatattgaaatatctatatatctt
LVRM1_0138_E07.b :
SKNB1_0046_F06.b :
SMG01_0045_A04.b : atttttaagcggaaaangaaaagcctgtgttgccacccccaaataagggaaaatgttggg
TES01_0056_G07.b : caagaactaaaaacttttgggggaaaaaatcttttccaccttttaagaggcgaaaaaaaa
OVRM1_0187_B11.b :
UTR01_0043_A02.b : ataagggg
OVRM1_0191_B10.b :
CBLT1_0002_C08.b : aaggccaattggccctttccacaccggatcctataaacttcgcggggaaaaaacctcttc
OVRM1_0018_G10.b :
OVRM1_0105_G07.b :
OVRM1_0028_D08.b :
PTG01_0105_A05.b : aaaaaaaggaggttttgacaccgaaccaatataggaaaaaaatttgggggcccccttggg
LVR01_0043_C08.b : aaaaagt
LVR01_0031_G02.b : ttttgtaaaaatattttgtgggcctttg
LVRM1_0105_A06.b :
PTG01_0108_E11.b : ccccgcgctttgttgttttcccccacaaaaaaaaataaattgttgggggagaaaaaacac
ADR01_0007_E05.b : caacaataaggaaaaaattgggcccccggggagaaaccccccccgcgcccgcccccccct
PTG01_0022_C07.b : agattattaaaactttgcgggaaaaaatcctttcaacttttaaaatggaaaaaaaaaaaa
UTR01_0047_B04.b :
UTR01_0075_H09.b : GCCAAGGCCCcagttggcgctccggccaccaccggattcctaaaccagcttggcccggga
UTR01_0069_G07.b : GCAAAGGCCCTGGTTGGCGCTCTGCCAGCAGCGGGATCCGTAAGCAGCTTGCGCGGGAGA
KDN01_0089_D02.b : GCCAAGGCCCA*GTTGGCGCTCTGCCAGCAGCGG*ATCCGTAAGCAGCTTGCGCGGGAGA
TCH01_0044_F04.b : GCCAAGGCCCA*GTTGGCGCTCTGCCAGCAGCGG*ATCCCGTAGCAGCTTGCGCGGGGAG
SPL01_0055_A07.b : GCCAAGGCCCA*GTTGGCGCTCTGCCAGCAGCGG*ATCCGTAAGCAGCTTGCGCGGGAGA
ADR01_0097_F07.b : GCCAAGGCCCA*GTTGGCGCTCTGCCAGCAGCGG*ATCCGTAAGCAGCTTTGCGCGGAGA
UTR01_0016_D10.b : GCCAAGGCCCA*GTTGGCGCTCTGCCAGCAGCGG*ATCCGTAAGCAGCTTGCGCGGGAGA
THY01_0041_D09.b : cccccaaagcccacttggcgcctctgccaccagccgatcccgaagccgcttgccccggaa
ADR01_0077_A04.b : GCCAAGGCCCA*GTTGGCGCTCTGCCAGCAGCGG*ATCCGTAAGCAGCTTGCGCGGGAGA
20110601C-007463 : AGAAGCTCTATGCCAACATGTTTGAGAGGCTGGCAGAGGAGGAGAGCAAGGCCAAGGTGT
---------+---------+---------+---------+---------+---------+ 1392
CBLT1_0059_H05.b : aagagaaaaaaagtgcgc
OVR01_0026_E05.b :
OVRM1_0074_B02.b :
PBL01_0001_A09.b :
ILNT1_0073_B12.b :
OVR01_0075_F12.b :
OVRM1_0153_D10.b :
SPL01_0063_C11.b :
OVRT1_0118_G01.b :
PBL01_0071_F02.b : cccccgggggggaaaatccccggtggggggccgccccccccggtttagaaaaggaaatct
BFLT1_0052_C03.b : gaggcaaaaaggtgggcgccccgggggagaacaccccccc
OVRM1_0041_F12.b :
CBLT1_0012_H07.b : gcgctgcttgggtcgacgaangttttgatgggtgtcagagaggtgaacaatctccgcccc
CBLT1_0097_C02.b : gtttggcagctgggttgctttgttgagtgagctaga
THY01_0090_A05.b :
OVRM1_0223_D03.b :
LVRM1_0051_B09.b :
OVR01_0101_C05.b :
OVR01_0021_A09.b :
BFLT1_0143_C02.b : ccatgaattaggaaataaatttgcgcgcctcctggtggagaaaatactcccatccgtggt
LVRM1_0192_F01.b :
OVRM1_0138_H12.b :
PBL01_0024_G12.b :
PBL01_0051_C08.b : tggggccctggggggaaaaccccccccccgcccccccccccccctttaaaaaaaaaaaaa
CBLT1_0049_H09.b : acaacttcttaaacaggtgtgccccctcaccggagaggagggtgtgggtcc
KDN01_0088_A02.b : aacagccaggttggaaccccgcccccgttagggggccaaatatgtggggccccccggggg
OVRM1_0071_E10.b :
LVRM1_0041_F07.b :
CBLT1_0004_D12.b :
LVRM1_0138_E07.b :
SKNB1_0046_F06.b :
SMG01_0045_A04.b : ggccccgggggaaaacccccccggggggggcccccccaccggttgttaaaaattaaaaaa
TES01_0056_G07.b : aaaaccccttgttgtaaaccccccccctctctatgaggggccaataaatgtggggccccc
OVRM1_0187_B11.b :
UTR01_0043_A02.b :
OVRM1_0191_B10.b :
CBLT1_0002_C08.b : ccatttttaaaggcggcaagaagaaaacagcccggtctttgaacacccgccccccaattt
OVRM1_0018_G10.b :
OVRM1_0105_G07.b :
OVRM1_0028_D08.b :
PTG01_0105_A05.b : ggaaaaaccccccgccggggggcccccccccaccccctttttagaaaattt
LVR01_0043_C08.b :
LVR01_0031_G02.b :
LVRM1_0105_A06.b :
PTG01_0108_E11.b : cccctctttttttttagggggaaaaaaaaaaaaacgtgtttttgccccccccccccaaaa
ADR01_0007_E05.b : tttgatttgaaaaaaaaaaaaaaaaaagcggccccgggccccgttgctt
PTG01_0022_C07.b : gccctgtttggaaacccccgcaccacaatagggagccaatatttgtgggggcgccctcgg
UTR01_0047_B04.b :
UTR01_0075_H09.b : aaaaaaaacctccattcccaacatgtttttaaaaaggctgggcaaaaaaagaaaaaacaa
UTR01_0069_G07.b : AGAAGCTCTATGCAAACATGTTTGAGAGGCTGGCaaaggaggaaagcaaggccaaggtgt
KDN01_0089_D02.b : AGAAGCTCTATGCCAACATGTTTGAGAGGCTGGCaaaggaagagagcaggccaaggtgtc
TCH01_0044_F04.b : AGAAGCTCTATGCCAACATGTTTGAAAGGCTGGCaaaaggagaaagcaggccaaggtgtt
SPL01_0055_A07.b : AGAAGCTCTATGCCAACATGTTTGANAGGCTGGCaaaggaaganagcaaggccaagtgtc
ADR01_0097_F07.b : AAGAGCTCTATGCCAACATGTTTGAGAAGCTGGCaaaaagagagagcaagcccaggtgtc
UTR01_0016_D10.b : AGAAGCTCTATGCCAACATGTTTGAGAGGCTGGCAGAGGAGGAGAGCAAGGCCAAGGTGT
THY01_0041_D09.b : aaaaaacctctttgccccactgtttaaaaggctgccacacggagaacaacaggcccacgg
ADR01_0077_A04.b : AGAAGCTCTATGCCAACATGTTTGAGAGGCTGGCAGAGGAGGAGAGCAAGGCCAAGGTGT
20110601C-007463 : CAGGAGACCAGCAGGCAGACACAGAGATGAAGGAGGAGCAGAAGAATGATGTGGCAGGGC
---------+---------+---------+---------+---------+---------+ 1452
CBLT1_0059_H05.b :
OVR01_0026_E05.b :
OVRM1_0074_B02.b :
PBL01_0001_A09.b :
ILNT1_0073_B12.b :
OVR01_0075_F12.b :
OVRM1_0153_D10.b :
SPL01_0063_C11.b :
OVRT1_0118_G01.b :
PBL01_0071_F02.b : tttgt
BFLT1_0052_C03.b :
OVRM1_0041_F12.b :
CBLT1_0012_H07.b : acacacgattttgtctaccttgtg
CBLT1_0097_C02.b :
THY01_0090_A05.b :
OVRM1_0223_D03.b :
LVRM1_0051_B09.b :
OVR01_0101_C05.b :
OVR01_0021_A09.b :
BFLT1_0143_C02.b : gcccctccccttccacacctgttaaa
LVRM1_0192_F01.b :
OVRM1_0138_H12.b :
PBL01_0024_G12.b :
PBL01_0051_C08.b : acccgcgccgcccccgccccccccccnnnnnnnnnnnnnnnnnggggccccgaaactgtt
CBLT1_0049_H09.b :
KDN01_0088_A02.b : ggaaaactccccccggttcct
OVRM1_0071_E10.b :
LVRM1_0041_F07.b :
CBLT1_0004_D12.b :
LVRM1_0138_E07.b :
SKNB1_0046_F06.b :
SMG01_0045_A04.b : aaaagtgggggggctccgcggccctctgcnnnncgccccctaggaagtttctttcat
TES01_0056_G07.b : ccggggaagaaaatacccccccgcccgcggggcgcgccgcgccccctaccagtg
OVRM1_0187_B11.b :
UTR01_0043_A02.b :
OVRM1_0191_B10.b :
CBLT1_0002_C08.b : aagggaaaaaaatttgtggggccccccgtggaggagaaaaaactctccccgcttgtgggg
OVRM1_0018_G10.b :
OVRM1_0105_G07.b :
OVRM1_0028_D08.b :
PTG01_0105_A05.b :
LVR01_0043_C08.b :
LVR01_0031_G02.b :
LVRM1_0105_A06.b :
PTG01_0108_E11.b : aataaaaaaaaaaaatatgt
ADR01_0007_E05.b :
PTG01_0022_C07.b : agagagaaaatctccccccggtcgggggcggccccgcacccccaccgtgtttaaaaggaa
UTR01_0047_B04.b :
UTR01_0075_H09.b : gggcccaaggggttccgggaaaacccacccgggccaaaaccccagaaaaataaaaaggaa
UTR01_0069_G07.b : caagaaacccgcaagcaaaccccaaaaatgaaggaagaaacaaaagaatggatttggcag
KDN01_0089_D02.b : aggagaccagcaggcagacacagagatgaaggaggagcaaangaatgatgtggcagggcg
TCH01_0044_F04.b : cagagaccgccgggcgacccngagatgaaggagagcaaanaatgatgtggcagggcgcca
SPL01_0055_A07.b : aggagaccagcaggcagacccngagatgaaggaggagccnaaaaatggatgtggcagggc
ADR01_0097_F07.b : aggagacccagcagcagacacagagatgaaggagagcagaagatgatgtggcaggncgcc
UTR01_0016_D10.b : CAGGAGACCAGCAGGCAGACACAGAGATGAAGGAGGAGCAGAAGAATGATGTGGCAGGGC
THY01_0041_D09.b : ggcccgggacaacccccagcatacccccagcacgaaagatgcaccaacaaaatcatttgg
ADR01_0077_A04.b : CAGGAGACCAGCAGGCAGACACAGAGATGAAGGAGGAGCAGAAGAATGATGTGGCAGGGC
20110601C-007463 : GCCAGCCTCAGGTGGAGGCGGAAGCATAGCCTCTCCCCAGCCCTGCTCCTGCAGCTGCCT
---------+---------+---------+---------+---------+---------+ 1512
CBLT1_0059_H05.b :
OVR01_0026_E05.b :
OVRM1_0074_B02.b :
PBL01_0001_A09.b :
ILNT1_0073_B12.b :
OVR01_0075_F12.b :
OVRM1_0153_D10.b :
SPL01_0063_C11.b :
OVRT1_0118_G01.b :
PBL01_0071_F02.b :
BFLT1_0052_C03.b :
OVRM1_0041_F12.b :
CBLT1_0012_H07.b :
CBLT1_0097_C02.b :
THY01_0090_A05.b :
OVRM1_0223_D03.b :
LVRM1_0051_B09.b :
OVR01_0101_C05.b :
OVR01_0021_A09.b :
BFLT1_0143_C02.b :
LVRM1_0192_F01.b :
OVRM1_0138_H12.b :
PBL01_0024_G12.b :
PBL01_0051_C08.b : atgctaccatccnnnnnnnntgnnnnnnnnnnnnnnnnnnnnnnn
CBLT1_0049_H09.b :
KDN01_0088_A02.b :
OVRM1_0071_E10.b :
LVRM1_0041_F07.b :
CBLT1_0004_D12.b :
LVRM1_0138_E07.b :
SKNB1_0046_F06.b :
SMG01_0045_A04.b :
TES01_0056_G07.b :
OVRM1_0187_B11.b :
UTR01_0043_A02.b :
OVRM1_0191_B10.b :
CBLT1_0002_C08.b : ccccccgctccacaaccccctttttttaaaaaat
OVRM1_0018_G10.b :
OVRM1_0105_G07.b :
OVRM1_0028_D08.b :
PTG01_0105_A05.b :
LVR01_0043_C08.b :
LVR01_0031_G02.b :
LVRM1_0105_A06.b :
PTG01_0108_E11.b :
ADR01_0007_E05.b :
PTG01_0022_C07.b : tagaaatattttttg
UTR01_0047_B04.b :
UTR01_0075_H09.b : gggaaacaaaaaaaaaaaatgaattgtggggggagggggggccccccccccccccctcct
UTR01_0069_G07.b : ggccccccgcctcaggttggaagccgaaagcctaacccctcccccccaacccccttgctc
KDN01_0089_D02.b : ccagcctcaggtgggaggcgaagcatagcctcttcccaggcctggttttggaactgcctg
TCH01_0044_F04.b : gctcaggtggaggcgaagctagcttctccagcctggtctgaagatgctgctccctggtcc
SPL01_0055_A07.b : cccgcctccnggtggaagccgaaagcttgnctctcccccagcctggttctggat
ADR01_0097_F07.b : agctcaggtggagcngaagcatagcctctcccagccctgctccgcagntgcctggctccc
UTR01_0016_D10.b : GCCAGCCTCAG
THY01_0041_D09.b : cccggccgcccacccctcccgtggcggcgcccacctctacctcctctcccctcccccggc
ADR01_0077_A04.b : GCCAGCCTCAGGTGGAGGCGGAAGCATAGCCTCTCCCCAGCCCTGCTCCTGCAGCTGCCT
20110601C-007463 : GCCTCCCCTGCTCCCCTACCTACTCCACCCTGTTAGTTTTGTAAAAACTGAAGAATTTTG
---------+---------+---------+---------+---------+---------+ 1572
CBLT1_0059_H05.b :
OVR01_0026_E05.b :
OVRM1_0074_B02.b :
PBL01_0001_A09.b :
ILNT1_0073_B12.b :
OVR01_0075_F12.b :
OVRM1_0153_D10.b :
SPL01_0063_C11.b :
OVRT1_0118_G01.b :
PBL01_0071_F02.b :
BFLT1_0052_C03.b :
OVRM1_0041_F12.b :
CBLT1_0012_H07.b :
CBLT1_0097_C02.b :
THY01_0090_A05.b :
OVRM1_0223_D03.b :
LVRM1_0051_B09.b :
OVR01_0101_C05.b :
OVR01_0021_A09.b :
BFLT1_0143_C02.b :
LVRM1_0192_F01.b :
OVRM1_0138_H12.b :
PBL01_0024_G12.b :
PBL01_0051_C08.b :
CBLT1_0049_H09.b :
KDN01_0088_A02.b :
OVRM1_0071_E10.b :
LVRM1_0041_F07.b :
CBLT1_0004_D12.b :
LVRM1_0138_E07.b :
SKNB1_0046_F06.b :
SMG01_0045_A04.b :
TES01_0056_G07.b :
OVRM1_0187_B11.b :
UTR01_0043_A02.b :
OVRM1_0191_B10.b :
CBLT1_0002_C08.b :
OVRM1_0018_G10.b :
OVRM1_0105_G07.b :
OVRM1_0028_D08.b :
PTG01_0105_A05.b :
LVR01_0043_C08.b :
LVR01_0031_G02.b :
LVRM1_0105_A06.b :
PTG01_0108_E11.b :
ADR01_0007_E05.b :
PTG01_0022_C07.b :
UTR01_0047_B04.b :
UTR01_0075_H09.b : cccggggtgggggagaagggggcggggagaaaaaaa
UTR01_0069_G07.b : cccggcaacccttgcccctggcccccccccctggcctcccctcacccccccttacctccc
KDN01_0089_D02.b : gctcccctggtccctaccctatccaacctgttattttgtaaaactgaagaattttgagtg
TCH01_0044_F04.b : tacctattcacctgtagttggaaactgagattttgaaaaaaaaaaaaaaaaaaagccatt
SPL01_0055_A07.b :
ADR01_0097_F07.b : tgcttcctacctactccacctgtagttttgtaaaacctgagaatttggaggaattaacct
UTR01_0016_D10.b :
THY01_0041_D09.b : ttccttctcccgtccctgcccctcccctcctcccctctccctcaccctccccctcggctt
ADR01_0077_A04.b : GCCTCCCCTGCTCCCCTACCTACTCCACCCTGTTAGTTTTGTAAAAACTGAAGAATTTTG
20110601C-007463 : AGTGAATTAGACTTTATTTTCTATCTGGTGGATGGTTGCTTTGGGGGAAGGGGGGGAGGA
---------+---------+---------+---------+---------+---------+ 1632
CBLT1_0059_H05.b :
OVR01_0026_E05.b :
OVRM1_0074_B02.b :
PBL01_0001_A09.b :
ILNT1_0073_B12.b :
OVR01_0075_F12.b :
OVRM1_0153_D10.b :
SPL01_0063_C11.b :
OVRT1_0118_G01.b :
PBL01_0071_F02.b :
BFLT1_0052_C03.b :
OVRM1_0041_F12.b :
CBLT1_0012_H07.b :
CBLT1_0097_C02.b :
THY01_0090_A05.b :
OVRM1_0223_D03.b :
LVRM1_0051_B09.b :
OVR01_0101_C05.b :
OVR01_0021_A09.b :
BFLT1_0143_C02.b :
LVRM1_0192_F01.b :
OVRM1_0138_H12.b :
PBL01_0024_G12.b :
PBL01_0051_C08.b :
CBLT1_0049_H09.b :
KDN01_0088_A02.b :
OVRM1_0071_E10.b :
LVRM1_0041_F07.b :
CBLT1_0004_D12.b :
LVRM1_0138_E07.b :
SKNB1_0046_F06.b :
SMG01_0045_A04.b :
TES01_0056_G07.b :
OVRM1_0187_B11.b :
UTR01_0043_A02.b :
OVRM1_0191_B10.b :
CBLT1_0002_C08.b :
OVRM1_0018_G10.b :
OVRM1_0105_G07.b :
OVRM1_0028_D08.b :
PTG01_0105_A05.b :
LVR01_0043_C08.b :
LVR01_0031_G02.b :
LVRM1_0105_A06.b :
PTG01_0108_E11.b :
ADR01_0007_E05.b :
PTG01_0022_C07.b :
UTR01_0047_B04.b :
UTR01_0075_H09.b :
UTR01_0069_G07.b : cccccccccggtggtttaaaatttttttttggttaaaaaaaaa
KDN01_0089_D02.b : atttaacctttattttcatcggttgaagggggctttggggaaagggggggagaacaacct
TCH01_0044_F04.b : ggtcaactcagtcggcctctaaattcccgagggccagtacgtacccttttgtaaggccca
SPL01_0055_A07.b :
ADR01_0097_F07.b : aattttcatccgtgaaaggggcttttggggaaggggggaaaaccgctgggattaaaaggg
UTR01_0016_D10.b :
THY01_0041_D09.b : ttttttatctaaactcgttctaattttctcacgacaacttaccccccttctcttctccct
ADR01_0077_A04.b : AGTGAATTAGACTTTATTTTCTATCTGGTGGATGGTTGCTTTGGGGGAAGGGGGGGAGGA
20110601C-007463 : GCAGGCTGGGGATTGAGTGGGGGGGGTGGTCTTTTCAGGTGTGGCACCCCCTCTTCCTTC
---------+---------+---------+---------+---------+---------+ 1692
CBLT1_0059_H05.b :
OVR01_0026_E05.b :
OVRM1_0074_B02.b :
PBL01_0001_A09.b :
ILNT1_0073_B12.b :
OVR01_0075_F12.b :
OVRM1_0153_D10.b :
SPL01_0063_C11.b :
OVRT1_0118_G01.b :
PBL01_0071_F02.b :
BFLT1_0052_C03.b :
OVRM1_0041_F12.b :
CBLT1_0012_H07.b :
CBLT1_0097_C02.b :
THY01_0090_A05.b :
OVRM1_0223_D03.b :
LVRM1_0051_B09.b :
OVR01_0101_C05.b :
OVR01_0021_A09.b :
BFLT1_0143_C02.b :
LVRM1_0192_F01.b :
OVRM1_0138_H12.b :
PBL01_0024_G12.b :
PBL01_0051_C08.b :
CBLT1_0049_H09.b :
KDN01_0088_A02.b :
OVRM1_0071_E10.b :
LVRM1_0041_F07.b :
CBLT1_0004_D12.b :
LVRM1_0138_E07.b :
SKNB1_0046_F06.b :
SMG01_0045_A04.b :
TES01_0056_G07.b :
OVRM1_0187_B11.b :
UTR01_0043_A02.b :
OVRM1_0191_B10.b :
CBLT1_0002_C08.b :
OVRM1_0018_G10.b :
OVRM1_0105_G07.b :
OVRM1_0028_D08.b :
PTG01_0105_A05.b :
LVR01_0043_C08.b :
LVR01_0031_G02.b :
LVRM1_0105_A06.b :
PTG01_0108_E11.b :
ADR01_0007_E05.b :
PTG01_0022_C07.b :
UTR01_0047_B04.b :
UTR01_0075_H09.b :
UTR01_0069_G07.b :
KDN01_0089_D02.b : gggnaattaatgggggggggatttatctggt
TCH01_0044_F04.b : taggacta
SPL01_0055_A07.b :
ADR01_0097_F07.b : gggggggtttttctgggggggcccccccttcccttccccttttcccccccacaaaaggga
UTR01_0016_D10.b :
THY01_0041_D09.b : tatttcgccttcaatcgcccgcctctttgggggccaaaggggcggtcaccactcccttcc
ADR01_0077_A04.b : GCAGGCTGGGGATTGAGTGGGGGGGGTGGTCTTTTCAGGTGTGGCACCCCCTCTTCCTTC
20110601C-007463 : CCCCTTTAACGCAACTCATCAAAAGGTAATTATTTG........................
---------+---------+---------+---------+---------+---------+ 1728
CBLT1_0059_H05.b :
OVR01_0026_E05.b :
OVRM1_0074_B02.b :
PBL01_0001_A09.b :
ILNT1_0073_B12.b :
OVR01_0075_F12.b :
OVRM1_0153_D10.b :
SPL01_0063_C11.b :
OVRT1_0118_G01.b :
PBL01_0071_F02.b :
BFLT1_0052_C03.b :
OVRM1_0041_F12.b :
CBLT1_0012_H07.b :
CBLT1_0097_C02.b :
THY01_0090_A05.b :
OVRM1_0223_D03.b :
LVRM1_0051_B09.b :
OVR01_0101_C05.b :
OVR01_0021_A09.b :
BFLT1_0143_C02.b :
LVRM1_0192_F01.b :
OVRM1_0138_H12.b :
PBL01_0024_G12.b :
PBL01_0051_C08.b :
CBLT1_0049_H09.b :
KDN01_0088_A02.b :
OVRM1_0071_E10.b :
LVRM1_0041_F07.b :
CBLT1_0004_D12.b :
LVRM1_0138_E07.b :
SKNB1_0046_F06.b :
SMG01_0045_A04.b :
TES01_0056_G07.b :
OVRM1_0187_B11.b :
UTR01_0043_A02.b :
OVRM1_0191_B10.b :
CBLT1_0002_C08.b :
OVRM1_0018_G10.b :
OVRM1_0105_G07.b :
OVRM1_0028_D08.b :
PTG01_0105_A05.b :
LVR01_0043_C08.b :
LVR01_0031_G02.b :
LVRM1_0105_A06.b :
PTG01_0108_E11.b :
ADR01_0007_E05.b :
PTG01_0022_C07.b :
UTR01_0047_B04.b :
UTR01_0075_H09.b :
UTR01_0069_G07.b :
KDN01_0089_D02.b :
TCH01_0044_F04.b :
SPL01_0055_A07.b :
ADR01_0097_F07.b : attttttcctccccgtggttgcccccttaaaaaaaaaggccaagtgggggtatattctat
UTR01_0016_D10.b :
THY01_0041_D09.b : tccccaactccataccgtgcctnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ADR01_0077_A04.b : CCCCTTTAACGCAACTCATCAAAAGGTAATTATTTGctcccccgtttgttagtccatttt
20110601C-007463 : ............................................................
---------+---------+---------+---------+---------+---------+ 1728
CBLT1_0059_H05.b :
OVR01_0026_E05.b :
OVRM1_0074_B02.b :
PBL01_0001_A09.b :
ILNT1_0073_B12.b :
OVR01_0075_F12.b :
OVRM1_0153_D10.b :
SPL01_0063_C11.b :
OVRT1_0118_G01.b :
PBL01_0071_F02.b :
BFLT1_0052_C03.b :
OVRM1_0041_F12.b :
CBLT1_0012_H07.b :
CBLT1_0097_C02.b :
THY01_0090_A05.b :
OVRM1_0223_D03.b :
LVRM1_0051_B09.b :
OVR01_0101_C05.b :
OVR01_0021_A09.b :
BFLT1_0143_C02.b :
LVRM1_0192_F01.b :
OVRM1_0138_H12.b :
PBL01_0024_G12.b :
PBL01_0051_C08.b :
CBLT1_0049_H09.b :
KDN01_0088_A02.b :
OVRM1_0071_E10.b :
LVRM1_0041_F07.b :
CBLT1_0004_D12.b :
LVRM1_0138_E07.b :
SKNB1_0046_F06.b :
SMG01_0045_A04.b :
TES01_0056_G07.b :
OVRM1_0187_B11.b :
UTR01_0043_A02.b :
OVRM1_0191_B10.b :
CBLT1_0002_C08.b :
OVRM1_0018_G10.b :
OVRM1_0105_G07.b :
OVRM1_0028_D08.b :
PTG01_0105_A05.b :
LVR01_0043_C08.b :
LVR01_0031_G02.b :
LVRM1_0105_A06.b :
PTG01_0108_E11.b :
ADR01_0007_E05.b :
PTG01_0022_C07.b :
UTR01_0047_B04.b :
UTR01_0075_H09.b :
UTR01_0069_G07.b :
KDN01_0089_D02.b :
TCH01_0044_F04.b :
SPL01_0055_A07.b :
ADR01_0097_F07.b : ttaaacacggg
UTR01_0016_D10.b :
THY01_0041_D09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ADR01_0077_A04.b : gaaaggtaaaggggcagtggtaggaagtagggctaaattaaacaggttgaaaggaaaccc
20110601C-007463 : ............................................................
---------+---------+---------+---------+---------+---------+ 1728
CBLT1_0059_H05.b :
OVR01_0026_E05.b :
OVRM1_0074_B02.b :
PBL01_0001_A09.b :
ILNT1_0073_B12.b :
OVR01_0075_F12.b :
OVRM1_0153_D10.b :
SPL01_0063_C11.b :
OVRT1_0118_G01.b :
PBL01_0071_F02.b :
BFLT1_0052_C03.b :
OVRM1_0041_F12.b :
CBLT1_0012_H07.b :
CBLT1_0097_C02.b :
THY01_0090_A05.b :
OVRM1_0223_D03.b :
LVRM1_0051_B09.b :
OVR01_0101_C05.b :
OVR01_0021_A09.b :
BFLT1_0143_C02.b :
LVRM1_0192_F01.b :
OVRM1_0138_H12.b :
PBL01_0024_G12.b :
PBL01_0051_C08.b :
CBLT1_0049_H09.b :
KDN01_0088_A02.b :
OVRM1_0071_E10.b :
LVRM1_0041_F07.b :
CBLT1_0004_D12.b :
LVRM1_0138_E07.b :
SKNB1_0046_F06.b :
SMG01_0045_A04.b :
TES01_0056_G07.b :
OVRM1_0187_B11.b :
UTR01_0043_A02.b :
OVRM1_0191_B10.b :
CBLT1_0002_C08.b :
OVRM1_0018_G10.b :
OVRM1_0105_G07.b :
OVRM1_0028_D08.b :
PTG01_0105_A05.b :
LVR01_0043_C08.b :
LVR01_0031_G02.b :
LVRM1_0105_A06.b :
PTG01_0108_E11.b :
ADR01_0007_E05.b :
PTG01_0022_C07.b :
UTR01_0047_B04.b :
UTR01_0075_H09.b :
UTR01_0069_G07.b :
KDN01_0089_D02.b :
TCH01_0044_F04.b :
SPL01_0055_A07.b :
ADR01_0097_F07.b :
UTR01_0016_D10.b :
THY01_0041_D09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ADR01_0077_A04.b : tggggaccccttcttacctttcctttcccggggggcagggcaggggaaaacagggggggc
20110601C-007463 : ............................................................
---------+---------+---------+---------+---------+---------+ 1728
CBLT1_0059_H05.b :
OVR01_0026_E05.b :
OVRM1_0074_B02.b :
PBL01_0001_A09.b :
ILNT1_0073_B12.b :
OVR01_0075_F12.b :
OVRM1_0153_D10.b :
SPL01_0063_C11.b :
OVRT1_0118_G01.b :
PBL01_0071_F02.b :
BFLT1_0052_C03.b :
OVRM1_0041_F12.b :
CBLT1_0012_H07.b :
CBLT1_0097_C02.b :
THY01_0090_A05.b :
OVRM1_0223_D03.b :
LVRM1_0051_B09.b :
OVR01_0101_C05.b :
OVR01_0021_A09.b :
BFLT1_0143_C02.b :
LVRM1_0192_F01.b :
OVRM1_0138_H12.b :
PBL01_0024_G12.b :
PBL01_0051_C08.b :
CBLT1_0049_H09.b :
KDN01_0088_A02.b :
OVRM1_0071_E10.b :
LVRM1_0041_F07.b :
CBLT1_0004_D12.b :
LVRM1_0138_E07.b :
SKNB1_0046_F06.b :
SMG01_0045_A04.b :
TES01_0056_G07.b :
OVRM1_0187_B11.b :
UTR01_0043_A02.b :
OVRM1_0191_B10.b :
CBLT1_0002_C08.b :
OVRM1_0018_G10.b :
OVRM1_0105_G07.b :
OVRM1_0028_D08.b :
PTG01_0105_A05.b :
LVR01_0043_C08.b :
LVR01_0031_G02.b :
LVRM1_0105_A06.b :
PTG01_0108_E11.b :
ADR01_0007_E05.b :
PTG01_0022_C07.b :
UTR01_0047_B04.b :
UTR01_0075_H09.b :
UTR01_0069_G07.b :
KDN01_0089_D02.b :
TCH01_0044_F04.b :
SPL01_0055_A07.b :
ADR01_0097_F07.b :
UTR01_0016_D10.b :
THY01_0041_D09.b : nnnnnnn
ADR01_0077_A04.b : gttccttctgttcttctcaccaggggtggtaatgtccctgggtagggaacccgggacccc
20110601C-007463 : ............................................................
---------+---------+---------+---------+---------+---------+ 1728
CBLT1_0059_H05.b :
OVR01_0026_E05.b :
OVRM1_0074_B02.b :
PBL01_0001_A09.b :
ILNT1_0073_B12.b :
OVR01_0075_F12.b :
OVRM1_0153_D10.b :
SPL01_0063_C11.b :
OVRT1_0118_G01.b :
PBL01_0071_F02.b :
BFLT1_0052_C03.b :
OVRM1_0041_F12.b :
CBLT1_0012_H07.b :
CBLT1_0097_C02.b :
THY01_0090_A05.b :
OVRM1_0223_D03.b :
LVRM1_0051_B09.b :
OVR01_0101_C05.b :
OVR01_0021_A09.b :
BFLT1_0143_C02.b :
LVRM1_0192_F01.b :
OVRM1_0138_H12.b :
PBL01_0024_G12.b :
PBL01_0051_C08.b :
CBLT1_0049_H09.b :
KDN01_0088_A02.b :
OVRM1_0071_E10.b :
LVRM1_0041_F07.b :
CBLT1_0004_D12.b :
LVRM1_0138_E07.b :
SKNB1_0046_F06.b :
SMG01_0045_A04.b :
TES01_0056_G07.b :
OVRM1_0187_B11.b :
UTR01_0043_A02.b :
OVRM1_0191_B10.b :
CBLT1_0002_C08.b :
OVRM1_0018_G10.b :
OVRM1_0105_G07.b :
OVRM1_0028_D08.b :
PTG01_0105_A05.b :
LVR01_0043_C08.b :
LVR01_0031_G02.b :
LVRM1_0105_A06.b :
PTG01_0108_E11.b :
ADR01_0007_E05.b :
PTG01_0022_C07.b :
UTR01_0047_B04.b :
UTR01_0075_H09.b :
UTR01_0069_G07.b :
KDN01_0089_D02.b :
TCH01_0044_F04.b :
SPL01_0055_A07.b :
ADR01_0097_F07.b :
UTR01_0016_D10.b :
THY01_0041_D09.b :
ADR01_0077_A04.b : tccaatccccctttttcctttggggggtttcccccccccttttcctgtaagagacgcccc
20110601C-007463 : ............................................................
---------+---------+---------+---------+---------+---------+ 1728
CBLT1_0059_H05.b :
OVR01_0026_E05.b :
OVRM1_0074_B02.b :
PBL01_0001_A09.b :
ILNT1_0073_B12.b :
OVR01_0075_F12.b :
OVRM1_0153_D10.b :
SPL01_0063_C11.b :
OVRT1_0118_G01.b :
PBL01_0071_F02.b :
BFLT1_0052_C03.b :
OVRM1_0041_F12.b :
CBLT1_0012_H07.b :
CBLT1_0097_C02.b :
THY01_0090_A05.b :
OVRM1_0223_D03.b :
LVRM1_0051_B09.b :
OVR01_0101_C05.b :
OVR01_0021_A09.b :
BFLT1_0143_C02.b :
LVRM1_0192_F01.b :
OVRM1_0138_H12.b :
PBL01_0024_G12.b :
PBL01_0051_C08.b :
CBLT1_0049_H09.b :
KDN01_0088_A02.b :
OVRM1_0071_E10.b :
LVRM1_0041_F07.b :
CBLT1_0004_D12.b :
LVRM1_0138_E07.b :
SKNB1_0046_F06.b :
SMG01_0045_A04.b :
TES01_0056_G07.b :
OVRM1_0187_B11.b :
UTR01_0043_A02.b :
OVRM1_0191_B10.b :
CBLT1_0002_C08.b :
OVRM1_0018_G10.b :
OVRM1_0105_G07.b :
OVRM1_0028_D08.b :
PTG01_0105_A05.b :
LVR01_0043_C08.b :
LVR01_0031_G02.b :
LVRM1_0105_A06.b :
PTG01_0108_E11.b :
ADR01_0007_E05.b :
PTG01_0022_C07.b :
UTR01_0047_B04.b :
UTR01_0075_H09.b :
UTR01_0069_G07.b :
KDN01_0089_D02.b :
TCH01_0044_F04.b :
SPL01_0055_A07.b :
ADR01_0097_F07.b :
UTR01_0016_D10.b :
THY01_0041_D09.b :
ADR01_0077_A04.b : atttg