[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-007465

Length: 1,492

Sequence [FASTA format sequence]
CGTCCCCCGA AAACCTCTGC TCCGCACTCG CCCCGGCGCC GGCGGAGGTA GAAGAGCGCC
ACGCGCACGC TCCGCCCACA TCGCCGACCC TCCCCGGGCC CTGCCGGATG TCCGCTTCTC
GCTGCTCGCA GTCGGAGGAC ATGGCGAACC AGGTCATCAA GTGCAAGGCT GCGGTTGCCT
GGGAGGCTGG AAAGCCTCTC TCCATAGAGG AGATAGAGGT GGCACCCCCA AAGGCTCATG
AAGTTCGAAT TAAGATTATT GCCACTGCAG TTTGCCACAC TGATGCCTAT ACCCTGAGTG
GGGCTGATCC TGAAGGGAGT TTTCCAGTGA TCCTGGGACA CGAAGGTGCT GGAATTGTGG
AAAGTGTTGG TGAAGGAGTT ACTAAGCTTA AGGCAGGTGA TACTGTCATC CCACTTTACA
TCCCACAGTG TGGAGAATGC AAATTTTGTC TAAATCCTAA AACAAACCTT TGCCAGAAAA
TAAGAGTCAC TCAAGGGAAA GGCTTAATGC CAGATGGCAC TAGCAGATTT ACTTGTAAAG
GAAAGACAAT TTTACATTAC ATGGGAACCA GTACCTTTTC TGAATACACA GTTGTGGCTG
ACATCTCTGT TGCTAAAATT GATCCTTTGG CCCCTTTGGA TAAAGTCTGC CTTCTGGGTT
GTGGCGTTTC AACTGGTTAT GGTGCGGCTG TGAACACTGC CAAGGTGGAG CCTGGCTCTA
CTTGTGCTGT CTTTGGCCTG GGAGGAGTTG GATTGGCAGT TATCATGGGC TGTAAGGTGG
CTGGTGCATC CCGGATCATT GGTGTGGACA TCAATAAAGA TAAATTCGCA AGGGCCAAGG
AGTTTGGAGC TTCTGAATGT ATTAACCCCC AGGATTTCAG TAAACCTATC CAGGAAGTGC
TCATTGAGAT GACTGATGGG GGAGTGGACT ATTCCTTTGA GTGTATTGGT AACGTGAAAG
TCATGAGAGC AGCGCTGGAG GCCTGCCACA AAGGCTGGGG TGTCAGCGTG GTGGTTGGAG
TAGCTGCTTC GGGCGAAGAA ATCGCCACTC GTCCATTCCA GCTGGTCACA GGCCGCACAT
GGAAAGGCAC TGCGTTTGGA GGATGGAAGA GTGTAGAAAG CATCCCAAAG TTGGTGTCAG
AATACATGTC CAAAAAAATA AAGGTTGATG AATTTGTGAC TCACAATCTG CCTTTTGACC
AAATAAACGA AGCCTTTGAA CTGATGCATG CAGGGAAAAG CATCCGAACA GTCATAAAGC
TTTAAATTCA AAAAGAGAAA AATTTGTCCC TCCTTGCACC CAAGTCTTGT GGTCTGATTG
GAGCAGCCAG ACAAGCAGGG AGGAGCTCTT TCAAGTTCAC AGCTTCCTTA GACCTTCATT
AACCTACTCT AGGGAATAAC GTTTTCTGGA TAAATCACAA GTCTCTAATC AAGGACAAGA
CTCGTACTGT CATAAGTCTG TTTTCTGGAC TCTTCTTCAC ATAAATCGTG CT


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinADH5alcohol dehydrogenase class-3 [Homo sapiens]. 6870.0O
Contig/Assembly ProteinADH1Balcohol dehydrogenase 1B [Homo sapiens]. 462e-130O
Contig/Assembly ProteinADH1Aalcohol dehydrogenase 1A [Homo sapiens]. 458e-129O
Contig/Assembly ProteinADH4alcohol dehydrogenase 4 [Homo sapiens]. 456e-128O
Contig/Assembly ProteinADH1Calcohol dehydrogenase 1C [Homo sapiens]. 452e-127O
Contig/Assembly ProteinADH7alcohol dehydrogenase class 4 mu/sigma chain isoform 2 [Homo sapiens]. 427e-119O
Contig/Assembly ProteinADH6alcohol dehydrogenase 6 isoform 1 [Homo sapiens]. 426e-119O
Contig/Assembly ProteinADH7alcohol dehydrogenase class 4 mu/sigma chain isoform 1 [Homo sapiens]. 426e-119O
Contig/Assembly ProteinADH6alcohol dehydrogenase 6 isoform 2 [Homo sapiens]. 421e-117O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinAdh5alcohol dehydrogenase class-3 [Mus musculus]. 6650.0O
Contig/Assembly ProteinAdh1alcohol dehydrogenase 1 [Mus musculus]. 454e-128O
Contig/Assembly ProteinAdh7alcohol dehydrogenase class 4 mu/sigma chain [Mus musculus]. 435e-122O
Contig/Assembly ProteinAdh4alcohol dehydrogenase 4 [Mus musculus]. 408e-114O
Contig/Assembly ProteinAdh6bPREDICTED: alcohol dehydrogenase 1 [Mus musculus]. 397e-110O
Contig/Assembly ProteinAdh6aalcohol dehydrogenase 6A (class V) [Mus musculus]. 380e-105O
Contig/Assembly ProteinSordsorbitol dehydrogenase [Mus musculus]. 66.65e-11O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC474946PREDICTED: similar to Alcohol dehydrogenase class III chi chain (Glutathione-dependent formaldehyde dehydrogenase) (FDH) isoform 1 [Canis familiaris]. 6890.0O
Contig/Assembly ProteinLOC609781PREDICTED: similar to Alcohol dehydrogenase class III chi chain (Glutathione-dependent formaldehyde dehydrogenase) (FDH) [Canis familiaris]. 6840.0
Contig/Assembly ProteinLOC474946PREDICTED: similar to Alcohol dehydrogenase class III chi chain (Glutathione-dependent formaldehyde dehydrogenase) (FDH) isoform 3 [Canis familiaris]. 606e-173O
Contig/Assembly ProteinLOC478487PREDICTED: similar to Alcohol dehydrogenase class II pi chain precursor isoform 2 [Canis familiaris]. 470e-132O
Contig/Assembly ProteinLOC478487PREDICTED: similar to Alcohol dehydrogenase class II pi chain precursor isoform 4 [Canis familiaris]. 469e-132O
Contig/Assembly ProteinLOC478487PREDICTED: similar to Alcohol dehydrogenase class II pi chain precursor isoform 3 [Canis familiaris]. 447e-125O
Contig/Assembly ProteinLOC478489PREDICTED: similar to Alcohol dehydrogenase gamma chain [Canis familiaris]. 445e-125O
Contig/Assembly ProteinLOC474946PREDICTED: similar to Alcohol dehydrogenase class III chi chain (Glutathione-dependent formaldehyde dehydrogenase) (FDH) isoform 2 [Canis familiaris]. 442e-124O
Contig/Assembly ProteinLOC478488PREDICTED: similar to Alcohol dehydrogenase 6 [Canis familiaris]. 388e-108
Contig/Assembly ProteinLOC487535PREDICTED: similar to Sorbitol dehydrogenase (L-iditol 2-dehydrogenase) [Canis familiaris]. 67.43e-11O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinADH5alcohol dehydrogenase class-3 [Bos taurus]. 6910.0O
Contig/Assembly ProteinADH4alcohol dehydrogenase 4 [Bos taurus]. 458e-129O
Contig/Assembly ProteinADH1Calcohol dehydrogenase 1C (class I), gamma polypeptide [Bos taurus]. 445e-125O
Contig/Assembly ProteinADH6alcohol dehydrogenase 6 [Bos taurus]. 408e-114O
Contig/Assembly ProteinADH6class V alcohol dehydrogenase [Bos taurus]. 389e-108O
Contig/Assembly ProteinSORDsorbitol dehydrogenase [Bos taurus]. 73.26e-13O
Contig/Assembly ProteinLOC100299281PREDICTED: crystallin, zeta-like [Bos taurus]. 52.41e-06


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100513555PREDICTED: alcohol dehydrogenase class-3-like [Sus scrofa]. 7250.0O
Contig/Assembly ProteinADH4PREDICTED: alcohol dehydrogenase 4 [Sus scrofa]. 461e-130O
Contig/Assembly ProteinADH1Calcohol dehydrogenase 1C (class I), gamma polypeptide [Sus scrofa]. 448e-126O
Contig/Assembly ProteinLOC100512795PREDICTED: alcohol dehydrogenase class 4 mu/sigma chain-like [Sus scrofa]. 423e-118
Contig/Assembly ProteinSORDPREDICTED: sorbitol dehydrogenase [Sus scrofa]. 73.24e-13O


Assembly Members: 61      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
AMP010070F01AMP01_0070_F01.bBW960109 
BFLT10046E01BFLT1_0046_E01.bFS643607 AK390254
BFLT10047E05BFLT1_0047_E05.bFS643697 
BKFL10040F03BKFL1_0040_F03.bFS650839 
BKFL10055A11BKFL1_0055_A11.bFS652127 
BKFL10086G12BKFL1_0086_G12.bFS654057 
CBLT10056G07CBLT1_0056_G07.bHX215651 
CBLT10063B06CBLT1_0063_B06.bHX216121 
CLNT10027B09CLNT1_0027_B09.bFS659158 
CLNT10032D06CLNT1_0032_D06.bFS659560 
CLNT10042C06CLNT1_0042_C06.bFS660347 
CLNT10058H07CLNT1_0058_H07.bFS661670 
CLNT10065A09CLNT1_0065_A09.bFS662145 
CLNT10087B04CLNT1_0087_B04.bFS663306 
CLNT10131E07CLNT1_0131_E07.bHX221538 
DCI010010B09DCI01_0010_B09.bDB791177 
DCI010091H07DCI01_0091_H07.bDB797687 
DCI010100D02DCI01_0100_D02.bDB798443 
ILNT10050F07ILNT1_0050_F07.bHX230694 
ITT010065G01ITT01_0065_G01.bBW981807 
KDN010061A03KDN01_0061_A03.bFS675252 
KDN010088H03KDN01_0088_H03.bFS677457 
LNG010027C12LNG01_0027_C12.bBP435887 
LVR010100D07LVR01_0100_D07.bBP444184 
LVRM10006E05LVRM1_0006_E05.bBP139517 
LVRM10028H05LVRM1_0028_H05.bBP140920 
LVRM10096G07LVRM1_0096_G07.bCJ003712 
LVRM10116G02LVRM1_0116_G02.bBP453068 
OVR010026D07OVR01_0026_D07.bBP142830 
OVR010034D02OVR01_0034_D02.bBP142649 
OVR010063C06OVR01_0063_C06.bBW965214 
OVR010079D05OVR01_0079_D05.bBW966607 
OVR010091C08OVR01_0091_C08.bBW967449 
OVRM10010B12OVRM1_0010_B12.bBP147306 
OVRM10024E03OVRM1_0024_E03.bBP458615 
OVRM10060C09OVRM1_0060_C09.bBP148244 AK235233
OVRM10074B12OVRM1_0074_B12.bBP147351 
OVRM10095E03OVRM1_0095_E03.bBP150174 
OVRM10140F08OVRM1_0140_F08.bBP151963 
OVRM10223B07OVRM1_0223_B07.bBP456135 
OVRT10020F01OVRT1_0020_F01.bFS688045 
OVRT10057C09OVRT1_0057_C09.bFS691045 
OVRT10086B06OVRT1_0086_B06.bFS693390 
OVRT10122G05OVRT1_0122_G05.bHX236617 
PBL010077C06PBL01_0077_C06.bBW972989 
PCT010016D05PCT01_0016_D05.b  
PST010024C04PST01_0024_C04.b  
PTG010110A11PTG01_0110_A11.bFS713281 
SMG010027D02SMG01_0027_D02.bFS715635 
SPL010001B03SPL01_0001_B03.bBP157046 
SPL010065E11SPL01_0065_E11.bCJ018885 
SPLT10006F07SPLT1_0006_F07.bHX239693 
SPLT10016E08SPLT1_0016_E08.bHX240439 
TCH010089A12TCH01_0089_A12.bCJ028897 
TES010099B07TES01_0099_B07.bCJ036461 
THY010001G02THY01_0001_G02.bBP166930 
THY010089C08THY01_0089_C08.bBP162622 
THY010106A05THY01_0106_A05.bBP159849 
THY010120F06THY01_0120_F06.bBP166204 
UTR010052H02UTR01_0052_H02.bBP464718 
UTR010106E12UTR01_0106_E12.bCJ039709 

  

SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
71C140.385W-
T800.615
134C470.440WSTCC/S
G1400.560TCG/S
518C4140.833OSGGC/G
T630.167GGT/G


Alignment:      TOP

20110601C-007465 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
BFLT1_0046_E01.b : gaattggtatagctgtcgxxxxxxxxxxxxxxxx
OVRM1_0074_B12.b : c
PTG01_0110_A11.b : nnn
OVRT1_0020_F01.b : tttttcctatagcgnac
BFLT1_0047_E05.b : ngaatccgttc
OVRM1_0060_C09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRM1_0095_E03.b :
LVRM1_0028_H05.b :
OVR01_0034_D02.b : aggatttxxxxxxxxxxxxxxx
SPL01_0065_E11.b : ttttggcattggactt
KDN01_0061_A03.b :
OVR01_0026_D07.b : cgggccxxxxxxxxxxxxxx
KDN01_0088_H03.b :
OVR01_0063_C06.b :
SMG01_0027_D02.b :
OVRM1_0223_B07.b :
OVRM1_0010_B12.b :
OVR01_0079_D05.b :
OVR01_0091_C08.b :
LVRM1_0096_G07.b :
CBLT1_0056_G07.b :
CBLT1_0063_B06.b :
THY01_0001_G02.b :
OVRT1_0057_C09.b :
LVR01_0100_D07.b :
PCT01_0016_D05.b :
DCI01_0010_B09.b : nnnnnnnnnnnnnn
CLNT1_0032_D06.b :
CLNT1_0042_C06.b :
THY01_0120_F06.b :
THY01_0106_A05.b :
CLNT1_0027_B09.b :
ITT01_0065_G01.b :
TES01_0099_B07.b :
CLNT1_0087_B04.b :
OVRT1_0122_G05.b :
TCH01_0089_A12.b :
CLNT1_0058_H07.b :
CLNT1_0065_A09.b :
AMP01_0070_F01.b : aa
OVRM1_0140_F08.b :
SPLT1_0016_E08.b :
CLNT1_0131_E07.b :
SPLT1_0006_F07.b :
OVRM1_0024_E03.b :
OVRT1_0086_B06.b :
THY01_0089_C08.b :
ILNT1_0050_F07.b :
LNG01_0027_C12.b :
BKFL1_0086_G12.b : nn
BKFL1_0055_A11.b : nn
DCI01_0100_D02.b :
BKFL1_0040_F03.b :
DCI01_0091_H07.b :
PST01_0024_C04.b :
LVRM1_0116_G02.b :
LVRM1_0006_E05.b :
PBL01_0077_C06.b :
SPL01_0001_B03.b :
UTR01_0106_E12.b :
UTR01_0052_H02.b :
20110601C-007465 : .......................................CGTCCCCCGAAAACCTCTGCT
---------+---------+---------+---------+---------+---------+ 21
BFLT1_0046_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGTCCCCCGAAAACCTCTGCT
OVRM1_0074_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PTG01_0110_A11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxx
OVRT1_0020_F01.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctgct
BFLT1_0047_E05.b : tgcgntcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0060_C09.b : nnacattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0095_E03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0028_H05.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0034_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0065_E11.b : nacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0061_A03.b : tagcgttgg
OVR01_0026_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0088_H03.b : nnntttgctgcggttg
OVR01_0063_C06.b : nnnggctagtactaanacxxxxxxx
SMG01_0027_D02.b : nnnnnnnnnnnnn
OVRM1_0223_B07.b : cagttt
OVRM1_0010_B12.b : cxxxxxxx
OVR01_0079_D05.b : ngctagtgatatgacxxxxx
OVR01_0091_C08.b : nggctaggactatgacxxxxxx
LVRM1_0096_G07.b :
CBLT1_0056_G07.b : ttt
CBLT1_0063_B06.b : nccttttttnn
THY01_0001_G02.b : tgacxxxxxxxxxxxxx
OVRT1_0057_C09.b : ncccgctttnngggnanccgttagcg
LVR01_0100_D07.b : gcttxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0016_D05.b :
DCI01_0010_B09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0032_D06.b :
CLNT1_0042_C06.b :
THY01_0120_F06.b :
THY01_0106_A05.b :
CLNT1_0027_B09.b :
ITT01_0065_G01.b :
TES01_0099_B07.b :
CLNT1_0087_B04.b :
OVRT1_0122_G05.b :
TCH01_0089_A12.b :
CLNT1_0058_H07.b :
CLNT1_0065_A09.b :
AMP01_0070_F01.b : tcctagggatacttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0140_F08.b :
SPLT1_0016_E08.b :
CLNT1_0131_E07.b :
SPLT1_0006_F07.b :
OVRM1_0024_E03.b :
OVRT1_0086_B06.b :
THY01_0089_C08.b :
ILNT1_0050_F07.b :
LNG01_0027_C12.b :
BKFL1_0086_G12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxx
BKFL1_0055_A11.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
DCI01_0100_D02.b : nnnnnaagtacctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0040_F03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxx
DCI01_0091_H07.b : nnnntttgatactaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0024_C04.b :
LVRM1_0116_G02.b :
LVRM1_0006_E05.b :
PBL01_0077_C06.b :
SPL01_0001_B03.b :
UTR01_0106_E12.b :
UTR01_0052_H02.b :
20110601C-007465 : CCGCACTCGCCCCGGCGCCGGCGGAGGTAGAAGAGCGCCACGCGCACGCTCCGCCCACAT
---------+---------+---------+---------+---------+---------+ 81
BFLT1_0046_E01.b : CCGCACTCGCCCCGGCGCCGGCGGAGGTAGAAGAGCGCCACGCGCACGCTCCGCCCACAT
OVRM1_0074_B12.b : xxGCACTCGCCCCGGCGCCGGCGGAGGTAGAAGAGCGCCACGCGCACGCCCCGCCCACAT
PTG01_0110_A11.b : ggGCACTCGCCCCGGCGCCGGCGGAGGTAGAAGAGCGCCACGCGCACGCTCCGCCCACAT
OVRT1_0020_F01.b : ccGCACTCGCCCCGGCGCCGGCGGAGGTAGAAGAGCGCCACGCGCACGCTCCGCCCACAT
BFLT1_0047_E05.b : xxGCACTCGCCCCGGCGCCGGCGGAGGTAGAAGAGCGCCACGCGCACGCTCCGCCCACAT
OVRM1_0060_C09.b : xxggACTCGCCCCGGCGCCGGCGGAGGTAGAAGAGCGCCACGCGCACGCCCCGCCCACAT
OVRM1_0095_E03.b : xxxctCTCGCCCCGGCGCCGGCGGAGGTAGAAGAGCGCCACGCGCACGCCCCGCCCACAT
LVRM1_0028_H05.b : xxxxxCTCGCCCCGGCGCCGGCGGAGGTAGAAGAGCGCCACGCGCACGCCCCGCCCACAT
OVR01_0034_D02.b : xxxxxCTCGCCCCGGCGCCGGCGGAGGTAGAAGAGCGCCACGCGCACGCTCCGCCCACAT
SPL01_0065_E11.b : xxxxxCTCGCCCCGGCGCCGGCGGAGGTAGAAGAGCGCCACGCGCACGCTCCGCCCACAT
KDN01_0061_A03.b : ctctggactCCCCGGCGCCGGCGGAGGTAGAAGAGCGCCACGCGCACGCTCCGCCCACAT
OVR01_0026_D07.b : xxxxxxxxxCCCCGGCGCCGGCGGAGGTAGAAGAGCGCCACGCGCACGCCCCGCCCACAT
KDN01_0088_H03.b : ctatggactCCCCGGCGCCGGCGGAGGTAGAAGAGCGCCACGCGCACGCTCCGCCCACAT
OVR01_0063_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCACAT
SMG01_0027_D02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxxxxxggACAT
OVRM1_0223_B07.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtCAT
OVRM1_0010_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAT
OVR01_0079_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAT
OVR01_0091_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAT
LVRM1_0096_G07.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAT
CBLT1_0056_G07.b : tgccaagtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgAT
CBLT1_0063_B06.b : nnncgacggtagacgccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgAT
THY01_0001_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
OVRT1_0057_C09.b : nacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
LVR01_0100_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
PCT01_0016_D05.b : nnnngggattttnnnttanccctacggtggcct
DCI01_0010_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0032_D06.b : nnnccgactgcggacgxxxxxxxxxxxxxxxxxxx
CLNT1_0042_C06.b : ncgtttgctgaggxxxxxxxxxxxxxxxxxxxx
THY01_0120_F06.b : agttgtcxxxxxxxxxxxxx
THY01_0106_A05.b : agtgtcaaaaacaxxxxxxxx
CLNT1_0027_B09.b : ccttctgctgtcgagtgxxxxxxxxxxxxxx
ITT01_0065_G01.b : nnnggtgatacaxxxxxxxx
TES01_0099_B07.b :
CLNT1_0087_B04.b : nnttttcttnnnggnnnccgtttgcgnacgagtgxxxxxxxxxxxxxx
OVRT1_0122_G05.b : nccccgtcagcgnaggxxxxxxxxxxxxxxx
TCH01_0089_A12.b : ttctgggtcttnnnggcttggactaagacagtttnacxxxxxxxxxxxxx
CLNT1_0058_H07.b : nntttcgtctgctgacgxxxxxxxxxxxxxx
CLNT1_0065_A09.b : nggctgttnnnnnnnnccgttagcgnacgxxxxxxxxxxxxxxx
AMP01_0070_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0140_F08.b : nagttgtcxxxxxxx
SPLT1_0016_E08.b : nnnnggcaggtaga
CLNT1_0131_E07.b : nnnnnccgtcctgcgnaggxxxxxxxxx
SPLT1_0006_F07.b : nnnccgcggtagax
OVRM1_0024_E03.b : nagttgtxxxxx
OVRT1_0086_B06.b : nnnttgtttnnngggnnccgttagcgttacgaggtt
THY01_0089_C08.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0050_F07.b : nnnccgcgga
LNG01_0027_C12.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0086_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0055_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0100_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0040_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
DCI01_0091_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0024_C04.b :
LVRM1_0116_G02.b :
LVRM1_0006_E05.b :
PBL01_0077_C06.b :
SPL01_0001_B03.b :
UTR01_0106_E12.b :
UTR01_0052_H02.b :
20110601C-007465 : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCGGAGGACA
---------+---------+---------+---------+---------+---------+ 141
BFLT1_0046_E01.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCGGAGGACA
OVRM1_0074_B12.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCCGAGGACA
PTG01_0110_A11.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCGGAGGACA
OVRT1_0020_F01.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCACGCAGTCGGAGGACA
BFLT1_0047_E05.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCGGAGGACA
OVRM1_0060_C09.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCCGAGGACA
OVRM1_0095_E03.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCCGAGGACA
LVRM1_0028_H05.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCCGAGGACA
OVR01_0034_D02.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCGGAGGACA
SPL01_0065_E11.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCGGAGGACA
KDN01_0061_A03.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCGGAGGACA
OVR01_0026_D07.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCCGAGGACA
KDN01_0088_H03.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCGGAGGACA
OVR01_0063_C06.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCGGTCCGAGGACA
SMG01_0027_D02.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCGGAGGACA
OVRM1_0223_B07.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCCGAGGACA
OVRM1_0010_B12.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCCGAGGACA
OVR01_0079_D05.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCCGAGGACA
OVR01_0091_C08.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCCGAGGACA
LVRM1_0096_G07.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCCGAGGACA
CBLT1_0056_G07.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCGGAGGACA
CBLT1_0063_B06.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCGGAGGACA
THY01_0001_G02.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCGGAGGACA
OVRT1_0057_C09.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCGGAGGACA
LVR01_0100_D07.b : CGCCGACCCTCCCCGGGCCCTGCCGGATGTCCGCTTCTCGCTGCTCGCAGTCGGAGGACA
PCT01_0016_D05.b : aatgccgacccctccGGCCCTGCCGGATGTCCGCTTCTCACTGCTCGCANTCCGAGGACA
DCI01_0010_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCCGCTTCTCGCTGCTCGCAGTCGGAGGACA
CLNT1_0032_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCTCGCTGCTCGCAGTCGGAGGACA
CLNT1_0042_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTCTCGCTGCTCGCAGTCGGAGGACA
THY01_0120_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCGCTGCTCGCAGTCGGAGGACA
THY01_0106_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcTCTCGCTGCTCGCAGTCGGAGGACA
CLNT1_0027_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcgTCTCGCTGCTCGCAGTCGGAGGACA
ITT01_0065_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTCGCTGCTCGCAGTCGGAGGACA
TES01_0099_B07.b : ttttcctacgttgctatganaCTCGCTGCTCGCAGTCGGAGGAC*
CLNT1_0087_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCGCTGCTCGCAGTCGGAGGACA
OVRT1_0122_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcCGCTGCTCGCAGTCGGAGGACA
TCH01_0089_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTGCTCGCAGTCCGAGGACA
CLNT1_0058_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTGCTCGCAGTCGGAGGACA
CLNT1_0065_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCTGCTCGCAGTCGGAGGACA
AMP01_0070_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGCTCGCAGTCGGAGGACA
OVRM1_0140_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCGCAGTCCGAGGACA
SPLT1_0016_E08.b : cgccgtagtaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGCAGTCGGAGGACA
CLNT1_0131_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtGCAGTCGGAGGACA
SPLT1_0006_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGCAGTCGGAGGACA
OVRM1_0024_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCCGAGGACA
OVRT1_0086_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCGGAGGACA
THY01_0089_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCGGAGGACA
ILNT1_0050_F07.b : acgaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGTCGGAGGACA
LNG01_0027_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCCGAGGACA
BKFL1_0086_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGGAGGACA
BKFL1_0055_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGACA
DCI01_0100_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGACA
BKFL1_0040_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGACA
DCI01_0091_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGGACA
PST01_0024_C04.b : ntctgcgttggctctgggctgctcgcgtcggaggaA
LVRM1_0116_G02.b : taatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0006_E05.b :
PBL01_0077_C06.b :
SPL01_0001_B03.b :
UTR01_0106_E12.b :
UTR01_0052_H02.b :
20110601C-007465 : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
---------+---------+---------+---------+---------+---------+ 201
BFLT1_0046_E01.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
OVRM1_0074_B12.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
PTG01_0110_A11.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
OVRT1_0020_F01.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
BFLT1_0047_E05.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
OVRM1_0060_C09.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
OVRM1_0095_E03.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCCCTCT
LVRM1_0028_H05.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
OVR01_0034_D02.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
SPL01_0065_E11.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGCAAGGCTGGAAAGCCTCTCT
KDN01_0061_A03.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
OVR01_0026_D07.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
KDN01_0088_H03.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
OVR01_0063_C06.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
SMG01_0027_D02.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
OVRM1_0223_B07.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
OVRM1_0010_B12.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
OVR01_0079_D05.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
OVR01_0091_C08.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
LVRM1_0096_G07.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
CBLT1_0056_G07.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
CBLT1_0063_B06.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
THY01_0001_G02.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
OVRT1_0057_C09.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
LVR01_0100_D07.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
PCT01_0016_D05.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
DCI01_0010_B09.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
CLNT1_0032_D06.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
CLNT1_0042_C06.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
THY01_0120_F06.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
THY01_0106_A05.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
CLNT1_0027_B09.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
ITT01_0065_G01.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
TES01_0099_B07.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
CLNT1_0087_B04.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
OVRT1_0122_G05.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
TCH01_0089_A12.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
CLNT1_0058_H07.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
CLNT1_0065_A09.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
AMP01_0070_F01.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
OVRM1_0140_F08.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
SPLT1_0016_E08.b : TGGCGAACCANGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
CLNT1_0131_E07.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
SPLT1_0006_F07.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
OVRM1_0024_E03.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
OVRT1_0086_B06.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
THY01_0089_C08.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
ILNT1_0050_F07.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
LNG01_0027_C12.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
BKFL1_0086_G12.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
BKFL1_0055_A11.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
DCI01_0100_D02.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
BKFL1_0040_F03.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
DCI01_0091_H07.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
PST01_0024_C04.b : TGGCGAACCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
LVRM1_0116_G02.b : xxxxxxxxCAGGTCATCAAGTGCAAGGCTGCGGTTGCCTGGGAGGCTGGAAAGCCTCTCT
LVRM1_0006_E05.b : atxxxxxxxxxxxxxxxxxxxxx
PBL01_0077_C06.b : nnaagt
SPL01_0001_B03.b : cttttggatgaaxxxxxxxxxxxxxxxxxx
UTR01_0106_E12.b :
UTR01_0052_H02.b :
20110601C-007465 : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
---------+---------+---------+---------+---------+---------+ 261
BFLT1_0046_E01.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
OVRM1_0074_B12.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
PTG01_0110_A11.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
OVRT1_0020_F01.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
BFLT1_0047_E05.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
OVRM1_0060_C09.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
OVRM1_0095_E03.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
LVRM1_0028_H05.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
OVR01_0034_D02.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
SPL01_0065_E11.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
KDN01_0061_A03.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCCCATGAAGTTCGAATTAAGATTATTG
OVR01_0026_D07.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
KDN01_0088_H03.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
OVR01_0063_C06.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
SMG01_0027_D02.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
OVRM1_0223_B07.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
OVRM1_0010_B12.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
OVR01_0079_D05.b : CCATANAGGAGATAGAGGGGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
OVR01_0091_C08.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
LVRM1_0096_G07.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
CBLT1_0056_G07.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
CBLT1_0063_B06.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
THY01_0001_G02.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
OVRT1_0057_C09.b : CCATAGAGGAGATAGAGGTGGCACCCTCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
LVR01_0100_D07.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
PCT01_0016_D05.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
DCI01_0010_B09.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
CLNT1_0032_D06.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
CLNT1_0042_C06.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
THY01_0120_F06.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
THY01_0106_A05.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
CLNT1_0027_B09.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
ITT01_0065_G01.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
TES01_0099_B07.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
CLNT1_0087_B04.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
OVRT1_0122_G05.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
TCH01_0089_A12.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
CLNT1_0058_H07.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
CLNT1_0065_A09.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
AMP01_0070_F01.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
OVRM1_0140_F08.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
SPLT1_0016_E08.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
CLNT1_0131_E07.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
SPLT1_0006_F07.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
OVRM1_0024_E03.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
OVRT1_0086_B06.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
THY01_0089_C08.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
ILNT1_0050_F07.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
LNG01_0027_C12.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
BKFL1_0086_G12.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
BKFL1_0055_A11.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
DCI01_0100_D02.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
BKFL1_0040_F03.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
DCI01_0091_H07.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
PST01_0024_C04.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
LVRM1_0116_G02.b : CCATAGAGGAGATAGAGGTGGCACCCCCAAAGGCTCATGAAGTTCGAATTAAGATTATTG
LVRM1_0006_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTCGAATTAAGATTATTG
PBL01_0077_C06.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTAAGATTATTG
SPL01_0001_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTATTG
UTR01_0106_E12.b :
UTR01_0052_H02.b :
20110601C-007465 : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
---------+---------+---------+---------+---------+---------+ 321
BFLT1_0046_E01.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
OVRM1_0074_B12.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
PTG01_0110_A11.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
OVRT1_0020_F01.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
BFLT1_0047_E05.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
OVRM1_0060_C09.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
OVRM1_0095_E03.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
LVRM1_0028_H05.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
OVR01_0034_D02.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
SPL01_0065_E11.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
KDN01_0061_A03.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
OVR01_0026_D07.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
KDN01_0088_H03.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
OVR01_0063_C06.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
SMG01_0027_D02.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
OVRM1_0223_B07.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
OVRM1_0010_B12.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
OVR01_0079_D05.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTTATCCTGAAGGGAGTT
OVR01_0091_C08.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
LVRM1_0096_G07.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
CBLT1_0056_G07.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
CBLT1_0063_B06.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
THY01_0001_G02.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
OVRT1_0057_C09.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
LVR01_0100_D07.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
PCT01_0016_D05.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
DCI01_0010_B09.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
CLNT1_0032_D06.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
CLNT1_0042_C06.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
THY01_0120_F06.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
THY01_0106_A05.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
CLNT1_0027_B09.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
ITT01_0065_G01.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
TES01_0099_B07.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
CLNT1_0087_B04.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
OVRT1_0122_G05.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
TCH01_0089_A12.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
CLNT1_0058_H07.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
CLNT1_0065_A09.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
AMP01_0070_F01.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
OVRM1_0140_F08.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
SPLT1_0016_E08.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
CLNT1_0131_E07.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
SPLT1_0006_F07.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
OVRM1_0024_E03.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
OVRT1_0086_B06.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
THY01_0089_C08.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
ILNT1_0050_F07.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
LNG01_0027_C12.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
BKFL1_0086_G12.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
BKFL1_0055_A11.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
DCI01_0100_D02.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
BKFL1_0040_F03.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
DCI01_0091_H07.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
PST01_0024_C04.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
LVRM1_0116_G02.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
LVRM1_0006_E05.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
PBL01_0077_C06.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
SPL01_0001_B03.b : CCACTGCAGTTTGCCACACTGATGCCTATACCCTGAGTGGGGCTGATCCTGAAGGGAGTT
UTR01_0106_E12.b :
UTR01_0052_H02.b :
20110601C-007465 : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
---------+---------+---------+---------+---------+---------+ 381
BFLT1_0046_E01.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
OVRM1_0074_B12.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
PTG01_0110_A11.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
OVRT1_0020_F01.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
BFLT1_0047_E05.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
OVRM1_0060_C09.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
OVRM1_0095_E03.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGGGTTA
LVRM1_0028_H05.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
OVR01_0034_D02.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
SPL01_0065_E11.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
KDN01_0061_A03.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
OVR01_0026_D07.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
KDN01_0088_H03.b : TTCCAGTGATCCTGGGACACAAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
OVR01_0063_C06.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
SMG01_0027_D02.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
OVRM1_0223_B07.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
OVRM1_0010_B12.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
OVR01_0079_D05.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
OVR01_0091_C08.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
LVRM1_0096_G07.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
CBLT1_0056_G07.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
CBLT1_0063_B06.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
THY01_0001_G02.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
OVRT1_0057_C09.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
LVR01_0100_D07.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
PCT01_0016_D05.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
DCI01_0010_B09.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
CLNT1_0032_D06.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
CLNT1_0042_C06.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAGGGAGTTA
THY01_0120_F06.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
THY01_0106_A05.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
CLNT1_0027_B09.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
ITT01_0065_G01.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
TES01_0099_B07.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
CLNT1_0087_B04.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
OVRT1_0122_G05.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
TCH01_0089_A12.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
CLNT1_0058_H07.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
CLNT1_0065_A09.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
AMP01_0070_F01.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
OVRM1_0140_F08.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
SPLT1_0016_E08.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
CLNT1_0131_E07.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
SPLT1_0006_F07.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
OVRM1_0024_E03.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
OVRT1_0086_B06.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
THY01_0089_C08.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
ILNT1_0050_F07.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
LNG01_0027_C12.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
BKFL1_0086_G12.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
BKFL1_0055_A11.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
DCI01_0100_D02.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
BKFL1_0040_F03.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
DCI01_0091_H07.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
PST01_0024_C04.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
LVRM1_0116_G02.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
LVRM1_0006_E05.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
PBL01_0077_C06.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
SPL01_0001_B03.b : TTCCAGTGATCCTGGGACACGAAGGTGCTGGAATTGTGGAAAGTGTTGGTGAAGGAGTTA
UTR01_0106_E12.b :
UTR01_0052_H02.b :
20110601C-007465 : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
---------+---------+---------+---------+---------+---------+ 441
BFLT1_0046_E01.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
OVRM1_0074_B12.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
PTG01_0110_A11.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
OVRT1_0020_F01.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
BFLT1_0047_E05.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
OVRM1_0060_C09.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGCGGAGAATGCA
OVRM1_0095_E03.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
LVRM1_0028_H05.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
OVR01_0034_D02.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
SPL01_0065_E11.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
KDN01_0061_A03.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
OVR01_0026_D07.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
KDN01_0088_H03.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
OVR01_0063_C06.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
SMG01_0027_D02.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
OVRM1_0223_B07.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
OVRM1_0010_B12.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
OVR01_0079_D05.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGGGTGGAGAATGCA
OVR01_0091_C08.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
LVRM1_0096_G07.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
CBLT1_0056_G07.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
CBLT1_0063_B06.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
THY01_0001_G02.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
OVRT1_0057_C09.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
LVR01_0100_D07.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
PCT01_0016_D05.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
DCI01_0010_B09.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
CLNT1_0032_D06.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAGTGCA
CLNT1_0042_C06.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
THY01_0120_F06.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
THY01_0106_A05.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
CLNT1_0027_B09.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
ITT01_0065_G01.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
TES01_0099_B07.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
CLNT1_0087_B04.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
OVRT1_0122_G05.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
TCH01_0089_A12.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
CLNT1_0058_H07.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
CLNT1_0065_A09.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
AMP01_0070_F01.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
OVRM1_0140_F08.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
SPLT1_0016_E08.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
CLNT1_0131_E07.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
SPLT1_0006_F07.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
OVRM1_0024_E03.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
OVRT1_0086_B06.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
THY01_0089_C08.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
ILNT1_0050_F07.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
LNG01_0027_C12.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
BKFL1_0086_G12.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
BKFL1_0055_A11.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
DCI01_0100_D02.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
BKFL1_0040_F03.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
DCI01_0091_H07.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
PST01_0024_C04.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
LVRM1_0116_G02.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
LVRM1_0006_E05.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
PBL01_0077_C06.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
SPL01_0001_B03.b : CTAAGCTTAAGGCAGGTGATACTGTCATCCCACTTTACATCCCACAGTGTGGAGAATGCA
UTR01_0106_E12.b :
UTR01_0052_H02.b :
20110601C-007465 : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
---------+---------+---------+---------+---------+---------+ 501
BFLT1_0046_E01.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
OVRM1_0074_B12.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
PTG01_0110_A11.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
OVRT1_0020_F01.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
BFLT1_0047_E05.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
OVRM1_0060_C09.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGACAATAAGAGTCACTCAAGGGAAAG
OVRM1_0095_E03.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
LVRM1_0028_H05.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCGAGGGAAAG
OVR01_0034_D02.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
SPL01_0065_E11.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
KDN01_0061_A03.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
OVR01_0026_D07.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
KDN01_0088_H03.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
OVR01_0063_C06.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
SMG01_0027_D02.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
OVRM1_0223_B07.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
OVRM1_0010_B12.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
OVR01_0079_D05.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
OVR01_0091_C08.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
LVRM1_0096_G07.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
CBLT1_0056_G07.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
CBLT1_0063_B06.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
THY01_0001_G02.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
OVRT1_0057_C09.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
LVR01_0100_D07.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
PCT01_0016_D05.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
DCI01_0010_B09.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
CLNT1_0032_D06.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
CLNT1_0042_C06.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
THY01_0120_F06.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
THY01_0106_A05.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
CLNT1_0027_B09.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
ITT01_0065_G01.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
TES01_0099_B07.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
CLNT1_0087_B04.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
OVRT1_0122_G05.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
TCH01_0089_A12.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
CLNT1_0058_H07.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
CLNT1_0065_A09.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
AMP01_0070_F01.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
OVRM1_0140_F08.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
SPLT1_0016_E08.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
CLNT1_0131_E07.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
SPLT1_0006_F07.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
OVRM1_0024_E03.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
OVRT1_0086_B06.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
THY01_0089_C08.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
ILNT1_0050_F07.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
LNG01_0027_C12.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
BKFL1_0086_G12.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
BKFL1_0055_A11.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
DCI01_0100_D02.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
BKFL1_0040_F03.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
DCI01_0091_H07.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
PST01_0024_C04.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
LVRM1_0116_G02.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
LVRM1_0006_E05.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
PBL01_0077_C06.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
SPL01_0001_B03.b : AATTTTGTCTAAATCCTAAAACAAACCTTTGCCAGAAAATAAGAGTCACTCAAGGGAAAG
UTR01_0106_E12.b :
UTR01_0052_H02.b :
20110601C-007465 : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
---------+---------+---------+---------+---------+---------+ 561
BFLT1_0046_E01.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
OVRM1_0074_B12.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
PTG01_0110_A11.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
OVRT1_0020_F01.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
BFLT1_0047_E05.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
OVRM1_0060_C09.b : GCTTAATGCCAGATGGTACTAGCAGATTTACTTGTAAAGGAAAGACACATTTACACTACA
OVRM1_0095_E03.b : GCTTAATGCCAGATGGTACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
LVRM1_0028_H05.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGANAGACAATTTTACATTACA
OVR01_0034_D02.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
SPL01_0065_E11.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACACTACA
KDN01_0061_A03.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
OVR01_0026_D07.b : GCTTAATGCCAGATGGTACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
KDN01_0088_H03.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
OVR01_0063_C06.b : GCTTAATGCCAGATGGTACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
SMG01_0027_D02.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
OVRM1_0223_B07.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
OVRM1_0010_B12.b : GCTTAATGCCAGATGGTACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
OVR01_0079_D05.b : GCTTAATGCCAGATGGTACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
OVR01_0091_C08.b : GCTTAATGCCAGATGGTACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
LVRM1_0096_G07.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACCATTTTACATTACA
CBLT1_0056_G07.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
CBLT1_0063_B06.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
THY01_0001_G02.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
OVRT1_0057_C09.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
LVR01_0100_D07.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
PCT01_0016_D05.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
DCI01_0010_B09.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
CLNT1_0032_D06.b : GCTTAATGCCAGATGACACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
CLNT1_0042_C06.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
THY01_0120_F06.b : GCTTAATGCCAGATGGCACTAGCACATTTACTTGTAAAGGAAAGACAATTTTACATTACA
THY01_0106_A05.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
CLNT1_0027_B09.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
ITT01_0065_G01.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
TES01_0099_B07.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
CLNT1_0087_B04.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
OVRT1_0122_G05.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
TCH01_0089_A12.b : GCTTAATGCCAGATGGTACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
CLNT1_0058_H07.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
CLNT1_0065_A09.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
AMP01_0070_F01.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
OVRM1_0140_F08.b : GCTTAATGCCAGATGGTACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
SPLT1_0016_E08.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
CLNT1_0131_E07.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
SPLT1_0006_F07.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
OVRM1_0024_E03.b : GCTTAATGCCAGATGGTACTAGCAGATTTATTTGTAAAGGAAAGACAATTTTACATTACA
OVRT1_0086_B06.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
THY01_0089_C08.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
ILNT1_0050_F07.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
LNG01_0027_C12.b : GCTTAATGCCAGATGGTACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
BKFL1_0086_G12.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAGGACAATTTTACATTACA
BKFL1_0055_A11.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
DCI01_0100_D02.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAA*TTTACATTACA
BKFL1_0040_F03.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
DCI01_0091_H07.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAA*TTTACATTACA
PST01_0024_C04.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
LVRM1_0116_G02.b : GCTTAATGCCAGATGGTACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
LVRM1_0006_E05.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
PBL01_0077_C06.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGGAAGACAATTTTACATTACA
SPL01_0001_B03.b : GCTTAATGCCAGATGGCACTAGCAGATTTACTTGTAAAGGAAAGACAATTTTACATTACA
UTR01_0106_E12.b : nntttgataggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0052_H02.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-007465 : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
---------+---------+---------+---------+---------+---------+ 621
BFLT1_0046_E01.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
OVRM1_0074_B12.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
PTG01_0110_A11.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
OVRT1_0020_F01.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
BFLT1_0047_E05.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
OVRM1_0060_C09.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
OVRM1_0095_E03.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
LVRM1_0028_H05.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTGANATTG
OVR01_0034_D02.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
SPL01_0065_E11.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
KDN01_0061_A03.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
OVR01_0026_D07.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
KDN01_0088_H03.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
OVR01_0063_C06.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
SMG01_0027_D02.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
OVRM1_0223_B07.b : TGGGAACCAGTACCTTTTCCGAATAC*CAATTGTGCCTGACATCTCTGCTGCTAAGATTG
OVRM1_0010_B12.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
OVR01_0079_D05.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
OVR01_0091_C08.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
LVRM1_0096_G07.b : TGGAAACCACTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAGTATTG
CBLT1_0056_G07.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
CBLT1_0063_B06.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
THY01_0001_G02.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
OVRT1_0057_C09.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
LVR01_0100_D07.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
PCT01_0016_D05.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
DCI01_0010_B09.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
CLNT1_0032_D06.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
CLNT1_0042_C06.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
THY01_0120_F06.b : TGGGAACCACTACCTTTTCTGAATACACAGTTGTGGCCGACATCTTTGTTGCTAAAATTG
THY01_0106_A05.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
CLNT1_0027_B09.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
ITT01_0065_G01.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
TES01_0099_B07.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
CLNT1_0087_B04.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
OVRT1_0122_G05.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
TCH01_0089_A12.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
CLNT1_0058_H07.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
CLNT1_0065_A09.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
AMP01_0070_F01.b : TGGGAACCAGTACCCTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
OVRM1_0140_F08.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
SPLT1_0016_E08.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
CLNT1_0131_E07.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
SPLT1_0006_F07.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
OVRM1_0024_E03.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
OVRT1_0086_B06.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
THY01_0089_C08.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
ILNT1_0050_F07.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
LNG01_0027_C12.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
BKFL1_0086_G12.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
BKFL1_0055_A11.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
DCI01_0100_D02.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
BKFL1_0040_F03.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
DCI01_0091_H07.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
PST01_0024_C04.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
LVRM1_0116_G02.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
LVRM1_0006_E05.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
PBL01_0077_C06.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
SPL01_0001_B03.b : TGGGAACCAGTACCTTTTCTGAATACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
UTR01_0106_E12.b : xxxxxxxxxxxxxxxxxxxxxtggACACAGTTGTGGCTGACATCTCTGTTGCTAAAATTG
UTR01_0052_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGTTGCTAAAATTG
20110601C-007465 : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
---------+---------+---------+---------+---------+---------+ 681
BFLT1_0046_E01.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
OVRM1_0074_B12.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGATATG
PTG01_0110_A11.b : ATCCTTTGGCCCCTTTGGANTAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
OVRT1_0020_F01.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
BFLT1_0047_E05.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
OVRM1_0060_C09.b : ATCCTTTGGCCCCTTTGGATACAGTCCGCCCTCCTGGTTGTGCCGTTTCAACTGGTTATG
OVRM1_0095_E03.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCA*CTGGTTATG
LVRM1_0028_H05.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
OVR01_0034_D02.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATC
SPL01_0065_E11.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
KDN01_0061_A03.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
OVR01_0026_D07.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
KDN01_0088_H03.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
OVR01_0063_C06.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
SMG01_0027_D02.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
OVRM1_0223_B07.b : ATCATTTGGCCCCattgcatcaatctgcctactgaggtgtgccacttgaactggctcagg
OVRM1_0010_B12.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
OVR01_0079_D05.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCCACTGGTTATG
OVR01_0091_C08.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
LVRM1_0096_G07.b : ATCCTTTGACCCCTATGGACTAAGTCTGCCCTCTGAGTTGCGGACTTTCAACcgggtaat
CBLT1_0056_G07.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
CBLT1_0063_B06.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
THY01_0001_G02.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
OVRT1_0057_C09.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
LVR01_0100_D07.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
PCT01_0016_D05.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTTGTGCGTTTTCACTGGGTATG
DCI01_0010_B09.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
CLNT1_0032_D06.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
CLNT1_0042_C06.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
THY01_0120_F06.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCACCTGGTTATG
THY01_0106_A05.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
CLNT1_0027_B09.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
ITT01_0065_G01.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
TES01_0099_B07.b : ATCCTTTGGCTCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
CLNT1_0087_B04.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
OVRT1_0122_G05.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
TCH01_0089_A12.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
CLNT1_0058_H07.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
CLNT1_0065_A09.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
AMP01_0070_F01.b : ATCCTTTGGCCCCTTTGGATAGAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
OVRM1_0140_F08.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
SPLT1_0016_E08.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
CLNT1_0131_E07.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
SPLT1_0006_F07.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
OVRM1_0024_E03.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
OVRT1_0086_B06.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
THY01_0089_C08.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
ILNT1_0050_F07.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
LNG01_0027_C12.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
BKFL1_0086_G12.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
BKFL1_0055_A11.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
DCI01_0100_D02.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
BKFL1_0040_F03.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
DCI01_0091_H07.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
PST01_0024_C04.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
LVRM1_0116_G02.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
LVRM1_0006_E05.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
PBL01_0077_C06.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
SPL01_0001_B03.b : ATCCTTCGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
UTR01_0106_E12.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
UTR01_0052_H02.b : ATCCTTTGGCCCCTTTGGATAAAGTCTGCCTTCTGGGTTGTGGCGTTTCAACTGGTTATG
20110601C-007465 : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
---------+---------+---------+---------+---------+---------+ 741
BFLT1_0046_E01.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
OVRM1_0074_B12.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGACTCTACTTGTGCTGTCTTTGGCCTAG
PTG01_0110_A11.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
OVRT1_0020_F01.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGN
BFLT1_0047_E05.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGN
OVRM1_0060_C09.b : GCGCGGCTGTGAACACTGCCAAGGTGGAGCCggcttcacttgtgctgtctctgccctggg
OVRM1_0095_E03.b : GTGCCGCTGTGAACACTGCCTAAGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGACTGG
LVRM1_0028_H05.b : GTGCGGCTGTGAACACTGCCNANGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
OVR01_0034_D02.b : GGGCGGCTGTGAACCCTGCCAACGCGGAGCCCGGCTCTACTTGGGCTGTCTTTGGCCTGC
SPL01_0065_E11.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
KDN01_0061_A03.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
OVR01_0026_D07.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
KDN01_0088_H03.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGN
OVR01_0063_C06.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
SMG01_0027_D02.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGN
OVRM1_0223_B07.b : gtgaggatgttagcactataaatagcggcaccagaggtgctatcgccctgccctccgatg
OVRM1_0010_B12.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGN
OVR01_0079_D05.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
OVR01_0091_C08.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
LVRM1_0096_G07.b : gtgcggctggtaaccttgtccacgcgggaacctgcgcctaataagccccacttaagcctg
CBLT1_0056_G07.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
CBLT1_0063_B06.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
THY01_0001_G02.b : GTGCGGCTGTGAACACTGCCCAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGC
OVRT1_0057_C09.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGN
LVR01_0100_D07.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
PCT01_0016_D05.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGNCCTGN
DCI01_0010_B09.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
CLNT1_0032_D06.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
CLNT1_0042_C06.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
THY01_0120_F06.b : GTGCGGCTGTGAACCCGGCCAAGtggacccggctctcctgtgctgctttcgctcggagga
THY01_0106_A05.b : GTGCGGGTGTGAACACTGCCAAGGTGGACCCTGctcttact
CLNT1_0027_B09.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
ITT01_0065_G01.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
TES01_0099_B07.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
CLNT1_0087_B04.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
OVRT1_0122_G05.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
TCH01_0089_A12.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGN
CLNT1_0058_H07.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
CLNT1_0065_A09.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
AMP01_0070_F01.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGNCTCTANCTGTGCTGTCTTTGGCCTGG
OVRM1_0140_F08.b : GTGCGGCTGTGAACACTGGCCAAGTGGAGGCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
SPLT1_0016_E08.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
CLNT1_0131_E07.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
SPLT1_0006_F07.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
OVRM1_0024_E03.b : GTGCGGCTGTGAACACTGCCGAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
OVRT1_0086_B06.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGN
THY01_0089_C08.b : GTGCGGCTGTGAACACTGCCGAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
ILNT1_0050_F07.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
LNG01_0027_C12.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
BKFL1_0086_G12.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGN
BKFL1_0055_A11.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGN
DCI01_0100_D02.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGN
BKFL1_0040_F03.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGN
DCI01_0091_H07.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGN
PST01_0024_C04.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
LVRM1_0116_G02.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGN
LVRM1_0006_E05.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
PBL01_0077_C06.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
SPL01_0001_B03.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
UTR01_0106_E12.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
UTR01_0052_H02.b : GTGCGGCTGTGAACACTGCCAAGGTGGAGCCTGGCTCTACTTGTGCTGTCTTTGGCCTGG
20110601C-007465 : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
---------+---------+---------+---------+---------+---------+ 799
BFLT1_0046_E01.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGNTAGGTGGCTGGTGCATCC*CGGATCAT
OVRM1_0074_B12.b : GAG*GAGTTGAATTGccactatcattcgctgtaggt
PTG01_0110_A11.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAAGTGGCTGGTGCATCC*CGGATCAT
OVRT1_0020_F01.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
BFLT1_0047_E05.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
OVRM1_0060_C09.b : gagatttggattgcagttatcacggcctgcaaggggctggtgctccccggacatggcg
OVRM1_0095_E03.b : GAG*Gcacttggatgtcatttatcgtgcgctgtcaggttgctggttgatcccggat
LVRM1_0028_H05.b : GAG*GAGTTGGGATGGCAGTTn
OVR01_0034_D02.b : GAG*GACCTTGATTGGCcagtcatcatggcctgcaaccgtgtccgctgcatccccgatct
SPL01_0065_E11.b : GAG*GAGTTTGGATGGCAGTTATCATGGGCTTGTAAGTGGCTGGTGCATCC*CGGATCAT
KDN01_0061_A03.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
OVR01_0026_D07.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCCCCGGATCGT
KDN01_0088_H03.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
OVR01_0063_C06.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
SMG01_0027_D02.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
OVRM1_0223_B07.b : aatcaagataatacccgcacaacagtctgcatatactcccatacctccataatcagcctc
OVRM1_0010_B12.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTANCGTGGCTGGTGCATCC*CGGATCAT
OVR01_0079_D05.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
OVR01_0091_C08.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
LVRM1_0096_G07.b : ggcagaactctgattaaccgataatactaagcttgccaagtcacaccagccatccaagac
CBLT1_0056_G07.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
CBLT1_0063_B06.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
THY01_0001_G02.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
OVRT1_0057_C09.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
LVR01_0100_D07.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
PCT01_0016_D05.b : NNGAGAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CCGATCAT
DCI01_0010_B09.b : GAG*GAGTTGGATTGGCANTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
CLNT1_0032_D06.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
CLNT1_0042_C06.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
THY01_0120_F06.b : ttggatg
THY01_0106_A05.b :
CLNT1_0027_B09.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
ITT01_0065_G01.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
TES01_0099_B07.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
CLNT1_0087_B04.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
OVRT1_0122_G05.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
TCH01_0089_A12.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
CLNT1_0058_H07.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
CLNT1_0065_A09.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
AMP01_0070_F01.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCCTCC*CGGATCAT
OVRM1_0140_F08.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
SPLT1_0016_E08.b : GAG*GAATTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAA
CLNT1_0131_E07.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
SPLT1_0006_F07.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
OVRM1_0024_E03.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
OVRT1_0086_B06.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
THY01_0089_C08.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
ILNT1_0050_F07.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
LNG01_0027_C12.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
BKFL1_0086_G12.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGNATCAT
BKFL1_0055_A11.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CCGATCAT
DCI01_0100_D02.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
BKFL1_0040_F03.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
DCI01_0091_H07.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
PST01_0024_C04.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
LVRM1_0116_G02.b : GAG*GAGTTGAATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
LVRM1_0006_E05.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
PBL01_0077_C06.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
SPL01_0001_B03.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
UTR01_0106_E12.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
UTR01_0052_H02.b : GAG*GAGTTGGATTGGCAGTTATCATGGGCTGTAAGGTGGCTGGTGCATCC*CGGATCAT
20110601C-007465 : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
---------+---------+---------+---------+---------+---------+ 856
BFLT1_0046_E01.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGGCAAAGAGGTTTGGAGCTTCTGA
OVRM1_0074_B12.b :
PTG01_0110_A11.b : TGTTGTGGACATCAA**TAAAGATAAATTCGCCAGGGGCCAAGGAGTTTGGAGCTTCTGA
OVRT1_0020_F01.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
BFLT1_0047_E05.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCNAGGA*GTTTGGAGCTTCTGA
OVRM1_0060_C09.b :
OVRM1_0095_E03.b :
LVRM1_0028_H05.b :
OVR01_0034_D02.b : ttcctgcgcacatctatatatataccttctcaccggccccacccctttcggaactccttc
SPL01_0065_E11.b : TGGTGTGGACATCCA**TAAAGATAAATTCCCAGGGGCCAAGAA***TTTGGAGCTCCGG
KDN01_0061_A03.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
OVR01_0026_D07.b : TGGTGTGGACATCCAATAAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGAAGCTTCTGA
KDN01_0088_H03.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
OVR01_0063_C06.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTTGAACTTCTGA
SMG01_0027_D02.b : TGGTGTGGGACATCA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
OVRM1_0223_B07.b : actccaaacactctcattata
OVRM1_0010_B12.b : TGGTGTGGACATCAA**TAAgataattcccaaggcccacgagcttggagcttctaacgta
OVR01_0079_D05.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAGGGCCCAGGA**GTTTGGAGCTTCTGA
OVR01_0091_C08.b : TGGTGTGGACATCCA**TAAAGATAAATTCGCAAGGGCCAAGGAGTTTGGGAGCTTCTGA
LVRM1_0096_G07.b : cctatgtccactactccccatctcatgg
CBLT1_0056_G07.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
CBLT1_0063_B06.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
THY01_0001_G02.b : TGGTGTGGACATCAA**TAAAGATAAATTTCGCAAGCGCCAACAAGTTTGGAGCCTCTGA
OVRT1_0057_C09.b : TGGTGTGGACATCAA**TAAAGATAAATTTCGCAGGGCCAAGGA*GTTTGGAGCTTCTGA
LVR01_0100_D07.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
PCT01_0016_D05.b : TGNTGTGGACATCAT**AAAGAATAAATTTCGCAGGGCCAA*GAGATTTGGAGCTTCTGA
DCI01_0010_B09.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCACGGGCCAAGGA*GTTTGGAGCTTCTGA
CLNT1_0032_D06.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
CLNT1_0042_C06.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
THY01_0120_F06.b :
THY01_0106_A05.b :
CLNT1_0027_B09.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
ITT01_0065_G01.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
TES01_0099_B07.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
CLNT1_0087_B04.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
OVRT1_0122_G05.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
TCH01_0089_A12.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
CLNT1_0058_H07.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
CLNT1_0065_A09.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
AMP01_0070_F01.b : TGGTGTGGACATCAA**TAA*GATAAATTCGCAAGGCCCAAGA**GTTTGGAGCTTCCTG
OVRM1_0140_F08.b : TGGTGTGNACATCAA**TAAAGAAAAATTCGCAGGGCaaggaagttggagcttcttgatg
SPLT1_0016_E08.b : TGGTGTGGACATCAA**TAAAGATAATTTCGC*AGGGCCAAGGA*GTTTGGAGCTTCTGA
CLNT1_0131_E07.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
SPLT1_0006_F07.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
OVRM1_0024_E03.b : TGGTGTGGACATCAA**TAAAGATAAATTCGNCAGGGCCAAGGA*GTTTGGAGCTTCTGA
OVRT1_0086_B06.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
THY01_0089_C08.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
ILNT1_0050_F07.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
LNG01_0027_C12.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
BKFL1_0086_G12.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAGGGCCAAGGGA**GTTGGAGCTTCTGA
BKFL1_0055_A11.b : TGGTGTGGACATCAA**TAAAGAAAATTTCGCAGGGCCAANG**AGTTTGGAGCTTCTGA
DCI01_0100_D02.b : TGGTGTGGACATCAA**TAAAGATAAATTTCGCAGGGCCCAAGGAG*TTGGAGCTTCTGA
BKFL1_0040_F03.b : TGGTGTGGNACATCA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
DCI01_0091_H07.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
PST01_0024_C04.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
LVRM1_0116_G02.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
LVRM1_0006_E05.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
PBL01_0077_C06.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
SPL01_0001_B03.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
UTR01_0106_E12.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
UTR01_0052_H02.b : TGGTGTGGACATCAA**TAAAGATAAATTCGCAAGGGCCAAGGA*GTTTGGAGCTTCTGA
20110601C-007465 : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
---------+---------+---------+---------+---------+---------+ 912
BFLT1_0046_E01.b : ATGTATTAA**CCCCCAG*A*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
OVRM1_0074_B12.b :
PTG01_0110_A11.b : ATGTATTAA**CCCCCCAGA*TTTTCATTAACCTATTCCCGAAGGTGCTCCTTGAAATGA
OVRT1_0020_F01.b : ATGTATTAA**CCCCCAGGA*TTTCAGCAAACCTA*TCCAGAAGGTGCTCATTGAAATGA
BFLT1_0047_E05.b : ATGTATTAC**CCCCCAG***ATTTCAGTAACCTA*TCCAGGAAGTGCTCATTGAGATGA
OVRM1_0060_C09.b :
OVRM1_0095_E03.b :
LVRM1_0028_H05.b :
OVR01_0034_D02.b : atttcattaacccccccgcactcccgtatacctatccatccaactggtccttttacctca
SPL01_0065_E11.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCggaagtgctccattgaaataa
KDN01_0061_A03.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
OVR01_0026_D07.b : ATGTATTAAACCCCCCAGGA*ATTCCGTAAACCTA*TCCCGGAAGTGCTCATTGAGATGA
KDN01_0088_H03.b : ATGTATTGA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
OVR01_0063_C06.b : ATGGATTAA**CCCCCAG*A*ATTTagttaaatctatccggaaattgttttttaaaatta
SMG01_0027_D02.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
OVRM1_0223_B07.b :
OVRM1_0010_B12.b : ttact
OVR01_0079_D05.b : ATGTATTAC**CCCCCAGGA*TTTCCAGTAACCTA*TCCAGGAAGTGCTCATTGAAATGA
OVR01_0091_C08.b : ATGTATTAC**CCCCCAGGA*TTTCAGTAAAACTA*TCCAGGAAGTGCTCATTGAAAAGA
LVRM1_0096_G07.b :
CBLT1_0056_G07.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
CBLT1_0063_B06.b : ATGTATTAC**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
THY01_0001_G02.b : ATGTATTAA**CCCCCAGGA*TTTCCGCAAAACTAATCCAGGAATTGCTCATTGAGATGA
OVRT1_0057_C09.b : ATGTATTAC**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
LVR01_0100_D07.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
PCT01_0016_D05.b : ATGTATTAA**CCCCCcagaatttccgtaaacctatccanggaaatgctccatgaaaata
DCI01_0010_B09.b : ATGTATTA***CCCCCAGGA*TTTCAGTTAACCTA*TCCAGGAAGTGCTCATTGAGATGA
CLNT1_0032_D06.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
CLNT1_0042_C06.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCCGGAAGTGCTCATTGAGATGA
THY01_0120_F06.b :
THY01_0106_A05.b :
CLNT1_0027_B09.b : ATGTATTAA**CCCCCAGGA*TTTCAAGTAACCTA*TCCAGGAAGTGCTCATTGAGATGA
ITT01_0065_G01.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
TES01_0099_B07.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
CLNT1_0087_B04.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTCAGATGA
OVRT1_0122_G05.b : ATGTATTAA**CCCCCAGGATTTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
TCH01_0089_A12.b : ATGTATTAA**CCCCCAAGA*TTTTCAT*AACCTA*TCCAGGAATTGCTCATTGANATGA
CLNT1_0058_H07.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
CLNT1_0065_A09.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
AMP01_0070_F01.b : ATGTATTAC**CCCCCAG*A*TTTCAGTAAcctatccggaagtgctcatgaaatgactga
OVRM1_0140_F08.b : tan
SPLT1_0016_E08.b : ATGTAATAA**CCCCCAGGA*TTTC*GTAACCCTA*TCCAGAAAATGCCCATTGAATTGA
CLNT1_0131_E07.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
SPLT1_0006_F07.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
OVRM1_0024_E03.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGaan
OVRT1_0086_B06.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
THY01_0089_C08.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
ILNT1_0050_F07.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
LNG01_0027_C12.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
BKFL1_0086_G12.b : ATGTATTAC**CCCCCAGGA**TTCAGTAAACCTA*TCCCAGGAGTGCTCATTGGGATGA
BKFL1_0055_A11.b : ATGTATTA***CCCCCANGA*ATTCAGGTAACCTA*TCCCAGAAGTGCTCATTGAGATGA
DCI01_0100_D02.b : ATGTATTAC**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
BKFL1_0040_F03.b : ATGTATTAA**CCCCCCAGA*TTTCAGNTAACCTA*TCCAGGAAGTGCTCATTGAGATGA
DCI01_0091_H07.b : ATGTATTAN**CCCCCAGGA*TTTCAGTNAACCTA*TCCCAGAAGTGCTCATTGAGATGA
PST01_0024_C04.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
LVRM1_0116_G02.b : ATGTATTA***CCCCCAGGA*TTTCAGTAAACCTA*TCC
LVRM1_0006_E05.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
PBL01_0077_C06.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
SPL01_0001_B03.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
UTR01_0106_E12.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
UTR01_0052_H02.b : ATGTATTAA**CCCCCAGGA*TTTCAGTAAACCTA*TCCAGGAAGTGCTCATTGAGATGA
20110601C-007465 : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAACGTGAAAGTCATGAGAGCA
---------+---------+---------+---------+---------+---------+ 971
BFLT1_0046_E01.b : CTGATGGGGG*AGTGGACTATTCCTTgagtgtatgggtaccgtgaagtcatgaaaagcac
OVRM1_0074_B12.b :
PTG01_0110_A11.b : CTGATGGGGG*AGGGGACTATTCCTTTGAatggtttggtaaacggaaaatcctgaaaacc
OVRT1_0020_F01.b : CTGATGGGGG*AATGGACTATTCTTTTAA*TGTATTGGTAACGTGAAAGTCATGAAAGCC
BFLT1_0047_E05.b : CTGATGGGGG*AGTGGACTATTCTTTTGAATGTATTGGTAACGTGAAAGTCATGAAAGCA
OVRM1_0060_C09.b :
OVRM1_0095_E03.b :
LVRM1_0028_H05.b :
OVR01_0034_D02.b : acatcccgcgcgcacatgccccccttcccttcatgtgccctggctcccacccaaccccac
SPL01_0065_E11.b : tgaagggggattggaatatcctttgaatgttatggtaacttgaaattccttgaaaccacc
KDN01_0061_A03.b : CTGATGGGGG*AGTGGACTATTCTTTTGAGTGTATTGGTAACGTGAAAATCATGgtgggt
OVR01_0026_D07.b : CTGATGGGGG*AATGGACTATTCCTTTGAGTGGATTGGGAACCGGAAAGTCttgaaaaca
KDN01_0088_H03.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAACGTGAAAGTCATGAGAGCA
OVR01_0063_C06.b : ctgatgggggagtggaatattcccttcgagtgtattggtaacctgaaaactcatgataac
SMG01_0027_D02.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAACGTGAAAATCATGAAAACA
OVRM1_0223_B07.b :
OVRM1_0010_B12.b :
OVR01_0079_D05.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAACCTGAAAagccttgaaagc
OVR01_0091_C08.b : CTGATGGGGG*AGTGGACTATTCCTTTGAAGGTATTGGAAACGTGAAAGTCATtaaaacc
LVRM1_0096_G07.b :
CBLT1_0056_G07.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAACGTGAAAGTCATGAGAGCA
CBLT1_0063_B06.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAACGTGAAAGTCATGAGAGCA
THY01_0001_G02.b : CTGATGGGGG*AGTGAACCATTTCTTTGAGggaatggcaacgtgaaagtcatgaaacacc
OVRT1_0057_C09.b : CTGATGGGGG*AGTGGACTATCCCTTTGAGTGTATTGGTAACGTGAAAATCATGAGAGCA
LVR01_0100_D07.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAACGTGAAAGTCATGAGAGCA
PCT01_0016_D05.b : actgatgggggaaatggacctatttcctttgattgtatgggtaacctggaaattcctgaa
DCI01_0010_B09.b : CTGATGGGGG*AGTGCACTATTCCTTTGAGTGTATTGGTAACGTGAAAATCATGAAAACA
CLNT1_0032_D06.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTAGTAACGTGAAAGTCATGAGAGCA
CLNT1_0042_C06.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAACGTGAAAGTCACGAGAGCA
THY01_0120_F06.b :
THY01_0106_A05.b :
CLNT1_0027_B09.b : CTGATGGGGG*AGTGGACTATTCCTTTGAATGTATTGGTAACGTGAAAGTCATGAAAGCA
ITT01_0065_G01.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAACGTGAAAGTCATGAGAGCA
TES01_0099_B07.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAACGTGAAAGTCATGAGAGCA
CLNT1_0087_B04.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAACGTGAAAGTCATGAGAGCA
OVRT1_0122_G05.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTTACGTGAAAGTCATGAGAGCA
TCH01_0089_A12.b : CTGATTGGGG*ATTGGAACTATCCTTTGATTGTATTGGTAACGTGAAAATCATGAaaaca
CLNT1_0058_H07.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAACGTGAAAGTCATGAGAGCA
CLNT1_0065_A09.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAACGTGAAAGTCATGAGAGCA
AMP01_0070_F01.b : tgggggaatgaactattcctttgaggtaatggntacgtgaaattcatgaaaccacccctg
OVRM1_0140_F08.b :
SPLT1_0016_E08.b : CTGATGGGGG*AATGGgacaattccttttaaggtattggttaacttgaaatttttgaaaa
CLNT1_0131_E07.b : CTGATGGGGG*AATGGACTATCCTTTTGATTGT*TTGGTAACGTGAAAGTCATTAAAACA
SPLT1_0006_F07.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAACGTGAAAGTCATGAGAGCA
OVRM1_0024_E03.b :
OVRT1_0086_B06.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAACGTGAAAGTCATGAGAGCA
THY01_0089_C08.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAACGTGAAAGTCATGAGAGCA
ILNT1_0050_F07.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATGGGTAACGTGAAAGTCATGAGAGCA
LNG01_0027_C12.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAGCGTGAAAGTCATGAGAGCA
BKFL1_0086_G12.b : CTGATGGGGGGAGTGAACTATTCCTTTGAGTGTATTGTTACCGTGAAAATCATGAAAACA
BKFL1_0055_A11.b : CTGATGGGGG*AGTGGACTATCCCTTTGAGTGTAATGGTAcgtgaaaatcatgaaaacaa
DCI01_0100_D02.b : CTGATGGGGG*AGTGAACTATTCCTTTGAGTGTATTGGTAACGTGAAAGTCATGAGAGCA
BKFL1_0040_F03.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATGGGTAACGTGAAAGTCATGAGAGCA
DCI01_0091_H07.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAACGTGAAAGTCATGAGAGCA
PST01_0024_C04.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAACGTGAAAGTCATGAGAGCA
LVRM1_0116_G02.b :
LVRM1_0006_E05.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAACGTGAAAGTCATGAGAGCA
PBL01_0077_C06.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAACGTGAAAGTCATGAGAGCA
SPL01_0001_B03.b : CTGATGGGGGGAGTGGACTATTCCTTTGAGTGTATTGGTAACGTGAAAGTCATGAGAGCA
UTR01_0106_E12.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAACGTGAAAGTCATGAGAGCA
UTR01_0052_H02.b : CTGATGGGGG*AGTGGACTATTCCTTTGAGTGTATTGGTAACGTGAAAGTCATGAGAGCA
20110601C-007465 : GCGCTGG*AGGCCTGCCACAAAGG*CTGGGGTGTCAGCGT*GGTGGTTGGAGTAGCTGCT
---------+---------+---------+---------+---------+---------+ 1028
BFLT1_0046_E01.b : cctggaggcctgccacaaagcctgggttgtcacctggtgtttggatacctgcttcgggcg
OVRM1_0074_B12.b :
PTG01_0110_A11.b : ccctttgaaggcttccccaaaggctgggggtccccctgggggtttgaataacttttttcg
OVRT1_0020_F01.b : GCGCTGG*AGGGCTGCCCCAAAaggctggggggccacctggtggttggaataacctcctc
BFLT1_0047_E05.b : CCGCTGG*AAGCCTGCCACAAAGG*CTGGGGTGTCAACTT*GGTGttggattacctgctt
OVRM1_0060_C09.b :
OVRM1_0095_E03.b :
LVRM1_0028_H05.b :
OVR01_0034_D02.b : taacaaccccccctcccaagccccccccacaacttgctcgcttccctcccgcccttcctc
SPL01_0065_E11.b : cttggaggcctgcccaaaagctggggtttcaacctggtgggttgaattaccgctttcggg
KDN01_0061_A03.b : atgcttagctttgtcccttgtgtgggtgtgtgtaactgcccttttttttagtctaatttc
OVR01_0026_D07.b : ggggcttggaggcctgccccaagggtggggggggtcacgggggggggtggaattatcttg
KDN01_0088_H03.b : GCGCTGG*GAGCCTGCCACAAAGG*CTGGGGTGTCAACTT*GGTGGTTGGAGTAGCTGCT
OVR01_0063_C06.b : aacccttgggagcttgtcacaaaaggctggggtttccatcatggtgggatcgattattct
SMG01_0027_D02.b : ACGCTTG*GAGGCCGCCACAAAAG*CTGGGGTGCCACCGT*GTTGGTTGGAATAACTGCT
OVRM1_0223_B07.b :
OVRM1_0010_B12.b :
OVR01_0079_D05.b : caccctgggagccctgccccaaggctggggggtccccccggtggtttggaataacctcct
OVR01_0091_C08.b : acccttggagcccgccccaaaagctgggggggtcaccgtggtggttggaaaaacctgctt
LVRM1_0096_G07.b :
CBLT1_0056_G07.b : GCGCTGG*AAGCCTGCCAC*AAGG*CTGGGGTGTCACCGT*GTTGGTggaatacctgctt
CBLT1_0063_B06.b : GCGCTGG*AAGCCTGCCACCAAGG*CTGGGGTGTCACCNT*GGTGGTTGGAattactggc
THY01_0001_G02.b : gct
OVRT1_0057_C09.b : GCGCTGG*AGGCCTGGCACAAAagcctggggtgccaccgtggttgtttgaaatacctgct
LVR01_0100_D07.b : GCGCTGG*AAGCCCTGCCACAAGG*CTGGGGTGTCACCGT*GGgtggttggaagtagctg
PCT01_0016_D05.b : accacccctggaagcctgccccaaaggcttggggttcaccctggtgggtggaaaaacctc
DCI01_0010_B09.b : GCGCTGG*AAGCCTGCCACAAAGctggggtgtccccgtgaggtttgaattactgcttcga
CLNT1_0032_D06.b : GCGCTGG*AGGCCTGCCACAAAGG*CTGGGGTGTCANCGT*GGTGGTTGGAGTAACTGCT
CLNT1_0042_C06.b : GCGCTGGAGGGCCTGCCACAAAGG*CTGGGGTGTCAGCGT*GGTGTTTGGAGTAGCTGCT
THY01_0120_F06.b :
THY01_0106_A05.b :
CLNT1_0027_B09.b : GCGCTGG*AGGCCTGCC*CAAAGG*CTTGGGTGTCAGCGT*GGTGGTTGGAATAGCTGCT
ITT01_0065_G01.b : GCGCTGG*ANGCCTGCCAACAAGG*CTGGGGTGTCANCGT*GGTGGTTGGAGTANCTGCT
TES01_0099_B07.b : GCGCTGGGAGGCTTGCCACAAAGGGCTGGGGTGTCANCGT*GTTGTTTGAAGTAACTGCT
CLNT1_0087_B04.b : GCGCTGG*AGGGCTGCCACAAAGG*CTGGGGTGTCAGCGT*GGTGGTTGGAGTAGCTGCT
OVRT1_0122_G05.b : ACGCTGG*AGGGCTGCCACAAAGG*CTGGGGTGTCACCGT*GTGGGTTGGAATAACTGCT
TCH01_0089_A12.b : acccttggaccctgcccaaaagcctgggtgtcaacctggtggtttgaataacttccttcg
CLNT1_0058_H07.b : GCGCTGG*AAGCCTGCCCACAAGG*CTGGGGTGTCAACGT*GGTGGTTGGAGTANCTGCT
CLNT1_0065_A09.b : GCGCTGGAAGCCCTGCAACAANG**CTGGGGTGTCANCGT*GGTGGTTGGAGTAGCTGCT
AMP01_0070_F01.b : gagccctgcccaaaggctgggtgtcaccctgggggttggataactgcttccgaaaaaaat
OVRM1_0140_F08.b :
SPLT1_0016_E08.b : acacccctggaggcctgccaaaaaaggtgggggtttccccgtggtgtttggagtaacctc
CLNT1_0131_E07.b : GCGCTGG*AGGGCctgccacaaggctggggtgtccacttggtggtttgaatacctgcttt
SPLT1_0006_F07.b : GCGCTGG*AGGCCTGCCACAAAGG*CTGGGGTGTCACCGT*GGTG*TTGGAGTAGCTGCT
OVRM1_0024_E03.b :
OVRT1_0086_B06.b : GCGCTGG*AAGCCTGCCACAAAGG*CTGGGGTGTCANCNT*GGTGGTTGGAtanctgctt
THY01_0089_C08.b : GCGCTGG*AGGCCTGCCACAAAGG*CTGGGGTGTCAGCGTTGGTGGTTGGAGTAACTGCT
ILNT1_0050_F07.b : GCGCTGG*AAGCCTGCCACAAAGG*CTGGGGTGTCAACGT*GGTGGTTGGAGTACCTGCT
LNG01_0027_C12.b : GCGCTGG*AGGCCTGCCACAAAGG*CTGGGGTGTCAGCGT*GGTGGTTGGAGTAGCTGCT
BKFL1_0086_G12.b : GCGCTGG*AGGCCTGCCACAAAGctggggtgtccacctggtggtggaatacctgcttcgg
BKFL1_0055_A11.b : cgctggaagccctgcacaaggctggggtgtcancttggtgtttgaatacctgcttccggc
DCI01_0100_D02.b : GCGCTGG*AAGCCCTGCACAAANG*CTGGGGTGTCACCTT*GGTGtttgagtanctgctt
BKFL1_0040_F03.b : CCGCTGG*GAGCCTGNCACCAAGG*CTGGGGTGTCANCTT*GTTGGTTTGAATAACTGCT
DCI01_0091_H07.b : GCGCTGG*AGGCCCTGCACAAANG*CTGGGGTGTCANCGT*GGTGGTTGGAGTAGCTGCT
PST01_0024_C04.b : GCGCTGG*AGGCCTGCCACAAAGG*CTGGGGTGTCANCGT*GGTGGTTGGAGTAGCTGCT
LVRM1_0116_G02.b :
LVRM1_0006_E05.b : GCGCTGG*AGGCCTGCCACAAAGG*CTGGGGTGTCAGCGT*GGTGGTTGGAGTAGCTG
PBL01_0077_C06.b : GCGCTGG*AGGCCTGCCACAAAGG*CTGGGGTGTCAGCGT*GGTGGTTGGAGTAGCTGCT
SPL01_0001_B03.b : GCGCTGG*AGGCCTGCCACAAAGG*CTGGGGTGTCAGCGT*GGTGGTTGGAGTAGCTGCT
UTR01_0106_E12.b : GCGCTGG*AGGCCTGCCACAAAGG*CTGGGGTGTCAGCGT*GGTGGTTGGAGTGGCTGCT
UTR01_0052_H02.b : GCGCTGG*AGGCCTGCCACAAAGG*CTGGGGTGTCAGCGT*GGTAGTTGGAGTAGCTGCT
20110601C-007465 : TCGGGCGAAGAAATCGCCACTCGTCCATTCCAGCTGGTCACAGGCCGCACATGGAAAGGC
---------+---------+---------+---------+---------+---------+ 1088
BFLT1_0046_E01.b : aaaaaatcccccctgtcattccaattggtcaagcccccaatgaaaaggcttgctttggag
OVRM1_0074_B12.b :
PTG01_0110_A11.b : gcaaaaaaattccccctcgttcattccaattgggtcagggcccaactggaaaagcccctc
OVRT1_0020_F01.b : cggcgcaaaaatccccatctgtccttccagttggtccaaggccaaattggaaaggcttgc
BFLT1_0047_E05.b : cgggcaaaatttccccctcgcccatccacctggccaagcccgcaatggaaaggcctgcct
OVRM1_0060_C09.b :
OVRM1_0095_E03.b :
LVRM1_0028_H05.b :
OVR01_0034_D02.b : tcccacaccctcctcctcttcgctctacctctaacctctccctcttcttcctccctcctc
SPL01_0065_E11.b : caaaaaaaccgct
KDN01_0061_A03.b : cttaactaagataaaaaaaatggttttataaaggaaaggtttcctgataaaaattgctct
OVR01_0026_D07.b : cttcgggggaaaaaaaatccccacctctccctttcccacttgggcccagggcccccacat
KDN01_0088_H03.b : TCGGGCaagaaaatcgcactcgtccatccaactggtcacaagcgcacatggaaagcactg
OVR01_0063_C06.b : ttttctagctaaaaaaatatcccgtctttcaattctttttggtaatactacttacatgga
SMG01_0027_D02.b : TCGGGCCAGAAATCGC*CACTCGTCCATTCCActggtcacaggcccactggaaaggactg
OVRM1_0223_B07.b :
OVRM1_0010_B12.b :
OVR01_0079_D05.b : tcgggccaaaaaaacccccccctctcccattcccgggtgggccccgggcccccccaggga
OVR01_0091_C08.b : cgggcaaaaaaatcccccacccgccattttccacgtgggcccaggccccccaatggaaaa
LVRM1_0096_G07.b :
CBLT1_0056_G07.b : cgggcgaaaaatcgcactcgtcctttcagctggtcaccggccccaatgaaaggccctgct
CBLT1_0063_B06.b : tcgggccgaanaaatccccctcgtcaattcagctgggtccaggccgccaatggaaaggcc
THY01_0001_G02.b :
OVRT1_0057_C09.b : tcgggcaaaaaaatcgccattcctccattccagctgggtcaaggccgcaaatggaaaagg
LVR01_0100_D07.b : cttccggggcaaaaaaatcgccccttctctcctttcccgcctggtccccgggcccccaca
PCT01_0016_D05.b : ctttgggcaaaaaaatcccattcgccatttcccactggtccaaggtccaaaagaaaaggc
DCI01_0010_B09.b : gcgaaaaatccccactctcccttccgctggtccaagccgcaatggaaaggcctgcgtttg
CLNT1_0032_D06.b : TCGGGCGAAGAAtcgcccctcgtccatccagctggtcacagccgcacatggaaagcactg
CLNT1_0042_C06.b : TCGGGCGAAGAAATCGGCACTCGTCCctttccagctggtcccaggcccgcaaatgtgaaa
THY01_0120_F06.b :
THY01_0106_A05.b :
CLNT1_0027_B09.b : TCGGGCGAAaaaatcgcattcgtccattcagcttggtccaggccccacatgaaaggcact
ITT01_0065_G01.b : TCGGGCGAAGAAATCGCCACTCGTCCATTTCAGCTGGTCACAGccgcacatgaaaagcac
TES01_0099_B07.b : TCGGGCGAAGAAATCGgccactcctcattccaactggtcaccagccgaaatgaaaagcac
CLNT1_0087_B04.b : TCCGGCGAAGAAtcgccactcgtccatccagctggtcacggccgcacatggaaggcactg
OVRT1_0122_G05.b : ccggcgaagaaatcgcccttcttccttccagctggtcacaggccccacatggaaagcctc
TCH01_0089_A12.b : ggcaaaaaaatccccactcctcctttccaactggttcaaagcccaaatgaaaaaggcctc
CLNT1_0058_H07.b : TCGGGCaaaaaatcgccactcgtccttccaactggtccaggccggaaatggaaaggcctg
CLNT1_0065_A09.b : TCGGGCGAAGAAATCGCactcgtccattcagctggtcacaggccnacatggaaaggcact
AMP01_0070_F01.b : ccccttcctcctttccacgggcccggcccaaatggaaaggcctcctttggaggaggaaaa
OVRM1_0140_F08.b :
SPLT1_0016_E08.b : tttggggagaaaaaaagcccatttttccatttccgctgggtacaagggcccaattgaaaa
CLNT1_0131_E07.b : cgggcaaaaaattcccaccccttcctttcactctggtcaagggccgccaaggaaaaggcc
SPLT1_0006_F07.b : TCGGGCGAAGAAATC*CCACTCGTTCATT*CAGCTGGTCACAAGGCGCACATGGAAAAGC
OVRM1_0024_E03.b :
OVRT1_0086_B06.b : cgggcgagaaatcgcactcgtccattcagctggtcacaggcgcacatggaaagcactgcg
THY01_0089_C08.b : TCcgggcgaaaaaatccccacctcttccatttccagctggtcacagggccccacatggga
ILNT1_0050_F07.b : TCGGCCGAA*AAATCGCCACTCGTTCATTTCAGCCGGTCACAAGCCGCACATGGAAAAGG
LNG01_0027_C12.b : TCAAGCGAAAAAATCGCCACTCCTCCATTCCAGCTGGTCACAGGCCGCACATGGAAAGGC
BKFL1_0086_G12.b : gcgaaaaatcgccatcgtccattcaactgggcaaggccgcattgaaaaggcctgcttttg
BKFL1_0055_A11.b : aaaaaatcgccatcctccatccacttggccaaggcccaatgaaaggccttccttttgagg
DCI01_0100_D02.b : cnggcaaagaatcgccactcgtccattcagctggtcacaggcgcacatggaaggcactgc
BKFL1_0040_F03.b : TCGGGCGAAAAAATCGCantcgtccattcagctggtccaaggccgccaatggaaagcact
DCI01_0091_H07.b : TCGGGCGAAGAAATCGCCACTCGTCCATTCCAGCTGGTCACAGGCCGCACATGGAAAAGC
PST01_0024_C04.b : TCGGGCGAAGAA*TCGCCACTCGTCCATTCCAGCTGGTCCACAGCCGCACATGGAAAGGC
LVRM1_0116_G02.b :
LVRM1_0006_E05.b :
PBL01_0077_C06.b : TCGGGCGAAGAAATCGCCACTCGTCCATTCCAGCTGGTCACAGGCCGCACATGGAAAGGC
SPL01_0001_B03.b : TCGGGCGAAGAAATCGCCACTCGTCCATTCCAGCTGGTCACAGGCCGCACATGGAAAGGC
UTR01_0106_E12.b : TCGGGCGAAGAAATCGCCACTCGTCCATTCCAGCTGGTCACAGGCCGCACATGGAAAGGC
UTR01_0052_H02.b : TCGGGCGAAGAAATCGCCACTCGTCCATTCCAGCTGGTCACAGGCCGCACATGGAAAGGC
20110601C-007465 : ACTGCGTTTGGAGGATGGAAGAGTGTAGAAAGCATCCCAAAGTTGGTGTCAGAATACATG
---------+---------+---------+---------+---------+---------+ 1148
BFLT1_0046_E01.b : gatgaaaagggaaaagctcccaaattggggccgaaactgtgcaaaaaaaaggtggagaat
OVRM1_0074_B12.b :
PTG01_0110_A11.b : ctttggggggaggaaaagtgtaaaacccccccagtgtggggtaaaaaaacgggcccaaaa
OVRT1_0020_F01.b : tttggaggaggaaaaggtataacgctcccaattttggggccaaaacatgtccacaaaaat
BFLT1_0047_E05.b : ttggagagtgaaatgtaaaacctctccagttggtgtcaaatcttggccaaaaaaaaggtg
OVRM1_0060_C09.b :
OVRM1_0095_E03.b :
LVRM1_0028_H05.b :
OVR01_0034_D02.b : ctctccgctctccccccccccctctctctccctacggcccccttttcttcttcctcccac
SPL01_0065_E11.b :
KDN01_0061_A03.b : actaaaagaaagggaaaatactttttgaactaaaatgggggaatgaataccttacgctcc
OVR01_0026_D07.b : gggaaaagggcacttggtttttggaggggagggaaaaaaggggtaaaaaaagacattccc
KDN01_0088_H03.b : cttttgnagatgaaaaatggaaaagcatccaaagttggggcaaaatcatgtcaaaaaata
OVR01_0063_C06.b : aatgcctccctcttttttctgagtaatacaatcatcaatcatttctcccattttatcttc
SMG01_0027_D02.b : cttttggagatggaaaatgaaaaagcttccaaagttgggccaaatattgtccaaaaaaaa
OVRM1_0223_B07.b :
OVRM1_0010_B12.b :
OVR01_0079_D05.b : aaaggccctgctttttggaggagggaaaaaggtaaaaagccctcccccaagttgggggtc
OVR01_0091_C08.b : gggcactgcttttggaaggatggaaaaaggtaaaaagcctccccccagattgggggccaa
LVRM1_0096_G07.b :
CBLT1_0056_G07.b : tttggaggaaggaaaatttaaaaacatcccaaattggtgttaaaatcatttcaaaaaaaa
CBLT1_0063_B06.b : tgcctttggaggatgaagaatgtaaaaacctccccaagttgggtcaaattactgtcaaaa
THY01_0001_G02.b :
OVRT1_0057_C09.b : cacttcttttggaggaaggaaaattgaaaaaacctcccaaaagtggggtccaaataaatg
LVR01_0100_D07.b : tgggaaaagggccttgcctttttggaaggaatggaaaaaaagggtaaaaaaagccatccc
PCT01_0016_D05.b : ctgcctttggggaagaaaaatttaaaacactcccaaattggggtccaaaacttgtccaaa
DCI01_0010_B09.b : aagatggagattgtaaaaccctccaggtggggtccgatactgtccaaaaatgagggtgat
CLNT1_0032_D06.b : cgtttggagatggaagaatgtaaaaagctccaaaattggtgtcaaaatactgtcaaaaaa
CLNT1_0042_C06.b : gcactggcgtttggagaatggaaaagtgtaaaaagcttcccaaatttgggtgtcaaaata
THY01_0120_F06.b :
THY01_0106_A05.b :
CLNT1_0027_B09.b : tcccttggaggatgaaaaatgtaaaaacctcccaagtttgggtcgaataatggtccaaaa
ITT01_0065_G01.b : tgcgtttggnagatggagattgtaaaaagcatccccaagtggtgtcagaatactgtccaa
TES01_0099_B07.b : tgcnttggaaggatgaagaatgtaaaaacatcccaaatttgggtcaaaatcatgtccaaa
CLNT1_0087_B04.b : cgtttggagatggaagatgtaaaagcatccaaagttgtgtcagatacatgtcaaaaaaaa
OVRT1_0122_G05.b : tctttgggagaatgaaaatttaaaaaccctccaagttgggtttaaatcttgtcccaaaaa
TCH01_0089_A12.b : ccttttggagaaagaaaaaattaaaaacttcccaaattttggccctaaaaatttttccaa
CLNT1_0058_H07.b : cgtttggaggatgaaaaatggaaaagcatcccaaatttgtgtccgataactgccaaaaaa
CLNT1_0065_A09.b : gctttggnagatgnnagatgtaaaagcatccaaagttgtgtcaaatacttgtcaaaaaat
AMP01_0070_F01.b : tgtaaaaccccccaagtgggttccaatactgcccaaaaaataaggtgatgaatttggacc
OVRM1_0140_F08.b :
SPLT1_0016_E08.b : ggccttgctttttgggagaggaaaaattttaaaacccctcccaaagttggggtctaaaaa
CLNT1_0131_E07.b : ttctttggaagaatggaaaatgtaaaaccctcccaaattggttccaaaaactgtccaaaa
SPLT1_0006_F07.b : ACTGCNTTTTGAGGATGGAAaaatgtaaaaacctcccaaagtggtgtccaaataatgtca
OVRM1_0024_E03.b :
OVRT1_0086_B06.b : tttggagatggagagtgtaaaagctcccaaagttgtgtcaaatactgtcaaaaaaaaagg
THY01_0089_C08.b : aaggcactggcgtttgggaagaaaggaaaaagggtaaaaaaggcttcccaaaattttggt
ILNT1_0050_F07.b : CCTGCTTTTGGAAGATGGAAAAATGTAAAAAGCTTCCAAAGTT*GGTGTCAAAAAACTTT
LNG01_0027_C12.b : ACTGCTTTTGGAGGATGGAAAAGTGTAAAAAGCATCCCAAAGTTGGTGTCAAAATACATG
BKFL1_0086_G12.b : gagaggaaaatttaaaaccctcccaattggggtccaaaactgtccaaaaaaaaggtaaaa
BKFL1_0055_A11.b : aaggaaaatgttaaacctcccaaaatggtgtcaaaaactgttccaaaataaagggaaaaa
DCI01_0100_D02.b : ctttggaggatggagagtgtaaaagcttcccaaattggtgtcagattcatgtcaaaaaaa
BKFL1_0040_F03.b : gcctttgaagatgaaaaatgtaaaagcctcccaagttggtgtcgaaacatgtccaaaaaa
DCI01_0091_H07.b : ACTGCGTTnnggaggatggagaatgtaaaangcatccaaaagtggtggtcgaatacatgt
PST01_0024_C04.b : ACTGCGTTTGGAGGATGGAAGAGTGTAAAAAGCATCCCAAAGTggtgttcagatacatgg
LVRM1_0116_G02.b :
LVRM1_0006_E05.b :
PBL01_0077_C06.b : ACTGCGTTTGGAGGATGGAAGAGTGTAGAAAGCATCCCAAAGTTGGTGTCAGAATACATG
SPL01_0001_B03.b : ACTGCGTTTGGAGGATGGAAGAGTGTAGAAAGCATCCCAAAGTTGGTGTCAGAATACATG
UTR01_0106_E12.b : ACTGCGTTTGGAGGATGGAAGAGTGTAGAAAGCATCCCAAAGTTGGTGTCAGAATACATG
UTR01_0052_H02.b : ACTGCGTTTGGAGGATGGAAGAGTGTAGAAAGCATCCCAAAGTTGGTGTCAGAATACATG
20110601C-007465 : TCCAAAAAAATAAAGGTTGATGAATTTGTGACTCACAATCTGCCTTTTGACCAAATAAAC
---------+---------+---------+---------+---------+---------+ 1208
BFLT1_0046_E01.b : tggcccccaacgccttttacaaaaaaaaacctttaaggtctcggggaaaactctcaagct
OVRM1_0074_B12.b :
PTG01_0110_A11.b : aaaaaggtgaaaaaattggtgacccaacccccctttttgccaaaaaacaaaccctttaaa
OVRT1_0020_F01.b : aaggtgaaaaattggggacaaaacgcctcttgacaaaaaacaacccctttatgtgcgcgg
BFLT1_0047_E05.b : agatttggaacccaatcgctttgacaaaaaaaaccttgaatgggcggcgggaaaatccaa
OVRM1_0060_C09.b :
OVRM1_0095_E03.b :
LVRM1_0028_H05.b :
OVR01_0034_D02.b : aattattcc
SPL01_0065_E11.b :
KDN01_0061_A03.b : gggaaggtggaaaaaaatttcctggcctttccttggaggcaaatcttccttctttaaaca
OVR01_0026_D07.b : caaaaaggttgggggtgtccaaaaaaaaacatggtgcccaaaaaaaaaaaaaataaaaag
KDN01_0088_H03.b : aagtggatgattgggaatccaatcgccttttaccaataaacaaccctggactgagcttgc
OVR01_0063_C06.b : aaaaaactcacacaaaacaccatgcctgataataattacatatcaccattttaccctcac
SMG01_0027_D02.b : gggtgaagaatttgaccccaatctgcctttgacaaaaaacaaccttttaagtggctgtgc
OVRM1_0223_B07.b :
OVRM1_0010_B12.b :
OVR01_0079_D05.b : aaaaaacattttcccacaaaataaaagggtggagagatttttggacctcccacactcgcc
OVR01_0091_C08.b : aaatactgtccccaaaaaatataaaggttgaagaaattttgggaacccacaactcgcctt
LVRM1_0096_G07.b :
CBLT1_0056_G07.b : aaggtgaagaatttggaaccacaaccgcctttgaccaaaaaacaaacctttaaactggtt
CBLT1_0063_B06.b : aataaaggtgaagattttggacccacatccgcctttttaccaataaccaaccttttaatt
THY01_0001_G02.b :
OVRT1_0057_C09.b : tccaaaaaataaggtggaaaatttgggacccacnactgccttttaccaataaacaaaacc
LVR01_0100_D07.b : ccaaagatttggggggtcacaaaaaaaccatttttcccaaaaaaaaaaaaaaaaaagggt
PCT01_0016_D05.b : aaaaaaggttaaaatttggagccccaatcgcctttaccaaaaaaaaaacccttttttgtg
DCI01_0010_B09.b : gatttggaccccattcgcctttgacaaaaaacaacctttaacggggtgcaggaaaacccc
CLNT1_0032_D06.b : taaaggtgatgaattgtgaccccatctgcctttgacaaataacaagccttgactgaggct
CLNT1_0042_C06.b : cctgtccaaaaaaaaaaaggttggggaatttggggacccaaatccggctttttgaccaaa
THY01_0120_F06.b :
THY01_0106_A05.b :
CLNT1_0027_B09.b : aaataagttgaaaaattgtgactcaaatccgcttttgaccaaaaacaacccttgtaatga
ITT01_0065_G01.b : aaaataaaggttgatgatttgtgactcacatctgccttttgaccaataaacaagctttga
TES01_0099_B07.b : aaataagggttataaattgggaaccaaatcggcctttgacaaaaaaacaaacctttgact
CLNT1_0087_B04.b : taaggtgatgaattttgaccccaactgcctttgccaataaacaaaccttaaatgatcgtg
OVRT1_0122_G05.b : taaaggtgtaaatttgtacccaaattcgcctttacaaaaaaaaaacctttaatgattctg
TCH01_0089_A12.b : aaaaaaaanttttaaatttttnacatcaaaatcccctttaaaaaaaataaaaaacctttt
CLNT1_0058_H07.b : aaagggtggagaattggggacccaaccggcctttgacaaataacaagccttgaactgtgc
CLNT1_0065_A09.b : aaggtgatgattgggactccaactgcttttgacaaataagaacctttgaatgtggtgcgg
AMP01_0070_F01.b : ccatctgccctttaacaaaaacccaacccttgaatgaggcggccgggaaaaccccccaca
OVRM1_0140_F08.b :
SPLT1_0016_E08.b : attttcccaaaaaaaaagaggttaaaaaatttgtggccccccaccttctcttttaataaa
CLNT1_0131_E07.b : aaaaaggtgaaaaatttgaacccaaacggcttttgacaataaaaaaactttaatgagcct
SPLT1_0006_F07.b : aaaaaataaaggtgatgatttgtgattcccatctgcttttgaccaataaccaaaccttta
OVRM1_0024_E03.b :
OVRT1_0086_B06.b : tgatgatttgtgatcaaatctgccttgaacaataacgagcctgaaatgatctgcgggaaa
THY01_0089_C08.b : gtcaaaaaatccttgttccaaaaaaataaaagggtttaagaaaattttgtgaactcccaa
ILNT1_0050_F07.b : TCCAAAAAAAaaaggttgaagatttggaactcaaaccgccttttgacaataaacaaaccc
LNG01_0027_C12.b : TCCCAAAAAAT*AAAaggttaatgaaattttttgactcccaaatctgccctttttgaacc
BKFL1_0086_G12.b : attggacccaaccgccttgaccataaacaactttatggttctgcggaaaacttcaaagcc
BKFL1_0055_A11.b : ttttgccccaacccccttttcacaaataaaaaccttaaattgtcggggggaaaactccaa
DCI01_0100_D02.b : aaaggtgaggattttggactccaatcggcctttgaccaaaaaccaaacctttaactgtgc
BKFL1_0040_F03.b : taaaggtgaaggattgggaccccaacggcctttgcccaaaaacaaactttttatttgttc
DCI01_0091_H07.b : cccaaaaaaaaaggtggaggatttgggactcccatctgcctttggaccaataacaaacct
PST01_0024_C04.b : tccaaaaaataaagttgatgaatttgtgactcacatctggctttgacaaataaacgaact
LVRM1_0116_G02.b :
LVRM1_0006_E05.b :
PBL01_0077_C06.b : TCCAAAAAAAT*AAGGTTGATGAATTTGTGACTCACAATCTGCCTTTTGACCAA*TAAAC
SPL01_0001_B03.b : TCCAAAAAAATAAAGGTTGATGAAATTGTGACTCACAATCTGCCTTTTtgacaaataaaa
UTR01_0106_E12.b : TCCAAAAAAATAAAGGTTGATGAATTTGTGACTCACAATCTGCCTTTTGACCAAATAAAC
UTR01_0052_H02.b : TCCAAAAAAATAAAGGTTGATGAATTTGTGACTCACAATCTGCCTTTTGACCAAATAAAC
20110601C-007465 : GAAGCCTTTGAACTGATGCATGCAGGGAAAAGCATCCGAACAGTCATAAAGCTTTAAATT
---------+---------+---------+---------+---------+---------+ 1268
BFLT1_0046_E01.b : taattttttttaaaaaaaattttcccctttcccattttgtggggtggggccccaaggggg
OVRM1_0074_B12.b :
PTG01_0110_A11.b : ttggtgtggggggaaaactctccaacactataaattttttttttaaaaaaaaaattttcc
OVRT1_0020_F01.b : gggaaacctccacacattaaattttttttacaaaaaaatttccctcctccccccattttg
BFLT1_0047_E05.b : ccctaaactttttcaaaaaaatttgcccttcccactttggggtttggaccccacaggggg
OVRM1_0060_C09.b :
OVRM1_0095_E03.b :
LVRM1_0028_H05.b :
OVR01_0034_D02.b :
SPL01_0065_E11.b :
KDN01_0061_A03.b : aaaaaagatgtatttttaaaaactgggctttgaaataaaanacaccccttccaacccggg
OVR01_0026_D07.b : gggggtgaataaagaaaaattttt
KDN01_0088_H03.b : gggaaacctccaacgtctaaactttatttaaaaaaaaatttccctcctacccaaactggg
OVR01_0063_C06.b : cct
SMG01_0027_D02.b : ggaaacttccaactttaaaacttagttcaaaaaaaaaatttccccctgtgcccacctggg
OVRM1_0223_B07.b :
OVRM1_0010_B12.b :
OVR01_0079_D05.b : ctttgacccaaaaaaccaaaacctttgtaagcgggtgcgtg
OVR01_0091_C08.b : ttttgccaaataaacgaaacctcttttaatt
LVRM1_0096_G07.b :
CBLT1_0056_G07.b : ggcgggaaaacccccaaacgtctaaactttttttctaagaaaaaaatttccttctttccc
CBLT1_0063_B06.b : gagcctggggggaaacctccaacaattctaagctttaattcaaagaaaaatttgcctcct
THY01_0001_G02.b :
OVRT1_0057_C09.b : ttgaactgggcctggcggaaaaacctccaaaaagctgttacttttatttcaaaaaaaaat
LVR01_0100_D07.b : tggaaaaaaatattttttgttggaaactccccaccaaaaatccccccgcccccctttttt
PCT01_0016_D05.b : ggtgggggaaaaaccccaaccttttattctttttttaaaaaaaaattttcccccctcccc
DCI01_0010_B09.b : aaagcttaacttaaaaaaaagaaattgccccttccccagttgggcgattgaacccagaga
CLNT1_0032_D06.b : gcggaaaacctccaaagtctataacttatttaaaaagaaattggccccctgcccaatcct
CLNT1_0042_C06.b : taacagaaacttttgaactgaggcatgccgggaaaaactccccaacagccttaagccttt
THY01_0120_F06.b :
THY01_0106_A05.b :
CLNT1_0027_B09.b : ggctgcgggaaaacctccaaaagcttaagcttttttctaaagaaaaattgtccccctgtc
ITT01_0065_G01.b : actgatgctgcagggaaaacctcgaacgtcttaagcttaagttcaaaaaaaaatttttcc
TES01_0099_B07.b : taagctggcgggaaaactcccaaacatctaaacttttattcaaaaaaaaaatttcccccc
CLNT1_0087_B04.b : cgggaaacctcaaaatccaaaccttaatttaaaaaaaattttcctcctgccccatttggg
OVRT1_0122_G05.b : tgggaaacaccccaacgtttaagcttttagttaaagaaaaattttcccctctcccagttt
TCH01_0089_A12.b : atttaaaaatntttaaaagaacactataattttt
CLNT1_0058_H07.b : gggggggaaacttccaacattctaacttttattcaaaaaaaaattgcccccttcccaatc
CLNT1_0065_A09.b : gaaaactccaaaaccttaaattttatcaaaaaaaaatggccccctgccccattttggtcg
AMP01_0070_F01.b : ccttaaccttaatatcaaaaaaaattc
OVRM1_0140_F08.b :
SPLT1_0016_E08.b : aaaaaacaaccccttataaatgatgtggggggaaaaacctcccaaatctatatgtttttt
CLNT1_0131_E07.b : gcggggaaaccccaacattaaacttttttttaaaaaaaattttcccctttccacttttgt
SPLT1_0006_F07.b : actgatcttgcaggaaaaactccaaaattcaaaactttatttcaaaaaaaattttccccc
OVRM1_0024_E03.b :
OVRT1_0086_B06.b : gatccaacgtcctaagcttaattaaaaaaaaaattgtctcctggcccaatttgggctgtg
THY01_0089_C08.b : attcctgcccctttttgacccaaaattaaaaccaaaaaccctttttgaaattgtaaagcc
ILNT1_0050_F07.b : tttaaatgaagcgtgcggggaaaacactccaacattcaaaaccttaatttcaaaaaaaaa
LNG01_0027_C12.b : aaaataaaaacaaaaccccttttaaaatttgattggcctgggccggggggaaaaaaaaac
BKFL1_0086_G12.b : taaattttttccaaaaaaaattccccctcccaaattgtggtcatggcccccaaagggggg
BKFL1_0055_A11.b : acctttaattttttttaaaaaaaattttccccctcccaactttggggtatgggcccccaa
DCI01_0100_D02.b : ctgcgggaaaacatccaaacccctaaaccttaattcaaagaaaaattttccctcctgtcc
BKFL1_0040_F03.b : gggggaaaaattccacacttaaacttttttctaaaaaaattttcccccggccccatttgg
DCI01_0091_H07.b : ttggactatgcgtgccgggaaaacttctaacaagcttaaactttattctaaaaaaaaatt
PST01_0024_C04.b : tttgactgatgctgccaggaaaacatccgacagtcttaagctttaattcaaaaaaaaaaa
LVRM1_0116_G02.b :
LVRM1_0006_E05.b :
PBL01_0077_C06.b : GAAGCCTTTG*ACTGATGCATGCAGGNAAAgcatccgacagtcataagctttagttcaga
SPL01_0001_B03.b : caagccctttgaactgatgcatggcagggaaaaacatcctaaacagtctaaaaactttta
UTR01_0106_E12.b : GAAGCCTTTGAACTGATGCATGCAGGGAAAAGCATCCGAACAGTCACAAAGCTTTAAATT
UTR01_0052_H02.b : GAAGCCTTTGAACTGATGCATGCAGGGAAAAGCATCCGAACAGTCATAAAGCTTTAAATT
20110601C-007465 : CAAAAAGAGAAAAATTTGTCCCTCCTTGCACCCAAGTCTTGTGGTCTGATTGGAGCAGCC
---------+---------+---------+---------+---------+---------+ 1328
BFLT1_0046_E01.b : gggtttttttcccccttctattttaaacctggggaagtt
OVRM1_0074_B12.b :
PTG01_0110_A11.b : cctttgccccattttgggttgtgtgtgccccccacaccggggaagcctttttataaaact
OVRT1_0020_F01.b : gtgttggacccccaaggggggaactttttatccccctctaactttatatctggaaaattt
BFLT1_0047_E05.b : gtcttattccctcttaactttacctgggagatttggataactctaggaaacagggaatgt
OVRM1_0060_C09.b :
OVRM1_0095_E03.b :
LVRM1_0028_H05.b :
OVR01_0034_D02.b :
SPL01_0065_E11.b :
KDN01_0061_A03.b : ccttgagaacattttttaacactttcctcggggaaaacagggtgacctgcaaacttggcg
OVR01_0026_D07.b :
KDN01_0088_H03.b : ttgatggaccccaaaacgggggaacctttcagtacactcttagacttaacccctgggaaa
OVR01_0063_C06.b :
SMG01_0027_D02.b : gcctttggacccccaaaacgggagacttttttttcccccttttaactttaaccctctggg
OVRM1_0223_B07.b :
OVRM1_0010_B12.b :
OVR01_0079_D05.b :
OVR01_0091_C08.b :
LVRM1_0096_G07.b :
CBLT1_0056_G07.b : aattggtggttttttggaaacccacaacagggaaacctttttattcccgctcctacactt
CBLT1_0063_B06.b : ttccccagtttttgggtattgtggccccaaaaagggggggacctttaatttcccttttaa
THY01_0001_G02.b :
OVRT1_0057_C09.b : ttttccctcttttcccaaattttgggcttgttgggaccccccaaccggggggaatctttt
LVR01_0100_D07.b : tgttgaacacccccaaaaaataaaaaaaaaacaccca
PCT01_0016_D05.b : cacttgggtgttgtgaaaacccaaacaaagggagatttttttaaccccttttttccttta
DCI01_0010_B09.b : ggggacttctgttcctcttaaccttgcaccgggaagtttgaaaaaagtcaaaggaaactt
CLNT1_0032_D06.b : gggctgttggaccccccaaaccggagaccttctagttcccttcttaaccttttaactcct
CLNT1_0042_C06.b : aatttcacaaaagagaaatttgtcccccttgcacccaactctgtggctcgtgtggaaccc
THY01_0120_F06.b :
THY01_0106_A05.b :
CLNT1_0027_B09.b : accaatctggggcttattgacacccaaacacggggaaccttttattcagtttctttacct
ITT01_0065_G01.b : ccttgccccaaatcttgggctcgatgggacccccaaacaccggaggacccttttatttca
TES01_0099_B07.b : tgcccccaatcttggtcctttttgaaccccaacaaccgggggaatctttcatttaaattt
CLNT1_0087_B04.b : gttgttggaccccaaaaacgggaaaattttttagtcactctcttaacctttaacccctgg
OVRT1_0122_G05.b : tgggtgtttggcacccaaaagcgagggagcttttattccccttttaacttttacacttgg
TCH01_0089_A12.b :
CLNT1_0058_H07.b : tgtgggtcgttggcgccccaaagcgggggaaccttttagtccacttccttaactctttaa
CLNT1_0065_A09.b : tattggcccaaaacgggggaaccttttttaactcctaacctttaaactcgggaaaattgg
AMP01_0070_F01.b :
OVRM1_0140_F08.b :
SPLT1_0016_E08.b : atttaaaaaaaaagattttccccctctctcccctatttgtggtgtgttggggcgccccca
CLNT1_0131_E07.b : tttgttggaccaacaaaggggagactttttttaccttttaaatttaacatctggagaatt
SPLT1_0006_F07.b : ttccccaatctggggttattggaccccaaaaacgggggacctttcattcagttcctaacc
OVRM1_0024_E03.b :
OVRT1_0086_B06.b : ggcccccaaaacgggggaatcttagttccggttcttaaactttataccttgggaagattt
THY01_0089_C08.b : catggccggggggaaaaaaaaccctcctcccaaaaacacacttctttttaaaaacccttt
ILNT1_0050_F07.b : attgtccccctgcacccattttggggttgatggacccccaacaccgggggaactttttag
LNG01_0027_C12.b : ccacccccaaaaacacaactttccctataaaaaaacccctcttttttta
BKFL1_0086_G12.b : acccttcccctcttaccctacacttggaaaattttgaaaaaactcttaggaaaccgggaa
BKFL1_0055_A11.b : agggggagtctttttccctcttaattttaccccaggaaatttttgaaaaa
DCI01_0100_D02.b : caatcttgggtctatgggcccccacagccgggggaactttaattcacc
BKFL1_0040_F03.b : ggctttgggacccaaaaagggagagcctttttcccctcctacctcttccctccgaggaat
DCI01_0091_H07.b : ttcccccttccccaactttgggtcgttgggacccccaaacggggagacttttnttcgctc
PST01_0024_C04.b : ttgtcctccttgacccaatcttggggctgattgtacacccaaaaacagagagaaccctca
LVRM1_0116_G02.b :
LVRM1_0006_E05.b :
PBL01_0077_C06.b : gagaaaatttgtccctcctgcacccnagtctgtgtctgattggagcaccaacagcaggna
SPL01_0001_B03.b : atttcaaaaaaaaaaaaatt
UTR01_0106_E12.b : CAAAAAGAGAAAAATTTGTCCCTCCTTGCACCCAAGTCTTGTGGTCTGATTGGAGCAGCC
UTR01_0052_H02.b : CAAAAAGAGAAAAATTTGTCCCTCCTTGCACCCAAGTCTTGTGGTCTGATTGGAGCAGCC
20110601C-007465 : AGACAAGCAGGGAGGAGCTCTTTCAAGTTCACAGCTTCCTTAGACCTTCATTAACCTACT
---------+---------+---------+---------+---------+---------+ 1388
BFLT1_0046_E01.b :
OVRM1_0074_B12.b :
PTG01_0110_A11.b : tttttaaacatataaaaaaat
OVRT1_0020_F01.b : gggaataacttctgaggaaact
BFLT1_0047_E05.b : gtgcctcccgggcctggatttttaggttcaaaaaaaagaggggggggaaaaacccccaaa
OVRM1_0060_C09.b :
OVRM1_0095_E03.b :
LVRM1_0028_H05.b :
OVR01_0034_D02.b :
SPL01_0065_E11.b :
KDN01_0061_A03.b : aagaaacaccccgaaaatagggccacccgccggggctttaaagaacttaatatggcaaat
OVR01_0026_D07.b :
KDN01_0088_H03.b : agttttgaaaacaatcttataggaaacttcgttaa
OVR01_0063_C06.b :
SMG01_0027_D02.b : aaaattttggaaaaaaatctctaagggaaacccggggaaaatttttggcctctcaagggg
OVRM1_0223_B07.b :
OVRM1_0010_B12.b :
OVR01_0079_D05.b :
OVR01_0091_C08.b :
LVRM1_0096_G07.b :
CBLT1_0056_G07.b : taaccccccggaaaaattttgagaaaaaaactctataggaaaaccncgcgaaaatgttgg
CBLT1_0063_B06.b : accctttaccaccaggaaagttctggaaacccatttcttagggaaaacacggggaaaatt
THY01_0001_G02.b :
OVRT1_0057_C09.b : atttccctttcctaaactttttaaccccggggaaaaatttctggaaacaccactctaaag
LVR01_0100_D07.b :
PCT01_0016_D05.b : tatcctggggaaaatttttgtagaaaaaccttctaagaaaacattttgaattttttttcc
DCI01_0010_B09.b : gtttatttggccctccacgggattgaatttataaaaataaa
CLNT1_0032_D06.b : gggaaaattttggaaaaacatctttaaggaaaacccgggaaatgtttggcctcttcaaag
CLNT1_0042_C06.b : cccaaacacggggggagaccttttagttctcacgttcttaaacctctttacaactccttg
THY01_0120_F06.b :
THY01_0106_A05.b :
CLNT1_0027_B09.b : ttaacccctgggaaagatttcggaaaaaaaccttaaaggagaacacggcgaaattttttg
ITT01_0065_G01.b : acctccttaaccttattaacaacccggggaaaaattttctggaaacacaatcctaaaagg
TES01_0099_B07.b : cttaaaccttttaccacctaggaaaaatttctggaaaaccaagtctttaaggaaaacacc
CLNT1_0087_B04.b : gaaaattttgggaaaaaaattttaaagaaaaccacgggaaaattttttggccttctcaag
OVRT1_0122_G05.b : gagaattttgggataaattttataggaagaattcggtaattttgtggctctccagggggc
TCH01_0089_A12.b :
CLNT1_0058_H07.b : cccttggagaaattttgggaaacaagccttaagggaaaacgggggaaaagtttttaaact
CLNT1_0065_A09.b : ggaaaaaatcttcagaaaacatgcgaagttttttttcctcacggcgccgaggtttttata
AMP01_0070_F01.b :
OVRM1_0140_F08.b :
SPLT1_0016_E08.b : acacgggggggggcctttttatgtacagccctgaaaactttataaactcgggggaaaaga
CLNT1_0131_E07.b : ttggaatacatttaggggaaaccgataaatttttgtttctcataggcgccttaaatttta
SPLT1_0006_F07.b : tttaaccttcgggaaaagtttgggaaaacaattttataggaaaaaccaggggaaaatgtt
OVRM1_0024_E03.b :
OVRT1_0086_B06.b : gggaaaacaattttaagggaaacacggggaaaatgtttggcctccccaaggggcctggga
THY01_0089_C08.b : ttttattaaatttttttcaaaaaaaaaaaaaaaaaaaaaaaa
ILNT1_0050_F07.b : ttaaccttcctaaccttttacacctccggaaaagtttttggaaaaaaaattctcaagaga
LNG01_0027_C12.b :
BKFL1_0086_G12.b : attttgctcctaagggcctagattttaaaaataa
BKFL1_0055_A11.b :
DCI01_0100_D02.b :
BKFL1_0040_F03.b : ttgtgataaattttagagaaacgggcaatttttgcgcctcacgcgctgaatttatagatc
DCI01_0091_H07.b : cttacctttaacccttggaaaatgtgtgaaataaactctaagggaacacaggcaaagttt
PST01_0024_C04.b : agtccacctccctaactttttaaccccctgggaaaacgttctggaaatccacgtcttata
LVRM1_0116_G02.b :
LVRM1_0006_E05.b :
PBL01_0077_C06.b : gagctcttcaagtccagcttcctagacctcataactacttaaggatacgtttctgaatat
SPL01_0001_B03.b :
UTR01_0106_E12.b : AGACNAGCAGGGAGGAGCTCTTTCAAGTTCACAGCTTCCTTAGACCTTCATTAACCTACT
UTR01_0052_H02.b : AGACAAGCAGGGAGGAGCTCTTTCAAGTTCACAGCTTCCTTAGACCTTCATTAACCTACT
20110601C-007465 : CTAGGGAATAACGTTTTCTGGA*TAAATCACAAGTCTCTAATCAAGGACAAGACTCGTAC
---------+---------+---------+---------+---------+---------+ 1447
BFLT1_0046_E01.b :
OVRM1_0074_B12.b :
PTG01_0110_A11.b :
OVRT1_0020_F01.b :
BFLT1_0047_E05.b : gagta
OVRM1_0060_C09.b :
OVRM1_0095_E03.b :
LVRM1_0028_H05.b :
OVR01_0034_D02.b :
SPL01_0065_E11.b :
KDN01_0061_A03.b : tgtttttaaaaa
OVR01_0026_D07.b :
KDN01_0088_H03.b :
OVR01_0063_C06.b :
SMG01_0027_D02.b : ggctttggatttttaaaaaaattctgtggaaaaaaagacagtcgccgcgcc
OVRM1_0223_B07.b :
OVRM1_0010_B12.b :
OVR01_0079_D05.b :
OVR01_0091_C08.b :
LVRM1_0096_G07.b :
CBLT1_0056_G07.b : ccctccacaaacgcgcgctaagaatttttaaaaagagctcctaaaaaaaaaaaaaaaaaa
CBLT1_0063_B06.b : gtttggcctctcacaaagggcgccttggaatttttaaaaaaggctctcaaaaaaaaaaaa
THY01_0001_G02.b :
OVRT1_0057_C09.b : a
LVR01_0100_D07.b :
PCT01_0016_D05.b : ccttccccgcggccccgtttttttttaaaagatccaaaaaaaaagggggggggggggggg
DCI01_0010_B09.b :
CLNT1_0032_D06.b : ggggccaaaa
CLNT1_0042_C06.b : ggaaaagttttgggtaaaaaaaattcttaacaggaagaaaccccgggtaaatatgtgtgc
THY01_0120_F06.b :
THY01_0106_A05.b :
CLNT1_0027_B09.b : cactcccaagaggcgcccttgaaatttctcaaagaatctcaaaaaaaaaagcggtgcttg
ITT01_0065_G01.b : aaaaaactccgggcaaaatgttttcgggacctctcacaagggggcgcctaagagaatttt
TES01_0099_B07.b : tggccaaatgtttggacc
CLNT1_0087_B04.b : ggggggcctggaatttttaaagagggtctaaaaaaaaaaagcagtgtgcgggggggcgta
OVRT1_0122_G05.b : tctgagattttataaaattctaaaaaaagagctgtcgtgtgtcgaactaaaacccccacc
TCH01_0089_A12.b :
CLNT1_0058_H07.b : ccccaagggggacaaaga
CLNT1_0065_A09.b : gtgtgcaaaaaaaaacggcggggggcggggaaacccccccacaatgtgtgtttgtgtttt
AMP01_0070_F01.b :
OVRM1_0140_F08.b :
SPLT1_0016_E08.b : ttctgttgggaaaaaggcctctctaaagaaaaaacacgacnggaaaagttttttgggcct
CLNT1_0131_E07.b : aaaattctaaaaaaaggttgtgtgggcctaaacacccccaaaganngtnnnnnnnnnnna
SPLT1_0006_F07.b : tggaacttcacaagggggcgttgagaattttacaaaagagtttcccgnaaaaaaaaaaga
OVRM1_0024_E03.b :
OVRT1_0086_B06.b : ttttattaaaatttttaaaaaaaaaagtgtggcggggcccggaaaacccccccaaaagga
THY01_0089_C08.b :
ILNT1_0050_F07.b : gaaactgacgtaaaacgttttggactccttcaaaggcggcgcgttagaaaatttttaaag
LNG01_0027_C12.b :
BKFL1_0086_G12.b :
BKFL1_0055_A11.b :
DCI01_0100_D02.b :
BKFL1_0040_F03.b : ttgaaaaaaaaaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0091_H07.b : gtgccttcaaact
PST01_0024_C04.b : ggaaaaacccaggcaaaaggtttgtgccctccacaagcggcgccttgaaatttataaaaa
LVRM1_0116_G02.b :
LVRM1_0006_E05.b :
PBL01_0077_C06.b : ccagttctatcagaaagacctactgcaaatctgttctgacctctcacaagtcggcacccc
SPL01_0001_B03.b :
UTR01_0106_E12.b : CTAGGGAAATAACGTTTCTGGAATAAATCACAAGTCTCCTAATCAGGACAAGACTCGTAC
UTR01_0052_H02.b : CTAGGGAATAACGTTTTCTGGA*TAAATCACAAGTCTCTAATCAAGGACAAGACTCGTAC
20110601C-007465 : TGTCATAAGTCTGTTTTCTGGACTCTTCTTCACATAAATCGTGCT...............
---------+---------+---------+---------+---------+---------+ 1492
BFLT1_0046_E01.b :
OVRM1_0074_B12.b :
PTG01_0110_A11.b :
OVRT1_0020_F01.b :
BFLT1_0047_E05.b :
OVRM1_0060_C09.b :
OVRM1_0095_E03.b :
LVRM1_0028_H05.b :
OVR01_0034_D02.b :
SPL01_0065_E11.b :
KDN01_0061_A03.b :
OVR01_0026_D07.b :
KDN01_0088_H03.b :
OVR01_0063_C06.b :
SMG01_0027_D02.b :
OVRM1_0223_B07.b :
OVRM1_0010_B12.b :
OVR01_0079_D05.b :
OVR01_0091_C08.b :
LVRM1_0096_G07.b :
CBLT1_0056_G07.b : caaa
CBLT1_0063_B06.b : aaaaaaaaa
THY01_0001_G02.b :
OVRT1_0057_C09.b :
LVR01_0100_D07.b :
PCT01_0016_D05.b : ggaaaaccccccccacaaggtttttaaaaaaannnnttatatgttgnggcccnnnnnnnt
DCI01_0010_B09.b :
CLNT1_0032_D06.b :
CLNT1_0042_C06.b : ggactccttcacaaggggcgcgcctaggatgatttataaan
THY01_0120_F06.b :
THY01_0106_A05.b :
CLNT1_0027_B09.b : gcgcgcaaaaaaacacccccaa
ITT01_0065_G01.b : ta
TES01_0099_B07.b :
CLNT1_0087_B04.b : aaaaacaccccccccaaagatttgttgttt
OVRT1_0122_G05.b : ataaaagtgttttgttttnanactatnnntntttatattggagatattagcaggaagaca
TCH01_0089_A12.b :
CLNT1_0058_H07.b :
CLNT1_0065_A09.b : tatt
AMP01_0070_F01.b :
OVRM1_0140_F08.b :
SPLT1_0016_E08.b : ctctccaaaggggcgggcaagaaaattatttattaaagaaag
CLNT1_0131_E07.b : agtaaaatnatttnnnnnngnnnnnnncccgtaaatcttacaccctaacnnnnnnnnnnn
SPLT1_0006_F07.b : aanaaaanaaanacgcccgcccctcttggggtttcaaaaaatgtgtggcaccaggaaatg
OVRM1_0024_E03.b :
OVRT1_0086_B06.b : tgtttgttagtaacacaaaatttctttt
THY01_0089_C08.b :
ILNT1_0050_F07.b : aagatattcccccnaagaaanaaaaacaaaaagaacaagacaaaccccgccgcctcgttt
LNG01_0027_C12.b :
BKFL1_0086_G12.b :
BKFL1_0055_A11.b :
DCI01_0100_D02.b :
BKFL1_0040_F03.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
DCI01_0091_H07.b :
PST01_0024_C04.b : aatctctataaaaaagcactttctctggcgcgcccaaaataaaacaccccccccccaaag
LVRM1_0116_G02.b :
LVRM1_0006_E05.b :
PBL01_0077_C06.b : taggaattttactaaaaggattcgcaaaaaaaaaaaaagccatgttcaccagtccgcctc
SPL01_0001_B03.b :
UTR01_0106_E12.b : TGTCATAAATCTGTTTTCGGGACTCCTCTTCACCTAAAgtcctgctagctccattaagga
UTR01_0052_H02.b : TGTCATAAGTCTGTTTTCTGGACTCTTCTTCACATAAATCGTGCTagctcattaangaat
20110601C-007465 : ............................................................
---------+---------+---------+---------+---------+---------+ 1492
BFLT1_0046_E01.b :
OVRM1_0074_B12.b :
PTG01_0110_A11.b :
OVRT1_0020_F01.b :
BFLT1_0047_E05.b :
OVRM1_0060_C09.b :
OVRM1_0095_E03.b :
LVRM1_0028_H05.b :
OVR01_0034_D02.b :
SPL01_0065_E11.b :
KDN01_0061_A03.b :
OVR01_0026_D07.b :
KDN01_0088_H03.b :
OVR01_0063_C06.b :
SMG01_0027_D02.b :
OVRM1_0223_B07.b :
OVRM1_0010_B12.b :
OVR01_0079_D05.b :
OVR01_0091_C08.b :
LVRM1_0096_G07.b :
CBLT1_0056_G07.b :
CBLT1_0063_B06.b :
THY01_0001_G02.b :
OVRT1_0057_C09.b :
LVR01_0100_D07.b :
PCT01_0016_D05.b : tcccccctccaacaaat
DCI01_0010_B09.b :
CLNT1_0032_D06.b :
CLNT1_0042_C06.b :
THY01_0120_F06.b :
THY01_0106_A05.b :
CLNT1_0027_B09.b :
ITT01_0065_G01.b :
TES01_0099_B07.b :
CLNT1_0087_B04.b :
OVRT1_0122_G05.b : gaat
TCH01_0089_A12.b :
CLNT1_0058_H07.b :
CLNT1_0065_A09.b :
AMP01_0070_F01.b :
OVRM1_0140_F08.b :
SPLT1_0016_E08.b :
CLNT1_0131_E07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
SPLT1_0006_F07.b : tttttgtgtttttataaaaaaatatttggt
OVRM1_0024_E03.b :
OVRT1_0086_B06.b :
THY01_0089_C08.b :
ILNT1_0050_F07.b : t
LNG01_0027_C12.b :
BKFL1_0086_G12.b :
BKFL1_0055_A11.b :
DCI01_0100_D02.b :
BKFL1_0040_F03.b : nnnnnnnnnnnnnnnnnnnnn
DCI01_0091_H07.b :
PST01_0024_C04.b : agaattttgtttgttttataaaaacaaaaacattctttt
LVRM1_0116_G02.b :
LVRM1_0006_E05.b :
PBL01_0077_C06.b : aatcccaggccctaccacactttttaaggctaaggttaaaaggcgccttaccgcgaaacc
SPL01_0001_B03.b :
UTR01_0106_E12.b : atacctttttaacctaaataaaaggaatttcctgccnnnnaanaaaannnaaaannnaaa
UTR01_0052_H02.b : attttttaacattataaaaggaatttctgccnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-007465 : ............................................................
---------+---------+---------+---------+---------+---------+ 1492
BFLT1_0046_E01.b :
OVRM1_0074_B12.b :
PTG01_0110_A11.b :
OVRT1_0020_F01.b :
BFLT1_0047_E05.b :
OVRM1_0060_C09.b :
OVRM1_0095_E03.b :
LVRM1_0028_H05.b :
OVR01_0034_D02.b :
SPL01_0065_E11.b :
KDN01_0061_A03.b :
OVR01_0026_D07.b :
KDN01_0088_H03.b :
OVR01_0063_C06.b :
SMG01_0027_D02.b :
OVRM1_0223_B07.b :
OVRM1_0010_B12.b :
OVR01_0079_D05.b :
OVR01_0091_C08.b :
LVRM1_0096_G07.b :
CBLT1_0056_G07.b :
CBLT1_0063_B06.b :
THY01_0001_G02.b :
OVRT1_0057_C09.b :
LVR01_0100_D07.b :
PCT01_0016_D05.b :
DCI01_0010_B09.b :
CLNT1_0032_D06.b :
CLNT1_0042_C06.b :
THY01_0120_F06.b :
THY01_0106_A05.b :
CLNT1_0027_B09.b :
ITT01_0065_G01.b :
TES01_0099_B07.b :
CLNT1_0087_B04.b :
OVRT1_0122_G05.b :
TCH01_0089_A12.b :
CLNT1_0058_H07.b :
CLNT1_0065_A09.b :
AMP01_0070_F01.b :
OVRM1_0140_F08.b :
SPLT1_0016_E08.b :
CLNT1_0131_E07.b :
SPLT1_0006_F07.b :
OVRM1_0024_E03.b :
OVRT1_0086_B06.b :
THY01_0089_C08.b :
ILNT1_0050_F07.b :
LNG01_0027_C12.b :
BKFL1_0086_G12.b :
BKFL1_0055_A11.b :
DCI01_0100_D02.b :
BKFL1_0040_F03.b :
DCI01_0091_H07.b :
PST01_0024_C04.b :
LVRM1_0116_G02.b :
LVRM1_0006_E05.b :
PBL01_0077_C06.b : ggttggaatttgggagaaccaaaccagaaattagaaacccgggnnnaaaaaaaatgttaa
SPL01_0001_B03.b :
UTR01_0106_E12.b : aaaaaanggggcccccttttgcttccaccttcc
UTR01_0052_H02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-007465 : ............................................................
---------+---------+---------+---------+---------+---------+ 1492
BFLT1_0046_E01.b :
OVRM1_0074_B12.b :
PTG01_0110_A11.b :
OVRT1_0020_F01.b :
BFLT1_0047_E05.b :
OVRM1_0060_C09.b :
OVRM1_0095_E03.b :
LVRM1_0028_H05.b :
OVR01_0034_D02.b :
SPL01_0065_E11.b :
KDN01_0061_A03.b :
OVR01_0026_D07.b :
KDN01_0088_H03.b :
OVR01_0063_C06.b :
SMG01_0027_D02.b :
OVRM1_0223_B07.b :
OVRM1_0010_B12.b :
OVR01_0079_D05.b :
OVR01_0091_C08.b :
LVRM1_0096_G07.b :
CBLT1_0056_G07.b :
CBLT1_0063_B06.b :
THY01_0001_G02.b :
OVRT1_0057_C09.b :
LVR01_0100_D07.b :
PCT01_0016_D05.b :
DCI01_0010_B09.b :
CLNT1_0032_D06.b :
CLNT1_0042_C06.b :
THY01_0120_F06.b :
THY01_0106_A05.b :
CLNT1_0027_B09.b :
ITT01_0065_G01.b :
TES01_0099_B07.b :
CLNT1_0087_B04.b :
OVRT1_0122_G05.b :
TCH01_0089_A12.b :
CLNT1_0058_H07.b :
CLNT1_0065_A09.b :
AMP01_0070_F01.b :
OVRM1_0140_F08.b :
SPLT1_0016_E08.b :
CLNT1_0131_E07.b :
SPLT1_0006_F07.b :
OVRM1_0024_E03.b :
OVRT1_0086_B06.b :
THY01_0089_C08.b :
ILNT1_0050_F07.b :
LNG01_0027_C12.b :
BKFL1_0086_G12.b :
BKFL1_0055_A11.b :
DCI01_0100_D02.b :
BKFL1_0040_F03.b :
DCI01_0091_H07.b :
PST01_0024_C04.b :
LVRM1_0116_G02.b :
LVRM1_0006_E05.b :
PBL01_0077_C06.b : gccctactacaattaaatcatctcnnnnnnnnnna
SPL01_0001_B03.b :
UTR01_0106_E12.b :
UTR01_0052_H02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
20110601C-007465 : ............................................................
---------+---------+---------+---------+---------+---------+ 1492
BFLT1_0046_E01.b :
OVRM1_0074_B12.b :
PTG01_0110_A11.b :
OVRT1_0020_F01.b :
BFLT1_0047_E05.b :
OVRM1_0060_C09.b :
OVRM1_0095_E03.b :
LVRM1_0028_H05.b :
OVR01_0034_D02.b :
SPL01_0065_E11.b :
KDN01_0061_A03.b :
OVR01_0026_D07.b :
KDN01_0088_H03.b :
OVR01_0063_C06.b :
SMG01_0027_D02.b :
OVRM1_0223_B07.b :
OVRM1_0010_B12.b :
OVR01_0079_D05.b :
OVR01_0091_C08.b :
LVRM1_0096_G07.b :
CBLT1_0056_G07.b :
CBLT1_0063_B06.b :
THY01_0001_G02.b :
OVRT1_0057_C09.b :
LVR01_0100_D07.b :
PCT01_0016_D05.b :
DCI01_0010_B09.b :
CLNT1_0032_D06.b :
CLNT1_0042_C06.b :
THY01_0120_F06.b :
THY01_0106_A05.b :
CLNT1_0027_B09.b :
ITT01_0065_G01.b :
TES01_0099_B07.b :
CLNT1_0087_B04.b :
OVRT1_0122_G05.b :
TCH01_0089_A12.b :
CLNT1_0058_H07.b :
CLNT1_0065_A09.b :
AMP01_0070_F01.b :
OVRM1_0140_F08.b :
SPLT1_0016_E08.b :
CLNT1_0131_E07.b :
SPLT1_0006_F07.b :
OVRM1_0024_E03.b :
OVRT1_0086_B06.b :
THY01_0089_C08.b :
ILNT1_0050_F07.b :
LNG01_0027_C12.b :
BKFL1_0086_G12.b :
BKFL1_0055_A11.b :
DCI01_0100_D02.b :
BKFL1_0040_F03.b :
DCI01_0091_H07.b :
PST01_0024_C04.b :
LVRM1_0116_G02.b :
LVRM1_0006_E05.b :
PBL01_0077_C06.b :
SPL01_0001_B03.b :
UTR01_0106_E12.b :
UTR01_0052_H02.b : nnnnn