[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-008009

Length: 1,004

Sequence [FASTA format sequence]
CTTCCGTAAA CAAAGCTCAC TGTGGAGGCG CGAGGTCCGG GATGTGACCC CAGCTCAAGC
TGCGGCGGTA GCATTGGCGG CTGCAGCTGC GGCGGTGGCT TCGGAGGCCC CGGAGTCTTT
GCAAGCTGAG GAAGAGGACC CCGATCCCCT TCTTCCTGAG GTCATAAGAA GCTGGCCTTG
GTGCAATAAG GAACTTAAAA CAATGGAGGA GCGCAAAGTG AAGAGGAGGA GTCCTAAGTC
TTTTAGTGCC CACTCTACTC AGGTTGTTAA TGCCAAAAAA AATGCCATTC CAGTTAGTAA
AAGCACAGGG TTTTCAAATC CTGCATCCCA GTCAACTTCA CAGCGACCAA AGTTAAAAAG
AGTGATGAAA GAAAAGGCCA AACCTCAGGG TGGAGAAGGC AAAGGCGCTC AGTCAACCCC
GATCCAACAC TCCTTTCTCA CCGATGTCTC CGATGTCCAG GAGATGGAGA GGGGGCTCCT
CAGCCTTTTG AATGACTTCC ATTCTGGAAA ACTCCAAGCG TTTGGAAATG AATGTTCCAT
TGAACAGATG GAACATGTTC GGGGAATGCA AGAGAAATTA GCTCGCTTGA ATTTGGAGCT
CTATGGAGAG TTAGAGGAAC TTCCTGAGGA TAAGAGAAAA GCAGCCAGTG ACTCCAATCT
CGATAGGCTT CTGTCTGATC TAGAAGAATT GAATTCTTCG ATACAGAAAC TACATTTGGC
AGATGCTCAA GATGTTCCAA ACACTTCTAC CAGCTAAAAT GAAGTGCACT TGCTTTCTCG
TGGTTTGAAG AAAAGCAGCA TCCTTTACTT TCCAGCTGAA TCCAGTAGCA GAATCATCTT
CCACAATAAG GAATTAAAGT ATCAAAGTGC CAGTGCAGTG ATTGCTTTCA CATGCTGCTT
TTAGTAACGT GCCATAATTC ACGTAACTGG NAGCCTANGC CTTGNNTGAN GCTTNATCAN
NGAATGTGAT ACAGAGCTTT GCTGCTATGC TTTAAATGGT GCCT


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCCDC28Acoiled-coil domain-containing protein 28A [Homo sapiens]. 3124e-85
Contig/Assembly ProteinCCDC28Bcoiled-coil domain-containing protein 28B [Homo sapiens]. 1287e-30O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCcdc28acoiled-coil domain-containing protein 28A [Mus musculus]. 2701e-72O
Contig/Assembly ProteinCcdc28bcoiled-coil domain-containing protein 28B [Mus musculus]. 1254e-29O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC476220PREDICTED: similar to CG10874-PA, isoform A [Canis familiaris]. 3162e-86
Contig/Assembly ProteinLOC487312PREDICTED: similar to 1810010N17Rik protein [Canis familiaris]. 1281e-29


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCCDC28APREDICTED: coiled-coil domain containing 28A-like [Bos taurus]. 3061e-83
Contig/Assembly ProteinCCDC28APREDICTED: coiled-coil domain containing 28A-like [Bos taurus]. 3061e-83
Contig/Assembly ProteinCCDC28Bcoiled-coil domain containing 28B [Bos taurus]. 93.62e-19O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100512200PREDICTED: LOW QUALITY PROTEIN: coiled-coil domain-containing protein 28A-like [Sus scrofa]. 3423e-94


Assembly Members: 23      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
CLNT10013C09CLNT1_0013_C09.bFS658086 
CLNT10060D04CLNT1_0060_D04.bFS661788 
CLNT10111C12CLNT1_0111_C12.bHX219994 
CLNT10137B07CLNT1_0137_B07.bHX221973 
ITT010033B11ITT01_0033_B11.bBW978950 
LVRM10090C02LVRM1_0090_C02.bCJ003196 
OVRM10015F01OVRM1_0015_F01.bBP151150 
OVRM10040H10OVRM1_0040_H10.bBP462073 AK395072
OVRM10176F12OVRM1_0176_F12.bBP460354 
OVRM10187H02OVRM1_0187_H02.b  
OVRM10225E10OVRM1_0225_E10.bBP459236 
OVRT10051H11OVRT1_0051_H11.bFS690616 
OVRT10091D11OVRT1_0091_D11.b  
PCT010024C06PCT01_0024_C06.bFS696233 
SMG010006G10SMG01_0006_G10.bFS713989 
SMG010019H08SMG01_0019_H08.bFS714956 
SMG010077B06SMG01_0077_B06.bFS719899 
SPL010020F02SPL01_0020_F02.bBP158408 
SPL010024A11SPL01_0024_A11.bBP156957 
SPL010068E12SPL01_0068_E12.bCJ019149 
THY010020A08THY01_0020_A08.bBP160088 
THY010052E06THY01_0052_E06.bBP164895 
THY010109G01THY01_0109_G01.bBP166911 

  

SNPs: 3      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
164A1700.773BNATA/I
G050.227GTA/V
451C1600.800BSTCC/S
T040.200TCT/S
523C220.211WSTTC/F
T1500.789TTT/F


Alignment:      TOP

20110601C-008009 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRM1_0040_H10.b :
OVRM1_0187_H02.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0077_B06.b :
OVRT1_0051_H11.b : nggt
LVRM1_0090_C02.b :
OVRM1_0225_E10.b :
THY01_0052_E06.b : ttttggxxxxx
OVRT1_0091_D11.b : ntt
THY01_0109_G01.b :
OVRM1_0176_F12.b :
OVRM1_0015_F01.b :
SPL01_0024_A11.b : cxxxx
SPL01_0020_F02.b :
CLNT1_0013_C09.b :
ITT01_0033_B11.b :
CLNT1_0060_D04.b :
SMG01_0006_G10.b :
SMG01_0019_H08.b :
CLNT1_0111_C12.b :
SPL01_0068_E12.b : ntt
THY01_0020_A08.b : cctcccacccctctacccctctccactcccccctcacaacacacgcccaccttagcta
PCT01_0024_C06.b :
CLNT1_0137_B07.b :
20110601C-008009 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRM1_0040_H10.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0187_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0077_B06.b : ttccttggactaagcagcggnxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0051_H11.b : atccgctagcggacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0090_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0225_E10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0052_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0091_D11.b : ttcccgtttgcgtacgagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0109_G01.b : gttgtcaaaxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0176_F12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0015_F01.b : agatttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0024_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0020_F02.b : gttggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0013_C09.b : ggactccttctgcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0033_B11.b : nnnggctgaacxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0060_D04.b : nnnnccgtctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0006_G10.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnx
SMG01_0019_H08.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnx
CLNT1_0111_C12.b : ttttcccgttagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0068_E12.b : ggctaggactatgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0020_A08.b : ttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PCT01_0024_C06.b : nnnncctatttnn
CLNT1_0137_B07.b : ncttctgctgtcg
20110601C-008009 : ..........CTTCCGTAAACAAAGCTCACTGTGGAGGCGCGAGGTCCGGGATGTGACCC
---------+---------+---------+---------+---------+---------+ 50
OVRM1_0040_H10.b : xxxxxxxxxxCTTCCGTAAACAAAGCTCACTGTGGAGGCGCGAGGTCCGGGATGTGACCC
OVRM1_0187_H02.b : xxxxxxxxxcCTTCCGTAAACAAAGCTCACTGTGAAGGCCCGAGGTCCGGAATGTGACCC
SMG01_0077_B06.b : xxxxxxxxxxCTTCCGTAAACAAAGCTCACTGTGGAGGCGCGAGGTCCGGGATGTGACCC
OVRT1_0051_H11.b : xxxxxxxxxxCTTCCGTAAACAAAGCTCACTGTGGAGGCGCGAGGTCCGGGATGTGACCC
LVRM1_0090_C02.b : xxxxxxxxxxxTTCCGTAAACAAAGCTCACTGTGGAGGCGCGAGGTCCGGGATGTGACCC
OVRM1_0225_E10.b : xxxxxxxxxxxxxxxGTAAACAAAGCTCACTGTGGAGGCGCGAGGTCCGGGATGTGACCC
THY01_0052_E06.b : xxxxxxxxxxxxxxxGTAAACAAAGCTCACTGTGGAGGCGCGAGGTCCGGGATGTGACCC
OVRT1_0091_D11.b : xxattcattggagtccgtaaacAAGCTCACTGTGGAGGCGCGAGGCCCTGGAGGTGACCC
THY01_0109_G01.b : xxxxxxxxxxxxxxxxxxxxtggAGCTCACTGTGGAGGCA***GGTCCGGGATGTGACCC
OVRM1_0176_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxGCTCACTGTGGAGGCGCGAGGTCCGGGATGTGACCC
OVRM1_0015_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxGCTCACTGTGGAGGCGCGAGGTCCGGGATGTGACCC
SPL01_0024_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxGCTCACTGTGGAGGCGCGAGGTCCGGGATGTGACCC
SPL01_0020_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxGCTCACTGTGGAGGCGCGAGGTCCGGGATGTGACCC
CLNT1_0013_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxGCTCACTGTGGAGGCGCGAGGTCCGGGATGTGACCC
ITT01_0033_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxGCTCACTGTGGAGGCGCGAGGTCCGGGATGTGACCC
CLNT1_0060_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxGCTCACTGTGGAGGCGCGAGGTCCGGGATGTGACCC
SMG01_0006_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxGCTCACTGTGGAGGCGCGAGGTCCGGGATGTGACCC
SMG01_0019_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxGCTCACTGTGGAGGCGCGAGGTCCGGGATGTGACCC
CLNT1_0111_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxGCTCACTGTGGAGGCGCGAGGTCCGGGATGTGACCC
SPL01_0068_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxGCTCACTGTGGAGGCGCGAGGTCCGGGATGTGACCC
THY01_0020_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxGCTCACTGTGGAGGCGCGAGGTCCGGGATGTGACCC
PCT01_0024_C06.b : nnnnnncctgcgttgtgctctggaagctcCTGTGGAGGCGCGAGGTCCGGGATGTGACCC
CLNT1_0137_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgGACCC
20110601C-008009 : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
---------+---------+---------+---------+---------+---------+ 110
OVRM1_0040_H10.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
OVRM1_0187_H02.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCACCTGCGGCGGTGGCTTCGAAGGCCC
SMG01_0077_B06.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
OVRT1_0051_H11.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
LVRM1_0090_C02.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
OVRM1_0225_E10.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
THY01_0052_E06.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
OVRT1_0091_D11.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
THY01_0109_G01.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
OVRM1_0176_F12.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
OVRM1_0015_F01.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
SPL01_0024_A11.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
SPL01_0020_F02.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
CLNT1_0013_C09.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
ITT01_0033_B11.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
CLNT1_0060_D04.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
SMG01_0006_G10.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
SMG01_0019_H08.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
CLNT1_0111_C12.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
SPL01_0068_E12.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
THY01_0020_A08.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
PCT01_0024_C06.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
CLNT1_0137_B07.b : CAGCTCAAGCTGCGGCGGTAGCATTGGCGGCTGCAGCTGCGGCGGTGGCTTCGGAGGCCC
20110601C-008009 : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCATAAGAA
---------+---------+---------+---------+---------+---------+ 170
OVRM1_0040_H10.b : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCGTAAGAA
OVRM1_0187_H02.b : CGGAGTCTTTGCAAGCTGAGGAAAAGGACCCCAATCCCCTTCTTCCTGAGGTCGAAAAAA
SMG01_0077_B06.b : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCATAAGAA
OVRT1_0051_H11.b : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCATAAGAA
LVRM1_0090_C02.b : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCGTAAGAA
OVRM1_0225_E10.b : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCGTAAGAA
THY01_0052_E06.b : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCATAAGAA
OVRT1_0091_D11.b : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCATAAGAA
THY01_0109_G01.b : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCATAAGAA
OVRM1_0176_F12.b : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCGTAAGAA
OVRM1_0015_F01.b : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCGTAAGAA
SPL01_0024_A11.b : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCATAAGAA
SPL01_0020_F02.b : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCATAAGAA
CLNT1_0013_C09.b : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCATAAGAA
ITT01_0033_B11.b : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCATAAGAA
CLNT1_0060_D04.b : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCATAAGAA
SMG01_0006_G10.b : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCATAAGAA
SMG01_0019_H08.b : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCATAAGAA
CLNT1_0111_C12.b : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCATAAGAA
SPL01_0068_E12.b : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCATAAGAA
THY01_0020_A08.b : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCATAAGAA
PCT01_0024_C06.b : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCATAAGAA
CLNT1_0137_B07.b : CGGAGTCTTTGCAAGCTGAGGAAGAGGACCCCGATCCCCTTCTTCCTGAGGTCATAAGAA
20110601C-008009 : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGCGCAAAGTGAAGAGGAGGA
---------+---------+---------+---------+---------+---------+ 230
OVRM1_0040_H10.b : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGCGCAAAGTGAAGAGGAGGA
OVRM1_0187_H02.b : GCTGGTTTTGGTGCAATAAGGAACTTAAAACAATGGAGGACCGCAAAGTGAAAAGGAGGA
SMG01_0077_B06.b : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGCGCAAAGTGAACAGGAGGA
OVRT1_0051_H11.b : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGCGCAAAGTGAAGAGGAGGA
LVRM1_0090_C02.b : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGCGCAAAGTGAAGAGGAGGA
OVRM1_0225_E10.b : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGCGCAAAGTGAAGAGGAGGA
THY01_0052_E06.b : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGCGCAAAGTGAAGAGGAGGA
OVRT1_0091_D11.b : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGCGCAAAGTGAAGAGGAGGA
THY01_0109_G01.b : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGCGCAAAGTGAAGAGGAGGA
OVRM1_0176_F12.b : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGCGCAAAGTGAAGAGGAGGA
OVRM1_0015_F01.b : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGTGCAAAGTGAAGAGGAGGA
SPL01_0024_A11.b : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGCGCAAAGTGAAGAGGAGGA
SPL01_0020_F02.b : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGCGCAAAGTGAAGAGGAGGA
CLNT1_0013_C09.b : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGCGCAAAGTGAAGAGGAGGA
ITT01_0033_B11.b : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGCGCAAAGTGAAGAGGAGGA
CLNT1_0060_D04.b : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGCGCAAAGTGAAGAGGAGGA
SMG01_0006_G10.b : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGCGCAAAGTGAAGAGGAGGA
SMG01_0019_H08.b : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGCGCAAAGTGAAGAGGAGGA
CLNT1_0111_C12.b : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGCGCAAAGTGAAGAGGAGGA
SPL01_0068_E12.b : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGCGCAAAGTGAAGAGGAGGA
THY01_0020_A08.b : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGCGCAAAGTGAAGAGGAGGA
PCT01_0024_C06.b : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGCGCAAAGTGAAGAGGAGGA
CLNT1_0137_B07.b : GCTGGCCTTGGTGCAATAAGGAACTTAAAACAATGGAGGAGCGCAAAGTGAAGAGGAGGA
20110601C-008009 : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAA*TGCCATT
---------+---------+---------+---------+---------+---------+ 289
OVRM1_0040_H10.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAA*TGCCATT
OVRM1_0187_H02.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAA*TGCCTTT
SMG01_0077_B06.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAA*TGCCATT
OVRT1_0051_H11.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAA*TGCCATT
LVRM1_0090_C02.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAA*TGCCATT
OVRM1_0225_E10.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAA*TGCCATT
THY01_0052_E06.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAA*TGCCATT
OVRT1_0091_D11.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAAATGCCATT
THY01_0109_G01.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAA*TGCCATT
OVRM1_0176_F12.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAA*TGCCATT
OVRM1_0015_F01.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAA*TGCCATT
SPL01_0024_A11.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAAATGCCATT
SPL01_0020_F02.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAA*TGCCATT
CLNT1_0013_C09.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAA*TGCCATT
ITT01_0033_B11.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAA*TGCCATT
CLNT1_0060_D04.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAA*TGCCATT
SMG01_0006_G10.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAA*TGCCATT
SMG01_0019_H08.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAA*TGCCATT
CLNT1_0111_C12.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAA*TGCCATT
SPL01_0068_E12.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAA*TGCCATT
THY01_0020_A08.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAA*TGCCATT
PCT01_0024_C06.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAA*TGCCATT
CLNT1_0137_B07.b : GTCCTAAGTCTTTTAGTGCCCACTCTACTCAGGTTGTTAATGCCAAAAAAAA*TGCCATT
20110601C-008009 : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
---------+---------+---------+---------+---------+---------+ 349
OVRM1_0040_H10.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
OVRM1_0187_H02.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAATTTCACAGCGACCA
SMG01_0077_B06.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
OVRT1_0051_H11.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
LVRM1_0090_C02.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
OVRM1_0225_E10.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
THY01_0052_E06.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
OVRT1_0091_D11.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
THY01_0109_G01.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
OVRM1_0176_F12.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
OVRM1_0015_F01.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
SPL01_0024_A11.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
SPL01_0020_F02.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
CLNT1_0013_C09.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
ITT01_0033_B11.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
CLNT1_0060_D04.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
SMG01_0006_G10.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
SMG01_0019_H08.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
CLNT1_0111_C12.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
SPL01_0068_E12.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
THY01_0020_A08.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
PCT01_0024_C06.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
CLNT1_0137_B07.b : CCAGTTAGTAAAAGCACAGGGTTTTCAAATCCTGCATCCCAGTCAACTTCACAGCGACCA
20110601C-008009 : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAGAAGGCAAAGGCGCT
---------+---------+---------+---------+---------+---------+ 409
OVRM1_0040_H10.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAGAAGGCAAAGGCGCT
OVRM1_0187_H02.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAAAAGGCAAAGGCGCT
SMG01_0077_B06.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCACGGTGGAGAAGGCAAAGGCGCT
OVRT1_0051_H11.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAGAAGGCAAAGGCGCT
LVRM1_0090_C02.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAGAAGGCAAAGGCGCT
OVRM1_0225_E10.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAGAAGGCAAAGGCGCT
THY01_0052_E06.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAGAAGGCAAAGGCGCT
OVRT1_0091_D11.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAGAAGGCAAAGGCGCT
THY01_0109_G01.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAGAAGGCAAAGGCGCT
OVRM1_0176_F12.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAGAAGGCAAAGGCGCT
OVRM1_0015_F01.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAGAAGGCAAAGGCGCT
SPL01_0024_A11.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAGAAGGCAAAGGCGCT
SPL01_0020_F02.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAGAAGGCAAAGGCGCT
CLNT1_0013_C09.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAGAAGGCAAAGGCGCT
ITT01_0033_B11.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAGAAGGCAAAGGCGCT
CLNT1_0060_D04.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAGAAGGCAAAGGCGCT
SMG01_0006_G10.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAGAAGGCAAAGGCGCT
SMG01_0019_H08.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAGAGGGCAAAGGCGCT
CLNT1_0111_C12.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAGAAGGCAAAGGCGCT
SPL01_0068_E12.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAGAAGGCAAAGGCGCT
THY01_0020_A08.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAGAAGGCAAAGGCGCT
PCT01_0024_C06.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAGAAGGCAAAGGCGCT
CLNT1_0137_B07.b : AAGTTAAAAAGAGTGATGAAAGAAAAGGCCAAACCTCAGGGTGGAGAAGGCAAAGGCGCT
20110601C-008009 : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCCGATGTCCAGGAGATGGAG
---------+---------+---------+---------+---------+---------+ 469
OVRM1_0040_H10.b : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCTGATGTCCAGGAGATGGAG
OVRM1_0187_H02.b : CAGTCAACCCCAATCCAACACTCCTTTCTCACCGATGTCTCTAATGTCCAGAAAATGGAA
SMG01_0077_B06.b : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCCGATGTCCAGGAGATGGAG
OVRT1_0051_H11.b : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCCGATGTCCAGGAGATGGAG
LVRM1_0090_C02.b : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCTGATGTCCAGGAGATGGAG
OVRM1_0225_E10.b : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCTGATGTCCAGGAGATGGAG
THY01_0052_E06.b : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCCGATGTCCAGGAGATGGAG
OVRT1_0091_D11.b : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCCGATGTCCAGGAGATGGAG
THY01_0109_G01.b : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCCGATGTCCAGGAGATGGAG
OVRM1_0176_F12.b : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCTGATGTCCAGGAGATGGAG
OVRM1_0015_F01.b : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCTGATGTCCAGGAGATGGAG
SPL01_0024_A11.b : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCCGATGTCCAGGAGATGAAG
SPL01_0020_F02.b : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCCGATGTCCAGGAGATGGAG
CLNT1_0013_C09.b : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCCGATGTCCAGGAGATGGAG
ITT01_0033_B11.b : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCCGATGTCCAGGAGATGGAG
CLNT1_0060_D04.b : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCCGATGTCCAGGAGATGGAG
SMG01_0006_G10.b : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCCGATGTCCAGGAGATGGAG
SMG01_0019_H08.b : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCCGATGTCCAGGAGATGGAG
CLNT1_0111_C12.b : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCCGATGTCCAGGAGATGGAG
SPL01_0068_E12.b : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCCGATGTCCAGGAGATGGAG
THY01_0020_A08.b : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCCGATGTCCAGGAGATGGAG
PCT01_0024_C06.b : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCCGATGTCCAGGAGATGGAG
CLNT1_0137_B07.b : CAGTCAACCCCGATCCAACACTCCTTTCTCACCGATGTCTCCGATGTCCAGGAGATGGAG
20110601C-008009 : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTTGGAAAT
---------+---------+---------+---------+---------+---------+ 529
OVRM1_0040_H10.b : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTCCGAAAT
OVRM1_0187_H02.b : AGGGGGCTCCTCACCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTCGGAAAT
SMG01_0077_B06.b : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTTGGAAAT
OVRT1_0051_H11.b : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTTGGAAAT
LVRM1_0090_C02.b : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTCGGAAAT
OVRM1_0225_E10.b : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTCGGAAAT
THY01_0052_E06.b : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTTGGAAAT
OVRT1_0091_D11.b : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTTGGAAAT
THY01_0109_G01.b : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTTGGAAAT
OVRM1_0176_F12.b : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCCAGCGTTCGGAAAT
OVRM1_0015_F01.b : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTCGGAAAT
SPL01_0024_A11.b : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTTGGAAAT
SPL01_0020_F02.b : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTCGGAAAT
CLNT1_0013_C09.b : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTTGGAAAT
ITT01_0033_B11.b : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTTGGAAAT
CLNT1_0060_D04.b : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTTGGAAAT
SMG01_0006_G10.b : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTTGGAAAT
SMG01_0019_H08.b : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTTGGAAAT
CLNT1_0111_C12.b : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTTGGAAAT
SPL01_0068_E12.b : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTTGGAAAT
THY01_0020_A08.b : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTTGGAAAT
PCT01_0024_C06.b : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTCGGAAAT
CLNT1_0137_B07.b : AGGGGGCTCCTCAGCCTTTTGAATGACTTCCATTCTGGAAAACTCCAAGCGTTTGGAAAT
20110601C-008009 : GAATGTTCCATTGAACAGATGGAACATGT*TCGGGGAATGCAAGAGAAATTAGCTCGCTT
---------+---------+---------+---------+---------+---------+ 588
OVRM1_0040_H10.b : GAATGTTCCATTGAACAGATGGAACATGT*TCGGGGAATGCAAGAGAAATTCACCCGCCT
OVRM1_0187_H02.b : GAATGTTCCATTGAACAAATGGAACATGT*TCGGGGAATGCAAAAGAAATTACCTCGCTT
SMG01_0077_B06.b : GAATGTTCCATTGAACAGATGGAACATGT*TCGGGGAATGCAAGAGAAATTAGCTCGCTT
OVRT1_0051_H11.b : GAATGTTCCATTGAACAGATGGAACATGT*TCGGGGAATGCAAGAGAAATTAGCTCGCTT
LVRM1_0090_C02.b : GAATGTTCCATTGAACAGATGGAACATGT*TCGGGGAATGCAAGAGAAATTAGCTCGCTT
OVRM1_0225_E10.b : GAATGTTCCATTGAACAGATGGAACATGT*TCGGGGAATGTAAGAGAAATTAGCTCGCTT
THY01_0052_E06.b : GAATGTTCCATTGAACAGATGGAACATGT*TCGGGGAATGCAAGAGAAATTAGCTCGCTT
OVRT1_0091_D11.b : GAATGTTCCATTGAACAGATGGAACATGT*TCGGGGAATGCAAGAGAAATTAGCTCGCTT
THY01_0109_G01.b : GAATGTTCCATTGAACAGATGGAACATGT*TCGGGGAATGCAAGAGAAATTAcctgcctt
OVRM1_0176_F12.b : GAATGTTCCATTGAAGAGATGGAACATGT*TCCGGGAATGCAAAAGAAATTAACTCGCTT
OVRM1_0015_F01.b : GAATGTTCCATTGAACAGATGGAACATGT*TCGGGGAATGCAAGAGAAATTAGCTCGCTT
SPL01_0024_A11.b : GAATGTTCCATTGAACAGATGGAACATGT*TCGGGGAATGCAAGAGAAATTAGCTCGCTT
SPL01_0020_F02.b : GAATGTTCCATTGAACAGATGGAACATGT*TCGGGGAATGCAAGAGAAATTAGCTCGCTT
CLNT1_0013_C09.b : GAATGTTCCATTGAACAGATGGAACATGT*TCGGGGAATGCAAGAGAAATTAGCTCGCTT
ITT01_0033_B11.b : GAATGTTCCATTGAACAGATGGAACATGT*TCGGGGAATGCAAGAGAAATTAGCTCGCTT
CLNT1_0060_D04.b : GAATGTTCCATTGAACAGATGGAACATGT*TCGGGGAATGCAAGAGAAATTAGCTCGCTT
SMG01_0006_G10.b : GAATGTTCCATTGAACAGATGGAACATGT*TCGGGGAATGCAAGAGAAATTAGCTCGCTT
SMG01_0019_H08.b : GAATGTTCCATTGAACAGATGGAACATGT*TCGGGGAATGCAAGAGAAATTAGCTCGCTT
CLNT1_0111_C12.b : GAATGTTCCATTGAACAGATGGAACATGT*TCGGGGAATGCAAGAGAAATTAGCTCGCTT
SPL01_0068_E12.b : GAATGTTCCATTGAACAGATGGAACATGT*TCGGGGAATGCAAGAGAAATTAGCTCGCTT
THY01_0020_A08.b : GAATGTTCCATTGAACAGATGGAACATGTTTCGGGGAATGCAAGAGAAATTAGCTCGCTT
PCT01_0024_C06.b : GAATGTTCCATTGAACAGATGGAACATGT*TCGGGGAATGCAAGAGAAATTAGCTCGCTT
CLNT1_0137_B07.b : GAATGTTCCATTGAACAGATGGAACATGT*TCGGGGAATGCAAGAGAAATTAGCTCGCTT
20110601C-008009 : GAATTTGGAGCTCTATGGAGAGTTAGAGGAACTTCCTGAGGATAAGAGAAAAGCAGCCAG
---------+---------+---------+---------+---------+---------+ 648
OVRM1_0040_H10.b : GAATTTTGACCTCTATGGAGAGTTACAAGAACTCTCTGAGGATAAcacaaagccaccagc
OVRM1_0187_H02.b : GAATTTGGAGCTCTATGGAGAGTTAGAGGAACTTCCTGAGGATAAGAGAAAAGCAGCCAG
SMG01_0077_B06.b : GAATTTGGAGCTCTATGGAGAGTTAGAGGAACTTCCTGAGGATAACAGAAAAGCAGCCGG
OVRT1_0051_H11.b : GAATTTGGAGCTCTATGGAGAGTTAGAGGAACTTCCTGAGGATAAGAGAAAAGCAGCCAG
LVRM1_0090_C02.b : GAATTTGGAGCTCTATGGAGAGTTAGAGGAACTTCCTGAGGATAAGAGAAAAGCAGCCAG
OVRM1_0225_E10.b : GAATTTGGAGCTCTATGGAGAGTTAGAGGAACTTCCTGAGGATAAGAGAAAAGCAGCCAG
THY01_0052_E06.b : GAATTTGGAGCTCTATGGAGAGTTAGAGGAACTTCCTGAGGATAAGAGAAAAGCAGCCAG
OVRT1_0091_D11.b : GAATTCGGAGCTCTATGGAGAGTTAGAGGAACTTCCTGAGGATAAGAGAAAAGCAGCCAG
THY01_0109_G01.b : gaattggagctctatgagagttaaaggacttccgaaaaaaaaaaaagcccccggacccc
OVRM1_0176_F12.b : GAATTTGGACCTCTccggcaccttaaacgacttcccgcagagatcacaacctaccccgtg
OVRM1_0015_F01.b : GAATTTGGAGCTCTATGGAGAGTTAGAGGAACTTCCTGAGGATAAGAGAAAAGCAGCCAG
SPL01_0024_A11.b : GAATTTGGAGCTCTATGGAGAGTTAGAGGAACTTCCTGAGGATAAGAGAAAAGCAGCCAG
SPL01_0020_F02.b : GAATTTGGAGCTCTATGGAGAGTTAGAGGAACTTCCTGAGGATAAGAGAAAAGCAGCCAG
CLNT1_0013_C09.b : GAATTTGGAGCTCTATGGAGAGTTAGAGGAACTTCCTGAGGATAAGAGAAAAGCAGCCAG
ITT01_0033_B11.b : GAATTTGGAGCTCTATGGAGAGTTAGAGGAACTTCCTGAGGATAAGAGAAAAGCAGCCAG
CLNT1_0060_D04.b : GAATTTGGAGCTCTATGGAGAGTTAGAGGAACTTCCTGAGGATAAGAGAAAAGCAGCCAG
SMG01_0006_G10.b : GAATTTGGAGCTCTATGGAGAGTTAGAGGAACTTCCTGAGGATAAGAGAAAAGCAGCCAG
SMG01_0019_H08.b : GAATTTGGAGCTCTATGGAGAGTTAGAGGAACTTCCTGAGGATAAGAGAAAAGCAGCCAG
CLNT1_0111_C12.b : GAATTTGGAGCTCTATGGAGAGTTAGAGGAACTTCCTGAGGATAAGAGAAAAGCAGCCAG
SPL01_0068_E12.b : GAATTTGGAGCTCTATGGAGAGTTAGAGGAACTTCCTGAGGATAAGAGAAAAGCAGCCAG
THY01_0020_A08.b : GAATTTGGAGCTCTATGGAGAGTTAGAGGAACTTCCTGAGGATAAGAGACAAGCAGCCAG
PCT01_0024_C06.b : GAATTTGGAGCTCTATGGAGAGTTAGAGGAACTTCCTGAGGATAAGAGAAAAGCAGCCAG
CLNT1_0137_B07.b : GAATTTGGAGCTCTATGGAGAGTTAGAGGAACTTCCTGAGGATAAGAGAAAAGCAGCCAG
20110601C-008009 : TGACTCCAATCTCGATAGGCTTCTGTCTGATCTAGAAGAATTGAATTCTTCGATACAGAA
---------+---------+---------+---------+---------+---------+ 708
OVRM1_0040_H10.b : gactcacatctcgataggcctctgtccgatccacaaaaatttatccttccaaacacacac
OVRM1_0187_H02.b : TGACTCCAATCTCGATAGGCTTCTGTCTGATCTAGAGAAATTG
SMG01_0077_B06.b : TGACTCCAATCTCGATAGGCTTCTGTCTGATCTAGAACAATTGAATTCTTCCATACAGAA
OVRT1_0051_H11.b : TGACTCCAATCTCGATAGGCTTCTGTCTGATCTAGAAGAATTGAATTCTTCGATACAGAA
LVRM1_0090_C02.b : TGACTCCAATCTCGATAGGCTTCTGTCTGATCTAGAAGAATTGAATTCTTCGATACAGAA
OVRM1_0225_E10.b : TGACTCCAATCTCGATAGGCTTCCGTCTGATCTACAAGAATTGAATTCTTCGATACACAA
THY01_0052_E06.b : TGACTCCAATCTCGATAGGCTTCTGTCTGATCTAGAAGAATTGAATTCTTCGATACAGAA
OVRT1_0091_D11.b : TGACTCCAATCTCGATAGGCTTCTGTCTGATCTAGAAGAATTGAATTCTTCGATACAGAA
THY01_0109_G01.b :
OVRM1_0176_F12.b : acctcaatctcgatacacttcagtccgaccaacaaaaataatattttcaggacaaaacga
OVRM1_0015_F01.b : TGACTCCAATCTCGATAGGCTTCTGTCTGATCTAGAAGAATTGAATTCTTCGATACAGAA
SPL01_0024_A11.b : TGACTCCAATCTCGATAGGCTTCTGTCTGATCTAGAAGAATTGAATTCTTCGATACAGAA
SPL01_0020_F02.b : TGACTCCAATCTCGATAGGCTTCTGTCTGATCTAGAAGAATTGAATTCTTCGATACAGAA
CLNT1_0013_C09.b : TGACTCCAATCTCGATAGGCTTCTGTCTGATCTAGAAGAATTGAATTCTTCGATACAGAA
ITT01_0033_B11.b : TGACTCCAATCTCGATAGGCTTCTGTCTGATCTAGAAGAATTGAATTCTTCGATACAGAA
CLNT1_0060_D04.b : TGACTCCAATCTCGATAGGCTTCTGTCTGATCTAGAAGAATTGAATTCTTCGATACAGAA
SMG01_0006_G10.b : TGACTCCAATCTCGATAGGCTTCTGTCTGATCTAGAAGAATTGAATTCTTCGATACAGAA
SMG01_0019_H08.b : TGACTCCAATCTCGATAGGCTTCTGTCTGATCTAGAAGAATTGAATTCTTCGATACAGAA
CLNT1_0111_C12.b : TGACTCCAATCTCGATAGGCTTCTGTCTGATCTAGAAGAATTGAATTCTTCGATACAGAA
SPL01_0068_E12.b : TGACTCCAATCTCGATAGGCTTCTGTCTGATCTAGAAGAATTGAATTCTTCGATACAGAA
THY01_0020_A08.b : TGACTCCAATCTCGATAAGCTTCTGTCTGATCTAGAAGAATTGAATTCTTCGATACAGAA
PCT01_0024_C06.b : TGACTCCAATCTCGATAGGCTTCTGTCTGATCTAGAAGAATTGAATTCTTCGATACAGAA
CLNT1_0137_B07.b : TGACTCCAATCTCGATAGGCTTCTGTCTGATCTAGAAGAATTGAATTCTTCGATACAGAA
20110601C-008009 : ACTACATTTGGCAGATGCTCAAGATGTTCCAAACACTTCTACCAGCTAAAATGAAGTGCA
---------+---------+---------+---------+---------+---------+ 768
OVRM1_0040_H10.b : cagattggcagagcccctaatttgcacactctttttcaagcgtacacaactcaaatccct
OVRM1_0187_H02.b :
SMG01_0077_B06.b : ACTACATTTGGCAGATGCTCAGGATGTTCCAAACACTTCTACCAGCTAAAATGAAGTGCA
OVRT1_0051_H11.b : ACTACATTTGGCAGATGCTCAAGATGTTCCCAACACTTCTACCAGCTAAAATGAAGTGCA
LVRM1_0090_C02.b : ACTACATTTGGCAGATGCTNCAGAT
OVRM1_0225_E10.b : ACTACATTTGGgcgatgccccaggatgtcccaacactcctaccacctacatgaattgcac
THY01_0052_E06.b : ACTACATTTGGCAGATGCTCAAGATGTTCCAAACACTTCTACCAGCTAAAATGAAGTGCA
OVRT1_0091_D11.b : ACTACATTTGGCAGATGCTCAAGATGTTCCAAACACTTCTACCAGCTAAAATGAAGTGCA
THY01_0109_G01.b :
OVRM1_0176_F12.b : ctacaaaccacagagtcagaagttccaaatattccacgcgctcgctacaaatcatacctt
OVRM1_0015_F01.b : ACTACATTTGGCAGATGCTCAAGATGTTCCAAACACTTCTACCAGCTAAAATG
SPL01_0024_A11.b : ACTACATTTGGCAGATGCTCAAGATGTTCCAAACACTTCTACCAGCTAA
SPL01_0020_F02.b : ACTACATTTGGCAGATGCTCAAGATGTTCCAAACACTTCTACCAGCTAAAATGAAGTGCA
CLNT1_0013_C09.b : ACTACATTTGGCAGATGCTCAAGATGTTCCAAACACTTCTACCAGCTAAAATGAAATGCA
ITT01_0033_B11.b : ACTACATTTGGCAGATGCTCAAGATGTTCCAAACACTTCTACCAGCTAAAATGAAGTGCA
CLNT1_0060_D04.b : ACTACATTTGGCAGATGCTCAAGATGTTCCAAACACTTCTACCAGCTAAAATGAAGTGCA
SMG01_0006_G10.b : ACTACATTTGGCAGATGCTNCAGATGTTCCAAACACTTCTACCAGCTAAAATGAAGTGCA
SMG01_0019_H08.b : ACTACATTTGGCAGATGCTCAAGATGTTCCCAACACTTCTACCAGCTAAAATGAAGTGCA
CLNT1_0111_C12.b : ACTACATTTGGCAGATGCTNCAGATGTTCCAAACACTTCTACCAGCTAAAATGAAGTGCA
SPL01_0068_E12.b : ACTACATTTGGCAGATGCTNCAGATGTTCCAAACACTTCTACCAGCTAAAATGAAGTGCA
THY01_0020_A08.b : ACTACATTTGGCAGATGCCCAAGATGTTCCAAAC*CTTCTACCAGCTAAAATGAAGGGCA
PCT01_0024_C06.b : ACTACATTTGGCAGATGCTCAAGATGTTCCCAACACTTCTACCAGCTAAAATGAAGTGCA
CLNT1_0137_B07.b : ACTACATTTGGCAGATGCTCAAGATGTTCCAAACACTTCTACCAGCTAAAATGAAGTGCA
20110601C-008009 : CTTGCTTTCTCGTGG*TTTGAAGAAAAGCAGCATCCTTTACTTTCCAGCTGAATCCAGTA
---------+---------+---------+---------+---------+---------+ 827
OVRM1_0040_H10.b : tttcatt
OVRM1_0187_H02.b :
SMG01_0077_B06.b : CTTGCTTTCTCGGGGGTTTGAAGAAAAGCAGCATCCTTTACTTTCCAGCTGAATCCAGTA
OVRT1_0051_H11.b : CTTGCTTTCTCGTGGAT*TGGAGAAAAGCAGCATCTTTTACTTTCCAGCTTGATCCAGTA
LVRM1_0090_C02.b :
OVRM1_0225_E10.b : ttgcttcctcgt
THY01_0052_E06.b : CTTGCTTTCTCGTGG*TTTGAAGAAAAGCAGCATCCTTTACTTTCCAGCTGAATCCAGTA
OVRT1_0091_D11.b : CTTGCTTTCTCGTGG*TTTGAAGAAAAGCAGCATCCTTTACTTTCCAGCTGAATCCAGTA
THY01_0109_G01.b :
OVRM1_0176_F12.b : tt
OVRM1_0015_F01.b :
SPL01_0024_A11.b :
SPL01_0020_F02.b : CTTGCTTTCTCGTGG*TTTGAAGAAAAGCAGCATCC
CLNT1_0013_C09.b : CTTGCTTTCTCGTGG*TTTGAAGAAAACCACCATCCTTTTCTTTtccgctggatccaggt
ITT01_0033_B11.b : CTTGCTTTCTCGTGG*TTTGAAGAAAAGCAGCATCCCTTACTTTCCAGCTGAATCCAGTA
CLNT1_0060_D04.b : CTTGCTTTCTCGTGG*TTTGAAGAAAAGCAGCATCCTTTACTTTCCAGCTGAATCCAGTA
SMG01_0006_G10.b : CTTGCTTTCTCGTGGTTTTGAAGAA*AGCAGCATCCTTTACTTTCCAGCTGAATCCAGTA
SMG01_0019_H08.b : CTTGCTTTCTCGTGG*TTNNGAGAAAAGCAGCATCCTTTACTTTCCAGCTGAATCCAGTA
CLNT1_0111_C12.b : CTTGCTTTCTCGTGG*TTTGAAGAAAAGCAGCATCCTTTACTTTNCAGCTGAAATCAGTA
SPL01_0068_E12.b : CTTGCTTTCTCGTGG*TTTGAAGAAAAGCAGCATCCTTTTACTTTCAGCTGAATCCAGTA
THY01_0020_A08.b : CCTGCCTTTCTCGTGGCTTGAAGAAAAGCAGCATCCTTTCACTTCCAGTTGAATCCAGCA
PCT01_0024_C06.b : CTTGCTTTCTCGTGG*TTNGNNAGAAAGCAGCATCCTTTACTTTCCAGCTGAATCCAGTA
CLNT1_0137_B07.b : CTTGCTTTCTCGTG**TTTTGAGAAAAACAGCATCCTTTACTTTTCAGCTGAATCCAGTA
20110601C-008009 : GCAGAATCATCTTCCACAATAAGGAATTAAAGT*ATCAAAGTGCCAGTGCAGTGATTGCT
---------+---------+---------+---------+---------+---------+ 886
OVRM1_0040_H10.b :
OVRM1_0187_H02.b :
SMG01_0077_B06.b : acgaaatctcttccaccatacggaattaagtaatcaaacggcagtgcagggttgctttca
OVRT1_0051_H11.b : GCAGAATCATCTTTCCACATAAGGAATTAAAGTAATCAAAGTGCAAGTGCATTGATTGCT
LVRM1_0090_C02.b :
OVRM1_0225_E10.b :
THY01_0052_E06.b : GCAGAATCATCTTCC
OVRT1_0091_D11.b : GCAGAATCATCTTCCACAATAAGGAATTAAAAGTATCAAAGTGGCAGTGCAGTGATTGCT
THY01_0109_G01.b :
OVRM1_0176_F12.b :
OVRM1_0015_F01.b :
SPL01_0024_A11.b :
SPL01_0020_F02.b :
CLNT1_0013_C09.b : aacaaaatcctccttcacaataagggattaaagttatccaagtgccagggccgtgattgc
ITT01_0033_B11.b : GCAGAATCCTCTTCCACAATAAGGATTTAA*GTTATCCAAGTGCAAGTGCAGTGATTGCT
CLNT1_0060_D04.b : GCAGAATCATCTTCCACAATAAGGAATTTAAGTAATCNAAGTGGCAGTGCAGTGATTGCT
SMG01_0006_G10.b : GCAGAATCATCTTCCACAATAGGGATTNAAAGT*ATCAAAGTGCAAGTGCAGTGATTGCT
SMG01_0019_H08.b : GCAGAATCATCTTCCCACATAGGAAATTAAAGT*ATCCAAGTGCCAGTGCAGGGATTGCC
CLNT1_0111_C12.b : GCAGAATCATCTTCCACAATAAGGGATTAAAGNTATCAAAGTGGCAGTGCAGTGATTGCC
SPL01_0068_E12.b : GCAGAATCATCTTTCCACATAGGGAATTAANNGTATC*AAGTGGCAGTGCAGTGATTGCT
THY01_0020_A08.b : ACAAAATCATCTTCCACCATTAGGgattaaagtcatccaagcgccagtgccgtg
PCT01_0024_C06.b : GCAGAATCATCTTCCCACATAGGAATTTTAAGT*ATCAAAGTGNCAGTGCAGTGATTGGC
CLNT1_0137_B07.b : GCAGAATCctcctccaccattagggaattaagttatccaagtgcaagggcaggtgtttgc
20110601C-008009 : TTCACATGCTGCTTTTAGTAACGTGCCATAATTCACGTAACTGGNAGCCTANGCCTTGNN
---------+---------+---------+---------+---------+---------+ 946
OVRM1_0040_H10.b :
OVRM1_0187_H02.b :
SMG01_0077_B06.b : ctgctgcttttaattacctgccctattcaccgtaactggaggctaggcctttgttaaggt
OVRT1_0051_H11.b : TTCcatgctgcttttagttaacgtgccattaattcccggaactggaggcctaggcttgtt
LVRM1_0090_C02.b :
OVRM1_0225_E10.b :
THY01_0052_E06.b :
OVRT1_0091_D11.b : TTCACATGCTGCTTTTtgttaacgtgccataattcacgtaactgggagcctangccttgt
THY01_0109_G01.b :
OVRM1_0176_F12.b :
OVRM1_0015_F01.b :
SPL01_0024_A11.b :
SPL01_0020_F02.b :
CLNT1_0013_C09.b : ttttccttgcttgcttttatattacggggcataattccccgaactgggggcctaagccct
ITT01_0033_B11.b : TTCACATGCCGCTTTaattaacgtgccatattcaccgtaactggaggcctaggcttgttg
CLNT1_0060_D04.b : Tcacatgctgcttttattaacggccataattcaccgtactggaggcctagccttgtgagg
SMG01_0006_G10.b : TT*ACATGCTGCttttagttaacgtgccttattcaccgtaactggaggcctaagccttgg
SMG01_0019_H08.b : TTCACATGCTGCTTTTagttaccgtggcataattcccctaactgggagcccaagccctgn
CLNT1_0111_C12.b : TTCACATGCTGCTTTTagttacgtgccataatttcacgtactggaggcctagcctttgtg
SPL01_0068_E12.b : TTCACATGCTGCTTTTtagttacgtgccattattcacgttactgggaggctangccctgn
THY01_0020_A08.b :
PCT01_0024_C06.b : TTCACATGCTGCTTTTAGTAACGTGCCATAATTCACGTAACTGGNAGCCTANGCCTTGNN
CLNT1_0137_B07.b : ttcccatgccgcttttagttaccggtgcctaattcaccgaactggagggcctaggctttg
20110601C-008009 : TGANGCTTNATCANNGAATGTGATACAGAGCTTTGCTGCTATGCTTTAAATGGTGCCT..
---------+---------+---------+---------+---------+---------+ 1004
OVRM1_0040_H10.b :
OVRM1_0187_H02.b :
SMG01_0077_B06.b : ttaccacgaaggggaacagaactttgcgggctggcttaaatggtgcgctaaggggtaaac
OVRT1_0051_H11.b : tgaagcttattcggaatgggaaaaaaacctttgctgccatgcttaatttgttggcttagg
LVRM1_0090_C02.b :
OVRM1_0225_E10.b :
THY01_0052_E06.b :
OVRT1_0091_D11.b : tgagggcttatcaaggaatgtgaaaagagcttttgctgcatgctttaaatgttgccctaa
THY01_0109_G01.b :
OVRM1_0176_F12.b :
OVRM1_0015_F01.b :
SPL01_0024_A11.b :
SPL01_0020_F02.b :
CLNT1_0013_C09.b : ttttgaaggttaatccggaaatgggaataacaagcttttgccgcccagcctttaattggt
ITT01_0033_B11.b : aaggctaaccagaaaatgtaatcaaagctttgcggcttgctttaaatggtggccttaggg
CLNT1_0060_D04.b : gctatcagaaagtgatacggagctttgctgctagcttatattgtgccttaggggtatact
SMG01_0006_G10.b : tgaaggcctantcaagaaatgtgatccaaagcttttgccggcatgctttaaattggtggc
SMG01_0019_H08.b : tggaaggctaattcggaaatgtgatcacgagctttgccgccaggcttaaaatggtgcctt
CLNT1_0111_C12.b : aagcttnatcagattgtgatacgagctttgctgctaggcttaatgttgcctaggggttaa
SPL01_0068_E12.b : tgaaggccttatccggaaatgtgatc
THY01_0020_A08.b :
PCT01_0024_C06.b : TGANGCTTNATCANNGAATGTGATACAGAGCTTTGCTGCTATGCTTTAAATGGTGCCTat
CLNT1_0137_B07.b : gtgaaggcttattcaggaaatgggaaacaagacttttcggcatgcttatatggtgcccta
20110601C-008009 : ............................................................
---------+---------+---------+---------+---------+---------+ 1004
OVRM1_0040_H10.b :
OVRM1_0187_H02.b :
SMG01_0077_B06.b : tgaaagggtggggctatggtgtaaaagggcaagggtttccctccggacccccaatttttc
OVRT1_0051_H11.b : ggttaaacttaaaatgtgtgggcaaaatgttgaagggctgaaggatttttctttcggaat
LVRM1_0090_C02.b :
OVRM1_0225_E10.b :
THY01_0052_E06.b :
OVRT1_0091_D11.b : ggggtaaacttggaaagtgttggcaaatggttgaaaggctaaaggttattccttctgaga
THY01_0109_G01.b :
OVRM1_0176_F12.b :
OVRM1_0015_F01.b :
SPL01_0024_A11.b :
SPL01_0020_F02.b :
CLNT1_0013_C09.b : gccctatgggggtttacccttaaagtgtttgtggcaattgtttaatagggggaaggatct
ITT01_0033_B11.b : gtttactttaaatgggtgggcttaatgttgttaaaagggcttaaagatcttcccttctga
CLNT1_0060_D04.b : gaatgtgtgggctaatgtgaaaggctgaggattatcttctgactacaaactattccctgg
SMG01_0006_G10.b : ctatggggttaaacctgaaaagggttgggctaaaggtgttgaaagggctgaaggattttc
SMG01_0019_H08.b : agggggttaacttgaagggggtggggcaaaagttgttgaaagggctgaagatctttcttc
CLNT1_0111_C12.b : cttgaagggttggccaatgtgataaggtgaaggtttatcttctgactcccaatttttcct
SPL01_0068_E12.b :
THY01_0020_A08.b :
PCT01_0024_C06.b : ggggtatactttgaatgggtggtgctaaatgtgntgatggnctgaagatctatcttnctg
CLNT1_0137_B07.b : tggggtttacttgaaaggtgttggccaagtttaaagggctgaagattttctttccgagcc
20110601C-008009 : ............................................................
---------+---------+---------+---------+---------+---------+ 1004
OVRM1_0040_H10.b :
OVRM1_0187_H02.b :
SMG01_0077_B06.b : cctgttggcccattaagggacagggtttgggggcccccctctttatgataaaacaataac
OVRT1_0051_H11.b : ccccaaattattccctgtgtggcccaattgaagggccaagcttttccggggccccccttt
LVRM1_0090_C02.b :
OVRM1_0225_E10.b :
THY01_0052_E06.b :
OVRT1_0091_D11.b : taacaaattattccagtggtggcccaattaaaggggaaaggtttttcgggagcccacctt
THY01_0109_G01.b :
OVRM1_0176_F12.b :
OVRM1_0015_F01.b :
SPL01_0024_A11.b :
SPL01_0020_F02.b :
CLNT1_0013_C09.b : actcttccggagctccaaaattttttcccggttgggtcccaattgatgggacaaaggctt
ITT01_0033_B11.b : actcaccaaatttttccactgttggtcccaattgagggggccaaggttttctggggcgcc
CLNT1_0060_D04.b : tggtcaagtgaggggcaagctttcggcacccacttcttttagtaaaatcaaaaacccggc
SMG01_0006_G10.b : cttccggagttaccaaattatttccatggtggtcccaaatgaaggggccaggtttttcgg
SMG01_0019_H08.b : ccgaattcccaaattattccccggtggtccaaattaaggggcccggctttccgggccccc
CLNT1_0111_C12.b : gttggcccaagtgaggggcaggcttttggggcccaccttttttaataaaattaaaaaacc
SPL01_0068_E12.b :
THY01_0020_A08.b :
PCT01_0024_C06.b : actcacaacctattcactgtggtcccagtgaggtgcaggcttttctggaaccaccttcat
CLNT1_0137_B07.b : ccaaaattttccccgtgtggtcccatttaggggcccagggtttttgggcccccctctttt
20110601C-008009 : ............................................................
---------+---------+---------+---------+---------+---------+ 1004
OVRM1_0040_H10.b :
OVRM1_0187_H02.b :
SMG01_0077_B06.b : accggggggttccaggccggaaaaaaagtaagaatttgcaattggtttataaaggtggtt
OVRT1_0051_H11.b : tttttacataaaaaaaaaaaaaccccggggtggttttcccggcccgagacaaaaggttta
LVRM1_0090_C02.b :
OVRM1_0225_E10.b :
THY01_0052_E06.b :
OVRT1_0091_D11.b : cgttaaagaaaacatcaataacccctggggggttttcccgggccgggaaaaaaggtttaa
THY01_0109_G01.b :
OVRM1_0176_F12.b :
OVRM1_0015_F01.b :
SPL01_0024_A11.b :
SPL01_0020_F02.b :
CLNT1_0013_C09.b : tttgggggcccccgtctttcttttacgtgaaaattaaaaaaccccctcggggggttttcc
ITT01_0033_B11.b : aatttccgttttcggttaaaaatccaaaaacccccggggggtgttttccacgcccgggac
CLNT1_0060_D04.b : ggttcccggccgggaaaaagggttgggttttggatttttttttaaaggtttttattcaaa
SMG01_0006_G10.b : ggacccagtttcgtttaaagaaaaaacaaaaacccccgggggggtttccagggcccggga
SMG01_0019_H08.b : cttctctttacggaaaaaccaaaaaaccccggcggttttccccgccgggcaaaaatgttt
CLNT1_0111_C12.b : ccgggtgtttcccggccgacaaaaatgttaagttttcaaattccttttaaaggggttttt
SPL01_0068_E12.b :
THY01_0020_A08.b :
PCT01_0024_C06.b : taacataaaatcaaaaacccctggggtgttcacgcccggccaaaaagtttaagaatttgc
CLNT1_0137_B07.b : tttaagaaaaataaaaacaccccgcggggttttccccccgcgggaaaaaaatgtttagat
20110601C-008009 : ............................................................
---------+---------+---------+---------+---------+---------+ 1004
OVRM1_0040_H10.b :
OVRM1_0187_H02.b :
SMG01_0077_B06.b : ttttcaaaaaaaaaaaaaaaaaaaaaaaagcctgtccctgtgggggcccttaatccgggc
OVRT1_0051_H11.b : agaattttcgaaatttttttttaataaaggtgttttattttaaaaaaaaaaaaggccgtg
LVRM1_0090_C02.b :
OVRM1_0225_E10.b :
THY01_0052_E06.b :
OVRT1_0091_D11.b : gatatttggaaatttgttttttaaaagggtggttttattccaaaaaaaaaaaaaaaanaa
THY01_0109_G01.b :
OVRM1_0176_F12.b :
OVRM1_0015_F01.b :
SPL01_0024_A11.b :
SPL01_0020_F02.b :
CLNT1_0013_C09.b : ccgcggcgtgcaaaaaaggtttaaggaatttttggaaactggtctttttttaagaggcgt
ITT01_0033_B11.b : aaaaaaggtttaaggtattttggaaatttgtttt
CLNT1_0060_D04.b : aaaaaaaaaggccttgttttgggggggcgcaaattaaaaaacccccccccccaaaaaagg
SMG01_0006_G10.b : aaaaaaggttaaggattttggaaatttgattttttaaaaggggggtttaattcaaaaaaa
SMG01_0019_H08.b : aagatttccaaattcccttttaaagggggttgttttccaaaaaaaaaaagcgctgtgtcc
CLNT1_0111_C12.b : taaaaaaaaaaggcatttttctggtggggcctaatttaaaaaacccccccccgcaaaaaa
SPL01_0068_E12.b :
THY01_0020_A08.b :
PCT01_0024_C06.b : aaattttttttaaaaggtgtttatttaaaaaaaaaaagccttgtttgagtgggtggccca
CLNT1_0137_B07.b : ttggcaatttctttttttaaagtggttttttcacaaaaaaaaaaaggcccgttccctgtg
20110601C-008009 : ............................................................
---------+---------+---------+---------+---------+---------+ 1004
OVRM1_0040_H10.b :
OVRM1_0187_H02.b :
SMG01_0077_B06.b : cctcgcccctttttagaggctataggataaaggggggtttcacgggaaaacaggtgtaaa
OVRT1_0051_H11.b : gcc
LVRM1_0090_C02.b :
OVRM1_0225_E10.b :
THY01_0052_E06.b :
OVRT1_0091_D11.b : annnannntnnggggctttgtttaatcgtggggggcgcaaatt
THY01_0109_G01.b :
OVRM1_0176_F12.b :
OVRM1_0015_F01.b :
SPL01_0024_A11.b :
SPL01_0020_F02.b :
CLNT1_0013_C09.b : tttttaatccacaan
ITT01_0033_B11.b :
CLNT1_0060_D04.b : gtgtgtttttttctatttaaaaaaaaacacaaatttttcttgggcgggaattggtgcgcc
SMG01_0006_G10.b : aaaaaaaaaaaaaaaggccagtgttccacttaggcgcgcccccttaaattccgcggggca
SMG01_0019_H08.b : catgggggggccctccaaaccccggggcaccaacgcccctttttgaaaggccctcgggga
CLNT1_0111_C12.b : aagtgttgttt
SPL01_0068_E12.b :
THY01_0020_A08.b :
PCT01_0024_C06.b : taaataaaaaaaaccccaccccgcaccaaaaaaaaaatttttttctttttctttttataa
CLNT1_0137_B07.b : ggggcgcgcctatttataaaaccccccccccgcgacaaaaaagaagattttttttttttc
20110601C-008009 : ............................................................
---------+---------+---------+---------+---------+---------+ 1004
OVRM1_0040_H10.b :
OVRM1_0187_H02.b :
SMG01_0077_B06.b : tttgggaaaaccccccccaaaaatgagggacgcgcctctaaaaaacatatta
OVRT1_0051_H11.b :
LVRM1_0090_C02.b :
OVRM1_0225_E10.b :
THY01_0052_E06.b :
OVRT1_0091_D11.b :
THY01_0109_G01.b :
OVRM1_0176_F12.b :
OVRM1_0015_F01.b :
SPL01_0024_A11.b :
SPL01_0020_F02.b :
CLNT1_0013_C09.b :
ITT01_0033_B11.b :
CLNT1_0060_D04.b : cgcc
SMG01_0006_G10.b : cttccaacccctttttttagagggccctaggaggaaaaaaacgggggcccttttcccccg
SMG01_0019_H08.b : taaagacg
CLNT1_0111_C12.b :
SPL01_0068_E12.b :
THY01_0020_A08.b :
PCT01_0024_C06.b : aaaaacaaacaaaatttttttttgggggaccaaataattgcggagaaatttctctcctcg
CLNT1_0137_B07.b : ccctttggtacacaacaccactacaaaattcttctttttgtgccatattatgtggcggag
20110601C-008009 : ............................................................
---------+---------+---------+---------+---------+---------+ 1004
OVRM1_0040_H10.b :
OVRM1_0187_H02.b :
SMG01_0077_B06.b :
OVRT1_0051_H11.b :
LVRM1_0090_C02.b :
OVRM1_0225_E10.b :
THY01_0052_E06.b :
OVRT1_0091_D11.b :
THY01_0109_G01.b :
OVRM1_0176_F12.b :
OVRM1_0015_F01.b :
SPL01_0024_A11.b :
SPL01_0020_F02.b :
CLNT1_0013_C09.b :
ITT01_0033_B11.b :
CLNT1_0060_D04.b :
SMG01_0006_G10.b : ggagaaaacttgttttttgaaaactttgggaaagaaaaacccaaat
SMG01_0019_H08.b :
CLNT1_0111_C12.b :
SPL01_0068_E12.b :
THY01_0020_A08.b :
PCT01_0024_C06.b : ccccnnnnnnnnctcggttgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
CLNT1_0137_B07.b : gatattttcccccgcacgtggggggaga
20110601C-008009 : ............................................................
---------+---------+---------+---------+---------+---------+ 1004
OVRM1_0040_H10.b :
OVRM1_0187_H02.b :
SMG01_0077_B06.b :
OVRT1_0051_H11.b :
LVRM1_0090_C02.b :
OVRM1_0225_E10.b :
THY01_0052_E06.b :
OVRT1_0091_D11.b :
THY01_0109_G01.b :
OVRM1_0176_F12.b :
OVRM1_0015_F01.b :
SPL01_0024_A11.b :
SPL01_0020_F02.b :
CLNT1_0013_C09.b :
ITT01_0033_B11.b :
CLNT1_0060_D04.b :
SMG01_0006_G10.b :
SMG01_0019_H08.b :
CLNT1_0111_C12.b :
SPL01_0068_E12.b :
THY01_0020_A08.b :
PCT01_0024_C06.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
CLNT1_0137_B07.b :