[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-008664

Length: 952

Sequence [FASTA format sequence]
GGCTATGGGT TTTGTTTGGT GTCCTGGTGC GCGGTTGGTA GCCGCGAACT CGTTTTCTTC
CTTTGAGACC TGGCTTCTGC ATTCCAGCGC GGATTGGTGA AGGCTCTACG GCTCCAGTAG
TAGCTAGGGG CCCTGCCGGC GTTTCCTCCC AGGCTCGGCC ATGCCGGCGG TGTTGGGTTT
TGAAGGCAGC GCCAACAAGA TTGGCGTGGG AGTGGTGCGG GATGGCACCG TGCTGGCGAA
CCCTCGGCGC ACTTACGTCA CGCCTCCGGG TACAGGATTC CTTCCAGGTG ATACTGCCAG
GCACCACAGA GCTGTTATCC TGGACCTGCT GCAGGAGGCA CTAACAGAGG CTGGATTAAC
TTCACAAGAT ATTGATTGCA TTGCGTATAC TAAAGGTCCT GGTATGGGTG CCCCATTGGT
TTCTGTGGCT GTTGTGGCGC GTACTATTGC CCAGTTGTGG AATAAGCCAT TGGTGGGTGT
TAACCATTGC ATAGGCCACA TTGAGATGGG CCGCCTCATC ACTGGAGCCA CCAGCCCAAC
TGTGCTGTAT GTCAGTGGAG GAAATACACA GGTGATTGCA TATTCAGAAC ATCGTTACCG
CATCTTTGGG GAAACCATCG ATATTGCTGT GGGTAATTGT CTGGATCGTT TTGCTCGAGT
CCTGAAGATT TCCAATGACC CAAGTCCAGG CTACAACATT GAACAAATGG CAAAGCGAGG
CAAGAAGCTA GTTGAGCTGC CATACACTGT AAAGGGCATG GACGTCTCAT TCTCGGGGAT
CTTGTCTTTC ATTGAGGATG TAGCCCAGCG GATGCTGGCC ACAGGCGAGT GTACTCCTGA
GGATCTATGC TTCTCCTTGC AGGAAACTGT GTTTGCAATG CTGGTAGAGA TCACAGAGCG
GGCCATGGCA CATTGCGGTT CCCAAGAAGC CCTCATCGTA GGAAGAATGG GT


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinOSGEPprobable tRNA threonylcarbamoyladenosine biosynthesis protein OSGEP [Homo sapiens]. 518e-147O
Contig/Assembly ProteinOSGEPL1probable tRNA threonylcarbamoyladenosine biosynthesis protein OSGEPL1 [Homo sapiens]. 872e-17O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinOsgepprobable tRNA threonylcarbamoyladenosine biosynthesis protein Osgep [Mus musculus]. 506e-144O
Contig/Assembly ProteinOsgepl1probable tRNA threonylcarbamoyladenosine biosynthesis protein Osgepl1 [Mus musculus]. 77.81e-14O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC478839PREDICTED: similar to O-sialoglycoprotein endopeptidase-like 1 [Canis familiaris]. 73.23e-13


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinOSGEPprobable tRNA threonylcarbamoyladenosine biosynthesis protein OSGEP [Bos taurus]. 518e-147O
Contig/Assembly ProteinOSGEPL1probable O-sialoglycoprotein endopeptidase 2 [Bos taurus]. 79.34e-15O
Contig/Assembly ProteinOSGEPL1PREDICTED: O-sialoglycoprotein endopeptidase-like 1 [Bos taurus]. 79.34e-15O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinOSGEPPREDICTED: probable tRNA threonylcarbamoyladenosine biosynthesis protein OSGEP [Sus scrofa]. 524e-149O
Contig/Assembly ProteinLOC100512818PREDICTED: probable tRNA threonylcarbamoyladenosine biosynthesis protein OSGEPL1-like [Sus scrofa]. 80.51e-15O


Assembly Members: 10      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010042E02ADR01_0042_E02.bDB785232 
OVR010095C01OVR01_0095_C01.bBW967741 
OVRM10066E05OVRM1_0066_E05.bBP150344 AK235297
OVRM10164C08OVRM1_0164_C08.bBP457118 AK348442
OVRM10191C11OVRM1_0191_C11.bBP457371 
PTG010079G03PTG01_0079_G03.bFS711140 
SMG010059B03SMG01_0059_B03.bFS718340 
SPL010020D02SPL01_0020_D02.bBP157710 
TES010004A05TES01_0004_A05.bCJ030223 AK398117
THY010091D03THY01_0091_D03.bBP163356 

  

SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
157A020.200MSTCA/S
G710.800TCG/S


Alignment:      TOP

20110601C-008664 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
TES01_0004_A05.b :
OVRM1_0066_E05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0059_B03.b : tttttggataaacaxxxxxxxxxxxxxxxxxxxxx
OVR01_0095_C01.b : nnnnggcatgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0164_C08.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPL01_0020_D02.b : ttttggggtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0091_D03.b : ccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0191_C11.b :
PTG01_0079_G03.b :
ADR01_0042_E02.b :
20110601C-008664 : ............GGCTATGGGTTTTGTTTGGTGTCCTGGTGCGCGGTTGGTAGCCGCGAA
---------+---------+---------+---------+---------+---------+ 48
TES01_0004_A05.b : ttttgacgttGGCTATGGGTTTTGTTTGGTGTCCTGGTGCGCGGTTGGTAGCCGCGAA
OVRM1_0066_E05.b : xxxxxxxxxxxxxxxxxxxxxxcTTGTTTGGTGCCCTGGTGCGCGGTTGGTAGCCGCGAA
SMG01_0059_B03.b : xxxxxxxxxxxxxxxxxxxxxxcTTGTTTGGCGTCCTGGTGCGCGGTTGGTAGCCGCGAA
OVR01_0095_C01.b : xxxxxxxxxxxxxxxxxxxxtacTTGTTTGGTGTCCTGGTGCGCGGTTGGTAGCCGCGAA
OVRM1_0164_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxGTTTGGTGTCCTGGTGCGCGGTTGGTAGCCGCGAA
SPL01_0020_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxGTTTGGTGTCCTGGTGCGCGGTTGGTAGCCGCGAA
THY01_0091_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxGTTTGGTGTCCTGGTGCGCGGTTGGTAGCCGCGAA
OVRM1_0191_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGAA
PTG01_0079_G03.b : ncgcgtaantnnntgagtaagcagcggtaxxxxxxxxxxxxxxxxxxxxxxxx
ADR01_0042_E02.b : ntttgaaacaxxxxxxxxxxxxxxxxxxxxxxxxx
20110601C-008664 : CTCGTTTTCTTCCTTTGAGACCTGGCTTCTGCATTCCAGCGCGGATTGGTGAAGGCTCTA
---------+---------+---------+---------+---------+---------+ 108
TES01_0004_A05.b : CTCGTTTTCTTCCTTTGAGACCTGGCTTCTGCATTCCAGCGCGGATTGGTGAAGGCTCTA
OVRM1_0066_E05.b : CTCGTTTTCTTCCTTTGAGACCTGGCTTCTGCATTCCAGCGCGGATTGGTGAAGGCTCTA
SMG01_0059_B03.b : CTCGTTTTCTTCCTTTGAGACCTGGCTTCTGCATTCCAGCGCGGATTGGTGAAGGCTCTA
OVR01_0095_C01.b : CTCGTTTTCTTCCTTTGAGACCTGGCTTCTGCATTCCAGCGCGGATTGGTGAAGGCTCTA
OVRM1_0164_C08.b : CTCGTTTTCTTCCTTTGAGACCTGGCTTCTGCATTCCAGCGCGGATTGGTGAAGGCTCTA
SPL01_0020_D02.b : CTCGTTTTCTTCCTTTGAGACCTGGCTTCTGCATTCCAGCGCGGATTGGTGAAGGCTCTA
THY01_0091_D03.b : CTCGTTTTCTTCCTTTGAGACCTGGCTTCTGCATTCCAGCGCGGATTGGTGAAGGCTCTA
OVRM1_0191_C11.b : CTCGTTTTCTTCCTTTGAGACCTGGCTTCTGCATTCCAGCGCGGATTGGTGAAGGCTCTA
PTG01_0079_G03.b : xxxxxxxxxxxxggTTGAGACCTGGCTTCTGCATTCCAGCGCGGATTGGTGAAGGCTCTA
ADR01_0042_E02.b : xxxxxxxxxxxxctggGAGACCTGGCTTCTGCATTCCAGCGCGGATTGGTGAAGGCTCTA
20110601C-008664 : CGGCTCCAGTAGTAGCTAGGGGCCCTGCCGGCGTTTCCTCCCAGGCTCGGCCATGCCGGC
---------+---------+---------+---------+---------+---------+ 168
TES01_0004_A05.b : CGGCTCCAGTAGTAGCTAGGGGCCCTGCCGGCGTTTCCTCCCAGGCTCGGCCATGCCGGC
OVRM1_0066_E05.b : CGGCTCCAGTAGTAGCTAGGGGCCCTGCCGGCGTTTCCTCCCAGGCTCAGCCATGCCGGC
SMG01_0059_B03.b : CGGCTCCAGTAGTAGCTAGGGGCCCTGCCGGCGTTTCCTCCCAGGCTCGGCCATGCCGGC
OVR01_0095_C01.b : CGGCTCCAGTAGTAGCTAGGGGCCCTGCCGGCGTTTCCTCCCAGGCTCGGCCATGCCGGC
OVRM1_0164_C08.b : CGGCTCCAGTAGTAGCTAGGGGCCCTGCCGGCGTTTCCTCCCAGGCTCGGCCATGCCGGC
SPL01_0020_D02.b : CGGCTCCAGTAGTAGCTAGGGGCCCTGCCGGCGTTTCCTCCCAGGCTCGGCCATGCCGGC
THY01_0091_D03.b : CGGCTCCAGTAGTAGCTAGGGGCCCTGCCGGCGTTTCCTCCCAGGCTCGGCCATGCCGGC
OVRM1_0191_C11.b : CGGCTCCAGTAGTAGCTAGGGGCCCTGCCGGCGTTTCCTCCCAGGCTCAGCCATGCCGGC
PTG01_0079_G03.b : CGGCTCCAGTAGTAGCTAGGGGCCCTGCCGGCGTTTCCTCCCAGGCTCGGCCATGCCGGC
ADR01_0042_E02.b : CGGCTCCAGTAGTAGCTAGGGGCCCTGCCGGCGTTTCCTCCCAGGCTCGGCCATGCCGGC
20110601C-008664 : GGTGTTGGGTTTTGAAGGCAGCGCCAACAAGATTGGCGTGGGAGTGGTGCGGGATGGCAC
---------+---------+---------+---------+---------+---------+ 228
TES01_0004_A05.b : GGTGTTGGGTTTTGAAGGCAGCGCCAACAAGATTGGCGTGGGAGTGGTGCGGGATGGCAC
OVRM1_0066_E05.b : GGTGTTGGGTTTTGAAGGCAGCGCCAACAAGATTGGCGTGGGAGTGGTGCGGGATGGCAC
SMG01_0059_B03.b : GGTGTTGGGTTTTGAAGGCAGCGCCAACAAGATTGGCGTGGGAGTGGTGCGGGATGGCAC
OVR01_0095_C01.b : GGTGTTGGGTTTTGAAGGCAGCGCCAACAAGATTGGCGTGGGAGTGGTGCGGGATGGCAC
OVRM1_0164_C08.b : GGTGTTGGGTTTTGAAGGCAGCGCCAACAAGATTGGCGTGGGAGTGGTGCGGGATGGCAC
SPL01_0020_D02.b : GGTGTTGGGTTTTGAAGGCAGCGCCAACAAGATTGGCGTGGGAGTGGTGCGGGATGGCAC
THY01_0091_D03.b : GGTGTTGGGTTTTGAAGGCAGCGCCAACAAGATTGGCGTGGGAGTGGTGCGGGATGGCAC
OVRM1_0191_C11.b : GGTGTTGGGTTTTGAAGGCAGCGCCAACAAGATTGGCGTGGGAGTGGTGCGGGATGGCAC
PTG01_0079_G03.b : GGTGTTGGGTTTTGAAGGCAGCGCCAACAAGATTGGCGTGGGAGTGGTGCGGGATGGCAC
ADR01_0042_E02.b : GGTGTTGGGTTTTGAAGGCAGCGCCAACAAGATTGGCGTGGGAGTGGTGCGGGATGGCAC
20110601C-008664 : CGTGCTGGCGAACCCTCGGCGCACTTACGTCACGCCTCCGGGTACAGGATTCCTTCCAGG
---------+---------+---------+---------+---------+---------+ 288
TES01_0004_A05.b : CGTGCTGGCGAACCCTCGGCGCACTTACGTCACGCCTCCGGGTACAGGATTCCTTCCAGG
OVRM1_0066_E05.b : CGTGCTGGCGAACCCTCGGCGCACTTACGTCACGCCTCCGGGTACAGGATTCCTTCCAGG
SMG01_0059_B03.b : CGTGCTGGCGAACCCTCGGCGCACTTACGTCACGCCTCCGGGTACAGGATTCCTTCCAGG
OVR01_0095_C01.b : CGTGCTGGCGAACCCTCGGCGCACTTACGTCACGCCTCCGGGTACAGGATTCCTTCCAGG
OVRM1_0164_C08.b : CGTGCTGGCGAACCCTCGGCGCACTTACGTCACGCCTCCGGGTACAGGATTCCTTCCAGG
SPL01_0020_D02.b : CGTGCTGGCGAACCCTCGGCGCACTTACGTCACGCCTCCGGGTACAGGATTCCTTCCAGG
THY01_0091_D03.b : CGTGCTGGCGAACCCTCGGCGCACTTACGTCACGCCTCCGGGTACAGGATTCCTTCCAGG
OVRM1_0191_C11.b : CGTGCTGGCGAACCCTCGGCGCACTTACGTCACGCCTCCGGGTACAGGATTCCTTCCAGG
PTG01_0079_G03.b : CGTGCTGGCGAACCCTCGGCGCACTTACGTCACGCCTCCGGGTACAGGATTCCTTCCAGG
ADR01_0042_E02.b : CGTGCTGGCGAACCCTCGGCGCACTTACGTCACGCCTCCGGGTACAGGATTCCTTCCAGG
20110601C-008664 : TGATACTGCCAGGCACCACAGAGCTGTTATCCTGGACCTGCTGCAGGAGGCACTAACAGA
---------+---------+---------+---------+---------+---------+ 348
TES01_0004_A05.b : TGATACTGCCAGGCACCACAGAGCTGTTATCCTGGACCTGCTGCAGGAGGCACTAACAGA
OVRM1_0066_E05.b : TGATACTGCCAGGCACCACAGAGCTGTTATCCTGGACCTGCTGCAGGAGGCACTAACAGA
SMG01_0059_B03.b : TGATACTGCCAGGCACCACAGAGCTGTTATCCTGGACCTGCTGCAGGAGGCACTAACAGA
OVR01_0095_C01.b : TGATACTGCCAGGCACCACAGAGCTGTTATCCTGGACCTGCTGCAGGAGGCACTAACAGA
OVRM1_0164_C08.b : TGATACTGCCAGGCACCACAGAGCTGTTATCCTAGACCTGCTGCAGGAGGCACTAACAGA
SPL01_0020_D02.b : TGATACTGCCAGGCACCACAGAGCTGTTATCCTGGACCAGCTGCAGGAGGCACTAACAGA
THY01_0091_D03.b : TGATACTGCCAGGCACCACAGAGCTGTTATCCTGGACCTGCTGCAGGAGGCACTAACAGA
OVRM1_0191_C11.b : TGATACTGCCAGGCACCACAGAGCTGTTATCCTGGACCTGCTGCAGGAGGCACTAACAGA
PTG01_0079_G03.b : TGATACTGCCAGGCACCACAGAGCTGTTATCCTGGACCTGCTGCAGGAGGCACTAACAGA
ADR01_0042_E02.b : TGATACTGCCAGGCACCACAGAGCTGTTATCCTGGACCTGCTGCAGGAGGCACTAACAGA
20110601C-008664 : GGCTGGATTAACTTCACAAGATATTGATTGCATTGCGTATACTAAAGGTCCTGGTATGGG
---------+---------+---------+---------+---------+---------+ 408
TES01_0004_A05.b : GGCTGGATTAACTTCACAAGATATTGATTGCATTGCGTATACTAAAGGTCCTGGTATGGG
OVRM1_0066_E05.b : GGCTGGATTAACTTCACAAGATATTGATTGCATTGCGTATACTAAAGGTCCTGGTATGGG
SMG01_0059_B03.b : GGCTGGATTAACTTCACAAGATATTGATTGCGTTGCGTATACTAAAGGTCCTGGTATGGG
OVR01_0095_C01.b : GGCTGGATTAACTTCACAAGATATTGATTGCATTGCGTATACTAAAGGTCCTGGTATGGG
OVRM1_0164_C08.b : GGCTGGATTAACTTCACAAGATATTGATTGCATTGCGTATACTAAAGGTCCTGGTATGGG
SPL01_0020_D02.b : GGCTGGATTAACTTCACAAGATATTGATTGCATTGCGTATACTAAAGGTCCTGGTATGGG
THY01_0091_D03.b : GGCTGGATTAACTTCACAAGATATTGATTGCATTGCGTATACTAAAGGTCCTGGTATGGG
OVRM1_0191_C11.b : GGCTGGATTAACTTCACAAGATATTGATTGCATTGCGTATACTAAAGGTCCTGGTATGGG
PTG01_0079_G03.b : GGCTGGATTAACTTCACAAGATATTGATTGCATTGCGTATACTAAAGGTCCTGGTATGGG
ADR01_0042_E02.b : GGCTGGATTAACTTCACAAGATATTGATTGCATTGCGTATACTAAAGGTCCTGGTATGGG
20110601C-008664 : TGCCCCATTGGTTTCTGTGGCTGTTGTGGCGCGTACTATTGCCCAGTTGTGGAATAAGCC
---------+---------+---------+---------+---------+---------+ 468
TES01_0004_A05.b : TGCCCCATTGGTTTCTGTGGCTGTTGTGGCGCGTACTATTGCCCAGTTGTGGAATAAGCC
OVRM1_0066_E05.b : TGCCCCATTGGTTTCTGTGGCTGTTGTGGCGCGTACTATTGCCCAGTTGTGGAATAAGCC
SMG01_0059_B03.b : TGCCCCATTGGTTTCTGTGGCTGTTGTGGCGCGTACTATTGCCCAGTTGTGGAATAAGCC
OVR01_0095_C01.b : TGCCCCATTGGTTTCTGTGGCTGTTGTGGCGCGTACTATTGCCCAGTTGTGGAATAAGCC
OVRM1_0164_C08.b : TGCCCCATTGGTTTCTGTGGCTGTTGTGGCGCGTACTATTGCCCAGTTGTGGAATAAGCC
SPL01_0020_D02.b : TGCCCCATTGGTTTCTGTGGCTGTTGTGGCGCGTACTATTGCCCAGTTGTGGAATAAGCC
THY01_0091_D03.b : TGCCCCATTGGTTTCTGTGGCTGTTGTGGCGCGTACTATTGCCCAGTTGTGGAATAAGCC
OVRM1_0191_C11.b : TGCCCCATTGGTTTCTGTGGCTGTTGTGGCGCGTACTATTGCCCAGTTGTGGAATAAGCC
PTG01_0079_G03.b : TGCCCCATTGGTTTCTGTGGCTGTTGTGGCGCGTACTATTGCCCAGTTGTGGAATAAGCC
ADR01_0042_E02.b : TGCCCCATTGGTTTCTGTGGCTGTTGTGGCGCGTACTATTGCCCAGTTGTGGAATAAGCC
20110601C-008664 : ATTGGTGGGTGTTAACCATTGCATAGGCCACATTGAGATGGGCCGCCTCATCACTGGAGC
---------+---------+---------+---------+---------+---------+ 528
TES01_0004_A05.b : ATTGGTGGGTGTTAACCATTGCATAGGCCACATTGAGATGGGCCGCCTCATCACTGGAGC
OVRM1_0066_E05.b : ATTGGTGGGTGTTAACCATTGCATAGGCCACATTGAGATGGGCCGCCTCATCACTGGAGC
SMG01_0059_B03.b : ATTGGTGGGTGTTAACCATTGCATAGGCCACATTGAGATGGGCCGCCTCATCACTGGAGC
OVR01_0095_C01.b : ATTGGTGGGTGTTAACCATTGCATAGGCCACATTGAGATGGGCCGCCTCATCACTGGAGC
OVRM1_0164_C08.b : ATTGGTGGGTGTTAACCATTGCATAGGCCACATTGAGATGGGCCGCCTCATCACTGGAGC
SPL01_0020_D02.b : ATTGGTGGGTGTTAACCATTGCATAGGCCACATTGAGATGGGCCGCCTCATCACTGGAGC
THY01_0091_D03.b : ATTGGTGGGTGTTAACCATTGCATAGGCCACATTGAGATGGGCCGCCTCATCACTGGAGC
OVRM1_0191_C11.b : ATTGGTGGGTGTTAACCATTGCATAGGCCACATTGAGATGGGCCGCCTCATCACTGGAGC
PTG01_0079_G03.b : ATTGGTGGGTGTTAACCATTGCATAGGCCACATTGAGATGGGCCGCCTCATCACTGGAGC
ADR01_0042_E02.b : ATTGGTGGGTGTTAACCATTGCATAGGCCACATTGAGATGGGCCGCCTCATCACTGGAGC
20110601C-008664 : CACCAGCCCAACTGTGCTGTATGTCAGTGGAGGAAATACACAGGTGATTGCATATTCAGA
---------+---------+---------+---------+---------+---------+ 588
TES01_0004_A05.b : CACCAGCCCAACTGTGCTGTATGTCAGTGGAGGAAATACACAGGTGATTGCATATTCAGA
OVRM1_0066_E05.b : CGCCTGCCCAACTGTGCTGTATGTCACTGGAGGAAATACACAGGTGATTGCATATTCAGA
SMG01_0059_B03.b : CACCAGCCCAACTGTGCTGTATGTCAGTGGAGGAAATACACAGGTGATTGCATATTCAGA
OVR01_0095_C01.b : CACCAGCCCAACTGTGCTGTATGTCAGTGGAGGAAATACACAGGTGATTGCATATTCAGA
OVRM1_0164_C08.b : CACCAGCCCAACTGTGCTGTATGTCAGTGGAGGAAATACACAGGTGATTGCATATTCAGA
SPL01_0020_D02.b : CACCAGCCCAACTGTGCTGTATGTCAGTGGAGGAAATACACAGGTGATTGCATATTCAGA
THY01_0091_D03.b : CACCAGCCCAACTGTGCTGTATGTCAGTGGAGGAAATACACAGGTGATTGCATATTCAGA
OVRM1_0191_C11.b : CACCAGCCCAACTGTGCTGTATGTCAGTGGAGGAAATACACAGGTGATTGCATATTCAGA
PTG01_0079_G03.b : CACCAGCCCAACTGTGCTGTATGTCAGTGGAGGAAATACACAGGTGATTGCATATTCAGA
ADR01_0042_E02.b : CACCAGCCCAACTGTGCTGTATGTCAGTGGAGGAAATACACAGGTGATTGCATATTCAGA
20110601C-008664 : ACATCGTTACCGCATCTTTGGGGAAACCATCGATATTGCTGTGGGTAATTGTCTGGATCG
---------+---------+---------+---------+---------+---------+ 648
TES01_0004_A05.b : ACATCGTTACCGCATCTTTGGGGAAACCATCGATATTGCTGTGGGTAATTGTCTGGATCG
OVRM1_0066_E05.b : ACATCGTTACCGCATCTTTGGGGAAACCATCGATCATGCTGCGGGTCATTGTCTAGATCG
SMG01_0059_B03.b : ACATCGTTACCGCATCTTTGGGGAAACCATCGATATTGCTGTGGGTAATTGTCTGGATCG
OVR01_0095_C01.b : ACATCGTTACCGCATCTTTGGGGAAACCATCGATATTGCTGTGGGTAATTGTCTGGATCG
OVRM1_0164_C08.b : ACATCGTTACCGCATCTTTGGGGAAACCATCGATATTGCTGTGGGTAATTGTCTGGATCG
SPL01_0020_D02.b : ACATCGTTACCGCATCTTTGGGGAAACCATCGATATTGCTGTGGGTAATTGTCTGGATCG
THY01_0091_D03.b : ACATCGTTACCGCATCTTTGGGGAAACCATCGATATTGCTGTGGGTAATTGTCTGGATCG
OVRM1_0191_C11.b : ACATCGTTACCGCATCTTTGGGGAAACCATCGATATTGCTGTGGGTAATTGTCTGGATCG
PTG01_0079_G03.b : ACATCGTTACCGCATCTTTGGGGAAACCATCGATATTGCTGTGGGTAATTGTCTGGATCG
ADR01_0042_E02.b : ACATCGTTACCGCATCTTTGGGGAAACCATCGATATTGCTGTGGGTAATTGTCTGGATCG
20110601C-008664 : TTTTGCTCGAGTCCTGAAGATTTCCAATGACCCAAGTCCAGGCTACAACATTGAACAAAT
---------+---------+---------+---------+---------+---------+ 708
TES01_0004_A05.b : TTTTGCTCGAGTCCTGAAGATTTCCAATGACCCAAGTCCAGGCTACAACATTGAACAAAT
OVRM1_0066_E05.b : CTTTGCTCCAGTCCTGAAGATTT*CAATGACCCAAGTCCAGGCTTCAAAATTTAACTAAT
SMG01_0059_B03.b : TTTTGCTCGAGTCCTGAAGATTTCCAATGACCCAAGTCCAGGCTACAACATTGAACAAAT
OVR01_0095_C01.b : TTTTGCTCGAGTCCTGAAGATTTCCAATGACCCAAGTCCAGGCTACAACATTGAACAAAT
OVRM1_0164_C08.b : TTTTGCTCGAGTCCTGAAGATTTCCAATGACCCAAGTCCAGGCTACCACATTGAACAAAT
SPL01_0020_D02.b : TTTTGCTCGAGTCCTGAAGATTTCCAATGACCCAAGTCCAGGCTACAACATTGAACAAAT
THY01_0091_D03.b : TTTTGCTCGAGTCCTGAAGATTTCCGATGACCCAAGTCCAGGCTACAACATTGAACAAAT
OVRM1_0191_C11.b : TTTTGTTCGAGTCCTGAAGA*TTCCAATGACCCAAGTCCAGGCTATA*CATTGAACAAAT
PTG01_0079_G03.b : TTTTGCTCGAGTCCTGAAGATTTCCAATGACCCAAGTCCAGGCTACAACATTGAACAAAT
ADR01_0042_E02.b : TTTTGCTCGAGTCCTGAAGATTTCCAATGACCCAAGTCCAGGCTACAATATTGAACAAAT
20110601C-008664 : GGCAAAGCGAGGCAAGAAGCTAGTTGAGCTGCCATACACTGTAAAGGGCATGGACGTCTC
---------+---------+---------+---------+---------+---------+ 768
TES01_0004_A05.b : GGCAAAGCGAGGCAAGAAGCTAGTTGAGCTGCCATACACTGTAAAGGGCATGGACGTCTC
OVRM1_0066_E05.b : GGCTAAACGAGGCAAaccgtaattgagctgcctaacatgtaaaggatatgtcgtctcgtg
SMG01_0059_B03.b : GGCAAAGCGAGGCAGGAAGCTAGTTGAGCTGCCATACACTGTAAAGGGCATGGACGTCCC
OVR01_0095_C01.b : GGCAAAGCGAGGCAAGAAGCTAGTTGAGCTGCCATACACTGTAAAGGGCATGGACGTCTC
OVRM1_0164_C08.b : GGCAAAGCGAGGCAAGAAGCTAGT
SPL01_0020_D02.b : GGCAAAGCGAGGCAAGAAGCTAGTTGAGCTGCCATACACTGTAAAGGGCATGGACGTCTC
THY01_0091_D03.b : GGCAAAGCGAGGCAAGAAGCTAGTTGAGCTGCCATACACTGTAAAGGGCATGGACGTCTC
OVRM1_0191_C11.b : GGC*AAGCGAGGCAAGAACCTAGTTGAGCTGCCATACACTGTAAAGGGCATGGACGTCTC
PTG01_0079_G03.b : GGCAAAGCGAGGCAAGAAGCTAGTTGAGCTGCCATACACTGTAAAGGGCATGGACGTCTC
ADR01_0042_E02.b : GGCAAAGCGAGGCAAGAAGCTAGTTGAGCTGCCATACACTGTAAAGGGCATGGACGTCTC
20110601C-008664 : ATTCTCGGGGATCTTGTCTTTCATTGAGGATGTAGCCCAGCGGATGCTGGCCACAGGCGA
---------+---------+---------+---------+---------+---------+ 828
TES01_0004_A05.b : ATTCTCGGGGATCTTGTCTTTCATTGAGGATGTAGCCCAGCGGATGCTGGCCACAGGCGA
OVRM1_0066_E05.b : tccgag
SMG01_0059_B03.b : ATTCTCGGGGAATCTGTCTTTCCTTGAGGATGTACCCCACCGGATGCTGGCCACAGGCGA
OVR01_0095_C01.b : ATTCTCGGGGATCTTGTCTTTCATTGAGGATGTAGCCCAGCGGATGCTGGCCACAGGCGA
OVRM1_0164_C08.b :
SPL01_0020_D02.b : ATTCTCGGGGATCTTGTCTTTCATTGAGGATGTAGCCCAGCGGATGCTG
THY01_0091_D03.b : ATTCTCGGGGATCTTGTCTTTCATTGAGGATGTAGCCCAGCGGATGCTGGCCACAGGCGA
OVRM1_0191_C11.b : ATTCCCGGGGATCTTGCCTTTCACTGAGGAAGTAGCCCACCGGATGCTGG
PTG01_0079_G03.b : ATTCTCGGGGATCTTGTCTTTCATTGAGGATGTAGCCCAGCGGATGCTGGCCACAAGCGA
ADR01_0042_E02.b : ATTCTCGGGGATCTTGTCTTTCATTGAGGATGTACCCCAACGGATGCTGGGCAACAGCGA
20110601C-008664 : GTGTACTCCTGAGGATCTATGCTTCTCCTTGCAGGAAACTGTGTTTGCAATGCTGGTAGA
---------+---------+---------+---------+---------+---------+ 888
TES01_0004_A05.b : GTGTACTCCTGAGGATCTATGCTTCTCCTTGCANGAAACTGTGTTTGCAATGCTGGTAGA
OVRM1_0066_E05.b :
SMG01_0059_B03.b : GTGTACTCCTGAGGATCTATGCTTCTCCTTGCAGGAAACTGGGTTTGaatggtggaaaaa
OVR01_0095_C01.b : GTGTACTCCTGAGGATCTATGCTTCTTCTTGCANGAAACTGTngtttgcatgctggtaga
OVRM1_0164_C08.b :
SPL01_0020_D02.b :
THY01_0091_D03.b : GTGTACTCCTGAGGATCTATGCTTCTCCTTGCAGGAAACTGTGTTTGCCATGCTGGtaga
OVRM1_0191_C11.b :
PTG01_0079_G03.b : GTGTACTCCTGAGGATCTATGCTTCTCCTTGCAGGAAACTGTGTTTGCAATGCTGGgtaa
ADR01_0042_E02.b : GTGTACTCCTGAGGATCTATGCCTCTCCTTGCAGGAAACTGTGTTTGCAATGCTGGtaaa
20110601C-008664 : GATCACAGAGCGGGCCATGGCACATTGCGGTTCCCAAGAAGCCCTCATCGTAGGAAGAAT
---------+---------+---------+---------+---------+---------+ 948
TES01_0004_A05.b : GATCACAGAGCGGGCCATGGCACATTGCGGTTCCCAAGAAGCCCTCATCGTAGGAAGAAT
OVRM1_0066_E05.b :
SMG01_0059_B03.b : atccaaaacggggcctggcaaattggcgttcccaagaggccttctcgaaggagaaggggt
OVR01_0095_C01.b : gatcacagagcgggcatggnnacattgccgttccccagaaggccctctcgtaagaggagt
OVRM1_0164_C08.b :
SPL01_0020_D02.b :
THY01_0091_D03.b : gattccagagcgggccatggcacattgcggttcccaggaagcccctctcctaggaggagg
OVRM1_0191_C11.b :
PTG01_0079_G03.b : agatcacaaaacggggccatggcacatttgcggttcccaggaagccctcctcgtaagaag
ADR01_0042_E02.b : gatcacagaacggggcctgcctcattgtcggttcccaaaaggcctttcccgaagaagaat
20110601C-008664 : GGGT........................................................
---------+---------+---------+---------+---------+---------+ 952
TES01_0004_A05.b : GGGTtgtaatattaggttacaggaaatgatggaaacaatgtgccaggaacgccgaagccg
OVRM1_0066_E05.b :
SMG01_0059_B03.b : tggaaatttaggttcgggaaagggggaaaaaggggccggaaagggaacccgggttttgcc
OVR01_0095_C01.b : gggttgaatattaggttacagggaatgatggaaacatgtgccaagaaagcggaacccggc
OVRM1_0164_C08.b :
SPL01_0020_D02.b :
THY01_0091_D03.b : gggtggtaatattagggtacaggaaatgatggaaacaatgggcccgaaccccgaaccccc
OVRM1_0191_C11.b :
PTG01_0079_G03.b : aatggggttggaatattaggttacaggaaaatgatggaaaacaatgtgccaggaaacccg
ADR01_0042_E02.b : gggttgtaaaattaggttatcggaatgatggaaatcattgtccttgaaaacggaacccgg
20110601C-008664 : ............................................................
---------+---------+---------+---------+---------+---------+ 952
TES01_0004_A05.b : ggttttttgcccaaatgaaaaattctgctttgacaatggaaccctgataacccaacttgc
OVRM1_0066_E05.b :
SMG01_0059_B03.b : aaaatgaaaatccgcatttaatggagcccgaatacccagtgggggggaaagtttagggtg
OVR01_0095_C01.b : tttttgcccaaaataagaaaatctgcctgaacaaggaaaccctgatacccccgctggggg
OVRM1_0164_C08.b :
SPL01_0020_D02.b :
THY01_0091_D03.b : gctttttgccccaaaagaaaaaattcgcatttgaacatgggaaccccggataccccccgc
OVRM1_0191_C11.b :
PTG01_0079_G03.b : aaaccccggcttttttgccaaaaataaaaaaattctgcctttgaaaatgggaccatgaga
ADR01_0042_E02.b : cttttttccataaataaaatatccgcttgctctggagcttgttaaacccccccggcttgg
20110601C-008664 : ............................................................
---------+---------+---------+---------+---------+---------+ 952
TES01_0004_A05.b : ctggaaaaagtttcaagctggacataggaaccccctcattgaatccgggggtcaaccgaa
OVRM1_0066_E05.b :
SMG01_0059_B03.b : aaataaaaacccctcagaaattgggggacccaaagtttgaacaaaaaataaaagccccgg
OVR01_0095_C01.b : gggaaaagtttcggctgggaatagaacccccccccgggaaactggggtcca
OVRM1_0164_C08.b :
SPL01_0020_D02.b :
THY01_0091_D03.b : ttgggctgggaaaatagtttcgggggtggaaatagggaccccccccccccggaaacttgg
OVRM1_0191_C11.b :
PTG01_0079_G03.b : acccccggctggctgggaaaaatgtttagggtggaacaaggaaacccccctcattaaatt
ADR01_0042_E02.b : aatatttcccggttgcaaataaaccccccattgatctgggcctcaccaaggttttttaac
20110601C-008664 : ............................................................
---------+---------+---------+---------+---------+---------+ 952
TES01_0004_A05.b : ggtttcggaaaaaagaaattaaaatgaacctggagggaatggaaagggtaaaagg
OVRM1_0066_E05.b :
SMG01_0059_B03.b : ggggacaacaggaaagggtcatataatacccctagtgacctcgagaccgggctttctccc
OVR01_0095_C01.b :
OVRM1_0164_C08.b :
SPL01_0020_D02.b :
THY01_0091_D03.b : ggggccccaccaaagggaa
OVRM1_0191_C11.b :
PTG01_0079_G03.b : gggtgtccccaaaaggtttcgaaaaaagaaaataatagtgtcctcgggggaccgaaaagg
ADR01_0042_E02.b : aataattaaatttcctggatgtcctacaactttacatttttattaataccctctttggac
20110601C-008664 : ............................................................
---------+---------+---------+---------+---------+---------+ 952
TES01_0004_A05.b :
OVRM1_0066_E05.b :
SMG01_0059_B03.b : ggaaataaacccaagagggggccccctcccccttgtcccgaaggctataaaaattttggt
OVR01_0095_C01.b :
OVRM1_0164_C08.b :
SPL01_0020_D02.b :
THY01_0091_D03.b :
OVRM1_0191_C11.b :
PTG01_0079_G03.b : gtaaaaggatccaataattcgccccctaaggaaacccccgggaacctggggccttaaccc
ADR01_0042_E02.b : ctcaggacaccggcttctaccttcttaaaaaaatcaaaaaacatgtgatctccctctcct
20110601C-008664 : ............................................................
---------+---------+---------+---------+---------+---------+ 952
TES01_0004_A05.b :
OVRM1_0066_E05.b :
SMG01_0059_B03.b : gaaaaaaaaaaagaaattttgtgagggcggcccttaaacccgggggagtactcaccctct
OVR01_0095_C01.b :
OVRM1_0164_C08.b :
SPL01_0020_D02.b :
THY01_0091_D03.b :
OVRM1_0191_C11.b :
PTG01_0079_G03.b : cccccgaaataaaaccctaaaaaagagggggaccccctcccccctctttaaccccaagag
ADR01_0042_E02.b : tttcctcaaaacctattaaattttctttttatatcaaaatataaatatattttgtttttc
20110601C-008664 : ............................................................
---------+---------+---------+---------+---------+---------+ 952
TES01_0004_A05.b :
OVRM1_0066_E05.b :
SMG01_0059_B03.b : ttaagagaccattgaaataaaagggggcgcttgtgacgagaaac
OVR01_0095_C01.b :
OVRM1_0164_C08.b :
SPL01_0020_D02.b :
THY01_0091_D03.b :
OVRM1_0191_C11.b :
PTG01_0079_G03.b : acctcttaaaaaaattttgtggttttaaaaaaaaaaaaagagcgcctggtctccatgtgt
ADR01_0042_E02.b : tcccttctgttatatccttctgagccttcattatcatcttttaggtttatactcgtttta
20110601C-008664 : ............................................................
---------+---------+---------+---------+---------+---------+ 952
TES01_0004_A05.b :
OVRM1_0066_E05.b :
SMG01_0059_B03.b :
OVR01_0095_C01.b :
OVRM1_0164_C08.b :
SPL01_0020_D02.b :
THY01_0091_D03.b :
OVRM1_0191_C11.b :
PTG01_0079_G03.b : gggcgggcccctttataatccctggggcgcaacttacccacccctttttgagaagggccc
ADR01_0042_E02.b : actgctcttcttttatacccgatgatactttccgcacctttgttttttacttt
20110601C-008664 : ............................................................
---------+---------+---------+---------+---------+---------+ 952
TES01_0004_A05.b :
OVRM1_0066_E05.b :
SMG01_0059_B03.b :
OVR01_0095_C01.b :
OVRM1_0164_C08.b :
SPL01_0020_D02.b :
THY01_0091_D03.b :
OVRM1_0191_C11.b :
PTG01_0079_G03.b : cataagagaataataaagagcgcgcctttttcaacccgagaaaagagatttggtttgtaa
ADR01_0042_E02.b :
20110601C-008664 : ............................................................
---------+---------+---------+---------+---------+---------+ 952
TES01_0004_A05.b :
OVRM1_0066_E05.b :
SMG01_0059_B03.b :
OVR01_0095_C01.b :
OVRM1_0164_C08.b :
SPL01_0020_D02.b :
THY01_0091_D03.b :
OVRM1_0191_C11.b :
PTG01_0079_G03.b : gaaacactctgggggagaaaa
ADR01_0042_E02.b :