
[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-012094

Length: 1,862

Sequence [FASTA format sequence]

SNP mapping information
SNP IDRel.Chr.Location (cM)

Assembly Overview:      TOP
Change score limit to  

BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFGAfibrinogen alpha chain isoform alpha preproprotein [Homo sapiens]. 574e-163O
Contig/Assembly ProteinFGAfibrinogen alpha chain isoform alpha-E preproprotein [Homo sapiens]. 574e-163O
Contig/Assembly ProteinFMN2formin-2 [Homo sapiens]. 77.44e-14
Contig/Assembly ProteinPRXperiaxin isoform 2 [Homo sapiens]. 64.34e-10O
Contig/Assembly ProteinKIAA0754hypothetical protein LOC643314 [Homo sapiens]. 622e-09
Contig/Assembly ProteinLOC100134663PREDICTED: hypothetical protein LOC100134663, partial [Homo sapiens]. 57.42e-08O
Contig/Assembly ProteinPEF1peflin [Homo sapiens]. 55.12e-07O
Contig/Assembly ProteinZNF828zinc finger protein 828 [Homo sapiens]. 54.34e-07O
Contig/Assembly ProteinZNF828zinc finger protein 828 [Homo sapiens]. 54.34e-07O
Contig/Assembly ProteinZNF828zinc finger protein 828 [Homo sapiens]. 54.34e-07O

BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFgafibrinogen, alpha polypeptide isoform 1 [Mus musculus]. 505e-143O
Contig/Assembly ProteinFgafibrinogen, alpha polypeptide isoform 2 [Mus musculus]. 505e-143O
Contig/Assembly ProteinRbm12RNA-binding protein 12 [Mus musculus]. 721e-12
Contig/Assembly ProteinRbm12RNA-binding protein 12 [Mus musculus]. 721e-12
Contig/Assembly ProteinPrxperiaxin isoform L [Mus musculus]. 67.83e-11O
Contig/Assembly ProteinFmn2formin-2 [Mus musculus]. 675e-11
Contig/Assembly ProteinTtntitin isoform N2-A [Mus musculus]. 60.16e-09
Contig/Assembly ProteinGm2027PREDICTED: H/ACA ribonucleoprotein complex non-core subunit NAF1 [Mus musculus]. 56.66e-08O
Contig/Assembly ProteinGm2027PREDICTED: H/ACA ribonucleoprotein complex non-core subunit NAF1 [Mus musculus]. 56.66e-08O
Contig/Assembly ProteinScaf4splicing factor, arginine/serine-rich 15 [Mus musculus]. 55.51e-07O

BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC475473PREDICTED: similar to Fibrinogen alpha chain precursor [Canis familiaris]. 6600.0O
Contig/Assembly ProteinLOC607769PREDICTED: similar to keratinocytes proline-rich protein [Canis familiaris]. 875e-17O
Contig/Assembly ProteinLOC484501PREDICTED: similar to Periaxin [Canis familiaris]. 68.92e-11
Contig/Assembly ProteinLOC490366PREDICTED: similar to formin 2 [Canis familiaris]. 52.81e-06
Contig/Assembly ProteinCOL7A1collagen alpha-1(VII) chain [Canis lupus familiaris]. 50.46e-06
Contig/Assembly ProteinLOC475918PREDICTED: similar to CG5700-PB [Canis familiaris]. 50.46e-06

BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFGAfibrinogen alpha chain precursor [Bos taurus]. 576e-164O
Contig/Assembly ProteinZNF828zinc finger protein 828 [Bos taurus]. 58.23e-08O
Contig/Assembly ProteinZNF828PREDICTED: hypothetical protein [Bos taurus]. 58.23e-08O
Contig/Assembly ProteinTTNPREDICTED: titin [Bos taurus]. 56.67e-08
Contig/Assembly ProteinTTNPREDICTED: titin [Bos taurus]. 56.67e-08

BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFGAPREDICTED: fibrinogen alpha chain [Sus scrofa]. 9580.0O
Contig/Assembly ProteinLOC100626178PREDICTED: fibrinogen alpha chain-like [Sus scrofa]. 539e-153O
Contig/Assembly ProteinPRXPREDICTED: periaxin [Sus scrofa]. 62.86e-10O
Contig/Assembly ProteinLOC100519384PREDICTED: glutamine-rich protein 2-like [Sus scrofa]. 57.82e-08
Contig/Assembly ProteinLOC100520792PREDICTED: peflin-like isoform 1 [Sus scrofa]. 51.22e-06O

Assembly Members: 935      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
LVRM10001A11LVRM1_0001_A11.bBP137871 AK394086
LVRM10089E01LVRM1_0089_E01.bCJ003136 AK394204
LVRM10116A07LVRM1_0116_A07.bBP448546 AK233276


SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change

Alignment:      TOP

20110601C-012094 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
LVRM1_0001_A11.b : cxxxxxxxxxxxxx
LVRM1_0183_C08.b : tt
LVRM1_0116_A07.b : cgtgtcxxxxxx
LVRM1_0108_H09.b : cagttgtcx
LVR01_0077_E10.b : gcattttagggttgxxxxxxxxxxxxxxxxx
LVRM1_0028_F10.b :
LVR01_0008_E12.b : ctataggtgacntanntagacxx
LVR01_0056_H05.b : gcxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0089_E01.b :
LVRM1_0084_B06.b :
LVRM1_0099_A06.b :
LVRM1_0106_B07.b : tggcc
LVRM1_0070_B05.b :
LVRM1_0156_F10.b :
LVRM1_0027_A08.b :
LVRM1_0039_B07.b :
LVRM1_0111_B11.b :
LVRM1_0077_F07.b :
LVRM1_0011_G12.b :
LVRM1_0014_F11.b :
LVR01_0033_D07.b : cxxxxxxxxxxxxxxxxxx
LVR01_0106_G05.b : xxxxxxxxxxxxxxxxxxxxx
LVR01_0089_E09.b : cxxxxxxxxxxxxxxxxxx
LVRM1_0176_B10.b :
LVRM1_0094_E07.b :
LVRM1_0007_B08.b :
LVRM1_0180_D02.b :
LVRM1_0174_D06.b :
LVRM1_0008_H12.b :
LVRM1_0035_E09.b :
LVRM1_0146_F07.b :
LVRM1_0075_H11.b :
LVRM1_0120_F10.b :
LVR01_0093_A09.b : gcatxxxxxxxxxxxx
LVR01_0098_H09.b : tttttttactggacttgtgxxxxx
LVRM1_0049_C03.b :
LVRM1_0087_H04.b :
LVRM1_0093_E11.b :
LVRM1_0085_E11.b :
LVRM1_0011_H08.b :
LVRM1_0095_B09.b :
LVRM1_0197_D03.b :
LVRM1_0189_D01.b :
LVRM1_0168_D01.b :
LVRM1_0182_C05.b :
LVRM1_0194_E08.b :
LVRM1_0118_A05.b :
LVRM1_0077_C07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LVRM1_0188_D02.b :
LVRM1_0048_H06.b :
LVRM1_0110_C01.b :
LVRM1_0170_G06.b :
LVRM1_0082_D05.b :
LVRM1_0097_G11.b :
LVRM1_0201_F08.b :
LVRM1_0150_E03.b :
LVRM1_0125_G07.b :
LVRM1_0118_C11.b :
LVRM1_0016_C04.b :
LVR01_0087_E11.b : ctttttggtxxxxxxxxxxxxx
LVRM1_0137_H01.b :
LVRM1_0122_B09.b :
LVRM1_0144_A10.b :
LVRM1_0080_G02.b :
LVRM1_0019_D03.b :
LVRM1_0070_C09.b :
LVRM1_0137_C12.b :
LVRM1_0011_D10.b :
LVRM1_0123_E07.b :
LVRM1_0121_E08.b :
LVRM1_0002_B06.b :
LVR01_0020_F12.b : ttxxxxxxxxxxxxxxxxxx
LVR01_0047_A01.b : ggggtgtttttccggcttggtgxxxxxx
LVR01_0103_D11.b : ggggttttggcttagtgcxxxxxx
LVR01_0084_A03.b : ggcataggtgxxxxxxx
LVR01_0077_E08.b : ccxxxxxxxxxxxxxxxxx
LVR01_0079_G02.b : ggggggggaatattatgcttggtgxxxxxxx
LVR01_0005_F03.b : gggcatttxxxxxxxxxx
LVR01_0048_F12.b : tggcggtttttcatgcttagtgxxxxxx
LVR01_0054_G03.b : gcatttggtgtcc
LVR01_0016_D01.b : acacggcttggtgcxxxxx
LVR01_0091_H12.b : attttggctctxxxxxxxxxx
LVR01_0014_A12.b : gctxxxxxxxxxxxxxxx
LVR01_0085_B10.b : gggcaxxxxxxxxxxxxxx
LVR01_0017_D11.b : ccttttggtgccnxxx
LVR01_0011_E11.b : gggaatagcttagtgxxxxxx
LVR01_0048_B08.b : ggttttttttttagcttggtgxxxxxxx
LVR01_0083_H02.b : taggcattggtgxxxxxxx
LVR01_0017_F01.b : tctttagcttagtgacntat
LVR01_0002_A05.b : aactcgtgaxxxxxxxxxx
LVR01_0093_D03.b : ccxxxxxxxxxxxxxxxx
LVR01_0018_A10.b : gcatatagtgcnxxxxx
LVR01_0072_F05.b : tttgaggggccccagcttagtgcactxx
LVR01_0073_D02.b : ttttggggtttttacgcttagtgxxxxxx
LVR01_0090_A07.b : gcatttcgctncnxxxxxx
LVR01_0010_H10.b : gcattangtgcxxxxxxx
LVR01_0077_A06.b : gctctxxxxxxxxxxxxxxxx
LVR01_0100_A02.b : gcatttcgtgnxxxxxxxx
LVRM1_0198_E05.b :
LVRM1_0187_F12.b :
LVRM1_0122_C05.b :
LVRM1_0009_C10.b :
LVRM1_0123_F06.b :
LVRM1_0140_C09.b :
LVR01_0031_G10.b : cxxxxxxxxxxxxx
LVRM1_0086_A11.b :
LVRM1_0004_G12.b :
LVRM1_0051_D03.b :
LVRM1_0160_B04.b :
LVRM1_0163_B04.b :
LVRM1_0200_G01.b :
LVRM1_0093_A12.b :
LVRM1_0004_E09.b :
LVRM1_0115_A05.b :
LVRM1_0176_F02.b :
LVRM1_0036_A02.b :
LVRM1_0082_C08.b :
LVRM1_0070_H07.b :
LVRM1_0105_H03.b :
LVRM1_0054_D11.b :
LVRM1_0038_H06.b :
LVRM1_0103_A06.b :
LVRM1_0070_E12.b :
LVRM1_0102_A10.b :
LVRM1_0098_D07.b :
LVRM1_0097_D06.b :
LVRM1_0101_D02.b :
LVRM1_0147_G01.b :
LVRM1_0164_B11.b :
LVRM1_0117_E09.b :
LVRM1_0030_C04.b :
LVRM1_0078_F07.b :
LVRM1_0112_C11.b :
LVRM1_0079_F05.b :
LVRM1_0032_D04.b :
LVRM1_0018_A07.b :
LVRM1_0151_C09.b :
LVRM1_0077_C08.b :
LVRM1_0158_E12.b :
LVRM1_0064_H03.b :
LVR01_0036_G01.b : ctxxxxxxxxxxxxxxxx
LVR01_0077_H04.b : gggtgctttcaggcattggtgxxxxxxx
LVR01_0030_F06.b : xxxxxxxxxxxxxxxx
LVR01_0038_B11.b : cxxxxxxxxxxxxxxxx
LVR01_0060_B06.b : gttaaaaagatctgtgxxxxxxxxxx
LVR01_0048_G02.b : gggtttttttttagcttggtgxxxxxx
LVR01_0054_G09.b : gttxxxxxxxxxxxxxxxx
LVR01_0053_C11.b : gcaxxxxxxxxxxxxxxx
LVR01_0106_C12.b : ggattttagctgcttggtgxxxxxx
LVR01_0091_G03.b : gcxxxxxxxxxxxxxxx
LVR01_0067_D05.b : ccxxxxxxxxxxxxxxxx
LVR01_0096_F11.b : cttxxxxxxxxxxxxxxx
LVR01_0034_A04.b : cctttatgtgxxxxxx
LVR01_0011_C12.b : gattataagctttggtgcxxxx
LVR01_0059_F01.b : gtcttaagctttcxxxxxxxx
LVR01_0061_E01.b : gtttatcggctttcgtgxxxxx
LVR01_0048_D06.b : gggtttttttttagcttagtgactx
LVR01_0073_G04.b : cgcatttggtgccntata
LVR01_0067_E11.b : gcatctagggtgxxxxxx
LVR01_0016_B09.b : gcatttxxxxxxxxx
LVR01_0099_H10.b : ggagcattggtgcnxxxxx
LVR01_0059_C04.b : ttaaaaagctttxxxxxxxx
LVRM1_0053_E03.b :
LVRM1_0192_A07.b :
LVRM1_0085_E10.b :
LVRM1_0196_H02.b :
LVRM1_0096_C04.b :
LVRM1_0038_A03.b :
LVRM1_0038_H05.b :
LVRM1_0189_E10.b :
LVRM1_0118_B07.b :
LVRM1_0055_G02.b :
LVRM1_0034_H07.b :
LVRM1_0084_B12.b :
LVRM1_0031_A07.b :
LVRM1_0153_H07.b :
LVRM1_0137_F02.b :
LVRM1_0145_B10.b :
LVRM1_0149_C09.b :
LVRM1_0034_G09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnx
LVRM1_0137_A11.b :
LVRM1_0052_G09.b :
LVRM1_0119_C11.b :
LVRM1_0002_B09.b :
LVR01_0060_C11.b : aaataaagcttttxxxxx
LVR01_0025_D06.b : ttagggtgxxx
LVR01_0087_D11.b : cxxxxxxxxxxxxx
LVR01_0049_A12.b : tttttttattaaaggcattgtgx
LVR01_0065_H02.b : gcttttagctttagtgxx
LVR01_0102_B04.b : ccatttgggtgxxxx
LVR01_0005_G11.b : cattagxxxxxxxx
LVR01_0097_B04.b : cttttggttgxxxx
LVR01_0051_B01.b : tttggtggtttttcaagcatagt
LVR01_0066_D10.b : gatxxxxxxxxxxxxxxxxx
LVR01_0058_D04.b : ccttttatggtgccta
LVRM1_0007_B02.b :
LVRM1_0183_H11.b :
LVRM1_0107_G01.b :
LVRM1_0204_E01.b :
LVRM1_0096_A11.b :
LVRM1_0052_H05.b :
LVRM1_0092_H05.b :
LVRM1_0200_C01.b :
LVRM1_0207_C05.b :
LVRM1_0202_H01.b :
LVRM1_0199_F03.b :
LVRM1_0200_F05.b :
LVRM1_0051_E01.b :
LVRM1_0199_G05.b :
LVRM1_0094_A11.b :
LVRM1_0011_D01.b :
LVRM1_0077_E03.b :
LVRM1_0061_C10.b :
LVRM1_0130_B09.b :
LVRM1_0130_G09.b :
LVRM1_0154_C12.b :
LVR01_0033_C11.b : xxxxxxxxxxxxxx
LVR01_0054_D04.b : gcattttgtgcact
LVR01_0020_A08.b : cctttatxxxxxxxxx
LVR01_0002_D12.b : xxxxxxxxxxx
LVR01_0078_F03.b : ggctttatggtgxxxxx
LVRM1_0174_B07.b :
LVRM1_0048_C09.b :
LVRM1_0087_A03.b :
LVRM1_0061_B02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LVRM1_0164_C10.b :
LVRM1_0049_H02.b :
LVRM1_0167_D07.b :
LVRM1_0091_A04.b :
LVRM1_0163_H11.b :
LVRM1_0164_C09.b :
LVRM1_0044_D08.b :
LVRM1_0085_A03.b :
LVRM1_0061_E01.b : aaacagacagnacagcacggcacagacagaaacccaagcggacgcggaaaaagga
LVRM1_0168_B06.b :
LVRM1_0061_F10.b :
LVR01_0091_B01.b : gagcattttgngncnxx
LVRM1_0176_E11.b :
LVRM1_0062_E10.b :
LVRM1_0136_B03.b :
LVRM1_0086_C11.b :
LVRM1_0174_A01.b :
LVRM1_0083_F08.b :
LVRM1_0172_A03.b :
LVRM1_0165_D06.b :
LVRM1_0173_G09.b :
LVRM1_0175_A09.b :
LVRM1_0146_A04.b : tagtttgt
LVRM1_0003_B01.b :
LVRM1_0045_H12.b :
LVRM1_0011_F04.b :
LVRM1_0176_G02.b :
LVRM1_0149_F11.b :
LVRM1_0065_A11.b :
LVRM1_0162_A04.b :
LVRM1_0078_C02.b : aagagaaagaggangataatganagantgaataattgtttataattttgatatagtttt
LVR01_0082_H04.b : gtcatttagggtgxxxxx
LVRM1_0157_C11.b :
LVRM1_0004_F02.b :
LVRM1_0188_H07.b :
LVRM1_0192_D04.b :
LVRM1_0019_B02.b :
LVRM1_0088_H10.b :
LVRM1_0092_C12.b :
LVRM1_0020_F05.b :
LVRM1_0053_C01.b :
LVRM1_0145_H05.b :
LVRM1_0192_D02.b :
LVRM1_0125_H05.b :
LVRM1_0055_F03.b :
LVRM1_0018_G01.b :
LVRM1_0087_G12.b :
LVRM1_0183_D01.b :
LVRM1_0084_F09.b :
LVRM1_0192_C03.b :
LVRM1_0149_A01.b :
LVRM1_0186_F05.b :
LVRM1_0043_B07.b :
LVRM1_0180_E02.b :
LVRM1_0208_C02.b :
LVRM1_0057_C05.b :
LVRM1_0064_C12.b :
LVRM1_0189_E02.b :
LVRM1_0124_E01.b :
LVRM1_0076_D11.b :
LVRM1_0196_E01.b :
LVRM1_0181_D03.b :
LVRM1_0057_H11.b :
LVRM1_0085_E02.b :
LVRM1_0179_E03.b :
LVRM1_0050_E11.b :
LVRM1_0055_A01.b :
LVRM1_0094_F01.b :
LVRM1_0087_E02.b :
LVRM1_0094_A09.b :
LVRM1_0081_G03.b :
LVRM1_0092_E05.b :
LVRM1_0126_B04.b :
LVRM1_0164_G03.b :
LVRM1_0003_F01.b :
LVRM1_0040_E01.b :
LVRM1_0164_F02.b :
LVRM1_0146_A02.b :
LVRM1_0207_A03.b :
LVRM1_0181_E11.b :
LVRM1_0181_H05.b :
LVRM1_0185_B11.b :
LVRM1_0093_F06.b :
LVRM1_0085_B10.b :
LVRM1_0166_E08.b :
LVRM1_0195_G07.b :
LVRM1_0082_D01.b :
LVRM1_0175_D02.b :
LVRM1_0094_H06.b :
LVRM1_0100_F02.b :
LVRM1_0100_E03.b :
LVRM1_0176_A01.b :
LVRM1_0100_F04.b :
LVRM1_0047_G06.b :
LVRM1_0115_E02.b :
LVRM1_0170_A05.b :
LVRM1_0176_E04.b :
LVRM1_0195_H01.b :
LVRM1_0184_B03.b :
LVRM1_0113_E04.b :
LVRM1_0093_C03.b :
LVRM1_0093_B02.b :
LVRM1_0173_E11.b :
LVRM1_0038_E06.b :
LVRM1_0103_H07.b :
LVRM1_0115_D03.b :
LVRM1_0007_H01.b :
LVRM1_0061_F05.b :
LVRM1_0039_G01.b :
LVRM1_0112_D02.b :
LVRM1_0189_A03.b :
LVRM1_0176_A12.b :
LVRM1_0020_B12.b :
LVRM1_0037_H04.b :
LVRM1_0038_E05.b :
LVRM1_0123_C06.b :
LVRM1_0172_B03.b :
LVRM1_0029_A04.b :
LVRM1_0100_A08.b :
LVRM1_0100_B07.b :
LVRM1_0101_F09.b :
LVRM1_0099_G02.b :
LVRM1_0100_D02.b :
LVRM1_0020_A12.b :
LVRM1_0118_D03.b :
LVRM1_0164_B08.b :
LVRM1_0176_F01.b :
LVRM1_0009_H04.b :
LVRM1_0198_F02.b :
LVRM1_0106_D04.b :
LVRM1_0189_D07.b :
LVRM1_0022_B01.b :
LVRM1_0037_A06.b :
LVRM1_0096_D08.b :
LVRM1_0108_E02.b :
LVRM1_0199_H03.b :
LVRM1_0038_B05.b :
LVRM1_0136_D11.b :
LVRM1_0047_H04.b :
LVRM1_0091_C05.b :
LVRM1_0091_H09.b :
LVRM1_0149_F12.b :
LVRM1_0121_D06.b :
LVRM1_0136_H12.b :
LVRM1_0054_F12.b :
LVRM1_0055_F12.b :
LVRM1_0101_A05.b :
LVRM1_0065_D08.b :
LVRM1_0130_A06.b :
LVRM1_0082_G06.b :
LVRM1_0207_A07.b :
LVRM1_0039_B01.b :
LVRM1_0097_E05.b :
LVRM1_0112_F01.b :
LVRM1_0117_A07.b :
LVRM1_0128_C05.b :
LVRM1_0047_B06.b :
LVRM1_0158_C12.b :
LVRM1_0145_H11.b :
LVRM1_0026_E08.b :
LVRM1_0117_G02.b :
LVRM1_0186_A12.b :
LVRM1_0197_F08.b :
LVRM1_0114_D11.b : cagttgtcxxxxxxxxxxxx
LVRM1_0040_H06.b :
LVRM1_0146_C05.b :
LVRM1_0204_F09.b :
LVRM1_0145_D12.b :
LVRM1_0082_G12.b :
LVRM1_0104_A06.b :
LVRM1_0037_A12.b :
LVRM1_0125_F01.b :
LVRM1_0205_D11.b :
LVRM1_0163_E10.b :
LVRM1_0033_F01.b :
LVRM1_0191_F10.b :
LVRM1_0114_H12.b :
LVRM1_0036_E05.b :
LVRM1_0039_B11.b :
LVRM1_0176_D05.b :
LVRM1_0043_F11.b :
LVRM1_0074_H03.b :
LVRM1_0085_F10.b :
LVRM1_0133_F08.b :
LVRM1_0061_B05.b :
LVRM1_0121_E06.b :
LVRM1_0136_A04.b :
LVRM1_0145_B12.b :
LVRM1_0043_F08.b :
LVRM1_0201_H09.b :
LVRM1_0102_A06.b :
LVRM1_0104_E12.b :
LVRM1_0039_G12.b :
LVRM1_0098_D05.b :
LVRM1_0014_G10.b :
LVRM1_0089_E12.b :
LVRM1_0030_F04.b :
LVRM1_0033_B07.b :
LVRM1_0031_A02.b :
LVRM1_0035_E07.b :
LVRM1_0070_C11.b :
LVRM1_0012_D05.b :
LVRM1_0053_B05.b :
LVRM1_0074_G01.b :
LVRM1_0077_D01.b :
LVRM1_0088_C06.b :
LVRM1_0086_E09.b :
LVRM1_0034_C03.b :
LVRM1_0109_C04.b :
LVRM1_0128_H10.b :
LVRM1_0074_H06.b :
LVRM1_0153_A05.b :
LVRM1_0082_D12.b :
LVRM1_0034_F06.b :
LVRM1_0054_G11.b :
LVRM1_0057_C10.b :
LVRM1_0089_F10.b :
LVRM1_0165_B12.b :
LVRM1_0199_A09.b :
LVRM1_0003_B07.b :
LVRM1_0003_A03.b :
LVRM1_0074_C07.b :
LVRM1_0106_A12.b :
LVRM1_0075_A11.b :
LVRM1_0065_E07.b :
LVRM1_0121_B08.b :
LVRM1_0004_F06.b :
LVRM1_0108_B02.b :
LVRM1_0073_A10.b :
LVRM1_0074_D05.b :
LVRM1_0154_H03.b :
LVRM1_0164_F10.b :
LVRM1_0117_C11.b :
LVRM1_0065_B06.b :
LVRM1_0039_H09.b :
LVRM1_0147_A08.b :
LVRM1_0200_E10.b :
LVRM1_0106_C08.b :
LVRM1_0032_H02.b :
LVRM1_0151_H04.b :
LVRM1_0014_B06.b :
LVRM1_0153_F12.b : tttatatatcatatcattacttgtatcgtattcttcctcttctactatacctaca
LVRM1_0105_C09.b :
LVRM1_0146_B09.b :
LVRM1_0033_G11.b :
LVRM1_0161_H07.b :
LVRM1_0172_D11.b :
LVRM1_0200_H08.b :
LVRM1_0071_F10.b :
LVRM1_0079_C03.b :
LVRM1_0105_E12.b :
LVRM1_0116_F09.b :
LVRM1_0087_D11.b :
LVRM1_0200_C10.b :
LVRM1_0036_E09.b :
LVRM1_0171_B12.b :
LVRM1_0102_A12.b :
LVRM1_0014_B05.b :
LVRM1_0151_F04.b :
LVRM1_0012_F06.b :
LVRM1_0050_F01.b :
LVRM1_0053_G12.b :
LVRM1_0117_H09.b :
LVRM1_0156_H06.b :
LVRM1_0008_D10.b :
LVRM1_0019_A09.b :
LVRM1_0022_C07.b :
LVRM1_0007_D10.b :
LVRM1_0017_F01.b :
LVRM1_0148_G02.b :
LVRM1_0151_B01.b :
LVRM1_0157_E07.b :
LVRM1_0080_F05.b :
LVRM1_0065_G11.b :
LVRM1_0049_F04.b :
LVRM1_0033_D05.b :
LVRM1_0142_C01.b :
LVRM1_0103_H03.b :
LVRM1_0143_A04.b :
LVR01_0035_H11.b : ggggacctattx
LVRM1_0079_D07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnctancccc
LVRM1_0058_H01.b :
LVRM1_0144_C05.b :
LVRM1_0144_D04.b :
LVRM1_0022_D05.b :
LVRM1_0159_D08.b :
LVRM1_0126_F07.b :
LVRM1_0128_H01.b :
LVRM1_0030_G04.b :
LVRM1_0033_B12.b :
LVRM1_0144_B06.b :
LVRM1_0155_H07.b :
LVRM1_0111_F06.b :
LVRM1_0022_F08.b :
LVRM1_0051_G02.b :
LVRM1_0109_H01.b :
LVRM1_0111_D03.b :
LVRM1_0019_F04.b :
LVRM1_0077_D06.b :
LVR01_0041_E05.b : cttttgggttgcct
LVRM1_0007_C11.b :
LVRM1_0034_D08.b :
LVRM1_0035_C10.b :
LVRM1_0140_G01.b :
LVRM1_0150_E10.b :
LVRM1_0021_A10.b :
LVRM1_0156_C11.b :
LVRM1_0173_E10.b :
LVR01_0038_B07.b : gcatttggtgxxxxx
LVRM1_0139_A06.b :
LVRM1_0151_E10.b :
LVRM1_0153_B11.b :
LVRM1_0154_F10.b :
LVRM1_0122_A12.b :
LVRM1_0134_E11.b :
LVRM1_0148_G11.b :
OVRM1_0092_H07.b :
LVRM1_0021_E10.b :
LVRM1_0030_G01.b :
LVR01_0001_B12.b : aaaaagcttcgtgxxxx
LVRM1_0033_C10.b :
LVRM1_0144_H05.b :
LVRM1_0078_H07.b :
LVRM1_0058_G11.b :
LVRM1_0127_G08.b :
LVRM1_0015_H08.b :
LVRM1_0110_E10.b :
LVRM1_0120_G06.b :
LVRM1_0124_F06.b :
LVRM1_0124_A10.b :
LVRM1_0021_H10.b :
LVRM1_0110_A10.b :
LVRM1_0119_G11.b :
LVRM1_0101_G11.b : nxxxxxxxxxxxxxxxxxxxxx
LVRM1_0012_F10.b :
LVRM1_0015_G12.b :
LVRM1_0160_B09.b :
LVRM1_0016_A11.b :
LVRM1_0149_C10.b :
LVRM1_0139_F10.b :
LVRM1_0146_G08.b :
LVRM1_0149_F10.b :
LVRM1_0050_F10.b :
LVRM1_0144_C11.b :
LVRM1_0149_D10.b :
LVRM1_0143_F09.b :
LVRM1_0157_E09.b :
LVRM1_0128_E09.b :
LVRM1_0149_B07.b :
LVRM1_0001_B04.b :
LVRM1_0063_A07.b :
LVRM1_0138_C08.b :
LVRM1_0140_B09.b :
LVRM1_0139_E12.b :
LVRM1_0121_B06.b :
LVRM1_0006_F10.b :
LVRM1_0125_E08.b :
LVRM1_0142_D12.b :
LVRM1_0006_G03.b :
LVRM1_0130_E08.b :
LVRM1_0001_F10.b :
LVRM1_0001_H12.b :
LVR01_0040_D06.b : cttttggggacxx
LVR01_0078_F04.b : gccxxxxxxxxxxxxxx
LVR01_0015_D07.b : ctttttggtgxxxxx
LVR01_0028_F10.b : xxxxxxxxxxxxx
LVR01_0035_H09.b : ttttggggggaxxxxx
LVR01_0019_E09.b : ctttttgggtaxxxx
LVR01_0035_H12.b : txxxxxxxxxxxxxxx
LVR01_0033_F09.b : txxxxxxxxxxxxxxx
LVR01_0040_F09.b : cctxxxxxxxxxxxxxx
LVR01_0043_F06.b : ccttttggtaxxxx
LVR01_0033_B07.b : tttttgggtgxxxx
LVR01_0043_E09.b : ttttttggtgxxxx
LVR01_0026_A01.b : cttatxxxxxxxxx
LVR01_0005_D07.b : ctxxxxxxxxxxxxxx
LVR01_0039_F10.b : gcxxxxxxxxxxxxxxx
LVR01_0026_D10.b : ttagxxxxxxxxxx
LVR01_0095_E07.b : ccxxxxxxxxxxxx
LVR01_0066_C09.b : ccxxxxxxxxxxxxxx
LVR01_0051_F06.b : gggggtgttttttggcttgtgact
LVR01_0102_D07.b : ttxxxxxxxxxxxxx
LVR01_0087_E07.b : ctttttgggtgxxxxx
LVR01_0060_E05.b : cxxxxxxxxxxx
LVR01_0071_G02.b : tttttttccttttggcctagtgxxxx
LVR01_0079_H02.b : gggggtcgtcxxxxxxxxxxxx
LVR01_0071_B03.b : gctgtgtgtccccagtttggtgxxxx
LVR01_0082_H10.b : agctxxxxxxxxxxxx
LVR01_0047_E11.b : cgggtgacntctttgcttagtgxxx
LVR01_0038_E10.b : ctttttggtgcacxxxx
LVR01_0035_A11.b : ctttxxxxxxxxxx
LVR01_0034_F12.b : gcatttggtgxxxx
LVR01_0037_G02.b : ctxxxxxxxxxxxxx
LVR01_0038_E04.b : cgggggcttagtgctxx
LVR01_0083_A06.b : agggcattggtgxxxx
LVR01_0047_H08.b : gggggttttcttggcttagtgxxxx
LVR01_0094_G11.b : gcxxxxxxxxxxxxx
LVR01_0088_H11.b : gccxxxxxxxxxxxxx
LVR01_0098_A10.b : gggctttgcxxxxxxxx
LVR01_0098_B01.b : ttgtttttttttgacttgtgcnxx
LVR01_0049_F09.b : ggggggggantcggcttaggxxxx
LVR01_0039_G04.b : ttgggggctttggtgxx
LVR01_0053_B04.b : gcattacgtgxxxx
LVR01_0068_H12.b : ttttttggcattcgtgxxxx
LVR01_0031_H09.b : cxxxxxxxxxxxxxx
LVR01_0022_F06.b : cctxxxxxxxxxxxxxxx
LVR01_0003_H09.b : tttgagtggaxxx
LVR01_0082_D01.b : ggcatttagcgtgxxxxx
LVR01_0087_A08.b : gggcaxxxxxxxxxx
LVR01_0086_D08.b : xxxxxxxxxxxxxxx
LVR01_0085_E09.b : cxxxxxxxxxxxxx
LVR01_0026_C09.b : tttggtgcacxxx
LVR01_0028_A04.b : tctaaxxxxxxxx
LVR01_0063_E06.b : ggtcgnccaggcttagtgxxx
LVR01_0015_F02.b : ctxxxxxxxxxxxxx
LVR01_0088_C04.b : ccaxxxxxxxxxxxx
LVR01_0014_B09.b : acxxxxxxxxxxxx
LVR01_0031_D10.b : cxxxxxxxxxxxxxx
LVR01_0086_D07.b : txxxxxxxxxxxx
LVR01_0041_F02.b : ggggggcagcatagtgxxxx
LVR01_0066_F12.b : cxxxxxxxxxxxxxxxx
LVR01_0073_C06.b : cctxxxxxxxxxxxxx
LVR01_0035_C02.b : ctxxxxxxxxxxxx
LVR01_0084_D01.b : gcaxxxxxxxxxxx
LVR01_0083_C12.b : ggcattacgtgxxxxx
LVR01_0022_C06.b : cxxxxxxxxxxxxxx
LVR01_0062_F01.b : tatacccagctttcgtgxxx
LVR01_0038_B02.b : cccxxxxxxxxxxx
LVR01_0074_A12.b : aaaataataatttaagcttggtgxxxx
LVR01_0049_E01.b : gggggttttacattgcttgtgxxxx
LVR01_0072_G01.b : tattgtgcctaccggcttggtgxxx
LVR01_0095_C05.b : ggtttttaaggcttagtgxxxx
LVR01_0029_A09.b : xxxxxxxxxxxxxx
LVR01_0067_C08.b : ggctctacggtgxxxx
LVR01_0096_C07.b : ccttttgcxxxxxxxx
LVR01_0055_F10.b : ccattttggtgxxxx
LVR01_0033_F12.b : cattttggtgxxx
LVR01_0049_D08.b : ttgtttttttttttgcttcgtgxxx
LVR01_0043_G10.b : ccxxxxxxxxxxxxxx
LVR01_0022_E03.b : cattatxxxxxxxx
LVR01_0071_A05.b : ttgtgggtttattagcttagtgxxxx
LVR01_0054_C09.b : ccattttgtgxxxx
LVR01_0089_H05.b : ggcagxxxxxxxxxxx
LVR01_0015_B10.b : ctttttgctgxxxx
LVR01_0002_G01.b : tttgcgtgcacta
LVR01_0044_H10.b : ttttttttggcttggtgcact
LVR01_0052_G05.b : gcxxxxxxxxxxxxx
LVR01_0102_H11.b : gcxxxxxxxxxxxxx
LVR01_0029_B01.b : xxxxxxxxxxxxx
LVR01_0081_C09.b : ggctxxxxxxxxxxxx
LVR01_0052_B02.b : gcattacgctgacc
LVR01_0085_H08.b : cxxxxxxxxxxxx
LVR01_0082_C09.b : gccxxxxxxxxxxxxxx
LVR01_0072_F12.b : ggcxxxxxxxxxxxxx
LVR01_0089_G10.b : cctttggtgxxxxx
LVR01_0002_E07.b : tttxxxxxxxxx
LVR01_0095_B01.b : gttttttttatgcttggtgacct
LVR01_0057_A07.b : ttcaaggctttggtgxxxx
LVR01_0016_H11.b : cctttgggtgaaxxx
LVR01_0053_H10.b : gctttttgtgxxxx
LVR01_0062_F05.b : ggcacaaagcattggtgxxxx
LVR01_0059_E03.b : ataaaagcatacxxxxxx
LVR01_0052_H07.b : gcatttgggtccntan
LVR01_0033_G03.b : cttttggtgccxxxx
LVR01_0009_G11.b : gctttgggggcxxx
LVR01_0086_B05.b : ctxxxxxxxxxxxx
LVR01_0048_F10.b : gggggtttttgggcttaggxxxx
LVR01_0088_H01.b : gcaxxxxxxxxxxxxx
LVR01_0092_C03.b : ggcattacgtgxxxx
LVR01_0101_D08.b : cxxxxxxxxxxxxxx
LVR01_0028_H07.b : xxxxxxxxxxxxxx
LVR01_0012_C07.b : gggtaaggcttagtgxxxx
LVR01_0083_D10.b : ggagcatacggtgxxxx
LVR01_0031_A10.b : tcttttggtgcxxxx
LVR01_0047_A10.b : cggtgcttttttttgcataggtgxxx
LVR01_0091_E12.b : atacaagcatacgtgxxx
LVR01_0028_F12.b : attacgttgcxxxx
LVR01_0035_A03.b : cttttcgtgcxxx
LVR01_0059_H05.b : gatattagcattcgtgxxx
LVR01_0079_F09.b : gcatatagggtgxxxxx
LVR01_0078_G04.b : gcatatatggtgxxxx
LVR01_0025_B05.b : ttttgggtgcacxxx
LVR01_0038_E11.b : cxxxxxxxxxxxxxx
LVR01_0092_E01.b : ccgactggctctcxxxxxx
LVR01_0044_H05.b : cctttgggtgcxxxx
LVR01_0091_E09.b : cctttggctgacxx
LVR01_0095_C04.b : ggttactgaagcttggtgxxxx
LVR01_0105_E05.b : ggggtgttgcgcttagtgxxxx
LVR01_0037_F08.b : ttttggggaxxxx
LVR01_0050_C06.b : ggtttttttttttagcttagtgact
LVR01_0072_D09.b : ggcxxxxxxxxxxxxxx
LVR01_0011_D07.b : gggtgagcttagtgcnxx
LVR01_0037_F03.b : cttxxxxxxxxxxxxx
LVR01_0030_G10.b : xxxxxxxxxxxxx
LVR01_0090_F01.b : gaggcataagtgacta
LVR01_0067_C02.b : ggaatttgggtatacagcttagtgxxxx
LVR01_0071_E11.b : ttgggtgtttcggcttggtgxxxx
LVR01_0054_D12.b : ggcatttggtgxxxxx
LVR01_0066_E06.b : acxxxxxxxxxxxxx
LVR01_0067_C06.b : ctttttatgtaaatctcgcttggtgxxxx
LVR01_0078_A09.b : ggggggttttatttgtttggtgxxxx
LVR01_0048_E12.b : gcttgttcttttaggtctagtgxxx
LVR01_0017_C09.b : cttttggtgaccta
LVR01_0101_E06.b : attxxxxxxxxxxxxx
LVR01_0074_F04.b : gcattttatggtgxxxx
LVR01_0050_F12.b : gtgtgggttttaactgcttagtgac
LVR01_0012_C08.b : gggtttagcattgtgxxxx
LVR01_0099_H11.b : ggcatatggtgcnxxx
LVR01_0004_G07.b : ttttatgtgxxxxx
LVR01_0071_F08.b : tttgtttttttttagcttggtgxxxx
LVR01_0008_C02.b : gagccacggtgaaxx
LVR01_0009_G09.b : cacxxxxxxxxxxxx
LVR01_0049_C03.b : gggggtgtttttatgcttggtgxxx
LVR01_0017_H11.b : gcatttgcgtgcxxxx
LVR01_0068_A07.b : gcattcacgtgxxxxx
LVR01_0008_A06.b : gggcatacgggaxxx
LVR01_0050_G09.b : gcxxxxxxxxxxxx
LVR01_0078_A07.b : gtctctagggtgxxxxx
LVR01_0019_B06.b : cctttttcgtgatxx
LVR01_0048_B07.b : gtgtntgttttcgcttggtgxxx
LVR01_0046_F10.b : gcttttgcgtgcxxxx
LVR01_0067_E03.b : gcatttagggtgcxxx
LVR01_0068_E10.b : gcatgtacggtgcxxx
LVR01_0084_B06.b : ggcatatcgtgxxxx
LVR01_0099_F09.b : catttcxxxxxxxxx
LVR01_0099_F10.b : gggccctggtgxxxx
LVR01_0063_H02.b : aaaaataaaggattggtgxxxx
LVR01_0022_A12.b : gcttttggtgccnxxx
LVR01_0057_C06.b : gggcatgcaaacgtgxxxxxx
LVR01_0061_C04.b : gtaaacctgcttacgtgxxx
LVR01_0094_A10.b : aaatacaggcttxxxxxxxx
LVR01_0078_C05.b : gcatxxxxxxxxxxxxx
LVR01_0098_B12.b : ggcatctggtgacntat
LVR01_0045_H07.b : ccxxxxxxxxxxxxxx
LVR01_0096_H03.b : gggctaaaatcgctttgtgcxxx
LVR01_0044_B05.b : gttgtttaagcttggtgxxxx
LVR01_0016_D12.b : tattgggctttxxxxxxxx
LVR01_0041_A03.b : gaaaaaaggcttcgtgaax
LVR01_0061_H04.b : aataatagctttggtgxxx
LVR01_0078_B04.b : ggcaaatagtgaactatt
LVR01_0083_C02.b : gggcatttxxxxxxx
LVR01_0045_C11.b : ttttttttaggcctcxxxxxxx
LVR01_0103_E01.b : gtgttttcggcatagtgxxxx
LVR01_0094_B02.b : gaaaaaaggcttagtgxxx
LVR01_0079_B06.b : gcxxxxxxxxxxxxxxx
LVR01_0031_F12.b : gcatttxxxxxxxxx
LVR01_0016_G06.b : cttttgggtgxxxxx
LVR01_0104_D07.b : gcggtttcaggattcgtgxxx
LVR01_0100_H02.b : ggctcxxxxxxxxxxxx
LVR01_0028_E07.b : xxxxxxxxxxxx
LVR01_0013_A03.b : gaaataaaagcatacggtgxxxx
LVR01_0074_H09.b : gcxxxxxxxxxxxxxxx
LVR01_0084_F05.b : cxxxxxxxxxxxxx
LVR01_0098_B06.b : tttttttttaagcatagtgxxxx
LVR01_0098_D04.b : gcxxxxxxxxxxxxx
LVR01_0025_B02.b : xxxxxxxxxxxxx
LVR01_0104_C11.b : gtgtttcctagcttagtgaax
LVR01_0051_E09.b : gcattaggtgccta
LVR01_0101_G02.b : tttggcataggtgx
LVR01_0074_C01.b : cttcttgtattaaacgattggtgxxx
LVR01_0060_H08.b : gctttaagcttatgtgxxx
LVR01_0060_H04.b : aaaaaaagcactggtgxxx
LVR01_0068_B04.b : gcxxxxxxxxxxxxxx
LVR01_0026_A06.b : tttggtgxxxxxx
LVR01_0084_F07.b : ctxxxxxxxxxxxxx
LVR01_0073_F05.b : gccattttggatgxxxxx
LVR01_0074_B07.b : gcxxxxxxxxxxxxx
LVR01_0017_G10.b : cattttgggccnx
LVR01_0056_C03.b : gtctxxxxxxxxxxxx
LVR01_0098_B07.b : gccattttggtgxxxxx
LVR01_0008_A12.b : gcattacgtgxxxx
LVR01_0090_B05.b : gcxxxxxxxxxxxxx
LVR01_0071_D05.b : gcattttatggtgxxxx
LVR01_0097_G01.b : ggcatttcgtgncnxxx
LVR01_0017_F04.b : ccattttggtgaccta
LVR01_0072_C08.b : gcxxxxxxxxxxxxxx
LVR01_0044_F12.b : gtatttttagcttggtgcxxx
LVR01_0101_F05.b : gcattttggtgxxxx
LVR01_0046_A03.b : ggtattaacggcttggtgxxx
LVR01_0001_B04.b : xxxxxxxxxxxx
LVR01_0046_G02.b : gggggttaggcttagtgxxx
LVR01_0061_D11.b : tataactagcxxxxxxxxxx
LVR01_0057_E05.b : ccattttggctgacxxx
LVR01_0046_H03.b : gtttttttagcttaxxxxxxx
LVR01_0056_D04.b : ccatattxxxxxxxx
LVRM1_0126_E12.b :
LVRM1_0040_C01.b :
LVRM1_0031_C04.b :
LVRM1_0126_F12.b :
LVRM1_0122_D10.b :
LVR01_0090_E07.b : gcttttggctgac
LVRM1_0087_F12.b :
LVR01_0104_G01.b : tgcttttgctgcatagtgxx
LVR01_0035_F10.b :
LVRM1_0163_C09.b :
LVR01_0055_D10.b : ctttaggt
LVRM1_0142_A08.b :
LVRM1_0002_E10.b :
LVR01_0086_C09.b :
LVRM1_0049_C05.b :
LVRM1_0206_A02.b :
LVRM1_0098_F07.b :
LVR01_0077_H09.b :
LVRM1_0141_F12.b :
LVRM1_0149_C01.b :
LVRM1_0001_A04.b :
LVRM1_0070_G02.b :
LVR01_0010_H04.b :
LVR01_0047_G01.b :
LVRM1_0025_H12.b :
LVRM1_0003_G03.b :
LVRM1_0102_G07.b :
LVRM1_0200_A11.b :
LVRM1_0089_H06.b :
LVRM1_0079_A08.b :
LVRM1_0186_B05.b :
LVRM1_0028_F11.b :
LVRM1_0151_D08.b :
LVR01_0019_B09.b :
LVR01_0087_C01.b :
LVR01_0048_F03.b :
LVR01_0081_D01.b :
LVR01_0054_H04.b :
LVR01_0031_D01.b :
LVR01_0042_D09.b :
LVRM1_0170_A06.b :
LVRM1_0176_D08.b :
LVRM1_0176_B12.b :
LVRM1_0083_A07.b :
LVR01_0060_C06.b :
LVRM1_0207_H06.b :
LVR01_0026_F10.b :
LVR01_0026_E04.b :
LVRM1_0193_G05.b :
LVRM1_0037_C02.b :
LVR01_0046_C07.b :
LVRM1_0051_B07.b :
LVR01_0002_H04.b :
LVR01_0003_H02.b :
LVRM1_0051_D09.b :
LVRM1_0153_A06.b :
LVRM1_0195_D02.b :
LVR01_0073_G05.b :
LVR01_0048_D03.b :
LVRM1_0177_A11.b :
LVRM1_0035_B01.b :
LVRM1_0138_A08.b :
LVRM1_0134_E10.b :
LVRM1_0074_E06.b :
LVR01_0039_G05.b :
LVR01_0078_E08.b :
LVR01_0085_H10.b :
LVRM1_0154_G12.b :
LVRM1_0042_D11.b :
LVRM1_0055_G06.b :
LVRM1_0195_B07.b :
LVRM1_0070_F04.b :
LVRM1_0161_F06.b :
LVRM1_0193_E04.b :
LVRM1_0087_G02.b :
LVR01_0033_A02.b :
LVRM1_0192_C05.b :
LVRM1_0152_A07.b :
LVRM1_0033_D11.b :
LVRM1_0104_C03.b :
LVRM1_0020_F03.b :
LVRM1_0174_A07.b :
LVR01_0013_D04.b :
LVRM1_0083_A03.b :
LVRM1_0122_F08.b :
LVRM1_0156_G07.b :
LVR01_0028_G09.b :
LVR01_0028_H11.b :
LVR01_0008_B05.b :
LVRM1_0119_A07.b :
LVR01_0059_A04.b :
LVR01_0082_D03.b :
LVR01_0074_C06.b :
LVR01_0102_A09.b :
LVR01_0054_A09.b :
LVR01_0099_B10.b :
LVRM1_0172_A12.b :
LVR01_0046_A04.b :
LVRM1_0084_D08.b :
LVR01_0044_F05.b :
LVR01_0003_B11.b :
LVRM1_0092_F05.b :
LVRM1_0023_C12.b :
LVRM1_0142_D02.b :
LVRM1_0052_G08.b :
LVR01_0029_H01.b :
LVR01_0059_C11.b :
LVRM1_0202_E09.b :
LVRM1_0164_C05.b :
LVR01_0073_G10.b :
LVRM1_0144_F01.b :
LVRM1_0189_H05.b :
LVRM1_0090_G05.b :
LVRM1_0166_D09.b :
LVRM1_0081_C04.b :
LVRM1_0134_E02.b :
LVRM1_0069_B03.b :
LVR01_0058_C10.b :
LVRM1_0176_B08.b :
LVRM1_0101_B02.b :
LVRM1_0108_H05.b :
LVRM1_0156_D07.b :
LVRM1_0173_F01.b :
LVRM1_0183_F08.b :
LVRM1_0184_H07.b :
20110601C-012094 : .................................................ATTTGTTGGCC
---------+---------+---------+---------+---------+---------+ 11
LVRM1_0001_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATTTGTTGGCC
LVRM1_0183_C08.b : gtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtTGGCC
LVRM1_0116_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggcctactggGGCC
LVRM1_0108_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttgtGGCC
LVR01_0077_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCC
LVRM1_0028_F10.b : cgttgacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
LVR01_0008_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0056_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0089_E01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0084_B06.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0099_A06.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_B07.b : attgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtt
LVRM1_0070_B05.b : tagtttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0156_F10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0027_A08.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_B07.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0111_B11.b : ccgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_F07.b : agttgaataaagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0011_G12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0014_F11.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxt
LVR01_0033_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_B10.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0094_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0007_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0180_D02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0174_D06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0008_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_E09.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_F07.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0075_H11.b : cgttgacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0120_F10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0093_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_C03.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0087_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0085_E11.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0011_H08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0095_B09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0197_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0189_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0168_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0182_C05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0194_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0118_A05.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_C07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxx
LVRM1_0188_D02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0048_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0110_C01.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0170_G06.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0082_D05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0097_G11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0201_F08.b : gggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0150_E03.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0125_G07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0118_C11.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0016_C04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0137_H01.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0122_B09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_A10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0080_G02.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_D03.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0070_C09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0137_C12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0011_D10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0123_E07.b : ncgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_E08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0002_B06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0020_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0047_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0079_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0005_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_G03.b : tatcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0014_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0085_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_F01.b : agacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0002_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0093_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0018_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0010_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0100_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0198_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0187_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0122_C05.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0009_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0123_F06.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0140_C09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0086_A11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0004_G12.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0051_D03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0160_B04.b : ccctttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0163_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_G01.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_A12.b : xxxxxxxxxxxxxxxxxxx
LVRM1_0004_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0115_A05.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_F02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0036_A02.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0082_C08.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0070_H07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0105_H03.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0054_D11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_H06.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0103_A06.b : taattgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0070_E12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0102_A10.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0098_D07.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0097_D06.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0101_D02.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0147_G01.b : cgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_B11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0117_E09.b : naatttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0030_C04.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_F07.b : acgtgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0112_C11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0079_F05.b : gttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0032_D04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0018_A07.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0151_C09.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_C08.b : agttgacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0158_E12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0064_H03.b : agatttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0036_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0053_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0059_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_G04.b : nxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0059_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0053_E03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0192_A07.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0085_E10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0196_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0096_C04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_A03.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_H05.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0189_E10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0118_B07.b : ncctgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0055_G02.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_H07.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0084_B12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_A07.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0153_H07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0137_F02.b : cgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_B10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_C09.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggggttgggatgtagca
LVRM1_0137_A11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0052_G09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0119_C11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0002_B09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0025_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0005_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_B01.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_D04.b : ctagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0007_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0183_H11.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0107_G01.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0204_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0096_A11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0052_H05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0092_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_C01.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0207_C05.b : gggxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0202_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0199_F03.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_F05.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0051_E01.b : tagttgtcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0199_G05.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0094_A11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0011_D01.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_E03.b : cgttgacaatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0061_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0130_B09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0130_G09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0154_C12.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_D04.b : actagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0020_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0002_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0174_B07.b : cagttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0048_C09.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0087_A03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0061_B02.b : nnnnnntcagtttgncxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_C10.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_H02.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0167_D07.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0091_A04.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0163_H11.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_C09.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0044_D08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0085_A03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0061_E01.b : ggaccaccaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0168_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0061_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_E11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0062_E10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0136_B03.b : ncagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0086_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0174_A01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0083_F08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0172_A03.b : caattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0165_D06.b : aattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0173_G09.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0175_A09.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_A04.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0003_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0045_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0011_F04.b : caattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_G02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_F11.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0065_A11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0162_A04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_C02.b : ttaaagactgcattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_C11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0004_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0188_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0192_D04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_B02.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0088_H10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0092_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0020_F05.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0053_C01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_H05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0192_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0125_H05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0055_F03.b : tagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0018_G01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0087_G12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0183_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0084_F09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0192_C03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_A01.b : cccttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0186_F05.b : xxxxxxxxxxxxxxxx
LVRM1_0043_B07.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0180_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0208_C02.b : xxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0057_C05.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0064_C12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0189_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0124_E01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0076_D11.b : cgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0196_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0181_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0057_H11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0085_E02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0179_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0050_E11.b : gagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0055_A01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0094_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0087_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0094_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0081_G03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0092_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_B04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0003_F01.b : xxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_E01.b : ccgttgtcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_A02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0207_A03.b : gggxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0181_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0181_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0185_B11.b : xxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0085_B10.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0166_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0195_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0082_D01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0175_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0094_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0100_F02.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0100_E03.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_A01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0100_F04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_G06.b : ttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0115_E02.b : cagtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0170_A05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_E04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0195_H01.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0184_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0113_E04.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_C03.b : cgttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_B02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0173_E11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_E06.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0103_H07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0115_D03.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0007_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0061_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_G01.b : ncgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0112_D02.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0189_A03.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0020_B12.b : acgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0037_H04.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_E05.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0123_C06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0172_B03.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0029_A04.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0100_A08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0100_B07.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0101_F09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0099_G02.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0100_D02.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0020_A12.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0118_D03.b : ncctgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_B08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_F01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0009_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0198_F02.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_D04.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0189_D07.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0022_B01.b : cxxxxxxxxxxxxxxxxx
LVRM1_0037_A06.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0096_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0108_E02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0199_H03.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_B05.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0136_D11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_H04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0091_C05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0091_H09.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_F12.b : ncgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_D06.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0136_H12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0054_F12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0055_F12.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0101_A05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0065_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0130_A06.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0082_G06.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0207_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_B01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0097_E05.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0112_F01.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0117_A07.b : naattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_C05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_B06.b : gtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0158_C12.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_H11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0026_E08.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0117_G02.b : taatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0186_A12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0197_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0114_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_H06.b : gcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_C05.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0204_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_D12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0082_G12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0104_A06.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0037_A12.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0125_F01.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0205_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0163_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_F01.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0191_F10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0114_H12.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0036_E05.b : gcgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_B11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_D05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0043_F11.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_H03.b : cgttgacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0085_F10.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0133_F08.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0061_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_E06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0136_A04.b : cagttgtcnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_B12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0043_F08.b : gtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0201_H09.b : gggtxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0102_A06.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0104_E12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_G12.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0098_D05.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0014_G10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0089_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0030_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_B07.b : gcgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_A02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_E07.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0070_C11.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0012_D05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0053_B05.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_G01.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_D01.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0088_C06.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0086_E09.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_C03.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0109_C04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_H10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_H06.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0153_A05.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0082_D12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_F06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0054_G11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0057_C10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0089_F10.b : ttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0165_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0199_A09.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0003_B07.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0003_A03.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_C07.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_A12.b : ncgtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0075_A11.b : cgttgaatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0065_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_B08.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0004_F06.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0108_B02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0073_A10.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_D05.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0154_H03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_F10.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0117_C11.b : cgtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0065_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_H09.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0147_A08.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_E10.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_C08.b : ncctttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0032_H02.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0151_H04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0014_B06.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0153_F12.b : tcacaattctgcattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0105_C09.b : ncctgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_B09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_G11.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0161_H07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0172_D11.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_H08.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0071_F10.b : ncgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0079_C03.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0105_E12.b : acctgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0116_F09.b : ncgtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0087_D11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_C10.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0036_E09.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0171_B12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0102_A12.b : agtttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0014_B05.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0151_F04.b : tagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0012_F06.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0050_F01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0053_G12.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0117_H09.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0156_H06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0008_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_A09.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0022_C07.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0007_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0017_F01.b : aagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0148_G02.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0151_B01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_E07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0080_F05.b : cgttgacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0065_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_F04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_D05.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0142_C01.b : ccagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0103_H03.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0143_A04.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0079_D07.b : nnnatnnnanccgatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0058_H01.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_C05.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_D04.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0022_D05.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0159_D08.b : ttttgnacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_F07.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_H01.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0030_G04.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_B12.b : gcgttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_B06.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0155_H07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0111_F06.b : taatttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0022_F08.b : acgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0051_G02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0109_H01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0111_D03.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_F04.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_D06.b : cgttgatcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0041_E05.b : tatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0007_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_D08.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_C10.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0140_G01.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0150_E10.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_A10.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0156_C11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0173_E10.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0139_A06.b : ncgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0151_E10.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0153_B11.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0154_F10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0122_A12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0134_E11.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0148_G11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0092_H07.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_E10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0030_G01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0001_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_C10.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_H05.b : ncagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_H07.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0058_G11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0127_G08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0015_H08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0110_E10.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0120_G06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0124_F06.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0124_A10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_H10.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0110_A10.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0119_G11.b : nagtttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0101_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0012_F10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0015_G12.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0160_B09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0016_A11.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_C10.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0139_F10.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_G08.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_F10.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0050_F10.b : tcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_C11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_D10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0143_F09.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_E09.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_E09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_B07.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0001_B04.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0063_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0138_C08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0140_B09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0139_E12.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_B06.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0006_F10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0125_E08.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0142_D12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0006_G03.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0130_E08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0001_F10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0001_H12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0019_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0026_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0005_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0039_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0026_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_F06.b : atatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0079_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0047_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0047_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0039_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0053_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0022_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0085_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0026_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0063_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0014_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0041_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0022_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0055_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0022_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0002_G01.b : nntagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0052_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0052_B02.b : tatagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0085_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0002_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0057_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0053_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0059_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0052_H07.b : ntagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0009_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0092_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0047_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0059_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0079_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0025_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0092_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0105_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_F01.b : tanngacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_C09.b : nntagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_F12.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0009_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0019_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0063_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0022_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0057_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_B12.b : anngacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0041_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_B04.b : agacaagtccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0079_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0100_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0013_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0025_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_E09.b : nntagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0026_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0056_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_F04.b : nntagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0001_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0057_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0056_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_E12.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_C01.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_F12.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0122_D10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0087_F12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_F10.b : ctctcgggtcctc
LVRM1_0163_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0055_D10.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0142_A08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0002_E10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_C09.b : gcttagggtgxxxxxxxxxx
LVRM1_0049_C05.b :
LVRM1_0206_A02.b :
LVRM1_0098_F07.b :
LVR01_0077_H09.b :
LVRM1_0141_F12.b :
LVRM1_0149_C01.b :
LVRM1_0001_A04.b :
LVRM1_0070_G02.b :
LVR01_0010_H04.b :
LVR01_0047_G01.b :
LVRM1_0025_H12.b :
LVRM1_0003_G03.b :
LVRM1_0102_G07.b :
LVRM1_0200_A11.b :
LVRM1_0089_H06.b :
LVRM1_0079_A08.b :
LVRM1_0186_B05.b :
LVRM1_0028_F11.b :
LVRM1_0151_D08.b :
LVR01_0019_B09.b :
LVR01_0087_C01.b :
LVR01_0048_F03.b :
LVR01_0081_D01.b :
LVR01_0054_H04.b :
LVR01_0031_D01.b :
LVR01_0042_D09.b :
LVRM1_0170_A06.b :
LVRM1_0176_D08.b :
LVRM1_0176_B12.b :
LVRM1_0083_A07.b :
LVR01_0060_C06.b :
LVRM1_0207_H06.b :
LVR01_0026_F10.b :
LVR01_0026_E04.b :
LVRM1_0193_G05.b :
LVRM1_0037_C02.b :
LVR01_0046_C07.b :
LVRM1_0051_B07.b :
LVR01_0002_H04.b :
LVR01_0003_H02.b :
LVRM1_0051_D09.b :
LVRM1_0153_A06.b :
LVRM1_0195_D02.b :
LVR01_0073_G05.b :
LVR01_0048_D03.b :
LVRM1_0177_A11.b :
LVRM1_0035_B01.b :
LVRM1_0138_A08.b :
LVRM1_0134_E10.b :
LVRM1_0074_E06.b :
LVR01_0039_G05.b :
LVR01_0078_E08.b :
LVR01_0085_H10.b :
LVRM1_0154_G12.b :
LVRM1_0042_D11.b :
LVRM1_0055_G06.b :
LVRM1_0195_B07.b :
LVRM1_0070_F04.b :
LVRM1_0161_F06.b :
LVRM1_0193_E04.b :
LVRM1_0087_G02.b :
LVR01_0033_A02.b :
LVRM1_0192_C05.b :
LVRM1_0152_A07.b :
LVRM1_0033_D11.b :
LVRM1_0104_C03.b :
LVRM1_0020_F03.b :
LVRM1_0174_A07.b :
LVR01_0013_D04.b :
LVRM1_0083_A03.b :
LVRM1_0122_F08.b :
LVRM1_0156_G07.b :
LVR01_0028_G09.b :
LVR01_0028_H11.b :
LVR01_0008_B05.b :
LVRM1_0119_A07.b :
LVR01_0059_A04.b :
LVR01_0082_D03.b :
LVR01_0074_C06.b :
LVR01_0102_A09.b :
LVR01_0054_A09.b :
LVR01_0099_B10.b :
LVRM1_0172_A12.b :
LVR01_0046_A04.b :
LVRM1_0084_D08.b :
LVR01_0044_F05.b :
LVR01_0003_B11.b :
LVRM1_0092_F05.b :
LVRM1_0023_C12.b :
LVRM1_0142_D02.b :
LVRM1_0052_G08.b :
LVR01_0029_H01.b :
LVR01_0059_C11.b :
LVRM1_0202_E09.b :
LVRM1_0164_C05.b :
LVR01_0073_G10.b :
LVRM1_0144_F01.b :
LVRM1_0189_H05.b :
LVRM1_0090_G05.b :
LVRM1_0166_D09.b :
LVRM1_0081_C04.b :
LVRM1_0134_E02.b :
LVRM1_0069_B03.b :
LVR01_0058_C10.b :
LVRM1_0176_B08.b :
LVRM1_0101_B02.b :
LVRM1_0108_H05.b :
LVRM1_0156_D07.b :
LVRM1_0173_F01.b :
LVRM1_0183_F08.b :
LVRM1_0184_H07.b :
---------+---------+---------+---------+---------+---------+ 66
LVRM1_0142_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0002_E10.b : xxxxxxxxxxxxxtgattcactccgttgttactgctgctgcggagctGAGCCCCACCC*C
LVR01_0086_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_C05.b : taattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0206_A02.b : cgggcgggagtgggcgtccggagcgagcgcctgcggt
LVRM1_0098_F07.b : cgttgtcxxxxxxxxxxxxx
LVR01_0077_H09.b : cctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_F12.b :
LVRM1_0149_C01.b :
LVRM1_0001_A04.b :
LVRM1_0070_G02.b :
LVR01_0010_H04.b :
LVR01_0047_G01.b :
LVRM1_0025_H12.b :
LVRM1_0003_G03.b :
LVRM1_0102_G07.b :
LVRM1_0200_A11.b :
LVRM1_0089_H06.b :
LVRM1_0079_A08.b :
LVRM1_0186_B05.b :
LVRM1_0028_F11.b :
LVRM1_0151_D08.b :
LVR01_0019_B09.b :
LVR01_0087_C01.b :
LVR01_0048_F03.b :
LVR01_0081_D01.b :
LVR01_0054_H04.b :
LVR01_0031_D01.b :
LVR01_0042_D09.b :
LVRM1_0170_A06.b :
LVRM1_0176_D08.b :
LVRM1_0176_B12.b :
LVRM1_0083_A07.b :
LVR01_0060_C06.b :
LVRM1_0207_H06.b :
LVR01_0026_F10.b :
LVR01_0026_E04.b :
LVRM1_0193_G05.b :
LVRM1_0037_C02.b :
LVR01_0046_C07.b :
LVRM1_0051_B07.b :
LVR01_0002_H04.b :
LVR01_0003_H02.b :
LVRM1_0051_D09.b :
LVRM1_0153_A06.b :
LVRM1_0195_D02.b :
LVR01_0073_G05.b :
LVR01_0048_D03.b :
LVRM1_0177_A11.b :
LVRM1_0035_B01.b :
LVRM1_0138_A08.b :
LVRM1_0134_E10.b :
LVRM1_0074_E06.b :
LVR01_0039_G05.b :
LVR01_0078_E08.b :
LVR01_0085_H10.b :
LVRM1_0154_G12.b :
LVRM1_0042_D11.b :
LVRM1_0055_G06.b :
LVRM1_0195_B07.b :
LVRM1_0070_F04.b :
LVRM1_0161_F06.b :
LVRM1_0193_E04.b :
LVRM1_0087_G02.b :
LVR01_0033_A02.b :
LVRM1_0192_C05.b :
LVRM1_0152_A07.b :
LVRM1_0033_D11.b :
LVRM1_0104_C03.b :
LVRM1_0020_F03.b :
LVRM1_0174_A07.b :
LVR01_0013_D04.b :
LVRM1_0083_A03.b :
LVRM1_0122_F08.b :
LVRM1_0156_G07.b :
LVR01_0028_G09.b :
LVR01_0028_H11.b :
LVR01_0008_B05.b :
LVRM1_0119_A07.b :
LVR01_0059_A04.b :
LVR01_0082_D03.b :
LVR01_0074_C06.b :
LVR01_0102_A09.b :
LVR01_0054_A09.b :
LVR01_0099_B10.b :
LVRM1_0172_A12.b :
LVR01_0046_A04.b :
LVRM1_0084_D08.b :
LVR01_0044_F05.b :
LVR01_0003_B11.b :
LVRM1_0092_F05.b :
LVRM1_0023_C12.b :
LVRM1_0142_D02.b :
LVRM1_0052_G08.b :
LVR01_0029_H01.b :
LVR01_0059_C11.b :
LVRM1_0202_E09.b :
LVRM1_0164_C05.b :
LVR01_0073_G10.b :
LVRM1_0144_F01.b :
LVRM1_0189_H05.b :
LVRM1_0090_G05.b :
LVRM1_0166_D09.b :
LVRM1_0081_C04.b :
LVRM1_0134_E02.b :
LVRM1_0069_B03.b :
LVR01_0058_C10.b :
LVRM1_0176_B08.b :
LVRM1_0101_B02.b :
LVRM1_0108_H05.b :
LVRM1_0156_D07.b :
LVRM1_0173_F01.b :
LVRM1_0183_F08.b :
LVRM1_0184_H07.b :
---------+---------+---------+---------+---------+---------+ 125
LVRM1_0098_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCACTGTGGTGGGCACAGTT
LVR01_0077_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggcgcctgatgactgagcaccagggaca
LVRM1_0141_F12.b : tcagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_C01.b : cccttgtcxxxxxxxxxxxxxxxxxxxx
LVRM1_0001_A04.b : atxxxxxxxxxxxxxxxxxxxx
LVRM1_0070_G02.b :
LVR01_0010_H04.b : cc
LVR01_0047_G01.b :
LVRM1_0025_H12.b :
LVRM1_0003_G03.b :
LVRM1_0102_G07.b :
LVRM1_0200_A11.b :
LVRM1_0089_H06.b :
LVRM1_0079_A08.b :
LVRM1_0186_B05.b :
LVRM1_0028_F11.b :
LVRM1_0151_D08.b :
LVR01_0019_B09.b :
LVR01_0087_C01.b :
LVR01_0048_F03.b :
LVR01_0081_D01.b :
LVR01_0054_H04.b :
LVR01_0031_D01.b :
LVR01_0042_D09.b :
LVRM1_0170_A06.b :
LVRM1_0176_D08.b :
LVRM1_0176_B12.b :
LVRM1_0083_A07.b :
LVR01_0060_C06.b :
LVRM1_0207_H06.b :
LVR01_0026_F10.b :
LVR01_0026_E04.b :
LVRM1_0193_G05.b :
LVRM1_0037_C02.b :
LVR01_0046_C07.b :
LVRM1_0051_B07.b :
LVR01_0002_H04.b :
LVR01_0003_H02.b :
LVRM1_0051_D09.b :
LVRM1_0153_A06.b :
LVRM1_0195_D02.b :
LVR01_0073_G05.b :
LVR01_0048_D03.b :
LVRM1_0177_A11.b :
LVRM1_0035_B01.b :
LVRM1_0138_A08.b :
LVRM1_0134_E10.b :
LVRM1_0074_E06.b :
LVR01_0039_G05.b :
LVR01_0078_E08.b :
LVR01_0085_H10.b :
LVRM1_0154_G12.b :
LVRM1_0042_D11.b :
LVRM1_0055_G06.b :
LVRM1_0195_B07.b :
LVRM1_0070_F04.b :
LVRM1_0161_F06.b :
LVRM1_0193_E04.b :
LVRM1_0087_G02.b :
LVR01_0033_A02.b :
LVRM1_0192_C05.b :
LVRM1_0152_A07.b :
LVRM1_0033_D11.b :
LVRM1_0104_C03.b :
LVRM1_0020_F03.b :
LVRM1_0174_A07.b :
LVR01_0013_D04.b :
LVRM1_0083_A03.b :
LVRM1_0122_F08.b :
LVRM1_0156_G07.b :
LVR01_0028_G09.b :
LVR01_0028_H11.b :
LVR01_0008_B05.b :
LVRM1_0119_A07.b :
LVR01_0059_A04.b :
LVR01_0082_D03.b :
LVR01_0074_C06.b :
LVR01_0102_A09.b :
LVR01_0054_A09.b :
LVR01_0099_B10.b :
LVRM1_0172_A12.b :
LVR01_0046_A04.b :
LVRM1_0084_D08.b :
LVR01_0044_F05.b :
LVR01_0003_B11.b :
LVRM1_0092_F05.b :
LVRM1_0023_C12.b :
LVRM1_0142_D02.b :
LVRM1_0052_G08.b :
LVR01_0029_H01.b :
LVR01_0059_C11.b :
LVRM1_0202_E09.b :
LVRM1_0164_C05.b :
LVR01_0073_G10.b :
LVRM1_0144_F01.b :
LVRM1_0189_H05.b :
LVRM1_0090_G05.b :
LVRM1_0166_D09.b :
LVRM1_0081_C04.b :
LVRM1_0134_E02.b :
LVRM1_0069_B03.b :
LVR01_0058_C10.b :
LVRM1_0176_B08.b :
LVRM1_0101_B02.b :
LVRM1_0108_H05.b :
LVRM1_0156_D07.b :
LVRM1_0173_F01.b :
LVRM1_0183_F08.b :
LVRM1_0184_H07.b :
---------+---------+---------+---------+---------+---------+ 184
LVRM1_0149_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0001_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAGGAGGTGTGCGTGG
LVRM1_0070_G02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0010_H04.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx