[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-012094

Length: 1,862

Sequence [FASTA format sequence]
ATTTGTTGGC CTACTGGACA ATTCTTTCCT CCAGCAGGAG TGCTCCTCCG GAGCGAGCCC
CACCCCTGGC AAAGATGTTT TCGGTGAGGC TCTTCTGCCT GGTCCTCACT GTGGTGGGCA
CAGTTCAGAT GGCAGAGGTC CAAGATAAAG GTGAATTTCT AGCTGAAGGA GGAGGTGTGC
GTGGCCCAAG ACTTACGGAA AGACATCAAT CTGCCTGCAA GGAGTCAGAC TGGCCTTTCT
GTTCTGACGA AGACTGGAAC ATCAAATGCC CTTCTGGCTG CAGAATGAAA GGGTTGATTG
ATGAAGTCAA TCAAGATTTT ACAAACAGAA TAAATAAACT AAAAAATTCA CTATTTGATT
ATCAGAAAAA CAATAAGGAC TCTAGTACAT TGAGCAGGAA CATAATTGAG CTTTTGAGAG
GGGACTTCTC CAATGCTAAC AACAATGATA ATATATACAG CCAAGTGTCA GAAGAACTGA
GAAGCAGAAT TGAGATCCTG AAGCGCAAAG TCTTAGAAAA AGTACAGCAC ATCCACCTTC
TGCAGAAAAA TGTCAGGGAT CAGCTGATAG AGATGAAACG GCTGGAGGTG GACATTGATA
TTAAGATCCG ATCTTGCAAA GGGTCATGCA GTAGGGCTTT AGAACATAAG GTAGACCTCA
AGGACTATGA AAATCAGCAG AAGCAACTTG ACCAGGTTAT TGCCATAAAC TTACTTCCCT
CTAGAGATAG GCAATACTTA CCACTGATAA AAATCAGCCC ACTTCCAGAC ATAACTCCTG
CAGATTTCAA GACCCAGGCT CGGGAAACCC CTCCAGAGTG GAAGGCACTG CTAGAAACAC
GGCAGGTGAA AATGGTGTTG GAGAGGGTTG GTGGAGACGA GCGTACCCGA GGAGGCTCTA
TATCTCATGG ACCAGGATCC GTACCTGGAA CTGGTAGCCC TGGAGGTCTG AAACCTGGGA
GCTATGGACC TGGAGGTCCT GGCACTTGGA AGCCTGGCCG TCCTGAGCCT GGAAGTACTG
GCACTTGGGA TTCTGGCCAT CCTGATCCTG GAAGTGCTGG CACTTGGAAG CCTGGCCGTC
CTGAGCCTGG AAGTACTGGC ACTTGGGATT CTGGCCATCC TGATCCTGGA AGTGCTGGCA
CTTGGAAGCC TGGCCGTCCT GAGCCTGGAA GTACTGGCAC TTGGGATTCT GGCCATCCTG
ATCCTGGAAG TGCTGGCACT TGGAAGCCTG GCCGTCCTGA GCCTGGAAGT ACTGGCACTT
GGGATTCTGG CCGTCCTGAT CCTGGAAGTG CTGGCACTTG GAAGCCTGGC CGTCCTGAGT
CTGGAAGTAC TGGCACTTGG CACTCCGAAC ATCTTGAGCA TGGAAGTAGT AGCACTTGGC
ACTCTGGTCA ACACGAGCAT GGAAGTGTTG GCTCTTGGAA GCCTGGAAGT TCTGGGTCTG
GAAGTTTAAG GCCAGATAGC TCAGGGCCCG GGGACACCAC TCCTTCCAAC CCAGACTGGG
GCACATTCAA AGAAGTGTCA GGAAGTGTAA GTCCAGGGAC AAAGAGCGAG GTCCACACAA
GTAAACTGGT CACTTCGAAA GGAGATAAGG ACATTGTGAT TGGTAAGGAG AAAGTCACCT
CTGGTCACAC AAGCACCACT CACCGTTCAT GCTCTAAAAC CATCACGAAG ACTGTTACGA
AAGCTGATGG TCGAACAGAA ACCATCAAGG AAGTGATAAA CTCCGAAGAT GGTTCTGACT
GTGGTGGCAC TGATGTAGAG TTCGCCCACA TGTTGCCTGG CAAGGGTAGC TTAGATGAGT
TCTTTCATAG GCACAGGGAT GAAACAAGCT TAAGTAGAGA TCCATTTCCA GATTTCTTCT
CC


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFGAfibrinogen alpha chain isoform alpha preproprotein [Homo sapiens]. 574e-163O
Contig/Assembly ProteinFGAfibrinogen alpha chain isoform alpha-E preproprotein [Homo sapiens]. 574e-163O
Contig/Assembly ProteinFMN2formin-2 [Homo sapiens]. 77.44e-14
Contig/Assembly ProteinPRXperiaxin isoform 2 [Homo sapiens]. 64.34e-10O
Contig/Assembly ProteinKIAA0754hypothetical protein LOC643314 [Homo sapiens]. 622e-09
Contig/Assembly ProteinLOC100134663PREDICTED: hypothetical protein LOC100134663, partial [Homo sapiens]. 57.42e-08O
Contig/Assembly ProteinPEF1peflin [Homo sapiens]. 55.12e-07O
Contig/Assembly ProteinZNF828zinc finger protein 828 [Homo sapiens]. 54.34e-07O
Contig/Assembly ProteinZNF828zinc finger protein 828 [Homo sapiens]. 54.34e-07O
Contig/Assembly ProteinZNF828zinc finger protein 828 [Homo sapiens]. 54.34e-07O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFgafibrinogen, alpha polypeptide isoform 1 [Mus musculus]. 505e-143O
Contig/Assembly ProteinFgafibrinogen, alpha polypeptide isoform 2 [Mus musculus]. 505e-143O
Contig/Assembly ProteinRbm12RNA-binding protein 12 [Mus musculus]. 721e-12
Contig/Assembly ProteinRbm12RNA-binding protein 12 [Mus musculus]. 721e-12
Contig/Assembly ProteinPrxperiaxin isoform L [Mus musculus]. 67.83e-11O
Contig/Assembly ProteinFmn2formin-2 [Mus musculus]. 675e-11
Contig/Assembly ProteinTtntitin isoform N2-A [Mus musculus]. 60.16e-09
Contig/Assembly ProteinGm2027PREDICTED: H/ACA ribonucleoprotein complex non-core subunit NAF1 [Mus musculus]. 56.66e-08O
Contig/Assembly ProteinGm2027PREDICTED: H/ACA ribonucleoprotein complex non-core subunit NAF1 [Mus musculus]. 56.66e-08O
Contig/Assembly ProteinScaf4splicing factor, arginine/serine-rich 15 [Mus musculus]. 55.51e-07O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC475473PREDICTED: similar to Fibrinogen alpha chain precursor [Canis familiaris]. 6600.0O
Contig/Assembly ProteinLOC607769PREDICTED: similar to keratinocytes proline-rich protein [Canis familiaris]. 875e-17O
Contig/Assembly ProteinLOC484501PREDICTED: similar to Periaxin [Canis familiaris]. 68.92e-11
Contig/Assembly ProteinLOC490366PREDICTED: similar to formin 2 [Canis familiaris]. 52.81e-06
Contig/Assembly ProteinCOL7A1collagen alpha-1(VII) chain [Canis lupus familiaris]. 50.46e-06
Contig/Assembly ProteinLOC475918PREDICTED: similar to CG5700-PB [Canis familiaris]. 50.46e-06


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFGAfibrinogen alpha chain precursor [Bos taurus]. 576e-164O
Contig/Assembly ProteinZNF828zinc finger protein 828 [Bos taurus]. 58.23e-08O
Contig/Assembly ProteinZNF828PREDICTED: hypothetical protein [Bos taurus]. 58.23e-08O
Contig/Assembly ProteinTTNPREDICTED: titin [Bos taurus]. 56.67e-08
Contig/Assembly ProteinTTNPREDICTED: titin [Bos taurus]. 56.67e-08


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFGAPREDICTED: fibrinogen alpha chain [Sus scrofa]. 9580.0O
Contig/Assembly ProteinLOC100626178PREDICTED: fibrinogen alpha chain-like [Sus scrofa]. 539e-153O
Contig/Assembly ProteinPRXPREDICTED: periaxin [Sus scrofa]. 62.86e-10O
Contig/Assembly ProteinLOC100519384PREDICTED: glutamine-rich protein 2-like [Sus scrofa]. 57.82e-08
Contig/Assembly ProteinLOC100520792PREDICTED: peflin-like isoform 1 [Sus scrofa]. 51.22e-06O


Assembly Members: 935      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
LVR010001B04LVR01_0001_B04.bBP442092 
LVR010001B12LVR01_0001_B12.bBP442705 
LVR010002A05LVR01_0002_A05.bBP441254 
LVR010002D12LVR01_0002_D12.bBP444489 
LVR010002E07LVR01_0002_E07.bBP444999 
LVR010002G01LVR01_0002_G01.bBP446309 
LVR010002H04LVR01_0002_H04.bBP447449 
LVR010003B11LVR01_0003_B11.bBP442628 
LVR010003H02LVR01_0003_H02.bBP447289 
LVR010003H09LVR01_0003_H09.bBP447834 
LVR010004G07LVR01_0004_G07.bBP446766 
LVR010005D07LVR01_0005_D07.bBP444125 
LVR010005F03LVR01_0005_F03.bBP445581 
LVR010005G11LVR01_0005_G11.bBP447058 
LVR010008A06LVR01_0008_A06.bBP441334 
LVR010008A12LVR01_0008_A12.bBP441791 
LVR010008B05LVR01_0008_B05.bBP442173 
LVR010008C02LVR01_0008_C02.bBP442865 
LVR010008E12LVR01_0008_E12.bBP445349 
LVR010009G09LVR01_0009_G09.bBP446909 
LVR010009G11LVR01_0009_G11.bBP447059 
LVR010010H04LVR01_0010_H04.bBP447454 
LVR010010H10LVR01_0010_H10.bBP447917 
LVR010011C12LVR01_0011_C12.bBP443609 
LVR010011D07LVR01_0011_D07.bBP444129 
LVR010011E11LVR01_0011_E11.bBP445275 
LVR010012C07LVR01_0012_C07.bBP443243 
LVR010012C08LVR01_0012_C08.bBP443314 
LVR010013A03LVR01_0013_A03.bBP441104 
LVR010013D04LVR01_0013_D04.bBP443915 
LVR010014A12LVR01_0014_A12.bBP441797 
LVR010014B09LVR01_0014_B09.bBP442485 
LVR010015B10LVR01_0015_B10.bBP442560 
LVR010015D07LVR01_0015_D07.bBP444132 
LVR010015F02LVR01_0015_F02.bBP445511 
LVR010016B09LVR01_0016_B09.bBP442487 
LVR010016D01LVR01_0016_D01.bBP443686 
LVR010016D12LVR01_0016_D12.bBP444501 
LVR010016G06LVR01_0016_G06.bBP446704 
LVR010016H11LVR01_0016_H11.bBP448000 
LVR010017C09LVR01_0017_C09.bBP443390 
LVR010017D11LVR01_0017_D11.bBP444424 
LVR010017F01LVR01_0017_F01.bBP445436 
LVR010017F04LVR01_0017_F04.bBP445665 
LVR010017G10LVR01_0017_G10.bBP446990 
LVR010017H11LVR01_0017_H11.bBP448001 
LVR010018A10LVR01_0018_A10.bBP441653 
LVR010019B06LVR01_0019_B06.bBP442262 
LVR010019B09LVR01_0019_B09.bBP442490 
LVR010019E09LVR01_0019_E09.bBP445141 
LVR010020A08LVR01_0020_A08.bBP441501 
LVR010020F12LVR01_0020_F12.bBP446249 
LVR010022A12LVR01_0022_A12.bBP441804 
LVR010022C06LVR01_0022_C06.bBP443180 
LVR010022E03LVR01_0022_E03.bBP444737 
LVR010022F06LVR01_0022_F06.bBP445817 
LVR010025B02LVR01_0025_B02.bBP441955 
LVR010025B05LVR01_0025_B05.bBP442188 
LVR010025D06LVR01_0025_D06.bBP444069 
LVR010026A01LVR01_0026_A01.bBP440955 
LVR010026A06LVR01_0026_A06.bBP441347 
LVR010026C09LVR01_0026_C09.bBP443395 
LVR010026D10LVR01_0026_D10.bBP444357 
LVR010026E04LVR01_0026_E04.bBP444810 
LVR010026F10LVR01_0026_F10.bBP446103 
LVR010028A04LVR01_0028_A04.bBP441195 
LVR010028E07LVR01_0028_E07.bBP445016 
LVR010028F10LVR01_0028_F10.bBP446104 
LVR010028F12LVR01_0028_F12.bBP446254 
LVR010028G09LVR01_0028_G09.bBP446921 
LVR010028H07LVR01_0028_H07.bBP447700 
LVR010028H11LVR01_0028_H11.bBP448009 
LVR010029A09LVR01_0029_A09.bBP441584 
LVR010029B01LVR01_0029_B01.bBP441880 
LVR010029H01LVR01_0029_H01.bBP447231 
LVR010030F06LVR01_0030_F06.bBP445822 
LVR010030G10LVR01_0030_G10.bBP447000 
LVR010031A10LVR01_0031_A10.bBP441663 
LVR010031D01LVR01_0031_D01.bBP443698 
LVR010031D10LVR01_0031_D10.bBP444360 
LVR010031F12LVR01_0031_F12.bBP446256 
LVR010031G10LVR01_0031_G10.bBP447001 
LVR010031H09LVR01_0031_H09.bBP447857 
LVR010033A02LVR01_0033_A02.bBP441041 
LVR010033B07LVR01_0033_B07.bBP442345 
LVR010033C11LVR01_0033_C11.bBP443548 
LVR010033D07LVR01_0033_D07.bBP444144 
LVR010033F09LVR01_0033_F09.bBP446034 
LVR010033F12LVR01_0033_F12.bBP446257 
LVR010033G03LVR01_0033_G03.bBP446489 
LVR010034A04LVR01_0034_A04.bBP441200 
LVR010034F12LVR01_0034_F12.bBP446258 
LVR010035A03LVR01_0035_A03.bBP441122 
LVR010035A11LVR01_0035_A11.bBP441740 
LVR010035C02LVR01_0035_C02.bBP442887 
LVR010035F10LVR01_0035_F10.bBP446110 
LVR010035H09LVR01_0035_H09.bBP447860 
LVR010035H11LVR01_0035_H11.bBP448015 
LVR010035H12LVR01_0035_H12.bBP448094 
LVR010036G01LVR01_0036_G01.bBP446333 
LVR010037F03LVR01_0037_F03.bBP445604 
LVR010037F08LVR01_0037_F08.bBP445963 
LVR010037G02LVR01_0037_G02.bBP446412 
LVR010038B02LVR01_0038_B02.bBP441964 
LVR010038B07LVR01_0038_B07.bBP442348 
LVR010038B11LVR01_0038_B11.bBP442654 
LVR010038E04LVR01_0038_E04.bBP444818 
LVR010038E10LVR01_0038_E10.bBP445223 
LVR010038E11LVR01_0038_E11.bBP445294 
LVR010039F10LVR01_0039_F10.bBP446113 
LVR010039G04LVR01_0039_G04.bBP446568 
LVR010039G05LVR01_0039_G05.bBP446645 
LVR010040D06LVR01_0040_D06.bBP444078 
LVR010040F09LVR01_0040_F09.bBP446037 
LVR010041A03LVR01_0041_A03.bBP441127 
LVR010041E05LVR01_0041_E05.bBP444889 
LVR010041F02LVR01_0041_F02.bBP445529 
LVR010042D09LVR01_0042_D09.bBP444293 
LVR010043E09LVR01_0043_E09.bBP445158 
LVR010043F06LVR01_0043_F06.bBP445830 
LVR010043G10LVR01_0043_G10.bBP447010 
LVR010044B05LVR01_0044_B05.bBP442203 
LVR010044F05LVR01_0044_F05.bBP445756 
LVR010044F12LVR01_0044_F12.bBP446267 
LVR010044H05LVR01_0044_H05.bBP447556 
LVR010044H10LVR01_0044_H10.bBP447945 
LVR010045C11LVR01_0045_C11.bBP443558 
LVR010045H07LVR01_0045_H07.bBP447715 
LVR010046A03LVR01_0046_A03.bBP441131 
LVR010046A04LVR01_0046_A04.bBP441210 
LVR010046C07LVR01_0046_C07.bBP443264 
LVR010046F10LVR01_0046_F10.bBP446120 
LVR010046G02LVR01_0046_G02.bBP446421 
LVR010046H03LVR01_0046_H03.bBP447405 
LVR010047A01LVR01_0047_A01.bBP440974 
LVR010047A10LVR01_0047_A10.bBP441676 
LVR010047E11LVR01_0047_E11.bBP445303 
LVR010047G01LVR01_0047_G01.bBP446343 
LVR010047H08LVR01_0047_H08.bBP447790 
LVR010048B07LVR01_0048_B07.bBP442358 
LVR010048B08LVR01_0048_B08.bBP442436 
LVR010048D03LVR01_0048_D03.bBP443866 
LVR010048D06LVR01_0048_D06.bBP444085 
LVR010048E12LVR01_0048_E12.bBP445384 
LVR010048F03LVR01_0048_F03.bBP445614 
LVR010048F10LVR01_0048_F10.bBP446122 
LVR010048F12LVR01_0048_F12.bBP446271 
LVR010048G02LVR01_0048_G02.bBP446423 
LVR010049A12LVR01_0049_A12.bBP441826 
LVR010049C03LVR01_0049_C03.bBP442973 
LVR010049D08LVR01_0049_D08.bBP444222 
LVR010049E01LVR01_0049_E01.bBP444607 
LVR010049F09LVR01_0049_F09.bBP446045 
LVR010050C06LVR01_0050_C06.bBP443199 
LVR010050F12LVR01_0050_F12.bBP446273 
LVR010050G09LVR01_0050_G09.bBP446940 
LVR010051B01LVR01_0051_B01.bBP441899 
LVR010051E09LVR01_0051_E09.bBP445165 
LVR010051F06LVR01_0051_F06.bBP445836 
LVR010052B02LVR01_0052_B02.bBP441977 
LVR010052G05LVR01_0052_G05.bBP446658 
LVR010052H07LVR01_0052_H07.bBP447721 
LVR010053B04LVR01_0053_B04.bBP442134 
LVR010053C11LVR01_0053_C11.bBP443566 
LVR010053H10LVR01_0053_H10.bBP447954 
LVR010054A09LVR01_0054_A09.bBP441607 
LVR010054C09LVR01_0054_C09.bBP443418 
LVR010054D04LVR01_0054_D04.bBP443945 
LVR010054D12LVR01_0054_D12.bBP444531 
LVR010054G03LVR01_0054_G03.bBP446506 
LVR010054G09LVR01_0054_G09.bBP446944 
LVR010054H04LVR01_0054_H04.bBP447490 
LVR010055D10LVR01_0055_D10.bBP444380 
LVR010055F10LVR01_0055_F10.bBP446127 
LVR010056C03LVR01_0056_C03.bBP442979 
LVR010056D04LVR01_0056_D04.bBP443947 
LVR010056H05LVR01_0056_H05.bBP447568 
LVR010057A07LVR01_0057_A07.bBP441454 
LVR010057C06LVR01_0057_C06.bBP443205 
LVR010057E05LVR01_0057_E05.bBP444901 
LVR010058C10LVR01_0058_C10.bBP443499 
LVR010058D04LVR01_0058_D04.bBP443949 
LVR010059A04LVR01_0059_A04.bBP441222 
LVR010059C04LVR01_0059_C04.bBP443060 
LVR010059C11LVR01_0059_C11.bBP443571 
LVR010059E03LVR01_0059_E03.bBP444764 
LVR010059F01LVR01_0059_F01.bBP445472 
LVR010059H05LVR01_0059_H05.bBP447571 
LVR010060B06LVR01_0060_B06.bBP442293 
LVR010060C06LVR01_0060_C06.bBP443207 
LVR010060C11LVR01_0060_C11.bBP443572 
LVR010060E05LVR01_0060_E05.bBP444904 
LVR010060H04LVR01_0060_H04.bBP447495 
LVR010060H08LVR01_0060_H08.bBP447803 
LVR010061C04LVR01_0061_C04.bBP443061 
LVR010061D11LVR01_0061_D11.bBP444461 
LVR010061E01LVR01_0061_E01.bBP444619 
LVR010061H04LVR01_0061_H04.bBP447496 
LVR010062F01LVR01_0062_F01.bBP445475 
LVR010062F05LVR01_0062_F05.bBP445774 
LVR010063E06LVR01_0063_E06.bBP444974 
LVR010063H02LVR01_0063_H02.bBP447340 
LVR010065H02LVR01_0065_H02.bBP447341 
LVR010066C09LVR01_0066_C09.bBP443429 
LVR010066D10LVR01_0066_D10.bBP444389 
LVR010066E06LVR01_0066_E06.bBP444976 
LVR010066F12LVR01_0066_F12.bBP446285 
LVR010067C02LVR01_0067_C02.bBP442913 
LVR010067C06LVR01_0067_C06.bBP443212 
LVR010067C08LVR01_0067_C08.bBP443354 
LVR010067D05LVR01_0067_D05.bBP444030 
LVR010067E03LVR01_0067_E03.bBP444771 
LVR010067E11LVR01_0067_E11.bBP445322 
LVR010068A07LVR01_0068_A07.bBP441464 
LVR010068B04LVR01_0068_B04.bBP442147 
LVR010068E10LVR01_0068_E10.bBP445249 
LVR010068H12LVR01_0068_H12.bBP448123 
LVR010071A05LVR01_0071_A05.bBP441308 
LVR010071B03LVR01_0071_B03.bBP442071 
LVR010071D05LVR01_0071_D05.bBP444032 
LVR010071E11LVR01_0071_E11.bBP445324 
LVR010071F08LVR01_0071_F08.bBP445991 
LVR010071G02LVR01_0071_G02.bBP446441 
LVR010072C08LVR01_0072_C08.bBP443357 
LVR010072D09LVR01_0072_D09.bBP444320 
LVR010072F05LVR01_0072_F05.bBP445780 
LVR010072F12LVR01_0072_F12.bBP446289 
LVR010072G01LVR01_0072_G01.bBP446364 
LVR010073C06LVR01_0073_C06.bBP443216 
LVR010073D02LVR01_0073_D02.bBP443811 
LVR010073F05LVR01_0073_F05.bBP445781 
LVR010073G04LVR01_0073_G04.bBP446597 
LVR010073G05LVR01_0073_G05.bBP446672 
LVR010073G10LVR01_0073_G10.bBP447036 
LVR010074A12LVR01_0074_A12.bBP441844 
LVR010074B07LVR01_0074_B07.bBP442380 
LVR010074C01LVR01_0074_C01.bBP442844 
LVR010074C06LVR01_0074_C06.bBP443217 
LVR010074F04LVR01_0074_F04.bBP445710 
LVR010074H09LVR01_0074_H09.bBP447893 
LVR010077A06LVR01_0077_A06.bBP441388 
LVR010077E08LVR01_0077_E08.bBP445111 
LVR010077E10LVR01_0077_E10.bBP445255 
LVR010077H04LVR01_0077_H04.bBP447507 
LVR010077H09LVR01_0077_H09.bBP447895 
LVR010078A07LVR01_0078_A07.bBP441471 
LVR010078A09LVR01_0078_A09.bBP441625 
LVR010078B04LVR01_0078_B04.bBP442154 
LVR010078C05LVR01_0078_C05.bBP443147 
LVR010078E08LVR01_0078_E08.bBP445112 
LVR010078F03LVR01_0078_F03.bBP445638 
LVR010078F04LVR01_0078_F04.bBP445712 
LVR010078G04LVR01_0078_G04.bBP446600 
LVR010079B06LVR01_0079_B06.bBP442308 
LVR010079F09LVR01_0079_F09.bBP446070 
LVR010079G02LVR01_0079_G02.bBP446448 
LVR010079H02LVR01_0079_H02.bBP447352 
LVR010081C09LVR01_0081_C09.bBP443440 
LVR010081D01LVR01_0081_D01.bBP443741 
LVR010082C09LVR01_0082_C09.bBP443441 
LVR010082D01LVR01_0082_D01.bBP443742 
LVR010082D03LVR01_0082_D03.bBP443894 
LVR010082H04LVR01_0082_H04.bBP447511 
LVR010082H10LVR01_0082_H10.bBP447976 
LVR010083A06LVR01_0083_A06.bCJ000006 
LVR010083C02LVR01_0083_C02.bCJ000023 
LVR010083C12LVR01_0083_C12.bCJ000033 
LVR010083D10LVR01_0083_D10.bCJ000042 
LVR010083H02LVR01_0083_H02.bBW962712 
LVR010084A03LVR01_0084_A03.bCJ000091 
LVR010084B06LVR01_0084_B06.bCJ000104 
LVR010084D01LVR01_0084_D01.bCJ000123 
LVR010084F05LVR01_0084_F05.bCJ000149 
LVR010084F07LVR01_0084_F07.bCJ000151 
LVR010085B10LVR01_0085_B10.bCJ000193 
LVR010085E09LVR01_0085_E09.bCJ000221 
LVR010085H08LVR01_0085_H08.bCJ000252 
LVR010085H10LVR01_0085_H10.bCJ000254 
LVR010086B05LVR01_0086_B05.bCJ000273 
LVR010086C09LVR01_0086_C09.bCJ000287 
LVR010086D07LVR01_0086_D07.bBW962726 
LVR010086D08LVR01_0086_D08.bCJ000297 
LVR010087A08LVR01_0087_A08.bCJ000347 
LVR010087C01LVR01_0087_C01.bCJ000361 
LVR010087D11LVR01_0087_D11.bCJ000377 
LVR010087E07LVR01_0087_E07.bCJ000384 
LVR010087E11LVR01_0087_E11.bBW962735 
LVR010088C04LVR01_0088_C04.bCJ000446 
LVR010088H01LVR01_0088_H01.bCJ000496 
LVR010088H11LVR01_0088_H11.bCJ000506 
LVR010089E09LVR01_0089_E09.bCJ000559 
LVR010089G10LVR01_0089_G10.bCJ000582 
LVR010089H05LVR01_0089_H05.bCJ000589 
LVR010090A07LVR01_0090_A07.bCJ000603 
LVR010090B05LVR01_0090_B05.bCJ000612 
LVR010090E07LVR01_0090_E07.bCJ000646 
LVR010090F01LVR01_0090_F01.bCJ000651 
LVR010091B01LVR01_0091_B01.bBW962751 
LVR010091E09LVR01_0091_E09.bBW962754 
LVR010091E12LVR01_0091_E12.bCJ000729 
LVR010091G03LVR01_0091_G03.bCJ000743 
LVR010091H12LVR01_0091_H12.bCJ000760 
LVR010092C03LVR01_0092_C03.bCJ000779 
LVR010092E01LVR01_0092_E01.bCJ000800 
LVR010093A09LVR01_0093_A09.bCJ000850 
LVR010093D03LVR01_0093_D03.bCJ000873 
LVR010094A10LVR01_0094_A10.bCJ000917 
LVR010094B02LVR01_0094_B02.bCJ000921 
LVR010094G11LVR01_0094_G11.bCJ000981 
LVR010095B01LVR01_0095_B01.bBP441924 
LVR010095C04LVR01_0095_C04.bBP443077 
LVR010095C05LVR01_0095_C05.bBP443151 
LVR010095E07LVR01_0095_E07.bBP445048 
LVR010096C07LVR01_0096_C07.bBP443295 
LVR010096F11LVR01_0096_F11.bBP446225 
LVR010096H03LVR01_0096_H03.bBP447438 
LVR010097B04LVR01_0097_B04.bBP442160 
LVR010097G01LVR01_0097_G01.bBP446375 
LVR010098A10LVR01_0098_A10.bBP441709 
LVR010098B01LVR01_0098_B01.bBP441927 
LVR010098B06LVR01_0098_B06.bBP442314 
LVR010098B07LVR01_0098_B07.bBP442390 
LVR010098B12LVR01_0098_B12.bBP442772 
LVR010098D04LVR01_0098_D04.bBP443972 
LVR010098H09LVR01_0098_H09.bBP447903 
LVR010099B10LVR01_0099_B10.bBP442619 
LVR010099F09LVR01_0099_F09.bBP446077 
LVR010099F10LVR01_0099_F10.bBP446152 
LVR010099H10LVR01_0099_H10.bBP447981 
LVR010099H11LVR01_0099_H11.bBP448058 
LVR010100A02LVR01_0100_A02.bBP441088 
LVR010100H02LVR01_0100_H02.bBP447360 
LVR010101D08LVR01_0101_D08.bBP444255 
LVR010101E06LVR01_0101_E06.bBP444992 
LVR010101F05LVR01_0101_F05.bBP445795 
LVR010101G02LVR01_0101_G02.bBP446457 
LVR010102A09LVR01_0102_A09.bBP441635 
LVR010102B04LVR01_0102_B04.bBP442165 
LVR010102D07LVR01_0102_D07.bBP444185 
LVR010102H11LVR01_0102_H11.bBP448061 
LVR010103D11LVR01_0103_D11.bBP444485 
LVR010103E01LVR01_0103_E01.bBP444643 
LVR010104C11LVR01_0104_C11.bBP443598 
LVR010104D07LVR01_0104_D07.bBP444186 
LVR010104G01LVR01_0104_G01.bBP446381 
LVR010105E05LVR01_0105_E05.bBP444930 
LVR010106C12LVR01_0106_C12.bBP443672 
LVR010106G05LVR01_0106_G05.bBP446691 
LVRM10001A04LVRM1_0001_A04.bBP137597 
LVRM10001A11LVRM1_0001_A11.bBP137871 AK394086
LVRM10001B04LVRM1_0001_B04.bBP138063 
LVRM10001F10LVRM1_0001_F10.bBP140161 
LVRM10001H12LVRM1_0001_H12.bBP141197 
LVRM10002B06LVRM1_0002_B06.bBP138148 
LVRM10002B09LVRM1_0002_B09.bBP138274 
LVRM10002E10LVRM1_0002_E10.b  
LVRM10003A03LVRM1_0003_A03.bCJ000994 
LVRM10003B01LVRM1_0003_B01.bCJ001001 
LVRM10003B07LVRM1_0003_B07.bBW962787 
LVRM10003F01LVRM1_0003_F01.bCJ001042 
LVRM10003G03LVRM1_0003_G03.bCJ001056 
LVRM10004E09LVRM1_0004_E09.bBW962796 
LVRM10004F02LVRM1_0004_F02.bBW962799 
LVRM10004F06LVRM1_0004_F06.bBW962801 
LVRM10004G12LVRM1_0004_G12.bCJ001128 
LVRM10006F10LVRM1_0006_F10.bBP140164 
LVRM10006G03LVRM1_0006_G03.bBP140353 
LVRM10007B02LVRM1_0007_B02.bBP137991 
LVRM10007B08LVRM1_0007_B08.bBP138233 
LVRM10007C11LVRM1_0007_C11.bBP138821 
LVRM10007D10LVRM1_0007_D10.bBP139255 
LVRM10007H01LVRM1_0007_H01.bBP140751 
LVRM10008D10LVRM1_0008_D10.bBP139256 
LVRM10008H12LVRM1_0008_H12.bBP141201 
LVRM10009C10LVRM1_0009_C10.bBP138780 
LVRM10009H04LVRM1_0009_H04.bBP140871 
LVRM10011D01LVRM1_0011_D01.bBP450545 
LVRM10011D10LVRM1_0011_D10.bBP451181 
LVRM10011F04LVRM1_0011_F04.bBP452372 
LVRM10011G12LVRM1_0011_G12.bBP453745 
LVRM10011H08LVRM1_0011_H08.bBP454294 
LVRM10012D05LVRM1_0012_D05.bBP450819 
LVRM10012F06LVRM1_0012_F06.bBP452505 
LVRM10012F10LVRM1_0012_F10.bBP452783 
LVRM10014B05LVRM1_0014_B05.bBP449194 
LVRM10014B06LVRM1_0014_B06.bBP449260 
LVRM10014F11LVRM1_0014_F11.bBP452854 
LVRM10014G10LVRM1_0014_G10.bBP453604 
LVRM10015G12LVRM1_0015_G12.bBP453748 
LVRM10015H08LVRM1_0015_H08.bBP454298 
LVRM10016A11LVRM1_0016_A11.bBP448804 
LVRM10016C04LVRM1_0016_C04.bBP449914 
LVRM10017F01LVRM1_0017_F01.bBP452180 
LVRM10018A07LVRM1_0018_A07.bBP448528 
LVRM10018G01LVRM1_0018_G01.bBP452985 
LVRM10019A09LVRM1_0019_A09.bBP137798 
LVRM10019B02LVRM1_0019_B02.bBP137994 
LVRM10019D03LVRM1_0019_D03.bBP138982 
LVRM10019F04LVRM1_0019_F04.bBP139934 
LVRM10020A12LVRM1_0020_A12.bBP137919 
LVRM10020B12LVRM1_0020_B12.bBP138408 
LVRM10020F03LVRM1_0020_F03.bBP139893 
LVRM10020F05LVRM1_0020_F05.bBP139974 
LVRM10021A10LVRM1_0021_A10.bBP137839 
LVRM10021E10LVRM1_0021_E10.bCJ001174 
LVRM10021H10LVRM1_0021_H10.bCJ001203 
LVRM10022B01LVRM1_0022_B01.bBP137958 
LVRM10022C07LVRM1_0022_C07.bBP138659 
LVRM10022D05LVRM1_0022_D05.bBP139066 
LVRM10022F08LVRM1_0022_F08.bBP140091 
LVRM10023C12LVRM1_0023_C12.bBP138869 
LVRM10025H12LVRM1_0025_H12.bBP141209 
LVRM10026E08LVRM1_0026_E08.bBP139632 
LVRM10027A08LVRM1_0027_A08.bBP137766 
LVRM10028F10LVRM1_0028_F10.bBP140176 
LVRM10028F11LVRM1_0028_F11.bBP140215 
LVRM10029A04LVRM1_0029_A04.bBP137613 
LVRM10030C04LVRM1_0030_C04.bBP138543 
LVRM10030F04LVRM1_0030_F04.bBP139943 
LVRM10030G01LVRM1_0030_G01.bBP140295 
LVRM10030G04LVRM1_0030_G04.bBP140403 
LVRM10031A02LVRM1_0031_A02.bBP137540 
LVRM10031A07LVRM1_0031_A07.bBP137729 
LVRM10031C04LVRM1_0031_C04.bBP138544 
LVRM10032D04LVRM1_0032_D04.bBP139035 
LVRM10032H02LVRM1_0032_H02.bBP140804 
LVRM10033B07LVRM1_0033_B07.bCJ001223 
LVRM10033B12LVRM1_0033_B12.bCJ001227 
LVRM10033C10LVRM1_0033_C10.bCJ001236 
LVRM10033D05LVRM1_0033_D05.bBW962814 
LVRM10033D11LVRM1_0033_D11.bCJ001248 
LVRM10033F01LVRM1_0033_F01.bCJ001261 
LVRM10033G11LVRM1_0033_G11.bCJ001281 
LVRM10034C03LVRM1_0034_C03.bCJ001317 
LVRM10034D08LVRM1_0034_D08.bCJ001333 
LVRM10034F06LVRM1_0034_F06.bCJ001353 
LVRM10034G09LVRM1_0034_G09.bCJ001365 
LVRM10034H07LVRM1_0034_H07.bCJ001373 
LVRM10035B01LVRM1_0035_B01.bCJ001388 
LVRM10035C10LVRM1_0035_C10.bCJ001408 
LVRM10035E07LVRM1_0035_E07.bCJ001427 
LVRM10035E09LVRM1_0035_E09.bCJ001429 
LVRM10036A02LVRM1_0036_A02.bBW962827 
LVRM10036E05LVRM1_0036_E05.bCJ001508 
LVRM10036E09LVRM1_0036_E09.bCJ001512 
LVRM10037A06LVRM1_0037_A06.bCJ001549 
LVRM10037A12LVRM1_0037_A12.bCJ001555 
LVRM10037C02LVRM1_0037_C02.bCJ001568 
LVRM10037H04LVRM1_0037_H04.bCJ001625 
LVRM10038A03LVRM1_0038_A03.bCJ001635 
LVRM10038B05LVRM1_0038_B05.bCJ001645 
LVRM10038E05LVRM1_0038_E05.bCJ001678 
LVRM10038E06LVRM1_0038_E06.bCJ001679 
LVRM10038H05LVRM1_0038_H05.bCJ001709 
LVRM10038H06LVRM1_0038_H06.bBW962846 
LVRM10039B01LVRM1_0039_B01.bCJ001727 
LVRM10039B07LVRM1_0039_B07.bCJ001732 
LVRM10039B11LVRM1_0039_B11.bCJ001735 
LVRM10039G01LVRM1_0039_G01.bCJ001779 
LVRM10039G12LVRM1_0039_G12.bCJ001789 
LVRM10039H09LVRM1_0039_H09.bCJ001798 
LVRM10040C01LVRM1_0040_C01.bCJ001819 
LVRM10040E01LVRM1_0040_E01.bBW962859 
LVRM10040H06LVRM1_0040_H06.bCJ001866 
LVRM10042D11LVRM1_0042_D11.bCJ001997 
LVRM10043B07LVRM1_0043_B07.bCJ002059 
LVRM10043F08LVRM1_0043_F08.bCJ002105 
LVRM10043F11LVRM1_0043_F11.bCJ002108 
LVRM10044D08LVRM1_0044_D08.bBW962878 
LVRM10045H12LVRM1_0045_H12.bBW962908 
LVRM10047B06LVRM1_0047_B06.bCJ002277 
LVRM10047G06LVRM1_0047_G06.bBW962920 
LVRM10047H04LVRM1_0047_H04.bBW962924 
LVRM10048C09LVRM1_0048_C09.bCJ002362 
LVRM10048H06LVRM1_0048_H06.bCJ002409 
LVRM10049C03LVRM1_0049_C03.bBP449847 
LVRM10049C05LVRM1_0049_C05.bBP449984 
LVRM10049F04LVRM1_0049_F04.bBP452378 
LVRM10049H02LVRM1_0049_H02.bBP453882 
LVRM10050E11LVRM1_0050_E11.bBP452054 
LVRM10050F01LVRM1_0050_F01.bBP452183 
LVRM10050F10LVRM1_0050_F10.bBP452791 
LVRM10051B07LVRM1_0051_B07.bBP449331 
LVRM10051D03LVRM1_0051_D03.bBP450686 
LVRM10051D09LVRM1_0051_D09.bBP451120 
LVRM10051E01LVRM1_0051_E01.bBP451402 
LVRM10051G02LVRM1_0051_G02.bBP453053 
LVRM10052G08LVRM1_0052_G08.bBP453464 
LVRM10052G09LVRM1_0052_G09.bBP453538 
LVRM10052H05LVRM1_0052_H05.bBP454086 
LVRM10053B05LVRM1_0053_B05.bBP138124 
LVRM10053C01LVRM1_0053_C01.bBP138449 
LVRM10053E03LVRM1_0053_E03.bBP139457 
LVRM10053G12LVRM1_0053_G12.bBP140724 
LVRM10054D11LVRM1_0054_D11.bBP139316 
LVRM10054F12LVRM1_0054_F12.bBP140261 
LVRM10054G11LVRM1_0054_G11.bBP140682 
LVRM10055A01LVRM1_0055_A01.bBP137515 
LVRM10055F03LVRM1_0055_F03.bBP139907 
LVRM10055F12LVRM1_0055_F12.bBP140262 
LVRM10055G02LVRM1_0055_G02.bBP140334 
LVRM10055G06LVRM1_0055_G06.bBP140481 
LVRM10057C05LVRM1_0057_C05.bBP138590 
LVRM10057C10LVRM1_0057_C10.bBP138798 
LVRM10057H11LVRM1_0057_H11.bBP141178 
LVRM10058G11LVRM1_0058_G11.bBP140686 
LVRM10058H01LVRM1_0058_H01.bBP140769 
LVRM10061B02LVRM1_0061_B02.bBP138012 
LVRM10061B05LVRM1_0061_B05.bBP138130 
LVRM10061C10LVRM1_0061_C10.bBP138800 
LVRM10061E01LVRM1_0061_E01.bBP139400 
LVRM10061F05LVRM1_0061_F05.bBP139990 
LVRM10061F10LVRM1_0061_F10.bBP140185 
LVRM10062E10LVRM1_0062_E10.bBP139719 
LVRM10063A07LVRM1_0063_A07.bBP137738 
LVRM10064C12LVRM1_0064_C12.bBP138887 
LVRM10064H03LVRM1_0064_H03.bBP140853 
LVRM10065A11LVRM1_0065_A11.bBP137899 
LVRM10065B06LVRM1_0065_B06.bBP138173 
LVRM10065D08LVRM1_0065_D08.bBP139199 
LVRM10065E07LVRM1_0065_E07.bBP139611 
LVRM10065G11LVRM1_0065_G11.bBP140691 
LVRM10069B03LVRM1_0069_B03.bBP449069 
LVRM10070B05LVRM1_0070_B05.bBP449203 
LVRM10070C09LVRM1_0070_C09.bBP450269 
LVRM10070C11LVRM1_0070_C11.bBP450414 
LVRM10070E12LVRM1_0070_E12.bBP452129 
LVRM10070F04LVRM1_0070_F04.bBP452383 
LVRM10070G02LVRM1_0070_G02.bBP453056 
LVRM10070H07LVRM1_0070_H07.bBP454234 
LVRM10071F10LVRM1_0071_F10.bBP452795 
LVRM10073A10LVRM1_0073_A10.bBP137861 
LVRM10074C07LVRM1_0074_C07.bBP138683 
LVRM10074D05LVRM1_0074_D05.bBP139089 
LVRM10074E06LVRM1_0074_E06.bBP139579 
LVRM10074G01LVRM1_0074_G01.bBP140307 
LVRM10074H03LVRM1_0074_H03.bBP140857 
LVRM10074H06LVRM1_0074_H06.bBP140983 
LVRM10075A11LVRM1_0075_A11.bBP137904 
LVRM10075H11LVRM1_0075_H11.bBP141190 
LVRM10076D11LVRM1_0076_D11.bBP139332 
LVRM10077C07LVRM1_0077_C07.bBP138686 
LVRM10077C08LVRM1_0077_C08.bBP138727 
LVRM10077D01LVRM1_0077_D01.bBP138931 
LVRM10077D06LVRM1_0077_D06.bBP139131 
LVRM10077E03LVRM1_0077_E03.bBP139471 
LVRM10077F07LVRM1_0077_F07.bBP140075 
LVRM10078C02LVRM1_0078_C02.bBP138490 
LVRM10078F07LVRM1_0078_F07.bBP140076 
LVRM10078H07LVRM1_0078_H07.bBP141029 
LVRM10079A08LVRM1_0079_A08.bBP137788 
LVRM10079C03LVRM1_0079_C03.bBP138523 
LVRM10079D07LVRM1_0079_D07.bBP139173 
LVRM10079F05LVRM1_0079_F05.bBP140001 
LVRM10080F05LVRM1_0080_F05.bBP140002 
LVRM10080G02LVRM1_0080_G02.bBP140348 
LVRM10081C04LVRM1_0081_C04.bCJ002440 
LVRM10081G03LVRM1_0081_G03.bCJ002483 
LVRM10082C08LVRM1_0082_C08.bCJ002530 
LVRM10082D01LVRM1_0082_D01.bCJ002535 
LVRM10082D05LVRM1_0082_D05.bCJ002539 
LVRM10082D12LVRM1_0082_D12.bCJ002546 
LVRM10082G06LVRM1_0082_G06.bCJ002572 
LVRM10082G12LVRM1_0082_G12.bCJ002578 
LVRM10083A03LVRM1_0083_A03.bCJ002592 
LVRM10083A07LVRM1_0083_A07.bCJ002595 
LVRM10083F08LVRM1_0083_F08.bCJ002651 
LVRM10084B06LVRM1_0084_B06.bCJ002691 
LVRM10084B12LVRM1_0084_B12.bCJ002697 
LVRM10084D08LVRM1_0084_D08.bCJ002715 
LVRM10084F09LVRM1_0084_F09.bCJ002736 
LVRM10085A03LVRM1_0085_A03.bCJ002764 
LVRM10085B10LVRM1_0085_B10.bCJ002780 
LVRM10085E02LVRM1_0085_E02.bCJ002806 
LVRM10085E10LVRM1_0085_E10.bCJ002813 
LVRM10085E11LVRM1_0085_E11.bCJ002814 
LVRM10085F10LVRM1_0085_F10.bCJ002823 
LVRM10086A11LVRM1_0086_A11.bCJ002853 
LVRM10086C11LVRM1_0086_C11.bCJ002874 
LVRM10086E09LVRM1_0086_E09.bCJ002893 
LVRM10087A03LVRM1_0087_A03.bCJ002921 
LVRM10087D11LVRM1_0087_D11.bCJ002964 
LVRM10087E02LVRM1_0087_E02.bCJ002967 
LVRM10087F12LVRM1_0087_F12.bCJ002988 
LVRM10087G02LVRM1_0087_G02.bCJ002990 
LVRM10087G12LVRM1_0087_G12.bCJ002997 
LVRM10087H04LVRM1_0087_H04.bCJ003001 
LVRM10088C06LVRM1_0088_C06.bCJ003034 
LVRM10088H10LVRM1_0088_H10.bCJ003093 
LVRM10089E01LVRM1_0089_E01.bCJ003136 AK394204
LVRM10089E12LVRM1_0089_E12.bCJ003145 
LVRM10089F10LVRM1_0089_F10.bCJ003154 
LVRM10089H06LVRM1_0089_H06.bCJ003172 
LVRM10090G05LVRM1_0090_G05.bCJ003241 
LVRM10091A04LVRM1_0091_A04.bCJ003257 
LVRM10091C05LVRM1_0091_C05.bCJ003279 
LVRM10091H09LVRM1_0091_H09.bCJ003337 
LVRM10092C12LVRM1_0092_C12.bBW962991 
LVRM10092E05LVRM1_0092_E05.bCJ003388 
LVRM10092F05LVRM1_0092_F05.bBW962993 
LVRM10092H05LVRM1_0092_H05.bCJ003418 
LVRM10093A12LVRM1_0093_A12.bCJ003432 
LVRM10093B02LVRM1_0093_B02.bCJ003434 
LVRM10093C03LVRM1_0093_C03.bBW963004 
LVRM10093E11LVRM1_0093_E11.bBW963011 
LVRM10093F06LVRM1_0093_F06.bCJ003473 
LVRM10094A09LVRM1_0094_A09.bBW963018 
LVRM10094A11LVRM1_0094_A11.bCJ003505 
LVRM10094E07LVRM1_0094_E07.bCJ003539 
LVRM10094F01LVRM1_0094_F01.bCJ003545 
LVRM10094H06LVRM1_0094_H06.bCJ003570 
LVRM10095B09LVRM1_0095_B09.bCJ003592 
LVRM10096A11LVRM1_0096_A11.bBW963046 
LVRM10096C04LVRM1_0096_C04.bCJ003675 
LVRM10096D08LVRM1_0096_D08.bCJ003688 
LVRM10097D06LVRM1_0097_D06.bCJ003763 
LVRM10097E05LVRM1_0097_E05.bCJ003772 
LVRM10097G11LVRM1_0097_G11.bCJ003801 
LVRM10098D05LVRM1_0098_D05.bCJ003846 
LVRM10098D07LVRM1_0098_D07.bCJ003848 
LVRM10098F07LVRM1_0098_F07.bCJ003869 
LVRM10099A06LVRM1_0099_A06.bCJ003898 
LVRM10099G02LVRM1_0099_G02.bCJ003953 
LVRM10100A08LVRM1_0100_A08.bCJ003983 
LVRM10100B07LVRM1_0100_B07.bCJ003994 
LVRM10100D02LVRM1_0100_D02.bCJ004012 
LVRM10100E03LVRM1_0100_E03.bCJ004024 
LVRM10100F02LVRM1_0100_F02.bCJ004035 
LVRM10100F04LVRM1_0100_F04.bCJ004037 
LVRM10101A05LVRM1_0101_A05.bBP137670 
LVRM10101B02LVRM1_0101_B02.bBP138023 
LVRM10101D02LVRM1_0101_D02.bBP138973 
LVRM10101F09LVRM1_0101_F09.bBP140159 
LVRM10101G11LVRM1_0101_G11.bBP140702 
LVRM10102A06LVRM1_0102_A06.bBP137710 
LVRM10102A10LVRM1_0102_A10.bBP137870 
LVRM10102A12LVRM1_0102_A12.bBP137949 
LVRM10102G07LVRM1_0102_G07.bBP140542 
LVRM10103A06LVRM1_0103_A06.bBP448469 
LVRM10103H03LVRM1_0103_H03.bBP453953 
LVRM10103H07LVRM1_0103_H07.bBP454237 
LVRM10104A06LVRM1_0104_A06.bBP448470 
LVRM10104C03LVRM1_0104_C03.bBP449856 
LVRM10104E12LVRM1_0104_E12.bBP452131 
LVRM10105C09LVRM1_0105_C09.bBP450274 
LVRM10105E12LVRM1_0105_E12.bBP452132 
LVRM10105H03LVRM1_0105_H03.bBP453955 
LVRM10106A12LVRM1_0106_A12.bBP448879 
LVRM10106B07LVRM1_0106_B07.bBP449339 
LVRM10106C08LVRM1_0106_C08.bBP450202 
LVRM10106D04LVRM1_0106_D04.bBP450764 
LVRM10107G01LVRM1_0107_G01.bBP452996 
LVRM10108B02LVRM1_0108_B02.bBP449012 
LVRM10108E02LVRM1_0108_E02.bBP451472 
LVRM10108H05LVRM1_0108_H05.bBP454096 
LVRM10108H09LVRM1_0108_H09.bBP454385 
LVRM10109C04LVRM1_0109_C04.bBP449930 
LVRM10109H01LVRM1_0109_H01.bBP453832 
LVRM10110A10LVRM1_0110_A10.bBP448748 
LVRM10110C01LVRM1_0110_C01.bBP449734 
LVRM10110E10LVRM1_0110_E10.bBP451999 
LVRM10111B11LVRM1_0111_B11.bBP449620 
LVRM10111D03LVRM1_0111_D03.bBP450700 
LVRM10111F06LVRM1_0111_F06.bBP452525 
LVRM10112C11LVRM1_0112_C11.bBP450426 
LVRM10112D02LVRM1_0112_D02.bBP450634 
LVRM10112F01LVRM1_0112_F01.bBP452197 
LVRM10113E04LVRM1_0113_E04.bBP451603 
LVRM10114D11LVRM1_0114_D11.bBP451278 
LVRM10114H12LVRM1_0114_H12.bBP454603 
LVRM10115A05LVRM1_0115_A05.bBP448413 
LVRM10115D03LVRM1_0115_D03.bBP450704 
LVRM10115E02LVRM1_0115_E02.bBP451478 
LVRM10116A07LVRM1_0116_A07.bBP448546 AK233276
LVRM10116F09LVRM1_0116_F09.bBP452738 
LVRM10117A07LVRM1_0117_A07.bBP448547 
LVRM10117C11LVRM1_0117_C11.bBP450431 
LVRM10117E09LVRM1_0117_E09.bBP451936 
LVRM10117G02LVRM1_0117_G02.bBP453069 
LVRM10117H09LVRM1_0117_H09.bBP454393 
LVRM10118A05LVRM1_0118_A05.bBP448416 
LVRM10118B07LVRM1_0118_B07.bBP449351 
LVRM10118C11LVRM1_0118_C11.bBP450432 
LVRM10118D03LVRM1_0118_D03.bBP450707 
LVRM10119A07LVRM1_0119_A07.bBP448549 
LVRM10119C11LVRM1_0119_C11.bBP450433 
LVRM10119G11LVRM1_0119_G11.bBP453704 
LVRM10120F10LVRM1_0120_F10.bBP452812 
LVRM10120G06LVRM1_0120_G06.bBP453341 
LVRM10121B06LVRM1_0121_B06.bBP449287 
LVRM10121B08LVRM1_0121_B08.bBP449424 
LVRM10121D06LVRM1_0121_D06.bBP450926 
LVRM10121E06LVRM1_0121_E06.bBP451746 
LVRM10121E08LVRM1_0121_E08.bBP451877 
LVRM10122A12LVRM1_0122_A12.bBP448895 
LVRM10122B09LVRM1_0122_B09.bBP449495 
LVRM10122C05LVRM1_0122_C05.bBP450009 
LVRM10122D10LVRM1_0122_D10.bBP451215 
LVRM10122F08LVRM1_0122_F08.bBP452673 
LVRM10123C06LVRM1_0123_C06.bBP450076 
LVRM10123E07LVRM1_0123_E07.bBP451817 
LVRM10123F06LVRM1_0123_F06.bBP452536 
LVRM10124A10LVRM1_0124_A10.bBP448762 
LVRM10124E01LVRM1_0124_E01.bBP451423 
LVRM10124F06LVRM1_0124_F06.bBP452537 
LVRM10125E08LVRM1_0125_E08.bBP451881 
LVRM10125F01LVRM1_0125_F01.bBP452209 
LVRM10125G07LVRM1_0125_G07.bBP453420 
LVRM10125H05LVRM1_0125_H05.bBP454112 
LVRM10126B04LVRM1_0126_B04.bBP449159 
LVRM10126E12LVRM1_0126_E12.bBP452150 
LVRM10126F07LVRM1_0126_F07.bBP452607 
LVRM10126F12LVRM1_0126_F12.bBP452945 
LVRM10127G08LVRM1_0127_G08.bBP453493 
LVRM10128C05LVRM1_0128_C05.bBP450014 
LVRM10128E09LVRM1_0128_E09.bBP451946 
LVRM10128H01LVRM1_0128_H01.bBP453848 
LVRM10128H10LVRM1_0128_H10.bBP454475 
LVRM10130A06LVRM1_0130_A06.bBP448493 
LVRM10130B09LVRM1_0130_B09.bBP449503 
LVRM10130E08LVRM1_0130_E08.bBP451886 
LVRM10130G09LVRM1_0130_G09.bBP453570 
LVRM10133F08LVRM1_0133_F08.bBP452683 
LVRM10134E02LVRM1_0134_E02.bBP451495 
LVRM10134E10LVRM1_0134_E10.bBP452020 
LVRM10134E11LVRM1_0134_E11.bBP452090 
LVRM10136A04LVRM1_0136_A04.bBP448365 
LVRM10136B03LVRM1_0136_B03.bBP449102 
LVRM10136D11LVRM1_0136_D11.bBP451300 
LVRM10136H12LVRM1_0136_H12.bBP454623 
LVRM10137A11LVRM1_0137_A11.bBP448839 
LVRM10137C12LVRM1_0137_C12.bBP450521 
LVRM10137F02LVRM1_0137_F02.bBP452284 
LVRM10137H01LVRM1_0137_H01.bBP453854 
LVRM10138A08LVRM1_0138_A08.bBP448634 
LVRM10138C08LVRM1_0138_C08.bBP450232 
LVRM10139A06LVRM1_0139_A06.bBP448501 
LVRM10139E12LVRM1_0139_E12.bBP452157 
LVRM10139F10LVRM1_0139_F10.bBP452830 
LVRM10140B09LVRM1_0140_B09.bBP449513 
LVRM10140C09LVRM1_0140_C09.bBP450308 
LVRM10140G01LVRM1_0140_G01.bBP453023 
LVRM10141F12LVRM1_0141_F12.bBP452960 
LVRM10142A08LVRM1_0142_A08.bBP448638 
LVRM10142C01LVRM1_0142_C01.bBP449759 
LVRM10142D02LVRM1_0142_D02.bBP450662 
LVRM10142D12LVRM1_0142_D12.bBP451374 
LVRM10143A04LVRM1_0143_A04.bBP448372 
LVRM10143F09LVRM1_0143_F09.bBP452764 
LVRM10144A10LVRM1_0144_A10.bBP448781 
LVRM10144B06LVRM1_0144_B06.bBP449308 
LVRM10144C05LVRM1_0144_C05.bBP450028 
LVRM10144C11LVRM1_0144_C11.bBP450457 
LVRM10144D04LVRM1_0144_D04.bBP450800 
LVRM10144F01LVRM1_0144_F01.bBP452227 
LVRM10144H05LVRM1_0144_H05.bBP454129 
LVRM10145B10LVRM1_0145_B10.bBP449587 
LVRM10145B12LVRM1_0145_B12.bBP449698 
LVRM10145D12LVRM1_0145_D12.bBP451377 
LVRM10145H05LVRM1_0145_H05.bBP454130 
LVRM10145H11LVRM1_0145_H11.bBP454564 
LVRM10146A02LVRM1_0146_A02.bBP448238 
LVRM10146A04LVRM1_0146_A04.bBP448375 
LVRM10146B09LVRM1_0146_B09.bBP449519 
LVRM10146C05LVRM1_0146_C05.bBP450030 
LVRM10146F07LVRM1_0146_F07.bBP452624 
LVRM10146G08LVRM1_0146_G08.bBP453512 
LVRM10147A08LVRM1_0147_A08.bBP448643 
LVRM10147G01LVRM1_0147_G01.bBP453030 
LVRM10148G02LVRM1_0148_G02.bBP453097 
LVRM10148G11LVRM1_0148_G11.bBP453732 
LVRM10149A01LVRM1_0149_A01.bBP448188 
LVRM10149B07LVRM1_0149_B07.bBP449378 
LVRM10149C01LVRM1_0149_C01.bBP449765 
LVRM10149C09LVRM1_0149_C09.bBP450316 
LVRM10149C10LVRM1_0149_C10.bBP450389 
LVRM10149D10LVRM1_0149_D10.bBP451240 
LVRM10149F10LVRM1_0149_F10.bBP452840 
LVRM10149F11LVRM1_0149_F11.bBP452900 
LVRM10149F12LVRM1_0149_F12.bBP452966 
LVRM10150E03LVRM1_0150_E03.bBP451572 
LVRM10150E10LVRM1_0150_E10.bBP452035 
LVRM10151B01LVRM1_0151_B01.bBP448983 
LVRM10151C09LVRM1_0151_C09.bBP450318 
LVRM10151D08LVRM1_0151_D08.bBP451098 
LVRM10151E10LVRM1_0151_E10.bBP452036 
LVRM10151F04LVRM1_0151_F04.bBP452428 
LVRM10151H04LVRM1_0151_H04.bBP454068 
LVRM10152A07LVRM1_0152_A07.bBP448577 
LVRM10153A05LVRM1_0153_A05.bBP448447 
LVRM10153A06LVRM1_0153_A06.bBP448513 
LVRM10153B11LVRM1_0153_B11.bBP449657 
LVRM10153F12LVRM1_0153_F12.bBP452969 
LVRM10153H07LVRM1_0153_H07.bBP454284 
LVRM10154C12LVRM1_0154_C12.bBP450536 
LVRM10154F10LVRM1_0154_F10.bBP452843 
LVRM10154G12LVRM1_0154_G12.bBP453805 
LVRM10154H03LVRM1_0154_H03.bBP453998 
LVRM10155H07LVRM1_0155_H07.bBP454286 
LVRM10156C11LVRM1_0156_C11.bBP450467 
LVRM10156D07LVRM1_0156_D07.bBP451030 
LVRM10156F10LVRM1_0156_F10.bBP452845 
LVRM10156G07LVRM1_0156_G07.bBP453448 
LVRM10156H06LVRM1_0156_H06.bBP454215 
LVRM10157C11LVRM1_0157_C11.bBP450468 
LVRM10157E07LVRM1_0157_E07.bBP451844 
LVRM10157E09LVRM1_0157_E09.bBP451975 
LVRM10158C12LVRM1_0158_C12.bBP450540 
LVRM10158E12LVRM1_0158_E12.bBP452172 
LVRM10159D08LVRM1_0159_D08.bBP451106 
LVRM10160B04LVRM1_0160_B04.bBP449189 
LVRM10160B09LVRM1_0160_B09.bBP449531 
LVRM10161F06LVRM1_0161_F06.bBP452570 
LVRM10161H07LVRM1_0161_H07.bBP454292 
LVRM10162A04LVRM1_0162_A04.bBP448388 
LVRM10163B04LVRM1_0163_B04.bBW963084 
LVRM10163C09LVRM1_0163_C09.bCJ004087 
LVRM10163E10LVRM1_0163_E10.bCJ004109 
LVRM10163H11LVRM1_0163_H11.bBW963093 
LVRM10164B08LVRM1_0164_B08.bCJ004157 
LVRM10164B11LVRM1_0164_B11.bCJ004160 
LVRM10164C05LVRM1_0164_C05.bCJ004165 
LVRM10164C09LVRM1_0164_C09.bCJ004168 
LVRM10164C10LVRM1_0164_C10.bCJ004169 
LVRM10164F02LVRM1_0164_F02.bCJ004194 
LVRM10164F10LVRM1_0164_F10.bCJ004201 
LVRM10164G03LVRM1_0164_G03.bCJ004206 
LVRM10165B12LVRM1_0165_B12.bCJ004244 
LVRM10165D06LVRM1_0165_D06.bCJ004261 
LVRM10166D09LVRM1_0166_D09.bCJ004336 
LVRM10166E08LVRM1_0166_E08.bCJ004346 
LVRM10167D07LVRM1_0167_D07.bBW963114 
LVRM10168B06LVRM1_0168_B06.bBW963117 
LVRM10168D01LVRM1_0168_D01.bCJ004485 
LVRM10170A05LVRM1_0170_A05.bCJ004618 
LVRM10170A06LVRM1_0170_A06.bCJ004619 
LVRM10170G06LVRM1_0170_G06.bCJ004683 
LVRM10171B12LVRM1_0171_B12.bCJ004718 
LVRM10172A03LVRM1_0172_A03.bCJ004778 
LVRM10172A12LVRM1_0172_A12.bCJ004785 
LVRM10172B03LVRM1_0172_B03.bCJ004787 
LVRM10172D11LVRM1_0172_D11.bCJ004816 
LVRM10173E10LVRM1_0173_E10.bCJ004905 
LVRM10173E11LVRM1_0173_E11.bCJ004906 
LVRM10173F01LVRM1_0173_F01.bCJ004908 
LVRM10173G09LVRM1_0173_G09.bBW963154 
LVRM10174A01LVRM1_0174_A01.bCJ004940 
LVRM10174A07LVRM1_0174_A07.bCJ004945 
LVRM10174B07LVRM1_0174_B07.bCJ004953 
LVRM10174D06LVRM1_0174_D06.bBW963157 
LVRM10175A09LVRM1_0175_A09.bCJ005020 
LVRM10175D02LVRM1_0175_D02.bBW963165 
LVRM10176A01LVRM1_0176_A01.bBW963167 
LVRM10176A12LVRM1_0176_A12.bBW963169 
LVRM10176B08LVRM1_0176_B08.bCJ005093 
LVRM10176B10LVRM1_0176_B10.bBW963170 
LVRM10176B12LVRM1_0176_B12.bCJ005096 
LVRM10176D05LVRM1_0176_D05.bCJ005113 
LVRM10176D08LVRM1_0176_D08.bCJ005116 
LVRM10176E04LVRM1_0176_E04.bCJ005123 
LVRM10176E11LVRM1_0176_E11.bCJ005130 
LVRM10176F01LVRM1_0176_F01.bCJ005132 
LVRM10176F02LVRM1_0176_F02.bCJ005133 
LVRM10176G02LVRM1_0176_G02.bCJ005145 
LVRM10177A11LVRM1_0177_A11.bCJ005175 
LVRM10179E03LVRM1_0179_E03.bCJ005368 
LVRM10180D02LVRM1_0180_D02.bCJ005447 
LVRM10180E02LVRM1_0180_E02.bCJ005456 
LVRM10181D03LVRM1_0181_D03.bCJ005529 
LVRM10181E11LVRM1_0181_E11.bCJ005546 
LVRM10181H05LVRM1_0181_H05.bCJ005574 
LVRM10182C05LVRM1_0182_C05.bCJ005605 
LVRM10183C08LVRM1_0183_C08.bBW963203 
LVRM10183D01LVRM1_0183_D01.bBW963205 
LVRM10183F08LVRM1_0183_F08.bCJ005714 
LVRM10183H11LVRM1_0183_H11.bBW963216 
LVRM10184B03LVRM1_0184_B03.bCJ005748 
LVRM10184H07LVRM1_0184_H07.bCJ005817 
LVRM10185B11LVRM1_0185_B11.bCJ005844 
LVRM10186A12LVRM1_0186_A12.bCJ005923 
LVRM10186B05LVRM1_0186_B05.bCJ005926 
LVRM10186F05LVRM1_0186_F05.bCJ005971 
LVRM10187F12LVRM1_0187_F12.bCJ006064 
LVRM10188D02LVRM1_0188_D02.bCJ006116 
LVRM10188H07LVRM1_0188_H07.bBW963241 
LVRM10189A03LVRM1_0189_A03.bCJ006170 
LVRM10189D01LVRM1_0189_D01.bCJ006198 
LVRM10189D07LVRM1_0189_D07.bCJ006203 
LVRM10189E02LVRM1_0189_E02.bCJ006209 
LVRM10189E10LVRM1_0189_E10.bCJ006217 
LVRM10189H05LVRM1_0189_H05.bCJ006245 
LVRM10191F10LVRM1_0191_F10.bBW963251 
LVRM10192A07LVRM1_0192_A07.bBW963254 
LVRM10192C03LVRM1_0192_C03.bCJ006347 
LVRM10192C05LVRM1_0192_C05.bCJ006349 
LVRM10192D02LVRM1_0192_D02.bBW963259 
LVRM10192D04LVRM1_0192_D04.bBW963260 
LVRM10193E04LVRM1_0193_E04.bBW963276 
LVRM10193G05LVRM1_0193_G05.bBW963284 
LVRM10194E08LVRM1_0194_E08.bCJ006521 
LVRM10195B07LVRM1_0195_B07.bCJ006571 
LVRM10195D02LVRM1_0195_D02.bBW963297 
LVRM10195G07LVRM1_0195_G07.bCJ006627 
LVRM10195H01LVRM1_0195_H01.bCJ006632 
LVRM10196E01LVRM1_0196_E01.bCJ006684 
LVRM10196H02LVRM1_0196_H02.bCJ006716 
LVRM10197D03LVRM1_0197_D03.bCJ006756 
LVRM10197F08LVRM1_0197_F08.bCJ006785 
LVRM10198E05LVRM1_0198_E05.bCJ006860 
LVRM10198F02LVRM1_0198_F02.bCJ006868 
LVRM10199A09LVRM1_0199_A09.bBW963307 
LVRM10199F03LVRM1_0199_F03.bCJ006954 
LVRM10199G05LVRM1_0199_G05.bCJ006967 
LVRM10199H03LVRM1_0199_H03.bCJ006976 
LVRM10200A11LVRM1_0200_A11.bCJ006991 
LVRM10200C01LVRM1_0200_C01.bBW963320 
LVRM10200C10LVRM1_0200_C10.bCJ007009 
LVRM10200E10LVRM1_0200_E10.bCJ007028 
LVRM10200F05LVRM1_0200_F05.bBW963327 
LVRM10200G01LVRM1_0200_G01.bBW963328 
LVRM10200H08LVRM1_0200_H08.bCJ007050 
LVRM10201F08LVRM1_0201_F08.bCJ007117 
LVRM10201H09LVRM1_0201_H09.bCJ007142 
LVRM10202E09LVRM1_0202_E09.bCJ007191 
LVRM10202H01LVRM1_0202_H01.bCJ007214 
LVRM10204E01LVRM1_0204_E01.bCJ007351 
LVRM10204F09LVRM1_0204_F09.bCJ007369 
LVRM10205D11LVRM1_0205_D11.bCJ007431 
LVRM10206A02LVRM1_0206_A02.b  
LVRM10207A03LVRM1_0207_A03.bCJ007555 
LVRM10207A07LVRM1_0207_A07.bCJ007559 
LVRM10207C05LVRM1_0207_C05.bCJ007580 
LVRM10207H06LVRM1_0207_H06.bCJ007635 
LVRM10208C02LVRM1_0208_C02.bCJ007666 
OVRM10092H07OVRM1_0092_H07.bBP154396 

  

SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
1129A020.029MNGAA/E
G34340.971GGA/G


Alignment:      TOP

20110601C-012094 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
LVRM1_0001_A11.b : cxxxxxxxxxxxxx
LVRM1_0183_C08.b : tt
LVRM1_0116_A07.b : cgtgtcxxxxxx
LVRM1_0108_H09.b : cagttgtcx
LVR01_0077_E10.b : gcattttagggttgxxxxxxxxxxxxxxxxx
LVRM1_0028_F10.b :
LVR01_0008_E12.b : ctataggtgacntanntagacxx
LVR01_0056_H05.b : gcxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0089_E01.b :
LVRM1_0084_B06.b :
LVRM1_0099_A06.b :
LVRM1_0106_B07.b : tggcc
LVRM1_0070_B05.b :
LVRM1_0156_F10.b :
LVRM1_0027_A08.b :
LVRM1_0039_B07.b :
LVRM1_0111_B11.b :
LVRM1_0077_F07.b :
LVRM1_0011_G12.b :
LVRM1_0014_F11.b :
LVR01_0033_D07.b : cxxxxxxxxxxxxxxxxxx
LVR01_0106_G05.b : xxxxxxxxxxxxxxxxxxxxx
LVR01_0089_E09.b : cxxxxxxxxxxxxxxxxxx
LVRM1_0176_B10.b :
LVRM1_0094_E07.b :
LVRM1_0007_B08.b :
LVRM1_0180_D02.b :
LVRM1_0174_D06.b :
LVRM1_0008_H12.b :
LVRM1_0035_E09.b :
LVRM1_0146_F07.b :
LVRM1_0075_H11.b :
LVRM1_0120_F10.b :
LVR01_0093_A09.b : gcatxxxxxxxxxxxx
LVR01_0098_H09.b : tttttttactggacttgtgxxxxx
LVRM1_0049_C03.b :
LVRM1_0087_H04.b :
LVRM1_0093_E11.b :
LVRM1_0085_E11.b :
LVRM1_0011_H08.b :
LVRM1_0095_B09.b :
LVRM1_0197_D03.b :
LVRM1_0189_D01.b :
LVRM1_0168_D01.b :
LVRM1_0182_C05.b :
LVRM1_0194_E08.b :
LVRM1_0118_A05.b :
LVRM1_0077_C07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LVRM1_0188_D02.b :
LVRM1_0048_H06.b :
LVRM1_0110_C01.b :
LVRM1_0170_G06.b :
LVRM1_0082_D05.b :
LVRM1_0097_G11.b :
LVRM1_0201_F08.b :
LVRM1_0150_E03.b :
LVRM1_0125_G07.b :
LVRM1_0118_C11.b :
LVRM1_0016_C04.b :
LVR01_0087_E11.b : ctttttggtxxxxxxxxxxxxx
LVRM1_0137_H01.b :
LVRM1_0122_B09.b :
LVRM1_0144_A10.b :
LVRM1_0080_G02.b :
LVRM1_0019_D03.b :
LVRM1_0070_C09.b :
LVRM1_0137_C12.b :
LVRM1_0011_D10.b :
LVRM1_0123_E07.b :
LVRM1_0121_E08.b :
LVRM1_0002_B06.b :
LVR01_0020_F12.b : ttxxxxxxxxxxxxxxxxxx
LVR01_0047_A01.b : ggggtgtttttccggcttggtgxxxxxx
LVR01_0103_D11.b : ggggttttggcttagtgcxxxxxx
LVR01_0084_A03.b : ggcataggtgxxxxxxx
LVR01_0077_E08.b : ccxxxxxxxxxxxxxxxxx
LVR01_0079_G02.b : ggggggggaatattatgcttggtgxxxxxxx
LVR01_0005_F03.b : gggcatttxxxxxxxxxx
LVR01_0048_F12.b : tggcggtttttcatgcttagtgxxxxxx
LVR01_0054_G03.b : gcatttggtgtcc
LVR01_0016_D01.b : acacggcttggtgcxxxxx
LVR01_0091_H12.b : attttggctctxxxxxxxxxx
LVR01_0014_A12.b : gctxxxxxxxxxxxxxxx
LVR01_0085_B10.b : gggcaxxxxxxxxxxxxxx
LVR01_0017_D11.b : ccttttggtgccnxxx
LVR01_0011_E11.b : gggaatagcttagtgxxxxxx
LVR01_0048_B08.b : ggttttttttttagcttggtgxxxxxxx
LVR01_0083_H02.b : taggcattggtgxxxxxxx
LVR01_0017_F01.b : tctttagcttagtgacntat
LVR01_0002_A05.b : aactcgtgaxxxxxxxxxx
LVR01_0093_D03.b : ccxxxxxxxxxxxxxxxx
LVR01_0018_A10.b : gcatatagtgcnxxxxx
LVR01_0072_F05.b : tttgaggggccccagcttagtgcactxx
LVR01_0073_D02.b : ttttggggtttttacgcttagtgxxxxxx
LVR01_0090_A07.b : gcatttcgctncnxxxxxx
LVR01_0010_H10.b : gcattangtgcxxxxxxx
LVR01_0077_A06.b : gctctxxxxxxxxxxxxxxxx
LVR01_0100_A02.b : gcatttcgtgnxxxxxxxx
LVRM1_0198_E05.b :
LVRM1_0187_F12.b :
LVRM1_0122_C05.b :
LVRM1_0009_C10.b :
LVRM1_0123_F06.b :
LVRM1_0140_C09.b :
LVR01_0031_G10.b : cxxxxxxxxxxxxx
LVRM1_0086_A11.b :
LVRM1_0004_G12.b :
LVRM1_0051_D03.b :
LVRM1_0160_B04.b :
LVRM1_0163_B04.b :
LVRM1_0200_G01.b :
LVRM1_0093_A12.b :
LVRM1_0004_E09.b :
LVRM1_0115_A05.b :
LVRM1_0176_F02.b :
LVRM1_0036_A02.b :
LVRM1_0082_C08.b :
LVRM1_0070_H07.b :
LVRM1_0105_H03.b :
LVRM1_0054_D11.b :
LVRM1_0038_H06.b :
LVRM1_0103_A06.b :
LVRM1_0070_E12.b :
LVRM1_0102_A10.b :
LVRM1_0098_D07.b :
LVRM1_0097_D06.b :
LVRM1_0101_D02.b :
LVRM1_0147_G01.b :
LVRM1_0164_B11.b :
LVRM1_0117_E09.b :
LVRM1_0030_C04.b :
LVRM1_0078_F07.b :
LVRM1_0112_C11.b :
LVRM1_0079_F05.b :
LVRM1_0032_D04.b :
LVRM1_0018_A07.b :
LVRM1_0151_C09.b :
LVRM1_0077_C08.b :
LVRM1_0158_E12.b :
LVRM1_0064_H03.b :
LVR01_0036_G01.b : ctxxxxxxxxxxxxxxxx
LVR01_0077_H04.b : gggtgctttcaggcattggtgxxxxxxx
LVR01_0030_F06.b : xxxxxxxxxxxxxxxx
LVR01_0038_B11.b : cxxxxxxxxxxxxxxxx
LVR01_0060_B06.b : gttaaaaagatctgtgxxxxxxxxxx
LVR01_0048_G02.b : gggtttttttttagcttggtgxxxxxx
LVR01_0054_G09.b : gttxxxxxxxxxxxxxxxx
LVR01_0053_C11.b : gcaxxxxxxxxxxxxxxx
LVR01_0106_C12.b : ggattttagctgcttggtgxxxxxx
LVR01_0091_G03.b : gcxxxxxxxxxxxxxxx
LVR01_0067_D05.b : ccxxxxxxxxxxxxxxxx
LVR01_0096_F11.b : cttxxxxxxxxxxxxxxx
LVR01_0034_A04.b : cctttatgtgxxxxxx
LVR01_0011_C12.b : gattataagctttggtgcxxxx
LVR01_0059_F01.b : gtcttaagctttcxxxxxxxx
LVR01_0061_E01.b : gtttatcggctttcgtgxxxxx
LVR01_0048_D06.b : gggtttttttttagcttagtgactx
LVR01_0073_G04.b : cgcatttggtgccntata
LVR01_0067_E11.b : gcatctagggtgxxxxxx
LVR01_0016_B09.b : gcatttxxxxxxxxx
LVR01_0099_H10.b : ggagcattggtgcnxxxxx
LVR01_0059_C04.b : ttaaaaagctttxxxxxxxx
LVRM1_0053_E03.b :
LVRM1_0192_A07.b :
LVRM1_0085_E10.b :
LVRM1_0196_H02.b :
LVRM1_0096_C04.b :
LVRM1_0038_A03.b :
LVRM1_0038_H05.b :
LVRM1_0189_E10.b :
LVRM1_0118_B07.b :
LVRM1_0055_G02.b :
LVRM1_0034_H07.b :
LVRM1_0084_B12.b :
LVRM1_0031_A07.b :
LVRM1_0153_H07.b :
LVRM1_0137_F02.b :
LVRM1_0145_B10.b :
LVRM1_0149_C09.b :
LVRM1_0034_G09.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnx
LVRM1_0137_A11.b :
LVRM1_0052_G09.b :
LVRM1_0119_C11.b :
LVRM1_0002_B09.b :
LVR01_0060_C11.b : aaataaagcttttxxxxx
LVR01_0025_D06.b : ttagggtgxxx
LVR01_0087_D11.b : cxxxxxxxxxxxxx
LVR01_0049_A12.b : tttttttattaaaggcattgtgx
LVR01_0065_H02.b : gcttttagctttagtgxx
LVR01_0102_B04.b : ccatttgggtgxxxx
LVR01_0005_G11.b : cattagxxxxxxxx
LVR01_0097_B04.b : cttttggttgxxxx
LVR01_0051_B01.b : tttggtggtttttcaagcatagt
LVR01_0066_D10.b : gatxxxxxxxxxxxxxxxxx
LVR01_0058_D04.b : ccttttatggtgccta
LVRM1_0007_B02.b :
LVRM1_0183_H11.b :
LVRM1_0107_G01.b :
LVRM1_0204_E01.b :
LVRM1_0096_A11.b :
LVRM1_0052_H05.b :
LVRM1_0092_H05.b :
LVRM1_0200_C01.b :
LVRM1_0207_C05.b :
LVRM1_0202_H01.b :
LVRM1_0199_F03.b :
LVRM1_0200_F05.b :
LVRM1_0051_E01.b :
LVRM1_0199_G05.b :
LVRM1_0094_A11.b :
LVRM1_0011_D01.b :
LVRM1_0077_E03.b :
LVRM1_0061_C10.b :
LVRM1_0130_B09.b :
LVRM1_0130_G09.b :
LVRM1_0154_C12.b :
LVR01_0033_C11.b : xxxxxxxxxxxxxx
LVR01_0054_D04.b : gcattttgtgcact
LVR01_0020_A08.b : cctttatxxxxxxxxx
LVR01_0002_D12.b : xxxxxxxxxxx
LVR01_0078_F03.b : ggctttatggtgxxxxx
LVRM1_0174_B07.b :
LVRM1_0048_C09.b :
LVRM1_0087_A03.b :
LVRM1_0061_B02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
LVRM1_0164_C10.b :
LVRM1_0049_H02.b :
LVRM1_0167_D07.b :
LVRM1_0091_A04.b :
LVRM1_0163_H11.b :
LVRM1_0164_C09.b :
LVRM1_0044_D08.b :
LVRM1_0085_A03.b :
LVRM1_0061_E01.b : aaacagacagnacagcacggcacagacagaaacccaagcggacgcggaaaaagga
LVRM1_0168_B06.b :
LVRM1_0061_F10.b :
LVR01_0091_B01.b : gagcattttgngncnxx
LVRM1_0176_E11.b :
LVRM1_0062_E10.b :
LVRM1_0136_B03.b :
LVRM1_0086_C11.b :
LVRM1_0174_A01.b :
LVRM1_0083_F08.b :
LVRM1_0172_A03.b :
LVRM1_0165_D06.b :
LVRM1_0173_G09.b :
LVRM1_0175_A09.b :
LVRM1_0146_A04.b : tagtttgt
LVRM1_0003_B01.b :
LVRM1_0045_H12.b :
LVRM1_0011_F04.b :
LVRM1_0176_G02.b :
LVRM1_0149_F11.b :
LVRM1_0065_A11.b :
LVRM1_0162_A04.b :
LVRM1_0078_C02.b : aagagaaagaggangataatganagantgaataattgtttataattttgatatagtttt
LVR01_0082_H04.b : gtcatttagggtgxxxxx
LVRM1_0157_C11.b :
LVRM1_0004_F02.b :
LVRM1_0188_H07.b :
LVRM1_0192_D04.b :
LVRM1_0019_B02.b :
LVRM1_0088_H10.b :
LVRM1_0092_C12.b :
LVRM1_0020_F05.b :
LVRM1_0053_C01.b :
LVRM1_0145_H05.b :
LVRM1_0192_D02.b :
LVRM1_0125_H05.b :
LVRM1_0055_F03.b :
LVRM1_0018_G01.b :
LVRM1_0087_G12.b :
LVRM1_0183_D01.b :
LVRM1_0084_F09.b :
LVRM1_0192_C03.b :
LVRM1_0149_A01.b :
LVRM1_0186_F05.b :
LVRM1_0043_B07.b :
LVRM1_0180_E02.b :
LVRM1_0208_C02.b :
LVRM1_0057_C05.b :
LVRM1_0064_C12.b :
LVRM1_0189_E02.b :
LVRM1_0124_E01.b :
LVRM1_0076_D11.b :
LVRM1_0196_E01.b :
LVRM1_0181_D03.b :
LVRM1_0057_H11.b :
LVRM1_0085_E02.b :
LVRM1_0179_E03.b :
LVRM1_0050_E11.b :
LVRM1_0055_A01.b :
LVRM1_0094_F01.b :
LVRM1_0087_E02.b :
LVRM1_0094_A09.b :
LVRM1_0081_G03.b :
LVRM1_0092_E05.b :
LVRM1_0126_B04.b :
LVRM1_0164_G03.b :
LVRM1_0003_F01.b :
LVRM1_0040_E01.b :
LVRM1_0164_F02.b :
LVRM1_0146_A02.b :
LVRM1_0207_A03.b :
LVRM1_0181_E11.b :
LVRM1_0181_H05.b :
LVRM1_0185_B11.b :
LVRM1_0093_F06.b :
LVRM1_0085_B10.b :
LVRM1_0166_E08.b :
LVRM1_0195_G07.b :
LVRM1_0082_D01.b :
LVRM1_0175_D02.b :
LVRM1_0094_H06.b :
LVRM1_0100_F02.b :
LVRM1_0100_E03.b :
LVRM1_0176_A01.b :
LVRM1_0100_F04.b :
LVRM1_0047_G06.b :
LVRM1_0115_E02.b :
LVRM1_0170_A05.b :
LVRM1_0176_E04.b :
LVRM1_0195_H01.b :
LVRM1_0184_B03.b :
LVRM1_0113_E04.b :
LVRM1_0093_C03.b :
LVRM1_0093_B02.b :
LVRM1_0173_E11.b :
LVRM1_0038_E06.b :
LVRM1_0103_H07.b :
LVRM1_0115_D03.b :
LVRM1_0007_H01.b :
LVRM1_0061_F05.b :
LVRM1_0039_G01.b :
LVRM1_0112_D02.b :
LVRM1_0189_A03.b :
LVRM1_0176_A12.b :
LVRM1_0020_B12.b :
LVRM1_0037_H04.b :
LVRM1_0038_E05.b :
LVRM1_0123_C06.b :
LVRM1_0172_B03.b :
LVRM1_0029_A04.b :
LVRM1_0100_A08.b :
LVRM1_0100_B07.b :
LVRM1_0101_F09.b :
LVRM1_0099_G02.b :
LVRM1_0100_D02.b :
LVRM1_0020_A12.b :
LVRM1_0118_D03.b :
LVRM1_0164_B08.b :
LVRM1_0176_F01.b :
LVRM1_0009_H04.b :
LVRM1_0198_F02.b :
LVRM1_0106_D04.b :
LVRM1_0189_D07.b :
LVRM1_0022_B01.b :
LVRM1_0037_A06.b :
LVRM1_0096_D08.b :
LVRM1_0108_E02.b :
LVRM1_0199_H03.b :
LVRM1_0038_B05.b :
LVRM1_0136_D11.b :
LVRM1_0047_H04.b :
LVRM1_0091_C05.b :
LVRM1_0091_H09.b :
LVRM1_0149_F12.b :
LVRM1_0121_D06.b :
LVRM1_0136_H12.b :
LVRM1_0054_F12.b :
LVRM1_0055_F12.b :
LVRM1_0101_A05.b :
LVRM1_0065_D08.b :
LVRM1_0130_A06.b :
LVRM1_0082_G06.b :
LVRM1_0207_A07.b :
LVRM1_0039_B01.b :
LVRM1_0097_E05.b :
LVRM1_0112_F01.b :
LVRM1_0117_A07.b :
LVRM1_0128_C05.b :
LVRM1_0047_B06.b :
LVRM1_0158_C12.b :
LVRM1_0145_H11.b :
LVRM1_0026_E08.b :
LVRM1_0117_G02.b :
LVRM1_0186_A12.b :
LVRM1_0197_F08.b :
LVRM1_0114_D11.b : cagttgtcxxxxxxxxxxxx
LVRM1_0040_H06.b :
LVRM1_0146_C05.b :
LVRM1_0204_F09.b :
LVRM1_0145_D12.b :
LVRM1_0082_G12.b :
LVRM1_0104_A06.b :
LVRM1_0037_A12.b :
LVRM1_0125_F01.b :
LVRM1_0205_D11.b :
LVRM1_0163_E10.b :
LVRM1_0033_F01.b :
LVRM1_0191_F10.b :
LVRM1_0114_H12.b :
LVRM1_0036_E05.b :
LVRM1_0039_B11.b :
LVRM1_0176_D05.b :
LVRM1_0043_F11.b :
LVRM1_0074_H03.b :
LVRM1_0085_F10.b :
LVRM1_0133_F08.b :
LVRM1_0061_B05.b :
LVRM1_0121_E06.b :
LVRM1_0136_A04.b :
LVRM1_0145_B12.b :
LVRM1_0043_F08.b :
LVRM1_0201_H09.b :
LVRM1_0102_A06.b :
LVRM1_0104_E12.b :
LVRM1_0039_G12.b :
LVRM1_0098_D05.b :
LVRM1_0014_G10.b :
LVRM1_0089_E12.b :
LVRM1_0030_F04.b :
LVRM1_0033_B07.b :
LVRM1_0031_A02.b :
LVRM1_0035_E07.b :
LVRM1_0070_C11.b :
LVRM1_0012_D05.b :
LVRM1_0053_B05.b :
LVRM1_0074_G01.b :
LVRM1_0077_D01.b :
LVRM1_0088_C06.b :
LVRM1_0086_E09.b :
LVRM1_0034_C03.b :
LVRM1_0109_C04.b :
LVRM1_0128_H10.b :
LVRM1_0074_H06.b :
LVRM1_0153_A05.b :
LVRM1_0082_D12.b :
LVRM1_0034_F06.b :
LVRM1_0054_G11.b :
LVRM1_0057_C10.b :
LVRM1_0089_F10.b :
LVRM1_0165_B12.b :
LVRM1_0199_A09.b :
LVRM1_0003_B07.b :
LVRM1_0003_A03.b :
LVRM1_0074_C07.b :
LVRM1_0106_A12.b :
LVRM1_0075_A11.b :
LVRM1_0065_E07.b :
LVRM1_0121_B08.b :
LVRM1_0004_F06.b :
LVRM1_0108_B02.b :
LVRM1_0073_A10.b :
LVRM1_0074_D05.b :
LVRM1_0154_H03.b :
LVRM1_0164_F10.b :
LVRM1_0117_C11.b :
LVRM1_0065_B06.b :
LVRM1_0039_H09.b :
LVRM1_0147_A08.b :
LVRM1_0200_E10.b :
LVRM1_0106_C08.b :
LVRM1_0032_H02.b :
LVRM1_0151_H04.b :
LVRM1_0014_B06.b :
LVRM1_0153_F12.b : tttatatatcatatcattacttgtatcgtattcttcctcttctactatacctaca
LVRM1_0105_C09.b :
LVRM1_0146_B09.b :
LVRM1_0033_G11.b :
LVRM1_0161_H07.b :
LVRM1_0172_D11.b :
LVRM1_0200_H08.b :
LVRM1_0071_F10.b :
LVRM1_0079_C03.b :
LVRM1_0105_E12.b :
LVRM1_0116_F09.b :
LVRM1_0087_D11.b :
LVRM1_0200_C10.b :
LVRM1_0036_E09.b :
LVRM1_0171_B12.b :
LVRM1_0102_A12.b :
LVRM1_0014_B05.b :
LVRM1_0151_F04.b :
LVRM1_0012_F06.b :
LVRM1_0050_F01.b :
LVRM1_0053_G12.b :
LVRM1_0117_H09.b :
LVRM1_0156_H06.b :
LVRM1_0008_D10.b :
LVRM1_0019_A09.b :
LVRM1_0022_C07.b :
LVRM1_0007_D10.b :
LVRM1_0017_F01.b :
LVRM1_0148_G02.b :
LVRM1_0151_B01.b :
LVRM1_0157_E07.b :
LVRM1_0080_F05.b :
LVRM1_0065_G11.b :
LVRM1_0049_F04.b :
LVRM1_0033_D05.b :
LVRM1_0142_C01.b :
LVRM1_0103_H03.b :
LVRM1_0143_A04.b :
LVR01_0035_H11.b : ggggacctattx
LVRM1_0079_D07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnctancccc
LVRM1_0058_H01.b :
LVRM1_0144_C05.b :
LVRM1_0144_D04.b :
LVRM1_0022_D05.b :
LVRM1_0159_D08.b :
LVRM1_0126_F07.b :
LVRM1_0128_H01.b :
LVRM1_0030_G04.b :
LVRM1_0033_B12.b :
LVRM1_0144_B06.b :
LVRM1_0155_H07.b :
LVRM1_0111_F06.b :
LVRM1_0022_F08.b :
LVRM1_0051_G02.b :
LVRM1_0109_H01.b :
LVRM1_0111_D03.b :
LVRM1_0019_F04.b :
LVRM1_0077_D06.b :
LVR01_0041_E05.b : cttttgggttgcct
LVRM1_0007_C11.b :
LVRM1_0034_D08.b :
LVRM1_0035_C10.b :
LVRM1_0140_G01.b :
LVRM1_0150_E10.b :
LVRM1_0021_A10.b :
LVRM1_0156_C11.b :
LVRM1_0173_E10.b :
LVR01_0038_B07.b : gcatttggtgxxxxx
LVRM1_0139_A06.b :
LVRM1_0151_E10.b :
LVRM1_0153_B11.b :
LVRM1_0154_F10.b :
LVRM1_0122_A12.b :
LVRM1_0134_E11.b :
LVRM1_0148_G11.b :
OVRM1_0092_H07.b :
LVRM1_0021_E10.b :
LVRM1_0030_G01.b :
LVR01_0001_B12.b : aaaaagcttcgtgxxxx
LVRM1_0033_C10.b :
LVRM1_0144_H05.b :
LVRM1_0078_H07.b :
LVRM1_0058_G11.b :
LVRM1_0127_G08.b :
LVRM1_0015_H08.b :
LVRM1_0110_E10.b :
LVRM1_0120_G06.b :
LVRM1_0124_F06.b :
LVRM1_0124_A10.b :
LVRM1_0021_H10.b :
LVRM1_0110_A10.b :
LVRM1_0119_G11.b :
LVRM1_0101_G11.b : nxxxxxxxxxxxxxxxxxxxxx
LVRM1_0012_F10.b :
LVRM1_0015_G12.b :
LVRM1_0160_B09.b :
LVRM1_0016_A11.b :
LVRM1_0149_C10.b :
LVRM1_0139_F10.b :
LVRM1_0146_G08.b :
LVRM1_0149_F10.b :
LVRM1_0050_F10.b :
LVRM1_0144_C11.b :
LVRM1_0149_D10.b :
LVRM1_0143_F09.b :
LVRM1_0157_E09.b :
LVRM1_0128_E09.b :
LVRM1_0149_B07.b :
LVRM1_0001_B04.b :
LVRM1_0063_A07.b :
LVRM1_0138_C08.b :
LVRM1_0140_B09.b :
LVRM1_0139_E12.b :
LVRM1_0121_B06.b :
LVRM1_0006_F10.b :
LVRM1_0125_E08.b :
LVRM1_0142_D12.b :
LVRM1_0006_G03.b :
LVRM1_0130_E08.b :
LVRM1_0001_F10.b :
LVRM1_0001_H12.b :
LVR01_0040_D06.b : cttttggggacxx
LVR01_0078_F04.b : gccxxxxxxxxxxxxxx
LVR01_0015_D07.b : ctttttggtgxxxxx
LVR01_0028_F10.b : xxxxxxxxxxxxx
LVR01_0035_H09.b : ttttggggggaxxxxx
LVR01_0019_E09.b : ctttttgggtaxxxx
LVR01_0035_H12.b : txxxxxxxxxxxxxxx
LVR01_0033_F09.b : txxxxxxxxxxxxxxx
LVR01_0040_F09.b : cctxxxxxxxxxxxxxx
LVR01_0043_F06.b : ccttttggtaxxxx
LVR01_0033_B07.b : tttttgggtgxxxx
LVR01_0043_E09.b : ttttttggtgxxxx
LVR01_0026_A01.b : cttatxxxxxxxxx
LVR01_0005_D07.b : ctxxxxxxxxxxxxxx
LVR01_0039_F10.b : gcxxxxxxxxxxxxxxx
LVR01_0026_D10.b : ttagxxxxxxxxxx
LVR01_0095_E07.b : ccxxxxxxxxxxxx
LVR01_0066_C09.b : ccxxxxxxxxxxxxxx
LVR01_0051_F06.b : gggggtgttttttggcttgtgact
LVR01_0102_D07.b : ttxxxxxxxxxxxxx
LVR01_0087_E07.b : ctttttgggtgxxxxx
LVR01_0060_E05.b : cxxxxxxxxxxx
LVR01_0071_G02.b : tttttttccttttggcctagtgxxxx
LVR01_0079_H02.b : gggggtcgtcxxxxxxxxxxxx
LVR01_0071_B03.b : gctgtgtgtccccagtttggtgxxxx
LVR01_0082_H10.b : agctxxxxxxxxxxxx
LVR01_0047_E11.b : cgggtgacntctttgcttagtgxxx
LVR01_0038_E10.b : ctttttggtgcacxxxx
LVR01_0035_A11.b : ctttxxxxxxxxxx
LVR01_0034_F12.b : gcatttggtgxxxx
LVR01_0037_G02.b : ctxxxxxxxxxxxxx
LVR01_0038_E04.b : cgggggcttagtgctxx
LVR01_0083_A06.b : agggcattggtgxxxx
LVR01_0047_H08.b : gggggttttcttggcttagtgxxxx
LVR01_0094_G11.b : gcxxxxxxxxxxxxx
LVR01_0088_H11.b : gccxxxxxxxxxxxxx
LVR01_0098_A10.b : gggctttgcxxxxxxxx
LVR01_0098_B01.b : ttgtttttttttgacttgtgcnxx
LVR01_0049_F09.b : ggggggggantcggcttaggxxxx
LVR01_0039_G04.b : ttgggggctttggtgxx
LVR01_0053_B04.b : gcattacgtgxxxx
LVR01_0068_H12.b : ttttttggcattcgtgxxxx
LVR01_0031_H09.b : cxxxxxxxxxxxxxx
LVR01_0022_F06.b : cctxxxxxxxxxxxxxxx
LVR01_0003_H09.b : tttgagtggaxxx
LVR01_0082_D01.b : ggcatttagcgtgxxxxx
LVR01_0087_A08.b : gggcaxxxxxxxxxx
LVR01_0086_D08.b : xxxxxxxxxxxxxxx
LVR01_0085_E09.b : cxxxxxxxxxxxxx
LVR01_0026_C09.b : tttggtgcacxxx
LVR01_0028_A04.b : tctaaxxxxxxxx
LVR01_0063_E06.b : ggtcgnccaggcttagtgxxx
LVR01_0015_F02.b : ctxxxxxxxxxxxxx
LVR01_0088_C04.b : ccaxxxxxxxxxxxx
LVR01_0014_B09.b : acxxxxxxxxxxxx
LVR01_0031_D10.b : cxxxxxxxxxxxxxx
LVR01_0086_D07.b : txxxxxxxxxxxx
LVR01_0041_F02.b : ggggggcagcatagtgxxxx
LVR01_0066_F12.b : cxxxxxxxxxxxxxxxx
LVR01_0073_C06.b : cctxxxxxxxxxxxxx
LVR01_0035_C02.b : ctxxxxxxxxxxxx
LVR01_0084_D01.b : gcaxxxxxxxxxxx
LVR01_0083_C12.b : ggcattacgtgxxxxx
LVR01_0022_C06.b : cxxxxxxxxxxxxxx
LVR01_0062_F01.b : tatacccagctttcgtgxxx
LVR01_0038_B02.b : cccxxxxxxxxxxx
LVR01_0074_A12.b : aaaataataatttaagcttggtgxxxx
LVR01_0049_E01.b : gggggttttacattgcttgtgxxxx
LVR01_0072_G01.b : tattgtgcctaccggcttggtgxxx
LVR01_0095_C05.b : ggtttttaaggcttagtgxxxx
LVR01_0029_A09.b : xxxxxxxxxxxxxx
LVR01_0067_C08.b : ggctctacggtgxxxx
LVR01_0096_C07.b : ccttttgcxxxxxxxx
LVR01_0055_F10.b : ccattttggtgxxxx
LVR01_0033_F12.b : cattttggtgxxx
LVR01_0049_D08.b : ttgtttttttttttgcttcgtgxxx
LVR01_0043_G10.b : ccxxxxxxxxxxxxxx
LVR01_0022_E03.b : cattatxxxxxxxx
LVR01_0071_A05.b : ttgtgggtttattagcttagtgxxxx
LVR01_0054_C09.b : ccattttgtgxxxx
LVR01_0089_H05.b : ggcagxxxxxxxxxxx
LVR01_0015_B10.b : ctttttgctgxxxx
LVR01_0002_G01.b : tttgcgtgcacta
LVR01_0044_H10.b : ttttttttggcttggtgcact
LVR01_0052_G05.b : gcxxxxxxxxxxxxx
LVR01_0102_H11.b : gcxxxxxxxxxxxxx
LVR01_0029_B01.b : xxxxxxxxxxxxx
LVR01_0081_C09.b : ggctxxxxxxxxxxxx
LVR01_0052_B02.b : gcattacgctgacc
LVR01_0085_H08.b : cxxxxxxxxxxxx
LVR01_0082_C09.b : gccxxxxxxxxxxxxxx
LVR01_0072_F12.b : ggcxxxxxxxxxxxxx
LVR01_0089_G10.b : cctttggtgxxxxx
LVR01_0002_E07.b : tttxxxxxxxxx
LVR01_0095_B01.b : gttttttttatgcttggtgacct
LVR01_0057_A07.b : ttcaaggctttggtgxxxx
LVR01_0016_H11.b : cctttgggtgaaxxx
LVR01_0053_H10.b : gctttttgtgxxxx
LVR01_0062_F05.b : ggcacaaagcattggtgxxxx
LVR01_0059_E03.b : ataaaagcatacxxxxxx
LVR01_0052_H07.b : gcatttgggtccntan
LVR01_0033_G03.b : cttttggtgccxxxx
LVR01_0009_G11.b : gctttgggggcxxx
LVR01_0086_B05.b : ctxxxxxxxxxxxx
LVR01_0048_F10.b : gggggtttttgggcttaggxxxx
LVR01_0088_H01.b : gcaxxxxxxxxxxxxx
LVR01_0092_C03.b : ggcattacgtgxxxx
LVR01_0101_D08.b : cxxxxxxxxxxxxxx
LVR01_0028_H07.b : xxxxxxxxxxxxxx
LVR01_0012_C07.b : gggtaaggcttagtgxxxx
LVR01_0083_D10.b : ggagcatacggtgxxxx
LVR01_0031_A10.b : tcttttggtgcxxxx
LVR01_0047_A10.b : cggtgcttttttttgcataggtgxxx
LVR01_0091_E12.b : atacaagcatacgtgxxx
LVR01_0028_F12.b : attacgttgcxxxx
LVR01_0035_A03.b : cttttcgtgcxxx
LVR01_0059_H05.b : gatattagcattcgtgxxx
LVR01_0079_F09.b : gcatatagggtgxxxxx
LVR01_0078_G04.b : gcatatatggtgxxxx
LVR01_0025_B05.b : ttttgggtgcacxxx
LVR01_0038_E11.b : cxxxxxxxxxxxxxx
LVR01_0092_E01.b : ccgactggctctcxxxxxx
LVR01_0044_H05.b : cctttgggtgcxxxx
LVR01_0091_E09.b : cctttggctgacxx
LVR01_0095_C04.b : ggttactgaagcttggtgxxxx
LVR01_0105_E05.b : ggggtgttgcgcttagtgxxxx
LVR01_0037_F08.b : ttttggggaxxxx
LVR01_0050_C06.b : ggtttttttttttagcttagtgact
LVR01_0072_D09.b : ggcxxxxxxxxxxxxxx
LVR01_0011_D07.b : gggtgagcttagtgcnxx
LVR01_0037_F03.b : cttxxxxxxxxxxxxx
LVR01_0030_G10.b : xxxxxxxxxxxxx
LVR01_0090_F01.b : gaggcataagtgacta
LVR01_0067_C02.b : ggaatttgggtatacagcttagtgxxxx
LVR01_0071_E11.b : ttgggtgtttcggcttggtgxxxx
LVR01_0054_D12.b : ggcatttggtgxxxxx
LVR01_0066_E06.b : acxxxxxxxxxxxxx
LVR01_0067_C06.b : ctttttatgtaaatctcgcttggtgxxxx
LVR01_0078_A09.b : ggggggttttatttgtttggtgxxxx
LVR01_0048_E12.b : gcttgttcttttaggtctagtgxxx
LVR01_0017_C09.b : cttttggtgaccta
LVR01_0101_E06.b : attxxxxxxxxxxxxx
LVR01_0074_F04.b : gcattttatggtgxxxx
LVR01_0050_F12.b : gtgtgggttttaactgcttagtgac
LVR01_0012_C08.b : gggtttagcattgtgxxxx
LVR01_0099_H11.b : ggcatatggtgcnxxx
LVR01_0004_G07.b : ttttatgtgxxxxx
LVR01_0071_F08.b : tttgtttttttttagcttggtgxxxx
LVR01_0008_C02.b : gagccacggtgaaxx
LVR01_0009_G09.b : cacxxxxxxxxxxxx
LVR01_0049_C03.b : gggggtgtttttatgcttggtgxxx
LVR01_0017_H11.b : gcatttgcgtgcxxxx
LVR01_0068_A07.b : gcattcacgtgxxxxx
LVR01_0008_A06.b : gggcatacgggaxxx
LVR01_0050_G09.b : gcxxxxxxxxxxxx
LVR01_0078_A07.b : gtctctagggtgxxxxx
LVR01_0019_B06.b : cctttttcgtgatxx
LVR01_0048_B07.b : gtgtntgttttcgcttggtgxxx
LVR01_0046_F10.b : gcttttgcgtgcxxxx
LVR01_0067_E03.b : gcatttagggtgcxxx
LVR01_0068_E10.b : gcatgtacggtgcxxx
LVR01_0084_B06.b : ggcatatcgtgxxxx
LVR01_0099_F09.b : catttcxxxxxxxxx
LVR01_0099_F10.b : gggccctggtgxxxx
LVR01_0063_H02.b : aaaaataaaggattggtgxxxx
LVR01_0022_A12.b : gcttttggtgccnxxx
LVR01_0057_C06.b : gggcatgcaaacgtgxxxxxx
LVR01_0061_C04.b : gtaaacctgcttacgtgxxx
LVR01_0094_A10.b : aaatacaggcttxxxxxxxx
LVR01_0078_C05.b : gcatxxxxxxxxxxxxx
LVR01_0098_B12.b : ggcatctggtgacntat
LVR01_0045_H07.b : ccxxxxxxxxxxxxxx
LVR01_0096_H03.b : gggctaaaatcgctttgtgcxxx
LVR01_0044_B05.b : gttgtttaagcttggtgxxxx
LVR01_0016_D12.b : tattgggctttxxxxxxxx
LVR01_0041_A03.b : gaaaaaaggcttcgtgaax
LVR01_0061_H04.b : aataatagctttggtgxxx
LVR01_0078_B04.b : ggcaaatagtgaactatt
LVR01_0083_C02.b : gggcatttxxxxxxx
LVR01_0045_C11.b : ttttttttaggcctcxxxxxxx
LVR01_0103_E01.b : gtgttttcggcatagtgxxxx
LVR01_0094_B02.b : gaaaaaaggcttagtgxxx
LVR01_0079_B06.b : gcxxxxxxxxxxxxxxx
LVR01_0031_F12.b : gcatttxxxxxxxxx
LVR01_0016_G06.b : cttttgggtgxxxxx
LVR01_0104_D07.b : gcggtttcaggattcgtgxxx
LVR01_0100_H02.b : ggctcxxxxxxxxxxxx
LVR01_0028_E07.b : xxxxxxxxxxxx
LVR01_0013_A03.b : gaaataaaagcatacggtgxxxx
LVR01_0074_H09.b : gcxxxxxxxxxxxxxxx
LVR01_0084_F05.b : cxxxxxxxxxxxxx
LVR01_0098_B06.b : tttttttttaagcatagtgxxxx
LVR01_0098_D04.b : gcxxxxxxxxxxxxx
LVR01_0025_B02.b : xxxxxxxxxxxxx
LVR01_0104_C11.b : gtgtttcctagcttagtgaax
LVR01_0051_E09.b : gcattaggtgccta
LVR01_0101_G02.b : tttggcataggtgx
LVR01_0074_C01.b : cttcttgtattaaacgattggtgxxx
LVR01_0060_H08.b : gctttaagcttatgtgxxx
LVR01_0060_H04.b : aaaaaaagcactggtgxxx
LVR01_0068_B04.b : gcxxxxxxxxxxxxxx
LVR01_0026_A06.b : tttggtgxxxxxx
LVR01_0084_F07.b : ctxxxxxxxxxxxxx
LVR01_0073_F05.b : gccattttggatgxxxxx
LVR01_0074_B07.b : gcxxxxxxxxxxxxx
LVR01_0017_G10.b : cattttgggccnx
LVR01_0056_C03.b : gtctxxxxxxxxxxxx
LVR01_0098_B07.b : gccattttggtgxxxxx
LVR01_0008_A12.b : gcattacgtgxxxx
LVR01_0090_B05.b : gcxxxxxxxxxxxxx
LVR01_0071_D05.b : gcattttatggtgxxxx
LVR01_0097_G01.b : ggcatttcgtgncnxxx
LVR01_0017_F04.b : ccattttggtgaccta
LVR01_0072_C08.b : gcxxxxxxxxxxxxxx
LVR01_0044_F12.b : gtatttttagcttggtgcxxx
LVR01_0101_F05.b : gcattttggtgxxxx
LVR01_0046_A03.b : ggtattaacggcttggtgxxx
LVR01_0001_B04.b : xxxxxxxxxxxx
LVR01_0046_G02.b : gggggttaggcttagtgxxx
LVR01_0061_D11.b : tataactagcxxxxxxxxxx
LVR01_0057_E05.b : ccattttggctgacxxx
LVR01_0046_H03.b : gtttttttagcttaxxxxxxx
LVR01_0056_D04.b : ccatattxxxxxxxx
LVRM1_0126_E12.b :
LVRM1_0040_C01.b :
LVRM1_0031_C04.b :
LVRM1_0126_F12.b :
LVRM1_0122_D10.b :
LVR01_0090_E07.b : gcttttggctgac
LVRM1_0087_F12.b :
LVR01_0104_G01.b : tgcttttgctgcatagtgxx
LVR01_0035_F10.b :
LVRM1_0163_C09.b :
LVR01_0055_D10.b : ctttaggt
LVRM1_0142_A08.b :
LVRM1_0002_E10.b :
LVR01_0086_C09.b :
LVRM1_0049_C05.b :
LVRM1_0206_A02.b :
LVRM1_0098_F07.b :
LVR01_0077_H09.b :
LVRM1_0141_F12.b :
LVRM1_0149_C01.b :
LVRM1_0001_A04.b :
LVRM1_0070_G02.b :
LVR01_0010_H04.b :
LVR01_0047_G01.b :
LVRM1_0025_H12.b :
LVRM1_0003_G03.b :
LVRM1_0102_G07.b :
LVRM1_0200_A11.b :
LVRM1_0089_H06.b :
LVRM1_0079_A08.b :
LVRM1_0186_B05.b :
LVRM1_0028_F11.b :
LVRM1_0151_D08.b :
LVR01_0019_B09.b :
LVR01_0087_C01.b :
LVR01_0048_F03.b :
LVR01_0081_D01.b :
LVR01_0054_H04.b :
LVR01_0031_D01.b :
LVR01_0042_D09.b :
LVRM1_0170_A06.b :
LVRM1_0176_D08.b :
LVRM1_0176_B12.b :
LVRM1_0083_A07.b :
LVR01_0060_C06.b :
LVRM1_0207_H06.b :
LVR01_0026_F10.b :
LVR01_0026_E04.b :
LVRM1_0193_G05.b :
LVRM1_0037_C02.b :
LVR01_0046_C07.b :
LVRM1_0051_B07.b :
LVR01_0002_H04.b :
LVR01_0003_H02.b :
LVRM1_0051_D09.b :
LVRM1_0153_A06.b :
LVRM1_0195_D02.b :
LVR01_0073_G05.b :
LVR01_0048_D03.b :
LVRM1_0177_A11.b :
LVRM1_0035_B01.b :
LVRM1_0138_A08.b :
LVRM1_0134_E10.b :
LVRM1_0074_E06.b :
LVR01_0039_G05.b :
LVR01_0078_E08.b :
LVR01_0085_H10.b :
LVRM1_0154_G12.b :
LVRM1_0042_D11.b :
LVRM1_0055_G06.b :
LVRM1_0195_B07.b :
LVRM1_0070_F04.b :
LVRM1_0161_F06.b :
LVRM1_0193_E04.b :
LVRM1_0087_G02.b :
LVR01_0033_A02.b :
LVRM1_0192_C05.b :
LVRM1_0152_A07.b :
LVRM1_0033_D11.b :
LVRM1_0104_C03.b :
LVRM1_0020_F03.b :
LVRM1_0174_A07.b :
LVR01_0013_D04.b :
LVRM1_0083_A03.b :
LVRM1_0122_F08.b :
LVRM1_0156_G07.b :
LVR01_0028_G09.b :
LVR01_0028_H11.b :
LVR01_0008_B05.b :
LVRM1_0119_A07.b :
LVR01_0059_A04.b :
LVR01_0082_D03.b :
LVR01_0074_C06.b :
LVR01_0102_A09.b :
LVR01_0054_A09.b :
LVR01_0099_B10.b :
LVRM1_0172_A12.b :
LVR01_0046_A04.b :
LVRM1_0084_D08.b :
LVR01_0044_F05.b :
LVR01_0003_B11.b :
LVRM1_0092_F05.b :
LVRM1_0023_C12.b :
LVRM1_0142_D02.b :
LVRM1_0052_G08.b :
LVR01_0029_H01.b :
LVR01_0059_C11.b :
LVRM1_0202_E09.b :
LVRM1_0164_C05.b :
LVR01_0073_G10.b :
LVRM1_0144_F01.b :
LVRM1_0189_H05.b :
LVRM1_0090_G05.b :
LVRM1_0166_D09.b :
LVRM1_0081_C04.b :
LVRM1_0134_E02.b :
LVRM1_0069_B03.b :
LVR01_0058_C10.b :
LVRM1_0176_B08.b :
LVRM1_0101_B02.b :
LVRM1_0108_H05.b :
LVRM1_0156_D07.b :
LVRM1_0173_F01.b :
LVRM1_0183_F08.b :
LVRM1_0184_H07.b :
20110601C-012094 : .................................................ATTTGTTGGCC
---------+---------+---------+---------+---------+---------+ 11
LVRM1_0001_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxATTTGTTGGCC
LVRM1_0183_C08.b : gtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtTGGCC
LVRM1_0116_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggcctactggGGCC
LVRM1_0108_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttgtGGCC
LVR01_0077_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGCC
LVRM1_0028_F10.b : cgttgacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
LVR01_0008_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0056_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0089_E01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0084_B06.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0099_A06.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_B07.b : attgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtt
LVRM1_0070_B05.b : tagtttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0156_F10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0027_A08.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_B07.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0111_B11.b : ccgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_F07.b : agttgaataaagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0011_G12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0014_F11.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxt
LVR01_0033_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_B10.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0094_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0007_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0180_D02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0174_D06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0008_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_E09.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_F07.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0075_H11.b : cgttgacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0120_F10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0093_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_C03.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0087_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0085_E11.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0011_H08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0095_B09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0197_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0189_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0168_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0182_C05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0194_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0118_A05.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_C07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxx
LVRM1_0188_D02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0048_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0110_C01.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0170_G06.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0082_D05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0097_G11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0201_F08.b : gggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0150_E03.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0125_G07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0118_C11.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0016_C04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0137_H01.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0122_B09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_A10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0080_G02.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_D03.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0070_C09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0137_C12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0011_D10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0123_E07.b : ncgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_E08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0002_B06.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0020_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0047_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0079_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0005_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_G03.b : tatcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0014_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0085_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_F01.b : agacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0002_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0093_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0018_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0010_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0100_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0198_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0187_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0122_C05.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0009_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0123_F06.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0140_C09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0086_A11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0004_G12.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0051_D03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0160_B04.b : ccctttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0163_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_G01.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_A12.b : xxxxxxxxxxxxxxxxxxx
LVRM1_0004_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0115_A05.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_F02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0036_A02.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0082_C08.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0070_H07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0105_H03.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0054_D11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_H06.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0103_A06.b : taattgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0070_E12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0102_A10.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0098_D07.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0097_D06.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0101_D02.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0147_G01.b : cgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_B11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0117_E09.b : naatttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0030_C04.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_F07.b : acgtgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0112_C11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0079_F05.b : gttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0032_D04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0018_A07.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0151_C09.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_C08.b : agttgacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0158_E12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0064_H03.b : agatttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0036_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0053_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0059_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_G04.b : nxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0059_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0053_E03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0192_A07.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0085_E10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0196_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0096_C04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_A03.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_H05.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0189_E10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0118_B07.b : ncctgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0055_G02.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_H07.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0084_B12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_A07.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0153_H07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0137_F02.b : cgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_B10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_C09.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtggggttgggatgtagca
LVRM1_0137_A11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0052_G09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0119_C11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0002_B09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0025_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0065_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0005_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_B01.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0058_D04.b : ctagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0007_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0183_H11.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0107_G01.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0204_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0096_A11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0052_H05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0092_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_C01.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0207_C05.b : gggxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0202_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0199_F03.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_F05.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0051_E01.b : tagttgtcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0199_G05.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0094_A11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0011_D01.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_E03.b : cgttgacaatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0061_C10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0130_B09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0130_G09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0154_C12.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_D04.b : actagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0020_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0002_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0174_B07.b : cagttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0048_C09.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0087_A03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0061_B02.b : nnnnnntcagtttgncxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_C10.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_H02.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0167_D07.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0091_A04.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0163_H11.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_C09.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0044_D08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0085_A03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0061_E01.b : ggaccaccaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0168_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0061_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_E11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0062_E10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0136_B03.b : ncagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0086_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0174_A01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0083_F08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0172_A03.b : caattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0165_D06.b : aattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0173_G09.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0175_A09.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_A04.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0003_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0045_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0011_F04.b : caattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_G02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_F11.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0065_A11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0162_A04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_C02.b : ttaaagactgcattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_C11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0004_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0188_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0192_D04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_B02.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0088_H10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0092_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0020_F05.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0053_C01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_H05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0192_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0125_H05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0055_F03.b : tagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0018_G01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0087_G12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0183_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0084_F09.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0192_C03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_A01.b : cccttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0186_F05.b : xxxxxxxxxxxxxxxx
LVRM1_0043_B07.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0180_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0208_C02.b : xxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0057_C05.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0064_C12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0189_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0124_E01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0076_D11.b : cgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0196_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0181_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0057_H11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0085_E02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0179_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0050_E11.b : gagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0055_A01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0094_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0087_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0094_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0081_G03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0092_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_B04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0003_F01.b : xxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_E01.b : ccgttgtcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_A02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0207_A03.b : gggxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0181_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0181_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0185_B11.b : xxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0085_B10.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0166_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0195_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0082_D01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0175_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0094_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0100_F02.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0100_E03.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_A01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0100_F04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_G06.b : ttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0115_E02.b : cagtgcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0170_A05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_E04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0195_H01.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0184_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0113_E04.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_C03.b : cgttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_B02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0173_E11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_E06.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0103_H07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0115_D03.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0007_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0061_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_G01.b : ncgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0112_D02.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0189_A03.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0020_B12.b : acgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0037_H04.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_E05.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0123_C06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0172_B03.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0029_A04.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0100_A08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0100_B07.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0101_F09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0099_G02.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0100_D02.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0020_A12.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0118_D03.b : ncctgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_B08.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_F01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0009_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0198_F02.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_D04.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0189_D07.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0022_B01.b : cxxxxxxxxxxxxxxxxx
LVRM1_0037_A06.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0096_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0108_E02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0199_H03.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_B05.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0136_D11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_H04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0091_C05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0091_H09.b : ctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_F12.b : ncgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_D06.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0136_H12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0054_F12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0055_F12.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0101_A05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0065_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0130_A06.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0082_G06.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0207_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_B01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0097_E05.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0112_F01.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0117_A07.b : naattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_C05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_B06.b : gtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0158_C12.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_H11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0026_E08.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0117_G02.b : taatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0186_A12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0197_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0114_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_H06.b : gcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_C05.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0204_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_D12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0082_G12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0104_A06.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0037_A12.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0125_F01.b : nagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0205_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0163_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_F01.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0191_F10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0114_H12.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0036_E05.b : gcgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_B11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_D05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0043_F11.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_H03.b : cgttgacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0085_F10.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0133_F08.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0061_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_E06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0136_A04.b : cagttgtcnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_B12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0043_F08.b : gtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0201_H09.b : gggtxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0102_A06.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0104_E12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_G12.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0098_D05.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0014_G10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0089_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0030_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_B07.b : gcgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_A02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_E07.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0070_C11.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0012_D05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0053_B05.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_G01.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_D01.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0088_C06.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0086_E09.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_C03.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0109_C04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_H10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_H06.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0153_A05.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0082_D12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_F06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0054_G11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0057_C10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0089_F10.b : ttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0165_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0199_A09.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0003_B07.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0003_A03.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_C07.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_A12.b : ncgtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0075_A11.b : cgttgaatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0065_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_B08.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0004_F06.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0108_B02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0073_A10.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0074_D05.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0154_H03.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_F10.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0117_C11.b : cgtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0065_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_H09.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0147_A08.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_E10.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_C08.b : ncctttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0032_H02.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0151_H04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0014_B06.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0153_F12.b : tcacaattctgcattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0105_C09.b : ncctgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_B09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_G11.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0161_H07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0172_D11.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_H08.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0071_F10.b : ncgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0079_C03.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0105_E12.b : acctgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0116_F09.b : ncgtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0087_D11.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_C10.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0036_E09.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0171_B12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0102_A12.b : agtttcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0014_B05.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0151_F04.b : tagttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0012_F06.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0050_F01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0053_G12.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0117_H09.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0156_H06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0008_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_A09.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0022_C07.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0007_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0017_F01.b : aagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0148_G02.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0151_B01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_E07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0080_F05.b : cgttgacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0065_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_F04.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_D05.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0142_C01.b : ccagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0103_H03.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0143_A04.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0079_D07.b : nnnatnnnanccgatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0058_H01.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_C05.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_D04.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0022_D05.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0159_D08.b : ttttgnacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_F07.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_H01.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0030_G04.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_B12.b : gcgttgtcatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_B06.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0155_H07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0111_F06.b : taatttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0022_F08.b : acgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0051_G02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0109_H01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0111_D03.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_F04.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_D06.b : cgttgatcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0041_E05.b : tatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0007_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_D08.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_C10.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0140_G01.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0150_E10.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_A10.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0156_C11.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0173_E10.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0139_A06.b : ncgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0151_E10.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0153_B11.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0154_F10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0122_A12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0134_E11.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0148_G11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0092_H07.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_E10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0030_G01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0001_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_C10.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_H05.b : ncagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_H07.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0058_G11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0127_G08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0015_H08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0110_E10.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0120_G06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0124_F06.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0124_A10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_H10.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0110_A10.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0119_G11.b : nagtttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0101_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0012_F10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0015_G12.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0160_B09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0016_A11.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_C10.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0139_F10.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_G08.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_F10.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0050_F10.b : tcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0144_C11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_D10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0143_F09.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0157_E09.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_E09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_B07.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0001_B04.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0063_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0138_C08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0140_B09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0139_E12.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_B06.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0006_F10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0125_E08.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0142_D12.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0006_G03.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0130_E08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0001_F10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0001_H12.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0019_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0040_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0026_A01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0005_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0039_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0026_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_F06.b : atatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0079_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_B03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0047_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0047_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0039_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0053_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_H12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0022_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0087_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0085_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0026_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0063_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0014_B09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0041_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0022_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0055_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0043_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0022_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0015_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0002_G01.b : nntagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0052_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0102_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0029_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0081_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0052_B02.b : tatagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0085_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0082_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0089_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0002_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0057_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0053_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0062_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0059_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0052_H07.b : ntagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0033_G03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0009_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0088_H01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0092_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0047_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0059_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0079_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_G04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0025_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0038_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0092_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0095_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0105_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0011_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0037_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_F01.b : tanngacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0054_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0066_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_C09.b : nntagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_E06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_F12.b : txxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0012_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0004_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0009_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0049_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_H11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0050_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0019_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0048_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0067_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0099_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0063_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0022_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0057_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_B12.b : anngacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_H07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0041_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0078_B04.b : agacaagtccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0083_C02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0045_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0103_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0094_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0079_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0031_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_G06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0100_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0028_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0013_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0025_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0051_E09.b : nntagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0060_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0026_A06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0084_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0074_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0056_C03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0098_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0008_A12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0071_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0097_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_F04.b : nntagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0072_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0044_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0101_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0001_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0061_D11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0057_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0046_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0056_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_E12.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_C01.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0126_F12.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0122_D10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0090_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0087_F12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0104_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0035_F10.b : ctctcgggtcctc
LVRM1_0163_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0055_D10.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0142_A08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0002_E10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0086_C09.b : gcttagggtgxxxxxxxxxx
LVRM1_0049_C05.b :
LVRM1_0206_A02.b :
LVRM1_0098_F07.b :
LVR01_0077_H09.b :
LVRM1_0141_F12.b :
LVRM1_0149_C01.b :
LVRM1_0001_A04.b :
LVRM1_0070_G02.b :
LVR01_0010_H04.b :
LVR01_0047_G01.b :
LVRM1_0025_H12.b :
LVRM1_0003_G03.b :
LVRM1_0102_G07.b :
LVRM1_0200_A11.b :
LVRM1_0089_H06.b :
LVRM1_0079_A08.b :
LVRM1_0186_B05.b :
LVRM1_0028_F11.b :
LVRM1_0151_D08.b :
LVR01_0019_B09.b :
LVR01_0087_C01.b :
LVR01_0048_F03.b :
LVR01_0081_D01.b :
LVR01_0054_H04.b :
LVR01_0031_D01.b :
LVR01_0042_D09.b :
LVRM1_0170_A06.b :
LVRM1_0176_D08.b :
LVRM1_0176_B12.b :
LVRM1_0083_A07.b :
LVR01_0060_C06.b :
LVRM1_0207_H06.b :
LVR01_0026_F10.b :
LVR01_0026_E04.b :
LVRM1_0193_G05.b :
LVRM1_0037_C02.b :
LVR01_0046_C07.b :
LVRM1_0051_B07.b :
LVR01_0002_H04.b :
LVR01_0003_H02.b :
LVRM1_0051_D09.b :
LVRM1_0153_A06.b :
LVRM1_0195_D02.b :
LVR01_0073_G05.b :
LVR01_0048_D03.b :
LVRM1_0177_A11.b :
LVRM1_0035_B01.b :
LVRM1_0138_A08.b :
LVRM1_0134_E10.b :
LVRM1_0074_E06.b :
LVR01_0039_G05.b :
LVR01_0078_E08.b :
LVR01_0085_H10.b :
LVRM1_0154_G12.b :
LVRM1_0042_D11.b :
LVRM1_0055_G06.b :
LVRM1_0195_B07.b :
LVRM1_0070_F04.b :
LVRM1_0161_F06.b :
LVRM1_0193_E04.b :
LVRM1_0087_G02.b :
LVR01_0033_A02.b :
LVRM1_0192_C05.b :
LVRM1_0152_A07.b :
LVRM1_0033_D11.b :
LVRM1_0104_C03.b :
LVRM1_0020_F03.b :
LVRM1_0174_A07.b :
LVR01_0013_D04.b :
LVRM1_0083_A03.b :
LVRM1_0122_F08.b :
LVRM1_0156_G07.b :
LVR01_0028_G09.b :
LVR01_0028_H11.b :
LVR01_0008_B05.b :
LVRM1_0119_A07.b :
LVR01_0059_A04.b :
LVR01_0082_D03.b :
LVR01_0074_C06.b :
LVR01_0102_A09.b :
LVR01_0054_A09.b :
LVR01_0099_B10.b :
LVRM1_0172_A12.b :
LVR01_0046_A04.b :
LVRM1_0084_D08.b :
LVR01_0044_F05.b :
LVR01_0003_B11.b :
LVRM1_0092_F05.b :
LVRM1_0023_C12.b :
LVRM1_0142_D02.b :
LVRM1_0052_G08.b :
LVR01_0029_H01.b :
LVR01_0059_C11.b :
LVRM1_0202_E09.b :
LVRM1_0164_C05.b :
LVR01_0073_G10.b :
LVRM1_0144_F01.b :
LVRM1_0189_H05.b :
LVRM1_0090_G05.b :
LVRM1_0166_D09.b :
LVRM1_0081_C04.b :
LVRM1_0134_E02.b :
LVRM1_0069_B03.b :
LVR01_0058_C10.b :
LVRM1_0176_B08.b :
LVRM1_0101_B02.b :
LVRM1_0108_H05.b :
LVRM1_0156_D07.b :
LVRM1_0173_F01.b :
LVRM1_0183_F08.b :
LVRM1_0184_H07.b :
20110601C-012094 : TACT*GGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
---------+---------+---------+---------+---------+---------+ 66
LVRM1_0001_A11.b : TACT*GGA**ATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0183_C08.b : TACT*GGA**ATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0116_A07.b : TACT*GGA**ATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0108_H09.b : TACTGGGA**TTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0077_E10.b : TACT*GGA**ATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0028_F10.b : TACT*GGA**ATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0008_E12.b : TACT*GGA**ATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0056_H05.b : gACT*GGA**ATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0089_E01.b : xxCT*GGA**TTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0084_B06.b : xxCTGGGA***TTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0099_A06.b : xxCT*GGA**ATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0106_B07.b : ggCT*GGA**TTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0070_B05.b : xxCT*GGA**ATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0156_F10.b : ctGGGGCA**ATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0027_A08.b : ctggTGGA**ATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0039_B07.b : xxxxGGGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0111_B11.b : xxxxGGGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0077_F07.b : xxxxGGGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0011_G12.b : xxxxGGGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0014_F11.b : ggggGAGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0033_D07.b : xxxgTGGA**ATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0106_G05.b : xactGGGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0089_E09.b : xxxxGAGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0176_B10.b : xxxxxGGA**ATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0094_E07.b : xxxxtGGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0007_B08.b : xxxxxGGA**ATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0180_D02.b : xxxxgGGA**ATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0174_D06.b : xxxxxGGA**ATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0008_H12.b : xxxxxGGA**ATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0035_E09.b : xxxxxGGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0146_F07.b : xxxctGGAAAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0075_H11.b : xxxxxGGA**TTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0120_F10.b : xxxxxGGA**ATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0093_A09.b : xxxxxGGA**ATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0098_H09.b : xxxxxGGA**ATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0049_C03.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0087_H04.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0093_E11.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0085_E11.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0011_H08.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0095_B09.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0197_D03.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0189_D01.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0168_D01.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0182_C05.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0194_E08.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0118_A05.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0077_C07.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0188_D02.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0048_H06.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0110_C01.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0170_G06.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0082_D05.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0097_G11.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0201_F08.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0150_E03.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0125_G07.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0118_C11.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0016_C04.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0087_E11.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0137_H01.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0122_B09.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0144_A10.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0080_G02.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0019_D03.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0070_C09.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0137_C12.b : xxxxxxGACAATTCCTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0011_D10.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0123_E07.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0121_E08.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0002_B06.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0020_F12.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0047_A01.b : xxxxxxGACAATTCCTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0103_D11.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0084_A03.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0077_E08.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0079_G02.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0005_F03.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0048_F12.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0054_G03.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0016_D01.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0091_H12.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0014_A12.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0085_B10.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0017_D11.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0011_E11.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0048_B08.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0083_H02.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0017_F01.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0002_A05.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0093_D03.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0018_A10.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0072_F05.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0073_D02.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0090_A07.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0010_H10.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0077_A06.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0100_A02.b : xxxxxxGACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0198_E05.b : xxxxxxxACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0187_F12.b : xxxxxxxACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0122_C05.b : xxxxxxxACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0009_C10.b : xxxtaacACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0123_F06.b : xxxxxxxACAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0140_C09.b : xxxxxxxGGAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0031_G10.b : xxxxxxxGGAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0086_A11.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0004_G12.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0051_D03.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0160_B04.b : xxxxxxxxGGATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0163_B04.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0200_G01.b : xxxxxttcCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0093_A12.b : xxxxxxctGGATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0004_E09.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0115_A05.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0176_F02.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0036_A02.b : xxxxxxgtCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0082_C08.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0070_H07.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0105_H03.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0054_D11.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0038_H06.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0103_A06.b : xxxxxxxxGAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0070_E12.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0102_A10.b : xxxxxxxxGAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0098_D07.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0097_D06.b : xxxxxxxxGAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0101_D02.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0147_G01.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0164_B11.b : xxxxxxxxGAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0117_E09.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0030_C04.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0078_F07.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0112_C11.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0079_F05.b : xxxxxxxxGAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0032_D04.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0018_A07.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0151_C09.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0077_C08.b : xxxxxxxxCAATTCTTT*CCTCCAGCGGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0158_E12.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0064_H03.b : xxxxxxxxGAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0036_G01.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0077_H04.b : xxxxxxgaGAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0030_F06.b : xxxxxxxxGAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0038_B11.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0060_B06.b : xxxxxxxtGGATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0048_G02.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0054_G09.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0053_C11.b : xxxxxxctGGATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0106_C12.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0091_G03.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0067_D05.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTACTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0096_F11.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0034_A04.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0011_C12.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0059_F01.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0061_E01.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0048_D06.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0073_G04.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0067_E11.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0016_B09.b : xxxxxxxxGAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0099_H10.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0059_C04.b : xxxxxxxxCAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0053_E03.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0192_A07.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0085_E10.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0196_H02.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0096_C04.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0038_A03.b : xxxxxxxxtTCTTCTTT*CCTCCAACAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0038_H05.b : xxxxxxxxtAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0189_E10.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0118_B07.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0055_G02.b : xxxxxxxxtAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0034_H07.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0084_B12.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0031_A07.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0153_H07.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0137_F02.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0145_B10.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0149_C09.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0034_G09.b : gcnggagacAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0137_A11.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0052_G09.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0119_C11.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0002_B09.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0060_C11.b : xxxxxxxxxATTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0025_D06.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0087_D11.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0049_A12.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0065_H02.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0102_B04.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0005_G11.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*GGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0097_B04.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0051_B01.b : xxxxxxxxxAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0066_D10.b : xxxxxtggtAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0058_D04.b : xxxxxxxxaAATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0007_B02.b : xxxxxxxxxxTTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0183_H11.b : xxxxxxxxxxTTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0107_G01.b : xxxxxxxxxxTTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0204_E01.b : xxxxxxxxxxTTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0096_A11.b : xxxxxxxxtcATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0052_H05.b : xxxxxxxxxxTTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0092_H05.b : xxxxxxxxxxTTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0200_C01.b : xxxxxxxxxtTTTCTTT*CCTCCAACAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0207_C05.b : xxxxxxxxxtATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0202_H01.b : xxxxxxxxxxATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0199_F03.b : xxxxxxxxxcATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0200_F05.b : xxxxxxxxtcATTCTTT*CCTCAAAAAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0051_E01.b : xxxxxxxxxxTTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0199_G05.b : xxxxxxxxxcATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0094_A11.b : xxxxxxxxxxTTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0011_D01.b : xxxxxxxxxxTTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0077_E03.b : xxxxxxxxxxTTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0061_C10.b : xxxxxxxxxxTTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0130_B09.b : xxxxxxxxxxTTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0130_G09.b : xxxxxxxxxxTTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0154_C12.b : xxxxxxxxxtATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0033_C11.b : xxxxxxxxxxTTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0054_D04.b : xxxxxxxxxxTTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0020_A08.b : xxxxxxxxxxTTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0002_D12.b : xxxxxxxxxxATTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0078_F03.b : xxxxxxxxxxTTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0174_B07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0048_C09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0087_A03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0061_B02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0164_C10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0049_H02.b : xxxxxxxxxtcTTCTTT*CCTCCAGAAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0167_D07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0091_A04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0163_H11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0164_C09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCC*ACCC*C
LVRM1_0044_D08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0085_A03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0061_E01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0168_B06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0061_F10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0091_B01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0176_E11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0062_E10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0136_B03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0086_C11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0174_A01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0083_F08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0172_A03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0165_D06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0173_G09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0175_A09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0146_A04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0003_B01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0045_H12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0011_F04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0176_G02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0149_F11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0065_A11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0162_A04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0078_C02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0082_H04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0157_C11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0004_F02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0188_H07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0192_D04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0019_B02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0088_H10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0092_C12.b : xxxxxxxxxxcTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0020_F05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0053_C01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0145_H05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0192_D02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0125_H05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*GGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0055_F03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0018_G01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0087_G12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0183_D01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0084_F09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0192_C03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0149_A01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0186_F05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0043_B07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0180_E02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0208_C02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0057_C05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0064_C12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0189_E02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0124_E01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0076_D11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0196_E01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0181_D03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0057_H11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0085_E02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0179_E03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0050_E11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAAG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0055_A01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAAG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0094_F01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0087_E02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0094_A09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0081_G03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0092_E05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0126_B04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0164_G03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0003_F01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0040_E01.b : xxxxxxxxxtcTTCTTT*CCTCCAACAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0164_F02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0146_A02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0207_A03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0181_E11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0181_H05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0185_B11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0093_F06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0085_B10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTTCG*GAGCGAGCCCCACCC*C
LVRM1_0166_E08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0195_G07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0082_D01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0175_D02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0094_H06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0100_F02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0100_E03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0176_A01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0100_F04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0047_G06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0115_E02.b : xxxxxxxxxxxTTCTTC*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0170_A05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0176_E04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGGGCCCCACCC*C
LVRM1_0195_H01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0184_B03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0113_E04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0093_C03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0093_B02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0173_E11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0038_E06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0103_H07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0115_D03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0007_H01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0061_F05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0039_G01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0112_D02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0189_A03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0176_A12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0020_B12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0037_H04.b : xxxxxxxxxxcTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0038_E05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0123_C06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0172_B03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0029_A04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0100_A08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0100_B07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0101_F09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0099_G02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0100_D02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0020_A12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0118_D03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0164_B08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0176_F01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0009_H04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0198_F02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0106_D04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0189_D07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0022_B01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0037_A06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0096_D08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0108_E02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0199_H03.b : xxxxxxxxxtcTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0038_B05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0136_D11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0047_H04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0091_C05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0091_H09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0149_F12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0121_D06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0136_H12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0054_F12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0055_F12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0101_A05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0065_D08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0130_A06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0082_G06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0207_A07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0039_B01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0097_E05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0112_F01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0117_A07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0128_C05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0047_B06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0158_C12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0145_H11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0026_E08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0117_G02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0186_A12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0197_F08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0114_D11.b : xxxxxxxxxxxTTCTTTTCCTCCAGCAGGGAGTGCTCCTCCNGGAGCGAGCCCCACCCCT
LVRM1_0040_H06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0146_C05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0204_F09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0145_D12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0082_G12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0104_A06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0037_A12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0125_F01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0205_D11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0163_E10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0033_F01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0191_F10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0114_H12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0036_E05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0039_B11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0176_D05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0043_F11.b : xxxxxggatggTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0074_H03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0085_F10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0133_F08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0061_B05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0121_E06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0136_A04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0145_B12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0043_F08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0201_H09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0102_A06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0104_E12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0039_G12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0098_D05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0014_G10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0089_E12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0030_F04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0033_B07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0031_A02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0035_E07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCTG*GAGCGAGCCCCACCC*C
LVRM1_0070_C11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0012_D05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0053_B05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0074_G01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0077_D01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0088_C06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0086_E09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0034_C03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0109_C04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0128_H10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0074_H06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0153_A05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0082_D12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0034_F06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0054_G11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0057_C10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0089_F10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0165_B12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0199_A09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0003_B07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0003_A03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0074_C07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0106_A12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0075_A11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0065_E07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0121_B08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0004_F06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0108_B02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0073_A10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0074_D05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0154_H03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0164_F10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0117_C11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0065_B06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0039_H09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0147_A08.b : xxxxxxxxxxxCTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0200_E10.b : xxxxxxxxtacTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0106_C08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0032_H02.b : xxxxxxxxxxxTTCCTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0151_H04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0014_B06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0153_F12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0105_C09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0146_B09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0033_G11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0161_H07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0172_D11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0200_H08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0071_F10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0079_C03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0105_E12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0116_F09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0087_D11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0200_C10.b : xxxxxxxxxxcTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0036_E09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGCGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0171_B12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0102_A12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0014_B05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0151_F04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0012_F06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0050_F01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0053_G12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0117_H09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0156_H06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0008_D10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0019_A09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGTGCCCCACCC*C
LVRM1_0022_C07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0007_D10.b : xxxxxxxxxxxTTCTTT*CCTCCGGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0017_F01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0148_G02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0151_B01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0157_E07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0080_F05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0065_G11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0049_F04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0033_D05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0142_C01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0103_H03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0143_A04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0035_H11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCC*GAGCGAGCCCCACCC*C
LVRM1_0079_D07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0058_H01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0144_C05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0144_D04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0022_D05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCGGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0159_D08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0126_F07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0128_H01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0030_G04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0033_B12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0144_B06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0155_H07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0111_F06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0022_F08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0051_G02.b : xxxxxxxxxtcTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0109_H01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0111_D03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0019_F04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0077_D06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0041_E05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0007_C11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0034_D08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0035_C10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0140_G01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0150_E10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0021_A10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0156_C11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0173_E10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0038_B07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCC*GAGCGAGCCCCACCC*C
LVRM1_0139_A06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0151_E10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0153_B11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0154_F10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0122_A12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0134_E11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0148_G11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
OVRM1_0092_H07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCA*GAGCGAGCCCCACCC*C
LVRM1_0021_E10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0030_G01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0001_B12.b : xxxxxxxxxxxTTCTTT*CCCCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0033_C10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0144_H05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0078_H07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0058_G11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0127_G08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0015_H08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0110_E10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0120_G06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0124_F06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0124_A10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0021_H10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0110_A10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0119_G11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0101_G11.b : xxxxxxxxxxxTTCTTTTCCTCCAGCAGGGAGTGCTCCTCCGNGAGCGAGCCCCACCCNC
LVRM1_0012_F10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0015_G12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0160_B09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0016_A11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGGCCCACCC*C
LVRM1_0149_C10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0139_F10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0146_G08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0149_F10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0050_F10.b : xxxxxxxxxxxTTCTTC*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0144_C11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0149_D10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0143_F09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0157_E09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0128_E09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0149_B07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0001_B04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0063_A07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0138_C08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0140_B09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0139_E12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0121_B06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0006_F10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0125_E08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0142_D12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0006_G03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0130_E08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0001_F10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0001_H12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0040_D06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0078_F04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0015_D07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0028_F10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0035_H09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0019_E09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0035_H12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0033_F09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0040_F09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0043_F06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0033_B07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0043_E09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0026_A01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTTCG*GAGCGAGCCCCACCC*C
LVR01_0005_D07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0039_F10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0026_D10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0095_E07.b : xxxxxxxxxxgTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0066_C09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0051_F06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0102_D07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0087_E07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0060_E05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0071_G02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0079_H02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0071_B03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0082_H10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0047_E11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0038_E10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0035_A11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0034_F12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0037_G02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0038_E04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0083_A06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0047_H08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0094_G11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0088_H11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0098_A10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0098_B01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0049_F09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0039_G04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0053_B04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0068_H12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0031_H09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0022_F06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0003_H09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0082_D01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0087_A08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0086_D08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GGGCGAGCCCCACCC*C
LVR01_0085_E09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0026_C09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0028_A04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0063_E06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0015_F02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0088_C04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0014_B09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0031_D10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0086_D07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0041_F02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0066_F12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0073_C06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0035_C02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0084_D01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0083_C12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0022_C06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0062_F01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0038_B02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0074_A12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0049_E01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0072_G01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0095_C05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0029_A09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0067_C08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0096_C07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0055_F10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0033_F12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0049_D08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0043_G10.b : xxxxxxxxxxxTTCTTT*CCCCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0022_E03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0071_A05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0054_C09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*T
LVR01_0089_H05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0015_B10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0002_G01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0044_H10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0052_G05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0102_H11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0029_B01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0081_C09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0052_B02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0085_H08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0082_C09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0072_F12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0089_G10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0002_E07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0095_B01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0057_A07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0016_H11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0053_H10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0062_F05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0059_E03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0052_H07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0033_G03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0009_G11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0086_B05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0048_F10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0088_H01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0092_C03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0101_D08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0028_H07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0012_C07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0083_D10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0031_A10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0047_A10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0091_E12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0028_F12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0035_A03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0059_H05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0079_F09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0078_G04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0025_B05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0038_E11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0092_E01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0044_H05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0091_E09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0095_C04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0105_E05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0037_F08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0050_C06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0072_D09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0011_D07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0037_F03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0030_G10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0090_F01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0067_C02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0071_E11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0054_D12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0066_E06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0067_C06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0078_A09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0048_E12.b : xxxxxxxxxxxTTCTTT*CCTCCAGTAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0017_C09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0101_E06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0074_F04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0050_F12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0012_C08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0099_H11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0004_G07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0071_F08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0008_C02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0009_G09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0049_C03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0017_H11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0068_A07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0008_A06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0050_G09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0078_A07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0019_B06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0048_B07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0046_F10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0067_E03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0068_E10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0084_B06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0099_F09.b : xxxxxxxxxxxTTCTCT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0099_F10.b : xxxxxxxxxxxTTCTCT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0063_H02.b : xxxxxxxxxxgTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0022_A12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0057_C06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0061_C04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0094_A10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0078_C05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0098_B12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0045_H07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0096_H03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0044_B05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0016_D12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0041_A03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0061_H04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0078_B04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0083_C02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0045_C11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0103_E01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0094_B02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0079_B06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0031_F12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0016_G06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0104_D07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0100_H02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0028_E07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0013_A03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0074_H09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0084_F05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0098_B06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0098_D04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0025_B02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0104_C11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0051_E09.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0101_G02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0074_C01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0060_H08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0060_H04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0068_B04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0026_A06.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0084_F07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0073_F05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0074_B07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0017_G10.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0056_C03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0098_B07.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0008_A12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0090_B05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0071_D05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0097_G01.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0017_F04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0072_C08.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0044_F12.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0101_F05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0046_A03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0001_B04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0046_G02.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0061_D11.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0057_E05.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGCGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0046_H03.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0056_D04.b : xxxxxxxxxxxTTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0126_E12.b : xxxxxxxxxtacTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0040_C01.b : xxxxxxxxxtccTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0031_C04.b : xxxxxxxxxxxcTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0126_F12.b : xxxxxxxxxxtcTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0122_D10.b : xxxxxxxxxxggTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0090_E07.b : xxxxxxxxxxxxTCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0087_F12.b : xxxxxxxxxxxtcCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0104_G01.b : xxxxxxxxxctggCTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0035_F10.b : atcttggaattcctTTT*CCTCCAGCAGAAAGTGCTCCTTCCGGAGCGAGCCCCACCC*C
LVRM1_0163_C09.b : xxxxxxxxxxxxxgTTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVR01_0055_D10.b : xxxxxxxxxxxxxxxTT*CCTCCAGCAGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0142_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxGG*AGTGCTCCTCCG*GAGCGAGCCCCACCC*C
LVRM1_0002_E10.b : xxxxxxxxxxxxxtgattcactccgttgttactgctgctgcggagctGAGCCCCACCC*C
LVR01_0086_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_C05.b : taattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0206_A02.b : cgggcgggagtgggcgtccggagcgagcgcctgcggt
LVRM1_0098_F07.b : cgttgtcxxxxxxxxxxxxx
LVR01_0077_H09.b : cctxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0141_F12.b :
LVRM1_0149_C01.b :
LVRM1_0001_A04.b :
LVRM1_0070_G02.b :
LVR01_0010_H04.b :
LVR01_0047_G01.b :
LVRM1_0025_H12.b :
LVRM1_0003_G03.b :
LVRM1_0102_G07.b :
LVRM1_0200_A11.b :
LVRM1_0089_H06.b :
LVRM1_0079_A08.b :
LVRM1_0186_B05.b :
LVRM1_0028_F11.b :
LVRM1_0151_D08.b :
LVR01_0019_B09.b :
LVR01_0087_C01.b :
LVR01_0048_F03.b :
LVR01_0081_D01.b :
LVR01_0054_H04.b :
LVR01_0031_D01.b :
LVR01_0042_D09.b :
LVRM1_0170_A06.b :
LVRM1_0176_D08.b :
LVRM1_0176_B12.b :
LVRM1_0083_A07.b :
LVR01_0060_C06.b :
LVRM1_0207_H06.b :
LVR01_0026_F10.b :
LVR01_0026_E04.b :
LVRM1_0193_G05.b :
LVRM1_0037_C02.b :
LVR01_0046_C07.b :
LVRM1_0051_B07.b :
LVR01_0002_H04.b :
LVR01_0003_H02.b :
LVRM1_0051_D09.b :
LVRM1_0153_A06.b :
LVRM1_0195_D02.b :
LVR01_0073_G05.b :
LVR01_0048_D03.b :
LVRM1_0177_A11.b :
LVRM1_0035_B01.b :
LVRM1_0138_A08.b :
LVRM1_0134_E10.b :
LVRM1_0074_E06.b :
LVR01_0039_G05.b :
LVR01_0078_E08.b :
LVR01_0085_H10.b :
LVRM1_0154_G12.b :
LVRM1_0042_D11.b :
LVRM1_0055_G06.b :
LVRM1_0195_B07.b :
LVRM1_0070_F04.b :
LVRM1_0161_F06.b :
LVRM1_0193_E04.b :
LVRM1_0087_G02.b :
LVR01_0033_A02.b :
LVRM1_0192_C05.b :
LVRM1_0152_A07.b :
LVRM1_0033_D11.b :
LVRM1_0104_C03.b :
LVRM1_0020_F03.b :
LVRM1_0174_A07.b :
LVR01_0013_D04.b :
LVRM1_0083_A03.b :
LVRM1_0122_F08.b :
LVRM1_0156_G07.b :
LVR01_0028_G09.b :
LVR01_0028_H11.b :
LVR01_0008_B05.b :
LVRM1_0119_A07.b :
LVR01_0059_A04.b :
LVR01_0082_D03.b :
LVR01_0074_C06.b :
LVR01_0102_A09.b :
LVR01_0054_A09.b :
LVR01_0099_B10.b :
LVRM1_0172_A12.b :
LVR01_0046_A04.b :
LVRM1_0084_D08.b :
LVR01_0044_F05.b :
LVR01_0003_B11.b :
LVRM1_0092_F05.b :
LVRM1_0023_C12.b :
LVRM1_0142_D02.b :
LVRM1_0052_G08.b :
LVR01_0029_H01.b :
LVR01_0059_C11.b :
LVRM1_0202_E09.b :
LVRM1_0164_C05.b :
LVR01_0073_G10.b :
LVRM1_0144_F01.b :
LVRM1_0189_H05.b :
LVRM1_0090_G05.b :
LVRM1_0166_D09.b :
LVRM1_0081_C04.b :
LVRM1_0134_E02.b :
LVRM1_0069_B03.b :
LVR01_0058_C10.b :
LVRM1_0176_B08.b :
LVRM1_0101_B02.b :
LVRM1_0108_H05.b :
LVRM1_0156_D07.b :
LVRM1_0173_F01.b :
LVRM1_0183_F08.b :
LVRM1_0184_H07.b :
20110601C-012094 : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
---------+---------+---------+---------+---------+---------+ 125
LVRM1_0001_A11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0183_C08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0116_A07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0108_H09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0077_E10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0028_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0008_E12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0056_H05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0089_E01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0084_B06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0099_A06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0106_B07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0070_B05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0156_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0027_A08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0039_B07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0111_B11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0077_F07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0011_G12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0014_F11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGATGGGCACAGTT
LVR01_0033_D07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0106_G05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0089_E09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0176_B10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0094_E07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0007_B08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0180_D02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0174_D06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0008_H12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0035_E09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0146_F07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0075_H11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0120_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0093_A09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0098_H09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0049_C03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0087_H04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0093_E11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0085_E11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0011_H08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0095_B09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0197_D03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0189_D01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0168_D01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0182_C05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0194_E08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0118_A05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0077_C07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCCGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0188_D02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0048_H06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0110_C01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0170_G06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0082_D05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0097_G11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0201_F08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0150_E03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0125_G07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCGCAGTT
LVRM1_0118_C11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0016_C04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0087_E11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0137_H01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0122_B09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0144_A10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0080_G02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0019_D03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0070_C09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0137_C12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0011_D10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0123_E07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0121_E08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0002_B06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0020_F12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0047_A01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0103_D11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0084_A03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0077_E08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0079_G02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0005_F03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0048_F12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0054_G03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0016_D01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0091_H12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0014_A12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0085_B10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0017_D11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0011_E11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0048_B08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0083_H02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0017_F01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0002_A05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0093_D03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0018_A10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0072_F05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0073_D02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0090_A07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0010_H10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0077_A06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0100_A02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0198_E05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0187_F12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0122_C05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0009_C10.b : TGGCAAAGATGTTTTCGGT*GAGGCACTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0123_F06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0140_C09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0031_G10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0086_A11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0004_G12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0051_D03.b : TGGCAAAGATGTTTTCGGT*GGGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0160_B04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0163_B04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0200_G01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0093_A12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0004_E09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0115_A05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0176_F02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0036_A02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0082_C08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0070_H07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0105_H03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0054_D11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0038_H06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0103_A06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0070_E12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0102_A10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0098_D07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0097_D06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0101_D02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0147_G01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0164_B11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0117_E09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0030_C04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0078_F07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0112_C11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0079_F05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0032_D04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0018_A07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0151_C09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0077_C08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0158_E12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0064_H03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0036_G01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0077_H04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0030_F06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0038_B11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0060_B06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0048_G02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0054_G09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0053_C11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0106_C12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0091_G03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0067_D05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0096_F11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0034_A04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0011_C12.b : TGGCAAAGATGTTTTCGGT*GAGGCCCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0059_F01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0061_E01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0048_D06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0073_G04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0067_E11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0016_B09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0099_H10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0059_C04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0053_E03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0192_A07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0085_E10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0196_H02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0096_C04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0038_A03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0038_H05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0189_E10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0118_B07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0055_G02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0034_H07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0084_B12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0031_A07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0153_H07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0137_F02.b : TGGCAAAGATGTCTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0145_B10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0149_C09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0034_G09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0137_A11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0052_G09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0119_C11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0002_B09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0060_C11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0025_D06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0087_D11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0049_A12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0065_H02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0102_B04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0005_G11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0097_B04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0051_B01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0066_D10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0058_D04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGTACAGTT
LVRM1_0007_B02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0183_H11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0107_G01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0204_E01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0096_A11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0052_H05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0092_H05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0200_C01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0207_C05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0202_H01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0199_F03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0200_F05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0051_E01.b : TGGCAAAGATGTCTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0199_G05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0094_A11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0011_D01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0077_E03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0061_C10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0130_B09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0130_G09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0154_C12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0033_C11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0054_D04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0020_A08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0002_D12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0078_F03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0174_B07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0048_C09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0087_A03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0061_B02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0164_C10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0049_H02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0167_D07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0091_A04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0163_H11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0164_C09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0044_D08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0085_A03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0061_E01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0168_B06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0061_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0091_B01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0176_E11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0062_E10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0136_B03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0086_C11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0174_A01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0083_F08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0172_A03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0165_D06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0173_G09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0175_A09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0146_A04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0003_B01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0045_H12.b : TGGCA*ATATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0011_F04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0176_G02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0149_F11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0065_A11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0162_A04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0078_C02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGCTGGGCACAGTT
LVR01_0082_H04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0157_C11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0004_F02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0188_H07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0192_D04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0019_B02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0088_H10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0092_C12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0020_F05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0053_C01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0145_H05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0192_D02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0125_H05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0055_F03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0018_G01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0087_G12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0183_D01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0084_F09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0192_C03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0149_A01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0186_F05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0043_B07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0180_E02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0208_C02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0057_C05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0064_C12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0189_E02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0124_E01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTTACTGTGGTGGGCACAGTT
LVRM1_0076_D11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0196_E01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0181_D03.b : AGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0057_H11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0085_E02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0179_E03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCATTGTGGTGGGCACAGTT
LVRM1_0050_E11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0055_A01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0094_F01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0087_E02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0094_A09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0081_G03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0092_E05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0126_B04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0164_G03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0003_F01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0040_E01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0164_F02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0146_A02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0207_A03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0181_E11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0181_H05.b : TGGCAAAGATGTTTTCGGT*GAGGCTTTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0185_B11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0093_F06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0085_B10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0166_E08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0195_G07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0082_D01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0175_D02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0094_H06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0100_F02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0100_E03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0176_A01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0100_F04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0047_G06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0115_E02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0170_A05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0176_E04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0195_H01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0184_B03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0113_E04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0093_C03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0093_B02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCAATGTGGTGGGCACAGTT
LVRM1_0173_E11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0038_E06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0103_H07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0115_D03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0007_H01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0061_F05.b : TGGCAAAGATGTTTTCGGT*GAGGCCCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0039_G01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0112_D02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0189_A03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0176_A12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0020_B12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0037_H04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0038_E05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0123_C06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0172_B03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0029_A04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0100_A08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0100_B07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0101_F09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0099_G02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0100_D02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0020_A12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0118_D03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0164_B08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0176_F01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0009_H04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0198_F02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0106_D04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0189_D07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0022_B01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0037_A06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0096_D08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0108_E02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0199_H03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0038_B05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCATAGTT
LVRM1_0136_D11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0047_H04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0091_C05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0091_H09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0149_F12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0121_D06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0136_H12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0054_F12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0055_F12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0101_A05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0065_D08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0130_A06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0082_G06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0207_A07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0039_B01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0097_E05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0112_F01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0117_A07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0128_C05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0047_B06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0158_C12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0145_H11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0026_E08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0117_G02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0186_A12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0197_F08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0114_D11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0040_H06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0146_C05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0204_F09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0145_D12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0082_G12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0104_A06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0037_A12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0125_F01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0205_D11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0163_E10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0033_F01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0191_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0114_H12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0036_E05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0039_B11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0176_D05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0043_F11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0074_H03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0085_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0133_F08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0061_B05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0121_E06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0136_A04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0145_B12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0043_F08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0201_H09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0102_A06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0104_E12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0039_G12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0098_D05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0014_G10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0089_E12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0030_F04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0033_B07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0031_A02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0035_E07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0070_C11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0012_D05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0053_B05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0074_G01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0077_D01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0088_C06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0086_E09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0034_C03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0109_C04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0128_H10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0074_H06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0153_A05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0082_D12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0034_F06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0054_G11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0057_C10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0089_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0165_B12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0199_A09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0003_B07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0003_A03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0074_C07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0106_A12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0075_A11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0065_E07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0121_B08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0004_F06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0108_B02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0073_A10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0074_D05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0154_H03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0164_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0117_C11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0065_B06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0039_H09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0147_A08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0200_E10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0106_C08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0032_H02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0151_H04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0014_B06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0153_F12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0105_C09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0146_B09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0033_G11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0161_H07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0172_D11.b : TGGCAAAGATGCTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0200_H08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0071_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0079_C03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0105_E12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0116_F09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0087_D11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0200_C10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0036_E09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0171_B12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0102_A12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0014_B05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0151_F04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0012_F06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0050_F01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0053_G12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0117_H09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0156_H06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0008_D10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0019_A09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0022_C07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0007_D10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0017_F01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0148_G02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0151_B01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0157_E07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0080_F05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0065_G11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0049_F04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0033_D05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0142_C01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0103_H03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0143_A04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0035_H11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGCGGGCACAGTT
LVRM1_0079_D07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0058_H01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGATCCTCACTGTGGTGGGCACAGTT
LVRM1_0144_C05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0144_D04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0022_D05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0159_D08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0126_F07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0128_H01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0030_G04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0033_B12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0144_B06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0155_H07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0111_F06.b : AGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0022_F08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0051_G02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0109_H01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0111_D03.b : TGGCAAAGGTGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0019_F04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0077_D06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0041_E05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0007_C11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0034_D08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0035_C10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0140_G01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0150_E10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0021_A10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0156_C11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0173_E10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0038_B07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0139_A06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0151_E10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0153_B11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0154_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0122_A12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0134_E11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0148_G11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
OVRM1_0092_H07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0021_E10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0030_G01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0001_B12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0033_C10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0144_H05.b : TGGCAAGGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0078_H07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0058_G11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0127_G08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0015_H08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0110_E10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0120_G06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0124_F06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0124_A10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0021_H10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0110_A10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0119_G11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0101_G11.b : TGGCAAAGATGTTTTCGGTNGAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0012_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0015_G12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0160_B09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0016_A11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0149_C10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0139_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0146_G08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0149_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0050_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0144_C11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0149_D10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0143_F09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0157_E09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0128_E09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0149_B07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0001_B04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0063_A07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0138_C08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0140_B09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0139_E12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0121_B06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0006_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0125_E08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0142_D12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0006_G03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0130_E08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0001_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0001_H12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0040_D06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0078_F04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0015_D07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0028_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0035_H09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0019_E09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0035_H12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0033_F09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0040_F09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0043_F06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0033_B07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0043_E09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0026_A01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0005_D07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0039_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTACCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0026_D10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0095_E07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0066_C09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0051_F06.b : TGGCAAAGATGTTTTCGGT*AAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0102_D07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0087_E07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0060_E05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0071_G02.b : TGGCAAAGATGTTTTCGGT*GGGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0079_H02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0071_B03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0082_H10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0047_E11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0038_E10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACGGTT
LVR01_0035_A11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0034_F12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0037_G02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0038_E04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0083_A06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0047_H08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0094_G11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0088_H11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0098_A10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0098_B01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0049_F09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0039_G04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0053_B04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0068_H12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0031_H09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0022_F06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0003_H09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0082_D01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0087_A08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0086_D08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0085_E09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0026_C09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0028_A04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0063_E06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0015_F02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0088_C04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0014_B09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0031_D10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0086_D07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0041_F02.b : TGGCAAAGATGTTCTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0066_F12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0073_C06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0035_C02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0084_D01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0083_C12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0022_C06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0062_F01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0038_B02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0074_A12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0049_E01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0072_G01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0095_C05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0029_A09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0067_C08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0096_C07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0055_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0033_F12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0049_D08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0043_G10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0022_E03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0071_A05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0054_C09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0089_H05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0015_B10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0002_G01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0044_H10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0052_G05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0102_H11.b : TGGCAAAGATGTTTCCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0029_B01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0081_C09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0052_B02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0085_H08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0082_C09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0072_F12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0089_G10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0002_E07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0095_B01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0057_A07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0016_H11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0053_H10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0062_F05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0059_E03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0052_H07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0033_G03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0009_G11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0086_B05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0048_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0088_H01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0092_C03.b : TGGCAAAGATGCTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0101_D08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0028_H07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0012_C07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0083_D10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0031_A10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0047_A10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0091_E12.b : AGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0028_F12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0035_A03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0059_H05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0079_F09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0078_G04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0025_B05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0038_E11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0092_E01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0044_H05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0091_E09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0095_C04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0105_E05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0037_F08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0050_C06.b : TGGCAAAGATGTTCTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0072_D09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0011_D07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0037_F03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0030_G10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGCGGTGGGCACAGTT
LVR01_0090_F01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0067_C02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0071_E11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0054_D12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0066_E06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0067_C06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0078_A09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0048_E12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0017_C09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0101_E06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0074_F04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0050_F12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0012_C08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0099_H11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0004_G07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0071_F08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0008_C02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0009_G09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0049_C03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0017_H11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0068_A07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0008_A06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0050_G09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0078_A07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0019_B06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0048_B07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0046_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0067_E03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0068_E10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0084_B06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0099_F09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0099_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0063_H02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0022_A12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0057_C06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0061_C04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0094_A10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCACACTGTGGTGGGCACAGTT
LVR01_0078_C05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0098_B12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0045_H07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0096_H03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0044_B05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTCCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0016_D12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0041_A03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0061_H04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0078_B04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0083_C02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0045_C11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0103_E01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0094_B02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0079_B06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0031_F12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0016_G06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0104_D07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0100_H02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0028_E07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0013_A03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0074_H09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0084_F05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0098_B06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0098_D04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0025_B02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0104_C11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0051_E09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0101_G02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0074_C01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0060_H08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0060_H04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0068_B04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0026_A06.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0084_F07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0073_F05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0074_B07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0017_G10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0056_C03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0098_B07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0008_A12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0090_B05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0071_D05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0097_G01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0017_F04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0072_C08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0044_F12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0101_F05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0046_A03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0001_B04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0046_G02.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0061_D11.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACCGTGGTGGGCACAGTT
LVR01_0057_E05.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCAGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0046_H03.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0056_D04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0126_E12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0040_C01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0031_C04.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0126_F12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0122_D10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0090_E07.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0087_F12.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0104_G01.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0035_F10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0163_C09.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0055_D10.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0142_A08.b : TGGCAAAGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0002_E10.b : TGGCAAAGATGTTTTCGGA*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVR01_0086_C09.b : xxxxxxgGATGTTTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0049_C05.b : xxxxxxxxxxxxxTTCGGT*GAGGCTCTTCTGCCTGGTCCTCACTGTGGTGGGCACAGTT
LVRM1_0206_A02.b : ggcaaagaggtgtgtgcGT*GAGGCTCTTCTGCCTGGTCCTCAGTGTGGTGGGCACAGGT
LVRM1_0098_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTCACTGTGGTGGGCACAGTT
LVR01_0077_H09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggcgcctgatgactgagcaccagggaca
LVRM1_0141_F12.b : tcagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_C01.b : cccttgtcxxxxxxxxxxxxxxxxxxxx
LVRM1_0001_A04.b : atxxxxxxxxxxxxxxxxxxxx
LVRM1_0070_G02.b :
LVR01_0010_H04.b : cc
LVR01_0047_G01.b :
LVRM1_0025_H12.b :
LVRM1_0003_G03.b :
LVRM1_0102_G07.b :
LVRM1_0200_A11.b :
LVRM1_0089_H06.b :
LVRM1_0079_A08.b :
LVRM1_0186_B05.b :
LVRM1_0028_F11.b :
LVRM1_0151_D08.b :
LVR01_0019_B09.b :
LVR01_0087_C01.b :
LVR01_0048_F03.b :
LVR01_0081_D01.b :
LVR01_0054_H04.b :
LVR01_0031_D01.b :
LVR01_0042_D09.b :
LVRM1_0170_A06.b :
LVRM1_0176_D08.b :
LVRM1_0176_B12.b :
LVRM1_0083_A07.b :
LVR01_0060_C06.b :
LVRM1_0207_H06.b :
LVR01_0026_F10.b :
LVR01_0026_E04.b :
LVRM1_0193_G05.b :
LVRM1_0037_C02.b :
LVR01_0046_C07.b :
LVRM1_0051_B07.b :
LVR01_0002_H04.b :
LVR01_0003_H02.b :
LVRM1_0051_D09.b :
LVRM1_0153_A06.b :
LVRM1_0195_D02.b :
LVR01_0073_G05.b :
LVR01_0048_D03.b :
LVRM1_0177_A11.b :
LVRM1_0035_B01.b :
LVRM1_0138_A08.b :
LVRM1_0134_E10.b :
LVRM1_0074_E06.b :
LVR01_0039_G05.b :
LVR01_0078_E08.b :
LVR01_0085_H10.b :
LVRM1_0154_G12.b :
LVRM1_0042_D11.b :
LVRM1_0055_G06.b :
LVRM1_0195_B07.b :
LVRM1_0070_F04.b :
LVRM1_0161_F06.b :
LVRM1_0193_E04.b :
LVRM1_0087_G02.b :
LVR01_0033_A02.b :
LVRM1_0192_C05.b :
LVRM1_0152_A07.b :
LVRM1_0033_D11.b :
LVRM1_0104_C03.b :
LVRM1_0020_F03.b :
LVRM1_0174_A07.b :
LVR01_0013_D04.b :
LVRM1_0083_A03.b :
LVRM1_0122_F08.b :
LVRM1_0156_G07.b :
LVR01_0028_G09.b :
LVR01_0028_H11.b :
LVR01_0008_B05.b :
LVRM1_0119_A07.b :
LVR01_0059_A04.b :
LVR01_0082_D03.b :
LVR01_0074_C06.b :
LVR01_0102_A09.b :
LVR01_0054_A09.b :
LVR01_0099_B10.b :
LVRM1_0172_A12.b :
LVR01_0046_A04.b :
LVRM1_0084_D08.b :
LVR01_0044_F05.b :
LVR01_0003_B11.b :
LVRM1_0092_F05.b :
LVRM1_0023_C12.b :
LVRM1_0142_D02.b :
LVRM1_0052_G08.b :
LVR01_0029_H01.b :
LVR01_0059_C11.b :
LVRM1_0202_E09.b :
LVRM1_0164_C05.b :
LVR01_0073_G10.b :
LVRM1_0144_F01.b :
LVRM1_0189_H05.b :
LVRM1_0090_G05.b :
LVRM1_0166_D09.b :
LVRM1_0081_C04.b :
LVRM1_0134_E02.b :
LVRM1_0069_B03.b :
LVR01_0058_C10.b :
LVRM1_0176_B08.b :
LVRM1_0101_B02.b :
LVRM1_0108_H05.b :
LVRM1_0156_D07.b :
LVRM1_0173_F01.b :
LVRM1_0183_F08.b :
LVRM1_0184_H07.b :
20110601C-012094 : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
---------+---------+---------+---------+---------+---------+ 184
LVRM1_0001_A11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0183_C08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0116_A07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0108_H09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0077_E10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0028_F10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0008_E12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0056_H05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0089_E01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0084_B06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0099_A06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0106_B07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0070_B05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0156_F10.b : CAGATGGCACAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0027_A08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGGGTGCGTGG
LVRM1_0039_B07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0111_B11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0077_F07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0011_G12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0014_F11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0033_D07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0106_G05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0089_E09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0176_B10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0094_E07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0007_B08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0180_D02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0174_D06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0008_H12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0035_E09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0146_F07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0075_H11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0120_F10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0093_A09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0098_H09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0049_C03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0087_H04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0093_E11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0085_E11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0011_H08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0095_B09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0197_D03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0189_D01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0168_D01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0182_C05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0194_E08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0118_A05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0077_C07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0188_D02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0048_H06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0110_C01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0170_G06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0082_D05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0097_G11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0201_F08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0150_E03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0125_G07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0118_C11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0016_C04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0087_E11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0137_H01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0122_B09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0144_A10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0080_G02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0019_D03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0070_C09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0137_C12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0011_D10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0123_E07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0121_E08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0002_B06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0020_F12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0047_A01.b : CAGATGGCAGAGGTCCAAGATAAGGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0103_D11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0084_A03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0077_E08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0079_G02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0005_F03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0048_F12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0054_G03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0016_D01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0091_H12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGTTGAAGGAGGAGGTGTGCGTGG
LVR01_0014_A12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0085_B10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0017_D11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0011_E11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0048_B08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0083_H02.b : CAGATGGCAAAGGTCCAAGATAAAGGTGAA*TTTCTATCTGAAGGAGGAGGTGTGCGTGG
LVR01_0017_F01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0002_A05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0093_D03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGTTGAAGGAGGAGGTGTGCGTGG
LVR01_0018_A10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0072_F05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0073_D02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0090_A07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0010_H10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0077_A06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0100_A02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0198_E05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0187_F12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0122_C05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0009_C10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0123_F06.b : CAGATGGCAGAGATCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0140_C09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0031_G10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0086_A11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0004_G12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0051_D03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0160_B04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0163_B04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0200_G01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0093_A12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0004_E09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0115_A05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0176_F02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0036_A02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0082_C08.b : CAGATGGCAGAGGTCCAAGATAAGGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0070_H07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0105_H03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0054_D11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0038_H06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0103_A06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0070_E12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0102_A10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0098_D07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0097_D06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0101_D02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0147_G01.b : CAGATGGCAGAGGTCCAAGATAAGGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0164_B11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0117_E09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0030_C04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0078_F07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0112_C11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0079_F05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0032_D04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0018_A07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0151_C09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0077_C08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0158_E12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0064_H03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0036_G01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0077_H04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0030_F06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0038_B11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0060_B06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0048_G02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0054_G09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0053_C11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0106_C12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0091_G03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0067_D05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0096_F11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0034_A04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0011_C12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0059_F01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0061_E01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0048_D06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0073_G04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0067_E11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0016_B09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0099_H10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0059_C04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0053_E03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0192_A07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0085_E10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0196_H02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0096_C04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0038_A03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0038_H05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0189_E10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0118_B07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0055_G02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0034_H07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0084_B12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0031_A07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0153_H07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0137_F02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0145_B10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0149_C09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0034_G09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0137_A11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0052_G09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0119_C11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0002_B09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0060_C11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0025_D06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0087_D11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0049_A12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0065_H02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0102_B04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0005_G11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0097_B04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0051_B01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0066_D10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0058_D04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0007_B02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTTAAGGAGGAGGTGTGCGTGG
LVRM1_0183_H11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0107_G01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0204_E01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0096_A11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0052_H05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0092_H05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0200_C01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0207_C05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0202_H01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0199_F03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0200_F05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0051_E01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0199_G05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0094_A11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0011_D01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0077_E03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0061_C10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0130_B09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGTGTGG
LVRM1_0130_G09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0154_C12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0033_C11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0054_D04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0020_A08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0002_D12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0078_F03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0174_B07.b : CTGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0048_C09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0087_A03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0061_B02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0164_C10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0049_H02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0167_D07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0091_A04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0163_H11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0164_C09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0044_D08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0085_A03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0061_E01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0168_B06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0061_F10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0091_B01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0176_E11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0062_E10.b : CAGATGGCAGAGGTCCAAGATGAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0136_B03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGGGGAGGTGTGCGTGG
LVRM1_0086_C11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0174_A01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0083_F08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0172_A03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0165_D06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0173_G09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0175_A09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0146_A04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0003_B01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0045_H12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0011_F04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0176_G02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0149_F11.b : CAGATGGCAGAAGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAAGAAGAAGTGTGCGTGG
LVRM1_0065_A11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0162_A04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0078_C02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0082_H04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0157_C11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0004_F02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0188_H07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0192_D04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0019_B02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0088_H10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0092_C12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0020_F05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0053_C01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0145_H05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0192_D02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0125_H05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0055_F03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0018_G01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0087_G12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0183_D01.b : CAGATGGCAGAGGTCCAAGATAAAGGTAAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0084_F09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0192_C03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0149_A01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0186_F05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0043_B07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0180_E02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0208_C02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0057_C05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0064_C12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0189_E02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0124_E01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0076_D11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0196_E01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0181_D03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0057_H11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAAGAGGAGGTGTGCGTGG
LVRM1_0085_E02.b : CAGATGGCAGGGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0179_E03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0050_E11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0055_A01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0094_F01.b : CAGATGGCAGAGGTCCGAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0087_E02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0094_A09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0081_G03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0092_E05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0126_B04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0164_G03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0003_F01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0040_E01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0164_F02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0146_A02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0207_A03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0181_E11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0181_H05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0185_B11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0093_F06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0085_B10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0166_E08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0195_G07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0082_D01.b : CAGGTGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0175_D02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0094_H06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0100_F02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0100_E03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0176_A01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAGGGAGGAGGTGTGCGTGG
LVRM1_0100_F04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0047_G06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0115_E02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0170_A05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0176_E04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0195_H01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0184_B03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0113_E04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0093_C03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0093_B02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0173_E11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0038_E06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0103_H07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0115_D03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0007_H01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0061_F05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0039_G01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0112_D02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0189_A03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0176_A12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0020_B12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0037_H04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0038_E05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0123_C06.b : CAGGTGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0172_B03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0029_A04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0100_A08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0100_B07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0101_F09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0099_G02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0100_D02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0020_A12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0118_D03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGCGG
LVRM1_0164_B08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0176_F01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0009_H04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0198_F02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0106_D04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0189_D07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0022_B01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0037_A06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0096_D08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0108_E02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0199_H03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0038_B05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0136_D11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0047_H04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0091_C05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0091_H09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0149_F12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0121_D06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0136_H12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0054_F12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0055_F12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0101_A05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0065_D08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0130_A06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0082_G06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0207_A07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0039_B01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0097_E05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0112_F01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0117_A07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0128_C05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0047_B06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0158_C12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0145_H11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0026_E08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0117_G02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0186_A12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0197_F08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0114_D11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0040_H06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0146_C05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0204_F09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0145_D12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0082_G12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0104_A06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0037_A12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0125_F01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0205_D11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0163_E10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0033_F01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0191_F10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAATTTTCTAGCTGAAAGANGAGGTGTGCGTGG
LVRM1_0114_H12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0036_E05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0039_B11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0176_D05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0043_F11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0074_H03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0085_F10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0133_F08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0061_B05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0121_E06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0136_A04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*CTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0145_B12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0043_F08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0201_H09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0102_A06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0104_E12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0039_G12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0098_D05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0014_G10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0089_E12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0030_F04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0033_B07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0031_A02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCATGG
LVRM1_0035_E07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0070_C11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0012_D05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0053_B05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0074_G01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0077_D01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0088_C06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0086_E09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0034_C03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0109_C04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0128_H10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0074_H06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0153_A05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0082_D12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0034_F06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0054_G11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0057_C10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0089_F10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0165_B12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0199_A09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0003_B07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0003_A03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0074_C07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0106_A12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0075_A11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0065_E07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0121_B08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0004_F06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0108_B02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0073_A10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0074_D05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0154_H03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0164_F10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0117_C11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0065_B06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0039_H09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0147_A08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0200_E10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0106_C08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0032_H02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0151_H04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0014_B06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0153_F12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0105_C09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0146_B09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0033_G11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0161_H07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0172_D11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0200_H08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0071_F10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0079_C03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0105_E12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0116_F09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0087_D11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0200_C10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0036_E09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0171_B12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0102_A12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0014_B05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0151_F04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0012_F06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0050_F01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0053_G12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0117_H09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0156_H06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0008_D10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0019_A09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0022_C07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTGGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0007_D10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0017_F01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0148_G02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0151_B01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0157_E07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0080_F05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0065_G11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0049_F04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0033_D05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0142_C01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0103_H03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0143_A04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0035_H11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0079_D07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0058_H01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0144_C05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0144_D04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0022_D05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0159_D08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0126_F07.b : CAGATGGCAGAGGTCCAAGATAAGGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0128_H01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0030_G04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0033_B12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0144_B06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0155_H07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0111_F06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0022_F08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0051_G02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0109_H01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0111_D03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0019_F04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0077_D06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0041_E05.b : CAGATGGCAGAGGTCCAAGATCAAGGTGAA*TTTCTAGCTGAGGGGGGAGGTGTGCTTGG
LVRM1_0007_C11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0034_D08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0035_C10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0140_G01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0150_E10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0021_A10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0156_C11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0173_E10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0038_B07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0139_A06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0151_E10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0153_B11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0154_F10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0122_A12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0134_E11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0148_G11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
OVRM1_0092_H07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0021_E10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0030_G01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0001_B12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0033_C10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0144_H05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0078_H07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGGGGTGTGCGTGG
LVRM1_0058_G11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0127_G08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0015_H08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0110_E10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0120_G06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0124_F06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0124_A10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0021_H10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0110_A10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0119_G11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0101_G11.b : CAGATGGCAGAGGTCCAAGATAAAGGTAAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0012_F10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0015_G12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0160_B09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0016_A11.b : CAGATGGCAGAGGTCC*AGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0149_C10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0139_F10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0146_G08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0149_F10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0050_F10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0144_C11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0149_D10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0143_F09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0157_E09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0128_E09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0149_B07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0001_B04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0063_A07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0138_C08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0140_B09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0139_E12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0121_B06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0006_F10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0125_E08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0142_D12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0006_G03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0130_E08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0001_F10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0001_H12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0040_D06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0078_F04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0015_D07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0028_F10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0035_H09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0019_E09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0035_H12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0033_F09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0040_F09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0043_F06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0033_B07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0043_E09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0026_A01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0005_D07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0039_F10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0026_D10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0095_E07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0066_C09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0051_F06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0102_D07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0087_E07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0060_E05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0071_G02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0079_H02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0071_B03.b : CAGGTGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0082_H10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0047_E11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0038_E10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0035_A11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0034_F12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TCTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0037_G02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0038_E04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0083_A06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0047_H08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0094_G11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0088_H11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0098_A10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0098_B01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0049_F09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0039_G04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0053_B04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0068_H12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0031_H09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0022_F06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGGAGGAGGAGGTGTGCGTGG
LVR01_0003_H09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0082_D01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0087_A08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0086_D08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0085_E09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0026_C09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0028_A04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0063_E06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0015_F02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0088_C04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0014_B09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0031_D10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0086_D07.b : CAGATGGCAGAGGTCCTAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0041_F02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0066_F12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0073_C06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0035_C02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0084_D01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0083_C12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0022_C06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0062_F01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0038_B02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0074_A12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0049_E01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0072_G01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0095_C05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0029_A09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0067_C08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGA*GTGTGCGTGG
LVR01_0096_C07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0055_F10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0033_F12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0049_D08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0043_G10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0022_E03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0071_A05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0054_C09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0089_H05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0015_B10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0002_G01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0044_H10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGCGG
LVR01_0052_G05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0102_H11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0029_B01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0081_C09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0052_B02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0085_H08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0082_C09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0072_F12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0089_G10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0002_E07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0095_B01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0057_A07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0016_H11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0053_H10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0062_F05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0059_E03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0052_H07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0033_G03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0009_G11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0086_B05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0048_F10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0088_H01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0092_C03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0101_D08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0028_H07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0012_C07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0083_D10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0031_A10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0047_A10.b : CAGATGGCAGAGGTCCAAGATAAAGGT*AA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0091_E12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0028_F12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0035_A03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0059_H05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0079_F09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0078_G04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0025_B05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0038_E11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0092_E01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0044_H05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0091_E09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0095_C04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0105_E05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0037_F08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0050_C06.b : CAAATGGCAGATGTCCAAGATAAAGGTGAA*TTTCTAGCTGAATGAGGATGTGTGCGTGG
LVR01_0072_D09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0011_D07.b : CAGATGGCAGAGGTCCAGGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0037_F03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0030_G10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0090_F01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0067_C02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0071_E11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0054_D12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0066_E06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0067_C06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0078_A09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0048_E12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0017_C09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0101_E06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0074_F04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0050_F12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0012_C08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0099_H11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0004_G07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0071_F08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0008_C02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0009_G09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0049_C03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0017_H11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0068_A07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0008_A06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0050_G09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0078_A07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0019_B06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0048_B07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0046_F10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0067_E03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGATGTGTGCGTGG
LVR01_0068_E10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0084_B06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0099_F09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0099_F10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0063_H02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0022_A12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0057_C06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0061_C04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0094_A10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0078_C05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0098_B12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0045_H07.b : CAGATGGCACAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCATGG
LVR01_0096_H03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0044_B05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0016_D12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0041_A03.b : CAGATGGCAGAGGTCCATGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0061_H04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0078_B04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0083_C02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0045_C11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGCGTGCGTGG
LVR01_0103_E01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0094_B02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0079_B06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0031_F12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0016_G06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0104_D07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0100_H02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0028_E07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0013_A03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0074_H09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0084_F05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0098_B06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0098_D04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0025_B02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0104_C11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0051_E09.b : CAGATGACAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0101_G02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0074_C01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0060_H08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0060_H04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0068_B04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0026_A06.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0084_F07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0073_F05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0074_B07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0017_G10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0056_C03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0098_B07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0008_A12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0090_B05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0071_D05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0097_G01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0017_F04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0072_C08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0044_F12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0101_F05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0046_A03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0001_B04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0046_G02.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0061_D11.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0057_E05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0046_H03.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0056_D04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0126_E12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0040_C01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0031_C04.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0126_F12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0122_D10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0090_E07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0087_F12.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0104_G01.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0035_F10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0163_C09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0055_D10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0142_A08.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0002_E10.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0086_C09.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0049_C05.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0206_A02.b : CAGATGGCAGAGGTCCAATATCAAGGTGAA*GTTCTAGGTGAACGAGGAGGTGTGCGTGG
LVRM1_0098_F07.b : CAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVR01_0077_H09.b : aAGATGGCAGAGGTCCAAGATAAAGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0141_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxGGTGAA*TTTCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0149_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggCTAGCTGAAGGAGGAGGTGTGCGTGG
LVRM1_0001_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGGAGGAGGTGTGCGTGG
LVRM1_0070_G02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0010_H04.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0047_G01.b : ggttttttttctggcattgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0025_H12.b :
LVRM1_0003_G03.b :
LVRM1_0102_G07.b :
LVRM1_0200_A11.b :
LVRM1_0089_H06.b :
LVRM1_0079_A08.b :
LVRM1_0186_B05.b :
LVRM1_0028_F11.b :
LVRM1_0151_D08.b :
LVR01_0019_B09.b :
LVR01_0087_C01.b :
LVR01_0048_F03.b :
LVR01_0081_D01.b :
LVR01_0054_H04.b :
LVR01_0031_D01.b :
LVR01_0042_D09.b :
LVRM1_0170_A06.b :
LVRM1_0176_D08.b :
LVRM1_0176_B12.b :
LVRM1_0083_A07.b :
LVR01_0060_C06.b :
LVRM1_0207_H06.b :
LVR01_0026_F10.b :
LVR01_0026_E04.b :
LVRM1_0193_G05.b :
LVRM1_0037_C02.b :
LVR01_0046_C07.b :
LVRM1_0051_B07.b :
LVR01_0002_H04.b :