[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-012185

Length: 1,877

Sequence [FASTA format sequence]
TTGTGCATGT GTGTGTTTAA GAAAATCTGT ATATAAACTT CTCCGCCGTG GTATCCAGAG
CAAGGCATGG TTTTCACTTT TTAACAAAAT GAGGTTACTC AATGCAGTGC CGCTTTTCAT
CCTTTTGATC ACATTGCAGT GTTCCCGTGC TGTGAGTCCC ACAGGCTGTG ACGATGCTGA
GCCTGTGGCC AGAAAAGCTC TAGACCTGAT CAATAAAGGA CGATGGGACG GCTACCTTTT
CGAGTTGCTG CAGGTTGCTG ATGCCCACTT GGACAAATCG GAATCTACCG CTGTCTATTA
TTTAGTCTTG CATGTAAAAG AATCAGACTG TCCAGTCCTA TCCAGGAAGC ACTGGGATGA
CTGTGAGCCA GCTGTTTCCA CACGTCCATC TGATATAGTT ATTGGACAAT GTAAGGTAAT
AGCTACAACA TGTTTGGATG GATCTCAGGA TCTTAGAGTG AATGGCTTTA ATTGCACCAC
AAGTTCTGCC TCTTCAGTAC TGGCCAATAC GAAAGACAGC CCAGTACTCA TCGATTTCTT
TGAGGATACG GAGCCCTACA GAAAAGAAGC TAACCAAACC TTGGAAAAGT ACAAAAGGGA
GAACAGTGAC TTTGCCTCTT TCCGAGTGGA CAAAGTGGAG AGGGTTGCAA GAGTGAGAGG
AGGGGAAAGA ACGAATTACT ACGTGGATTT CTCTGTGAGG AACTGCTCCA GTCGCTGGCG
CTCTCCTACC TTTGGATTCT GTAGAGCAGA TTTCATCAAT GATGCAGAAG CCTCTGACTT
GGAAAACCCA GAAGATATTG TCATAAACTG TGAAGTCTTC AACTTCAAGG ATCATAGAAA
CATCAGTGGT GGGCAGAAGC ATTTGGGCCA TCGCTTCCAC TCTGGCGAGC ATGAGCATTC
TCCTGCTGGC AGGCCTCCAC ATAAGCCCGG TAGATCTCGA GATCACCATG ATTCCCACAA
GCCACATAAA TTTGGGTGCC CACCTCCTCT AGGAGACAAA AGTCACTCAG ACAGTCCACC
ATTTCAAGCA GAAGCTTCTC CATCATTGGC CTCTTTAGGC ACCAATGGGG TCCATGGACC
CTCAGATAAT CATAGTTCCA GTGAGCATCA TCTCCCAGGA CATCCTCCTC ATGGACGCCA
TCCCCATGGA CCCCCTCCTC ATGGACGCCA TCCCCATGGG CCCCCTCCTC ATGGACGCCA
TCCCCATGGA CCCCCTCCTC ATGGACACCA TCCCCATGGG CCCCCTCCTC ATGGACACCA
TCCCCATGGG CCCCCTCCTC ATGGACACCA TCCCCATGGA CCCCCTCCTC ATGGACGCCA
TCCCCATGGA CCCCCTCCTC ATGGACACCA TCCCCATGGA CCCCCTCCTC ATAGACACCA
TCCCCATGGC CATGATTTCC ATGACTATGG ACCCTGTGAC CCACCACCCC ATAGCCAAGA
TCCCCAAGAC CACCATCGCT GGGGCCATGG CCCACCACCT AGGCACTCAG AAGAAAGAGG
TCCAGGTAAA AAACACTTTC CCTTCCATGG GAGAGAGATT GGATATGTTC ACCGACTCCC
ACCATTAAAG AAAGGTGAGG TTCTTCCTCT TTCCGAAGCC AATTTTCCCA GTTTCTTGTT
GCCACACCAC AAGCCCCCTA CAGCCAGAGA TTCAGCCCCT TCCCTCAATC AGCCTCTGAA
ATCATGTTCA GGGAACATTC AAGGGGTGAA TTTTCACATC CGGTCAAAGT TTTTTTGCCC
ATTACATTTC CAAAATAAAA TCCTCTTTGG CCTTGTTGGG GAAAAATGGG ATTAACGTCC
CTGAAATTTG AACCCATAAA TAAAAAAGGG ATTTCATTAA AAAAAAAAAA AAAAAAAAAA
AAAAAAAAAA AAAAAAA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHRGhistidine-rich glycoprotein precursor [Homo sapiens]. 399e-111O
Contig/Assembly ProteinFETUBfetuin-B precursor [Homo sapiens]. 70.94e-12O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHrghistidine-rich glycoprotein [Mus musculus]. 3442e-94O
Contig/Assembly ProteinFetubfetuin-B isoform 3 [Mus musculus]. 622e-09O
Contig/Assembly ProteinFetubfetuin-B isoform 1 [Mus musculus]. 622e-09O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC477805PREDICTED: similar to PGC-1 related co-activator isoform 2 [Canis familiaris]. 59.79e-09
Contig/Assembly ProteinLOC477805PREDICTED: similar to PGC-1 related co-activator isoform 1 [Canis familiaris]. 59.79e-09
Contig/Assembly ProteinLOC478665PREDICTED: similar to Fetuin-B precursor (IRL685) (16G2) [Canis familiaris]. 58.92e-08O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHRGhistidine-rich glycoprotein [Bos taurus]. 454e-128O
Contig/Assembly ProteinLOC100336270PREDICTED: histidine-rich glycoprotein-like [Bos taurus]. 2565e-68O
Contig/Assembly ProteinFETUBfetuin-B precursor [Bos taurus]. 62.41e-09O
Contig/Assembly ProteinPPRC1PREDICTED: peroxisome proliferator-activated receptor gamma coactivator 1-alpha-like [Bos taurus]. 51.23e-06
Contig/Assembly ProteinPPRC1peroxisome proliferator-activated receptor gamma coactivator-related protein 1 [Bos taurus]. 51.23e-06
Contig/Assembly ProteinSELPLGP-selectin glycoprotein ligand 1 [Bos taurus]. 50.17e-06O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSENP2PREDICTED: histidine-rich glycoprotein [Sus scrofa]. 6820.0O
Contig/Assembly ProteinPPRC1PREDICTED: peroxisome proliferator-activated receptor gamma coactivator-related protein 1 [Sus scrofa]. 53.54e-07


Assembly Members: 227      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
KDN010096D10KDN01_0096_D10.bFS678077 
LVR010003E12LVR01_0003_E12.bBP445346 
LVR010016D08LVR01_0016_D08.bBP444200 
LVR010017B10LVR01_0017_B10.bBP442562 
LVR010019A05LVR01_0019_A05.bBP441267 
LVR010030A05LVR01_0030_A05.bBP441275 
LVR010034E10LVR01_0034_E10.bBP445221 
LVR010041B06LVR01_0041_B06.bBP442276 
LVR010049A08LVR01_0049_A08.b  
LVR010053F01LVR01_0053_F01.bBP445467 
LVR010053F11LVR01_0053_F11.bBP446201 
LVR010063F06LVR01_0063_F06.bBP445847 
LVR010068B10LVR01_0068_B10.bBP442605 
LVR010068C08LVR01_0068_C08.bBP443355 
LVR010073F08LVR01_0073_F08.bBP445993 
LVR010077G05LVR01_0077_G05.bBP446675 
LVR010091A09LVR01_0091_A09.bCJ000687 
LVR010093A11LVR01_0093_A11.bCJ000852 
LVR010096B05LVR01_0096_B05.bBP442237 
LVR010105G08LVR01_0105_G08.bBP446902 
LVR010106C08LVR01_0106_C08.bBP443376 
LVRM10001F09LVRM1_0001_F09.bBP140121 
LVRM10002E07LVRM1_0002_E07.bBP139588 
LVRM10003D02LVRM1_0003_D02.bBW962789 
LVRM10004D09LVRM1_0004_D09.bBW962794 
LVRM10005A03LVRM1_0005_A03.bBP137561 
LVRM10005C01LVRM1_0005_C01.bBP138440 
LVRM10005D04LVRM1_0005_D04.bBP139018 
LVRM10006C09LVRM1_0006_C09.bBP138736 
LVRM10007D03LVRM1_0007_D03.bBP138979 
LVRM10008G10LVRM1_0008_G10.bBP140623 AK232700
LVRM10010A11LVRM1_0010_A11.bBP137878 
LVRM10013B09LVRM1_0013_B09.bBP449466 
LVRM10013H10LVRM1_0013_H10.bBP454438 
LVRM10014H08LVRM1_0014_H08.bBP454297 
LVRM10015A07LVRM1_0015_A07.bBP448525 
LVRM10016C11LVRM1_0016_C11.bBP450406 
LVRM10016G01LVRM1_0016_G01.bBP452983 
LVRM10018D04LVRM1_0018_D04.bBP450753 
LVRM10019A04LVRM1_0019_A04.bBP137604 
LVRM10019F12LVRM1_0019_F12.bBP140248 
LVRM10020A11LVRM1_0020_A11.bBP137880 
LVRM10021A01LVRM1_0021_A01.bBP137504 
LVRM10021F06LVRM1_0021_F06.bCJ001181 
LVRM10023C03LVRM1_0023_C03.bBP138503 
LVRM10023H04LVRM1_0023_H04.bBP140876 
LVRM10024B02LVRM1_0024_B02.bBP137998 
LVRM10024C10LVRM1_0024_C10.bBP138785 
LVRM10028C05LVRM1_0028_C05.bBP138582 
LVRM10028E01LVRM1_0028_E01.bBP139390 
LVRM10029B01LVRM1_0029_B01.bBP137962 
LVRM10031D06LVRM1_0031_D06.bBP139113 
LVRM10032G01LVRM1_0032_G01.bBP140297 
LVRM10033E09LVRM1_0033_E09.bCJ001257 
LVRM10034A07LVRM1_0034_A07.bCJ001297 
LVRM10034G06LVRM1_0034_G06.bCJ001362 
LVRM10034H08LVRM1_0034_H08.bCJ001374 
LVRM10035G10LVRM1_0035_G10.bCJ001451 
LVRM10035H12LVRM1_0035_H12.bCJ001463 
LVRM10036B10LVRM1_0036_B10.bCJ001481 
LVRM10036B11LVRM1_0036_B11.bCJ001482 
LVRM10036B12LVRM1_0036_B12.bBW962829 
LVRM10037H08LVRM1_0037_H08.bCJ001629 
LVRM10037H10LVRM1_0037_H10.bCJ001631 
LVRM10038C01LVRM1_0038_C01.bCJ001653 
LVRM10039D04LVRM1_0039_D04.bCJ001750 
LVRM10040C05LVRM1_0040_C05.bCJ001823 
LVRM10041E01LVRM1_0041_E01.bCJ001915 
LVRM10042B12LVRM1_0042_B12.bCJ001976 
LVRM10044H08LVRM1_0044_H08.bCJ002203 
LVRM10047B01LVRM1_0047_B01.bCJ002274 
LVRM10047B11LVRM1_0047_B11.bCJ002282 
LVRM10049E04LVRM1_0049_E04.bBP451589 
LVRM10049G09LVRM1_0049_G09.bBP453535 
LVRM10050E04LVRM1_0050_E04.bBP451590 
LVRM10050E07LVRM1_0050_E07.bBP451794 
LVRM10051F03LVRM1_0051_F03.bBP452319 
LVRM10051H02LVRM1_0051_H02.bBP453884 
LVRM10052H07LVRM1_0052_H07.bBP454233 
LVRM10055H02LVRM1_0055_H02.bBP140807 
LVRM10056A02LVRM1_0056_A02.bBP137544 
LVRM10057H03LVRM1_0057_H03.bBP140849 
LVRM10061G04LVRM1_0061_G04.bBP140412 
LVRM10062F10LVRM1_0062_F10.bBP140186 
LVRM10068C07LVRM1_0068_C07.bBP138681 
LVRM10070H12LVRM1_0070_H12.bBP454590 
LVRM10072C03LVRM1_0072_C03.bBP449854 
LVRM10075H07LVRM1_0075_H07.bBP141026 
LVRM10077B03LVRM1_0077_B03.bBP138057 
LVRM10077G12LVRM1_0077_G12.bBP140741 
LVRM10078G03LVRM1_0078_G03.bBP140385 
LVRM10079F06LVRM1_0079_F06.bBP140036 
LVRM10083A12LVRM1_0083_A12.bCJ002599 
LVRM10083E04LVRM1_0083_E04.bCJ002635 
LVRM10083F04LVRM1_0083_F04.bCJ002647 
LVRM10083H09LVRM1_0083_H09.bCJ002673 
LVRM10087A10LVRM1_0087_A10.bCJ002927 
LVRM10087D05LVRM1_0087_D05.bCJ002958 
LVRM10088F10LVRM1_0088_F10.bCJ003071 
LVRM10091G09LVRM1_0091_G09.bCJ003327 
LVRM10091G11LVRM1_0091_G11.bCJ003329 
LVRM10092E08LVRM1_0092_E08.bCJ003391 
LVRM10093A11LVRM1_0093_A11.bCJ003431 
LVRM10093C12LVRM1_0093_C12.bCJ003450 
LVRM10094G07LVRM1_0094_G07.bCJ003560 
LVRM10096A01LVRM1_0096_A01.bCJ003656 
LVRM10096A05LVRM1_0096_A05.bCJ003659 
LVRM10096G10LVRM1_0096_G10.bCJ003715 
LVRM10098E08LVRM1_0098_E08.bCJ003860 
LVRM10101F10LVRM1_0101_F10.bBP140200 
LVRM10102B04LVRM1_0102_B04.bBP138104 
LVRM10102E09LVRM1_0102_E09.bBP139697 
LVRM10105B05LVRM1_0105_B05.bBP449205 
LVRM10106B06LVRM1_0106_B06.bBP449274 
LVRM10107B05LVRM1_0107_B05.bBP449207 
LVRM10107C09LVRM1_0107_C09.bBP450276 
LVRM10107E05LVRM1_0107_E05.bBP451664 
LVRM10108D12LVRM1_0108_D12.bBP451343 
LVRM10108E09LVRM1_0108_E09.bBP451927 
LVRM10111H05LVRM1_0111_H05.bBP454099 
LVRM10113B05LVRM1_0113_B05.bBP449213 
LVRM10117A05LVRM1_0117_A05.bBP448415 
LVRM10119A02LVRM1_0119_A02.bBP448220 
LVRM10121E04LVRM1_0121_E04.bBP451610 
LVRM10121F12LVRM1_0121_F12.bBP452940 
LVRM10122B02LVRM1_0122_B02.bBP449024 
LVRM10122D11LVRM1_0122_D11.bBP451286 
LVRM10122E05LVRM1_0122_E05.bBP451678 
LVRM10123A04LVRM1_0123_A04.bBP448353 
LVRM10128A08LVRM1_0128_A08.bBP448624 
LVRM10128C08LVRM1_0128_C08.bBP450223 
LVRM10129B10LVRM1_0129_B10.bBP449571 
LVRM10130B11LVRM1_0130_B11.bBP449637 
LVRM10133E10LVRM1_0133_E10.bBP452019 
LVRM10134B10LVRM1_0134_B10.bBP449576 
LVRM10134C10LVRM1_0134_C10.bBP450375 
LVRM10135E11LVRM1_0135_E11.bBP452091 
LVRM10136G02LVRM1_0136_G02.bBP453087 
LVRM10139F02LVRM1_0139_F02.bBP452286 
LVRM10139F05LVRM1_0139_F05.bBP452482 
LVRM10139G06LVRM1_0139_G06.bBP453360 
LVRM10142D08LVRM1_0142_D08.bBP451089 
LVRM10143A07LVRM1_0143_A07.bBP448570 
LVRM10143F03LVRM1_0143_F03.bBP452356 
LVRM10145H06LVRM1_0145_H06.bBP454204 
LVRM10146F12LVRM1_0146_F12.bBP452964 
LVRM10147A09LVRM1_0147_A09.bBP448711 
LVRM10147C06LVRM1_0147_C06.bBP450099 
LVRM10147H02LVRM1_0147_H02.bBP453929 
LVRM10148E06LVRM1_0148_E06.bBP451773 
LVRM10148E11LVRM1_0148_E11.bBP452104 
LVRM10149H08LVRM1_0149_H08.bBP454352 
LVRM10150A07LVRM1_0150_A07.bBP448575 
LVRM10150E05LVRM1_0150_E05.bBP451702 
LVRM10151A12LVRM1_0151_A12.bBP448922 
LVRM10151E11LVRM1_0151_E11.bBP452107 
LVRM10152B09LVRM1_0152_B09.bBP449523 
LVRM10152C05LVRM1_0152_C05.bBP450036 
LVRM10152E10LVRM1_0152_E10.bBP452037 
LVRM10156A06LVRM1_0156_A06.bBP448516 
LVRM10156B06LVRM1_0156_B06.bBP449317 
LVRM10158H03LVRM1_0158_H03.bBP454002 
LVRM10159F02LVRM1_0159_F02.bBP452305 
LVRM10159F03LVRM1_0159_F03.bBP452368 
LVRM10159G08LVRM1_0159_G08.bBP453524 
LVRM10160F06LVRM1_0160_F06.bBP452569 
LVRM10161E07LVRM1_0161_E07.bBP451846 
LVRM10162C01LVRM1_0162_C01.bBP449774 
LVRM10163A10LVRM1_0163_A10.bCJ004072 
LVRM10163B11LVRM1_0163_B11.bCJ004081 
LVRM10163D05LVRM1_0163_D05.bCJ004094 
LVRM10163E03LVRM1_0163_E03.bCJ004102 
LVRM10163H05LVRM1_0163_H05.bBW963092 
LVRM10164F12LVRM1_0164_F12.bCJ004203 
LVRM10166D05LVRM1_0166_D05.bCJ004333 
LVRM10166F02LVRM1_0166_F02.bCJ004352 
LVRM10168C11LVRM1_0168_C11.bCJ004483 
LVRM10168F06LVRM1_0168_F06.bCJ004512 
LVRM10168G08LVRM1_0168_G08.bCJ004522 
LVRM10169D08LVRM1_0169_D08.bBW963128 
LVRM10170D10LVRM1_0170_D10.bCJ004657 
LVRM10171C07LVRM1_0171_C07.bCJ004723 
LVRM10171G05LVRM1_0171_G05.bCJ004761 
LVRM10175F11LVRM1_0175_F11.bCJ005067 
LVRM10176C04LVRM1_0176_C04.bCJ005100 
LVRM10176G07LVRM1_0176_G07.bCJ005149 
LVRM10177C07LVRM1_0177_C07.bCJ005190 
LVRM10179D07LVRM1_0179_D07.bCJ005360 
LVRM10181B03LVRM1_0181_B03.bCJ005511 
LVRM10181C04LVRM1_0181_C04.bCJ005520 
LVRM10181G04LVRM1_0181_G04.bBW963191 
LVRM10182G05LVRM1_0182_G05.bCJ005651 
LVRM10183A03LVRM1_0183_A03.bBW963196 
LVRM10184B12LVRM1_0184_B12.bBW963217 
LVRM10184C04LVRM1_0184_C04.bCJ005758 
LVRM10186E02LVRM1_0186_E02.bCJ005958 
LVRM10186G01LVRM1_0186_G01.bCJ005979 
LVRM10186H06LVRM1_0186_H06.bCJ005993 
LVRM10187B02LVRM1_0187_B02.bCJ006011 
LVRM10188E01LVRM1_0188_E01.bCJ006125 
LVRM10188H09LVRM1_0188_H09.bBW963242 
LVRM10191F03LVRM1_0191_F03.bCJ006304 
LVRM10195C10LVRM1_0195_C10.bCJ006586 
LVRM10195C12LVRM1_0195_C12.bCJ006588 
LVRM10195E03LVRM1_0195_E03.bCJ006600 
LVRM10195F11LVRM1_0195_F11.bCJ006619 
LVRM10196F09LVRM1_0196_F09.bCJ006699 
LVRM10197B12LVRM1_0197_B12.bCJ006742 
LVRM10197H12LVRM1_0197_H12.bCJ006812 
LVRM10198A07LVRM1_0198_A07.bCJ006819 
LVRM10198F12LVRM1_0198_F12.bBW963306 
LVRM10199A10LVRM1_0199_A10.bCJ006909 
LVRM10199C09LVRM1_0199_C09.bBW963309 
LVRM10199F08LVRM1_0199_F08.bCJ006959 
LVRM10199G03LVRM1_0199_G03.b  
LVRM10200C11LVRM1_0200_C11.bCJ007010 
LVRM10202B06LVRM1_0202_B06.bCJ007162 
LVRM10202C11LVRM1_0202_C11.bCJ007173 
LVRM10203F02LVRM1_0203_F02.bCJ007281 
LVRM10204G12LVRM1_0204_G12.bCJ007379 
LVRM10205E10LVRM1_0205_E10.bCJ007441 
LVRM10205F07LVRM1_0205_F07.bCJ007447 
LVRM10206F02LVRM1_0206_F02.bCJ007523 
LVRM10207F06LVRM1_0207_F06.bCJ007614 
LVRM10208A06LVRM1_0208_A06.bCJ007646 
LVRM10208D07LVRM1_0208_D07.bCJ007682 
LVRM10208H07LVRM1_0208_H07.bCJ007726 

  

SNPs: 2      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
295C01750.907BSGTC/V
G1800.093GTG/V
423C19920.575MNGCT/A
T0820.425GTT/V


Alignment:      TOP

20110601C-012185 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
LVRM1_0008_G10.b : x
LVRM1_0168_C11.b :
LVRM1_0091_G11.b :
LVRM1_0047_B01.b :
LVRM1_0198_F12.b :
LVRM1_0016_C11.b :
LVRM1_0117_A05.b :
LVRM1_0061_G04.b :
LVRM1_0196_F09.b :
LVRM1_0202_B06.b :
LVRM1_0195_F11.b :
LVRM1_0042_B12.b :
LVRM1_0024_B02.b : ncggcggggggggggggcggccgnttcgacctgccctcccggcccggcgaccgtccgtta
LVRM1_0079_F06.b :
LVRM1_0049_G09.b :
LVRM1_0077_G12.b :
LVR01_0034_E10.b : gttttggttgcxx
LVRM1_0158_H03.b :
LVRM1_0171_G05.b :
LVRM1_0020_A11.b :
LVRM1_0122_B02.b :
LVRM1_0163_H05.b :
LVRM1_0163_D05.b :
LVRM1_0087_D05.b :
LVRM1_0164_F12.b :
LVRM1_0077_B03.b :
LVRM1_0134_B10.b :
LVRM1_0188_E01.b :
LVRM1_0187_B02.b :
LVRM1_0206_F02.b :
LVRM1_0208_A06.b :
LVRM1_0092_E08.b :
LVRM1_0039_D04.b :
LVRM1_0204_G12.b :
LVRM1_0122_E05.b :
LVRM1_0098_E08.b :
LVRM1_0102_B04.b :
LVRM1_0197_H12.b :
LVRM1_0029_B01.b :
LVRM1_0149_H08.b :
LVRM1_0152_B09.b :
LVRM1_0031_D06.b :
LVRM1_0130_B11.b :
LVRM1_0152_E10.b :
LVR01_0105_G08.b : ggggctntgagcttg
LVR01_0030_A05.b : attagggtg
LVRM1_0096_A05.b :
LVRM1_0019_F12.b :
LVRM1_0159_F03.b :
KDN01_0096_D10.b :
LVRM1_0168_G08.b :
LVRM1_0205_E10.b :
LVRM1_0056_A02.b :
LVRM1_0135_E11.b :
LVRM1_0181_B03.b :
LVRM1_0106_B06.b :
LVRM1_0018_D04.b :
LVRM1_0035_G10.b :
LVRM1_0004_D09.b :
LVRM1_0111_H05.b :
LVRM1_0198_A07.b :
LVRM1_0151_A12.b :
LVRM1_0188_H09.b :
LVRM1_0015_A07.b :
LVRM1_0133_E10.b :
LVRM1_0163_B11.b :
LVRM1_0147_H02.b :
LVRM1_0134_C10.b :
LVRM1_0021_A01.b :
LVRM1_0051_H02.b :
LVRM1_0177_C07.b :
LVRM1_0191_F03.b :
LVRM1_0202_C11.b :
LVRM1_0121_F12.b :
LVRM1_0006_C09.b :
LVRM1_0146_F12.b :
LVRM1_0024_C10.b :
LVRM1_0122_D11.b :
LVRM1_0199_A10.b :
LVRM1_0195_C10.b :
LVRM1_0075_H07.b :
LVRM1_0175_F11.b :
LVRM1_0034_A07.b :
LVRM1_0050_E07.b :
LVRM1_0037_H10.b :
LVRM1_0113_B05.b :
LVRM1_0148_E11.b :
LVRM1_0107_C09.b :
LVRM1_0139_F05.b :
LVRM1_0148_E06.b :
LVR01_0053_F01.b :
LVR01_0063_F06.b :
LVR01_0096_B05.b :
LVR01_0068_C08.b :
LVR01_0068_B10.b :
LVRM1_0016_G01.b :
LVRM1_0062_F10.b :
LVRM1_0107_E05.b :
LVRM1_0052_H07.b :
LVRM1_0094_G07.b :
LVRM1_0032_G01.b :
LVR01_0041_B06.b :
LVRM1_0183_A03.b :
LVRM1_0088_F10.b :
LVRM1_0150_E05.b :
LVRM1_0150_A07.b :
LVRM1_0034_G06.b :
LVRM1_0181_G04.b :
LVRM1_0096_G10.b :
LVRM1_0184_B12.b :
LVRM1_0169_D08.b :
LVRM1_0083_A12.b :
LVRM1_0014_H08.b :
LVRM1_0055_H02.b :
LVRM1_0013_B09.b :
LVRM1_0028_E01.b : ccccnnnccccac
LVRM1_0119_A02.b :
LVRM1_0083_H09.b :
LVRM1_0205_F07.b :
LVRM1_0166_D05.b :
LVRM1_0010_A11.b :
LVRM1_0197_B12.b :
LVRM1_0128_A08.b :
LVRM1_0050_E04.b :
LVRM1_0160_F06.b :
LVRM1_0087_A10.b :
LVRM1_0186_E02.b :
LVRM1_0070_H12.b :
LVRM1_0047_B11.b :
LVRM1_0163_E03.b :
LVRM1_0208_D07.b :
LVRM1_0041_E01.b :
LVRM1_0195_E03.b :
LVRM1_0186_H06.b :
LVRM1_0195_C12.b :
LVRM1_0105_B05.b :
LVRM1_0078_G03.b :
LVRM1_0003_D02.b :
LVRM1_0005_C01.b :
LVRM1_0101_F10.b :
LVRM1_0152_C05.b :
LVRM1_0145_H06.b :
LVRM1_0129_B10.b :
LVRM1_0019_A04.b :
LVRM1_0037_H08.b :
LVRM1_0199_F08.b :
LVRM1_0036_B11.b :
LVRM1_0068_C07.b :
LVRM1_0021_F06.b :
LVRM1_0199_C09.b :
LVRM1_0128_C08.b :
LVRM1_0057_H03.b :
LVRM1_0142_D08.b :
LVRM1_0102_E09.b :
LVRM1_0036_B12.b :
LVRM1_0033_E09.b :
LVRM1_0151_E11.b :
LVRM1_0161_E07.b :
LVRM1_0107_B05.b :
LVRM1_0139_G06.b :
LVRM1_0002_E07.b :
LVR01_0016_D08.b :
LVR01_0073_F08.b :
LVR01_0106_C08.b :
LVR01_0077_G05.b :
LVR01_0017_B10.b :
LVR01_0091_A09.b :
LVRM1_0159_F02.b :
LVRM1_0034_H08.b :
LVRM1_0035_H12.b :
LVRM1_0040_C05.b :
LVRM1_0091_G09.b :
LVRM1_0199_G03.b :
LVRM1_0156_B06.b :
LVRM1_0203_F02.b :
LVRM1_0207_F06.b :
LVRM1_0162_C01.b :
LVRM1_0136_G02.b :
LVR01_0019_A05.b :
LVRM1_0208_H07.b :
LVRM1_0139_F02.b :
LVRM1_0200_C11.b :
LVRM1_0093_C12.b :
LVRM1_0168_F06.b :
LVRM1_0083_E04.b :
LVRM1_0184_C04.b :
LVRM1_0143_F03.b :
LVRM1_0001_F09.b :
LVRM1_0023_C03.b :
LVRM1_0121_E04.b :
LVRM1_0123_A04.b :
LVRM1_0083_F04.b :
LVR01_0053_F11.b :
LVRM1_0171_C07.b :
LVR01_0049_A08.b :
LVRM1_0147_A09.b :
LVRM1_0176_G07.b :
LVRM1_0181_C04.b :
LVRM1_0176_C04.b :
LVRM1_0159_G08.b :
LVRM1_0096_A01.b :
LVRM1_0038_C01.b :
LVRM1_0108_E09.b :
LVRM1_0005_D04.b :
LVRM1_0170_D10.b :
LVRM1_0023_H04.b :
LVRM1_0108_D12.b :
LVRM1_0186_G01.b :
LVRM1_0013_H10.b :
LVRM1_0093_A11.b :
LVRM1_0166_F02.b :
LVRM1_0028_C05.b :
LVRM1_0036_B10.b :
LVRM1_0143_A07.b :
LVRM1_0051_F03.b :
LVRM1_0072_C03.b :
LVRM1_0182_G05.b :
LVRM1_0156_A06.b :
LVRM1_0049_E04.b :
LVRM1_0005_A03.b :
LVRM1_0044_H08.b :
LVRM1_0179_D07.b :
LVRM1_0147_C06.b :
LVRM1_0163_A10.b :
LVR01_0003_E12.b :
LVR01_0093_A11.b :
LVRM1_0007_D03.b :
20110601C-012185 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
LVRM1_0008_G10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0168_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0091_G11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_B01.b : agttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0198_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0016_C11.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0117_A05.b : agtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0061_G04.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0196_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0202_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0195_F11.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0042_B12.b : ttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0024_B02.b : tgtgcccngccccattgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0079_F06.b : ttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_G09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_G12.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0034_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0158_H03.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0171_G05.b : agttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0020_A11.b : acgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0122_B02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0163_H05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0163_D05.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0087_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0164_F12.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0077_B03.b : agttgacatxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0134_B10.b : nagttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0188_E01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0187_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0206_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0208_A06.b : gggxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0092_E08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_D04.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0204_G12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0122_E05.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0098_E08.b : gagttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0102_B04.b : cagtgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0197_H12.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0029_B01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0149_H08.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0152_B09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0031_D06.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0130_B11.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0152_E10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0105_G08.b : tgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0030_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0096_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_F12.b : cgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0159_F03.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0096_D10.b : nnnnc
LVRM1_0168_G08.b : xxxxxxxxxxxxxxxxxxxx
LVRM1_0205_E10.b : xxxxxxxxxxxxxxxxxxxxxx
LVRM1_0056_A02.b : agttgacx
LVRM1_0135_E11.b :
LVRM1_0181_B03.b :
LVRM1_0106_B06.b :
LVRM1_0018_D04.b :
LVRM1_0035_G10.b :
LVRM1_0004_D09.b :
LVRM1_0111_H05.b :
LVRM1_0198_A07.b :
LVRM1_0151_A12.b :
LVRM1_0188_H09.b :
LVRM1_0015_A07.b :
LVRM1_0133_E10.b :
LVRM1_0163_B11.b :
LVRM1_0147_H02.b :
LVRM1_0134_C10.b :
LVRM1_0021_A01.b :
LVRM1_0051_H02.b :
LVRM1_0177_C07.b :
LVRM1_0191_F03.b :
LVRM1_0202_C11.b :
LVRM1_0121_F12.b :
LVRM1_0006_C09.b : cx
LVRM1_0146_F12.b :
LVRM1_0024_C10.b :
LVRM1_0122_D11.b :
LVRM1_0199_A10.b :
LVRM1_0195_C10.b :
LVRM1_0075_H07.b :
LVRM1_0175_F11.b :
LVRM1_0034_A07.b :
LVRM1_0050_E07.b :
LVRM1_0037_H10.b :
LVRM1_0113_B05.b :
LVRM1_0148_E11.b :
LVRM1_0107_C09.b :
LVRM1_0139_F05.b :
LVRM1_0148_E06.b :
LVR01_0053_F01.b : tgttttttttttattagcatagtgxxxxxxxxxxx
LVR01_0063_F06.b : gagctccccgagcatagtgxxxxxxxxxxx
LVR01_0096_B05.b : tggttttttcggattggtgxxxxxxxxxxxx
LVR01_0068_C08.b : gcatatagggtgcxxxxxxxxxxx
LVR01_0068_B10.b : tttgtgtttttatacgctacgtgxxx
LVRM1_0016_G01.b :
LVRM1_0062_F10.b :
LVRM1_0107_E05.b :
LVRM1_0052_H07.b :
LVRM1_0094_G07.b :
LVRM1_0032_G01.b :
LVR01_0041_B06.b : tttttaggcttagtgxxxxxx
LVRM1_0183_A03.b :
LVRM1_0088_F10.b :
LVRM1_0150_E05.b :
LVRM1_0150_A07.b :
LVRM1_0034_G06.b :
LVRM1_0181_G04.b :
LVRM1_0096_G10.b :
LVRM1_0184_B12.b : ccttttgtcxxxxxxxxxxxxxxxxxxxxx
LVRM1_0169_D08.b :
LVRM1_0083_A12.b :
LVRM1_0014_H08.b :
LVRM1_0055_H02.b :
LVRM1_0013_B09.b :
LVRM1_0028_E01.b : ccccnnncnnnnncccnngcgccctngccaaaaatccgcccncgcnnncccccccccccc
LVRM1_0119_A02.b :
LVRM1_0083_H09.b :
LVRM1_0205_F07.b :
LVRM1_0166_D05.b :
LVRM1_0010_A11.b :
LVRM1_0197_B12.b :
LVRM1_0128_A08.b :
LVRM1_0050_E04.b :
LVRM1_0160_F06.b :
LVRM1_0087_A10.b :
LVRM1_0186_E02.b :
LVRM1_0070_H12.b :
LVRM1_0047_B11.b :
LVRM1_0163_E03.b :
LVRM1_0208_D07.b :
LVRM1_0041_E01.b :
LVRM1_0195_E03.b :
LVRM1_0186_H06.b :
LVRM1_0195_C12.b :
LVRM1_0105_B05.b :
LVRM1_0078_G03.b :
LVRM1_0003_D02.b :
LVRM1_0005_C01.b :
LVRM1_0101_F10.b :
LVRM1_0152_C05.b :
LVRM1_0145_H06.b :
LVRM1_0129_B10.b :
LVRM1_0019_A04.b :
LVRM1_0037_H08.b :
LVRM1_0199_F08.b :
LVRM1_0036_B11.b :
LVRM1_0068_C07.b :
LVRM1_0021_F06.b :
LVRM1_0199_C09.b :
LVRM1_0128_C08.b :
LVRM1_0057_H03.b :
LVRM1_0142_D08.b :
LVRM1_0102_E09.b :
LVRM1_0036_B12.b :
LVRM1_0033_E09.b :
LVRM1_0151_E11.b :
LVRM1_0161_E07.b :
LVRM1_0107_B05.b :
LVRM1_0139_G06.b :
LVRM1_0002_E07.b :
LVR01_0016_D08.b : cxxxxxxxxxxxxxxxxxx
LVR01_0073_F08.b : gcctatacgtgxxxxxxxx
LVR01_0106_C08.b : gggggtttncagcattgtgxxxxxxx
LVR01_0077_G05.b : ggcttatagggtgxxxxxxxxx
LVR01_0017_B10.b : cxxxxxxxxxxxxxxxxxx
LVR01_0091_A09.b : tcgtttaacggaacagtgxxxxxxxx
LVRM1_0159_F02.b :
LVRM1_0034_H08.b :
LVRM1_0035_H12.b :
LVRM1_0040_C05.b :
LVRM1_0091_G09.b :
LVRM1_0199_G03.b :
LVRM1_0156_B06.b :
LVRM1_0203_F02.b :
LVRM1_0207_F06.b :
LVRM1_0162_C01.b :
LVRM1_0136_G02.b :
LVR01_0019_A05.b : ccat
LVRM1_0208_H07.b :
LVRM1_0139_F02.b :
LVRM1_0200_C11.b :
LVRM1_0093_C12.b :
LVRM1_0168_F06.b :
LVRM1_0083_E04.b :
LVRM1_0184_C04.b :
LVRM1_0143_F03.b :
LVRM1_0001_F09.b :
LVRM1_0023_C03.b :
LVRM1_0121_E04.b : tagttgtcx
LVRM1_0123_A04.b :
LVRM1_0083_F04.b :
LVR01_0053_F11.b :
LVRM1_0171_C07.b :
LVR01_0049_A08.b :
LVRM1_0147_A09.b :
LVRM1_0176_G07.b :
LVRM1_0181_C04.b :
LVRM1_0176_C04.b :
LVRM1_0159_G08.b :
LVRM1_0096_A01.b :
LVRM1_0038_C01.b :
LVRM1_0108_E09.b :
LVRM1_0005_D04.b :
LVRM1_0170_D10.b :
LVRM1_0023_H04.b :
LVRM1_0108_D12.b :
LVRM1_0186_G01.b :
LVRM1_0013_H10.b :
LVRM1_0093_A11.b :
LVRM1_0166_F02.b :
LVRM1_0028_C05.b :
LVRM1_0036_B10.b :
LVRM1_0143_A07.b :
LVRM1_0051_F03.b :
LVRM1_0072_C03.b :
LVRM1_0182_G05.b :
LVRM1_0156_A06.b :
LVRM1_0049_E04.b :
LVRM1_0005_A03.b :
LVRM1_0044_H08.b :
LVRM1_0179_D07.b :
LVRM1_0147_C06.b :
LVRM1_0163_A10.b :
LVR01_0003_E12.b :
LVR01_0093_A11.b :
LVRM1_0007_D03.b :
20110601C-012185 : ....TTGTGCATGTGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
---------+---------+---------+---------+---------+---------+ 56
LVRM1_0008_G10.b : xxxxTTGTGCATGTGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0168_C11.b : xxxxxxxxxxATGTGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0091_G11.b : xxxxxxgtgcATGTGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0047_B01.b : xxxxxxxgggATGTGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0198_F12.b : xxxxxxxxxtgTGTGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0016_C11.b : xxxxxxxxxxxTGTGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0117_A05.b : xxxxxxxxxxxTGTGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0061_G04.b : xxxxxxxxxxxTGTGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0196_F09.b : xxxxxxxxxxxTGTGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0202_B06.b : xxxxxxxxxxxTGTGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0195_F11.b : xxxxxxxxxxxTGTGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0042_B12.b : xxxxxxxxxxxTGTGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0024_B02.b : xxxxxxxxxxgTGTGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0079_F06.b : xxxxxxxxxxxTGTGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0049_G09.b : xxxxxxxxxxxTGTGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0077_G12.b : xxxxxxxxxxxTGTGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVR01_0034_E10.b : xxxxxxxxxxxTGTGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0158_H03.b : xxxxxxxxxxxxGTGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0171_G05.b : xxxxxxxxxxxxGTGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0020_A11.b : xxxxxxxxxxxxGTGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0122_B02.b : xxxxxxxxxxxxGTGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0163_H05.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0163_D05.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0087_D05.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0164_F12.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0077_B03.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0134_B10.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0188_E01.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0187_B02.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0206_F02.b : xxttggcctactggGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0208_A06.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0092_E08.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0039_D04.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0204_G12.b : xxxxxxxxxxgtggGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0122_E05.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0098_E08.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0102_B04.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0197_H12.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0029_B01.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0149_H08.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0152_B09.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0031_D06.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACCTCTCCGCCGTGGTATCC
LVRM1_0130_B11.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0152_E10.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVR01_0105_G08.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVR01_0030_A05.b : xxxxxxxxxxxxxxGTGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0096_A05.b : xxxxxxxxxxxxxxxxGTGTTTAAGGAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0019_F12.b : xxxxxxxxxxxxxxxxGTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0159_F03.b : xxxxxxxxxxxxxgttcTGTTTAAGAAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
KDN01_0096_D10.b : ctgctgtggctatggggggtgtttagAAATCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0168_G08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0205_E10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTGTATATAAACTTCTCCGCCGTGGTATCC
LVRM1_0056_A02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTGGTATCC
LVRM1_0135_E11.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxct
LVRM1_0181_B03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0106_B06.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0018_D04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_G10.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0004_D09.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0111_H05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0198_A07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0151_A12.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0188_H09.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0015_A07.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0133_E10.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0163_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0147_H02.b : cagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0134_C10.b : ncgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_A01.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0051_H02.b : tagtttgtacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0177_C07.b : axxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0191_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0202_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0121_F12.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0006_C09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0146_F12.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0024_C10.b : cgttgatcaaagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0122_D11.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0199_A10.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0195_C10.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0075_H07.b : cgttgatcaaagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0175_F11.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_A07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0050_E07.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0037_H10.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0113_B05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0148_E11.b : nxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0107_C09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0139_F05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0148_E06.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0053_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0063_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0096_B05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0068_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0016_G01.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0062_F10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0107_E05.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0052_H07.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0094_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0032_G01.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0041_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0183_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0088_F10.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0150_E05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0150_A07.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_G06.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0181_G04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0096_G10.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0184_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0169_D08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0083_A12.b : agtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0014_H08.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0055_H02.b : tcagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0013_B09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0028_E01.b : cccaccatttgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0119_A02.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0083_H09.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0205_F07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0166_D05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0010_A11.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0197_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_A08.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0050_E04.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0160_F06.b : tagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0087_A10.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0186_E02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0070_H12.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0047_B11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0163_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0208_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0041_E01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0195_E03.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0186_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0195_C12.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0105_B05.b : naatgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0078_G03.b : agttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0003_D02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0005_C01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0101_F10.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0152_C05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0145_H06.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0129_B10.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0019_A04.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0037_H08.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0199_F08.b : gcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0036_B11.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0068_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0021_F06.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0199_C09.b : ccgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0128_C08.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0057_H03.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0142_D08.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0102_E09.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0036_B12.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0033_E09.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0151_E11.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0161_E07.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0107_B05.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0139_G06.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0002_E07.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0016_D08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0073_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0106_C08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0077_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0017_B10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0091_A09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0159_F02.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0034_H08.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0035_H12.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0040_C05.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0091_G09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0199_G03.b : tcgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0156_B06.b : cgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0203_F02.b : gggxxxxxxxxxxxxxxxxx
LVRM1_0207_F06.b : xxxxxxxxxxxxxxxxxxxxx
LVRM1_0162_C01.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0136_G02.b : cagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0019_A05.b : gtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0208_H07.b : xxxxxxxxxxx
LVRM1_0139_F02.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0200_C11.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0093_C12.b : xxxxxxxxxxxxxxxxxx
LVRM1_0168_F06.b : xxxxxxxxxxxxxxxxxxxxx
LVRM1_0083_E04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0184_C04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0143_F03.b : ncgttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0001_F09.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0023_C03.b :
LVRM1_0121_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgtgtgttt
LVRM1_0123_A04.b :
LVRM1_0083_F04.b :
LVR01_0053_F11.b :
LVRM1_0171_C07.b :
LVR01_0049_A08.b :
LVRM1_0147_A09.b :
LVRM1_0176_G07.b :
LVRM1_0181_C04.b :
LVRM1_0176_C04.b :
LVRM1_0159_G08.b :
LVRM1_0096_A01.b :
LVRM1_0038_C01.b :
LVRM1_0108_E09.b :
LVRM1_0005_D04.b :
LVRM1_0170_D10.b :
LVRM1_0023_H04.b :
LVRM1_0108_D12.b :
LVRM1_0186_G01.b :
LVRM1_0013_H10.b :
LVRM1_0093_A11.b :
LVRM1_0166_F02.b :
LVRM1_0028_C05.b :
LVRM1_0036_B10.b :
LVRM1_0143_A07.b :
LVRM1_0051_F03.b :
LVRM1_0072_C03.b :
LVRM1_0182_G05.b :
LVRM1_0156_A06.b :
LVRM1_0049_E04.b :
LVRM1_0005_A03.b :
LVRM1_0044_H08.b :
LVRM1_0179_D07.b :
LVRM1_0147_C06.b :
LVRM1_0163_A10.b :
LVR01_0003_E12.b :
LVR01_0093_A11.b :
LVRM1_0007_D03.b :
20110601C-012185 : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
---------+---------+---------+---------+---------+---------+ 116
LVRM1_0008_G10.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0168_C11.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0091_G11.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0047_B01.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0198_F12.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0016_C11.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0117_A05.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0061_G04.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0196_F09.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0202_B06.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0195_F11.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0042_B12.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0024_B02.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0079_F06.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0049_G09.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0077_G12.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVR01_0034_E10.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0158_H03.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0171_G05.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0020_A11.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0122_B02.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0163_H05.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0163_D05.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0087_D05.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0164_F12.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0077_B03.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0134_B10.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0188_E01.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0187_B02.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0206_F02.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0208_A06.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0092_E08.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0039_D04.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0204_G12.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0122_E05.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0098_E08.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0102_B04.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0197_H12.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0029_B01.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0149_H08.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0152_B09.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0031_D06.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0130_B11.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0152_E10.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVR01_0105_G08.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVR01_0030_A05.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0096_A05.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0019_F12.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0159_F03.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
KDN01_0096_D10.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0168_G08.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0205_E10.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0056_A02.b : AGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0135_E11.b : gGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0181_B03.b : xGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0106_B06.b : gGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0018_D04.b : xGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0035_G10.b : xGAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTGCTCAATGCAGTGCCGCTTT
LVRM1_0004_D09.b : xGAGCAAGGCATGGTTTTCACTTTTTA*CAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0111_H05.b : xxAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0198_A07.b : xxAGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0151_A12.b : xxAGCAAGGCATGGTTTTCACTTTTTA*CAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0188_H09.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0015_A07.b : xxxGCAAGGCATGGTTTTCACTTTTTA*CAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0133_E10.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0163_B11.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0147_H02.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0134_C10.b : xtgGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0021_A01.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0051_H02.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0177_C07.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0191_F03.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0202_C11.b : xxtGGAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0121_F12.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0006_C09.b : xxtGGAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0146_F12.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0024_C10.b : xxxGCAAGGCATGGTTTTCACTTTTTA*CAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0122_D11.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0199_A10.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0195_C10.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0075_H07.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0175_F11.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0034_A07.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0050_E07.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAGTGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0037_H10.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0113_B05.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0148_E11.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0107_C09.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0139_F05.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0148_E06.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCTGCTTT
LVR01_0053_F01.b : xxgGGAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVR01_0063_F06.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVR01_0096_B05.b : xctGGAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVR01_0068_C08.b : xxxGCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVR01_0068_B10.b : xxxxCAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0016_G01.b : xxxxxAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0062_F10.b : xxxxxAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0107_E05.b : xxxxxAAGGCATGGTTTTCACTTTTTA*CAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0052_H07.b : xxxxxAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0094_G07.b : xxggaAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0032_G01.b : xxxxxAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVR01_0041_B06.b : xxxxxAAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0183_A03.b : xxxxxtAGGCATGGTTATCCCTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0088_F10.b : xxxxxxAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0150_E05.b : xxxxxtAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0150_A07.b : xxxxxtAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0034_G06.b : xxxxxxAGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0181_G04.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0096_G10.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0184_B12.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0169_D08.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0083_A12.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0014_H08.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0055_H02.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0013_B09.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0028_E01.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0119_A02.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0083_H09.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0205_F07.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0166_D05.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0010_A11.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0197_B12.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0128_A08.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0050_E04.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0160_F06.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0087_A10.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0186_E02.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0070_H12.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0047_B11.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0163_E03.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0208_D07.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0041_E01.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0195_E03.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0186_H06.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0195_C12.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0105_B05.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0078_G03.b : xxxxxxxGGCATGGTTTTCACTTTTTA*CAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0003_D02.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0005_C01.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGGGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0101_F10.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0152_C05.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0145_H06.b : xxxxxxxGGCATGGTTTTCACTTTTTA*CAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0129_B10.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0019_A04.b : xxxxxxxGGCATGGTTTTCACTTTTTA*CAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0037_H08.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0199_F08.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0036_B11.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0068_C07.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0021_F06.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0199_C09.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0128_C08.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0057_H03.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0142_D08.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0102_E09.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0036_B12.b : xxxgctcGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0033_E09.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0151_E11.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0161_E07.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0107_B05.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0139_G06.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0002_E07.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTACCGCTTT
LVR01_0016_D08.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVR01_0073_F08.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVR01_0106_C08.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVR01_0077_G05.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVR01_0017_B10.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVR01_0091_A09.b : xxxxxxxGGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0159_F02.b : xxxxxxtcGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0034_H08.b : xxxxxxxtGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0035_H12.b : xxxgctacGCATGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0040_C05.b : xxxxxxxxxtcTGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0091_G09.b : xxxxxxxxxxxTGGTTTTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0199_G03.b : xtcccaagcatggaaaaTCACTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0156_B06.b : xxxxxxxxxxxxxxxxxxxxCTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0203_F02.b : xxxxxxxxxxxxxxxxxxxxxTTTTTTACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0207_F06.b : xxxxxxxxxxxxxxxxxxtttTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0162_C01.b : xxxxxxxxxxxxxxxxxxxxtTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0136_G02.b : xxxxxxxxxxxxxxxxxxxxxTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVR01_0019_A05.b : xxxxxxxxxxxxxxxxxxxxxTTTTTAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0208_H07.b : xxxxxxxxxxxxxxxxxxxxxxxTTTTACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0139_F02.b : xxxxxxxxxxxxxxxxxxxxxxxxggAACAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0200_C11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxcCAAAATGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0093_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0168_F06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0083_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0184_C04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0143_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0001_F09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGAGGTTACTCAATGCAGTGCCGCTTT
LVRM1_0023_C03.b : gaggtagCTCAGTGCGGTGCCGCTTT
LVRM1_0121_E04.b : aagaaaatctgtatataaacttctccgccgtggtatccagagcaaggcatggttttcact
LVRM1_0123_A04.b : tagttgtcxxxxxxxxxxxxxxx
LVRM1_0083_F04.b : agttgtcxxxxxxxxxxxxxx
LVR01_0053_F11.b :
LVRM1_0171_C07.b :
LVR01_0049_A08.b :
LVRM1_0147_A09.b :
LVRM1_0176_G07.b :
LVRM1_0181_C04.b :
LVRM1_0176_C04.b :
LVRM1_0159_G08.b :
LVRM1_0096_A01.b :
LVRM1_0038_C01.b :
LVRM1_0108_E09.b :
LVRM1_0005_D04.b :
LVRM1_0170_D10.b :
LVRM1_0023_H04.b :
LVRM1_0108_D12.b :
LVRM1_0186_G01.b :
LVRM1_0013_H10.b :
LVRM1_0093_A11.b :
LVRM1_0166_F02.b :
LVRM1_0028_C05.b :
LVRM1_0036_B10.b :
LVRM1_0143_A07.b :
LVRM1_0051_F03.b :
LVRM1_0072_C03.b :
LVRM1_0182_G05.b :
LVRM1_0156_A06.b :
LVRM1_0049_E04.b :
LVRM1_0005_A03.b :
LVRM1_0044_H08.b :
LVRM1_0179_D07.b :
LVRM1_0147_C06.b :
LVRM1_0163_A10.b :
LVR01_0003_E12.b :
LVR01_0093_A11.b :
LVRM1_0007_D03.b :
20110601C-012185 : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
---------+---------+---------+---------+---------+---------+ 176
LVRM1_0008_G10.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0168_C11.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0091_G11.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0047_B01.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0198_F12.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0016_C11.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0117_A05.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0061_G04.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0196_F09.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0202_B06.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0195_F11.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0042_B12.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0024_B02.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0079_F06.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0049_G09.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0077_G12.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVR01_0034_E10.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0158_H03.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0171_G05.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0020_A11.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0122_B02.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0163_H05.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0163_D05.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0087_D05.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0164_F12.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0077_B03.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0134_B10.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0188_E01.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0187_B02.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0206_F02.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0208_A06.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0092_E08.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0039_D04.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0204_G12.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0122_E05.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0098_E08.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0102_B04.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGGTG
LVRM1_0197_H12.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0029_B01.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0149_H08.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0152_B09.b : TCGTCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0031_D06.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0130_B11.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0152_E10.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVR01_0105_G08.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVR01_0030_A05.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0096_A05.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0019_F12.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0159_F03.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
KDN01_0096_D10.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0168_G08.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0205_E10.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0056_A02.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0135_E11.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0181_B03.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0106_B06.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0018_D04.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0035_G10.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0004_D09.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0111_H05.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0198_A07.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0151_A12.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0188_H09.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0015_A07.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0133_E10.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0163_B11.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0147_H02.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0134_C10.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0021_A01.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0051_H02.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0177_C07.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0191_F03.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0202_C11.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0121_F12.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0006_C09.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0146_F12.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0024_C10.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0122_D11.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0199_A10.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0195_C10.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0075_H07.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0175_F11.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0034_A07.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0050_E07.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0037_H10.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0113_B05.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0148_E11.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0107_C09.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0139_F05.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0148_E06.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVR01_0053_F01.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVR01_0063_F06.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVR01_0096_B05.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVR01_0068_C08.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVR01_0068_B10.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0016_G01.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0062_F10.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0107_E05.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0052_H07.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0094_G07.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0032_G01.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVR01_0041_B06.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0183_A03.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0088_F10.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0150_E05.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0150_A07.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0034_G06.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0181_G04.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0096_G10.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0184_B12.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0169_D08.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0083_A12.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0014_H08.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0055_H02.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0013_B09.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0028_E01.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGGCGATG
LVRM1_0119_A02.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0083_H09.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0205_F07.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0166_D05.b : TCGTCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0010_A11.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0197_B12.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0128_A08.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0050_E04.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0160_F06.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0087_A10.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0186_E02.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0070_H12.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0047_B11.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0163_E03.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0208_D07.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0041_E01.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0195_E03.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0186_H06.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0195_C12.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0105_B05.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0078_G03.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0003_D02.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0005_C01.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0101_F10.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0152_C05.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0145_H06.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0129_B10.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0019_A04.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0037_H08.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0199_F08.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0036_B11.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0068_C07.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0021_F06.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0199_C09.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0128_C08.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0057_H03.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0142_D08.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0102_E09.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0036_B12.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0033_E09.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0151_E11.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0161_E07.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0107_B05.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0139_G06.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0002_E07.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVR01_0016_D08.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVR01_0073_F08.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVR01_0106_C08.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVR01_0077_G05.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVR01_0017_B10.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVR01_0091_A09.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0159_F02.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0034_H08.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0035_H12.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0040_C05.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0091_G09.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0199_G03.b : TCCTCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0156_B06.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0203_F02.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0207_F06.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0162_C01.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0136_G02.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVR01_0019_A05.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0208_H07.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0139_F02.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0200_C11.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0093_C12.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0168_F06.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0083_E04.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0184_C04.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0143_F03.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0001_F09.b : TCATCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0023_C03.b : TCGTCCTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0121_E04.b : ttttaaTTTTGATCACATTGCAGTGTTCCCGTGCTGTGAGTCCCACAGGCTGTGACGATG
LVRM1_0123_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGTCCCACAGGCTGTGACGATG
LVRM1_0083_F04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCCCACAGGCTGTGACGATG
LVR01_0053_F11.b : ttttttttttttttttggcttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0171_C07.b : n
LVR01_0049_A08.b : gccttttggtccnxxxxxxxxxx
LVRM1_0147_A09.b :
LVRM1_0176_G07.b :
LVRM1_0181_C04.b :
LVRM1_0176_C04.b :
LVRM1_0159_G08.b :
LVRM1_0096_A01.b :
LVRM1_0038_C01.b :
LVRM1_0108_E09.b :
LVRM1_0005_D04.b :
LVRM1_0170_D10.b :
LVRM1_0023_H04.b :
LVRM1_0108_D12.b :
LVRM1_0186_G01.b :
LVRM1_0013_H10.b :
LVRM1_0093_A11.b :
LVRM1_0166_F02.b :
LVRM1_0028_C05.b :
LVRM1_0036_B10.b :
LVRM1_0143_A07.b :
LVRM1_0051_F03.b :
LVRM1_0072_C03.b :
LVRM1_0182_G05.b :
LVRM1_0156_A06.b :
LVRM1_0049_E04.b :
LVRM1_0005_A03.b :
LVRM1_0044_H08.b :
LVRM1_0179_D07.b :
LVRM1_0147_C06.b :
LVRM1_0163_A10.b :
LVR01_0003_E12.b :
LVR01_0093_A11.b :
LVRM1_0007_D03.b :
20110601C-012185 : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
---------+---------+---------+---------+---------+---------+ 236
LVRM1_0008_G10.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0168_C11.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0091_G11.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGAACGGCTACC
LVRM1_0047_B01.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0198_F12.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0016_C11.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0117_A05.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0061_G04.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0196_F09.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0202_B06.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0195_F11.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0042_B12.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0024_B02.b : CTGAGCCTGTGGCCAGAAAAGCTCTATACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0079_F06.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0049_G09.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0077_G12.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVR01_0034_E10.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0158_H03.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0171_G05.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0020_A11.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTG*TCAATAAAGGACGATGGGACGGCTACC
LVRM1_0122_B02.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0163_H05.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0163_D05.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0087_D05.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0164_F12.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0077_B03.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0134_B10.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0188_E01.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0187_B02.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0206_F02.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0208_A06.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0092_E08.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0039_D04.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0204_G12.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0122_E05.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0098_E08.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0102_B04.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0197_H12.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0029_B01.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0149_H08.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0152_B09.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0031_D06.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0130_B11.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0152_E10.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVR01_0105_G08.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVR01_0030_A05.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0096_A05.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0019_F12.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0159_F03.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
KDN01_0096_D10.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0168_G08.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0205_E10.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0056_A02.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0135_E11.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0181_B03.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0106_B06.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0018_D04.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0035_G10.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0004_D09.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0111_H05.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0198_A07.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0151_A12.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTGCC
LVRM1_0188_H09.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0015_A07.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0133_E10.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0163_B11.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0147_H02.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0134_C10.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0021_A01.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0051_H02.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0177_C07.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0191_F03.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0202_C11.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0121_F12.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0006_C09.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0146_F12.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0024_C10.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0122_D11.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0199_A10.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0195_C10.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0075_H07.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0175_F11.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0034_A07.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0050_E07.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0037_H10.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0113_B05.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0148_E11.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0107_C09.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0139_F05.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0148_E06.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGAGACGGCTACC
LVR01_0053_F01.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVR01_0063_F06.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVR01_0096_B05.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVR01_0068_C08.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVR01_0068_B10.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0016_G01.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0062_F10.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0107_E05.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0052_H07.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0094_G07.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0032_G01.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVR01_0041_B06.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0183_A03.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAACGACGATGGGACGGCTACC
LVRM1_0088_F10.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0150_E05.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0150_A07.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0034_G06.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0181_G04.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0096_G10.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0184_B12.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0169_D08.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0083_A12.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0014_H08.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0055_H02.b : CTGAGCCTGCGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0013_B09.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0028_E01.b : CTGAGCCTGTGGCCACAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0119_A02.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0083_H09.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0205_F07.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0166_D05.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0010_A11.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0197_B12.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0128_A08.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0050_E04.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0160_F06.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0087_A10.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0186_E02.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0070_H12.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0047_B11.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0163_E03.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0208_D07.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0041_E01.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0195_E03.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0186_H06.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0195_C12.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0105_B05.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0078_G03.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0003_D02.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0005_C01.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0101_F10.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0152_C05.b : CTGAGCCTGTAGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0145_H06.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0129_B10.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0019_A04.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0037_H08.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0199_F08.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0036_B11.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0068_C07.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0021_F06.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0199_C09.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGGCCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0128_C08.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0057_H03.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0142_D08.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0102_E09.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0036_B12.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0033_E09.b : CTGAGCCTGTGGCCAGAAAAGCTCTGGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0151_E11.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0161_E07.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0107_B05.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0139_G06.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0002_E07.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCCGATCAATAAAGGACGATGGGACGGCTACC
LVR01_0016_D08.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVR01_0073_F08.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVR01_0106_C08.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVR01_0077_G05.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVR01_0017_B10.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCCACC
LVR01_0091_A09.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0159_F02.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0034_H08.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0035_H12.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0040_C05.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0091_G09.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0199_G03.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0156_B06.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0203_F02.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0207_F06.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0162_C01.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0136_G02.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVR01_0019_A05.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0208_H07.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0139_F02.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0200_C11.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0093_C12.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0168_F06.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0083_E04.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0184_C04.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0143_F03.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTATC
LVRM1_0001_F09.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0023_C03.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0121_E04.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0123_A04.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVRM1_0083_F04.b : CTGAGCCTGTGGCCAGAAAAGCTCTAGACCTGATCAATAAAGGACGATGGGACGGCTACC
LVR01_0053_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtAAGGACGATGGGACGGCTACC
LVRM1_0171_C07.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxC
LVR01_0049_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0147_A09.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_G07.b :
LVRM1_0181_C04.b :
LVRM1_0176_C04.b :
LVRM1_0159_G08.b :
LVRM1_0096_A01.b :
LVRM1_0038_C01.b :
LVRM1_0108_E09.b :
LVRM1_0005_D04.b :
LVRM1_0170_D10.b :
LVRM1_0023_H04.b :
LVRM1_0108_D12.b :
LVRM1_0186_G01.b :
LVRM1_0013_H10.b :
LVRM1_0093_A11.b :
LVRM1_0166_F02.b :
LVRM1_0028_C05.b :
LVRM1_0036_B10.b :
LVRM1_0143_A07.b :
LVRM1_0051_F03.b :
LVRM1_0072_C03.b :
LVRM1_0182_G05.b :
LVRM1_0156_A06.b :
LVRM1_0049_E04.b :
LVRM1_0005_A03.b :
LVRM1_0044_H08.b :
LVRM1_0179_D07.b :
LVRM1_0147_C06.b :
LVRM1_0163_A10.b :
LVR01_0003_E12.b :
LVR01_0093_A11.b :
LVRM1_0007_D03.b :
20110601C-012185 : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
---------+---------+---------+---------+---------+---------+ 296
LVRM1_0008_G10.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0168_C11.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0091_G11.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0047_B01.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0198_F12.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0016_C11.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0117_A05.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0061_G04.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0196_F09.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0202_B06.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0195_F11.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0042_B12.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0024_B02.b : TTTTCCAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0079_F06.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0049_G09.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0077_G12.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVR01_0034_E10.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTGT
LVRM1_0158_H03.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0171_G05.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0020_A11.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0122_B02.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0163_H05.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0163_D05.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0087_D05.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0164_F12.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0077_B03.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0134_B10.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0188_E01.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0187_B02.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0206_F02.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0208_A06.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0092_E08.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0039_D04.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0204_G12.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0122_E05.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0098_E08.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0102_B04.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0197_H12.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0029_B01.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0149_H08.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0152_B09.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0031_D06.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0130_B11.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0152_E10.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVR01_0105_G08.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTGT
LVR01_0030_A05.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTGT
LVRM1_0096_A05.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0019_F12.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0159_F03.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACTAATCGGAATCTACCGCTGTCT
KDN01_0096_D10.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTGT
LVRM1_0168_G08.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0205_E10.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0056_A02.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0135_E11.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0181_B03.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0106_B06.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0018_D04.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0035_G10.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0004_D09.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0111_H05.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0198_A07.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0151_A12.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0188_H09.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0015_A07.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0133_E10.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0163_B11.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0147_H02.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0134_C10.b : TTTTCGAGTTGCTGCGGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0021_A01.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0051_H02.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0177_C07.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0191_F03.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0202_C11.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGAAATCTACCGCTGTCT
LVRM1_0121_F12.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0006_C09.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0146_F12.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0024_C10.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0122_D11.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0199_A10.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0195_C10.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0075_H07.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0175_F11.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0034_A07.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0050_E07.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0037_H10.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0113_B05.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0148_E11.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0107_C09.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0139_F05.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0148_E06.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVR01_0053_F01.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTGT
LVR01_0063_F06.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTGT
LVR01_0096_B05.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTGT
LVR01_0068_C08.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTGT
LVR01_0068_B10.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTGT
LVRM1_0016_G01.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0062_F10.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0107_E05.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0052_H07.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0094_G07.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0032_G01.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGCCT
LVR01_0041_B06.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTGT
LVRM1_0183_A03.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0088_F10.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0150_E05.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0150_A07.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0034_G06.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0181_G04.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0096_G10.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0184_B12.b : TTTTCAAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0169_D08.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0083_A12.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0014_H08.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0055_H02.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0013_B09.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0028_E01.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0119_A02.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0083_H09.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0205_F07.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0166_D05.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0010_A11.b : TCTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0197_B12.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACGAATCGGAATCTACCGCTGTCT
LVRM1_0128_A08.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0050_E04.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0160_F06.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0087_A10.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0186_E02.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0070_H12.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0047_B11.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0163_E03.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0208_D07.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0041_E01.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0195_E03.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0186_H06.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0195_C12.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0105_B05.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0078_G03.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0003_D02.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0005_C01.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0101_F10.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0152_C05.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0145_H06.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0129_B10.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0019_A04.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0037_H08.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0199_F08.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0036_B11.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0068_C07.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0021_F06.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0199_C09.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0128_C08.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0057_H03.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0142_D08.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0102_E09.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0036_B12.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0033_E09.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0151_E11.b : TTTCCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0161_E07.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0107_B05.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0139_G06.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0002_E07.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVR01_0016_D08.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTGT
LVR01_0073_F08.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTGT
LVR01_0106_C08.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTGT
LVR01_0077_G05.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTGT
LVR01_0017_B10.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTGT
LVR01_0091_A09.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTGT
LVRM1_0159_F02.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0034_H08.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0035_H12.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0040_C05.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0091_G09.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0199_G03.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0156_B06.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0203_F02.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0207_F06.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0162_C01.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0136_G02.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVR01_0019_A05.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTGT
LVRM1_0208_H07.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0139_F02.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0200_C11.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0093_C12.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0168_F06.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0083_E04.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0184_C04.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0143_F03.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0001_F09.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0023_C03.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0121_E04.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0123_A04.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0083_F04.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVR01_0053_F11.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTGT
LVRM1_0171_C07.b : TTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVR01_0049_A08.b : xTTTCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAGTCTACCGCTGTGT
LVRM1_0147_A09.b : xxxxCGAGTTGCTGCAGGTTGCTGATGCCCACTTGGACAAATCGGAATCTACCGCTGTCT
LVRM1_0176_G07.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0181_C04.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0176_C04.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0159_G08.b : nagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0096_A01.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0038_C01.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0108_E09.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0005_D04.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0170_D10.b : ttgtcxx
LVRM1_0023_H04.b : gaacagaaacgccggtgacggtgggaaggggagatgag
LVRM1_0108_D12.b :
LVRM1_0186_G01.b :
LVRM1_0013_H10.b :
LVRM1_0093_A11.b :
LVRM1_0166_F02.b :
LVRM1_0028_C05.b :
LVRM1_0036_B10.b :
LVRM1_0143_A07.b :
LVRM1_0051_F03.b :
LVRM1_0072_C03.b :
LVRM1_0182_G05.b :
LVRM1_0156_A06.b :
LVRM1_0049_E04.b :
LVRM1_0005_A03.b :
LVRM1_0044_H08.b :
LVRM1_0179_D07.b :
LVRM1_0147_C06.b :
LVRM1_0163_A10.b :
LVR01_0003_E12.b :
LVR01_0093_A11.b :
LVRM1_0007_D03.b :
20110601C-012185 : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
---------+---------+---------+---------+---------+---------+ 356
LVRM1_0008_G10.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0168_C11.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0091_G11.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0047_B01.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0198_F12.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0016_C11.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0117_A05.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0061_G04.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0196_F09.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0202_B06.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0195_F11.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0042_B12.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0024_B02.b : ATTATTTAGTCTTGCATGCAAAAGAATCACACTGCCCAGTCCTATCCCGGAAGCACTGGG
LVRM1_0079_F06.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0049_G09.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0077_G12.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVR01_0034_E10.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0158_H03.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0171_G05.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0020_A11.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0122_B02.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0163_H05.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0163_D05.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0087_D05.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0164_F12.b : ATTATTTAGGCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0077_B03.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0134_B10.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0188_E01.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0187_B02.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0206_F02.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0208_A06.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0092_E08.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0039_D04.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0204_G12.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0122_E05.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0098_E08.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0102_B04.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0197_H12.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0029_B01.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0149_H08.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0152_B09.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0031_D06.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0130_B11.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0152_E10.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVR01_0105_G08.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVR01_0030_A05.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0096_A05.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0019_F12.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0159_F03.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGTAGCACTGGG
KDN01_0096_D10.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0168_G08.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0205_E10.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGA
LVRM1_0056_A02.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0135_E11.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0181_B03.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0106_B06.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0018_D04.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0035_G10.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0004_D09.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0111_H05.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAATCCTATCCAGGAAGCACTGGG
LVRM1_0198_A07.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0151_A12.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0188_H09.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0015_A07.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0133_E10.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0163_B11.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0147_H02.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0134_C10.b : ATTATTTGGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0021_A01.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0051_H02.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0177_C07.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0191_F03.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0202_C11.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0121_F12.b : ATTATTTAGTCTCGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0006_C09.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0146_F12.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0024_C10.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0122_D11.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0199_A10.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0195_C10.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0075_H07.b : ATTATTTAGTCTTGCATGTAAAAGGATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0175_F11.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0034_A07.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0050_E07.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0037_H10.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0113_B05.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0148_E11.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0107_C09.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0139_F05.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0148_E06.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVR01_0053_F01.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVR01_0063_F06.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVR01_0096_B05.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVR01_0068_C08.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVR01_0068_B10.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0016_G01.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0062_F10.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0107_E05.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0052_H07.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAGGCACTGGG
LVRM1_0094_G07.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0032_G01.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVR01_0041_B06.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0183_A03.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0088_F10.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0150_E05.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0150_A07.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0034_G06.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0181_G04.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0096_G10.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0184_B12.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0169_D08.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0083_A12.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0014_H08.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0055_H02.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0013_B09.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0028_E01.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGCAAGCACTGGG
LVRM1_0119_A02.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0083_H09.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0205_F07.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0166_D05.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0010_A11.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0197_B12.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0128_A08.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0050_E04.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0160_F06.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0087_A10.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0186_E02.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0070_H12.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0047_B11.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0163_E03.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0208_D07.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0041_E01.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0195_E03.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0186_H06.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0195_C12.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0105_B05.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0078_G03.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0003_D02.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0005_C01.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0101_F10.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0152_C05.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0145_H06.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0129_B10.b : ATTATTTAGTCTTGCATATAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0019_A04.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0037_H08.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0199_F08.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0036_B11.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0068_C07.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0021_F06.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0199_C09.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0128_C08.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0057_H03.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0142_D08.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0102_E09.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0036_B12.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0033_E09.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0151_E11.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0161_E07.b : ATTATTTAGTCTTGCATGTGAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0107_B05.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0139_G06.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0002_E07.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVR01_0016_D08.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVR01_0073_F08.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVR01_0106_C08.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVR01_0077_G05.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVR01_0017_B10.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVR01_0091_A09.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0159_F02.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0034_H08.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0035_H12.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0040_C05.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0091_G09.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0199_G03.b : ATTATTTAGTCTTGCATGTTTTATAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0156_B06.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0203_F02.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0207_F06.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0162_C01.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0136_G02.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVR01_0019_A05.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0208_H07.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0139_F02.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0200_C11.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0093_C12.b : ATTATTTAGTCTTGCGTGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0168_F06.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0083_E04.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0184_C04.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0143_F03.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0001_F09.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0023_C03.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0121_E04.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0123_A04.b : ATTATTTAGTCTTGCATATAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0083_F04.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVR01_0053_F11.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0171_C07.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVR01_0049_A08.b : ATTATTTAGTCTTGACTGTAAAAGAATCAGACTGTCGAGTCCTATCCAGGAAGCACTGGG
LVRM1_0147_A09.b : ATTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0176_G07.b : xTTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0181_C04.b : xxTATTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0176_C04.b : xxxxTTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0159_G08.b : xxxxTTTAGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0096_A01.b : xxxxxxxxGTCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0038_C01.b : xxxxxxxxxxCTTGCATGTAAAAGAATCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0108_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxCAGACTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0005_D04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGTCCAGTCCTATCCAGGAAGCACTGGG
LVRM1_0170_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCACTGGG
LVRM1_0023_H04.b : gggggggggggaggggcaaggaggggaggtgatgaaatggtgacattgtcxxxxxxxxxx
LVRM1_0108_D12.b : nagttgtcxxxxxxxxxxxxxx
LVRM1_0186_G01.b : xxxx
LVRM1_0013_H10.b : ttgtcxxxxxxxx
LVRM1_0093_A11.b :
LVRM1_0166_F02.b :
LVRM1_0028_C05.b :
LVRM1_0036_B10.b :
LVRM1_0143_A07.b :
LVRM1_0051_F03.b :
LVRM1_0072_C03.b :
LVRM1_0182_G05.b :
LVRM1_0156_A06.b :
LVRM1_0049_E04.b :
LVRM1_0005_A03.b :
LVRM1_0044_H08.b :
LVRM1_0179_D07.b :
LVRM1_0147_C06.b :
LVRM1_0163_A10.b :
LVR01_0003_E12.b :
LVR01_0093_A11.b :
LVRM1_0007_D03.b :
20110601C-012185 : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
---------+---------+---------+---------+---------+---------+ 415
LVRM1_0008_G10.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0168_C11.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0091_G11.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0047_B01.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0198_F12.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0016_C11.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0117_A05.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0061_G04.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0196_F09.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0202_B06.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0195_F11.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0042_B12.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0024_B02.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAATTGTAAG
LVRM1_0079_F06.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0049_G09.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0077_G12.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVR01_0034_E10.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0158_H03.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0171_G05.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0020_A11.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0122_B02.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0163_H05.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0163_D05.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0087_D05.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0164_F12.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0077_B03.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAGT*GTAAG
LVRM1_0134_B10.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0188_E01.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0187_B02.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0206_F02.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0208_A06.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0092_E08.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0039_D04.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0204_G12.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0122_E05.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0098_E08.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTCATTGGACAAT*GTAAG
LVRM1_0102_B04.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0197_H12.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0029_B01.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0149_H08.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0152_B09.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0031_D06.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0130_B11.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0152_E10.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVR01_0105_G08.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVR01_0030_A05.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0096_A05.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0019_F12.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0159_F03.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAATTATTGGACAAT*GTTAG
KDN01_0096_D10.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0168_G08.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAATTATTGGACAAT*GTAAG
LVRM1_0205_E10.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0056_A02.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0135_E11.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0181_B03.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0106_B06.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0018_D04.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0035_G10.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0004_D09.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0111_H05.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0198_A07.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0151_A12.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0188_H09.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0015_A07.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGGACAT*GTAAG
LVRM1_0133_E10.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0163_B11.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0147_H02.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0134_C10.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0021_A01.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0051_H02.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0177_C07.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0191_F03.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0202_C11.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0121_F12.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0006_C09.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0146_F12.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0024_C10.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0122_D11.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0199_A10.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0195_C10.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0075_H07.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0175_F11.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0034_A07.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0050_E07.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0037_H10.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0113_B05.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0148_E11.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0107_C09.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0139_F05.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0148_E06.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVR01_0053_F01.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVR01_0063_F06.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVR01_0096_B05.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGGTATAGTTATTGGACAAT*GTAAG
LVR01_0068_C08.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVR01_0068_B10.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0016_G01.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0062_F10.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0107_E05.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0052_H07.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0094_G07.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0032_G01.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVR01_0041_B06.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0183_A03.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATATTTATTGGACAAT*GCAAG
LVRM1_0088_F10.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0150_E05.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0150_A07.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0034_G06.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0181_G04.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0096_G10.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0184_B12.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0169_D08.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0083_A12.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0014_H08.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0055_H02.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0013_B09.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0028_E01.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0119_A02.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0083_H09.b : ATGACTGTGAGCCGGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0205_F07.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0166_D05.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0010_A11.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0197_B12.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0128_A08.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0050_E04.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0160_F06.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0087_A10.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0186_E02.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0070_H12.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0047_B11.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0163_E03.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0208_D07.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCCGATATAGTTATTGGACAAT*GTAAG
LVRM1_0041_E01.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0195_E03.b : ATGACTGTGAGCCAGCTATTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0186_H06.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0195_C12.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0105_B05.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0078_G03.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0003_D02.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0005_C01.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0101_F10.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0152_C05.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0145_H06.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0129_B10.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0019_A04.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0037_H08.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0199_F08.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0036_B11.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0068_C07.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0021_F06.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0199_C09.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0128_C08.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0057_H03.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0142_D08.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0102_E09.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0036_B12.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0033_E09.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0151_E11.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0161_E07.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0107_B05.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0139_G06.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0002_E07.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVR01_0016_D08.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVR01_0073_F08.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVR01_0106_C08.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVR01_0077_G05.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVR01_0017_B10.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVR01_0091_A09.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0159_F02.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0034_H08.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0035_H12.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0040_C05.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0091_G09.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0199_G03.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0156_B06.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0203_F02.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0207_F06.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0162_C01.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0136_G02.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVR01_0019_A05.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0208_H07.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0139_F02.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0200_C11.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0093_C12.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0168_F06.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0083_E04.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0184_C04.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCT*****AGTTATTGGACAAT*GTAAG
LVRM1_0143_F03.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0001_F09.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0023_C03.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0121_E04.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0123_A04.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0083_F04.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVR01_0053_F11.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0171_C07.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVR01_0049_A08.b : ATGACTGTGAGCCAGCTGTTTCCACACTTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0147_A09.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0176_G07.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0181_C04.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATTTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0176_C04.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0159_G08.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0096_A01.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0038_C01.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0108_E09.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0005_D04.b : ATGGCTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0170_D10.b : ATGACTGTGAGCCAGCTGTTTCCACACGTCCATCTGATATAGTTATTGGACAAT*GTAAG
LVRM1_0023_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAGTTATTGGACAAT*GTAAG
LVRM1_0108_D12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTAGTTATTGGACAAT*GTAAG
LVRM1_0186_G01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTTATTGGACAAT*GTAAG
LVRM1_0013_H10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGGACAAT*GTAAG
LVRM1_0093_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTAAG
LVRM1_0166_F02.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTAAG
LVRM1_0028_C05.b : cgttgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0036_B10.b : gagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0143_A07.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0051_F03.b : tagttgtc
LVRM1_0072_C03.b : na
LVRM1_0182_G05.b :
LVRM1_0156_A06.b :
LVRM1_0049_E04.b :
LVRM1_0005_A03.b :
LVRM1_0044_H08.b :
LVRM1_0179_D07.b :
LVRM1_0147_C06.b :
LVRM1_0163_A10.b :
LVR01_0003_E12.b :
LVR01_0093_A11.b :
LVRM1_0007_D03.b :
20110601C-012185 : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
---------+---------+---------+---------+---------+---------+ 472
LVRM1_0008_G10.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0168_C11.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAAAGTGAATGGCTTTAAT
LVRM1_0091_G11.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0047_B01.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0198_F12.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0016_C11.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CANGATCTTANAGTGAATGGCTTTTAT
LVRM1_0117_A05.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0061_G04.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0196_F09.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0202_B06.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0195_F11.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0042_B12.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0024_B02.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0079_F06.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0049_G09.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0077_G12.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVR01_0034_E10.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0158_H03.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0171_G05.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTANAGTGAATGGCTTTAAT
LVRM1_0020_A11.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0122_B02.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0163_H05.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0163_D05.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0087_D05.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0164_F12.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0077_B03.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0134_B10.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0188_E01.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0187_B02.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0206_F02.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0208_A06.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0092_E08.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0039_D04.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0204_G12.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0122_E05.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0098_E08.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0102_B04.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0197_H12.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0029_B01.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0149_H08.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0152_B09.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0031_D06.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0130_B11.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0152_E10.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVR01_0105_G08.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVR01_0030_A05.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0096_A05.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0019_F12.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0159_F03.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
KDN01_0096_D10.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0168_G08.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAAGATCTTAGAGTGATTGGCTTTAAT
LVRM1_0205_E10.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0056_A02.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0135_E11.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0181_B03.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0106_B06.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0018_D04.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0035_G10.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0004_D09.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0111_H05.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0198_A07.b : GTAATAGTTACAAC*ATG*TTTGGATGGATTT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0151_A12.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CACGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0188_H09.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CACGATCTTACAGCGAATGGCTTTAAT
LVRM1_0015_A07.b : GTAATAATTACCAC*ATG*TTTGGAATGATCCCCAGGACCTTAGAGTGAATGGCTTTAAT
LVRM1_0133_E10.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0163_B11.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0147_H02.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0134_C10.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0021_A01.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0051_H02.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0177_C07.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0191_F03.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0202_C11.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0121_F12.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0006_C09.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0146_F12.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0024_C10.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0122_D11.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0199_A10.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0195_C10.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0075_H07.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0175_F11.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0034_A07.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0050_E07.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGGGTGAATGGCTTTAAT
LVRM1_0037_H10.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0113_B05.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0148_E11.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0107_C09.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0139_F05.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0148_E06.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVR01_0053_F01.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVR01_0063_F06.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVR01_0096_B05.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVR01_0068_C08.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVR01_0068_B10.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0016_G01.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0062_F10.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0107_E05.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0052_H07.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0094_G07.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0032_G01.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVR01_0041_B06.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0183_A03.b : GTAATATCTACAAC*ATG*TTTGGATGGATCT*CATGATCTTAAAGTGAATGGCTTTAAT
LVRM1_0088_F10.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0150_E05.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0150_A07.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0034_G06.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0181_G04.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAAGATCTTCAAGTGAATGGCTTTAAT
LVRM1_0096_G10.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTACAGTGAATGGCTTTAAT
LVRM1_0184_B12.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTACAGTGAATGGCTTTAAT
LVRM1_0169_D08.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0083_A12.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0014_H08.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0055_H02.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CACGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0013_B09.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTACAGTGAATGGCTTTAAT
LVRM1_0028_E01.b : GTAATAGTTACAACCATG*TTTGGATGGATCT*CACGATCTTAGAGCGAATGGCTTTAAT
LVRM1_0119_A02.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0083_H09.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0205_F07.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0166_D05.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0010_A11.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0197_B12.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0128_A08.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0050_E04.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0160_F06.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0087_A10.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0186_E02.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0070_H12.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0047_B11.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0163_E03.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0208_D07.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0041_E01.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0195_E03.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0186_H06.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0195_C12.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0105_B05.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0078_G03.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0003_D02.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0005_C01.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0101_F10.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0152_C05.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0145_H06.b : GGAATAGTTACAAC*ATG*TTTGGATGGATCT*CACGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0129_B10.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0019_A04.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0037_H08.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0199_F08.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0036_B11.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0068_C07.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0021_F06.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0199_C09.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0128_C08.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0057_H03.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0142_D08.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0102_E09.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0036_B12.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0033_E09.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0151_E11.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0161_E07.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0107_B05.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0139_G06.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0002_E07.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVR01_0016_D08.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVR01_0073_F08.b : GTAATAGCTACAAC*ATGTTTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVR01_0106_C08.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVR01_0077_G05.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVR01_0017_B10.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVR01_0091_A09.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0159_F02.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0034_H08.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0035_H12.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0040_C05.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0091_G09.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0199_G03.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0156_B06.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0203_F02.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0207_F06.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0162_C01.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0136_G02.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVR01_0019_A05.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0208_H07.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0139_F02.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0200_C11.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0093_C12.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0168_F06.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0083_E04.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0184_C04.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0143_F03.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0001_F09.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0023_C03.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0121_E04.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0123_A04.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0083_F04.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVR01_0053_F11.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0171_C07.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVR01_0049_A08.b : GGAATAGCTACGAC*ATG*TTTGGATGGATCT*CAAGATCTTATAGTGAATGGCTTTAAT
LVRM1_0147_A09.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0176_G07.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0181_C04.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0176_C04.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0159_G08.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0096_A01.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0038_C01.b : GTAATAGCTACAAC*ATT*ATTGGATGGATCT*CAGGGTCTTAGAGTGAATGGCTTTAAT
LVRM1_0108_E09.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0005_D04.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0170_D10.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0023_H04.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTGAT
LVRM1_0108_D12.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0186_G01.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0013_H10.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0093_A11.b : GTAATAGTTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0166_F02.b : GTAATAGCTACAAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0028_C05.b : xxxxxxxgttacAC*ATG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0036_B10.b : xxxxxxxxxxxxxxgggG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0143_A07.b : xxxxxxxxxxxxxxxxxG*TTTGGATGGATCT*CAGGATCTTAGAGTGAATGGCTTTAAT
LVRM1_0051_F03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTTAAT
LVRM1_0072_C03.b : gttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxT
LVRM1_0182_G05.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0156_A06.b : cagtgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0049_E04.b : tagttgtcxxxxxxxxxx
LVRM1_0005_A03.b : atxxxxxxxxxxxxxxxxxxxx
LVRM1_0044_H08.b : ttgtcxxxxxxxxxx
LVRM1_0179_D07.b :
LVRM1_0147_C06.b :
LVRM1_0163_A10.b :
LVR01_0003_E12.b :
LVR01_0093_A11.b :
LVRM1_0007_D03.b :
20110601C-012185 : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
---------+---------+---------+---------+---------+---------+ 532
LVRM1_0008_G10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0168_C11.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCCTC
LVRM1_0091_G11.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGGAAGACAGCCCAGTACTCATC
LVRM1_0047_B01.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0198_F12.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0016_C11.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0117_A05.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0061_G04.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0196_F09.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0202_B06.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0195_F11.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0042_B12.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0024_B02.b : TGCACCACAAGTTCTGCCTCTTCAGAACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0079_F06.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0049_G09.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0077_G12.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVR01_0034_E10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0158_H03.b : TGCACCACAAGTTCTGCATCTTCAATACTGGACAATACGA*AGACAGCCCAGTACTCATC
LVRM1_0171_G05.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0020_A11.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACNAAAGACAGCCCAGTACTCATC
LVRM1_0122_B02.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0163_H05.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACCAAAGGACAGCCAGTACTCGTC
LVRM1_0163_D05.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0087_D05.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0164_F12.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGTAAGACAGCCCAGTACTCATC
LVRM1_0077_B03.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0134_B10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0188_E01.b : TGCACCACGAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0187_B02.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0206_F02.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0208_A06.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0092_E08.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0039_D04.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0204_G12.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0122_E05.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0098_E08.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0102_B04.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0197_H12.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0029_B01.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0149_H08.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0152_B09.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0031_D06.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0130_B11.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0152_E10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVR01_0105_G08.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVR01_0030_A05.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0096_A05.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0019_F12.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0159_F03.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
KDN01_0096_D10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0168_G08.b : TGCAACACAAGTTCTGCCTCTTCAGTACTGGCCAATATAAAGGACAGCCCAtactccgcg
LVRM1_0205_E10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0056_A02.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0135_E11.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0181_B03.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0106_B06.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0018_D04.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0035_G10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGAAAGCCCAGTACTCATC
LVRM1_0004_D09.b : TGCACCACAAGTTCTGCCTCTTCAGTGCTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0111_H05.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0198_A07.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0151_A12.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0188_H09.b : TGCACCACAAATTCTGCCTCATCAGTACTGGCCAcataaaaaagacagcccacaactcac
LVRM1_0015_A07.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGGCCATACGAAAGACAGCCCAGTACTCATC
LVRM1_0133_E10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0163_B11.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0147_H02.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0134_C10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0021_A01.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0051_H02.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0177_C07.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0191_F03.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0202_C11.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0121_F12.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0006_C09.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0146_F12.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0024_C10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0122_D11.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0199_A10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0195_C10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0075_H07.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0175_F11.b : TGCACCACAAGTTCTGCCTCCTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0034_A07.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0050_E07.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0037_H10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0113_B05.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0148_E11.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0107_C09.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0139_F05.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0148_E06.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVR01_0053_F01.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVR01_0063_F06.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVR01_0096_B05.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVR01_0068_C08.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVR01_0068_B10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0016_G01.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0062_F10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0107_E05.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0052_H07.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0094_G07.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0032_G01.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVR01_0041_B06.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0183_A03.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAACGACAGCCCAGTACTCATC
LVRM1_0088_F10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0150_E05.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0150_A07.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0034_G06.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0181_G04.b : TGCCCCACA*GTTCTGCCTCATCCGTACTGGAACATACAAAAGACAGCCCAGTACTCAGC
LVRM1_0096_G10.b : TGCACCACAAGTTCTGCCTCTTCACTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0184_B12.b : TGCACCCCAAGTCCCGCCTCTTCAGTACTGGCCAATACAAAAGACAGCCCAAAACTCCTC
LVRM1_0169_D08.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCGAGTACTCATC
LVRM1_0083_A12.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0014_H08.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0055_H02.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0013_B09.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0028_E01.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACCAAAGACAACCCAGTACTCATC
LVRM1_0119_A02.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0083_H09.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAAACAGCCCAGTACTCATC
LVRM1_0205_F07.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0166_D05.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0010_A11.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACAAAAGACAGCCCAGTACTCATC
LVRM1_0197_B12.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0128_A08.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0050_E04.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0160_F06.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0087_A10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0186_E02.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0070_H12.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0047_B11.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0163_E03.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0208_D07.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0041_E01.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0195_E03.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0186_H06.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0195_C12.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0105_B05.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0078_G03.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0003_D02.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0005_C01.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0101_F10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0152_C05.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0145_H06.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0129_B10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0019_A04.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0037_H08.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0199_F08.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0036_B11.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0068_C07.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0021_F06.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0199_C09.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0128_C08.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0057_H03.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0142_D08.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0102_E09.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0036_B12.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0033_E09.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0151_E11.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0161_E07.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0107_B05.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0139_G06.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0002_E07.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVR01_0016_D08.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVR01_0073_F08.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVR01_0106_C08.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVR01_0077_G05.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVR01_0017_B10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVR01_0091_A09.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0159_F02.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0034_H08.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0035_H12.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0040_C05.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0091_G09.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0199_G03.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAATACTCATC
LVRM1_0156_B06.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0203_F02.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0207_F06.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0162_C01.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0136_G02.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVR01_0019_A05.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0208_H07.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0139_F02.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0200_C11.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0093_C12.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0168_F06.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0083_E04.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0184_C04.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0143_F03.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0001_F09.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0023_C03.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGGACTCATC
LVRM1_0121_E04.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0123_A04.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0083_F04.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVR01_0053_F11.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0171_C07.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVR01_0049_A08.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCGATACTCGTC
LVRM1_0147_A09.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0176_G07.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0181_C04.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0176_C04.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0159_G08.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0096_A01.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0038_C01.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0108_E09.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0005_D04.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0170_D10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0023_H04.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0108_D12.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0186_G01.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0013_H10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0093_A11.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0166_F02.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0028_C05.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0036_B10.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0143_A07.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0051_F03.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0072_C03.b : TGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0182_G05.b : xGCACCACAAGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0156_A06.b : xxxxxxxxxxGTTCTGCCTCTTCAGTACTGGCCAATACGAAAGACAGCCCAGTACTCATC
LVRM1_0049_E04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggcAGACAGCCCAGTACTCATC
LVRM1_0005_A03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGACAGCCCAGTACTCATC
LVRM1_0044_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgggCAGCCCAGTACTCATC
LVRM1_0179_D07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0147_C06.b : ncgtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0163_A10.b : cxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVR01_0003_E12.b : tctacgtggcctatanngacxxxx
LVR01_0093_A11.b :
LVRM1_0007_D03.b :
20110601C-012185 : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
---------+---------+---------+---------+---------+---------+ 590
LVRM1_0008_G10.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCATACCTTGG*AAAAGT
LVRM1_0168_C11.b : GATTTCTTTG*AGGATACGGAACCCTACAGAAAAGAAGCTAnnaccctcaccaaagaaca
LVRM1_0091_G11.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAANAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0047_B01.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0198_F12.b : CATTTCTTGA*ACGATACGGACCCTTAC*GAAAAAAAACTTAACAAACCTGGG*AAAAGT
LVRM1_0016_C11.b : GATTTCTTTG*AGGATACGGAGCCCTACAAAAAAGA*GCTAACCAAACTTTGG*AAAA*T
LVRM1_0117_A05.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0061_G04.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0196_F09.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0202_B06.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0195_F11.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0042_B12.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0024_B02.b : GCTTTCTCTG*AGGATACCGAGCCCTACAGAAAAGAAGCTTACCAAACCTTGG*ATAAGT
LVRM1_0079_F06.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*TAAAGT
LVRM1_0049_G09.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0077_G12.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVR01_0034_E10.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0158_H03.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAA*CCAACCAAACCTTGG*AAAAGT
LVRM1_0171_G05.b : GATTTCTTTG*ACGATACGGGACCCTACCGAAAAGAAGCTAACCAAACCTTGG*AAAACT
LVRM1_0020_A11.b : GATTTCTTTG*AGGATACGGAGCCCTACNGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0122_B02.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0163_H05.b : AATTTCTGTG*AGGATACAGAACCCTACCGAAAAGAActaactaaatctgtgaaagtcac
LVRM1_0163_D05.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAANAGAAGCTAACNAAACCTTGG*AAAAGA
LVRM1_0087_D05.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0164_F12.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0077_B03.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAATAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0134_B10.b : GATTTCTTTG*AGGATACGGAGCCCTACAAAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0188_E01.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0187_B02.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0206_F02.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0208_A06.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAANAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0092_E08.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0039_D04.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0204_G12.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0122_E05.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0098_E08.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0102_B04.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0197_H12.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0029_B01.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0149_H08.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0152_B09.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0031_D06.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAACT
LVRM1_0130_B11.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0152_E10.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGNNAAAAGT
LVR01_0105_G08.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVR01_0030_A05.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0096_A05.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0019_F12.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0159_F03.b : GATTTCTTTG*AGGATACGGAGCCCTTCATAAAAAAAGCTAACCAAACCTTGG*AAAATT
KDN01_0096_D10.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0168_G08.b : atttcggtgaggacaaagagcagcgagcgaaacaagctaaccaaacccgcggaaaagtga
LVRM1_0205_E10.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0056_A02.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0135_E11.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAATAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0181_B03.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0106_B06.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0018_D04.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0035_G10.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0004_D09.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0111_H05.b : GATTTCTTTG*AGGTTACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0198_A07.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAGGT
LVRM1_0151_A12.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0188_H09.b : ccatttcttacgagatatagagctctccagaaaagaagccagataatccctgcaaaaatc
LVRM1_0015_A07.b : GATTTCTTTGGAGGATACGGAGCCCTACAGAAAAGAAACTAACCAAACTTTGA*AAAA*T
LVRM1_0133_E10.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTTACCAAACCTTGG*TAAAGT
LVRM1_0163_B11.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0147_H02.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0134_C10.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0021_A01.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0051_H02.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCATACCTTGG*AAAAGT
LVRM1_0177_C07.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0191_F03.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0202_C11.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0121_F12.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0006_C09.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0146_F12.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0024_C10.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0122_D11.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0199_A10.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0195_C10.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0075_H07.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0175_F11.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0034_A07.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0050_E07.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0037_H10.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0113_B05.b : GATTTCTTTG*AAGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0148_E11.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0107_C09.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0139_F05.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0148_E06.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACTAAACCTTGG*AAAAGT
LVR01_0053_F01.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVR01_0063_F06.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVR01_0096_B05.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVR01_0068_C08.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVR01_0068_B10.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0016_G01.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0062_F10.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGT*AAAAGT
LVRM1_0107_E05.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAATAGAAGCTAACCAAACCTTGG*TAAAGT
LVRM1_0052_H07.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0094_G07.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0032_G01.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVR01_0041_B06.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0183_A03.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAATAGAAGCTCACCGAACCTTGG*AAAAGT
LVRM1_0088_F10.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAACAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0150_E05.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0150_A07.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0034_G06.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0181_G04.b : GAATTCTTTagagaagccgagacctaaggacaggaaacgtcaccaaccctggcaaaagta
LVRM1_0096_G10.b : GCTTTCTTTG*ATGATTGCGAACCCTACAAACGAGAAGCTAACCACACCTTGGCAAAagt
LVRM1_0184_B12.b : GATTTCTTTG*ACGATATGGAGCtctcaaaaaaaaatactaaactcaccttgaaaacagt
LVRM1_0169_D08.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAGAGT
LVRM1_0083_A12.b : GATTTCTTTG*AAGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0014_H08.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0055_H02.b : GATTTCTTTG*AGGATACGGAGCCCTACCGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0013_B09.b : GATTTCTTTG*AGGATACCGAGCCCTACAGAAAAGAAGCTAACCAAACCCTGG*AAAAGT
LVRM1_0028_E01.b : GATTTCTTTG*ATGATACGGAGCCCTACAGAAAAGAACCTAACCTAACCTTGGAAAAGCT
LVRM1_0119_A02.b : TATTTCTTTG*ANGATACGGANCCCTACAGAAAAGAAGCTAACCGAACCTTGG*GAAAGT
LVRM1_0083_H09.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAGAGT
LVRM1_0205_F07.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAAACCAACCTTTG*GAGAGT
LVRM1_0166_D05.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0010_A11.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0197_B12.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0128_A08.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0050_E04.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0160_F06.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0087_A10.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0186_E02.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0070_H12.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGT*GAAAGT
LVRM1_0047_B11.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0163_E03.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0208_D07.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0041_E01.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0195_E03.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0186_H06.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0195_C12.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0105_B05.b : GATTTCTTTG*AGGATACGGAGCCCTGCAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0078_G03.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0003_D02.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0005_C01.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0101_F10.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0152_C05.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0145_H06.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCACACCTTGG*GAAAGT
LVRM1_0129_B10.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGN
LVRM1_0019_A04.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0037_H08.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0199_F08.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0036_B11.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0068_C07.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0021_F06.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0199_C09.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0128_C08.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0057_H03.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0142_D08.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0102_E09.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0036_B12.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0033_E09.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0151_E11.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0161_E07.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0107_B05.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0139_G06.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0002_E07.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVR01_0016_D08.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVR01_0073_F08.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVR01_0106_C08.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVR01_0077_G05.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVR01_0017_B10.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVR01_0091_A09.b : GATTTCTTTG*AGGATACGGAGCCCTACAAAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0159_F02.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0034_H08.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0035_H12.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0040_C05.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCTAACCTTGG*AAAAGT
LVRM1_0091_G09.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0199_G03.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*TAAAGT
LVRM1_0156_B06.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0203_F02.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0207_F06.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0162_C01.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0136_G02.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVR01_0019_A05.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0208_H07.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0139_F02.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0200_C11.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0093_C12.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0168_F06.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0083_E04.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0184_C04.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0143_F03.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0001_F09.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0023_C03.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAGAGT
LVRM1_0121_E04.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0123_A04.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0083_F04.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVR01_0053_F11.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0171_C07.b : GATTTCGTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVR01_0049_A08.b : GATTTCTTTGAGAGATACCGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0147_A09.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0176_G07.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0181_C04.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0176_C04.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0159_G08.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0096_A01.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTGACCAAACCTTGG*AAAAGT
LVRM1_0038_C01.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0108_E09.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0005_D04.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0170_D10.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0023_H04.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAnagccttgggaaaa
LVRM1_0108_D12.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0186_G01.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0013_H10.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0093_A11.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0166_F02.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0028_C05.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0036_B10.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0143_A07.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0051_F03.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0072_C03.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0182_G05.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0156_A06.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0049_E04.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0005_A03.b : GATTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0044_H08.b : GATTTCTTTG*GGGATGCGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0179_D07.b : xxTTTCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0147_C06.b : xxxtgCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVRM1_0163_A10.b : xxxxxCTTTG*AGGATACGGAGCCCTACAGAAAAGAAGCTAACCAAACCTTGG*AAAAGT
LVR01_0003_E12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGT
LVR01_0093_A11.b :
LVRM1_0007_D03.b :
20110601C-012185 : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
---------+---------+---------+---------+---------+---------+ 647
LVRM1_0008_G10.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0168_C11.b : aaaggaaaaaaagggatttccctttttccaagtgcaaaaatgaaaaaggtttcaaaaggt
LVRM1_0091_G11.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0047_B01.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0198_F12.b : ACAAAAGGGA*GAAacagggatttcgcctccttccgaatggaacaaatggtgataggttg
LVRM1_0016_C11.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTTCCAGTGGACAAgtgaaaaaggtttca
LVRM1_0117_A05.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0061_G04.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0196_F09.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0202_B06.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGGCAAAGTGGAGAGGGTT*G
LVRM1_0195_F11.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0042_B12.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0024_B02.b : ACAACAGGGA*GAACAGTGACTTTGCCT*CCTTCCGAGTGGACAAGCTGGAGAGGGTC*G
LVRM1_0079_F06.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0049_G09.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAG*GTT*G
LVRM1_0077_G12.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVR01_0034_E10.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0158_H03.b : ACTAAATGAG*ATACAGTGACTTTGCCT*CTTTCCTAGTGTACAA*GTCGAGAGattgga
LVRM1_0171_G05.b : ACAAAAAGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGAACCAAGCGGAGAGGGTT*G
LVRM1_0020_A11.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACNAAGTGGAGAGGGTT*G
LVRM1_0122_B02.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0163_H05.b : acccggagaagagtgacttggcccctttgctaccggatgaggtgaaaaggttgcaagaca
LVRM1_0163_D05.b : ACAAAACGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAAAGGGTT*G
LVRM1_0087_D05.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAAGGTT*G
LVRM1_0164_F12.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGGGAAGGTT*G
LVRM1_0077_B03.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0134_B10.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAATGGAGAGGGCT*G
LVRM1_0188_E01.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0187_B02.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0206_F02.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGTTT*G
LVRM1_0208_A06.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0092_E08.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0039_D04.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0204_G12.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGTTT*G
LVRM1_0122_E05.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAA*TGGAGAGG*TT*G
LVRM1_0098_E08.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0102_B04.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0197_H12.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0029_B01.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0149_H08.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGTTGGC
LVRM1_0152_B09.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGG*TT*G
LVRM1_0031_D06.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0130_B11.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0152_E10.b : ACAAAAGGGAAGAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTTTG
LVR01_0105_G08.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVR01_0030_A05.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0096_A05.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0019_F12.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0159_F03.b : ACAAAAGG*A*GAACAGTGACTTTGCCT*CTTTCCTAGAGGACAAAGTGtgaaaggtttg
KDN01_0096_D10.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0168_G08.b : ggaaagagacgaagcagacaatacggcacgtagaagtgaaagacagaaagaagaatatac
LVRM1_0205_E10.b : ACAAAAGGGA*GAACAGTGACCTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0056_A02.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0135_E11.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGCGGAGAGGGTT*G
LVRM1_0181_B03.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0106_B06.b : ACAAAAGGGA*GAACAGTGACTTTACCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0018_D04.b : ACAAAAGGGA*GAGCAGTGACTTTGCCT*CTTTCCGAGTGGNACAAGTGGAGAGGGTT*G
LVRM1_0035_G10.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0004_D09.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0111_H05.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAA*TGGAGAGG*TT*G
LVRM1_0198_A07.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0151_A12.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0188_H09.b : cccatacggataactcgcattataccatctataaggtgaacgacagggacaagcattgca
LVRM1_0015_A07.b : ACCAAAGGGA*GAACA*TGACTTTGCCT*CTTTCCGAGTGGACA*AGTGGAGAGGgttcc
LVRM1_0133_E10.b : ACAAAAGGGA*GAACCGTGACTTTGCCT*CTTTTCGAGTGGATTAAGTGGACAGGGTT*G
LVRM1_0163_B11.b : ACAAAACGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGAAGAGGGTT*C
LVRM1_0147_H02.b : ACAAAAGGGA*GAACAGTGACTTTGCCTCCTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0134_C10.b : ACATAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0021_A01.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0051_H02.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAA*GTGCAGAGG*TT*G
LVRM1_0177_C07.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGCAGAGGGTT*G
LVRM1_0191_F03.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGNACAAGTGGAGAGGGTT*G
LVRM1_0202_C11.b : ACAAAAGGGA*GAACAGTGACTTTGTCT*CTTTCCGAGTGGNACAAGTGGAGAGGGTT*G
LVRM1_0121_F12.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0006_C09.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0146_F12.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0024_C10.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0122_D11.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0199_A10.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0195_C10.b : ACAAAAGGGA*GAACAGTGACCTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0075_H07.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0175_F11.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0034_A07.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0050_E07.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0037_H10.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAAGGGT*T
LVRM1_0113_B05.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0148_E11.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGTTT*G
LVRM1_0107_C09.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0139_F05.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0148_E06.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVR01_0053_F01.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVR01_0063_F06.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVR01_0096_B05.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVR01_0068_C08.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVR01_0068_B10.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0016_G01.b : ACAAAAGGGA*GAACACTGACTTTGCCT*CTTTCCGAGTGGACAAACCGCACAGGGTT*G
LVRM1_0062_F10.b : ACAAAAGGGA*GAACAGGGACTTTGCCT*CTTTCCTAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0107_E05.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCTAGTGGACTAAGTGGAAAGGGTT*G
LVRM1_0052_H07.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0094_G07.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0032_G01.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVR01_0041_B06.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0183_A03.b : ACCAAAGGGA*AAACAGTGACTTTGCCT*CTTTCCGATTGGACAAtttgtataaggttgc
LVRM1_0088_F10.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0150_E05.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0150_A07.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGTTG*G
LVRM1_0034_G06.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0181_G04.b : ctaaaaggaagaccggggacaatacctacgtcaaagaggacagagctgaaccgagatgtg
LVRM1_0096_G10.b : acaaaacgcaaaacagttcactccacctcaatcccgagtggacaacaaggcaacgcgata
LVRM1_0184_B12.b : acaataaggaaaaaaatgccctataccctttccaaagcgtatacaaaaaaaaccatgaca
LVRM1_0169_D08.b : ACCCAGGGGA*GAAAAGTCGACTTGCCT*CTTTtcggagtggaaaggtggaaagggttgc
LVRM1_0083_A12.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAAAGGGTT*G
LVRM1_0014_H08.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGACAGGGTT*G
LVRM1_0055_H02.b : ACAAAGGGGA*G*ACAGTGACTTTGCCT*CTTTCCTAGTGGACCAAGTGGAGAGGTTT*C
LVRM1_0013_B09.b : ACCAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAA*GTGGAGACG*TT*G
LVRM1_0028_E01.b : ACAAAAGGGA*TAACAGTGACTTTGCCT*CTTTCCcagcgcgacaaatgaatacgcgtcc
LVRM1_0119_A02.b : ACANAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAA*GTGGATAGGGTT*G
LVRM1_0083_H09.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0205_F07.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGNAGAGGGTT*G
LVRM1_0166_D05.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGGACAAGTGGAGAGGGTT*G
LVRM1_0010_A11.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0197_B12.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0128_A08.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0050_E04.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0160_F06.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGTTG*C
LVRM1_0087_A10.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0186_E02.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0070_H12.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0047_B11.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0163_E03.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0208_D07.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0041_E01.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0195_E03.b : ACAAAAGGGA*GAACAGTGACTTAGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0186_H06.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0195_C12.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0105_B05.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0078_G03.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0003_D02.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0005_C01.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0101_F10.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0152_C05.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGTTG*C
LVRM1_0145_H06.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGG*TT*G
LVRM1_0129_B10.b : TACAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0019_A04.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0037_H08.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0199_F08.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACGAAGTGGAGAGGGTT*G
LVRM1_0036_B11.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0068_C07.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0021_F06.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0199_C09.b : TCAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0128_C08.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGG*TT*G
LVRM1_0057_H03.b : ACAAAAAGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0142_D08.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0102_E09.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0036_B12.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0033_E09.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0151_E11.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0161_E07.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0107_B05.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACANAGTGGAGAGGGTT*G
LVRM1_0139_G06.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0002_E07.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVR01_0016_D08.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVR01_0073_F08.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVR01_0106_C08.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVR01_0077_G05.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAAAGGGTT*G
LVR01_0017_B10.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVR01_0091_A09.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0159_F02.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0034_H08.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0035_H12.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0040_C05.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGCAGAGGGTT*G
LVRM1_0091_G09.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0199_G03.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0156_B06.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0203_F02.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0207_F06.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGGACAAGTGGAGAGGGTT*G
LVRM1_0162_C01.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0136_G02.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVR01_0019_A05.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0208_H07.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAATGGAGAGGGTT*G
LVRM1_0139_F02.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0200_C11.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0093_C12.b : ACAAAAGGGGAGAACAGTGACTTTGCCT*CTTTCCTAGTGAACAAAGTGGAAAGGGTT*G
LVRM1_0168_F06.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGAC*AAGTGGAGAGGGTT*G
LVRM1_0083_E04.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0184_C04.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0143_F03.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0001_F09.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0023_C03.b : ACAAGAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGAAGAGGTGT*G
LVRM1_0121_E04.b : ACCAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGTCT*G
LVRM1_0123_A04.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGGACAAGTGGAGAGGGGT*G
LVRM1_0083_F04.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVR01_0053_F11.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0171_C07.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVR01_0049_A08.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGATAGGGTT*G
LVRM1_0147_A09.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0176_G07.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0181_C04.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0176_C04.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0159_G08.b : ACAAAAGGGA*GAACTGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0096_A01.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0038_C01.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0108_E09.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0005_D04.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0170_D10.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0023_H04.b : agttacaaaaggtgagaacagtgnactttgcctctttccggagagaggggggcgacccca
LVRM1_0108_D12.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0186_G01.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0013_H10.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0093_A11.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0166_F02.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0028_C05.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0036_B10.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0143_A07.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0051_F03.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0072_C03.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0182_G05.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0156_A06.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0049_E04.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0005_A03.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0044_H08.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0179_D07.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0147_C06.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVRM1_0163_A10.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVR01_0003_E12.b : ACAAAAGGGA*GAACAGTGACTTTGCCT*CTTTCCGAGTGGACAAAGTGGAGAGGGTT*G
LVR01_0093_A11.b :
LVRM1_0007_D03.b :
20110601C-012185 : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
---------+---------+---------+---------+---------+---------+ 705
LVRM1_0008_G10.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0168_C11.b : agaagtgaggaaccaaacaccctcacctgttatttgccttagaaaaagctgctcccccat
LVRM1_0091_G11.b : CAAGAGTGAAA*AGAGGGGAAAGAACAAA*TACTACGTGG*ATTTCTCTGTGAGGAACGG
LVRM1_0047_B01.b : CAAGAGTGAGA*GGAAGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0198_F12.b : ccaaaactgctaggaggggaacgaacgaattccatacgcggaatttttatggtgaagaac
LVRM1_0016_C11.b : aaactgagaggaggggaaaaaccaattactaactggattctccgggaagaatgccccagt
LVRM1_0117_A05.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0061_G04.b : CTAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACCTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0196_F09.b : CAAGAGTGAGA*GGAGGGGGAAGAACGAATTACTACGTGG*ATTTCTCTGTGAAGAACTG
LVRM1_0202_B06.b : CAAGAGTGAGA*GGANGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAAGAACTG
LVRM1_0195_F11.b : CAAGAGTGAGN*AGAGGGGAAAGAACGAATTACTACGTGG*AATTCTCTGTGAGGGACTG
LVRM1_0042_B12.b : CNAGAGTGAGA*AGAAGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAAGAACTG
LVRM1_0024_B02.b : *AAAAGTGAGA*GGAGGGGAAAGAACGCATTACAACGTGG*ATTTCTCTGgtgagaactg
LVRM1_0079_F06.b : CAAGAGTGAGA*GGAGGGG*AAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0049_G09.b : CAAGAGTGAGA*AGGAGGGGAAGAACGAA*TACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0077_G12.b : CAAGAGTGAGA*GGAGGNGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVR01_0034_E10.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0158_H03.b : agagtgagagtaggcgaagaagaattactacttggatttcctgtgagaaaagccccacgt
LVRM1_0171_G05.b : CACAAGTGAAA*GCGAGGGAAAaaaccaatagtccgtggaattagccgtgaggaaaaaga
LVRM1_0020_A11.b : CAAGAGTGAGA*AGGAGGGAAAGAACGAA*TACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0122_B02.b : CAAGAGTGAGA*GGAGGGGAAAGAACGA*TTACTACGTGG*ATTTCTCTGTGAAGAACTG
LVRM1_0163_H05.b : aaagggtgggatggcacgactgaaagccacaagtgtccgggcgtaacaatataggcccag
LVRM1_0163_D05.b : CAAGAGTGAGA*CGAAGGGTAAAGACCAATTAataagtggaattgtgctggagagaaatg
LVRM1_0087_D05.b : CAAGAGTGAGA*GGATGCGAAAGA*CGAATTACTACGTGG*ACTTCTCTGTGAGaaatgc
LVRM1_0164_F12.b : CAAGAGTGAGA*GGAAGGGAAAGAACGAATTACTACGTGG*ATTTCnatcatgatgcaga
LVRM1_0077_B03.b : TCAGAGTGAGA*GGCAGGCAAAGAACCAATCACTATCTGC*ATTTCTCTGTGAGGAACTG
LVRM1_0134_B10.b : CAAGAATGACA*GGAGGCGGAAGAACCAATTACCACGTGG*ACTTCTCTGTGAAGAACTG
LVRM1_0188_E01.b : CAAGAGTGACA*GGAGGGGAAA*AACGAATTACTACCTGG*ATTTCTCGGTGAGAGACTG
LVRM1_0187_B02.b : CAAGAGTGAGA*GGAGGG*AAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0206_F02.b : CNAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0208_A06.b : CAAGAGTGAGA*AGAGGGGGAATGACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0092_E08.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0039_D04.b : CAAGAGTGAGA*AGGAGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0204_G12.b : CAAGAGTGAGA*GGANGGGAAAGAAACGATTACTACGTGG*ATTTCTCTGTGNAGAACTG
LVRM1_0122_E05.b : CAAGAGTGAGA*GGAGGGGAAAAGACGAATTACTACGTGG*ATTTCTCTGTGAGGAA*TG
LVRM1_0098_E08.b : CAAGAGTGAGA*GGAAGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAAGAACTG
LVRM1_0102_B04.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0197_H12.b : CNAGAGTGAGA*GGANGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0029_B01.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0149_H08.b : CAAGGGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0152_B09.b : CNAGAGTGAGA*GGAGGGGAAAGAACCAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0031_D06.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0130_B11.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0152_E10.b : CAAGAGTGAGA*AGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAAGAACTG
LVR01_0105_G08.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVR01_0030_A05.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0096_A05.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0019_F12.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0159_F03.b : ccagaatgaaaagaaaggaaaaaaacaattccaacttggatttccttgtgtagaatggat
KDN01_0096_D10.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0168_G08.b : gaacgctcgagccaaaagccgaaaaacaccacgacagcacccggacaaaaagggagcaaa
LVRM1_0205_E10.b : CAAGAGTGAGA*GGAAGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0056_A02.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0135_E11.b : CTAGAGTGAGT*AGAGGGtcaactaatcaattcatactcgccatctcccttgttagaacc
LVRM1_0181_B03.b : NCAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0106_B06.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0018_D04.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0035_G10.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0004_D09.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0111_H05.b : CCAGAGTGAGA*GGAGGGGA*AGAACGAATTACTACGTGG*ATTTCTCCGTGAGGAACTG
LVRM1_0198_A07.b : CAAGAGTGAGA*GGAGAGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0151_A12.b : CA*GAGTGAGA*GGAGGGGAAAGAACNAATTACTACGTGG*ATATCTCTGTGAGGAACTG
LVRM1_0188_H09.b : ccaactacggatagcgcacatctatccgttccaatcccaatataccctacacccgcaatg
LVRM1_0015_A07.b : aacattgaaaagaggggaaagaccgattcactcctggaattccctgtagagaatgcctcc
LVRM1_0133_E10.b : CCtcagctagtagatgttacatactcacttcctcccccgcatttttttgtgccgattgtc
LVRM1_0163_B11.b : CAAGAGTGACA*GGAGGGGAAACAGCGA*TTACTACGTGG*ATatccaggtgacgaaccg
LVRM1_0147_H02.b : CAAGAGTGAGA*GGAGGGGAAAGAACCGATTACTACGTGGgagttctctgggaggaactg
LVRM1_0134_C10.b : CCAGAGTGAGA*GGACGGTTAATAACGAATTCCTACGTGC*ATTTttcttgttacttatt
LVRM1_0021_A01.b : CAAGAGTGACA*GGAGGGGAAAAAACCAATTACTACGTGG*ATTTCTCTGTGAcggaact
LVRM1_0051_H02.b : CCAGACTGAGA*GGATCGCATACAACAAATTACTACGTGG*ATTTCTCTGTTGAGCACTG
LVRM1_0177_C07.b : CAAGAGTGAAA*CGAGGGGAAAGAACGAATTACTACGTGGGAATTCTCCGGGAAGGAATG
LVRM1_0191_F03.b : CAAGAGTGAGA*GGAGGGGGAAGAACGAA*TACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0202_C11.b : CNAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0121_F12.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ACTTCTCTGTGAGGAACTG
LVRM1_0006_C09.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0146_F12.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*GATTCTCTGTGAGGAACTG
LVRM1_0024_C10.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0122_D11.b : CA*GAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0199_A10.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0195_C10.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0075_H07.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0175_F11.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGNAGAACTG
LVRM1_0034_A07.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0050_E07.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0037_H10.b : GCAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0113_B05.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0148_E11.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0107_C09.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0139_F05.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0148_E06.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVR01_0053_F01.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVR01_0063_F06.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVR01_0096_B05.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVR01_0068_C08.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVR01_0068_B10.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0016_G01.b : CCATAATGACA*TGAAGGGAAAtacctattactccttggatctctttgcgaccatatgcc
LVRM1_0062_F10.b : CAAGAGTGGGA*TGAGGGGAAAGAGCGAATTGCTACTTGG*ATTTatgtgaggggggatg
LVRM1_0107_E05.b : CAAGAGTGAGA*GGAAGGGAAAGAACGAATTACTACGTGT*ATTTCTCTGTGAAGAACTG
LVRM1_0052_H07.b : CCAGAGTGAGA*GGAGGGGAAAGA*CGAATTACTACGTGG*ATT*CTCTGTGAGGAACTG
LVRM1_0094_G07.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0032_G01.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVR01_0041_B06.b : CAAGAGTGAGA*GGA*GGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0183_A03.b : cagattgtaccgagggtacacaccgaattgtcaccgtcaacctcacagtgattggattgc
LVRM1_0088_F10.b : CAAGAGTGAGA*GGACGGGAACGAA*GAATTACTAGCTGG*ATTTCTtcggaagaaccgc
LVRM1_0150_E05.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACCTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0150_A07.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0034_G06.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0181_G04.b : acgacgccgacgcagcgacaccaaacaatcggtaacaccaaatcttaaaatgaggaagag
LVRM1_0096_G10.b : cccaaactgacatcaaccgaacaaaaccacataacacgttgagctgtctcctccaagcac
LVRM1_0184_B12.b : taacgacaaaaaaaagaaaaaatatttcttaacaaattataaactgaacgccgccccaca
LVRM1_0169_D08.b : aaacattgagatgagggggaccaacaaagtagtgctgggattaaaccaggcagaaccgga
LVRM1_0083_A12.b : CAACAATGAGA*GGAGGGGAAAGACCGAtttagaacatcgatttatccctcgcggacgga
LVRM1_0014_H08.b : CAAGAGTGACA*CGACGGGAAATAACGAAT*ACTACGTGG*Agtccccgcgaggaactgc
LVRM1_0055_H02.b : CCAGAGTGAGACGAAGGGGAAAGAACGAATTTCCACGTGGgattcttctgtggaggaact
LVRM1_0013_B09.b : CAAGAGTGAGA*GGAAGG*AAAGCACGAAGTACTACGAGG*ATTTCTCcagtgagggagg
LVRM1_0028_E01.b : catactgaccataggtgtaacaaacaatccacaacagcatttctcttgcaggaaaagata
LVRM1_0119_A02.b : CCAGAGTGAGA*GGAGGGGAAAGAACGAATTNCTGCGTGG*ATTTTACTGTGAGGAACTG
LVRM1_0083_H09.b : CACGAGTGAGA*GGAAGGGAAACAACGAATTACTACGTGG*ATTTCTCTGTCAGGAACTG
LVRM1_0205_F07.b : CCAGAATGAGA*AGAAGGGNAAAGACGAATTACTACGTGG*ATTTCTCTGTGNAGAACTG
LVRM1_0166_D05.b : CAAGAGTGACA*GGAGGGGATAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0010_A11.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACCTGG*ATTTTTCTGTGAGGAACTG
LVRM1_0197_B12.b : CAAGAGTGAGA*GGAAGGGACAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0128_A08.b : CAAGAGTGAGA*GGAGGGGAAAGACC*AATTACTACGTGG*AATTCTCTGTGAAGGACTG
LVRM1_0050_E04.b : CAAGAGTGAGAGGACGGCGCAAGAACGAATTACTACGTGG*AATTCTCTGTGAGGAACTG
LVRM1_0160_F06.b : NAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0087_A10.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAAGAACTG
LVRM1_0186_E02.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0070_H12.b : CCAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACCTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0047_B11.b : CAAGAGTGAAG*AGACGGGAAAGAACGAATTACTACGTGG*ATTTCCCTGTGAGGAACTG
LVRM1_0163_E03.b : CAAGAGTGAGA*GGACGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0208_D07.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0041_E01.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0195_E03.b : CAAGAGTGAGA*GGAGGGGAACGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0186_H06.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0195_C12.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATGACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0105_B05.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0078_G03.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGCGAGGAACTG
LVRM1_0003_D02.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0005_C01.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0101_F10.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0152_C05.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0145_H06.b : CCAGAGTGAGA*GGAGGGGAAAGA*CNAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0129_B10.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGNAGGACTG
LVRM1_0019_A04.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0037_H08.b : CAAGAGTGNAG*AGGAGGGGAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0199_F08.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0036_B11.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0068_C07.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0021_F06.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0199_C09.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0128_C08.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0057_H03.b : CAAGAGTGAGA*GGAGGGGGAAGAACGAATTACTACGCGG*ATTTCTCTGTGAGGGACTG
LVRM1_0142_D08.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0102_E09.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0036_B12.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGGACTG
LVRM1_0033_E09.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAAGGACTG
LVRM1_0151_E11.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0161_E07.b : CCAGAGTGAGA*GGAGGGGAAAGAACG*ATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0107_B05.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGGACTG
LVRM1_0139_G06.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0002_E07.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVR01_0016_D08.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVR01_0073_F08.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVR01_0106_C08.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVR01_0077_G05.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVR01_0017_B10.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVR01_0091_A09.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0159_F02.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0034_H08.b : CAAGAGTGAGG*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0035_H12.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0040_C05.b : CAAGAGTGAGA*GGAGGGGACAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0091_G09.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0199_G03.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0156_B06.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0203_F02.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0207_F06.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0162_C01.b : CNAGAGTGNAG*AGGAGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGGACTG
LVRM1_0136_G02.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVR01_0019_A05.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0208_H07.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGGAGAACTG
LVRM1_0139_F02.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0200_C11.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0093_C12.b : CAAGAATGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTCCTCTGTGAAGAACTG
LVRM1_0168_F06.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0083_E04.b : CAAGAGTGAGA*NGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0184_C04.b : CNAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0143_F03.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0001_F09.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0023_C03.b : CAAAATTGACA*CGAGGAGAAAGAACGA*TTACTACGTGG*ATTTCTCTGTGACGAACTG
LVRM1_0121_E04.b : CAAGAGTGAGA*GGAGGGGGAAAGACGAATTACTACGTGG*GATTCTCTGTGAGGAACTG
LVRM1_0123_A04.b : CAAGAGTGAGA*AGAGGGGAAATAACGAACTACTACGTGG*ATTTCTCTGGGGAGAACTG
LVRM1_0083_F04.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVR01_0053_F11.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0171_C07.b : CAAGAGTGANA*GGAGGGGAAAGAACCAATTACTACGTGG*ACTTCTCTGTGACGAACTG
LVR01_0049_A08.b : CAAGAATGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0147_A09.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0176_G07.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0181_C04.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0176_C04.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0159_G08.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0096_A01.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0038_C01.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0108_E09.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0005_D04.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0170_D10.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0023_H04.b : cgagtgagggccggaagggccggaataaggaaagggggaacaggcactgacaatggaaaa
LVRM1_0108_D12.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0186_G01.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0013_H10.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0093_A11.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0166_F02.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0028_C05.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0036_B10.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0143_A07.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0051_F03.b : CAAGAGTGAGA*GGAGGGGAAAGAACGGATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0072_C03.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0182_G05.b : CAAGAGTGAGA*GGAGGGGAAAGAGCGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0156_A06.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0049_E04.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0005_A03.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0044_H08.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0179_D07.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0147_C06.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVRM1_0163_A10.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVR01_0003_E12.b : CAAGAGTGAGA*GGAGGGGAAAGAACGAATTACTACGTGG*ATTTCTCTGTGAGGAACTG
LVR01_0093_A11.b :
LVRM1_0007_D03.b :
20110601C-012185 : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
---------+---------+---------+---------+---------+---------+ 762
LVRM1_0008_G10.b : CTACAGTCGCTGGC*GCTCTTCTACCTTTGGATTCGTAGA*GCAGATTTCAcaatg
LVRM1_0168_C11.b : acagacctctccgtattgaaaaaaaaccgccactta
LVRM1_0091_G11.b : CTCCAATCGCTGGC*GTTCTCCTACCTTTAGATTCTGTAG
LVRM1_0047_B01.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGAATCTGTAn
LVRM1_0198_F12.b : agattccagccgctggtacctctcttaacctatgcatactagtaatacaagatttta
LVRM1_0016_C11.b : cgctgcgcactccaaccttcaattcgtcaacaaaatccataatgatccaat
LVRM1_0117_A05.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTnatt
LVRM1_0061_G04.b : GTTCCGTCGCTGGC*GCTCTCCTACCTGTGGATggcttgagagcagatttatgaatg
LVRM1_0196_F09.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTTCn
LVRM1_0202_B06.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTTCA
LVRM1_0195_F11.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGAATCTGTAGAGCAGATTTCATC
LVRM1_0042_B12.b : CTCCAGTCGCTGGC*GCTCTC*TACCTTTGGATTCCGTAAAGCAGAATTCCTCACTGAT
LVRM1_0024_B02.b : ttcattccttgtgctctcctacc
LVRM1_0079_F06.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATCT*CATCTATGA*
LVRM1_0049_G09.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAAAGCAGATTT*CATCAATGA*
LVRM1_0077_G12.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCACTGA*
LVR01_0034_E10.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTTTCATCAATGA*
LVRM1_0158_H03.b : cctgggtcccccaccttggattctgtcaactgattcctc
LVRM1_0171_G05.b : tcacggaatggcgcccagcaacagggtgatacaatcaagcatagg
LVRM1_0020_A11.b : CTTCCGTCGCTGGC*GCTCTCCTACGTTTGGATTCTGTAGAGCA
LVRM1_0122_B02.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGGATCTGTAGAGCAGATTTCAc
LVRM1_0163_H05.b : gggtgcaaacaagccgctaggataaagccatcgcc
LVRM1_0163_D05.b : catcaatcggagagcggtctccatacattgggaatcagataagcaaattccgc
LVRM1_0087_D05.b : tccaatcgctggccctccctaccttggaatctgtaaagcagattcacc
LVRM1_0164_F12.b : agcctctgacttggaaaacccagaagaattgtcataaactgtgaagtcttcaacttcna
LVRM1_0077_B03.b : CTCCAcacgttgctgctctcccaccctggcatccgcatactaaaattcctcacgctcgcc
LVRM1_0134_B10.b : CTCCAGCCGCccggcctcttctcacctccgaatttcgcagaatagacttcaattataccc
LVRM1_0188_E01.b : CTCAAGTCGCTGGC*ACTCACCTACaat
LVRM1_0187_B02.b : CTCCAGTCGCTGGC*GCTCTCCTAACTTTGGGATCcgaa
LVRM1_0206_F02.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTT
LVRM1_0208_A06.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGAATCTGTAGAGCAn
LVRM1_0092_E08.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAcagat
LVRM1_0039_D04.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCT
LVRM1_0204_G12.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGNATCTGTAGAGCAGATTcatca
LVRM1_0122_E05.b : CTTCAGTCGCTGGC*GCTCTCCTACCT*TGAAATCTGTAaaacaaat
LVRM1_0098_E08.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAAAGCAa
LVRM1_0102_B04.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGA
LVRM1_0197_H12.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTTCNATC*ATGA*
LVRM1_0029_B01.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0149_H08.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGA*TCTGTAGAGCAGATTTCAT**CATGA*
LVRM1_0152_B09.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0031_D06.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATCT*CATCAATGA*
LVRM1_0130_B11.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0152_E10.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGA*TCCGTAAAGCAGAATT*CATCGATGA*
LVR01_0105_G08.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVR01_0030_A05.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0096_A05.b : CTCCAGTCGCTGGC*GCTCTCCTAACTTTGGCATCTGTAAAGCA
LVRM1_0019_F12.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGAATTTCATC*ATGA*
LVRM1_0159_F03.b : tccgtcgcttgtcccctcctcacttttgatttttgctattcattttccccgtattcccaa
KDN01_0096_D10.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0168_G08.b : acacaaatcgagaacgcaagaaagggagccaaggtaacgacaataaagatgcagagagga
LVRM1_0205_E10.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTTTCATC*ATGA*
LVRM1_0056_A02.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0135_E11.b : ttttccacctcttgactttccctaaccttggtatcctgcttatcttatttccccattgtt
LVRM1_0181_B03.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGAATTTCATC*ATGA*
LVRM1_0106_B06.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0018_D04.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0035_G10.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGGATCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0004_D09.b : CTCCAGTCGCTGGC*GCTCTCCTA*CTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0111_H05.b : CTCCAGTCGCCGG**GCTCTCCTACCTTTGGGATCTGTAGAGCACAGTTCtcattgaggc
LVRM1_0198_A07.b : CNTCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTTCAT**CATGA*
LVRM1_0151_A12.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTTC**TTCATGA*
LVRM1_0188_H09.b : aatcgtagtgcgcactacgcccaaaacggtccacataacacaacactccatattattatc
LVRM1_0015_A07.b : atcgctgacctctccacctttggatccggtaaagcaaatttctcccgatgcaaacctccg
LVRM1_0133_E10.b : cccttttttggcgctttccctctttctgttttttcctctcttactcttccctttgcctta
LVRM1_0163_B11.b : ctgcagtcattggagccacctcgatctgcacacggttagcggatactaaagggggcccgc
LVRM1_0147_H02.b : catcagtcccctggcgcttctcctactttggaatctgtgaaagcaaatttcctccaggat
LVRM1_0134_C10.b : gttctagcccccggcgctttactactttgggaatctgtatctctgaataccgccttcacg
LVRM1_0021_A01.b : gccccatcactgggggtcttccacctttggaatcggcatagcagaattcaccctgagggc
LVRM1_0051_H02.b : CTCCAGccccccgcactctcctccattggataccggaggagagatttctctggggacgca
LVRM1_0177_C07.b : CTCCAGTCCGCTGG*GCTCTCCTACCTTTGGATTCTGTAaaaacaattccatcacgatgc
LVRM1_0191_F03.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCCATGA*
LVRM1_0202_C11.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCNATGA*
LVRM1_0121_F12.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGAATT*CATCAATGA*
LVRM1_0006_C09.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0146_F12.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0024_C10.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTTCC*TCAATGA*
LVRM1_0122_D11.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0199_A10.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCNATGA*
LVRM1_0195_C10.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0075_H07.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTTTCATC*ATGA*
LVRM1_0175_F11.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGGGCAGATTT*CATCAATGA*
LVRM1_0034_A07.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0050_E07.b : CTCCAGTCCCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0037_H10.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCNATGA*
LVRM1_0113_B05.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0148_E11.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGGATCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0107_C09.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCACATTT*CATCAATGA*
LVRM1_0139_F05.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0148_E06.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVR01_0053_F01.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVR01_0063_F06.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVR01_0096_B05.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVR01_0068_C08.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVR01_0068_B10.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0016_G01.b : ccacccgattgcccctcctacctggagatctgcgattgcaaatgcacccagagcacgaac
LVRM1_0062_F10.b : catcgaacgggtgccttggatgactttgggtgatagaaggaacgtgatagatattggaat
LVRM1_0107_E05.b : CTCCAGTCGCTTGC*GCTCTCCTACCTTTGG*TTCCGTAGAGCAAATTTCATCATGatgc
LVRM1_0052_H07.b : CTCCAATCGCTGGC*GCTCTCCTACCTCTGGAGTCTGTAGAGCAGATT**CATCAATGA*
LVRM1_0094_G07.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0032_G01.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVR01_0041_B06.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0183_A03.b : accatttcccgcctccccgtgtaacattggggaacaataagaatgtattaacatgtatta
LVRM1_0088_F10.b : tccagtgctggcactctcgtacctttgactccggtcaaccaatgtgcccactgaaccgga
LVRM1_0150_E05.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATT**CATCAATGA*
LVRM1_0150_A07.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCCATGA*
LVRM1_0034_G06.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTTCTGTAAGCAGATTT*CATCAATGA*
LVRM1_0181_G04.b : cctaagcgacgtacaataagctccccaagaaccgaccgagccgaactaagcgacccgcaa
LVRM1_0096_G10.b : ctaacccacattactgcaaccaatacaacttatacactttccacgagtcaacaactctcg
LVRM1_0184_B12.b : atcattaagggtcacgattctaaacgaagatttaataaccacaaacaagaaaaacaaaca
LVRM1_0169_D08.b : gtcatacagagagaagctaattgagttcgattaagaaaaaaagaaccgcgaaaggaaccc
LVRM1_0083_A12.b : cctaagactggcagtcacacaggttccgatcctgacacgggcttgcctcgggagcaaacc
LVRM1_0014_H08.b : tccagtcctgggtctctcctaccttggcatccgtcaagcatattgctcattgaggcagac
LVRM1_0055_H02.b : gcttccgttcccttggagctcctcttaactttgggattccggngaggcgtattttcacta
LVRM1_0013_B09.b : gtgccggcacggggggaaaggggatatgatacaagaaaagaacagaggagggagcaccag
LVRM1_0028_E01.b : aacgagggtccgtcaacaaccctggatccggaggccgagccccttttattcg
LVRM1_0119_A02.b : CTTCAGTCGgtggggatgcacnacctgttggttccgntagagggaattcatcaaggatca
LVRM1_0083_H09.b : CTCCAGTCGATGGC*GCTCTgccaccgctggaatctgtacacgcgattcgagcatgatgc
LVRM1_0205_F07.b : CTCCAGTCCCTGGC*GCTCTCCTACTTTGGGATCcggtagaacaaattcctccatgatgc
LVRM1_0166_D05.b : CTCCAGTCCCTGGG*CCTCTCCTACCTTTGGCATCTGTAAAatagattgatcaaggatgc
LVRM1_0010_A11.b : CTCCAGTTGATGGC*GCATTCCTACCTTTGcatttgtcctagtcattctcttatgttgtc
LVRM1_0197_B12.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGAATCTGTATAGCAGATTTatcaacgtgca
LVRM1_0128_A08.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTGGGA*TCTGTAGAGAAGATTcatcaatgatgc
LVRM1_0050_E04.b : CTCCAGTCCCTTGCGGCTCCCCTACCTTTTGGATCTGTAGAGCAGATTTCCATCAatgaa
LVRM1_0160_F06.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGA*TCTGTAGAGCAGATTT**CATCATGA*
LVRM1_0087_A10.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCCGTAGAGCAGATTT*CATCACTGA*
LVRM1_0186_E02.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0070_H12.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTTAGAGCAGATTTCATCAATGA*
LVRM1_0047_B11.b : CTCCAGTCGCTGGC*GCTCTCTTCCCTTTGGATTCTGTATATGAGATTT*CCTCGATGA*
LVRM1_0163_E03.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAACAGATTTCCATC*ATGA*
LVRM1_0208_D07.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0041_E01.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CGTCAATGA*
LVRM1_0195_E03.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0186_H06.b : CTCCAGTCGCTGGC*GCTCTCCTACC*TTGGATTCTGTAGAGCAGATTT*CATCCATGA*
LVRM1_0195_C12.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0105_B05.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0078_G03.b : CTCCTGCCGCTGGC*GTTCTCCTACCTTTGGATTCTGTAGAGCACATTT**ATCAATGA*
LVRM1_0003_D02.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTTCNATC*ATGA*
LVRM1_0005_C01.b : TCTCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCCATGA*
LVRM1_0101_F10.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0152_C05.b : CTCCCGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGAATT*CCTCAATGA*
LVRM1_0145_H06.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGA*TCTGTAGAGCAGATTTCA**TCATGA*
LVRM1_0129_B10.b : CTCCAGTCGCTGGC*GCTCTCCTACCCTTG*ATTCTGTAGAGCAGATTT*CATCNATGA*
LVRM1_0019_A04.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTCCCATC*ATGA*
LVRM1_0037_H08.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0199_F08.b : CTCCAGTCGCTGGC*GCTCTCCCTACCTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0036_B11.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0068_C07.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0021_F06.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0199_C09.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCCATGA*
LVRM1_0128_C08.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0057_H03.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCCATGA*
LVRM1_0142_D08.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0102_E09.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTTTCATC*ATGA*
LVRM1_0036_B12.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0033_E09.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0151_E11.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGGATT*CATCAATGA*
LVRM1_0161_E07.b : CTCCAGTCGCTGGC*GCTCTCCTA*CTTTGGATTCTGTANAGCAGATTT*CTTCAATGA*
LVRM1_0107_B05.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTTTCATC*ATGA*
LVRM1_0139_G06.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0002_E07.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVR01_0016_D08.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVR01_0073_F08.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVR01_0106_C08.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVR01_0077_G05.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVR01_0017_B10.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVR01_0091_A09.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0159_F02.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGGTAAGCAGATTT*CATCAATGA*
LVRM1_0034_H08.b : CTCCAGTCGCTGGC*GCTCTCCTA*CTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0035_H12.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0040_C05.b : CTCCAGTTCCTGGC*GCTCTCCTACCTTTGGATTCTGTATAGCAAGATT*CCTCCATGA*
LVRM1_0091_G09.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0199_G03.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGAATT*CATCAATGA*
LVRM1_0156_B06.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0203_F02.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0207_F06.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0162_C01.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTT*GATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0136_G02.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVR01_0019_A05.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0208_H07.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAAAGCAGATTT*CATCAATGA*
LVRM1_0139_F02.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0200_C11.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0093_C12.b : CTCCAGTCGCTGGC*GCTCCTCCAACTTTGGAATCTGTAAAACCAATTTCCtcaatggag
LVRM1_0168_F06.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAAATTT*CATCACTGA*
LVRM1_0083_E04.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAAGGA*
LVRM1_0184_C04.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATTCATGA*
LVRM1_0143_F03.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0001_F09.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0023_C03.b : CTCCAGGTGCTGGC*GCTCTgctact
LVRM1_0121_E04.b : CTCCAGTCGCTGGC*GCTCTCCTAACTTTGGATTCTGTAaaacaaaattcccccatgaag
LVRM1_0123_A04.b : CTCCAGTCTGCGGG*GTTCTCCTACCTTTGGtttccgttcatgtgagttcgatcattgat
LVRM1_0083_F04.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCACATTT*CATCGACGA*
LVR01_0053_F11.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0171_C07.b : CTCCAGTCGCTGGgggtgtcccactctgcactcaccagaaaaaatttcgtccatgcccgc
LVR01_0049_A08.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTACAGCAGATTT*CATCAATGA*
LVRM1_0147_A09.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0176_G07.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0181_C04.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0176_C04.b : CTCCAGTCACTGGC*GCTCTCCCACCTTTGGATTCTGTCAGACACATCT*CATCAATGA*
LVRM1_0159_G08.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0096_A01.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0038_C01.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0108_E09.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0005_D04.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0170_D10.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGACTT*CATCAATGA*
LVRM1_0023_H04.b : caaaacagggaaggacgataataaagggggggggggagaaaggggcaggggacaaaggtg
LVRM1_0108_D12.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0186_G01.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0013_H10.b : CTCCAGTCGCTGGC*GCTCTCCCACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0093_A11.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0166_F02.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0028_C05.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0036_B10.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0143_A07.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0051_F03.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0072_C03.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0182_G05.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0156_A06.b : CTCCAGCCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0049_E04.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0005_A03.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0044_H08.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0179_D07.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVRM1_0147_C06.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGAA
LVRM1_0163_A10.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVR01_0003_E12.b : CTCCAGTCGCTGGC*GCTCTCCTACCTTTGGATTCTGTAGAGCAGATTT*CATCAATGA*
LVR01_0093_A11.b : gcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0007_D03.b : xxxxxxxxxxxxxxxxxxxx
20110601C-012185 : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
---------+---------+---------+---------+---------+---------+ 820
LVRM1_0008_G10.b :
LVRM1_0168_C11.b :
LVRM1_0091_G11.b :
LVRM1_0047_B01.b :
LVRM1_0198_F12.b :
LVRM1_0016_C11.b :
LVRM1_0117_A05.b :
LVRM1_0061_G04.b :
LVRM1_0196_F09.b :
LVRM1_0202_B06.b :
LVRM1_0195_F11.b :
LVRM1_0042_B12.b :
LVRM1_0024_B02.b :
LVRM1_0079_F06.b : TGCAGAA
LVRM1_0049_G09.b : TGCAAAAACCTC
LVRM1_0077_G12.b : TGCAGAAGCCTCTGACTTGG*AAAACCCACAACATATg
LVR01_0034_E10.b : TGCAAAAGCCTCTGACTTGG*AAAACCAGAAGATATTTGTCATAAAACTGTGAAGTCTTC
LVRM1_0158_H03.b :
LVRM1_0171_G05.b :
LVRM1_0020_A11.b :
LVRM1_0122_B02.b :
LVRM1_0163_H05.b :
LVRM1_0163_D05.b :
LVRM1_0087_D05.b :
LVRM1_0164_F12.b :
LVRM1_0077_B03.b : g
LVRM1_0134_B10.b : agtaccctccgacttgtcaaaccagagaaattg
LVRM1_0188_E01.b :
LVRM1_0187_B02.b :
LVRM1_0206_F02.b :
LVRM1_0208_A06.b :
LVRM1_0092_E08.b :
LVRM1_0039_D04.b :
LVRM1_0204_G12.b :
LVRM1_0122_E05.b :
LVRM1_0098_E08.b :
LVRM1_0102_B04.b :
LVRM1_0197_H12.b : TGCAGAA
LVRM1_0029_B01.b : TGCAGA
LVRM1_0149_H08.b : TGCAGAAGCtctgacttggaaacca
LVRM1_0152_B09.b : TGCAGAAGCCTCc
LVRM1_0031_D06.b : TGCAGAACCCTCTGAC
LVRM1_0130_B11.b : TGCAGAAGCCTCTGACTTGG
LVRM1_0152_E10.b : TGCAAAAACCTCTGACTTGG*AAAACCCA
LVR01_0105_G08.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVR01_0030_A05.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0096_A05.b :
LVRM1_0019_F12.b : TGCAGAAGCCTCTGACTTGG
LVRM1_0159_F03.b : tcctctg
KDN01_0096_D10.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0168_G08.b : at
LVRM1_0205_E10.b : TGCAGAAGCCTCTGACTT
LVRM1_0056_A02.b : TGCAGAAGCCTCTGACTTGC*ACAACCCAtaa
LVRM1_0135_E11.b : gcctaatccccctacctcctaaacccttaatatatttctttcacctgttaacttctttac
LVRM1_0181_B03.b : TGCAGAAGCCTCTGACTTGG*GAAACCCA
LVRM1_0106_B06.b : TGCAGAAGCCTCTGAATTGG*ATAACCCAGAAGAT
LVRM1_0018_D04.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGT
LVRM1_0035_G10.b : TGCAGAAGCCTCTGACTTTG*GAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0004_D09.b : TGCAGAGGCCTCTGACTTGG*AAAACCCAGAAGATA*TGTCATTAA*CTGTNGAGTCTTC
LVRM1_0111_H05.b : aaaaacctctgacttgtaaaaccctaccatttttccta
LVRM1_0198_A07.b : TGCAAAA*CCTCTGACTTGG*AAACCCAGaggatttgtct
LVRM1_0151_A12.b : TGCAGAGGCCTCTGACTTGG*AGAACCCAGAAAATATTGTCATAAA*CTGTGAAGTCT
LVRM1_0188_H09.b : cacaaacataatattcacacgtcgcatcacattctccctcccac
LVRM1_0015_A07.b : acttgaaacccccagattattctcgagt
LVRM1_0133_E10.b : tctttttcatcggcccctcttacacattttcctcctatccgtattcccctaccctttttc
LVRM1_0163_B11.b : gtatgctcatagaagcacgacagaaatcggccagt
LVRM1_0147_H02.b : gacaaagcctctgacttggtagacccagaaagaattggctt
LVRM1_0134_C10.b : ctttaacctccttatttcacttatctcattattttgttcctattgccatccctctcttcg
LVRM1_0021_A01.b : gaaacctgcgactttgaacaccagaacaaat
LVRM1_0051_H02.b : cagcctcttgccttcgaaattcccactattttgc
LVRM1_0177_C07.b : aaaacgcttgaacttgcaaacccaagaaac
LVRM1_0191_F03.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAAAAGAa
LVRM1_0202_C11.b : TGCAGAAACCTCTGACTTTG*AAAAACCAGAAGATATTGTCATAAA*CTGTGGAG
LVRM1_0121_F12.b : TGCAGAAACCTCTGACTTGG*AAAACCAGAAa
LVRM1_0006_C09.b : TGCAAAAGCCTCTGACTTGG*ATACCCAGAgatattgtcataactgtgaaggcttcactt
LVRM1_0146_F12.b : TGCAGAAGCCTCTGACTTTG*GAAACCCAGAAGAa
LVRM1_0024_C10.b : TGCAGAACCCTCTGACTTGG*AATACC*AGAACATAT
LVRM1_0122_D11.b : TGCAGAAGCCTCTGACTTGG*TAAACCCAGAAGATAT
LVRM1_0199_A10.b : TGCAGAAGCCTCTGACTTGG*AAAACC*AGAAGATATTGTCATAAA*C
LVRM1_0195_C10.b : TGCAGAAGCCTCTGACTTGG*AAA*CCCAGAAGATATTGTCATCAA*CTGTGA
LVRM1_0075_H07.b : TGCAGAAGCCTCTGACTTTG*GAAACCCAGAAGATATTGTCATAAA*CTGTG
LVRM1_0175_F11.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAACATATTGGCATAGA*CTGTG
LVRM1_0034_A07.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGT
LVRM1_0050_E07.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAAAGAATA*TGTCATAAC*CTGTGgagtcctc
LVRM1_0037_H10.b : TGCAGAAGCCTCTGACTTTG*GAAACCCAAAGGAT*TTGTCATAAA*CTGTGA
LVRM1_0113_B05.b : TGCAGAAGCCTCTGACTTGG*GAAACACAGAAGA*ATTGTCATGAA*CTGTGGAGTCTTC
LVRM1_0148_E11.b : TGCAGAAGCCTCTGACTTGG*TAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0107_C09.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0139_F05.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATNAA*CTGTGAAGTCTTC
LVRM1_0148_E06.b : TGCAGAAGCCTCTGACTTGG*AAAACCCA*AAAATATTGTCATAAA*CTGTGAAGTCTTT
LVR01_0053_F01.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVR01_0063_F06.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVR01_0096_B05.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVR01_0068_C08.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVR01_0068_B10.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0016_G01.b : tccgacactggaggcgcacagaatcgacaggacatatactaccag
LVRM1_0062_F10.b : gtcagttgtatggtgagtgagatgtgataggtgacgatgaagatggatgggaaa
LVRM1_0107_E05.b : aaaacccccgacttggaaaacccaaaaatt
LVRM1_0052_H07.b : TGCAGAAGCtctgacttgaataacccgaagatatgttctaactgtgag
LVRM1_0094_G07.b : TGCAGAACCCTCTGACTTGG*AAAACCCAGAAGATctgttn
LVRM1_0032_G01.b : TGCAGAAGCCTCTGACTTGN*NAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCctt
LVR01_0041_B06.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0183_A03.b : cgttattaccactcacgatgggtcacttttctcacgat
LVRM1_0088_F10.b : aacacctgacctgggacaaacgaaaaacaccgggaacccccacaggtccgt
LVRM1_0150_E05.b : TGCAGAAGCCTCTGATTTGGTAAAACCCCGAAGATATTGTCATATA*CTGTG
LVRM1_0150_A07.b : TGCAGAAACCTCTGACTTGG*AAAAACCACAAGATATTGTTCATAA*CTGTGAAagtctc
LVRM1_0034_G06.b : TGCAGAAGCCTCTGACTTGG*AAAACC*AGAAGATATTGTCATAAA*CTGTGAAGTCCTC
LVRM1_0181_G04.b : acagaccatgaacaccaaagaacaaaacgacgca
LVRM1_0096_G10.b : cctacaccgtagcaaatcccacccccacccagagtctgccccagaacacccacactaccc
LVRM1_0184_B12.b : ttctcaaaccccc
LVRM1_0169_D08.b : ccgccacagccccgccggaagatatccccatcccggtataaggct
LVRM1_0083_A12.b : cgcggcagacagggccggagccaaggcggt
LVRM1_0014_H08.b : ccccggcgcgggaaaccccagagtagcatctttaggtgcgcgagcggtaatccagacgct
LVRM1_0055_H02.b : acgatggcataaccctctgtactgtgaaaaccttctatgaaatttgccgataacatgg
LVRM1_0013_B09.b : cacggaggggatgcggggaggaaagcgagaggagagggaggaggagagagagcggagga
LVRM1_0028_E01.b :
LVRM1_0119_A02.b : taaccctctgacttagggaacccaggaaagatttgccaaaagtgtgaaaactatg
LVRM1_0083_H09.b : gcaaacctcctatgttgtaacagccctatagcccgtgatga
LVRM1_0205_F07.b : caagacccctgactggaaacccagagatattgtctaaactgtaaa
LVRM1_0166_D05.b : gaaacctctgaattgaaagacctgaagaattgtcgta
LVRM1_0010_A11.b : tacgttctgactgtaaataccccaaattttgccttacctcttaattatcatttcacgaat
LVRM1_0197_B12.b : gaagcctctgcctggaaaacccataagaaatttaataaactgtgaatcctt
LVRM1_0128_A08.b : aaaacccctgacttggaaaacccgaagataatgccataaacggtgagtcttctacttcca
LVRM1_0050_E04.b : gcggaagcccctgacctggaaaatcccccagataatggtcttaacatgtga
LVRM1_0160_F06.b : TGCAGAagctccgactgggaaaaccccaatatatgtcataaactgtggagtctccacttt
LVRM1_0087_A10.b : TGCATAAGCCTCcgcattgggaaaaccagaaaattcgtcataaacggcga
LVRM1_0186_E02.b : TGCAGAAGCCTCTGACTTGG*AAAAC
LVRM1_0070_H12.b : TGCAGAAGCCTCTtgactggaaaa
LVRM1_0047_B11.b : GGCATAAGCCTCTGACTTGG*AATACCCcaaaatattgttctcactgg
LVRM1_0163_E03.b : TGCACAAGCCTCTGACTTGGGAAAACCCAAagattg
LVRM1_0208_D07.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAGAatatgtca
LVRM1_0041_E01.b : TGCAGAAACCTCTGACTTGG*AAn
LVRM1_0195_E03.b : TGCAGAAGCCTCTGACTTGG*AAAACCC
LVRM1_0186_H06.b : TGCAGAAGCCTCTGACTTGG*GAAA*CCAGAAGATATTGTCtt
LVRM1_0195_C12.b : TGCAGAAACCTCTGACTTGG*AAAACCCAGAA
LVRM1_0105_B05.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGAattgtcan
LVRM1_0078_G03.b : TGCAGAACCCTCTGACCTGC*CAAACCCGGAACATATTGcttaaccgcggacgcttccac
LVRM1_0003_D02.b : TGCAGAAGCCTCTGACTTGG*NAAACCCAGAAGATATTGTCATAAA*CTGTG
LVRM1_0005_C01.b : TGCAGAGCCCT*TTACTTGG*AA*ACCCAGAAGATATttggataacctgtgagtctgaac
LVRM1_0101_F10.b : TGCAGAAGCCTCTGACTTGG*AAAACCCANA*GATATTGTtcataactgttgagtctttc
LVRM1_0152_C05.b : TGCAGAAGCCTCTGAACTTG*AAAACCCCACAGATATTGT
LVRM1_0145_H06.b : TGCAGAAGCCTCTGACTTGG*AAACCCCA*AAAATATTGTCttaactgtgaagtctcaac
LVRM1_0129_B10.b : TGCAGAAGCCTCTGACTTG**AAAACCCAGAAGAT*TTGTCATAActgtggaatcttcaa
LVRM1_0019_A04.b : TGCANAAGCCTCTGACTTGG*GAAACCCAGAAGATATTGTCATAAAn
LVRM1_0037_H08.b : TGCAGAAGCCTCTGACTTGG*AAAACCAAGA*GATATTGTCATAAA*CTGT
LVRM1_0199_F08.b : TGCAGAAGCCTCTGACTTGG*AAAAC*CAGAAGATATTGTCATAAA*CTGT
LVRM1_0036_B11.b : TGCAGAAGCCTCTGACTTTG*GAAAACCCAGAGATATTGTCATAAA*CTGTGA
LVRM1_0068_C07.b : TGCAAAAGCCTCTGACTTTG*GAAACCCAGAAGATATTGTCATAAA*CTGT
LVRM1_0021_F06.b : TGCANAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAG
LVRM1_0199_C09.b : TGCAGAAGCCTCTGACTTGG*AAAACCAA*AAGATATTGTCATAAA*CTGTGn
LVRM1_0128_C08.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGA*ATTGTCATAAA*CTGGGAAGTCctc
LVRM1_0057_H03.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGACATTGTCATAAA*CGGTGAAGTCTcc
LVRM1_0142_D08.b : TGCAGAAGCCTCTGACTTGN*A*AACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0102_E09.b : TGCAGAAGCCTCTNGACTTG*GAAACCCAGAAGATATTGTCANTAA*CTGTGAAGTCTTC
LVRM1_0036_B12.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGGAGTCTTC
LVRM1_0033_E09.b : TGCAAAAGCCTCTGACTTGG*AAAACCCAAAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0151_E11.b : TGCAGAAGCCTCTGACTTTG*GAAACCCAGAAGATATTGTCATAAA*CTGTGGAGTCTTC
LVRM1_0161_E07.b : TGCAAAAGCCTCTGACTTGG*AAAACCACGAAGATATTGTC*TAAA*CTGTGAAGTCTTC
LVRM1_0107_B05.b : TGCAGAAGCCTCTGACTTGG*AAA*CCCAGCAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0139_G06.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATNAA*CTGTGAAGTCTTC
LVRM1_0002_E07.b : TGCAAAAGCCTCTGACTTGG**AAACCCAGAAGATATTGTCATACA*CTGTGAAGCCTTC
LVR01_0016_D08.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVR01_0073_F08.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVR01_0106_C08.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVR01_0077_G05.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVR01_0017_B10.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVR01_0091_A09.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0159_F02.b : AGCAAAAGCTTCTGACTTGG*AAAACCCAGAATATAT
LVRM1_0034_H08.b : TGCAGAAGCCTCTGACTTGG*GAGAACCCAAAGATATTGTCATAAA*CTGTGGAGTCTTC
LVRM1_0035_H12.b : TGCAGAAACCTCTGACTTGG*A*AACCCAGAAGATAT*GTCATAAA*CTGTGAAGTCTTC
LVRM1_0040_C05.b : TCCACAACCCTCTGAATTGG*AAAtaccagcaacac
LVRM1_0091_G09.b : TGCAGAAACCTCTGACTTGG*AAAACCCAGAAGAT*TTGTCATAAA*CTGTGAAGT
LVRM1_0199_G03.b : TGCAGAACCCTCTGACTTGG*AAAAC
LVRM1_0156_B06.b : TGCAGAAACCTCTGACTTGG*ANAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0203_F02.b : TGCAGAAGCCTCTGACTTGG*AAACCCCAGAAGATAT*GTCATAAA*CTGTn
LVRM1_0207_F06.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGA*GATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0162_C01.b : TGCAGAAGCCTCTGACTTGG*AAAACCC*GAAAATATTGTCATTAA*CTG
LVRM1_0136_G02.b : TGCAGAAACCTCTGACTTGG**AAACCCAGAAGATATTGTCATAAA*CTGTNGAGTCTTC
LVR01_0019_A05.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0208_H07.b : TGCAGAAGCCTCTGACTGGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCctc
LVRM1_0139_F02.b : TGCAGAAGCCTCTGACTTGG*AAA*CCCAGAAGATAT*GTCCTAAA*CTGTGAAGTCTTC
LVRM1_0200_C11.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAGGATATTTGTCATAA*CTGTGAAGTCTTC
LVRM1_0093_C12.b : cccaaccccctgatttggaaacccagaagaatttgcccaaaccgtgaa
LVRM1_0168_F06.b : TGCAGAAGCCTCTGACTTGG*AANACCCAGAAGATATgtcatagactggggatcctt
LVRM1_0083_E04.b : TGCAGAAACCTCTGATTTGG*AAAACCCAGAAGATATTGTCATA
LVRM1_0184_C04.b : TGCACAAGCCTCTGACCTGT*NAAACCCCGAAGATATTGTCAAAAA*CTGTGAAGTC
LVRM1_0143_F03.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAA*ATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0001_F09.b : TGCAAAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATACA*CTGTGAAGTCTTC
LVRM1_0023_C03.b :
LVRM1_0121_E04.b : ccagaacctctgacctgggaaaacccaaaagaaa
LVRM1_0123_A04.b : tacaatcccccctcgtgttttactaatacactttgccatttttcggtacgtttctacctc
LVRM1_0083_F04.b : TGCACAAGCCTCTGATTTGG*GAAACCCAGAAGATATTGTCATAAA*CTGTGGAGTCTTC
LVR01_0053_F11.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0171_C07.b : gaacccacgtactgggcaaaccgcagaaatagcctagcaaaccatccagccgcctccaat
LVR01_0049_A08.b : TGCAAAAGCCTCTGACTTGA*AAAACCCACAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0147_A09.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0176_G07.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0181_C04.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0176_C04.b : TGCACAAGCCCCTGACTTGG*AAAACCCAGAAcactatgccacccccagagaagccgcta
LVRM1_0159_G08.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0096_A01.b : TGCACAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAGA*CTGTGAAGTCTTC
LVRM1_0038_C01.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0108_E09.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0005_D04.b : TGCAGAAGCCTCTGACTTGG*AAAACCCACAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0170_D10.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0023_H04.b : agaactggacgacgaaccggggcgggggaaaaagggaaaaggagagaaaaggagacagag
LVRM1_0108_D12.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0186_G01.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0013_H10.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0093_A11.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0166_F02.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0028_C05.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0036_B10.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0143_A07.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0051_F03.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0072_C03.b : TGCACAAGCCTCTGACTTGG*AAAACCCACAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0182_G05.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0156_A06.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0049_E04.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0005_A03.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0044_H08.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0179_D07.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0147_C06.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0163_A10.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVR01_0003_E12.b : TGCAGAAGCCTCTGACTTGG*AAAACCCAGAAGATATTGTCATAAA*CTGTGAAGTCTTC
LVR01_0093_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTTGTCATAAA*CTGTGAAGTCTTC
LVRM1_0007_D03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCTGTGAAGTCTTC
20110601C-012185 : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
---------+---------+---------+---------+---------+---------+ 879
LVRM1_0008_G10.b :
LVRM1_0168_C11.b :
LVRM1_0091_G11.b :
LVRM1_0047_B01.b :
LVRM1_0198_F12.b :
LVRM1_0016_C11.b :
LVRM1_0117_A05.b :
LVRM1_0061_G04.b :
LVRM1_0196_F09.b :
LVRM1_0202_B06.b :
LVRM1_0195_F11.b :
LVRM1_0042_B12.b :
LVRM1_0024_B02.b :
LVRM1_0079_F06.b :
LVRM1_0049_G09.b :
LVRM1_0077_G12.b :
LVR01_0034_E10.b : AACTTtcaaggatcataaaaacctccgttggtgggccaaaaacttttgggccatcgcttt
LVRM1_0158_H03.b :
LVRM1_0171_G05.b :
LVRM1_0020_A11.b :
LVRM1_0122_B02.b :
LVRM1_0163_H05.b :
LVRM1_0163_D05.b :
LVRM1_0087_D05.b :
LVRM1_0164_F12.b :
LVRM1_0077_B03.b :
LVRM1_0134_B10.b :
LVRM1_0188_E01.b :
LVRM1_0187_B02.b :
LVRM1_0206_F02.b :
LVRM1_0208_A06.b :
LVRM1_0092_E08.b :
LVRM1_0039_D04.b :
LVRM1_0204_G12.b :
LVRM1_0122_E05.b :
LVRM1_0098_E08.b :
LVRM1_0102_B04.b :
LVRM1_0197_H12.b :
LVRM1_0029_B01.b :
LVRM1_0149_H08.b :
LVRM1_0152_B09.b :
LVRM1_0031_D06.b :
LVRM1_0130_B11.b :
LVRM1_0152_E10.b :
LVR01_0105_G08.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAGGCATTTGGGCCATCGCTTTCA
LVR01_0030_A05.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGGCATCGCTTCCA
LVRM1_0096_A05.b :
LVRM1_0019_F12.b :
LVRM1_0159_F03.b :
KDN01_0096_D10.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0168_G08.b :
LVRM1_0205_E10.b :
LVRM1_0056_A02.b :
LVRM1_0135_E11.b : tctaat
LVRM1_0181_B03.b :
LVRM1_0106_B06.b :
LVRM1_0018_D04.b :
LVRM1_0035_G10.b : AACT
LVRM1_0004_D09.b : GACTTCAaggan
LVRM1_0111_H05.b :
LVRM1_0198_A07.b :
LVRM1_0151_A12.b :
LVRM1_0188_H09.b :
LVRM1_0015_A07.b :
LVRM1_0133_E10.b : atttac
LVRM1_0163_B11.b :
LVRM1_0147_H02.b :
LVRM1_0134_C10.b : cacataactcatcc
LVRM1_0021_A01.b :
LVRM1_0051_H02.b :
LVRM1_0177_C07.b :
LVRM1_0191_F03.b :
LVRM1_0202_C11.b :
LVRM1_0121_F12.b :
LVRM1_0006_C09.b : taaggatcatagaacatcagtggtgggcagagcatttggccatcgt
LVRM1_0146_F12.b :
LVRM1_0024_C10.b :
LVRM1_0122_D11.b :
LVRM1_0199_A10.b :
LVRM1_0195_C10.b :
LVRM1_0075_H07.b :
LVRM1_0175_F11.b :
LVRM1_0034_A07.b :
LVRM1_0050_E07.b : cactccaagatcatatcaacatcagtggtgggcagaagcatn
LVRM1_0037_H10.b :
LVRM1_0113_B05.b : cacn
LVRM1_0148_E11.b : AACTTCAA
LVRM1_0107_C09.b : AACTTCAA
LVRM1_0139_F05.b : AACTTCAAG
LVRM1_0148_E06.b : CACTTCAAGGA
LVR01_0053_F01.b : AACTTCAAGGATCATAAAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTTCA
LVR01_0063_F06.b : GACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGGCATCGCTTCCA
LVR01_0096_B05.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVR01_0068_C08.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVR01_0068_B10.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0016_G01.b :
LVRM1_0062_F10.b :
LVRM1_0107_E05.b :
LVRM1_0052_H07.b :
LVRM1_0094_G07.b :
LVRM1_0032_G01.b : ctacttcag
LVR01_0041_B06.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0183_A03.b :
LVRM1_0088_F10.b :
LVRM1_0150_E05.b :
LVRM1_0150_A07.b : aactttcagg
LVRM1_0034_G06.b : AACTTC
LVRM1_0181_G04.b :
LVRM1_0096_G10.b : caacctgagggn
LVRM1_0184_B12.b :
LVRM1_0169_D08.b :
LVRM1_0083_A12.b :
LVRM1_0014_H08.b : aagcact
LVRM1_0055_H02.b :
LVRM1_0013_B09.b :
LVRM1_0028_E01.b :
LVRM1_0119_A02.b :
LVRM1_0083_H09.b :
LVRM1_0205_F07.b :
LVRM1_0166_D05.b :
LVRM1_0010_A11.b : ctattaatctttcgccggctcaccttn
LVRM1_0197_B12.b :
LVRM1_0128_A08.b : ggatctagaaacatcagtggg
LVRM1_0050_E04.b :
LVRM1_0160_F06.b : caggatatagaa
LVRM1_0087_A10.b :
LVRM1_0186_E02.b :
LVRM1_0070_H12.b :
LVRM1_0047_B11.b :
LVRM1_0163_E03.b :
LVRM1_0208_D07.b :
LVRM1_0041_E01.b :
LVRM1_0195_E03.b :
LVRM1_0186_H06.b :
LVRM1_0195_C12.b :
LVRM1_0105_B05.b :
LVRM1_0078_G03.b : t
LVRM1_0003_D02.b :
LVRM1_0005_C01.b : ttgccgaacaag
LVRM1_0101_F10.b : acttccaggatcatagaaact
LVRM1_0152_C05.b :
LVRM1_0145_H06.b : ttcaggatcatagaac
LVRM1_0129_B10.b : ctcaaggatcataa
LVRM1_0019_A04.b :
LVRM1_0037_H08.b :
LVRM1_0199_F08.b :
LVRM1_0036_B11.b :
LVRM1_0068_C07.b :
LVRM1_0021_F06.b :
LVRM1_0199_C09.b :
LVRM1_0128_C08.b : cacctccaagatcatatgaacatccgtg
LVRM1_0057_H03.b :
LVRM1_0142_D08.b : Acttcaaagatcatagcaacat
LVRM1_0102_E09.b : AACT
LVRM1_0036_B12.b : AACn
LVRM1_0033_E09.b : AACTTC
LVRM1_0151_E11.b : CACTTC
LVRM1_0161_E07.b : ACCTTCcagatcataaaaactcaatggtgggcaaaacatt
LVRM1_0107_B05.b : AACTTCA
LVRM1_0139_G06.b : AACTTCNAGGATCATAGAAn
LVRM1_0002_E07.b : AACTTCAAGGATCATAGA*ACATCAGTGTGGG*GCAGAAGCn
LVR01_0016_D08.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAAAAGCATTTGGGCCATCGCTTCCA
LVR01_0073_F08.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVR01_0106_C08.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVR01_0077_G05.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVR01_0017_B10.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVR01_0091_A09.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0159_F02.b :
LVRM1_0034_H08.b : AACTTCAA
LVRM1_0035_H12.b : AACTTCAgg
LVRM1_0040_C05.b :
LVRM1_0091_G09.b :
LVRM1_0199_G03.b :
LVRM1_0156_B06.b : CACTTCAAGGA
LVRM1_0203_F02.b :
LVRM1_0207_F06.b : AACT
LVRM1_0162_C01.b :
LVRM1_0136_G02.b : AACTTCAggatcctag
LVR01_0019_A05.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0208_H07.b :
LVRM1_0139_F02.b : AACTTCAAGGATCATAGAAACATCAGn
LVRM1_0200_C11.b : AACTTTCAGGATCATAGAn
LVRM1_0093_C12.b :
LVRM1_0168_F06.b :
LVRM1_0083_E04.b :
LVRM1_0184_C04.b :
LVRM1_0143_F03.b : AACTTCAAGGA
LVRM1_0001_F09.b : AACTTCA*GGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0023_C03.b :
LVRM1_0121_E04.b :
LVRM1_0123_A04.b : acgatcttgcaatagcgttaggggttgacctattgtgccgtccattttctttgtttggaa
LVRM1_0083_F04.b : ACCTTCCAGGATCATAGAAcctcactggcgggggaaaccattgcgcaatcccttccaca
LVR01_0053_F11.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0171_C07.b : gccgcgacctttccgctgcctactccgcgaccactttgccgcagtgtatgccgccagctg
LVR01_0049_A08.b : AACTTCAAAGATCATACAAACATCAGTGGTGG*GCAGAATCATTTGGGCCATCGCTTCCA
LVRM1_0147_A09.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAACATTTGGGCCATCGCTTCCA
LVRM1_0176_G07.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0181_C04.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0176_C04.b : aattcaagatcacacgagccttacgatggggaacgaaactccagcgatcggcacaaagct
LVRM1_0159_G08.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0096_A01.b : GACTTCAGAGATCCTACAAACATCAATGGTGG*GCAGAAGCATTTGGGCCATCACTTCCA
LVRM1_0038_C01.b : AACTTCAAGGATCATAGAAACATCAGTGGTGGCGCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0108_E09.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0005_D04.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0170_D10.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0023_H04.b : agggaaaaaaaaagggaggaagcggaaagtgaaagaaagaggagaggaaaggagagcaag
LVRM1_0108_D12.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0186_G01.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0013_H10.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0093_A11.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0166_F02.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0028_C05.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0036_B10.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0143_A07.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0051_F03.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0072_C03.b : AACTTCGAGGATCATAGAAACATCAGTGGTGG*GGAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0182_G05.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0156_A06.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0049_E04.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0005_A03.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0044_H08.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0179_D07.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0147_C06.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGGAGCATTTGGGCCATCGCTTCCA
LVRM1_0163_A10.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVR01_0003_E12.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVR01_0093_A11.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
LVRM1_0007_D03.b : AACTTCAAGGATCATAGAAACATCAGTGGTGG*GCAGAAGCATTTGGGCCATCGCTTCCA
20110601C-012185 : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
---------+---------+---------+---------+---------+---------+ 937
LVRM1_0008_G10.b :
LVRM1_0168_C11.b :
LVRM1_0091_G11.b :
LVRM1_0047_B01.b :
LVRM1_0198_F12.b :
LVRM1_0016_C11.b :
LVRM1_0117_A05.b :
LVRM1_0061_G04.b :
LVRM1_0196_F09.b :
LVRM1_0202_B06.b :
LVRM1_0195_F11.b :
LVRM1_0042_B12.b :
LVRM1_0024_B02.b :
LVRM1_0079_F06.b :
LVRM1_0049_G09.b :
LVRM1_0077_G12.b :
LVR01_0034_E10.b : ccactctggcaagcatgaacattctcctgctgggcaggcctcccacaaaaaccccggaaa
LVRM1_0158_H03.b :
LVRM1_0171_G05.b :
LVRM1_0020_A11.b :
LVRM1_0122_B02.b :
LVRM1_0163_H05.b :
LVRM1_0163_D05.b :
LVRM1_0087_D05.b :
LVRM1_0164_F12.b :
LVRM1_0077_B03.b :
LVRM1_0134_B10.b :
LVRM1_0188_E01.b :
LVRM1_0187_B02.b :
LVRM1_0206_F02.b :
LVRM1_0208_A06.b :
LVRM1_0092_E08.b :
LVRM1_0039_D04.b :
LVRM1_0204_G12.b :
LVRM1_0122_E05.b :
LVRM1_0098_E08.b :
LVRM1_0102_B04.b :
LVRM1_0197_H12.b :
LVRM1_0029_B01.b :
LVRM1_0149_H08.b :
LVRM1_0152_B09.b :
LVRM1_0031_D06.b :
LVRM1_0130_B11.b :
LVRM1_0152_E10.b :
LVR01_0105_G08.b : CTCTGGCGAG*CATGAACATTTCTCCTGCTGGCAGGCCTCCACATAAACCCcggaaaatc
LVR01_0030_A05.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0096_A05.b :
LVRM1_0019_F12.b :
LVRM1_0159_F03.b :
KDN01_0096_D10.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0168_G08.b :
LVRM1_0205_E10.b :
LVRM1_0056_A02.b :
LVRM1_0135_E11.b :
LVRM1_0181_B03.b :
LVRM1_0106_B06.b :
LVRM1_0018_D04.b :
LVRM1_0035_G10.b :
LVRM1_0004_D09.b :
LVRM1_0111_H05.b :
LVRM1_0198_A07.b :
LVRM1_0151_A12.b :
LVRM1_0188_H09.b :
LVRM1_0015_A07.b :
LVRM1_0133_E10.b :
LVRM1_0163_B11.b :
LVRM1_0147_H02.b :
LVRM1_0134_C10.b :
LVRM1_0021_A01.b :
LVRM1_0051_H02.b :
LVRM1_0177_C07.b :
LVRM1_0191_F03.b :
LVRM1_0202_C11.b :
LVRM1_0121_F12.b :
LVRM1_0006_C09.b :
LVRM1_0146_F12.b :
LVRM1_0024_C10.b :
LVRM1_0122_D11.b :
LVRM1_0199_A10.b :
LVRM1_0195_C10.b :
LVRM1_0075_H07.b :
LVRM1_0175_F11.b :
LVRM1_0034_A07.b :
LVRM1_0050_E07.b :
LVRM1_0037_H10.b :
LVRM1_0113_B05.b :
LVRM1_0148_E11.b :
LVRM1_0107_C09.b :
LVRM1_0139_F05.b :
LVRM1_0148_E06.b :
LVR01_0053_F01.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCAC*TAAACCCGGTAAATCT
LVR01_0063_F06.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCANGCCTCCACATAAACCCGGTAGATCT
LVR01_0096_B05.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVR01_0068_C08.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVR01_0068_B10.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCCTCACATAAGCCCGGTAGATCT
LVRM1_0016_G01.b :
LVRM1_0062_F10.b :
LVRM1_0107_E05.b :
LVRM1_0052_H07.b :
LVRM1_0094_G07.b :
LVRM1_0032_G01.b :
LVR01_0041_B06.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0183_A03.b :
LVRM1_0088_F10.b :
LVRM1_0150_E05.b :
LVRM1_0150_A07.b :
LVRM1_0034_G06.b :
LVRM1_0181_G04.b :
LVRM1_0096_G10.b :
LVRM1_0184_B12.b :
LVRM1_0169_D08.b :
LVRM1_0083_A12.b :
LVRM1_0014_H08.b :
LVRM1_0055_H02.b :
LVRM1_0013_B09.b :
LVRM1_0028_E01.b :
LVRM1_0119_A02.b :
LVRM1_0083_H09.b :
LVRM1_0205_F07.b :
LVRM1_0166_D05.b :
LVRM1_0010_A11.b :
LVRM1_0197_B12.b :
LVRM1_0128_A08.b :
LVRM1_0050_E04.b :
LVRM1_0160_F06.b :
LVRM1_0087_A10.b :
LVRM1_0186_E02.b :
LVRM1_0070_H12.b :
LVRM1_0047_B11.b :
LVRM1_0163_E03.b :
LVRM1_0208_D07.b :
LVRM1_0041_E01.b :
LVRM1_0195_E03.b :
LVRM1_0186_H06.b :
LVRM1_0195_C12.b :
LVRM1_0105_B05.b :
LVRM1_0078_G03.b :
LVRM1_0003_D02.b :
LVRM1_0005_C01.b :
LVRM1_0101_F10.b :
LVRM1_0152_C05.b :
LVRM1_0145_H06.b :
LVRM1_0129_B10.b :
LVRM1_0019_A04.b :
LVRM1_0037_H08.b :
LVRM1_0199_F08.b :
LVRM1_0036_B11.b :
LVRM1_0068_C07.b :
LVRM1_0021_F06.b :
LVRM1_0199_C09.b :
LVRM1_0128_C08.b :
LVRM1_0057_H03.b :
LVRM1_0142_D08.b :
LVRM1_0102_E09.b :
LVRM1_0036_B12.b :
LVRM1_0033_E09.b :
LVRM1_0151_E11.b :
LVRM1_0161_E07.b :
LVRM1_0107_B05.b :
LVRM1_0139_G06.b :
LVRM1_0002_E07.b :
LVR01_0016_D08.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVR01_0073_F08.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVR01_0106_C08.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVR01_0077_G05.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVR01_0017_B10.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVR01_0091_A09.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0159_F02.b :
LVRM1_0034_H08.b :
LVRM1_0035_H12.b :
LVRM1_0040_C05.b :
LVRM1_0091_G09.b :
LVRM1_0199_G03.b :
LVRM1_0156_B06.b :
LVRM1_0203_F02.b :
LVRM1_0207_F06.b :
LVRM1_0162_C01.b :
LVRM1_0136_G02.b :
LVR01_0019_A05.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0208_H07.b :
LVRM1_0139_F02.b :
LVRM1_0200_C11.b :
LVRM1_0093_C12.b :
LVRM1_0168_F06.b :
LVRM1_0083_E04.b :
LVRM1_0184_C04.b :
LVRM1_0143_F03.b :
LVRM1_0001_F09.b : CTCTGGCGAG*CATGAGCt
LVRM1_0023_C03.b :
LVRM1_0121_E04.b :
LVRM1_0123_A04.b : gaagacggc
LVRM1_0083_F04.b :
LVR01_0053_F11.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0171_C07.b : tctgcgcattgcatgcaccccggccgcagacgcaagccgaagggggcactgacatggagg
LVR01_0049_A08.b : CTCTGGCGAGACATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAATCCCGGTAGATCT
LVRM1_0147_A09.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAACCCGGTAGATCT
LVRM1_0176_G07.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCGGGGTAGATCT
LVRM1_0181_C04.b : CTCTGGCGAG*CAAGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAAATCT
LVRM1_0176_C04.b : aaatcccatccgctttgctttatagcccgcactaccctgtccggggagccacgttccccc
LVRM1_0159_G08.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0096_A01.b : CTCTGGCGAG*Cgctgacattctcatgctggaaggcgtccacgtaggaccagtcaatttc
LVRM1_0038_C01.b : CTCTGGGCGAGCATGAACA*TTCTCCTGCTGGgcaggcctccacataaggccccggtaga
LVRM1_0108_E09.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0005_D04.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0170_D10.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0023_H04.b : ggcaaagactaagaagagagaacaaaagaaaaaaaagaaagagaaacaaccggccacgag
LVRM1_0108_D12.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0186_G01.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0013_H10.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0093_A11.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0166_F02.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0028_C05.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0036_B10.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0143_A07.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0051_F03.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0072_C03.b : CTCTGGCGAG*AAGGAGCA*TTCTCCTGCCGGCCGGCCTCCTCACAACCCCGGTAGATCT
LVRM1_0182_G05.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0156_A06.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0049_E04.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0005_A03.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0044_H08.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0179_D07.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0147_C06.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0163_A10.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVR01_0003_E12.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVR01_0093_A11.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
LVRM1_0007_D03.b : CTCTGGCGAG*CATGAGCA*TTCTCCTGCTGGCAGGCCTCCACATAAGCCCGGTAGATCT
20110601C-012185 : CGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
---------+---------+---------+---------+---------+---------+ 994
LVRM1_0008_G10.b :
LVRM1_0168_C11.b :
LVRM1_0091_G11.b :
LVRM1_0047_B01.b :
LVRM1_0198_F12.b :
LVRM1_0016_C11.b :
LVRM1_0117_A05.b :
LVRM1_0061_G04.b :
LVRM1_0196_F09.b :
LVRM1_0202_B06.b :
LVRM1_0195_F11.b :
LVRM1_0042_B12.b :
LVRM1_0024_B02.b :
LVRM1_0079_F06.b :
LVRM1_0049_G09.b :
LVRM1_0077_G12.b :
LVR01_0034_E10.b : atcctcaaaaatcaccatgatttcccacaaaccccataaatttttgggggccccacctcc
LVRM1_0158_H03.b :
LVRM1_0171_G05.b :
LVRM1_0020_A11.b :
LVRM1_0122_B02.b :
LVRM1_0163_H05.b :
LVRM1_0163_D05.b :
LVRM1_0087_D05.b :
LVRM1_0164_F12.b :
LVRM1_0077_B03.b :
LVRM1_0134_B10.b :
LVRM1_0188_E01.b :
LVRM1_0187_B02.b :
LVRM1_0206_F02.b :
LVRM1_0208_A06.b :
LVRM1_0092_E08.b :
LVRM1_0039_D04.b :
LVRM1_0204_G12.b :
LVRM1_0122_E05.b :
LVRM1_0098_E08.b :
LVRM1_0102_B04.b :
LVRM1_0197_H12.b :
LVRM1_0029_B01.b :
LVRM1_0149_H08.b :
LVRM1_0152_B09.b :
LVRM1_0031_D06.b :
LVRM1_0130_B11.b :
LVRM1_0152_E10.b :
LVR01_0105_G08.b : tcaagaccacccatgattccccacaacccccataaattttggggtgcccccctcctccta
LVR01_0030_A05.b : CGAGATCACCATGAATCCCACAAGCCACAT*AAATTTGGGGTGCCCCACCTCCTCTAGGA
LVRM1_0096_A05.b :
LVRM1_0019_F12.b :
LVRM1_0159_F03.b :
KDN01_0096_D10.b : CGAGATCACCATGAATCCCACAAGC*ACAT*AAATTTGGGTGCCCACCTCTC***TAGGA
LVRM1_0168_G08.b :
LVRM1_0205_E10.b :
LVRM1_0056_A02.b :
LVRM1_0135_E11.b :
LVRM1_0181_B03.b :
LVRM1_0106_B06.b :
LVRM1_0018_D04.b :
LVRM1_0035_G10.b :
LVRM1_0004_D09.b :
LVRM1_0111_H05.b :
LVRM1_0198_A07.b :
LVRM1_0151_A12.b :
LVRM1_0188_H09.b :
LVRM1_0015_A07.b :
LVRM1_0133_E10.b :
LVRM1_0163_B11.b :
LVRM1_0147_H02.b :
LVRM1_0134_C10.b :
LVRM1_0021_A01.b :
LVRM1_0051_H02.b :
LVRM1_0177_C07.b :
LVRM1_0191_F03.b :
LVRM1_0202_C11.b :
LVRM1_0121_F12.b :
LVRM1_0006_C09.b :
LVRM1_0146_F12.b :
LVRM1_0024_C10.b :
LVRM1_0122_D11.b :
LVRM1_0199_A10.b :
LVRM1_0195_C10.b :
LVRM1_0075_H07.b :
LVRM1_0175_F11.b :
LVRM1_0034_A07.b :
LVRM1_0050_E07.b :
LVRM1_0037_H10.b :
LVRM1_0113_B05.b :
LVRM1_0148_E11.b :
LVRM1_0107_C09.b :
LVRM1_0139_F05.b :
LVRM1_0148_E06.b :
LVR01_0053_F01.b : CGAAATTACCATGAATTCCACAAGCCACAA*AAATTTGGGTGCCCACCTCCTtctaggaa
LVR01_0063_F06.b : CGAGATCACCATGATTCCCACAAGCCACATAAATTTGGGGTGCCCACCTCTTCTA*AGGA
LVR01_0096_B05.b : CGAGATCACCATGATTCCCACAAGCCACATAAATTTTGGGTGCCCAC**CTCCTCTAAGA
LVR01_0068_C08.b : CGAGATCACCATGAATCCCACAAGCCACATAAAATTTGGGTGCCCAC**CTCCTCTAGGA
LVR01_0068_B10.b : CGAGATCACCATGATTCCCACAAGCCACATAAATTTGGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0016_G01.b :
LVRM1_0062_F10.b :
LVRM1_0107_E05.b :
LVRM1_0052_H07.b :
LVRM1_0094_G07.b :
LVRM1_0032_G01.b :
LVR01_0041_B06.b : CGAGATCACCATGATTCCCACAA*CCACAT*AAATTTTGGTGCCCAC**CTCCTCTAAGA
LVRM1_0183_A03.b :
LVRM1_0088_F10.b :
LVRM1_0150_E05.b :
LVRM1_0150_A07.b :
LVRM1_0034_G06.b :
LVRM1_0181_G04.b :
LVRM1_0096_G10.b :
LVRM1_0184_B12.b :
LVRM1_0169_D08.b :
LVRM1_0083_A12.b :
LVRM1_0014_H08.b :
LVRM1_0055_H02.b :
LVRM1_0013_B09.b :
LVRM1_0028_E01.b :
LVRM1_0119_A02.b :
LVRM1_0083_H09.b :
LVRM1_0205_F07.b :
LVRM1_0166_D05.b :
LVRM1_0010_A11.b :
LVRM1_0197_B12.b :
LVRM1_0128_A08.b :
LVRM1_0050_E04.b :
LVRM1_0160_F06.b :
LVRM1_0087_A10.b :
LVRM1_0186_E02.b :
LVRM1_0070_H12.b :
LVRM1_0047_B11.b :
LVRM1_0163_E03.b :
LVRM1_0208_D07.b :
LVRM1_0041_E01.b :
LVRM1_0195_E03.b :
LVRM1_0186_H06.b :
LVRM1_0195_C12.b :
LVRM1_0105_B05.b :
LVRM1_0078_G03.b :
LVRM1_0003_D02.b :
LVRM1_0005_C01.b :
LVRM1_0101_F10.b :
LVRM1_0152_C05.b :
LVRM1_0145_H06.b :
LVRM1_0129_B10.b :
LVRM1_0019_A04.b :
LVRM1_0037_H08.b :
LVRM1_0199_F08.b :
LVRM1_0036_B11.b :
LVRM1_0068_C07.b :
LVRM1_0021_F06.b :
LVRM1_0199_C09.b :
LVRM1_0128_C08.b :
LVRM1_0057_H03.b :
LVRM1_0142_D08.b :
LVRM1_0102_E09.b :
LVRM1_0036_B12.b :
LVRM1_0033_E09.b :
LVRM1_0151_E11.b :
LVRM1_0161_E07.b :
LVRM1_0107_B05.b :
LVRM1_0139_G06.b :
LVRM1_0002_E07.b :
LVR01_0016_D08.b : CGAGATCACCATGAATCCCACAAGCCACATAAATTTTGGGTGCCCACCctcctctaggaa
LVR01_0073_F08.b : CGAGATCACCATGATTCCCACAAGCCACATAAAATTGGGGTGCCCACCTtttctaggaaa
LVR01_0106_C08.b : CGAGATCACCATGATTCCCACAAGCCACATAAATTTTGGGTGCCCcacctcctctaggga
LVR01_0077_G05.b : CGAGATCACCATGAATCCCACAAGCCACATAAAATTTGGGTGCCCACCTCCctctaggaa
LVR01_0017_B10.b : CGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAAGA
LVR01_0091_A09.b : CGAGATCACCATGATTCCCACAAGCCCAT**AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0159_F02.b :
LVRM1_0034_H08.b :
LVRM1_0035_H12.b :
LVRM1_0040_C05.b :
LVRM1_0091_G09.b :
LVRM1_0199_G03.b :
LVRM1_0156_B06.b :
LVRM1_0203_F02.b :
LVRM1_0207_F06.b :
LVRM1_0162_C01.b :
LVRM1_0136_G02.b :
LVR01_0019_A05.b : CGAGATCACCATGATTCCCCACAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0208_H07.b :
LVRM1_0139_F02.b :
LVRM1_0200_C11.b :
LVRM1_0093_C12.b :
LVRM1_0168_F06.b :
LVRM1_0083_E04.b :
LVRM1_0184_C04.b :
LVRM1_0143_F03.b :
LVRM1_0001_F09.b :
LVRM1_0023_C03.b :
LVRM1_0121_E04.b :
LVRM1_0123_A04.b :
LVRM1_0083_F04.b :
LVR01_0053_F11.b : CGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0171_C07.b : gcgcgcggccggggagacatccaacattcagaga
LVR01_0049_A08.b : CGAGATCACCATGATTCACACAAGCCACAT*AAATTTGTGTGCCCAC**CTCCTCTAGGA
LVRM1_0147_A09.b : CGAGATTCACATGATTCCCACAGGG*ACAT*TAATTTGGGTGGCCAC**CTCCTCTAGGA
LVRM1_0176_G07.b : CGAGATCACCATGATTCCCANAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0181_C04.b : CGAGATCACCATGAATCCacaagccaaataaattggggtgcccactcatctgaggagaga
LVRM1_0176_C04.b : cgatcgcctgacggctggcatacacaggagtattaaccaaggggcctcacccgcttcctg
LVRM1_0159_G08.b : CGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0096_A01.b : agcctccccatgatttgcccagagcccataaggatggggtggctcccttgcctaagagac
LVRM1_0038_C01.b : tctcgaagatccccatggattcccacaagcccccataaatttggggtgcccccacttccc
LVRM1_0108_E09.b : CGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0005_D04.b : CTATATCACCATGATTCCtaacgccacataattttaggtgcccatcttccctagagacca
LVRM1_0170_D10.b : CGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0023_H04.b : gaaagagggaggaaaagggcaaggattgttggggggccacaaaaaacgggggggaagaca
LVRM1_0108_D12.b : CGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0186_G01.b : TGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0013_H10.b : CGAGATCACCGTGATTCCCACAAGCCGCAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0093_A11.b : CGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0166_F02.b : CGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0028_C05.b : CGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0036_B10.b : CGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0143_A07.b : CGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0051_F03.b : CGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTATGA
LVRM1_0072_C03.b : CGAGATTACCATGACTCCCACACGCCAGATAgagtggggtgcgccccttccgctcggaga
LVRM1_0182_G05.b : CGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0156_A06.b : CGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0049_E04.b : CGAGATCACCATGATTCTCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0005_A03.b : CGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0044_H08.b : CGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0179_D07.b : CGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0147_C06.b : CGAGATCACCATGATTCCCACAAGCCACAT*GAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0163_A10.b : CGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVR01_0003_E12.b : CGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVR01_0093_A11.b : CGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
LVRM1_0007_D03.b : CGAGATCACCATGATTCCCACAAGCCACAT*AAATTTGGGTGCCCAC**CTCCTCTAGGA
20110601C-012185 : GACAAAAGTCACTCAGACAGTCCA*CCATTTCAAGCAGAAGCTTCTCCATCATTGGCCT*
---------+---------+---------+---------+---------+---------+ 1052
LVRM1_0008_G10.b :
LVRM1_0168_C11.b :
LVRM1_0091_G11.b :
LVRM1_0047_B01.b :
LVRM1_0198_F12.b :
LVRM1_0016_C11.b :
LVRM1_0117_A05.b :
LVRM1_0061_G04.b :
LVRM1_0196_F09.b :
LVRM1_0202_B06.b :
LVRM1_0195_F11.b :
LVRM1_0042_B12.b :
LVRM1_0024_B02.b :
LVRM1_0079_F06.b :
LVRM1_0049_G09.b :
LVRM1_0077_G12.b :
LVR01_0034_E10.b : ctcaaggaaaaaaaaaatcccccccaaacagccccccaattttcaagccaaaaaccttcc
LVRM1_0158_H03.b :
LVRM1_0171_G05.b :
LVRM1_0020_A11.b :
LVRM1_0122_B02.b :
LVRM1_0163_H05.b :
LVRM1_0163_D05.b :
LVRM1_0087_D05.b :
LVRM1_0164_F12.b :
LVRM1_0077_B03.b :
LVRM1_0134_B10.b :
LVRM1_0188_E01.b :
LVRM1_0187_B02.b :
LVRM1_0206_F02.b :
LVRM1_0208_A06.b :
LVRM1_0092_E08.b :
LVRM1_0039_D04.b :
LVRM1_0204_G12.b :
LVRM1_0122_E05.b :
LVRM1_0098_E08.b :
LVRM1_0102_B04.b :
LVRM1_0197_H12.b :
LVRM1_0029_B01.b :
LVRM1_0149_H08.b :
LVRM1_0152_B09.b :
LVRM1_0031_D06.b :
LVRM1_0130_B11.b :
LVRM1_0152_E10.b :
LVR01_0105_G08.b : ggaaaacaaaagtccctccaaaaaaagtccacccattttcaaaccaaaaccttcctccca
LVR01_0030_A05.b : GACAAAAGTCACTCcaacaggtccaccaatttcaagcaaaaaccttctccatccatgggc
LVRM1_0096_A05.b :
LVRM1_0019_F12.b :
LVRM1_0159_F03.b :
KDN01_0096_D10.b : GACNAAAGTCACTCAGACAGTCCA*CCATTTC*AGCAGAAGCTTCTCCATCAATTGCCT*
LVRM1_0168_G08.b :
LVRM1_0205_E10.b :
LVRM1_0056_A02.b :
LVRM1_0135_E11.b :
LVRM1_0181_B03.b :
LVRM1_0106_B06.b :
LVRM1_0018_D04.b :
LVRM1_0035_G10.b :
LVRM1_0004_D09.b :
LVRM1_0111_H05.b :
LVRM1_0198_A07.b :
LVRM1_0151_A12.b :
LVRM1_0188_H09.b :
LVRM1_0015_A07.b :
LVRM1_0133_E10.b :
LVRM1_0163_B11.b :
LVRM1_0147_H02.b :
LVRM1_0134_C10.b :
LVRM1_0021_A01.b :
LVRM1_0051_H02.b :
LVRM1_0177_C07.b :
LVRM1_0191_F03.b :
LVRM1_0202_C11.b :
LVRM1_0121_F12.b :
LVRM1_0006_C09.b :
LVRM1_0146_F12.b :
LVRM1_0024_C10.b :
LVRM1_0122_D11.b :
LVRM1_0199_A10.b :
LVRM1_0195_C10.b :
LVRM1_0075_H07.b :
LVRM1_0175_F11.b :
LVRM1_0034_A07.b :
LVRM1_0050_E07.b :
LVRM1_0037_H10.b :
LVRM1_0113_B05.b :
LVRM1_0148_E11.b :
LVRM1_0107_C09.b :
LVRM1_0139_F05.b :
LVRM1_0148_E06.b :
LVR01_0053_F01.b : aacaaaatcactccaacagtcccaccttttcaaggcaaaaactttcccct
LVR01_0063_F06.b : GACAAAAATCACTCAAACAGTCCA*CCATTTCAAGCAaaaacttcctcaatcattggccc
LVR01_0096_B05.b : AACAAAAGTCACTCAGACAGTCCA*ACATTCCAAGCAaaaagctttctcatcatttggcc
LVR01_0068_C08.b : GAACAAAGTCACTCAGACAGTCCACCCATTTCAAGCAGAAGCTTCTCCATCATTtggcct
LVR01_0068_B10.b : AACAAAAGTCACTCAGACAGTCCA*CCATTTCAAGCcaaaagctcctccatcatg
LVRM1_0016_G01.b :
LVRM1_0062_F10.b :
LVRM1_0107_E05.b :
LVRM1_0052_H07.b :
LVRM1_0094_G07.b :
LVRM1_0032_G01.b :
LVR01_0041_B06.b : AACAAAAagtcactcagacagtccaaccattttcagcaaaaccttctccttccttgggcc
LVRM1_0183_A03.b :
LVRM1_0088_F10.b :
LVRM1_0150_E05.b :
LVRM1_0150_A07.b :
LVRM1_0034_G06.b :
LVRM1_0181_G04.b :
LVRM1_0096_G10.b :
LVRM1_0184_B12.b :
LVRM1_0169_D08.b :
LVRM1_0083_A12.b :
LVRM1_0014_H08.b :
LVRM1_0055_H02.b :
LVRM1_0013_B09.b :
LVRM1_0028_E01.b :
LVRM1_0119_A02.b :
LVRM1_0083_H09.b :
LVRM1_0205_F07.b :
LVRM1_0166_D05.b :
LVRM1_0010_A11.b :
LVRM1_0197_B12.b :
LVRM1_0128_A08.b :
LVRM1_0050_E04.b :
LVRM1_0160_F06.b :
LVRM1_0087_A10.b :
LVRM1_0186_E02.b :
LVRM1_0070_H12.b :
LVRM1_0047_B11.b :
LVRM1_0163_E03.b :
LVRM1_0208_D07.b :
LVRM1_0041_E01.b :
LVRM1_0195_E03.b :
LVRM1_0186_H06.b :
LVRM1_0195_C12.b :
LVRM1_0105_B05.b :
LVRM1_0078_G03.b :
LVRM1_0003_D02.b :
LVRM1_0005_C01.b :
LVRM1_0101_F10.b :
LVRM1_0152_C05.b :
LVRM1_0145_H06.b :
LVRM1_0129_B10.b :
LVRM1_0019_A04.b :
LVRM1_0037_H08.b :
LVRM1_0199_F08.b :
LVRM1_0036_B11.b :
LVRM1_0068_C07.b :
LVRM1_0021_F06.b :
LVRM1_0199_C09.b :
LVRM1_0128_C08.b :
LVRM1_0057_H03.b :
LVRM1_0142_D08.b :
LVRM1_0102_E09.b :
LVRM1_0036_B12.b :
LVRM1_0033_E09.b :
LVRM1_0151_E11.b :
LVRM1_0161_E07.b :
LVRM1_0107_B05.b :
LVRM1_0139_G06.b :
LVRM1_0002_E07.b :
LVR01_0016_D08.b : aacaaaaatcactcaaaccgtccacccatttcaaggcaaaaaccttctcccatcatgggc
LVR01_0073_F08.b : acaaaaatcactccgaacgttccacaatttcaagcagaaaccttctccatcattgggcct
LVR01_0106_C08.b : gacaaaattcactccgaaaagtcccaccattttcaaagcaaaaacttcctcccttcattt
LVR01_0077_G05.b : acaaaaagtcactccaaacagtccacccatttaaagc
LVR01_0017_B10.b : AACAAAAGTCACTCAGACAGTCCA*CCATTTCAAGCAGAAGCTTCTCCATCATTGGCCTC
LVR01_0091_A09.b : AACAAAAGTCACTCAGACCATCCA*CCATTCCAAGCAAAACCTCCTCCATCATTGGCCcc
LVRM1_0159_F02.b :
LVRM1_0034_H08.b :
LVRM1_0035_H12.b :
LVRM1_0040_C05.b :
LVRM1_0091_G09.b :
LVRM1_0199_G03.b :
LVRM1_0156_B06.b :
LVRM1_0203_F02.b :
LVRM1_0207_F06.b :
LVRM1_0162_C01.b :
LVRM1_0136_G02.b :
LVR01_0019_A05.b : GACAAAAGTCACTCAGACAGTCCA*CCATTTCAAGCAGAAACTTTCTCATCATTTGGCCT
LVRM1_0208_H07.b :
LVRM1_0139_F02.b :
LVRM1_0200_C11.b :
LVRM1_0093_C12.b :
LVRM1_0168_F06.b :
LVRM1_0083_E04.b :
LVRM1_0184_C04.b :
LVRM1_0143_F03.b :
LVRM1_0001_F09.b :
LVRM1_0023_C03.b :
LVRM1_0121_E04.b :
LVRM1_0123_A04.b :
LVRM1_0083_F04.b :
LVR01_0053_F11.b : GACAAAAGTCACTCAGACAGTCCA*CCATTTCAGGCAGAAGCTTCTCCATCATTGGGCTT
LVRM1_0171_C07.b :
LVR01_0049_A08.b : GACAATAGTCACTCATACAGTCCA*TCATTTCACGCAGAATCTTCTCTATCATTGGCCT*
LVRM1_0147_A09.b : GAn
LVRM1_0176_G07.b : GAC*AAAGTCACTCACACAGTTCA*CCATTTCAAGCAGAAGCTTCccc
LVRM1_0181_C04.b : aagtcactcagacagtccaccatttc
LVRM1_0176_C04.b : tgggcacctgtcccccacc
LVRM1_0159_G08.b : GACAAAAGTCACTCAGACAGTCCA*CCATTTCAAGCAGAGGCTTCTCCATCATTGGCCT*
LVRM1_0096_A01.b : gcagcccgtcagaccaggcgccatccacgcctcaggtga
LVRM1_0038_C01.b : cttaggacagaaaagagtcactcccacaagttccn
LVRM1_0108_E09.b : GACAAAAGTCACTCAGACAGTCCN*ACCATTTCAGCAGAAGCTTCTCCATCATTGGCCT*
LVRM1_0005_D04.b : cagccactcagacagtccaccctcttagcaaaatctatgtcatcattggtctcgttatgc
LVRM1_0170_D10.b : GACAAAAGTCACTCAGACAGTCCA*CCATTTCAAGCAGAAGCTTCTCCATCATTGGCCT*
LVRM1_0023_H04.b : aaaaacggcaaaagggggtgtttttgttttgttttctcccccgcagaggaaaaaaagaaa
LVRM1_0108_D12.b : GACAAAAGTCACTCAGACAGTCCA*CCATTTCAAGCAGAAGCTTCTCCATCATTGGCCT*
LVRM1_0186_G01.b : GACAAAAGTCACTCAGACAGTCCA*CCATTTCAAGCAGAAGCTTCTCCATCATTGGCCT*
LVRM1_0013_H10.b : GACAAAAGTCGCTCCGACANGCCA*CCAGTTCCAGCGAAAGCGTCTCCATCAGTGGgcct
LVRM1_0093_A11.b : GACGAAAGTCACTCAAACAGTCCA*CCATTTCtaggcagagcttctcgctcacttggctc
LVRM1_0166_F02.b : GACAAAAGTCACTCAGACAGTCCA*CCATTTCAAGCAGAAGCTTCTCCATCATTGGCCT*
LVRM1_0028_C05.b : GACAAAAGTCACTCAGACAGTCCA*CCATTTCAAGCAGAAGCTTCTCCATCATTGGCCT*
LVRM1_0036_B10.b : GACAAAAGTCACTCAGACAGTCCA*CCATTTCAAGCAGAAGCTTCTCCATCATTGGCCT*
LVRM1_0143_A07.b : GACAAAAGTCACTCAGACAGTCCA*CCATTTCAAGCAGAAGCTTCTCCATCATTGGCCT*
LVRM1_0051_F03.b : GACAAAAGTCACTCCGACAGTCCA*CCATTTCAAGCAGAAGCTTCTCCATCATTGGCCT*
LVRM1_0072_C03.b : caagagtcactcatacgatcgaccacatcacgtggaaggctcctcggccttgtgctctcc
LVRM1_0182_G05.b : GACAAAAGTCACTCAGACAGTCCA*CCATTTCAAGCAGAAGCTTCTCCATCATTGGCCT*
LVRM1_0156_A06.b : GACAAAAGTCACTCAGACAGTCCA*CCATTTCAAGCAGAAGCTTCTCCATCATTGGCCT*
LVRM1_0049_E04.b : GACAAAAGTCACTCAGACAGTCCA*CCATTTCAAGCAGAAGCTTCTCCATCATTGGCCT*
LVRM1_0005_A03.b : GACAAAAGTCACTCAGACAGTCCA*CCATTTCAAGCAGAAGCTTCTCCATCATTGGCCT*
LVRM1_0044_H08.b : GACAAAAGTCACTCAAACGGTCCA*C*ATTTCAAGCAGAAGCTTCTCGATCATTGGCCT*
LVRM1_0179_D07.b : GACAAAAGTCACTCAGACAGTCCA*CCATTTCAAGCAGAAGCTTCTCCATCATTGGCCT*
LVRM1_0147_C06.b : GACAAAAGTCACTCAGACAGTCCA*CCATTTCAAGCAGAAGCTTCTCCATCATTGGCCT*
LVRM1_0163_A10.b : GACAAAAGTCACTCAGACAGTCCA*CCATTTCAAGCAGAAGCTTCTCCATCATTGGCCT*
LVR01_0003_E12.b : GACAAAAGTCACTCAGACAGTCCA*CCATTTCAAGCAGAAGCTTCTCCATCATTGGCCT*
LVR01_0093_A11.b : GACAAAAGTCACTCAGACAGTCCA*CCATTTCAAGCAGAAGCTTCTCCATCATTGGCCT*
LVRM1_0007_D03.b : GACAAAAGTCACTCAGACAGTCCA*CCATTTCAAGCAGAAGCTTCTCCATCATTGGCCT*
20110601C-012185 : CTTTAGGCACCAATGGGG*TCCATGGACCCTCAGATAATCATAGTTCCAGTGAGCATCAT
---------+---------+---------+---------+---------+---------+ 1111
LVRM1_0008_G10.b :
LVRM1_0168_C11.b :
LVRM1_0091_G11.b :
LVRM1_0047_B01.b :
LVRM1_0198_F12.b :
LVRM1_0016_C11.b :
LVRM1_0117_A05.b :
LVRM1_0061_G04.b :
LVRM1_0196_F09.b :
LVRM1_0202_B06.b :
LVRM1_0195_F11.b :
LVRM1_0042_B12.b :
LVRM1_0024_B02.b :
LVRM1_0079_F06.b :
LVRM1_0049_G09.b :
LVRM1_0077_G12.b :
LVR01_0034_E10.b : ccattctttgggcccccttttaaggccccaaaagggggggtccccggggaacccccccca
LVRM1_0158_H03.b :
LVRM1_0171_G05.b :
LVRM1_0020_A11.b :
LVRM1_0122_B02.b :
LVRM1_0163_H05.b :
LVRM1_0163_D05.b :
LVRM1_0087_D05.b :
LVRM1_0164_F12.b :
LVRM1_0077_B03.b :
LVRM1_0134_B10.b :
LVRM1_0188_E01.b :
LVRM1_0187_B02.b :
LVRM1_0206_F02.b :
LVRM1_0208_A06.b :
LVRM1_0092_E08.b :
LVRM1_0039_D04.b :
LVRM1_0204_G12.b :
LVRM1_0122_E05.b :
LVRM1_0098_E08.b :
LVRM1_0102_B04.b :
LVRM1_0197_H12.b :
LVRM1_0029_B01.b :
LVRM1_0149_H08.b :
LVRM1_0152_B09.b :
LVRM1_0031_D06.b :
LVRM1_0130_B11.b :
LVRM1_0152_E10.b :
LVR01_0105_G08.b : tcaattgggcccttctttttaggacccaaatgggggggtccccagggaaccccccccaaa
LVR01_0030_A05.b : cctcttttaggcacccaatgggggtccaatggaacccctcaaaaaaattccaaaattttc
LVRM1_0096_A05.b :
LVRM1_0019_F12.b :
LVRM1_0159_F03.b :
KDN01_0096_D10.b : CTTTAGGCACA*ATGGGG*TCCATGGACCCTCAGATAATCATAATTCAG*TGAACATCAT
LVRM1_0168_G08.b :
LVRM1_0205_E10.b :
LVRM1_0056_A02.b :
LVRM1_0135_E11.b :
LVRM1_0181_B03.b :
LVRM1_0106_B06.b :
LVRM1_0018_D04.b :
LVRM1_0035_G10.b :
LVRM1_0004_D09.b :
LVRM1_0111_H05.b :
LVRM1_0198_A07.b :
LVRM1_0151_A12.b :
LVRM1_0188_H09.b :
LVRM1_0015_A07.b :
LVRM1_0133_E10.b :
LVRM1_0163_B11.b :
LVRM1_0147_H02.b :
LVRM1_0134_C10.b :
LVRM1_0021_A01.b :
LVRM1_0051_H02.b :
LVRM1_0177_C07.b :
LVRM1_0191_F03.b :
LVRM1_0202_C11.b :
LVRM1_0121_F12.b :
LVRM1_0006_C09.b :
LVRM1_0146_F12.b :
LVRM1_0024_C10.b :
LVRM1_0122_D11.b :
LVRM1_0199_A10.b :
LVRM1_0195_C10.b :
LVRM1_0075_H07.b :
LVRM1_0175_F11.b :
LVRM1_0034_A07.b :
LVRM1_0050_E07.b :
LVRM1_0037_H10.b :
LVRM1_0113_B05.b :
LVRM1_0148_E11.b :
LVRM1_0107_C09.b :
LVRM1_0139_F05.b :
LVRM1_0148_E06.b :
LVR01_0053_F01.b :
LVR01_0063_F06.b : tctttaaggccccaatggggttccatggaaccctcaaaaaaatcatagtttccagtgaac
LVR01_0096_B05.b : tctttaggcacccaatgggggtcaatgggaccctccaaaaaatcataatttcccgttgaa
LVR01_0068_C08.b : cctttaggcaccaatggggt
LVR01_0068_B10.b :
LVRM1_0016_G01.b :
LVRM1_0062_F10.b :
LVRM1_0107_E05.b :
LVRM1_0052_H07.b :
LVRM1_0094_G07.b :
LVRM1_0032_G01.b :
LVR01_0041_B06.b : tcctttagggaccaattgggggtccatgggaccctcaaaaaaattctaaatttcccggtg
LVRM1_0183_A03.b :
LVRM1_0088_F10.b :
LVRM1_0150_E05.b :
LVRM1_0150_A07.b :
LVRM1_0034_G06.b :
LVRM1_0181_G04.b :
LVRM1_0096_G10.b :
LVRM1_0184_B12.b :
LVRM1_0169_D08.b :
LVRM1_0083_A12.b :
LVRM1_0014_H08.b :
LVRM1_0055_H02.b :
LVRM1_0013_B09.b :
LVRM1_0028_E01.b :
LVRM1_0119_A02.b :
LVRM1_0083_H09.b :
LVRM1_0205_F07.b :
LVRM1_0166_D05.b :
LVRM1_0010_A11.b :
LVRM1_0197_B12.b :
LVRM1_0128_A08.b :
LVRM1_0050_E04.b :
LVRM1_0160_F06.b :
LVRM1_0087_A10.b :
LVRM1_0186_E02.b :
LVRM1_0070_H12.b :
LVRM1_0047_B11.b :
LVRM1_0163_E03.b :
LVRM1_0208_D07.b :
LVRM1_0041_E01.b :
LVRM1_0195_E03.b :
LVRM1_0186_H06.b :
LVRM1_0195_C12.b :
LVRM1_0105_B05.b :
LVRM1_0078_G03.b :
LVRM1_0003_D02.b :
LVRM1_0005_C01.b :
LVRM1_0101_F10.b :
LVRM1_0152_C05.b :
LVRM1_0145_H06.b :
LVRM1_0129_B10.b :
LVRM1_0019_A04.b :
LVRM1_0037_H08.b :
LVRM1_0199_F08.b :
LVRM1_0036_B11.b :
LVRM1_0068_C07.b :
LVRM1_0021_F06.b :
LVRM1_0199_C09.b :
LVRM1_0128_C08.b :
LVRM1_0057_H03.b :
LVRM1_0142_D08.b :
LVRM1_0102_E09.b :
LVRM1_0036_B12.b :
LVRM1_0033_E09.b :
LVRM1_0151_E11.b :
LVRM1_0161_E07.b :
LVRM1_0107_B05.b :
LVRM1_0139_G06.b :
LVRM1_0002_E07.b :
LVR01_0016_D08.b : ctcctttaggcacccattgggggcccatggaaccctccaaaaaaatcataagtttcccag
LVR01_0073_F08.b : ctttaagccaca
LVR01_0106_C08.b : ggcctccttttaggccccaaaggggggtcccatgggacccccccaaaaaaaccaaaaatt
LVR01_0077_G05.b :
LVR01_0017_B10.b : TTTAagccacaaatgggggtccatgggacccctcaaaataatcataagtttccagttgag
LVR01_0091_A09.b : ctttaggccccaaatgggggccccatggacccctcaaaaaatcaaaaattcccagtaagc
LVRM1_0159_F02.b :
LVRM1_0034_H08.b :
LVRM1_0035_H12.b :
LVRM1_0040_C05.b :
LVRM1_0091_G09.b :
LVRM1_0199_G03.b :
LVRM1_0156_B06.b :
LVRM1_0203_F02.b :
LVRM1_0207_F06.b :
LVRM1_0162_C01.b :
LVRM1_0136_G02.b :
LVR01_0019_A05.b : CTTTAGGCACCAATGGGGgtccctgaaccctccaaataatcatagtttccagtggagcat
LVRM1_0208_H07.b :
LVRM1_0139_F02.b :
LVRM1_0200_C11.b :
LVRM1_0093_C12.b :
LVRM1_0168_F06.b :
LVRM1_0083_E04.b :
LVRM1_0184_C04.b :
LVRM1_0143_F03.b :
LVRM1_0001_F09.b :
LVRM1_0023_C03.b :
LVRM1_0121_E04.b :
LVRM1_0123_A04.b :
LVRM1_0083_F04.b :
LVR01_0053_F11.b : CTTTAAGCACCAATGGGG*TCCATGGACCCTCAAATAATCATAGTTCCAGTGAGCATCAT
LVRM1_0171_C07.b :
LVR01_0049_A08.b : CTTTAGGCACCAGTGGGG*TCGATGGACCCTCAAATAATCATAagtgccagtgaccatca
LVRM1_0147_A09.b :
LVRM1_0176_G07.b :
LVRM1_0181_C04.b :
LVRM1_0176_C04.b :
LVRM1_0159_G08.b : CTTTAGGCACCAt
LVRM1_0096_A01.b :
LVRM1_0038_C01.b :
LVRM1_0108_E09.b : CTTTAGGGCACCATGGGG*TCCATGGACCCCTCAGATATCATAGTTCCAGTGAGCATCAT
LVRM1_0005_D04.b : tcctatggtcccatcgcccctcagatttcaacttccactggtcccatn
LVRM1_0170_D10.b : CTTTAGGCACAAATGGGG*TCCATGGACCCTCAGATAtcatag
LVRM1_0023_H04.b :
LVRM1_0108_D12.b : CTTTAGGCACCAATGGGG*TCCATGGACCCTCAGATAATCATAGTTCCAGTGAGCATCAT
LVRM1_0186_G01.b : CTTTAGGCACCGATGGGG*TCCATGGACCCCCAGATAATCATAGTTCCGGTGAGCATCAT
LVRM1_0013_H10.b : cttagggcacaatggagtccgaggaccctcagaaagacgaagtgcagggagcatgatcgc
LVRM1_0093_A11.b : cttaggcaccaagggagtccatggaaccctaaaaaaatcgaaattccggggagcatcagc
LVRM1_0166_F02.b : CTTTAGGCACCAAAGGGG*TCCATGGACCCTCAGATAATCATAGTTCCAGTGAGCATCAT
LVRM1_0028_C05.b : CTTTAGGCACCAATGGGG*TCCATGGACCCTCAGATAATCATAGTTCCAGTGAGCATCAT
LVRM1_0036_B10.b : CTTTAGGCACCAATGGGG*TCCATGGACCCTCAGATAATCATAGTTCCAGTGAGCATCAT
LVRM1_0143_A07.b : CTTTAGGCACCAATGGGG*TCCATGGACCCTCAGATAATCATAGTTCCAGTGAGCATCAT
LVRM1_0051_F03.b : CTTTAGGCACCAATGGGG*TCCATGGACCCcacataatctagttccagtgagcatcatct
LVRM1_0072_C03.b : gtggnctcacggaggtcgatggagtcccgagtaggtattaggtccggtgaggggtatccg
LVRM1_0182_G05.b : CTTTAGGCACCAATGGGG*TCCATGGACCCTCAGATAATCATAGTTCCAGTGAGCATCAT
LVRM1_0156_A06.b : CTTTAGGCACCAATGGGG*TCCATGGACCCTCAGATAATCATAGTTCCAGTGAGCATCAT
LVRM1_0049_E04.b : CTTTAGGCACCAATGGGG*TCCATGGACCCTCAGATAATCATAGTTCCAGTGAGCATCAT
LVRM1_0005_A03.b : CTTTAGGCACCAATGGGG*TCCATGGACCCTCAGATAATCATAGTTCCAGTGAGCATCAT
LVRM1_0044_H08.b : CTTAAGGCACCAATGGGGgcagatggaccccccagaaaacccgaataccactgaacaacg
LVRM1_0179_D07.b : CTTTAGGCACCAATGGGG*TCCATGGACCCTCAAATAATCATAGTTCCAGTGAGCATCAT
LVRM1_0147_C06.b : CTTTAAGCACCAATGGGGGTCCATGGACCCTCAAATAATCATAGTTCCAGTGAGCATCAT
LVRM1_0163_A10.b : CTTTAGGCACCAATGGGG*TCCATGGACCCTCAGATAATCATAGTTCCAGTGAGCATCAT
LVR01_0003_E12.b : CTTTAGGCACCAATGGGG*TCCATGGACCCTCAGATAATCATAGTTCCAGTGAGCATCAT
LVR01_0093_A11.b : CTTTAGGCACCAATGGGG*TCCATGGACCCTTAGATAATCATAGTTCCAGTGAGCATCAT
LVRM1_0007_D03.b : CTTTAGGCACCAATGGGG*TCCATGGACCCTCAGATAATCATAGTTCCAGTGAGCATCAT
20110601C-012185 : CTCCCAGGACATCCTCCTCATGGACGCCATCCCCATGGACCCCCTCCTCATGGACGCCAT
---------+---------+---------+---------+---------+---------+ 1171
LVRM1_0008_G10.b :
LVRM1_0168_C11.b :
LVRM1_0091_G11.b :
LVRM1_0047_B01.b :
LVRM1_0198_F12.b :
LVRM1_0016_C11.b :
LVRM1_0117_A05.b :
LVRM1_0061_G04.b :
LVRM1_0196_F09.b :
LVRM1_0202_B06.b :
LVRM1_0195_F11.b :
LVRM1_0042_B12.b :
LVRM1_0024_B02.b :
LVRM1_0079_F06.b :
LVRM1_0049_G09.b :
LVRM1_0077_G12.b :
LVR01_0034_E10.b : aaaataatttcttatatttcccaggggaaaacaattctttctttccccccagaaaaaaaa
LVRM1_0158_H03.b :
LVRM1_0171_G05.b :
LVRM1_0020_A11.b :
LVRM1_0122_B02.b :
LVRM1_0163_H05.b :
LVRM1_0163_D05.b :
LVRM1_0087_D05.b :
LVRM1_0164_F12.b :
LVRM1_0077_B03.b :
LVRM1_0134_B10.b :
LVRM1_0188_E01.b :
LVRM1_0187_B02.b :
LVRM1_0206_F02.b :
LVRM1_0208_A06.b :
LVRM1_0092_E08.b :
LVRM1_0039_D04.b :
LVRM1_0204_G12.b :
LVRM1_0122_E05.b :
LVRM1_0098_E08.b :
LVRM1_0102_B04.b :
LVRM1_0197_H12.b :
LVRM1_0029_B01.b :
LVRM1_0149_H08.b :
LVRM1_0152_B09.b :
LVRM1_0031_D06.b :
LVRM1_0130_B11.b :
LVRM1_0152_E10.b :
LVR01_0105_G08.b : aaaaaaaccataaaatttttcccgggggaaaaaccaatcttcttcccccccccaaaggaa
LVR01_0030_A05.b : cagttgaagccatccatccctccccaaggaaaaattccctcccctccaaggggaaaaccc
LVRM1_0096_A05.b :
LVRM1_0019_F12.b :
LVRM1_0159_F03.b :
KDN01_0096_D10.b : CTCCCAGGACATC*TCCTCATGGACGCCATCCCatgaaccccttctcatgacaccatccc
LVRM1_0168_G08.b :
LVRM1_0205_E10.b :
LVRM1_0056_A02.b :
LVRM1_0135_E11.b :
LVRM1_0181_B03.b :
LVRM1_0106_B06.b :
LVRM1_0018_D04.b :
LVRM1_0035_G10.b :
LVRM1_0004_D09.b :
LVRM1_0111_H05.b :
LVRM1_0198_A07.b :
LVRM1_0151_A12.b :
LVRM1_0188_H09.b :
LVRM1_0015_A07.b :
LVRM1_0133_E10.b :
LVRM1_0163_B11.b :
LVRM1_0147_H02.b :
LVRM1_0134_C10.b :
LVRM1_0021_A01.b :
LVRM1_0051_H02.b :
LVRM1_0177_C07.b :
LVRM1_0191_F03.b :
LVRM1_0202_C11.b :
LVRM1_0121_F12.b :
LVRM1_0006_C09.b :
LVRM1_0146_F12.b :
LVRM1_0024_C10.b :
LVRM1_0122_D11.b :
LVRM1_0199_A10.b :
LVRM1_0195_C10.b :
LVRM1_0075_H07.b :
LVRM1_0175_F11.b :
LVRM1_0034_A07.b :
LVRM1_0050_E07.b :
LVRM1_0037_H10.b :
LVRM1_0113_B05.b :
LVRM1_0148_E11.b :
LVRM1_0107_C09.b :
LVRM1_0139_F05.b :
LVRM1_0148_E06.b :
LVR01_0053_F01.b :
LVR01_0063_F06.b : catcatcctcccaaagaaaatccctccctcatgggaaccccc
LVR01_0096_B05.b : cattcattcccccaaggaaattccccccctcccatggaacccccccaccccccccatggg
LVR01_0068_C08.b :
LVR01_0068_B10.b :
LVRM1_0016_G01.b :
LVRM1_0062_F10.b :
LVRM1_0107_E05.b :
LVRM1_0052_H07.b :
LVRM1_0094_G07.b :
LVRM1_0032_G01.b :
LVR01_0041_B06.b : gaacctccttcctccccaagaaacatcctcccctcatgggacacccccttccccccatgg
LVRM1_0183_A03.b :
LVRM1_0088_F10.b :
LVRM1_0150_E05.b :
LVRM1_0150_A07.b :
LVRM1_0034_G06.b :
LVRM1_0181_G04.b :
LVRM1_0096_G10.b :
LVRM1_0184_B12.b :
LVRM1_0169_D08.b :
LVRM1_0083_A12.b :
LVRM1_0014_H08.b :
LVRM1_0055_H02.b :
LVRM1_0013_B09.b :
LVRM1_0028_E01.b :
LVRM1_0119_A02.b :
LVRM1_0083_H09.b :
LVRM1_0205_F07.b :
LVRM1_0166_D05.b :
LVRM1_0010_A11.b :
LVRM1_0197_B12.b :
LVRM1_0128_A08.b :
LVRM1_0050_E04.b :
LVRM1_0160_F06.b :
LVRM1_0087_A10.b :
LVRM1_0186_E02.b :
LVRM1_0070_H12.b :
LVRM1_0047_B11.b :
LVRM1_0163_E03.b :
LVRM1_0208_D07.b :
LVRM1_0041_E01.b :
LVRM1_0195_E03.b :
LVRM1_0186_H06.b :
LVRM1_0195_C12.b :
LVRM1_0105_B05.b :
LVRM1_0078_G03.b :
LVRM1_0003_D02.b :
LVRM1_0005_C01.b :
LVRM1_0101_F10.b :
LVRM1_0152_C05.b :
LVRM1_0145_H06.b :
LVRM1_0129_B10.b :
LVRM1_0019_A04.b :
LVRM1_0037_H08.b :
LVRM1_0199_F08.b :
LVRM1_0036_B11.b :
LVRM1_0068_C07.b :
LVRM1_0021_F06.b :
LVRM1_0199_C09.b :
LVRM1_0128_C08.b :
LVRM1_0057_H03.b :
LVRM1_0142_D08.b :
LVRM1_0102_E09.b :
LVRM1_0036_B12.b :
LVRM1_0033_E09.b :
LVRM1_0151_E11.b :
LVRM1_0161_E07.b :
LVRM1_0107_B05.b :
LVRM1_0139_G06.b :
LVRM1_0002_E07.b :
LVR01_0016_D08.b : tgaaccttcctttccccccaagaaaaatcccccccctcatggggaaagccccatcccccc
LVR01_0073_F08.b :
LVR01_0106_C08.b : ttcccggtgaaaaccttcattcctcccccaggaaacaatcccttcccctctattggaaaa
LVR01_0077_G05.b :
LVR01_0017_B10.b : gcatccatcctccccaggaaattccttcccttcatggaaccccccattcccccaatggga
LVR01_0091_A09.b : aatcatctcccccagaaaaaccccccctcaagggaacccccctccccccattggaacccc
LVRM1_0159_F02.b :
LVRM1_0034_H08.b :
LVRM1_0035_H12.b :
LVRM1_0040_C05.b :
LVRM1_0091_G09.b :
LVRM1_0199_G03.b :
LVRM1_0156_B06.b :
LVRM1_0203_F02.b :
LVRM1_0207_F06.b :
LVRM1_0162_C01.b :
LVRM1_0136_G02.b :
LVR01_0019_A05.b : cctcctcccaggaacatcctccttcctggaaccccatcccccatgggaccccccttcctt
LVRM1_0208_H07.b :
LVRM1_0139_F02.b :
LVRM1_0200_C11.b :
LVRM1_0093_C12.b :
LVRM1_0168_F06.b :
LVRM1_0083_E04.b :
LVRM1_0184_C04.b :
LVRM1_0143_F03.b :
LVRM1_0001_F09.b :
LVRM1_0023_C03.b :
LVRM1_0121_E04.b :
LVRM1_0123_A04.b :
LVRM1_0083_F04.b :
LVR01_0053_F11.b : CTCCCAGGACATCCTCCTCATGGAagcccaccccctgggaccccctcctcatggac
LVRM1_0171_C07.b :
LVR01_0049_A08.b : tctccccagaacatccctcctcatggacttcctccccattggacccccctcctcatggga
LVRM1_0147_A09.b :
LVRM1_0176_G07.b :
LVRM1_0181_C04.b :
LVRM1_0176_C04.b :
LVRM1_0159_G08.b :
LVRM1_0096_A01.b :
LVRM1_0038_C01.b :
LVRM1_0108_E09.b : CT
LVRM1_0005_D04.b :
LVRM1_0170_D10.b :
LVRM1_0023_H04.b :
LVRM1_0108_D12.b : CTCCCAGGACATCCTCCTCATGGACGCCA
LVRM1_0186_G01.b : CTCCacgacatcct
LVRM1_0013_H10.b : acgaaaaatgcgccgaggggaacgagcgacagagaacggagcgggttggggcggtggaaa
LVRM1_0093_A11.b : gcccaggacattcccctcatgggaggccatcccacaggaacc
LVRM1_0166_F02.b : CTCCCAGGACATCCTCCTCATGGACGCCATCC
LVRM1_0028_C05.b : CTCTCAGGACATCCTCCTCATGGACGCCATn
LVRM1_0036_B10.b : CTCCCAGGACATCCTCCTCATGGACGCCATCCCCATGGACCCC*TCCTCATGGACGCCAT
LVRM1_0143_A07.b : CTCCCAGGACATCCTCCTCATGGACGCCATCCCCATGGACCCCCTCCTCATGGACGCCAT
LVRM1_0051_F03.b : cccaggcatcctcctaatggaggcattctcagggaccccttccatggagaccttaccaag
LVRM1_0072_C03.b : gccaggagttcggcctgaaagggccaggcacgctgggtcctttgctgcagggagctgttc
LVRM1_0182_G05.b : CTCCCAGGACATCCTCCTCATGGACGCCATCCCCATGGACCCCCTCCTCATGGACGCCAT
LVRM1_0156_A06.b : CTCCCAGGACATCCTCCTCATGGACGCCATCCCCATGGACCCCCTCCTCATGGACGCCAT
LVRM1_0049_E04.b : CTCCCAGGACATCCTCCTCATGGACGCCATCCCCATGGACCCCCTCCTCATGAACGCCAT
LVRM1_0005_A03.b : CTCCCAGGACATCCTCCTCATGGACGCCATCCCCATGGACCCTCTTTTTATGGACGCCAT
LVRM1_0044_H08.b : tctcccaggaaatccccctcgtgggagcccatccccagtggaccgcggtcaccgggggga
LVRM1_0179_D07.b : CTCCCAGGACATCCTCCTCATGGACGCCATCCCCATGGACCCCCTCCTCATGGACGCCAT
LVRM1_0147_C06.b : CTCCCAGGACATCCTCCTCATGGACGCCATCCCCATGGAACCCCTCCTCAGGGAGGCAAT
LVRM1_0163_A10.b : CTCCCAGGACATCCTCCTCATGGACGCCATCCCCATGGACCCCCTCCTCATGGACGCCAT
LVR01_0003_E12.b : CTCCCAGGACATCCTCCTCATGGACGCCATCCCCATGGACCCCCTCCTCATGGACGCCAT
LVR01_0093_A11.b : CTCCCAGGACATCCTCCTCATGGACGCCATCCCCATGGACCCCCTCCTCATGGACGCCAT
LVRM1_0007_D03.b : CTCCCAGGACATCCTCCTCATGGACGCCATCCCCATGGACCCCCTCCTCATGGACGCCAT
20110601C-012185 : CCCCAT*GGGCCCCCTCCTCATGGACGCCATCCCCATGGACCCCCTCCTCATGG*ACACC
---------+---------+---------+---------+---------+---------+ 1229
LVRM1_0008_G10.b :
LVRM1_0168_C11.b :
LVRM1_0091_G11.b :
LVRM1_0047_B01.b :
LVRM1_0198_F12.b :
LVRM1_0016_C11.b :
LVRM1_0117_A05.b :
LVRM1_0061_G04.b :
LVRM1_0196_F09.b :
LVRM1_0202_B06.b :
LVRM1_0195_F11.b :
LVRM1_0042_B12.b :
LVRM1_0024_B02.b :
LVRM1_0079_F06.b :
LVRM1_0049_G09.b :
LVRM1_0077_G12.b :
LVR01_0034_E10.b : tcctcccccccctcacagggggaaacacccccccccctccccccccacaggggggaaaaa
LVRM1_0158_H03.b :
LVRM1_0171_G05.b :
LVRM1_0020_A11.b :
LVRM1_0122_B02.b :
LVRM1_0163_H05.b :
LVRM1_0163_D05.b :
LVRM1_0087_D05.b :
LVRM1_0164_F12.b :
LVRM1_0077_B03.b :
LVRM1_0134_B10.b :
LVRM1_0188_E01.b :
LVRM1_0187_B02.b :
LVRM1_0206_F02.b :
LVRM1_0208_A06.b :
LVRM1_0092_E08.b :
LVRM1_0039_D04.b :
LVRM1_0204_G12.b :
LVRM1_0122_E05.b :
LVRM1_0098_E08.b :
LVRM1_0102_B04.b :
LVRM1_0197_H12.b :
LVRM1_0029_B01.b :
LVRM1_0149_H08.b :
LVRM1_0152_B09.b :
LVRM1_0031_D06.b :
LVRM1_0130_B11.b :
LVRM1_0152_E10.b :
LVR01_0105_G08.b : acaaatcccccctccccccctcccaaggtgggaaaaaacccccccccca
LVR01_0030_A05.b : cccattccccccccaatggtggaaaaccccccccccccttccccccttccaaag
LVRM1_0096_A05.b :
LVRM1_0019_F12.b :
LVRM1_0159_F03.b :
KDN01_0096_D10.b : tgggccccttcctagggagccatcccatggaccctcccatggaacctcccctgggcccct
LVRM1_0168_G08.b :
LVRM1_0205_E10.b :
LVRM1_0056_A02.b :
LVRM1_0135_E11.b :
LVRM1_0181_B03.b :
LVRM1_0106_B06.b :
LVRM1_0018_D04.b :
LVRM1_0035_G10.b :
LVRM1_0004_D09.b :
LVRM1_0111_H05.b :
LVRM1_0198_A07.b :
LVRM1_0151_A12.b :
LVRM1_0188_H09.b :
LVRM1_0015_A07.b :
LVRM1_0133_E10.b :
LVRM1_0163_B11.b :
LVRM1_0147_H02.b :
LVRM1_0134_C10.b :
LVRM1_0021_A01.b :
LVRM1_0051_H02.b :
LVRM1_0177_C07.b :
LVRM1_0191_F03.b :
LVRM1_0202_C11.b :
LVRM1_0121_F12.b :
LVRM1_0006_C09.b :
LVRM1_0146_F12.b :
LVRM1_0024_C10.b :
LVRM1_0122_D11.b :
LVRM1_0199_A10.b :
LVRM1_0195_C10.b :
LVRM1_0075_H07.b :
LVRM1_0175_F11.b :
LVRM1_0034_A07.b :
LVRM1_0050_E07.b :
LVRM1_0037_H10.b :
LVRM1_0113_B05.b :
LVRM1_0148_E11.b :
LVRM1_0107_C09.b :
LVRM1_0139_F05.b :
LVRM1_0148_E06.b :
LVR01_0053_F01.b :
LVR01_0063_F06.b :
LVR01_0096_B05.b : aaacccccccctccctcccaatgggaaacccccccatcccccccccaggggggggccccc
LVR01_0068_C08.b :
LVR01_0068_B10.b :
LVRM1_0016_G01.b :
LVRM1_0062_F10.b :
LVRM1_0107_E05.b :
LVRM1_0052_H07.b :
LVRM1_0094_G07.b :
LVRM1_0032_G01.b :
LVR01_0041_B06.b : ggaaccccccctccccccctcatgggaaaccccccttccccccccaggggggggcccccc
LVRM1_0183_A03.b :
LVRM1_0088_F10.b :
LVRM1_0150_E05.b :
LVRM1_0150_A07.b :
LVRM1_0034_G06.b :
LVRM1_0181_G04.b :
LVRM1_0096_G10.b :
LVRM1_0184_B12.b :
LVRM1_0169_D08.b :
LVRM1_0083_A12.b :
LVRM1_0014_H08.b :
LVRM1_0055_H02.b :
LVRM1_0013_B09.b :
LVRM1_0028_E01.b :
LVRM1_0119_A02.b :
LVRM1_0083_H09.b :
LVRM1_0205_F07.b :
LVRM1_0166_D05.b :
LVRM1_0010_A11.b :
LVRM1_0197_B12.b :
LVRM1_0128_A08.b :
LVRM1_0050_E04.b :
LVRM1_0160_F06.b :
LVRM1_0087_A10.b :
LVRM1_0186_E02.b :
LVRM1_0070_H12.b :
LVRM1_0047_B11.b :
LVRM1_0163_E03.b :
LVRM1_0208_D07.b :
LVRM1_0041_E01.b :
LVRM1_0195_E03.b :
LVRM1_0186_H06.b :
LVRM1_0195_C12.b :
LVRM1_0105_B05.b :
LVRM1_0078_G03.b :
LVRM1_0003_D02.b :
LVRM1_0005_C01.b :
LVRM1_0101_F10.b :
LVRM1_0152_C05.b :
LVRM1_0145_H06.b :
LVRM1_0129_B10.b :
LVRM1_0019_A04.b :
LVRM1_0037_H08.b :
LVRM1_0199_F08.b :
LVRM1_0036_B11.b :
LVRM1_0068_C07.b :
LVRM1_0021_F06.b :
LVRM1_0199_C09.b :
LVRM1_0128_C08.b :
LVRM1_0057_H03.b :
LVRM1_0142_D08.b :
LVRM1_0102_E09.b :
LVRM1_0036_B12.b :
LVRM1_0033_E09.b :
LVRM1_0151_E11.b :
LVRM1_0161_E07.b :
LVRM1_0107_B05.b :
LVRM1_0139_G06.b :
LVRM1_0002_E07.b :
LVR01_0016_D08.b : caagggaaaccccccccctcccccaatggggaaacccccccctttccccccactaggggg
LVR01_0073_F08.b :
LVR01_0106_C08.b : ccccccaattccccccctggggggaaacccccccccttcccccccaaatgggggaaaccc
LVR01_0077_G05.b :
LVR01_0017_B10.b : acccccccctccctccaatggggaaccccccacattcccccc
LVR01_0091_A09.b : cccccccccccaggggaaacccccactcccccccatggggggccccccccccccccccct
LVRM1_0159_F02.b :
LVRM1_0034_H08.b :
LVRM1_0035_H12.b :
LVRM1_0040_C05.b :
LVRM1_0091_G09.b :
LVRM1_0199_G03.b :
LVRM1_0156_B06.b :
LVRM1_0203_F02.b :
LVRM1_0207_F06.b :
LVRM1_0162_C01.b :
LVRM1_0136_G02.b :
LVR01_0019_A05.b : ctggaaacccaattcccc
LVRM1_0208_H07.b :
LVRM1_0139_F02.b :
LVRM1_0200_C11.b :
LVRM1_0093_C12.b :
LVRM1_0168_F06.b :
LVRM1_0083_E04.b :
LVRM1_0184_C04.b :
LVRM1_0143_F03.b :
LVRM1_0001_F09.b :
LVRM1_0023_C03.b :
LVRM1_0121_E04.b :
LVRM1_0123_A04.b :
LVRM1_0083_F04.b :
LVR01_0053_F11.b :
LVRM1_0171_C07.b :
LVR01_0049_A08.b : cgccatccccctggggcccccctcctcatgggaccccctcccccattggacccccctccc
LVRM1_0147_A09.b :
LVRM1_0176_G07.b :
LVRM1_0181_C04.b :
LVRM1_0176_C04.b :
LVRM1_0159_G08.b :
LVRM1_0096_A01.b :
LVRM1_0038_C01.b :
LVRM1_0108_E09.b :
LVRM1_0005_D04.b :
LVRM1_0170_D10.b :
LVRM1_0023_H04.b :
LVRM1_0108_D12.b :
LVRM1_0186_G01.b :
LVRM1_0013_H10.b : gg
LVRM1_0093_A11.b :
LVRM1_0166_F02.b :
LVRM1_0028_C05.b :
LVRM1_0036_B10.b : CCCCAgggc
LVRM1_0143_A07.b : CCCCAT*GGGCCCCCTTCTCATGGACACCA
LVRM1_0051_F03.b : gggccctcctcttggaacctaccccaggggccccttgccaggaaattatcccatgggggc
LVRM1_0072_C03.b : cttgggccggggctgatattgcagggcctcctagggacn
LVRM1_0182_G05.b : CCCCAT*GGGCCCCCTCCTCATGGACGCCATCCCCAg
LVRM1_0156_A06.b : CCCCAT*GGGCCCCCTCTTCATGGACACCATCCCCATGGACCCCCTCCTCATGG*ACACC
LVRM1_0049_E04.b : CCCCTTGGGGCCCCCTCCTCATGGACACCATCCCCAGGGACCCCCTCCTCATGGGACACC
LVRM1_0005_A03.b : TCCCAT*GGGCGCCCCTCTTCATGACACCATCCCCATGGACCCCttcttatggacaccat
LVRM1_0044_H08.b : gatgtcagtgggggcccgtcgagtggactgcttgcacagggggcgcgtgtgttaggaaag
LVRM1_0179_D07.b : CCCCAT*GGGCCCCCTCCTCATGGACACCATCCCCCTGGACCCCCTCCTCATGG*ACACC
LVRM1_0147_C06.b : CCCCAT*GGGCCCCCTCCcccatggaagccattcccatggaacccctcctcaagggaaac
LVRM1_0163_A10.b : CCCCAT*GGGCCCCCTCCTCATGGACGCCATCCCCATGGACCCCCTCCTCATGG*ACACC
LVR01_0003_E12.b : CCCCAT*GGGCCCCCTCCTCATGGACGCCATCCCCATGGACCCCCTCCTCATGG*ACACC
LVR01_0093_A11.b : CCCCAT*GGGCCCCCTCCTCATGGACGCCATCCCCATGGACCCCTTCCTCATGG*ACACC
LVRM1_0007_D03.b : CCCCAT*GGGCCCTCTCCTCATGGACGCCATCCCCATGGACCCCCTCCTCATGG*ACACC
20110601C-012185 : ATCCCCATGGGCCCCCTCCTCATGGACACCATCCCCATGGGCCCCCTCCTCATGGACACC
---------+---------+---------+---------+---------+---------+ 1289
LVRM1_0008_G10.b :
LVRM1_0168_C11.b :
LVRM1_0091_G11.b :
LVRM1_0047_B01.b :
LVRM1_0198_F12.b :
LVRM1_0016_C11.b :
LVRM1_0117_A05.b :
LVRM1_0061_G04.b :
LVRM1_0196_F09.b :
LVRM1_0202_B06.b :
LVRM1_0195_F11.b :
LVRM1_0042_B12.b :
LVRM1_0024_B02.b :
LVRM1_0079_F06.b :
LVRM1_0049_G09.b :
LVRM1_0077_G12.b :
LVR01_0034_E10.b : accccccccccccccct
LVRM1_0158_H03.b :
LVRM1_0171_G05.b :
LVRM1_0020_A11.b :
LVRM1_0122_B02.b :
LVRM1_0163_H05.b :
LVRM1_0163_D05.b :
LVRM1_0087_D05.b :
LVRM1_0164_F12.b :
LVRM1_0077_B03.b :
LVRM1_0134_B10.b :
LVRM1_0188_E01.b :
LVRM1_0187_B02.b :
LVRM1_0206_F02.b :
LVRM1_0208_A06.b :
LVRM1_0092_E08.b :
LVRM1_0039_D04.b :
LVRM1_0204_G12.b :
LVRM1_0122_E05.b :
LVRM1_0098_E08.b :
LVRM1_0102_B04.b :
LVRM1_0197_H12.b :
LVRM1_0029_B01.b :
LVRM1_0149_H08.b :
LVRM1_0152_B09.b :
LVRM1_0031_D06.b :
LVRM1_0130_B11.b :
LVRM1_0152_E10.b :
LVR01_0105_G08.b :
LVR01_0030_A05.b :
LVRM1_0096_A05.b :
LVRM1_0019_F12.b :
LVRM1_0159_F03.b :
KDN01_0096_D10.b : cccagggaaccatccagtggcccctcctgggaccttccgtggaccccccctggaacttcc
LVRM1_0168_G08.b :
LVRM1_0205_E10.b :
LVRM1_0056_A02.b :
LVRM1_0135_E11.b :
LVRM1_0181_B03.b :
LVRM1_0106_B06.b :
LVRM1_0018_D04.b :
LVRM1_0035_G10.b :
LVRM1_0004_D09.b :
LVRM1_0111_H05.b :
LVRM1_0198_A07.b :
LVRM1_0151_A12.b :
LVRM1_0188_H09.b :
LVRM1_0015_A07.b :
LVRM1_0133_E10.b :
LVRM1_0163_B11.b :
LVRM1_0147_H02.b :
LVRM1_0134_C10.b :
LVRM1_0021_A01.b :
LVRM1_0051_H02.b :
LVRM1_0177_C07.b :
LVRM1_0191_F03.b :
LVRM1_0202_C11.b :
LVRM1_0121_F12.b :
LVRM1_0006_C09.b :
LVRM1_0146_F12.b :
LVRM1_0024_C10.b :
LVRM1_0122_D11.b :
LVRM1_0199_A10.b :
LVRM1_0195_C10.b :
LVRM1_0075_H07.b :
LVRM1_0175_F11.b :
LVRM1_0034_A07.b :
LVRM1_0050_E07.b :
LVRM1_0037_H10.b :
LVRM1_0113_B05.b :
LVRM1_0148_E11.b :
LVRM1_0107_C09.b :
LVRM1_0139_F05.b :
LVRM1_0148_E06.b :
LVR01_0053_F01.b :
LVR01_0063_F06.b :
LVR01_0096_B05.b : cccccccccccccctcacagggggggaaaaacccc
LVR01_0068_C08.b :
LVR01_0068_B10.b :
LVRM1_0016_G01.b :
LVRM1_0062_F10.b :
LVRM1_0107_E05.b :
LVRM1_0052_H07.b :
LVRM1_0094_G07.b :
LVRM1_0032_G01.b :
LVR01_0041_B06.b : cccccccccccccaagtgggggaaacaccccccctctcccccccccccccagtaggt
LVRM1_0183_A03.b :
LVRM1_0088_F10.b :
LVRM1_0150_E05.b :
LVRM1_0150_A07.b :
LVRM1_0034_G06.b :
LVRM1_0181_G04.b :
LVRM1_0096_G10.b :
LVRM1_0184_B12.b :
LVRM1_0169_D08.b :
LVRM1_0083_A12.b :
LVRM1_0014_H08.b :
LVRM1_0055_H02.b :
LVRM1_0013_B09.b :
LVRM1_0028_E01.b :
LVRM1_0119_A02.b :
LVRM1_0083_H09.b :
LVRM1_0205_F07.b :
LVRM1_0166_D05.b :
LVRM1_0010_A11.b :
LVRM1_0197_B12.b :
LVRM1_0128_A08.b :
LVRM1_0050_E04.b :
LVRM1_0160_F06.b :
LVRM1_0087_A10.b :
LVRM1_0186_E02.b :
LVRM1_0070_H12.b :
LVRM1_0047_B11.b :
LVRM1_0163_E03.b :
LVRM1_0208_D07.b :
LVRM1_0041_E01.b :
LVRM1_0195_E03.b :
LVRM1_0186_H06.b :
LVRM1_0195_C12.b :
LVRM1_0105_B05.b :
LVRM1_0078_G03.b :
LVRM1_0003_D02.b :
LVRM1_0005_C01.b :
LVRM1_0101_F10.b :
LVRM1_0152_C05.b :
LVRM1_0145_H06.b :
LVRM1_0129_B10.b :
LVRM1_0019_A04.b :
LVRM1_0037_H08.b :
LVRM1_0199_F08.b :
LVRM1_0036_B11.b :
LVRM1_0068_C07.b :
LVRM1_0021_F06.b :
LVRM1_0199_C09.b :
LVRM1_0128_C08.b :
LVRM1_0057_H03.b :
LVRM1_0142_D08.b :
LVRM1_0102_E09.b :
LVRM1_0036_B12.b :
LVRM1_0033_E09.b :
LVRM1_0151_E11.b :
LVRM1_0161_E07.b :
LVRM1_0107_B05.b :
LVRM1_0139_G06.b :
LVRM1_0002_E07.b :
LVR01_0016_D08.b : gggccccccccccctcccctcctcataggggggagaaacccccccccccctctctccccc
LVR01_0073_F08.b :
LVR01_0106_C08.b : cccccatctccccccccccccgggggggggggcccccccccccccccctccc
LVR01_0077_G05.b :
LVR01_0017_B10.b :
LVR01_0091_A09.b : caaggggagaaacacccccctcccccctcccccccatgtgggaagaaccccccc
LVRM1_0159_F02.b :
LVRM1_0034_H08.b :
LVRM1_0035_H12.b :
LVRM1_0040_C05.b :
LVRM1_0091_G09.b :
LVRM1_0199_G03.b :
LVRM1_0156_B06.b :
LVRM1_0203_F02.b :
LVRM1_0207_F06.b :
LVRM1_0162_C01.b :
LVRM1_0136_G02.b :
LVR01_0019_A05.b :
LVRM1_0208_H07.b :
LVRM1_0139_F02.b :
LVRM1_0200_C11.b :
LVRM1_0093_C12.b :
LVRM1_0168_F06.b :
LVRM1_0083_E04.b :
LVRM1_0184_C04.b :
LVRM1_0143_F03.b :
LVRM1_0001_F09.b :
LVRM1_0023_C03.b :
LVRM1_0121_E04.b :
LVRM1_0123_A04.b :
LVRM1_0083_F04.b :
LVR01_0053_F11.b :
LVRM1_0171_C07.b :
LVR01_0049_A08.b : tcttggaacaccatcccccaggggccccccttttttcttggaacaccatt
LVRM1_0147_A09.b :
LVRM1_0176_G07.b :
LVRM1_0181_C04.b :
LVRM1_0176_C04.b :
LVRM1_0159_G08.b :
LVRM1_0096_A01.b :
LVRM1_0038_C01.b :
LVRM1_0108_E09.b :
LVRM1_0005_D04.b :
LVRM1_0170_D10.b :
LVRM1_0023_H04.b :
LVRM1_0108_D12.b :
LVRM1_0186_G01.b :
LVRM1_0013_H10.b :
LVRM1_0093_A11.b :
LVRM1_0166_F02.b :
LVRM1_0028_C05.b :
LVRM1_0036_B10.b :
LVRM1_0143_A07.b :
LVRM1_0051_F03.b : n
LVRM1_0072_C03.b :
LVRM1_0182_G05.b :
LVRM1_0156_A06.b : ATCCCC
LVRM1_0049_E04.b : ATCCCCATGGAACCCCTCCTtcatggaacccc
LVRM1_0005_A03.b : cccattgaccacctcttagggacacattccattggaccccttctctgg
LVRM1_0044_H08.b : cgagcacagagggcgcccgactaatggga
LVRM1_0179_D07.b : ATC*CCATGGACCCCCTCCTCATGGACACC
LVRM1_0147_C06.b : catccccatggggccccctcctcatggaaacaattcccctagggcccccccctctg
LVRM1_0163_A10.b : ATCCCCATGGGCCCCCTCCTCATGGACACCATCCCCATGGGCCCCCTCCTCAGGGACACC
LVR01_0003_E12.b : ATCCCCATGGGCCCCCTCCTCATGGACACCATCCCCATGGGCCCCCTCCTCATGGACACC
LVR01_0093_A11.b : ATCCCCATGGGCCCCCTCCTCATGGACACCATCCCCATGGGCCCCCTCCTCATGGACACC
LVRM1_0007_D03.b : ATCCCCATGGGCCCCCTCCTCATGGACACCATCCCCATGGGCCCCCTCCTCATGGACACC
20110601C-012185 : ATCCCCATGGACCCCCTCCTCATGGACGCCATCCCCATGGACCCCCTCCTCATGGACACC
---------+---------+---------+---------+---------+---------+ 1349
LVRM1_0008_G10.b :
LVRM1_0168_C11.b :
LVRM1_0091_G11.b :
LVRM1_0047_B01.b :
LVRM1_0198_F12.b :
LVRM1_0016_C11.b :
LVRM1_0117_A05.b :
LVRM1_0061_G04.b :
LVRM1_0196_F09.b :
LVRM1_0202_B06.b :
LVRM1_0195_F11.b :
LVRM1_0042_B12.b :
LVRM1_0024_B02.b :
LVRM1_0079_F06.b :
LVRM1_0049_G09.b :
LVRM1_0077_G12.b :
LVR01_0034_E10.b :
LVRM1_0158_H03.b :
LVRM1_0171_G05.b :
LVRM1_0020_A11.b :
LVRM1_0122_B02.b :
LVRM1_0163_H05.b :
LVRM1_0163_D05.b :
LVRM1_0087_D05.b :
LVRM1_0164_F12.b :
LVRM1_0077_B03.b :
LVRM1_0134_B10.b :
LVRM1_0188_E01.b :
LVRM1_0187_B02.b :
LVRM1_0206_F02.b :
LVRM1_0208_A06.b :
LVRM1_0092_E08.b :
LVRM1_0039_D04.b :
LVRM1_0204_G12.b :
LVRM1_0122_E05.b :
LVRM1_0098_E08.b :
LVRM1_0102_B04.b :
LVRM1_0197_H12.b :
LVRM1_0029_B01.b :
LVRM1_0149_H08.b :
LVRM1_0152_B09.b :
LVRM1_0031_D06.b :
LVRM1_0130_B11.b :
LVRM1_0152_E10.b :
LVR01_0105_G08.b :
LVR01_0030_A05.b :
LVRM1_0096_A05.b :
LVRM1_0019_F12.b :
LVRM1_0159_F03.b :
KDN01_0096_D10.b : cgggacccctctgggacaccccgggacccctctaaaaacctcccgggcgtattcgggatt
LVRM1_0168_G08.b :
LVRM1_0205_E10.b :
LVRM1_0056_A02.b :
LVRM1_0135_E11.b :
LVRM1_0181_B03.b :
LVRM1_0106_B06.b :
LVRM1_0018_D04.b :
LVRM1_0035_G10.b :
LVRM1_0004_D09.b :
LVRM1_0111_H05.b :
LVRM1_0198_A07.b :
LVRM1_0151_A12.b :
LVRM1_0188_H09.b :
LVRM1_0015_A07.b :
LVRM1_0133_E10.b :
LVRM1_0163_B11.b :
LVRM1_0147_H02.b :
LVRM1_0134_C10.b :
LVRM1_0021_A01.b :
LVRM1_0051_H02.b :
LVRM1_0177_C07.b :
LVRM1_0191_F03.b :
LVRM1_0202_C11.b :
LVRM1_0121_F12.b :
LVRM1_0006_C09.b :
LVRM1_0146_F12.b :
LVRM1_0024_C10.b :
LVRM1_0122_D11.b :
LVRM1_0199_A10.b :
LVRM1_0195_C10.b :
LVRM1_0075_H07.b :
LVRM1_0175_F11.b :
LVRM1_0034_A07.b :
LVRM1_0050_E07.b :
LVRM1_0037_H10.b :
LVRM1_0113_B05.b :
LVRM1_0148_E11.b :
LVRM1_0107_C09.b :
LVRM1_0139_F05.b :
LVRM1_0148_E06.b :
LVR01_0053_F01.b :
LVR01_0063_F06.b :
LVR01_0096_B05.b :
LVR01_0068_C08.b :
LVR01_0068_B10.b :
LVRM1_0016_G01.b :
LVRM1_0062_F10.b :
LVRM1_0107_E05.b :
LVRM1_0052_H07.b :
LVRM1_0094_G07.b :
LVRM1_0032_G01.b :
LVR01_0041_B06.b :
LVRM1_0183_A03.b :
LVRM1_0088_F10.b :
LVRM1_0150_E05.b :
LVRM1_0150_A07.b :
LVRM1_0034_G06.b :
LVRM1_0181_G04.b :
LVRM1_0096_G10.b :
LVRM1_0184_B12.b :
LVRM1_0169_D08.b :
LVRM1_0083_A12.b :
LVRM1_0014_H08.b :
LVRM1_0055_H02.b :
LVRM1_0013_B09.b :
LVRM1_0028_E01.b :
LVRM1_0119_A02.b :
LVRM1_0083_H09.b :
LVRM1_0205_F07.b :
LVRM1_0166_D05.b :
LVRM1_0010_A11.b :
LVRM1_0197_B12.b :
LVRM1_0128_A08.b :
LVRM1_0050_E04.b :
LVRM1_0160_F06.b :
LVRM1_0087_A10.b :
LVRM1_0186_E02.b :
LVRM1_0070_H12.b :
LVRM1_0047_B11.b :
LVRM1_0163_E03.b :
LVRM1_0208_D07.b :
LVRM1_0041_E01.b :
LVRM1_0195_E03.b :
LVRM1_0186_H06.b :
LVRM1_0195_C12.b :
LVRM1_0105_B05.b :
LVRM1_0078_G03.b :
LVRM1_0003_D02.b :
LVRM1_0005_C01.b :
LVRM1_0101_F10.b :
LVRM1_0152_C05.b :
LVRM1_0145_H06.b :
LVRM1_0129_B10.b :
LVRM1_0019_A04.b :
LVRM1_0037_H08.b :
LVRM1_0199_F08.b :
LVRM1_0036_B11.b :
LVRM1_0068_C07.b :
LVRM1_0021_F06.b :
LVRM1_0199_C09.b :
LVRM1_0128_C08.b :
LVRM1_0057_H03.b :
LVRM1_0142_D08.b :
LVRM1_0102_E09.b :
LVRM1_0036_B12.b :
LVRM1_0033_E09.b :
LVRM1_0151_E11.b :
LVRM1_0161_E07.b :
LVRM1_0107_B05.b :
LVRM1_0139_G06.b :
LVRM1_0002_E07.b :
LVR01_0016_D08.b : cccaccctatggggggaa
LVR01_0073_F08.b :
LVR01_0106_C08.b :
LVR01_0077_G05.b :
LVR01_0017_B10.b :
LVR01_0091_A09.b :
LVRM1_0159_F02.b :
LVRM1_0034_H08.b :
LVRM1_0035_H12.b :
LVRM1_0040_C05.b :
LVRM1_0091_G09.b :
LVRM1_0199_G03.b :
LVRM1_0156_B06.b :
LVRM1_0203_F02.b :
LVRM1_0207_F06.b :
LVRM1_0162_C01.b :
LVRM1_0136_G02.b :
LVR01_0019_A05.b :
LVRM1_0208_H07.b :
LVRM1_0139_F02.b :
LVRM1_0200_C11.b :
LVRM1_0093_C12.b :
LVRM1_0168_F06.b :
LVRM1_0083_E04.b :
LVRM1_0184_C04.b :
LVRM1_0143_F03.b :
LVRM1_0001_F09.b :
LVRM1_0023_C03.b :
LVRM1_0121_E04.b :
LVRM1_0123_A04.b :
LVRM1_0083_F04.b :
LVR01_0053_F11.b :
LVRM1_0171_C07.b :
LVR01_0049_A08.b :
LVRM1_0147_A09.b :
LVRM1_0176_G07.b :
LVRM1_0181_C04.b :
LVRM1_0176_C04.b :
LVRM1_0159_G08.b :
LVRM1_0096_A01.b :
LVRM1_0038_C01.b :
LVRM1_0108_E09.b :
LVRM1_0005_D04.b :
LVRM1_0170_D10.b :
LVRM1_0023_H04.b :
LVRM1_0108_D12.b :
LVRM1_0186_G01.b :
LVRM1_0013_H10.b :
LVRM1_0093_A11.b :
LVRM1_0166_F02.b :
LVRM1_0028_C05.b :
LVRM1_0036_B10.b :
LVRM1_0143_A07.b :
LVRM1_0051_F03.b :
LVRM1_0072_C03.b :
LVRM1_0182_G05.b :
LVRM1_0156_A06.b :
LVRM1_0049_E04.b :
LVRM1_0005_A03.b :
LVRM1_0044_H08.b :
LVRM1_0179_D07.b :
LVRM1_0147_C06.b :
LVRM1_0163_A10.b : ATn
LVR01_0003_E12.b : ATCCCCATGGACCCCCTCCTCATGGACACCATCCCCATGGACCCCCTCCTCATGGACACC
LVR01_0093_A11.b : ATCCCCATGGACCCCCTCCTCATGGACGCCATCCCCATGGACCCCCTCCTCATGGACACC
LVRM1_0007_D03.b : ATCCCCATGGACCCCCTGCTCATGGACGCCATCCCCATGGACCCCCTCCTCATGGACACC
20110601C-012185 : ATCCCCATGGACCCCCTCCTCATAGACACCATCCCCATGGCCATGATTTCCATGACTATG
---------+---------+---------+---------+---------+---------+ 1409
LVRM1_0008_G10.b :
LVRM1_0168_C11.b :
LVRM1_0091_G11.b :
LVRM1_0047_B01.b :
LVRM1_0198_F12.b :
LVRM1_0016_C11.b :
LVRM1_0117_A05.b :
LVRM1_0061_G04.b :
LVRM1_0196_F09.b :
LVRM1_0202_B06.b :
LVRM1_0195_F11.b :
LVRM1_0042_B12.b :
LVRM1_0024_B02.b :
LVRM1_0079_F06.b :
LVRM1_0049_G09.b :
LVRM1_0077_G12.b :
LVR01_0034_E10.b :
LVRM1_0158_H03.b :
LVRM1_0171_G05.b :
LVRM1_0020_A11.b :
LVRM1_0122_B02.b :
LVRM1_0163_H05.b :
LVRM1_0163_D05.b :
LVRM1_0087_D05.b :
LVRM1_0164_F12.b :
LVRM1_0077_B03.b :
LVRM1_0134_B10.b :
LVRM1_0188_E01.b :
LVRM1_0187_B02.b :
LVRM1_0206_F02.b :
LVRM1_0208_A06.b :
LVRM1_0092_E08.b :
LVRM1_0039_D04.b :
LVRM1_0204_G12.b :
LVRM1_0122_E05.b :
LVRM1_0098_E08.b :
LVRM1_0102_B04.b :
LVRM1_0197_H12.b :
LVRM1_0029_B01.b :
LVRM1_0149_H08.b :
LVRM1_0152_B09.b :
LVRM1_0031_D06.b :
LVRM1_0130_B11.b :
LVRM1_0152_E10.b :
LVR01_0105_G08.b :
LVR01_0030_A05.b :
LVRM1_0096_A05.b :
LVRM1_0019_F12.b :
LVRM1_0159_F03.b :
KDN01_0096_D10.b : ggccgtgcccccccaaaaattcacaacatggtgggggcccacatgc
LVRM1_0168_G08.b :
LVRM1_0205_E10.b :
LVRM1_0056_A02.b :
LVRM1_0135_E11.b :
LVRM1_0181_B03.b :
LVRM1_0106_B06.b :
LVRM1_0018_D04.b :
LVRM1_0035_G10.b :
LVRM1_0004_D09.b :
LVRM1_0111_H05.b :
LVRM1_0198_A07.b :
LVRM1_0151_A12.b :
LVRM1_0188_H09.b :
LVRM1_0015_A07.b :
LVRM1_0133_E10.b :
LVRM1_0163_B11.b :
LVRM1_0147_H02.b :
LVRM1_0134_C10.b :
LVRM1_0021_A01.b :
LVRM1_0051_H02.b :
LVRM1_0177_C07.b :
LVRM1_0191_F03.b :
LVRM1_0202_C11.b :
LVRM1_0121_F12.b :
LVRM1_0006_C09.b :
LVRM1_0146_F12.b :
LVRM1_0024_C10.b :
LVRM1_0122_D11.b :
LVRM1_0199_A10.b :
LVRM1_0195_C10.b :
LVRM1_0075_H07.b :
LVRM1_0175_F11.b :
LVRM1_0034_A07.b :
LVRM1_0050_E07.b :
LVRM1_0037_H10.b :
LVRM1_0113_B05.b :
LVRM1_0148_E11.b :
LVRM1_0107_C09.b :
LVRM1_0139_F05.b :
LVRM1_0148_E06.b :
LVR01_0053_F01.b :
LVR01_0063_F06.b :
LVR01_0096_B05.b :
LVR01_0068_C08.b :
LVR01_0068_B10.b :
LVRM1_0016_G01.b :
LVRM1_0062_F10.b :
LVRM1_0107_E05.b :
LVRM1_0052_H07.b :
LVRM1_0094_G07.b :
LVRM1_0032_G01.b :
LVR01_0041_B06.b :
LVRM1_0183_A03.b :
LVRM1_0088_F10.b :
LVRM1_0150_E05.b :
LVRM1_0150_A07.b :
LVRM1_0034_G06.b :
LVRM1_0181_G04.b :
LVRM1_0096_G10.b :
LVRM1_0184_B12.b :
LVRM1_0169_D08.b :
LVRM1_0083_A12.b :
LVRM1_0014_H08.b :
LVRM1_0055_H02.b :
LVRM1_0013_B09.b :
LVRM1_0028_E01.b :
LVRM1_0119_A02.b :
LVRM1_0083_H09.b :
LVRM1_0205_F07.b :
LVRM1_0166_D05.b :
LVRM1_0010_A11.b :
LVRM1_0197_B12.b :
LVRM1_0128_A08.b :
LVRM1_0050_E04.b :
LVRM1_0160_F06.b :
LVRM1_0087_A10.b :
LVRM1_0186_E02.b :
LVRM1_0070_H12.b :
LVRM1_0047_B11.b :
LVRM1_0163_E03.b :
LVRM1_0208_D07.b :
LVRM1_0041_E01.b :
LVRM1_0195_E03.b :
LVRM1_0186_H06.b :
LVRM1_0195_C12.b :
LVRM1_0105_B05.b :
LVRM1_0078_G03.b :
LVRM1_0003_D02.b :
LVRM1_0005_C01.b :
LVRM1_0101_F10.b :
LVRM1_0152_C05.b :
LVRM1_0145_H06.b :
LVRM1_0129_B10.b :
LVRM1_0019_A04.b :
LVRM1_0037_H08.b :
LVRM1_0199_F08.b :
LVRM1_0036_B11.b :
LVRM1_0068_C07.b :
LVRM1_0021_F06.b :
LVRM1_0199_C09.b :
LVRM1_0128_C08.b :
LVRM1_0057_H03.b :
LVRM1_0142_D08.b :
LVRM1_0102_E09.b :
LVRM1_0036_B12.b :
LVRM1_0033_E09.b :
LVRM1_0151_E11.b :
LVRM1_0161_E07.b :
LVRM1_0107_B05.b :
LVRM1_0139_G06.b :
LVRM1_0002_E07.b :
LVR01_0016_D08.b :
LVR01_0073_F08.b :
LVR01_0106_C08.b :
LVR01_0077_G05.b :
LVR01_0017_B10.b :
LVR01_0091_A09.b :
LVRM1_0159_F02.b :
LVRM1_0034_H08.b :
LVRM1_0035_H12.b :
LVRM1_0040_C05.b :
LVRM1_0091_G09.b :
LVRM1_0199_G03.b :
LVRM1_0156_B06.b :
LVRM1_0203_F02.b :
LVRM1_0207_F06.b :
LVRM1_0162_C01.b :
LVRM1_0136_G02.b :
LVR01_0019_A05.b :
LVRM1_0208_H07.b :
LVRM1_0139_F02.b :
LVRM1_0200_C11.b :
LVRM1_0093_C12.b :
LVRM1_0168_F06.b :
LVRM1_0083_E04.b :
LVRM1_0184_C04.b :
LVRM1_0143_F03.b :
LVRM1_0001_F09.b :
LVRM1_0023_C03.b :
LVRM1_0121_E04.b :
LVRM1_0123_A04.b :
LVRM1_0083_F04.b :
LVR01_0053_F11.b :
LVRM1_0171_C07.b :
LVR01_0049_A08.b :
LVRM1_0147_A09.b :
LVRM1_0176_G07.b :
LVRM1_0181_C04.b :
LVRM1_0176_C04.b :
LVRM1_0159_G08.b :
LVRM1_0096_A01.b :
LVRM1_0038_C01.b :
LVRM1_0108_E09.b :
LVRM1_0005_D04.b :
LVRM1_0170_D10.b :
LVRM1_0023_H04.b :
LVRM1_0108_D12.b :
LVRM1_0186_G01.b :
LVRM1_0013_H10.b :
LVRM1_0093_A11.b :
LVRM1_0166_F02.b :
LVRM1_0028_C05.b :
LVRM1_0036_B10.b :
LVRM1_0143_A07.b :
LVRM1_0051_F03.b :
LVRM1_0072_C03.b :
LVRM1_0182_G05.b :
LVRM1_0156_A06.b :
LVRM1_0049_E04.b :
LVRM1_0005_A03.b :
LVRM1_0044_H08.b :
LVRM1_0179_D07.b :
LVRM1_0147_C06.b :
LVRM1_0163_A10.b :
LVR01_0003_E12.b : ATCCCCATGGACCCCCTCCTCATAGACACCATCCCCATGGCCATGATTTCCATGACTATG
LVR01_0093_A11.b : ATCCCCATGGACCCCCTCCTCATAGACACCATCCCCATGGCCATGATTTCCATGACTATG
LVRM1_0007_D03.b : ATCCTCATGGACCCCCTCCTCATAAACACCATCCCCATGGGCATGCATTCCATGACTATG
20110601C-012185 : GACCCTGTGACCCACCACCCCATAGCCAAGATCCCCAAGACCACCATCGCTGGGGCCATG
---------+---------+---------+---------+---------+---------+ 1469
LVRM1_0008_G10.b :
LVRM1_0168_C11.b :
LVRM1_0091_G11.b :
LVRM1_0047_B01.b :
LVRM1_0198_F12.b :
LVRM1_0016_C11.b :
LVRM1_0117_A05.b :
LVRM1_0061_G04.b :
LVRM1_0196_F09.b :
LVRM1_0202_B06.b :
LVRM1_0195_F11.b :
LVRM1_0042_B12.b :
LVRM1_0024_B02.b :
LVRM1_0079_F06.b :
LVRM1_0049_G09.b :
LVRM1_0077_G12.b :
LVR01_0034_E10.b :
LVRM1_0158_H03.b :
LVRM1_0171_G05.b :
LVRM1_0020_A11.b :
LVRM1_0122_B02.b :
LVRM1_0163_H05.b :
LVRM1_0163_D05.b :
LVRM1_0087_D05.b :
LVRM1_0164_F12.b :
LVRM1_0077_B03.b :
LVRM1_0134_B10.b :
LVRM1_0188_E01.b :
LVRM1_0187_B02.b :
LVRM1_0206_F02.b :
LVRM1_0208_A06.b :
LVRM1_0092_E08.b :
LVRM1_0039_D04.b :
LVRM1_0204_G12.b :
LVRM1_0122_E05.b :
LVRM1_0098_E08.b :
LVRM1_0102_B04.b :
LVRM1_0197_H12.b :
LVRM1_0029_B01.b :
LVRM1_0149_H08.b :
LVRM1_0152_B09.b :
LVRM1_0031_D06.b :
LVRM1_0130_B11.b :
LVRM1_0152_E10.b :
LVR01_0105_G08.b :
LVR01_0030_A05.b :
LVRM1_0096_A05.b :
LVRM1_0019_F12.b :
LVRM1_0159_F03.b :
KDN01_0096_D10.b :
LVRM1_0168_G08.b :
LVRM1_0205_E10.b :
LVRM1_0056_A02.b :
LVRM1_0135_E11.b :
LVRM1_0181_B03.b :
LVRM1_0106_B06.b :
LVRM1_0018_D04.b :
LVRM1_0035_G10.b :
LVRM1_0004_D09.b :
LVRM1_0111_H05.b :
LVRM1_0198_A07.b :
LVRM1_0151_A12.b :
LVRM1_0188_H09.b :
LVRM1_0015_A07.b :
LVRM1_0133_E10.b :
LVRM1_0163_B11.b :
LVRM1_0147_H02.b :
LVRM1_0134_C10.b :
LVRM1_0021_A01.b :
LVRM1_0051_H02.b :
LVRM1_0177_C07.b :
LVRM1_0191_F03.b :
LVRM1_0202_C11.b :
LVRM1_0121_F12.b :
LVRM1_0006_C09.b :
LVRM1_0146_F12.b :
LVRM1_0024_C10.b :
LVRM1_0122_D11.b :
LVRM1_0199_A10.b :
LVRM1_0195_C10.b :
LVRM1_0075_H07.b :
LVRM1_0175_F11.b :
LVRM1_0034_A07.b :
LVRM1_0050_E07.b :
LVRM1_0037_H10.b :
LVRM1_0113_B05.b :
LVRM1_0148_E11.b :
LVRM1_0107_C09.b :
LVRM1_0139_F05.b :
LVRM1_0148_E06.b :
LVR01_0053_F01.b :
LVR01_0063_F06.b :
LVR01_0096_B05.b :
LVR01_0068_C08.b :
LVR01_0068_B10.b :
LVRM1_0016_G01.b :
LVRM1_0062_F10.b :
LVRM1_0107_E05.b :
LVRM1_0052_H07.b :
LVRM1_0094_G07.b :
LVRM1_0032_G01.b :
LVR01_0041_B06.b :
LVRM1_0183_A03.b :
LVRM1_0088_F10.b :
LVRM1_0150_E05.b :
LVRM1_0150_A07.b :
LVRM1_0034_G06.b :
LVRM1_0181_G04.b :
LVRM1_0096_G10.b :
LVRM1_0184_B12.b :
LVRM1_0169_D08.b :
LVRM1_0083_A12.b :
LVRM1_0014_H08.b :
LVRM1_0055_H02.b :
LVRM1_0013_B09.b :
LVRM1_0028_E01.b :
LVRM1_0119_A02.b :
LVRM1_0083_H09.b :
LVRM1_0205_F07.b :
LVRM1_0166_D05.b :
LVRM1_0010_A11.b :
LVRM1_0197_B12.b :
LVRM1_0128_A08.b :
LVRM1_0050_E04.b :
LVRM1_0160_F06.b :
LVRM1_0087_A10.b :
LVRM1_0186_E02.b :
LVRM1_0070_H12.b :
LVRM1_0047_B11.b :
LVRM1_0163_E03.b :
LVRM1_0208_D07.b :
LVRM1_0041_E01.b :
LVRM1_0195_E03.b :
LVRM1_0186_H06.b :
LVRM1_0195_C12.b :
LVRM1_0105_B05.b :
LVRM1_0078_G03.b :
LVRM1_0003_D02.b :
LVRM1_0005_C01.b :
LVRM1_0101_F10.b :
LVRM1_0152_C05.b :
LVRM1_0145_H06.b :
LVRM1_0129_B10.b :
LVRM1_0019_A04.b :
LVRM1_0037_H08.b :
LVRM1_0199_F08.b :
LVRM1_0036_B11.b :
LVRM1_0068_C07.b :
LVRM1_0021_F06.b :
LVRM1_0199_C09.b :
LVRM1_0128_C08.b :
LVRM1_0057_H03.b :
LVRM1_0142_D08.b :
LVRM1_0102_E09.b :
LVRM1_0036_B12.b :
LVRM1_0033_E09.b :
LVRM1_0151_E11.b :
LVRM1_0161_E07.b :
LVRM1_0107_B05.b :
LVRM1_0139_G06.b :
LVRM1_0002_E07.b :
LVR01_0016_D08.b :
LVR01_0073_F08.b :
LVR01_0106_C08.b :
LVR01_0077_G05.b :
LVR01_0017_B10.b :
LVR01_0091_A09.b :
LVRM1_0159_F02.b :
LVRM1_0034_H08.b :
LVRM1_0035_H12.b :
LVRM1_0040_C05.b :
LVRM1_0091_G09.b :
LVRM1_0199_G03.b :
LVRM1_0156_B06.b :
LVRM1_0203_F02.b :
LVRM1_0207_F06.b :
LVRM1_0162_C01.b :
LVRM1_0136_G02.b :
LVR01_0019_A05.b :
LVRM1_0208_H07.b :
LVRM1_0139_F02.b :
LVRM1_0200_C11.b :
LVRM1_0093_C12.b :
LVRM1_0168_F06.b :
LVRM1_0083_E04.b :
LVRM1_0184_C04.b :
LVRM1_0143_F03.b :
LVRM1_0001_F09.b :
LVRM1_0023_C03.b :
LVRM1_0121_E04.b :
LVRM1_0123_A04.b :
LVRM1_0083_F04.b :
LVR01_0053_F11.b :
LVRM1_0171_C07.b :
LVR01_0049_A08.b :
LVRM1_0147_A09.b :
LVRM1_0176_G07.b :
LVRM1_0181_C04.b :
LVRM1_0176_C04.b :
LVRM1_0159_G08.b :
LVRM1_0096_A01.b :
LVRM1_0038_C01.b :
LVRM1_0108_E09.b :
LVRM1_0005_D04.b :
LVRM1_0170_D10.b :
LVRM1_0023_H04.b :
LVRM1_0108_D12.b :
LVRM1_0186_G01.b :
LVRM1_0013_H10.b :
LVRM1_0093_A11.b :
LVRM1_0166_F02.b :
LVRM1_0028_C05.b :
LVRM1_0036_B10.b :
LVRM1_0143_A07.b :
LVRM1_0051_F03.b :
LVRM1_0072_C03.b :
LVRM1_0182_G05.b :
LVRM1_0156_A06.b :
LVRM1_0049_E04.b :
LVRM1_0005_A03.b :
LVRM1_0044_H08.b :
LVRM1_0179_D07.b :
LVRM1_0147_C06.b :
LVRM1_0163_A10.b :
LVR01_0003_E12.b : GACCCTGTGACCCACCACCCCATAGCCAAGATCCCCAAGACCACCATCGCTGGGGCCATG
LVR01_0093_A11.b : GACCCTGTGACCCACCACCCCATAGCCAAGATCCCCAAGACCACCATCGCTGGGGCCATG
LVRM1_0007_D03.b : GACCCTGTGACCCACCACCCCATAGTCTAGATTCCCAAGATCACCGTCGCTGGGGCCATG
20110601C-012185 : GCCCACCACCTAGGCACTCAGAAGAAAGAGGTCCAGGTAAAAAACACTTTCCCTTCCATG
---------+---------+---------+---------+---------+---------+ 1529
LVRM1_0008_G10.b :
LVRM1_0168_C11.b :
LVRM1_0091_G11.b :
LVRM1_0047_B01.b :
LVRM1_0198_F12.b :
LVRM1_0016_C11.b :
LVRM1_0117_A05.b :
LVRM1_0061_G04.b :
LVRM1_0196_F09.b :
LVRM1_0202_B06.b :
LVRM1_0195_F11.b :
LVRM1_0042_B12.b :
LVRM1_0024_B02.b :
LVRM1_0079_F06.b :
LVRM1_0049_G09.b :
LVRM1_0077_G12.b :
LVR01_0034_E10.b :
LVRM1_0158_H03.b :
LVRM1_0171_G05.b :
LVRM1_0020_A11.b :
LVRM1_0122_B02.b :
LVRM1_0163_H05.b :
LVRM1_0163_D05.b :
LVRM1_0087_D05.b :
LVRM1_0164_F12.b :
LVRM1_0077_B03.b :
LVRM1_0134_B10.b :
LVRM1_0188_E01.b :
LVRM1_0187_B02.b :
LVRM1_0206_F02.b :
LVRM1_0208_A06.b :
LVRM1_0092_E08.b :
LVRM1_0039_D04.b :
LVRM1_0204_G12.b :
LVRM1_0122_E05.b :
LVRM1_0098_E08.b :
LVRM1_0102_B04.b :
LVRM1_0197_H12.b :
LVRM1_0029_B01.b :
LVRM1_0149_H08.b :
LVRM1_0152_B09.b :
LVRM1_0031_D06.b :
LVRM1_0130_B11.b :
LVRM1_0152_E10.b :
LVR01_0105_G08.b :
LVR01_0030_A05.b :
LVRM1_0096_A05.b :
LVRM1_0019_F12.b :
LVRM1_0159_F03.b :
KDN01_0096_D10.b :
LVRM1_0168_G08.b :
LVRM1_0205_E10.b :
LVRM1_0056_A02.b :
LVRM1_0135_E11.b :
LVRM1_0181_B03.b :
LVRM1_0106_B06.b :
LVRM1_0018_D04.b :
LVRM1_0035_G10.b :
LVRM1_0004_D09.b :
LVRM1_0111_H05.b :
LVRM1_0198_A07.b :
LVRM1_0151_A12.b :
LVRM1_0188_H09.b :
LVRM1_0015_A07.b :
LVRM1_0133_E10.b :
LVRM1_0163_B11.b :
LVRM1_0147_H02.b :
LVRM1_0134_C10.b :
LVRM1_0021_A01.b :
LVRM1_0051_H02.b :
LVRM1_0177_C07.b :
LVRM1_0191_F03.b :
LVRM1_0202_C11.b :
LVRM1_0121_F12.b :
LVRM1_0006_C09.b :
LVRM1_0146_F12.b :
LVRM1_0024_C10.b :
LVRM1_0122_D11.b :
LVRM1_0199_A10.b :
LVRM1_0195_C10.b :
LVRM1_0075_H07.b :
LVRM1_0175_F11.b :
LVRM1_0034_A07.b :
LVRM1_0050_E07.b :
LVRM1_0037_H10.b :
LVRM1_0113_B05.b :
LVRM1_0148_E11.b :
LVRM1_0107_C09.b :
LVRM1_0139_F05.b :
LVRM1_0148_E06.b :
LVR01_0053_F01.b :
LVR01_0063_F06.b :
LVR01_0096_B05.b :
LVR01_0068_C08.b :
LVR01_0068_B10.b :
LVRM1_0016_G01.b :
LVRM1_0062_F10.b :
LVRM1_0107_E05.b :
LVRM1_0052_H07.b :
LVRM1_0094_G07.b :
LVRM1_0032_G01.b :
LVR01_0041_B06.b :
LVRM1_0183_A03.b :
LVRM1_0088_F10.b :
LVRM1_0150_E05.b :
LVRM1_0150_A07.b :
LVRM1_0034_G06.b :
LVRM1_0181_G04.b :
LVRM1_0096_G10.b :
LVRM1_0184_B12.b :
LVRM1_0169_D08.b :
LVRM1_0083_A12.b :
LVRM1_0014_H08.b :
LVRM1_0055_H02.b :
LVRM1_0013_B09.b :
LVRM1_0028_E01.b :
LVRM1_0119_A02.b :
LVRM1_0083_H09.b :
LVRM1_0205_F07.b :
LVRM1_0166_D05.b :
LVRM1_0010_A11.b :
LVRM1_0197_B12.b :
LVRM1_0128_A08.b :
LVRM1_0050_E04.b :
LVRM1_0160_F06.b :
LVRM1_0087_A10.b :
LVRM1_0186_E02.b :
LVRM1_0070_H12.b :
LVRM1_0047_B11.b :
LVRM1_0163_E03.b :
LVRM1_0208_D07.b :
LVRM1_0041_E01.b :
LVRM1_0195_E03.b :
LVRM1_0186_H06.b :
LVRM1_0195_C12.b :
LVRM1_0105_B05.b :
LVRM1_0078_G03.b :
LVRM1_0003_D02.b :
LVRM1_0005_C01.b :
LVRM1_0101_F10.b :
LVRM1_0152_C05.b :
LVRM1_0145_H06.b :
LVRM1_0129_B10.b :
LVRM1_0019_A04.b :
LVRM1_0037_H08.b :
LVRM1_0199_F08.b :
LVRM1_0036_B11.b :
LVRM1_0068_C07.b :
LVRM1_0021_F06.b :
LVRM1_0199_C09.b :
LVRM1_0128_C08.b :
LVRM1_0057_H03.b :
LVRM1_0142_D08.b :
LVRM1_0102_E09.b :
LVRM1_0036_B12.b :
LVRM1_0033_E09.b :
LVRM1_0151_E11.b :
LVRM1_0161_E07.b :
LVRM1_0107_B05.b :
LVRM1_0139_G06.b :
LVRM1_0002_E07.b :
LVR01_0016_D08.b :
LVR01_0073_F08.b :
LVR01_0106_C08.b :
LVR01_0077_G05.b :
LVR01_0017_B10.b :
LVR01_0091_A09.b :
LVRM1_0159_F02.b :
LVRM1_0034_H08.b :
LVRM1_0035_H12.b :
LVRM1_0040_C05.b :
LVRM1_0091_G09.b :
LVRM1_0199_G03.b :
LVRM1_0156_B06.b :
LVRM1_0203_F02.b :
LVRM1_0207_F06.b :
LVRM1_0162_C01.b :
LVRM1_0136_G02.b :
LVR01_0019_A05.b :
LVRM1_0208_H07.b :
LVRM1_0139_F02.b :
LVRM1_0200_C11.b :
LVRM1_0093_C12.b :
LVRM1_0168_F06.b :
LVRM1_0083_E04.b :
LVRM1_0184_C04.b :
LVRM1_0143_F03.b :
LVRM1_0001_F09.b :
LVRM1_0023_C03.b :
LVRM1_0121_E04.b :
LVRM1_0123_A04.b :
LVRM1_0083_F04.b :
LVR01_0053_F11.b :
LVRM1_0171_C07.b :
LVR01_0049_A08.b :
LVRM1_0147_A09.b :
LVRM1_0176_G07.b :
LVRM1_0181_C04.b :
LVRM1_0176_C04.b :
LVRM1_0159_G08.b :
LVRM1_0096_A01.b :
LVRM1_0038_C01.b :
LVRM1_0108_E09.b :
LVRM1_0005_D04.b :
LVRM1_0170_D10.b :
LVRM1_0023_H04.b :
LVRM1_0108_D12.b :
LVRM1_0186_G01.b :
LVRM1_0013_H10.b :
LVRM1_0093_A11.b :
LVRM1_0166_F02.b :
LVRM1_0028_C05.b :
LVRM1_0036_B10.b :
LVRM1_0143_A07.b :
LVRM1_0051_F03.b :
LVRM1_0072_C03.b :
LVRM1_0182_G05.b :
LVRM1_0156_A06.b :
LVRM1_0049_E04.b :
LVRM1_0005_A03.b :
LVRM1_0044_H08.b :
LVRM1_0179_D07.b :
LVRM1_0147_C06.b :
LVRM1_0163_A10.b :
LVR01_0003_E12.b : GCCCACCACCTAGGCACTCAGATGAAAGAGGTCCAGGTAAAAAACACTTTCCCTTTCATG
LVR01_0093_A11.b : GCCCACCACCTAGGCACTCAGAAGAAAGAGGTCCAGGTAAAAAACACTTTCCCTTCCATG
LVRM1_0007_D03.b : GACCAaccacctagttttctttgagaaggaggttcaggtaaaaaactatttttctttctt
20110601C-012185 : *GGAGAGAGATTGGATATGTTCACCGACTCCCACCATTAAAGAAAGGTGAGGTTCTTCCT
---------+---------+---------+---------+---------+---------+ 1588
LVRM1_0008_G10.b :
LVRM1_0168_C11.b :
LVRM1_0091_G11.b :
LVRM1_0047_B01.b :
LVRM1_0198_F12.b :
LVRM1_0016_C11.b :
LVRM1_0117_A05.b :
LVRM1_0061_G04.b :
LVRM1_0196_F09.b :
LVRM1_0202_B06.b :
LVRM1_0195_F11.b :
LVRM1_0042_B12.b :
LVRM1_0024_B02.b :
LVRM1_0079_F06.b :
LVRM1_0049_G09.b :
LVRM1_0077_G12.b :
LVR01_0034_E10.b :
LVRM1_0158_H03.b :
LVRM1_0171_G05.b :
LVRM1_0020_A11.b :
LVRM1_0122_B02.b :
LVRM1_0163_H05.b :
LVRM1_0163_D05.b :
LVRM1_0087_D05.b :
LVRM1_0164_F12.b :
LVRM1_0077_B03.b :
LVRM1_0134_B10.b :
LVRM1_0188_E01.b :
LVRM1_0187_B02.b :
LVRM1_0206_F02.b :
LVRM1_0208_A06.b :
LVRM1_0092_E08.b :
LVRM1_0039_D04.b :
LVRM1_0204_G12.b :
LVRM1_0122_E05.b :
LVRM1_0098_E08.b :
LVRM1_0102_B04.b :
LVRM1_0197_H12.b :
LVRM1_0029_B01.b :
LVRM1_0149_H08.b :
LVRM1_0152_B09.b :
LVRM1_0031_D06.b :
LVRM1_0130_B11.b :
LVRM1_0152_E10.b :
LVR01_0105_G08.b :
LVR01_0030_A05.b :
LVRM1_0096_A05.b :
LVRM1_0019_F12.b :
LVRM1_0159_F03.b :
KDN01_0096_D10.b :
LVRM1_0168_G08.b :
LVRM1_0205_E10.b :
LVRM1_0056_A02.b :
LVRM1_0135_E11.b :
LVRM1_0181_B03.b :
LVRM1_0106_B06.b :
LVRM1_0018_D04.b :
LVRM1_0035_G10.b :
LVRM1_0004_D09.b :
LVRM1_0111_H05.b :
LVRM1_0198_A07.b :
LVRM1_0151_A12.b :
LVRM1_0188_H09.b :
LVRM1_0015_A07.b :
LVRM1_0133_E10.b :
LVRM1_0163_B11.b :
LVRM1_0147_H02.b :
LVRM1_0134_C10.b :
LVRM1_0021_A01.b :
LVRM1_0051_H02.b :
LVRM1_0177_C07.b :
LVRM1_0191_F03.b :
LVRM1_0202_C11.b :
LVRM1_0121_F12.b :
LVRM1_0006_C09.b :
LVRM1_0146_F12.b :
LVRM1_0024_C10.b :
LVRM1_0122_D11.b :
LVRM1_0199_A10.b :
LVRM1_0195_C10.b :
LVRM1_0075_H07.b :
LVRM1_0175_F11.b :
LVRM1_0034_A07.b :
LVRM1_0050_E07.b :
LVRM1_0037_H10.b :
LVRM1_0113_B05.b :
LVRM1_0148_E11.b :
LVRM1_0107_C09.b :
LVRM1_0139_F05.b :
LVRM1_0148_E06.b :
LVR01_0053_F01.b :
LVR01_0063_F06.b :
LVR01_0096_B05.b :
LVR01_0068_C08.b :
LVR01_0068_B10.b :
LVRM1_0016_G01.b :
LVRM1_0062_F10.b :
LVRM1_0107_E05.b :
LVRM1_0052_H07.b :
LVRM1_0094_G07.b :
LVRM1_0032_G01.b :
LVR01_0041_B06.b :
LVRM1_0183_A03.b :
LVRM1_0088_F10.b :
LVRM1_0150_E05.b :
LVRM1_0150_A07.b :
LVRM1_0034_G06.b :
LVRM1_0181_G04.b :
LVRM1_0096_G10.b :
LVRM1_0184_B12.b :
LVRM1_0169_D08.b :
LVRM1_0083_A12.b :
LVRM1_0014_H08.b :
LVRM1_0055_H02.b :
LVRM1_0013_B09.b :
LVRM1_0028_E01.b :
LVRM1_0119_A02.b :
LVRM1_0083_H09.b :
LVRM1_0205_F07.b :
LVRM1_0166_D05.b :
LVRM1_0010_A11.b :
LVRM1_0197_B12.b :
LVRM1_0128_A08.b :
LVRM1_0050_E04.b :
LVRM1_0160_F06.b :
LVRM1_0087_A10.b :
LVRM1_0186_E02.b :
LVRM1_0070_H12.b :
LVRM1_0047_B11.b :
LVRM1_0163_E03.b :
LVRM1_0208_D07.b :
LVRM1_0041_E01.b :
LVRM1_0195_E03.b :
LVRM1_0186_H06.b :
LVRM1_0195_C12.b :
LVRM1_0105_B05.b :
LVRM1_0078_G03.b :
LVRM1_0003_D02.b :
LVRM1_0005_C01.b :
LVRM1_0101_F10.b :
LVRM1_0152_C05.b :
LVRM1_0145_H06.b :
LVRM1_0129_B10.b :
LVRM1_0019_A04.b :
LVRM1_0037_H08.b :
LVRM1_0199_F08.b :
LVRM1_0036_B11.b :
LVRM1_0068_C07.b :
LVRM1_0021_F06.b :
LVRM1_0199_C09.b :
LVRM1_0128_C08.b :
LVRM1_0057_H03.b :
LVRM1_0142_D08.b :
LVRM1_0102_E09.b :
LVRM1_0036_B12.b :
LVRM1_0033_E09.b :
LVRM1_0151_E11.b :
LVRM1_0161_E07.b :
LVRM1_0107_B05.b :
LVRM1_0139_G06.b :
LVRM1_0002_E07.b :
LVR01_0016_D08.b :
LVR01_0073_F08.b :
LVR01_0106_C08.b :
LVR01_0077_G05.b :
LVR01_0017_B10.b :
LVR01_0091_A09.b :
LVRM1_0159_F02.b :
LVRM1_0034_H08.b :
LVRM1_0035_H12.b :
LVRM1_0040_C05.b :
LVRM1_0091_G09.b :
LVRM1_0199_G03.b :
LVRM1_0156_B06.b :
LVRM1_0203_F02.b :
LVRM1_0207_F06.b :
LVRM1_0162_C01.b :
LVRM1_0136_G02.b :
LVR01_0019_A05.b :
LVRM1_0208_H07.b :
LVRM1_0139_F02.b :
LVRM1_0200_C11.b :
LVRM1_0093_C12.b :
LVRM1_0168_F06.b :
LVRM1_0083_E04.b :
LVRM1_0184_C04.b :
LVRM1_0143_F03.b :
LVRM1_0001_F09.b :
LVRM1_0023_C03.b :
LVRM1_0121_E04.b :
LVRM1_0123_A04.b :
LVRM1_0083_F04.b :
LVR01_0053_F11.b :
LVRM1_0171_C07.b :
LVR01_0049_A08.b :
LVRM1_0147_A09.b :
LVRM1_0176_G07.b :
LVRM1_0181_C04.b :
LVRM1_0176_C04.b :
LVRM1_0159_G08.b :
LVRM1_0096_A01.b :
LVRM1_0038_C01.b :
LVRM1_0108_E09.b :
LVRM1_0005_D04.b :
LVRM1_0170_D10.b :
LVRM1_0023_H04.b :
LVRM1_0108_D12.b :
LVRM1_0186_G01.b :
LVRM1_0013_H10.b :
LVRM1_0093_A11.b :
LVRM1_0166_F02.b :
LVRM1_0028_C05.b :
LVRM1_0036_B10.b :
LVRM1_0143_A07.b :
LVRM1_0051_F03.b :
LVRM1_0072_C03.b :
LVRM1_0182_G05.b :
LVRM1_0156_A06.b :
LVRM1_0049_E04.b :
LVRM1_0005_A03.b :
LVRM1_0044_H08.b :
LVRM1_0179_D07.b :
LVRM1_0147_C06.b :
LVRM1_0163_A10.b :
LVR01_0003_E12.b : GGGAAAGAGATTGGATATGTTCACCGACTCCCACCATTAAAGAAAGGTGAaggtccttct
LVR01_0093_A11.b : *GGAGAGAGATTGGATATGTTCACCGACTCCCACCATTAAAGAAAGGTGAGGTTCTTCCT
LVRM1_0007_D03.b : ggcgaagagtatgtttatt
20110601C-012185 : CTTTCCGAAGCCAATTTTCCCAGTTTCTTGTTGCCACACCACAAGCCCCCTACAGCCAGA
---------+---------+---------+---------+---------+---------+ 1648
LVRM1_0008_G10.b :
LVRM1_0168_C11.b :
LVRM1_0091_G11.b :
LVRM1_0047_B01.b :
LVRM1_0198_F12.b :
LVRM1_0016_C11.b :
LVRM1_0117_A05.b :
LVRM1_0061_G04.b :
LVRM1_0196_F09.b :
LVRM1_0202_B06.b :
LVRM1_0195_F11.b :
LVRM1_0042_B12.b :
LVRM1_0024_B02.b :
LVRM1_0079_F06.b :
LVRM1_0049_G09.b :
LVRM1_0077_G12.b :
LVR01_0034_E10.b :
LVRM1_0158_H03.b :
LVRM1_0171_G05.b :
LVRM1_0020_A11.b :
LVRM1_0122_B02.b :
LVRM1_0163_H05.b :
LVRM1_0163_D05.b :
LVRM1_0087_D05.b :
LVRM1_0164_F12.b :
LVRM1_0077_B03.b :
LVRM1_0134_B10.b :
LVRM1_0188_E01.b :
LVRM1_0187_B02.b :
LVRM1_0206_F02.b :
LVRM1_0208_A06.b :
LVRM1_0092_E08.b :
LVRM1_0039_D04.b :
LVRM1_0204_G12.b :
LVRM1_0122_E05.b :
LVRM1_0098_E08.b :
LVRM1_0102_B04.b :
LVRM1_0197_H12.b :
LVRM1_0029_B01.b :
LVRM1_0149_H08.b :
LVRM1_0152_B09.b :
LVRM1_0031_D06.b :
LVRM1_0130_B11.b :
LVRM1_0152_E10.b :
LVR01_0105_G08.b :
LVR01_0030_A05.b :
LVRM1_0096_A05.b :
LVRM1_0019_F12.b :
LVRM1_0159_F03.b :
KDN01_0096_D10.b :
LVRM1_