[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-012214

Length: 2,150

Sequence [FASTA format sequence]
TAGTTATATT CATGTCTTCC TTTAAAGAGA GTAGAATCTT ACAAATGTTC TTCTAAATAA
GTAGTAGAAG AAAAGAAATA GATGTGAGAG GAAGAAGTCC TTTTATTACC TTGAATCGCG
CTCCGGCTGC CGCCCTGAGC CCCGCGCCCC GTTATGGAGC GGCCGCCGCT GCCCGCCCTG
CTGCTGGGCG CCGCCGGGCT GCTGCTCCTG CTGCTGCCCC TCTCCTCTTC CTCCTCTTCG
GACGCCTGCG GCCCCTGCGA GCCGGCCACC TGCCCGCCCC TGCCCCCGCG GGGCTGCCCG
CTGGGCGAGA CCCGCGACGC GTGCGGCTGC TGCCCGGTGT GCGCGCGCGG CGAGGGCGAG
CCGTGCGGGG GCGGCGGCGC CGGCAGGGGG CACTGCGCGC CGGGCATGGA GTGCGTGAAG
AGCCGCAAGA GGCGGAAGGG TAAAGCGGGC GCAGCAGCCG GCGGCCCGGG CGTAAGCGGT
GTGTGCGTGT GCAAGAGCCG CTACCCGGTG TGCGGCAGCG ACGGCGTCAC CTACCCCAGC
GGCTGCCAGC TGCGCGCCGC CAGCCTGAGG GCCGAGAGCC GCGGGGAGAA AGCCGTCACC
CAGGTCAGCA AGGGCACCTG CGAGCAAGGT CCTTCCATCG TGACACCCCC TAAGGACATC
TGGAATGTCA CTGGTGCCCA GGTGTACCTG AGCTGCGAGG TCATCGGAAT CCCAACCCCT
GCCCTCATCT GGAACAAGGT ACAAAGGGGT CACTATGGAG TTCAAAGGAC GGAACTCTTG
CCTGGTGACC GAGATAACCT GGCCATTCAG ACGCGGGGTG GCCCAGAAAA GCATGAAGTG
ACGGGCTGGG TGCTGATATC TCCTCTTAGT AAGGAAGACG CTGGAGAGTA TGAGTGCCAT
GCAGCTAACT CCCAAGGACA GGCTTCAGCA TCAGCAAAAA TTACAGTGGT TGACACTTTA
CATGAGATAC CAGTGAAAAA AGGTGAAGGT GCTGAGCTGT AAACCTGCAG AGTATATTAG
TCTGCGTAGC TAATAGTCAT GGATAACTAC AGCCCTGGTT CTCACCTAAT AACCAGCTTC
TTTTCATGCA GTACACTAAC ACTTTAGTTA TATTCAGTGG TTTTTACACA GTGAAATATG
AAATAAAGGT AACACATCAA GACTATCTAC AAAAGCTGTA TTTACAGAAA AGCATGCTTA
TCATGAAACA AAACAAATAA AATGCTTTTT CTCACAATAC AGTACATTTT CATTAATTAA
AAAAAAAAAT TTAAAGCCAT ATCATAGAAA CAAGACACAC AGAGTTGTAA GAGAGCTAAA
CACTCATCAT CCGAGGTGCA ATACTCATGG ACATGAGCTC CTGAAACAGC AGCTTGCAGG
CATACGGCAT CCGCACCAGC GAGATCTAGG GTAGAGAGAA GGCCATTAGC GAGGACAGAC
AGCAGCGCCC TCATGGCCCT TAACCCACTC GCTTAGGTTG TGAGTGCGTG ACTGGTGCCA
GCACTCAGCC TATGACCTTG GCCTCTGGTG GTTCCCTCTC TTAACTGGCT TCGGTATTTC
ACTCTTTCTG CTAGACCTAA TTTATATTCA CCTTCATGAT TTAAAGTTCC TTCTACAAGT
CCTTATTACT TCCAAAAGAT GAACAGCCAA GAGGAATTCT AAGGTAAAAC TTACACTGGT
TTTTTGAAAA ACCTAATTGT TACCTTTTCC CTCATTTCAA ACTAGGAATC TGACAGAAGC
TTGCTGTCAA AACTGCCCAT CTGTTCCATC CCACTAAATC TGCCCACATG GTCAGACCAG
CAGGGTCCCA TCCTGAACAA GAGCACCTGC CCGTGAGGTC TAGCGCACCT GAGTCTTATT
CCGGCAGCCT CTGCATTCAT ACGTATGGGT CCGGGTGTTA GCGATCGCCA TTATGCCACA
CAGGTTGCAG ACATGAACCT GATAAGGATC TGATGCCTCA AATAGTCTTT CCCTTAAAAA
CTGGGCTGCT CCATGGGCAA TCTGACAGTC TCGTTTCATT TCTCCCAAAC GCAGGCCACC
GTCACTGTTA AGAGAAAAAC AGCTGACTAT TTTGTGCTTA TTTTCTATTA TCCATGCTAC
TTTGACTAAA CGGCAAAATA AAGAACACTG TTTAGGAAAG GAGATTTGGA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinIGFBP7insulin-like growth factor-binding protein 7 [Homo sapiens]. 3428e-94O
Contig/Assembly ProteinIGFBPL1insulin-like growth factor-binding protein-like 1 precursor [Homo sapiens]. 1473e-35O
Contig/Assembly ProteinPOLR2BDNA-directed RNA polymerase II subunit RPB2 [Homo sapiens]. 1406e-33
Contig/Assembly ProteinKAZALD1kazal-type serine protease inhibitor domain-containing protein 1 precursor [Homo sapiens]. 1113e-24O
Contig/Assembly ProteinPOLR3BDNA-directed RNA polymerase III subunit RPC2 isoform 1 [Homo sapiens]. 60.85e-09
Contig/Assembly ProteinPOLR3BDNA-directed RNA polymerase III subunit RPC2 isoform 2 [Homo sapiens]. 60.85e-09
Contig/Assembly ProteinPOLR1BDNA-directed RNA polymerase I subunit RPA2 isoform 2 [Homo sapiens]. 522e-06
Contig/Assembly ProteinPOLR1BDNA-directed RNA polymerase I subunit RPA2 isoform 1 [Homo sapiens]. 522e-06
Contig/Assembly ProteinHTRA1serine protease HTRA1 precursor [Homo sapiens]. 51.24e-06O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinIgfbp7insulin-like growth factor-binding protein 7 isoform 2 [Mus musculus]. 3356e-92O
Contig/Assembly ProteinIgfbp7insulin-like growth factor-binding protein 7 isoform 1 [Mus musculus]. 3195e-87O
Contig/Assembly ProteinIgfbpl1insulin-like growth factor-binding protein-like 1 precursor [Mus musculus]. 1466e-35O
Contig/Assembly ProteinPolr2bDNA-directed RNA polymerase II subunit RPB2 [Mus musculus]. 1405e-33
Contig/Assembly ProteinKazald1kazal-type serine protease inhibitor domain-containing protein 1 [Mus musculus]. 1073e-23O
Contig/Assembly ProteinPolr3bDNA-directed RNA polymerase III subunit RPC2 [Mus musculus]. 60.84e-09
Contig/Assembly ProteinHtra1serine protease HTRA1 precursor [Mus musculus]. 52.81e-06O
Contig/Assembly ProteinPolr1bDNA-directed RNA polymerase I subunit RPA2 [Mus musculus]. 50.45e-06


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC608559PREDICTED: similar to Insulin-like growth factor binding protein 7 precursor (IGFBP-7) (IBP-7) (IGF-binding protein 7) (MAC25 protein) (Prostacyclin-stimulating factor) (PGI2-stimulating factor) isoform 1 [Canis familiaris]. 3472e-95O
Contig/Assembly ProteinLOC608559PREDICTED: similar to Insulin-like growth factor binding protein 7 precursor (IGFBP-7) (IBP-7) (IGF-binding protein 7) (MAC25 protein) (Prostacyclin-stimulating factor) (PGI2-stimulating factor) isoform 3 [Canis familiaris]. 3396e-93O
Contig/Assembly ProteinLOC608559PREDICTED: similar to Insulin-like growth factor binding protein 7 precursor (IGFBP-7) (IBP-7) (IGF-binding protein 7) (MAC25 protein) (Prostacyclin-stimulating factor) (PGI2-stimulating factor) isoform 2 [Canis familiaris]. 2329e-61O
Contig/Assembly ProteinLOC475152PREDICTED: similar to DNA-directed RNA polymerase II 140 kDa polypeptide (RNA polymerase II subunit 2) (RPB2) isoform 13 [Canis familiaris]. 1406e-33
Contig/Assembly ProteinLOC475152PREDICTED: similar to DNA-directed RNA polymerase II 140 kDa polypeptide (RNA polymerase II subunit 2) (RPB2) isoform 12 [Canis familiaris]. 1406e-33
Contig/Assembly ProteinLOC475152PREDICTED: similar to DNA-directed RNA polymerase II 140 kDa polypeptide (RNA polymerase II subunit 2) (RPB2) isoform 16 [Canis familiaris]. 1406e-33
Contig/Assembly ProteinLOC475152PREDICTED: similar to DNA-directed RNA polymerase II 140 kDa polypeptide (RNA polymerase II subunit 2) (RPB2) isoform 11 [Canis familiaris]. 1406e-33
Contig/Assembly ProteinLOC475152PREDICTED: similar to DNA-directed RNA polymerase II 140 kDa polypeptide (RNA polymerase II subunit 2) (RPB2) isoform 15 [Canis familiaris]. 1406e-33
Contig/Assembly ProteinLOC475152PREDICTED: similar to DNA-directed RNA polymerase II 140 kDa polypeptide (RNA polymerase II subunit 2) (RPB2) isoform 14 [Canis familiaris]. 1406e-33
Contig/Assembly ProteinLOC475152PREDICTED: similar to DNA-directed RNA polymerase II 140 kDa polypeptide (RNA polymerase II subunit 2) (RPB2) isoform 17 [Canis familiaris]. 1406e-33


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinIGFBP7insulin-like growth factor-binding protein 7 [Bos taurus]. 3481e-95O
Contig/Assembly ProteinIGFBPL1insulin-like growth factor-binding protein-like 1 precursor [Bos taurus]. 1575e-38O
Contig/Assembly ProteinPOLR2BDNA-directed RNA polymerase II subunit RPB2 [Bos taurus]. 1406e-33
Contig/Assembly ProteinLOC781250PREDICTED: insulin-like growth factor-binding protein-like 1-like, partial [Bos taurus]. 1252e-28O
Contig/Assembly ProteinKAZALD1PREDICTED: Kazal-type serine peptidase inhibitor domain 1-like [Bos taurus]. 1052e-22O
Contig/Assembly ProteinKAZALD1PREDICTED: Kazal-type serine peptidase inhibitor domain 1-like [Bos taurus]. 1052e-22O
Contig/Assembly ProteinPOLR3BDNA-directed RNA polymerase III subunit RPC2 [Bos taurus]. 60.85e-09
Contig/Assembly ProteinPOLR3BPREDICTED: polymerase (RNA) III (DNA directed) polypeptide B [Bos taurus]. 60.85e-09
Contig/Assembly ProteinHTRA1PREDICTED: HtrA serine peptidase 1 [Bos taurus]. 52.42e-06
Contig/Assembly ProteinHTRA1PREDICTED: HtrA serine peptidase 1 [Bos taurus]. 52.42e-06


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinIGFBP7insulin-like growth factor-binding protein 7 [Sus scrofa]. 3557e-98O
Contig/Assembly ProteinLOC100155070PREDICTED: insulin-like growth factor-binding protein-like 1-like [Sus scrofa]. 1504e-36O
Contig/Assembly ProteinPOLR2BPREDICTED: DNA-directed RNA polymerase II subunit RPB2 [Sus scrofa]. 1404e-33
Contig/Assembly ProteinLOC100624902PREDICTED: kazal-type serine protease inhibitor domain-containing protein 1-like [Sus scrofa]. 1103e-24O
Contig/Assembly ProteinLOC100524232PREDICTED: insulin-like growth factor-binding protein-like 1-like [Sus scrofa]. 1012e-21O
Contig/Assembly ProteinLOC100523122PREDICTED: DNA-directed RNA polymerase III subunit RPC2-like [Sus scrofa]. 60.83e-09
Contig/Assembly ProteinLOC100620767PREDICTED: DNA-directed RNA polymerase III subunit RPC2-like [Sus scrofa]. 60.83e-09O
Contig/Assembly ProteinLOC100515628PREDICTED: serine protease HTRA1-like [Sus scrofa]. 521e-06O
Contig/Assembly ProteinPOLR1BPREDICTED: DNA-directed RNA polymerase I subunit RPA2 isoform 1 [Sus scrofa]. 521e-06


Assembly Members: 176      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
BKFL10049E07BKFL1_0049_E07.bFS651639 
BKFL10056C12BKFL1_0056_C12.bFS652238 
BKFL10103C07BKFL1_0103_C07.bFS655507 
CLNT10007E05CLNT1_0007_E05.bFS657602 
CLNT10014A11CLNT1_0014_A11.bFS658151 
CLNT10022F10CLNT1_0022_F10.bHX219175 
CLNT10041F04CLNT1_0041_F04.bFS660294 
CLNT10051H02CLNT1_0051_H02.bFS661123 
CLNT10055E08CLNT1_0055_E08.bFS661410 
CLNT10061A10CLNT1_0061_A10.bFS661847 
CLNT10062A10CLNT1_0062_A10.bFS661922 
CLNT10064B01CLNT1_0064_B01.bFS662071 
CLNT10064E03CLNT1_0064_E03.bFS662101 
CLNT10064F02CLNT1_0064_F02.bFS662111 
CLNT10064G09CLNT1_0064_G09.bFS662123 
CLNT10066C04CLNT1_0066_C04.b  
CLNT10066E04CLNT1_0066_E04.bFS662263 
CLNT10074E03CLNT1_0074_E03.bFS662925 
CLNT10074H09CLNT1_0074_H09.bFS662961 
CLNT10096B04CLNT1_0096_B04.b  
CLNT10096D04CLNT1_0096_D04.bFS664017 
CLNT10113G10CLNT1_0113_G10.bHX220188 
CLNT10115D01CLNT1_0115_D01.bHX220303 
CLNT10128D11CLNT1_0128_D11.bHX221302 
CLNT10146A11CLNT1_0146_A11.bHX222667 
CLNT10150E07CLNT1_0150_E07.b  
CLNT10151F03CLNT1_0151_F03.bHX223105 
HTMT10044C07HTMT1_0044_C07.b  
ILNT10020C05ILNT1_0020_C05.bHX228240 
ILNT10056D06ILNT1_0056_D06.bHX231166 
ITT010012E04ITT01_0012_E04.bBW977097 
KDN010005A09KDN01_0005_A09.bFS671529 AK393112
KDN010008C02KDN01_0008_C02.bFS671778 
KDN010012B08KDN01_0012_B08.bFS672076 
KDN010016C12KDN01_0016_C12.bFS672397 
KDN010028A09KDN01_0028_A09.bFS673287 
KDN010028B03KDN01_0028_B03.bFS673291 
KDN010035D10KDN01_0035_D10.bFS673870 
KDN010079F03KDN01_0079_F03.b  
KDN010080C12KDN01_0080_C12.bFS676792 
KDN010091A05KDN01_0091_A05.bFS677631 
KDN010093D03KDN01_0093_D03.bFS677828 
KDN010096D09KDN01_0096_D09.b  
LNG010002H02LNG01_0002_H02.bBP440034 
LNG010028F08LNG01_0028_F08.bBP438559 
LNG010034F12LNG01_0034_F12.bBP438900 
LNG010034G12LNG01_0034_G12.bBP439899 
LNG010035A11LNG01_0035_A11.bBP433850 
LNG010035H02LNG01_0035_H02.bBP440062 
LNG010042H03LNG01_0042_H03.bBP440150 
LNG010046F07LNG01_0046_F07.bBP438489 
LNG010080G12LNG01_0080_G12.bBP439925 
LNG010091D10LNG01_0091_D10.bBP436730 
LNG010098D07LNG01_0098_D07.bBP436506 
LNG010103C05LNG01_0103_C05.bBP435351 
LVR010057C12LVR01_0057_C12.bBP443644 
MLN010069C05MLN01_0069_C05.bCJ013100 
MLN010101H05MLN01_0101_H05.bBW963907 
OVR010043B12OVR01_0043_B12.b  
OVR010090D11OVR01_0090_D11.b  
OVRM10059H02OVRM1_0059_H02.bBP153806 
OVRM10154A10OVRM1_0154_A10.bBP455344 
OVRM10204C10OVRM1_0204_C10.bBP457301 
OVRM10206H10OVRM1_0206_H10.bBP462120 
OVRT10001E06OVRT1_0001_E06.bFS686461 
OVRT10002A05OVRT1_0002_A05.bFS686502 
OVRT10003C10OVRT1_0003_C10.bFS686610 
OVRT10004A04OVRT1_0004_A04.bFS686666 
OVRT10005G05OVRT1_0005_G05.b  
OVRT10008G02OVRT1_0008_G02.bFS687072 
OVRT10019D07OVRT1_0019_D07.bFS687950 
OVRT10022A06OVRT1_0022_A06.bFS688158 
OVRT10022E11OVRT1_0022_E11.bFS688209 
OVRT10023B04OVRT1_0023_B04.bFS688255 
OVRT10025C10OVRT1_0025_C10.bFS688439 
OVRT10028E11OVRT1_0028_E11.bFS688695 
OVRT10031H01OVRT1_0031_H01.bFS688947 
OVRT10033A09OVRT1_0033_A09.bFS689045 
OVRT10035E03OVRT1_0035_E03.bFS689251 
OVRT10035F07OVRT1_0035_F07.bFS689267 
OVRT10036C01OVRT1_0036_C01.bFS689318 
OVRT10036C05OVRT1_0036_C05.bFS689322 
OVRT10036G06OVRT1_0036_G06.bFS689363 
OVRT10038A03OVRT1_0038_A03.bFS689464 
OVRT10040E06OVRT1_0040_E06.bFS689676 
OVRT10041A04OVRT1_0041_A04.bFS689713 
OVRT10041G09OVRT1_0041_G09.bFS689776 
OVRT10042D12OVRT1_0042_D12.bFS689834 
OVRT10042E01OVRT1_0042_E01.bFS689835 
OVRT10043F11OVRT1_0043_F11.bFS689935 
OVRT10044E01OVRT1_0044_E01.bFS690001 
OVRT10045B04OVRT1_0045_B04.bFS690054 
OVRT10045G02OVRT1_0045_G02.b  
OVRT10048F02OVRT1_0048_F02.bFS690333 
OVRT10054D09OVRT1_0054_D09.bFS690814 
OVRT10058D02OVRT1_0058_D02.bFS691135 
OVRT10064E08OVRT1_0064_E08.bFS691651 
OVRT10069A11OVRT1_0069_A11.bFS692024 
OVRT10072D05OVRT1_0072_D05.bFS692271 
OVRT10073A09OVRT1_0073_A09.bFS692322 
OVRT10073E02OVRT1_0073_E02.bFS692356 
OVRT10074C11OVRT1_0074_C11.bFS692425 
OVRT10076E05OVRT1_0076_E05.bFS692607 
OVRT10078B06OVRT1_0078_B06.b  
OVRT10082A12OVRT1_0082_A12.b  
OVRT10082B08OVRT1_0082_B08.bFS693069 
OVRT10084H08OVRT1_0084_H08.bFS693286 
OVRT10085E08OVRT1_0085_E08.bFS693339 
OVRT10087B04OVRT1_0087_B04.bFS693470 
OVRT10093E08OVRT1_0093_E08.b  
OVRT10098F02OVRT1_0098_F02.bFS694420 
OVRT10100A06OVRT1_0100_A06.bFS694541 
OVRT10100C01OVRT1_0100_C01.bFS694557 
OVRT10100F07OVRT1_0100_F07.b  
OVRT10106F03OVRT1_0106_F03.bHX235291 
OVRT10111F01OVRT1_0111_F01.bHX235706 
OVRT10120H01OVRT1_0120_H01.b  
OVRT10123D02OVRT1_0123_D02.bHX236662 
OVRT10123G01OVRT1_0123_G01.bHX236686 
OVRT10124B12OVRT1_0124_B12.bHX236723 
OVRT10126H09OVRT1_0126_H09.bHX236938 
OVRT10128B05OVRT1_0128_B05.bHX237036 
OVRT10132A05OVRT1_0132_A05.bHX237347 
OVRT10132E08OVRT1_0132_E08.bHX237388 
OVRT10136B01OVRT1_0136_B01.bHX237678 
OVRT10141A09OVRT1_0141_A09.bHX238074 
OVRT10141A10OVRT1_0141_A10.bHX238075 
OVRT10143E01OVRT1_0143_E01.bHX238278 
OVRT10143G01OVRT1_0143_G01.bHX238302 
OVRT10147B03OVRT1_0147_B03.bHX238583 
OVRT10147C10OVRT1_0147_C10.bHX238596 
OVRT10149B12OVRT1_0149_B12.bHX238758 
PST010033B11PST01_0033_B11.bFS699410 
PST010039F12PST01_0039_F12.bFS699911 
PST010041H08PST01_0041_H08.bFS700089 
PST010042A08PST01_0042_A08.bFS700100 
PST010042G06PST01_0042_G06.bFS700162 
PST010044E03PST01_0044_E03.bFS700304 
PST010054E06PST01_0054_E06.bFS701114 
PST010064F10PST01_0064_F10.bFS701917 
PST010072A08PST01_0072_A08.b  
PST010074D09PST01_0074_D09.bFS702661 
PST010080F02PST01_0080_F02.bFS703172 
PST010098A12PST01_0098_A12.b  
PST010099B11PST01_0099_B11.bFS704604 
SKNB10013E01SKNB1_0013_E01.bDB800715 
SMG010092C12SMG01_0092_C12.bFS721214 
SPLT10001G07SPLT1_0001_G07.bHX239334 
TCH010011H03TCH01_0011_H03.bBW975696 
TCH010012C01TCH01_0012_C01.bBW975698 
TCH010023B08TCH01_0023_B08.bCJ024109 
TCH010027F05TCH01_0027_F05.bBW975726 
TCH010028A06TCH01_0028_A06.bCJ024485 
TCH010033G03TCH01_0033_G03.bCJ024905 
TCH010037B04TCH01_0037_B04.bCJ025165 
TCH010039E03TCH01_0039_E03.bBW975759 
TCH010039H04TCH01_0039_H04.bBW975760 
TCH010046A02TCH01_0046_A02.bBW975777 
TCH010085H10TCH01_0085_H10.bCJ028655 
TCH010087F04TCH01_0087_F04.bCJ028793 
TCH010093B10TCH01_0093_B10.bCJ029206 
TCH010093E09TCH01_0093_E09.bCJ029234 
TES010001D08TES01_0001_D08.bCJ030051 AK351135
TES010020A03TES01_0020_A03.bCJ031314 
TES010040A03TES01_0040_A03.bCJ032571 
TES010056A11TES01_0056_A11.bCJ033538 
TES010059H04TES01_0059_H04.bCJ033812 
TES010070D01TES01_0070_D01.bCJ034516 
TES010101A03TES01_0101_A03.bCJ036599 
TES010112B01TES01_0112_B01.bCJ037372 
THY010040A10THY01_0040_A10.bBP160302 
UTR010043B07UTR01_0043_B07.bBP170192 
UTR010045A04UTR01_0045_A04.bBP169524 
UTR010052H06UTR01_0052_H06.bBP464814 
UTR010060D01UTR01_0060_D01.bBP463546 
UTR010075C07UTR01_0075_C07.bBP463415 

  

SNPs: 4      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
249C16400.982BSTGC/C
T030.018TGT/C
385A11830.858ONAGG/R
G1910.142GGG/G
437A6510.516WNAAG/K
G6200.484AGG/R
443A14030.947WNAAA/K
G800.053AGA/R


Alignment:      TOP

20110601C-012214 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0151_F03.b : nnncccgttctgcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b :
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b :
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b :
PST01_0054_E06.b :
PST01_0098_A12.b :
KDN01_0028_A09.b :
PST01_0074_D09.b :
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b :
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b :
KDN01_0008_C02.b :
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b :
PST01_0041_H08.b :
OVRT1_0001_E06.b :
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b :
OVRT1_0076_E05.b :
OVRT1_0126_H09.b :
CLNT1_0113_G10.b :
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b :
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b :
OVRT1_0036_C01.b :
OVRT1_0078_B06.b :
OVRT1_0082_B08.b :
LNG01_0034_G12.b :
OVRT1_0040_E06.b :
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b :
OVRT1_0069_A11.b :
OVRT1_0036_C05.b :
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b :
OVRT1_0042_E01.b :
OVRT1_0036_G06.b :
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b :
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b :
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b :
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b :
THY01_0040_A10.b :
OVRT1_0106_F03.b :
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b :
OVRT1_0136_B01.b :
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b :
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b :
OVRT1_0147_C10.b :
OVRT1_0002_A05.b :
SMG01_0092_C12.b :
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b :
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b :
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b :
OVRT1_0035_E03.b :
TCH01_0037_B04.b :
LNG01_0091_D10.b :
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b :
OVRT1_0048_F02.b :
CLNT1_0064_E03.b :
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b :
PST01_0044_E03.b :
OVRT1_0005_G05.b :
KDN01_0005_A09.b :
KDN01_0096_D09.b :
KDN01_0091_A05.b :
PST01_0042_G06.b :
KDN01_0012_B08.b :
KDN01_0035_D10.b :
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b :
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b :
CLNT1_0150_E07.b :
OVRT1_0100_A06.b :
OVRT1_0072_D05.b :
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
20110601C-012214 : .................TAGTTATATTCATGTCTTCCTTTAAAGAGAGTAGAATCTTACA
---------+---------+---------+---------+---------+---------+ 43
CLNT1_0151_F03.b : xxxxxxxxxxxcgcttaTAGTTATATTCATGTCTTCCTTTAAAGAGAGTAGAATCTTACA
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b : g
TES01_0001_D08.b :
OVRT1_0044_E01.b : ggg
TES01_0040_A03.b :
OVRT1_0149_B12.b : nnncttcg
TES01_0112_B01.b :
CLNT1_0096_B04.b : ng
OVRT1_0025_C10.b : g
PST01_0042_A08.b :
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b :
PST01_0054_E06.b :
PST01_0098_A12.b :
KDN01_0028_A09.b :
PST01_0074_D09.b :
LVR01_0057_C12.b : tccgagcxxxxxxxxx
OVRT1_0022_A06.b : tt
KDN01_0079_F03.b :
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b :
KDN01_0008_C02.b :
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b : ncgtttcnnnnn
PST01_0041_H08.b :
OVRT1_0001_E06.b : n
OVRT1_0004_A04.b : nggactcgttctgcgcacgxxxxxxxxxxxxxx
CLNT1_0041_F04.b :
OVRT1_0041_G09.b : ntgga
SPLT1_0001_G07.b :
OVR01_0043_B12.b : ggggcattatggtgx
PST01_0064_F10.b :
OVRT1_0076_E05.b : tt
OVRT1_0126_H09.b : nt
CLNT1_0113_G10.b : n
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b : nn
OVRT1_0045_G02.b : n
OVRT1_0082_A12.b : ngga
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b : ng
OVRT1_0036_C01.b : ng
OVRT1_0078_B06.b : ngggatcga
OVRT1_0082_B08.b : ngg
LNG01_0034_G12.b : cgccttttgg
OVRT1_0040_E06.b : ng
LNG01_0046_F07.b : tttttagttgattatatgatacgt
TCH01_0046_A02.b : gggact
OVRT1_0038_A03.b : gg
OVRT1_0069_A11.b : nntttt
OVRT1_0036_C05.b : ng
TCH01_0028_A06.b : nttttc
OVRT1_0041_A04.b : ngg
OVRT1_0023_B04.b :
OVRT1_0042_E01.b : nggg
OVRT1_0036_G06.b : ng
OVRT1_0035_F07.b : nngg
OVRT1_0074_C11.b : ngggact
OVRT1_0084_H08.b : ngg
TCH01_0023_B08.b : nccgctagtgacttgacxxxxx
TCH01_0039_H04.b : nnng
TCH01_0087_F04.b : nnnggctt
TCH01_0011_H03.b : nnnnng
LNG01_0103_C05.b : nnnttag
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b : gg
TCH01_0093_B10.b : ttttg
TCH01_0093_E09.b :
CLNT1_0074_H09.b : nggt
OVRT1_0033_A09.b : tg
TCH01_0085_H10.b : ngggttg
TCH01_0039_E03.b : nnnggc
LNG01_0098_D07.b : nnnnn
THY01_0040_A10.b : xxxxxxxxxxxxxx
OVRT1_0106_F03.b :
OVRT1_0064_E08.b : nnc
OVRM1_0204_C10.b :
UTR01_0075_C07.b : gttgaactat
OVRM1_0206_H10.b :
OVRT1_0143_G01.b : nnngtc
OVRM1_0154_A10.b :
OVRT1_0141_A10.b : nnncccttcnnnnnnnn
OVRT1_0132_E08.b : aaccccccnnnnnnc
OVRT1_0136_B01.b : gctccctnnnnc
OVRT1_0147_B03.b : nnn
OVRT1_0143_E01.b : accccttnnnnncc
LNG01_0035_A11.b : catxxxxxxxxxxxxxx
LNG01_0080_G12.b : nnnggtggctg
TCH01_0033_G03.b : nggccttggcact
OVRT1_0008_G02.b : gg
TCH01_0012_C01.b : nnnnggatag
OVRM1_0059_H02.b :
OVRT1_0028_E11.b : g
CLNT1_0055_E08.b :
OVRT1_0141_A09.b : nnnccgttccnnnnnn
OVRT1_0003_C10.b : g
OVRT1_0147_C10.b : nn
OVRT1_0002_A05.b : gg
SMG01_0092_C12.b :
OVRT1_0054_D09.b : ngg
HTMT1_0044_C07.b : ttttggcaggtagaggccgtx
CLNT1_0064_G09.b :
UTR01_0045_A04.b : gxxxxxxxxx
CLNT1_0061_A10.b : gg
OVRT1_0085_E08.b : nggt
LNG01_0042_H03.b : gggctgtnctcgcatagtgxx
CLNT1_0064_F02.b :
OVRT1_0042_D12.b : nggg
CLNT1_0096_D04.b : ng
OVRT1_0058_D02.b : ccggg
LNG01_0035_H02.b : gttttgggtgacta
OVRT1_0073_E02.b : ngg
OVRT1_0073_A09.b : nggga
MLN01_0069_C05.b : gggatag
LNG01_0034_F12.b : gcattatggtgxxxx
OVRT1_0043_F11.b : gg
CLNT1_0051_H02.b : ngggc
OVRT1_0035_E03.b : nn
TCH01_0037_B04.b : nnnnggcatag
LNG01_0091_D10.b : nggggtgct
UTR01_0043_B07.b : gggggcxxxxxxx
UTR01_0060_D01.b : ggcxxxxxxxxxxx
MLN01_0101_H05.b : ncctgctgt
CLNT1_0066_E04.b :
OVRT1_0048_F02.b : g
CLNT1_0064_E03.b :
OVRT1_0031_H01.b : ntg
CLNT1_0014_A11.b : a
UTR01_0052_H06.b : ctttttagtgcacxxx
CLNT1_0074_E03.b : tggg
CLNT1_0064_B01.b : g
CLNT1_0062_A10.b : gg
LNG01_0028_F08.b : ctxxxxxxxxxxxx
CLNT1_0007_E05.b : ng
OVRT1_0022_E11.b : ngg
LNG01_0002_H02.b : ggcatttcgtgxxx
TCH01_0027_F05.b : nnnggcttg
ITT01_0012_E04.b :
PST01_0044_E03.b :
OVRT1_0005_G05.b : ngg
KDN01_0005_A09.b :
KDN01_0096_D09.b :
KDN01_0091_A05.b :
PST01_0042_G06.b :
KDN01_0012_B08.b :
KDN01_0035_D10.b :
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b :
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b : nngg
OVRT1_0019_D07.b : ntttc
CLNT1_0150_E07.b :
OVRT1_0100_A06.b : nn
OVRT1_0072_D05.b :
OVR01_0090_D11.b : tttggctag
OVRT1_0111_F01.b :
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
20110601C-012214 : AATGTTCTTCTAAATAAGTAGTAGAAGAAAAGAAATAGATGTGAGAGGAAGAAGTCCTTT
---------+---------+---------+---------+---------+---------+ 103
CLNT1_0151_F03.b : AATGTTCTTCTAAATAAGTAGTAGAAGAAAAGAAATAGATGTGAGAGGAAGAAGTCCTTT
PST01_0033_B11.b : cgc
TES01_0020_A03.b : g
OVRT1_0100_C01.b : actacttctgcgtacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0001_D08.b : ncctgcggt
OVRT1_0044_E01.b : ctccgttctgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0040_A03.b : agc
OVRT1_0149_B12.b : ttangcgtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0112_B01.b : nnaactgc
CLNT1_0096_B04.b : gactcgtttgcgccggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0025_C10.b : gatccttctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0042_A08.b : nnnnctcgc
KDN01_0016_C12.b : cgc
CLNT1_0022_F10.b : ntttctattgcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0093_D03.b : nnncctgcg
PST01_0054_E06.b : ctcgc
PST01_0098_A12.b : tcgc
KDN01_0028_A09.b : naatcgc
PST01_0074_D09.b : cgc
LVR01_0057_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0022_A06.b : ggtactcgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0079_F03.b : nttcgc
PST01_0039_F12.b : ctggc
KDN01_0080_C12.b : tggc
PST01_0080_F02.b : nccggc
KDN01_0028_B03.b : nnnccccgc
KDN01_0008_C02.b : nttttggtcgc
CLNT1_0066_C04.b : nccttcttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0128_B05.b : ncttttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0124_B12.b : natccttctgcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0132_A05.b : nnccgtttgcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0041_H08.b :
OVRT1_0001_E06.b : ctccctctgctgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0004_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggcaggcccgcag
CLNT1_0041_F04.b : tctgctgtcgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0041_G09.b : ctcctttangcgtangagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0001_G07.b : ncctgcgagtagacgccgtagtaxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0043_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0064_F10.b : gc
OVRT1_0076_E05.b : ggatgcatttgctgcatgatgcaagactgttcatatcggaxxxxxxxxxxxxxxxxxxxx
OVRT1_0126_H09.b : tttcgtttgctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0113_G10.b : cctctttcagcgtaagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0146_A11.b : ntctcgtctgcgttggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0101_A03.b : catcgcggt
CLNT1_0115_D01.b : aatctttctgcgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0045_G02.b : actccgtcatgcgtacgatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0082_A12.b : ctccatagtgcgcatgagtgtgacactgcttcatttcggcggtcagccccaggccctgtt
OVRT1_0098_F02.b : cccttctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0045_B04.b : aaaccgtctgctgtcgnatgttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0087_B04.b : gaatcgtctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0036_C01.b : aactctttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0078_B06.b : tcctctgtcatgaggacggcgaccatttcatttcgcgcgtgacgcccaggcaccgtggat
OVRT1_0082_B08.b : accactcggcgccacgagtgtgctacagctcgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0034_G12.b : ggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0040_E06.b : gactcgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0046_F07.b : gacttataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0046_A02.b : tgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0038_A03.b : actcgttggctgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0069_A11.b : cgcactancgcgtgattaccacgagagggactatttcgggggnnntcctgaaggccngtt
OVRT1_0036_C05.b : gactcgtctgcgccggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0028_A06.b : tagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0041_A04.b : cttcgttctgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0023_B04.b : nnnaactcgtttgcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0042_E01.b : actcctctggcgccggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0036_G06.b : gactcgtttgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0035_F07.b : tcttcgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0074_C11.b : ccgttttggctgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0084_H08.b : gactcttcggctgcagagtgcgctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0023_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtc
TCH01_0039_H04.b : tgataggatataaacagtttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0087_F04.b : gtgactttacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0011_H03.b : ctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0103_C05.b : ctggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0070_D01.b : ntttcatg
OVRT1_0123_G01.b : ccttctgctgtggagtgttctttgctcxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0128_D11.b : actccttctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0093_B10.b : gctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0093_E09.b : gtttggacttatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0074_H09.b : tctccttctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0033_A09.b : gactccgtctgctgccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0085_H10.b : ttgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0039_E03.b : ttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0098_D07.b : aagctggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0040_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0106_F03.b : nccgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0064_E08.b : cctcgtctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0204_C10.b : gagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0075_C07.b : taacaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0206_H10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0143_G01.b : ttcgttctgctgtcagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0154_A10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0141_A10.b : cccgtttgcgntcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0132_E08.b : ctccttcgcgcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0136_B01.b : catctcttgcgctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0147_B03.b : tttcgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0143_E01.b : ctcgtttagcgntacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0035_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0080_G12.b : gtacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0033_G03.b : tacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0008_G02.b : atcctctctgcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0012_C01.b : tactaagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0059_H02.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0028_E11.b : actccttctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0055_E08.b : agtttagctgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0141_A09.b : nnccgtttgcgttacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0003_C10.b : atcctctctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0147_C10.b : ccccgttcngcgtcagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0002_A05.b : actcgttttgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0092_C12.b : nttaattgactaaagcagcggntcgxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0054_D09.b : gcttctcttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0044_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgagggccccttgggaggcccgcag
CLNT1_0064_G09.b : attcttctgcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0045_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0061_A10.b : actccgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0085_E08.b : ctcattcatcttgacggttgcccctcacctcaaaacggggggattccccnggcccggttt
LNG01_0042_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0064_F02.b : ntacttctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0042_D12.b : ctgctttcggctgcagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0096_D04.b : gactcgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0058_D02.b : actcgtcttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0035_H02.b : ctcagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0073_E02.b : gactctattgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0073_A09.b : ctcgtctctgcgtcagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0069_C05.b : tataagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0034_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0043_F11.b : actcgtcttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0051_H02.b : actcgttctgcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0035_E03.b : ccccgtctgcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0037_B04.b : tactaagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0091_D10.b : ggccttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0043_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0060_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0101_H05.b : gacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0066_E04.b : nccttctgctgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0048_F02.b : actacgtctgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0064_E03.b : actcttctgcggcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0031_H01.b : acttacgtctgcgttacgatgttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0014_A11.b : ctccgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0052_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0074_E03.b : acccgtctgnctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0064_B01.b : aatccgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0062_A10.b : gttccgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0028_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0007_E05.b : ggctcgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0022_E11.b : actcctcttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0002_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0027_F05.b : tgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0012_E04.b : gtgtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0044_E03.b : taac
OVRT1_0005_G05.b : actcgttcagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0005_A09.b : tcgc
KDN01_0096_D09.b : nnccctgc
KDN01_0091_A05.b : nnnnncctg
PST01_0042_G06.b : nctcac
KDN01_0012_B08.b : nnnccgctgc
KDN01_0035_D10.b : ttttccggc
TES01_0056_A11.b : ncccg
OVRT1_0123_D02.b : acgctttttgcgtaagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0100_F07.b : ggggcttcttgcgcacgatgttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0059_H04.b : nttttctgc
PST01_0072_A08.b : ncctg
PST01_0099_B11.b : nngtggc
OVRT1_0120_H01.b : taccgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0093_E08.b : aacactatctgctcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0019_D07.b : cgcacttcgggatgatctgccggagagtgttatattttggggnnntntcnngnnantgnt
CLNT1_0150_E07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
OVRT1_0100_A06.b : nttcgctcctcttatgattatccgccagggctatttcgtgggggnnnntgggnnnntgnt
OVRT1_0072_D05.b : nggtacgactancgcatgattatcaggcagctctanatcgtggggnnnnntnnggnnn
OVR01_0090_D11.b : tactattacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0111_F01.b :
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : ctagatcatgcgtgcttctcttctaagcatnatgatac
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
20110601C-012214 : TATTACCTTGAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
---------+---------+---------+---------+---------+---------+ 163
CLNT1_0151_F03.b : TATTACCTGCAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
PST01_0033_B11.b : gttGGCTCTGGATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
TES01_0020_A03.b : ttggctacTGGATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0100_C01.b : xxxxxcctTTAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
TES01_0001_D08.b : ggctctggTGGATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0044_E01.b : xxxxccttGGAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCTTTTATGGAGCGGC
TES01_0040_A03.b : gttggctcTGGATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0149_B12.b : xxxxxxxxTCAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
TES01_0112_B01.b : tgtggctcTGGATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
CLNT1_0096_B04.b : xxxxccctGAAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0025_C10.b : xxxxctttGGAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCTTTATGGAGCGGC
PST01_0042_A08.b : tgtggctcTGGATCGCGCTCC*GCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
KDN01_0016_C12.b : gttggctcTGGATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGCC
CLNT1_0022_F10.b : xxxxctttGGAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
KDN01_0093_D03.b : gtggctacTGGATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
PST01_0054_E06.b : gttggctcTGGATCGCGCTCCGGCTGCCGTCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
PST01_0098_A12.b : ggtggctaTGGATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCCCC
KDN01_0028_A09.b : gttggctcTGGATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
PST01_0074_D09.b : gttggctcTGGATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
LVR01_0057_C12.b : xxxxxxxxGGAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0022_A06.b : xxxxxxcaTTAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
KDN01_0079_F03.b : gttggctcTGGATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGCC
PST01_0039_F12.b : gttggctcTGGATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
KDN01_0080_C12.b : gttggctcTGGATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
PST01_0080_F02.b : tgtggctcTGGATCGCGCTC*GGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
KDN01_0028_B03.b : tgtggctaTGGATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
KDN01_0008_C02.b : gttggctcTGGATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
CLNT1_0066_C04.b : xxxxcccttGAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCTTTTTGGAGCGGC
OVRT1_0128_B05.b : xxxxxxcgtTTATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0124_B12.b : xxxxxxxxcCAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0132_A05.b : xxxxxxxxtGAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCCTTATGGAGCGGC
PST01_0041_H08.b : gttggctctGGATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGT
OVRT1_0001_E06.b : xxxxxxttgAAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0004_A04.b : gctgccgctCAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
CLNT1_0041_F04.b : xxxxxxxxtGAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0041_G09.b : xxxxxccttAAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
SPLT1_0001_G07.b : xxxxxxxxxGAATCGCGCTCCCCCTTTCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVR01_0043_B12.b : ccggtttacGAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCCCCCCGTTATGGAGCGGC
PST01_0064_F10.b : gttggctacGGATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0076_E05.b : xxxxctctaGAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCTTTATGGAGCGGC
OVRT1_0126_H09.b : xxxxxxcggtAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
CLNT1_0113_G10.b : xxxxxcctttTATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGCTTTGGAGCGGC
CLNT1_0146_A11.b : xxxxxxxcctTATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
TES01_0101_A03.b : ggctctggtaGATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
CLNT1_0115_D01.b : xxxxxxxxxtATTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0045_G02.b : xxxxxxxcgtTATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0082_A12.b : tacctcccatATTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0098_F02.b : xxxxxxxxttAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0045_B04.b : xxxxxxxxxcGATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0087_B04.b : xxxxxxxxxtAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0036_C01.b : xxxxxxxxxtAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0078_B06.b : accctcgagaAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0082_B08.b : xxxxxxcggtTATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
LNG01_0034_G12.b : xxxxxxxxxxAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0040_E06.b : xxxxxcctttAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
LNG01_0046_F07.b : xxxxxxxxxxAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
TCH01_0046_A02.b : xxxxxxxxxxAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0038_A03.b : xxxxxxxxxtTATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGCTTTGGAGCGGC
OVRT1_0069_A11.b : ggcctcccttTTTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAgcggc
OVRT1_0036_C05.b : xxxxxxxxxtAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
TCH01_0028_A06.b : xxxxxxxxxxTATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0041_A04.b : xxxxxxxxxtAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0023_B04.b : xxxxxxxxxcTATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0042_E01.b : xxxxxxxxxxTATCGCGCTCCGGCTGCCGCCCTGAGCCCTGCGCCCCTTTATGGAGCGGC
OVRT1_0036_G06.b : xxxxxxxxxtTATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0035_F07.b : xxxxxxxcgcTATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0074_C11.b : xxxxxcatggATTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCCTTATGGAGCGGC
OVRT1_0084_H08.b : xxxxxxxcgtTATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
TCH01_0023_B08.b : agccttgttgAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
TCH01_0039_H04.b : xxxxxxxxxxAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
TCH01_0087_F04.b : xxxxxxxxxxAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
TCH01_0011_H03.b : xxxxxxxxxxTATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
LNG01_0103_C05.b : xxxxxxxxxxAATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
TES01_0070_D01.b : ctgtggctctnATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0123_G01.b : xxxxxxxxxccATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
CLNT1_0128_D11.b : xxxxxxxxcgtTTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
TCH01_0093_B10.b : xxxxxxxxxxxATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
TCH01_0093_E09.b : xxxxxxxxxxxATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
CLNT1_0074_H09.b : xxxxxxxxxxxTTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0033_A09.b : xxxxxxxxxxxTTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
TCH01_0085_H10.b : xxxxxxxxxxxATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
TCH01_0039_E03.b : xxxxxxxxxxxATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
LNG01_0098_D07.b : xxxxxxxxxxxATCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
THY01_0040_A10.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0106_F03.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0064_E08.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAACCCCGCGCCCCGTTATGGAGCGGC
OVRM1_0204_C10.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCACGCGCCCCGTTATGGAGCGGC
UTR01_0075_C07.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRM1_0206_H10.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCACGCGCCCCGTTATGGAGCGGC
OVRT1_0143_G01.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRM1_0154_A10.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCACGCGCCCCGTTATGGAGCGGC
OVRT1_0141_A10.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0132_E08.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0136_B01.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0147_B03.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0143_E01.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
LNG01_0035_A11.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
LNG01_0080_G12.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
TCH01_0033_G03.b : xxxxxxxxxtggTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0008_G02.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCTTCGTTATGGAGCGGC
TCH01_0012_C01.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRM1_0059_H02.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCACGCGCCCCGTTATGGAGCGGC
OVRT1_0028_E11.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCTGTTATGGAGCGGC
CLNT1_0055_E08.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0141_A09.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0003_C10.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0147_C10.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0002_A05.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
SMG01_0092_C12.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0054_D09.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
HTMT1_0044_C07.b : gctgccgctcaaTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
CLNT1_0064_G09.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
UTR01_0045_A04.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
CLNT1_0061_A10.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0085_E08.b : ggcctcccatttTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
LNG01_0042_H03.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
CLNT1_0064_F02.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0042_D12.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
CLNT1_0096_D04.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCTTTATGGAGCGGC
OVRT1_0058_D02.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCTCGTTATGGAGCGGC
LNG01_0035_H02.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0073_E02.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0073_A09.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
MLN01_0069_C05.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
LNG01_0034_F12.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0043_F11.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
CLNT1_0051_H02.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0035_E03.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
TCH01_0037_B04.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
LNG01_0091_D10.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
UTR01_0043_B07.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
UTR01_0060_D01.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
MLN01_0101_H05.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
CLNT1_0066_E04.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0048_F02.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
CLNT1_0064_E03.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0031_H01.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
CLNT1_0014_A11.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
UTR01_0052_H06.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
CLNT1_0074_E03.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
CLNT1_0064_B01.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
CLNT1_0062_A10.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
LNG01_0028_F08.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
CLNT1_0007_E05.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0022_E11.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
LNG01_0002_H02.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
TCH01_0027_F05.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
ITT01_0012_E04.b : xxxxxxxxxxxxTCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
PST01_0044_E03.b : gttggctactggaCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0005_G05.b : xcccctaagagggCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCTTTATATGGAGCGGC
KDN01_0005_A09.b : ggtggctactggaCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
KDN01_0096_D09.b : ggtgtgctctggaCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
KDN01_0091_A05.b : cggtggctctggaCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
PST01_0042_G06.b : gttggctatggaaCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCCGC
KDN01_0012_B08.b : gttggctactggaCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
KDN01_0035_D10.b : tgtggctactggaCGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
TES01_0056_A11.b : cggtggctctgaacGCGCTCCG*CTGCCGCCCTGAGCCCCGCGCCCCGTTGTGGAGCGGC
OVRT1_0123_D02.b : xxxxxxxxxxxtctGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0100_F07.b : xxxxccctttaatgGCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
TES01_0059_H04.b : gctggctactggacGCGCTCC*GCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
PST01_0072_A08.b : cgttggctctggatGCGCT*CGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
PST01_0099_B11.b : ggtggctactggacGCGCTC*GGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGCC
OVRT1_0120_H01.b : xxxxxxttgccattaCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVRT1_0093_E08.b : xxxxccttttatacaCGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCTTTATGGAGCGGC
OVRT1_0019_D07.b : ggccccctttaatgaCGCTCCGGCGGCCGCCCTGAGCCCCGCGCCCCTTTATGGAGCGGC
CLNT1_0150_E07.b : xxxxxxxxccaatttaGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGCTATCGATCGGC
OVRT1_0100_A06.b : ggnctcccctaataggGCTCCGGNTGCCGCCCTGAGCCCCGCGCCCCCTTTTGGAGCGGC
OVRT1_0072_D05.b : ngttggnctccatctaGCTCCGGCTGCCGCCCTGAGCCCCGCGCCCCGTTATGGAGCGGC
OVR01_0090_D11.b : xxxxxxxxxxxcaccccctggtggggaacgtgttgcggCCGCGCCCCGATATGGACCGGC
OVRT1_0111_F01.b :
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : agagcgaggggcgggtacatcctcaaactctattagtgctctcggccgagaggagaaaaa
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
20110601C-012214 : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
---------+---------+---------+---------+---------+---------+ 220
CLNT1_0151_F03.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
PST01_0033_B11.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
TES01_0020_A03.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0100_C01.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
TES01_0001_D08.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0044_E01.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
TES01_0040_A03.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0149_B12.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
TES01_0112_B01.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
CLNT1_0096_B04.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0025_C10.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
PST01_0042_A08.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
KDN01_0016_C12.b : TGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
CLNT1_0022_F10.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
KDN01_0093_D03.b : CGCT**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
PST01_0054_E06.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
PST01_0098_A12.b : CTCA**GAGGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCCGCTCCTGCTGCTGCCCC
KDN01_0028_A09.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
PST01_0074_D09.b : CGCTCTGCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
LVR01_0057_C12.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0022_A06.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
KDN01_0079_F03.b : TTCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
PST01_0039_F12.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
KDN01_0080_C12.b : CGCC**TCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
PST01_0080_F02.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
KDN01_0028_B03.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
KDN01_0008_C02.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
CLNT1_0066_C04.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0128_B05.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0124_B12.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0132_A05.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
PST01_0041_H08.b : TGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0001_E06.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0004_A04.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
CLNT1_0041_F04.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0041_G09.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
SPLT1_0001_G07.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVR01_0043_B12.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
PST01_0064_F10.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0076_E05.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0126_H09.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
CLNT1_0113_G10.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
CLNT1_0146_A11.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
TES01_0101_A03.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
CLNT1_0115_D01.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0045_G02.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0082_A12.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0098_F02.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0045_B04.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0087_B04.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0036_C01.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0078_B06.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0082_B08.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
LNG01_0034_G12.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0040_E06.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
LNG01_0046_F07.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
TCH01_0046_A02.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0038_A03.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0069_A11.b : cgcc**gctgcccgccctgctgctgggcgccgccgcggctgctgctcctgctgctgcCCC
OVRT1_0036_C05.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
TCH01_0028_A06.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0041_A04.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0023_B04.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0042_E01.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0036_G06.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0035_F07.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0074_C11.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0084_H08.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
TCH01_0023_B08.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
TCH01_0039_H04.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
TCH01_0087_F04.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
TCH01_0011_H03.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
LNG01_0103_C05.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCAGCTGCCCC
TES01_0070_D01.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0123_G01.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
CLNT1_0128_D11.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
TCH01_0093_B10.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
TCH01_0093_E09.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
CLNT1_0074_H09.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0033_A09.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
TCH01_0085_H10.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
TCH01_0039_E03.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
LNG01_0098_D07.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
THY01_0040_A10.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0106_F03.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0064_E08.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRM1_0204_C10.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
UTR01_0075_C07.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRM1_0206_H10.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0143_G01.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRM1_0154_A10.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0141_A10.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0132_E08.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCC*CTGCTGCCCC
OVRT1_0136_B01.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0147_B03.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0143_E01.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCACCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
LNG01_0035_A11.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
LNG01_0080_G12.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
TCH01_0033_G03.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0008_G02.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
TCH01_0012_C01.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRM1_0059_H02.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0028_E11.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCAGCCCC
CLNT1_0055_E08.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0141_A09.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0003_C10.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0147_C10.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCA*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0002_A05.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
SMG01_0092_C12.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0054_D09.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
HTMT1_0044_C07.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
CLNT1_0064_G09.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
UTR01_0045_A04.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
CLNT1_0061_A10.b : CGCC**GCTGCCCGCCCCGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0085_E08.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
LNG01_0042_H03.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
CLNT1_0064_F02.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0042_D12.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
CLNT1_0096_D04.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCCGCTCCTGCTGCTGCCCC
OVRT1_0058_D02.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
LNG01_0035_H02.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0073_E02.b : CGCC**GCTGTCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0073_A09.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
MLN01_0069_C05.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
LNG01_0034_F12.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0043_F11.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
CLNT1_0051_H02.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0035_E03.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
TCH01_0037_B04.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
LNG01_0091_D10.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
UTR01_0043_B07.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
UTR01_0060_D01.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
MLN01_0101_H05.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
CLNT1_0066_E04.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0048_F02.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
CLNT1_0064_E03.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCCGCTCCTGCTGCTGCCCC
OVRT1_0031_H01.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
CLNT1_0014_A11.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
UTR01_0052_H06.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
CLNT1_0074_E03.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
CLNT1_0064_B01.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
CLNT1_0062_A10.b : CGCC**GCTGCCCGCCCCGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
LNG01_0028_F08.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
CLNT1_0007_E05.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0022_E11.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
LNG01_0002_H02.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
TCH01_0027_F05.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
ITT01_0012_E04.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
PST01_0044_E03.b : CGCC**TTTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0005_G05.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
KDN01_0005_A09.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
KDN01_0096_D09.b : CGTC**ACTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
KDN01_0091_A05.b : CGCT**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
PST01_0042_G06.b : TGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
KDN01_0012_B08.b : CCCT**AATGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCCCTTGCTGCTGCCCC
KDN01_0035_D10.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
TES01_0056_A11.b : CGCC**TCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0123_D02.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0100_F07.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
TES01_0059_H04.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
PST01_0072_A08.b : CCCC**TTTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
PST01_0099_B11.b : CTCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0120_H01.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0093_E08.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0019_D07.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
CLNT1_0150_E07.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0100_A06.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0072_D05.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVR01_0090_D11.b : CGCC**GCTGCCCGCCCTGCTGCTGGGCGCCGCCG*GGCTGCTGCTCCTGCTGCTGCCCC
OVRT1_0111_F01.b :
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : aaacttaacaccttttcgtgtacaaaaaaaacacagaaaacacctctcgggggggaggtc
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
20110601C-012214 : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
---------+---------+---------+---------+---------+---------+ 280
CLNT1_0151_F03.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
PST01_0033_B11.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
TES01_0020_A03.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0100_C01.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
TES01_0001_D08.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0044_E01.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
TES01_0040_A03.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0149_B12.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
TES01_0112_B01.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
CLNT1_0096_B04.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0025_C10.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
PST01_0042_A08.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
KDN01_0016_C12.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCTC
CLNT1_0022_F10.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
KDN01_0093_D03.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
PST01_0054_E06.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
PST01_0098_A12.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
KDN01_0028_A09.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
PST01_0074_D09.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
LVR01_0057_C12.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0022_A06.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
KDN01_0079_F03.b : TCTCCTCTCCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
PST01_0039_F12.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
KDN01_0080_C12.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
PST01_0080_F02.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
KDN01_0028_B03.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
KDN01_0008_C02.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
CLNT1_0066_C04.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0128_B05.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0124_B12.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0132_A05.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
PST01_0041_H08.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0001_E06.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCTAGCCGGCCACCTGCCCGCCCC
OVRT1_0004_A04.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCGCCTGCCCGCCCC
CLNT1_0041_F04.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0041_G09.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
SPLT1_0001_G07.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVR01_0043_B12.b : TCTCCTCTTCCTCCTCTTCGGACGCCTCCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
PST01_0064_F10.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0076_E05.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0126_H09.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
CLNT1_0113_G10.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
CLNT1_0146_A11.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
TES01_0101_A03.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
CLNT1_0115_D01.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0045_G02.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0082_A12.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0098_F02.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACTTGCCCGCCCC
OVRT1_0045_B04.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0087_B04.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0036_C01.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0078_B06.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0082_B08.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
LNG01_0034_G12.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0040_E06.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
LNG01_0046_F07.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
TCH01_0046_A02.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0038_A03.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0069_A11.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0036_C05.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
TCH01_0028_A06.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0041_A04.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0023_B04.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0042_E01.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0036_G06.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0035_F07.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0074_C11.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0084_H08.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
TCH01_0023_B08.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
TCH01_0039_H04.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
TCH01_0087_F04.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
TCH01_0011_H03.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
LNG01_0103_C05.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
TES01_0070_D01.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0123_G01.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
CLNT1_0128_D11.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
TCH01_0093_B10.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
TCH01_0093_E09.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
CLNT1_0074_H09.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0033_A09.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
TCH01_0085_H10.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
TCH01_0039_E03.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
LNG01_0098_D07.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
THY01_0040_A10.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0106_F03.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0064_E08.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRM1_0204_C10.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGTGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
UTR01_0075_C07.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRM1_0206_H10.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGTGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0143_G01.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRM1_0154_A10.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGTGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0141_A10.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0132_E08.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0136_B01.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0147_B03.b : TCTCCTCTTCCCCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0143_E01.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
LNG01_0035_A11.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
LNG01_0080_G12.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
TCH01_0033_G03.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0008_G02.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
TCH01_0012_C01.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRM1_0059_H02.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGTGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0028_E11.b : TCTCCTCTTCCTCCTCTTCGGACTCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
CLNT1_0055_E08.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0141_A09.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0003_C10.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0147_C10.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0002_A05.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
SMG01_0092_C12.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0054_D09.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
HTMT1_0044_C07.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGACACCTGCCCGCCCC
CLNT1_0064_G09.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
UTR01_0045_A04.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
CLNT1_0061_A10.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0085_E08.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCTAGCCGGCCACCTGCCCGCCCC
LNG01_0042_H03.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
CLNT1_0064_F02.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0042_D12.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
CLNT1_0096_D04.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0058_D02.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
LNG01_0035_H02.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0073_E02.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0073_A09.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
MLN01_0069_C05.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
LNG01_0034_F12.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACATGCCCGCCCC
OVRT1_0043_F11.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
CLNT1_0051_H02.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0035_E03.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
TCH01_0037_B04.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
LNG01_0091_D10.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
UTR01_0043_B07.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
UTR01_0060_D01.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
MLN01_0101_H05.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
CLNT1_0066_E04.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0048_F02.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
CLNT1_0064_E03.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0031_H01.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
CLNT1_0014_A11.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
UTR01_0052_H06.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
CLNT1_0074_E03.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
CLNT1_0064_B01.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
CLNT1_0062_A10.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
LNG01_0028_F08.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
CLNT1_0007_E05.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0022_E11.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
LNG01_0002_H02.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
TCH01_0027_F05.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
ITT01_0012_E04.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
PST01_0044_E03.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0005_G05.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
KDN01_0005_A09.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
KDN01_0096_D09.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
KDN01_0091_A05.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
PST01_0042_G06.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
KDN01_0012_B08.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTgcccgcccc
KDN01_0035_D10.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
TES01_0056_A11.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0123_D02.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0100_F07.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
TES01_0059_H04.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
PST01_0072_A08.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
PST01_0099_B11.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0120_H01.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0093_E08.b : TCTCCTCTTCATCCTCTTCGGACGCCTGCGGCCCCTGCTAGCAGGCCACCTGCCCGCCCC
OVRT1_0019_D07.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
CLNT1_0150_E07.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0100_A06.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0072_D05.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVR01_0090_D11.b : TCTCCTCTTCCTCCTCTTCGGACGCCTGCGGCCCCTGCGAGCCGGCCACCTGCCCGCCCC
OVRT1_0111_F01.b :
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : ggatcggcaacagattttctttagtaagggtaacagacacatatccaaattgttttgtgg
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
20110601C-012214 : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
---------+---------+---------+---------+---------+---------+ 340
CLNT1_0151_F03.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
PST01_0033_B11.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
TES01_0020_A03.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0100_C01.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
TES01_0001_D08.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0044_E01.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
TES01_0040_A03.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0149_B12.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
TES01_0112_B01.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
CLNT1_0096_B04.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0025_C10.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
PST01_0042_A08.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
KDN01_0016_C12.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
CLNT1_0022_F10.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
KDN01_0093_D03.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
PST01_0054_E06.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
PST01_0098_A12.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
KDN01_0028_A09.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
PST01_0074_D09.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCAGCTGCCCGGTGT
LVR01_0057_C12.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0022_A06.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
KDN01_0079_F03.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
PST01_0039_F12.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
KDN01_0080_C12.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
PST01_0080_F02.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
KDN01_0028_B03.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
KDN01_0008_C02.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
CLNT1_0066_C04.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0128_B05.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0124_B12.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0132_A05.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
PST01_0041_H08.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0001_E06.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0004_A04.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
CLNT1_0041_F04.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0041_G09.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
SPLT1_0001_G07.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCACGACGCGTGCGGCTGCTGCCCGGTGT
OVR01_0043_B12.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
PST01_0064_F10.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0076_E05.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0126_H09.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
CLNT1_0113_G10.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
CLNT1_0146_A11.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
TES01_0101_A03.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
CLNT1_0115_D01.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0045_G02.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0082_A12.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0098_F02.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0045_B04.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0087_B04.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0036_C01.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0078_B06.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTACTGCCCGGTGT
OVRT1_0082_B08.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
LNG01_0034_G12.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0040_E06.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
LNG01_0046_F07.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
TCH01_0046_A02.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0038_A03.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0069_A11.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0036_C05.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
TCH01_0028_A06.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0041_A04.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0023_B04.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0042_E01.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0036_G06.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0035_F07.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0074_C11.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0084_H08.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
TCH01_0023_B08.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
TCH01_0039_H04.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
TCH01_0087_F04.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
TCH01_0011_H03.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
LNG01_0103_C05.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
TES01_0070_D01.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0123_G01.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
CLNT1_0128_D11.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
TCH01_0093_B10.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCTACGCGTGCGGCTGCTGCCCTGTGT
TCH01_0093_E09.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
CLNT1_0074_H09.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0033_A09.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
TCH01_0085_H10.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
TCH01_0039_E03.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
LNG01_0098_D07.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
THY01_0040_A10.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0106_F03.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0064_E08.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRM1_0204_C10.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
UTR01_0075_C07.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRM1_0206_H10.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0143_G01.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRM1_0154_A10.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0141_A10.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0132_E08.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0136_B01.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0147_B03.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0143_E01.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
LNG01_0035_A11.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
LNG01_0080_G12.b : TGTCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
TCH01_0033_G03.b : TGCCCCCGCGGGGCTGCCCGCTGGGCTAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0008_G02.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
TCH01_0012_C01.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRM1_0059_H02.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0028_E11.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCCGCTGCTGCCCGGTGT
CLNT1_0055_E08.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0141_A09.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0003_C10.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0147_C10.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0002_A05.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
SMG01_0092_C12.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTAT
OVRT1_0054_D09.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
HTMT1_0044_C07.b : AGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCTCGACGCGTGCGGCTGCTGCCCGGTGT
CLNT1_0064_G09.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
UTR01_0045_A04.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
CLNT1_0061_A10.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0085_E08.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
LNG01_0042_H03.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
CLNT1_0064_F02.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0042_D12.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
CLNT1_0096_D04.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0058_D02.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
LNG01_0035_H02.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0073_E02.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0073_A09.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
MLN01_0069_C05.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
LNG01_0034_F12.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0043_F11.b : TGCCCCCGCGGGGCTGCCCGCTGGGTGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
CLNT1_0051_H02.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0035_E03.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
TCH01_0037_B04.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
LNG01_0091_D10.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
UTR01_0043_B07.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
UTR01_0060_D01.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
MLN01_0101_H05.b : TGCCCCCGCGGGACTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
CLNT1_0066_E04.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0048_F02.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
CLNT1_0064_E03.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0031_H01.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
CLNT1_0014_A11.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
UTR01_0052_H06.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
CLNT1_0074_E03.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
CLNT1_0064_B01.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
CLNT1_0062_A10.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
LNG01_0028_F08.b : TGCCCCCGCGGGGCTGCCCGCTGGGTGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
CLNT1_0007_E05.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0022_E11.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
LNG01_0002_H02.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
TCH01_0027_F05.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
ITT01_0012_E04.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
PST01_0044_E03.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0005_G05.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
KDN01_0005_A09.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
KDN01_0096_D09.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
KDN01_0091_A05.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
PST01_0042_G06.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
KDN01_0012_B08.b : cgcccccgcggggcTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
KDN01_0035_D10.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
TES01_0056_A11.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0123_D02.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0100_F07.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
TES01_0059_H04.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTgcccggcgt
PST01_0072_A08.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
PST01_0099_B11.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0120_H01.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0093_E08.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCTCGACGCGTGCGACTGCTGCCCGGTGT
OVRT1_0019_D07.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
CLNT1_0150_E07.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0100_A06.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVRT1_0072_D05.b : TGCCCCCGCGGGGCTGCCCGCTGGGCGAGACCCGCGACGCGTGCGGCTGCTGCCCGGTGT
OVR01_0090_D11.b : TGCCCCCGCGGGGCTGCCTGCTGGGCGAGACCCCCGACGCGTGCTGCTGCTGCCCGGTGT
OVRT1_0111_F01.b :
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : tgccgtataagctttcacagccgcttcggacccctcttttccttattccttattcattaa
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
20110601C-012214 : GCGCGCGCGGCGAGGGCGAGCCGTGCGGGGGCGGCG*GCGCCGGCAGGGGGCACTGCGCG
---------+---------+---------+---------+---------+---------+ 399
CLNT1_0151_F03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
PST01_0033_B11.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TES01_0020_A03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0100_C01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TES01_0001_D08.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0044_E01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TES01_0040_A03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0149_B12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TES01_0112_B01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0096_B04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0025_C10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
PST01_0042_A08.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0016_C12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0022_F10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0093_D03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
PST01_0054_E06.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
PST01_0098_A12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0028_A09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
PST01_0074_D09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
LVR01_0057_C12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0022_A06.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0079_F03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
PST01_0039_F12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0080_C12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
PST01_0080_F02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0028_B03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0008_C02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0066_C04.b : GCGCGCGCGGCGAGGGCGAGCCGTGCAGGGGCGGCG*GCGCCGGCAGGGGGCACTGCGCG
OVRT1_0128_B05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0124_B12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0132_A05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
PST01_0041_H08.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRT1_0001_E06.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0004_A04.b : GCGCGCGCGGCGAGGGCGATCCGTGCGGGGACGGCG*GCGCCGGCGGGGGGTACTGCGCG
CLNT1_0041_F04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0041_G09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCACG
SPLT1_0001_G07.b : GCGCGCGCGGCGAGGGCGAGCCGTGCGGGGGCGGCG*GCGCCAGCAGGGGGCACTGCGCG
OVR01_0043_B12.b : GCGCGCGCGGCGAGGGCGAGCCGTGCGGGGGCGGCG*GCGCTGGCAGGGGGCACTGCGCG
PST01_0064_F10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0076_E05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCA
OVRT1_0126_H09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0113_G10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0146_A11.b : GCGCGCGCGGCGAGGGCGAGCCGTGCGGGGGCGGCG*GCTCCTGCAGGGGGCACTGCGCG
TES01_0101_A03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0115_D01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRT1_0045_G02.b : GCGCGCGCGGCGAGGGCTAGCCGTGCGGGGGCGGCG*GCGCCGGCAGGGGGCACTGCGCG
OVRT1_0082_A12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0098_F02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0045_B04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0087_B04.b : GCGCGCGCGGCGAGGGCGAGCCGTGCGGGGGCGGCGAGCGCCGGCTTGGGGCACTGCTCG
OVRT1_0036_C01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0078_B06.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0082_B08.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
LNG01_0034_G12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRT1_0040_E06.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
LNG01_0046_F07.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TCH01_0046_A02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRT1_0038_A03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0069_A11.b : GCGCGCGCGGCGAGGGCTAGCCGTGCGGGGGCGGCG*GCGCCGGCAGGGGGCACTGCGCG
OVRT1_0036_C05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TCH01_0028_A06.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0041_A04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0023_B04.b : gcgcgcg**gcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRT1_0042_E01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0036_G06.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0035_F07.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0074_C11.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0084_H08.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TCH01_0023_B08.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TCH01_0039_H04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TCH01_0087_F04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TCH01_0011_H03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
LNG01_0103_C05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TES01_0070_D01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0123_G01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0128_D11.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TCH01_0093_B10.b : GCGCGCGCGGCAAGGGCGAGCCGTGCGGGGGCGGCT*GCGCCGAGCTGAGGCACTGCGCG
TCH01_0093_E09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0074_H09.b : Acgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0033_A09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TCH01_0085_H10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TCH01_0039_E03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
LNG01_0098_D07.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
THY01_0040_A10.b : gcgcgcgcggcgagggccagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0106_F03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0064_E08.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRM1_0204_C10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
UTR01_0075_C07.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggTAGGGGGCACTGCGCG
OVRM1_0206_H10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRT1_0143_G01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRM1_0154_A10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0141_A10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0132_E08.b : GCGCGCGCGGCGAGGGCGATCCGTGCGGGGGCGGCG*GCGCCGGCAGGGGGCACTGCGCG
OVRT1_0136_B01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0147_B03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0143_E01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
LNG01_0035_A11.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
LNG01_0080_G12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TCH01_0033_G03.b : GCGCGCGCGGCGAGGGCGAGCCGTGCGGGAGCGGCG*GCGCCTGCGGGGGGCACTGCGCG
OVRT1_0008_G02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TCH01_0012_C01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRM1_0059_H02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0028_E11.b : GCGCGCGCGGCAAGGGCGAGCCGTGCGGGGGCGGCG*GCCCCGGCAGGGGGCACTGCGCG
CLNT1_0055_E08.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRT1_0141_A09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0003_C10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0147_C10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgcccgcAGGGGGCACTGCGCG
OVRT1_0002_A05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcTGGGGGCACTGCGCG
SMG01_0092_C12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0054_D09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
HTMT1_0044_C07.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
CLNT1_0064_G09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
UTR01_0045_A04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0061_A10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRT1_0085_E08.b : GCGCGCGCGGCGAGGGCGAGCCGTGCGGGGGCGGCA*GCGCCGGCTGGGGGCACTGCGCG
LNG01_0042_H03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
CLNT1_0064_F02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0042_D12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0096_D04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0058_D02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
LNG01_0035_H02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0073_E02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0073_A09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
MLN01_0069_C05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
LNG01_0034_F12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRT1_0043_F11.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0051_H02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0035_E03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
TCH01_0037_B04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
LNG01_0091_D10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
UTR01_0043_B07.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
UTR01_0060_D01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
MLN01_0101_H05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0066_E04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0048_F02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0064_E03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCTCTGCGCG
OVRT1_0031_H01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0014_A11.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGAGCACTGCGCG
UTR01_0052_H06.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0074_E03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0064_B01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGTGCG
CLNT1_0062_A10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
LNG01_0028_F08.b : GTgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
CLNT1_0007_E05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRT1_0022_E11.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
LNG01_0002_H02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
TCH01_0027_F05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
ITT01_0012_E04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
PST01_0044_E03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0005_G05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0005_A09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0096_D09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0091_A05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGTGGCACTGCGCG
PST01_0042_G06.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0012_B08.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0035_D10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TES01_0056_A11.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRT1_0123_D02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0100_F07.b : GCGCGCGCGGCGAGGGCTAGCCGTGCGGGGGCGGCG*GCGCCGGCAGGGGGCACTGCCCG
TES01_0059_H04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
PST01_0072_A08.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
PST01_0099_B11.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0120_H01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0093_E08.b : GCCCACGCAGCTAGGGAAAGCCGTGCGGGGGCGGAG*GCGCCGGCGGGGGGCACTGCACG
OVRT1_0019_D07.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
CLNT1_0150_E07.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0100_A06.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0072_D05.b : GCGCGCGCGGCTAGGGAGAGCCGTGCGGGGGCGGCG*GCGCCGGCAGGGGGCACTGCGCG
OVR01_0090_D11.b : GCACGCGCGGAGAGGGCGAGCCGTGCCGGGGCGGCG*GCGCCGGCTGGGGGCACTGCTCG
OVRT1_0111_F01.b : ttttnccgtcagcgnacgxxxxxxxxxxxxxx
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : cagggttaagcgtgtggncaaggggtgtctcacggtatgttcaggaaaataacccgatta
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
20110601C-012214 : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
---------+---------+---------+---------+---------+---------+ 459
CLNT1_0151_F03.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
PST01_0033_B11.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
TES01_0020_A03.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0100_C01.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
TES01_0001_D08.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0044_E01.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
TES01_0040_A03.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0149_B12.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
TES01_0112_B01.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
CLNT1_0096_B04.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0025_C10.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCTGCAGCC
PST01_0042_A08.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
KDN01_0016_C12.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
CLNT1_0022_F10.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
KDN01_0093_D03.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
PST01_0054_E06.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAGAGCGGGCGCAGCAGCC
PST01_0098_A12.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
KDN01_0028_A09.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAGAGCGGGCGCAGCAGCC
PST01_0074_D09.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
LVR01_0057_C12.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0022_A06.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
KDN01_0079_F03.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
PST01_0039_F12.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
KDN01_0080_C12.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
PST01_0080_F02.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
KDN01_0028_B03.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
KDN01_0008_C02.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
CLNT1_0066_C04.b : CCGGGCATGGATTGCTTGAATAGCCGCACGAGGCTGAGGGGTAGCGCGGGCGCAGCATCC
OVRT1_0128_B05.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0124_B12.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCATCC
OVRT1_0132_A05.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
PST01_0041_H08.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAGAGCGGGCGCAGCAGCC
OVRT1_0001_E06.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0004_A04.b : CCGGGCATGGAGTGCGTGAAAAGCCGCAAGACGCGGATGGGTAAAGCGGGCGCCTCAGCC
CLNT1_0041_F04.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0041_G09.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAACC
SPLT1_0001_G07.b : CCGGGCATGGAGTGCGTGAAGAGCCGCATGATGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVR01_0043_B12.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
PST01_0064_F10.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0076_E05.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0126_H09.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
CLNT1_0113_G10.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
CLNT1_0146_A11.b : CCGGGCATGGAGTGCGTGAAGAGCCGCACGACGCGGAAGGGTAAATCGGGCGCAGCAGCC
TES01_0101_A03.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
CLNT1_0115_D01.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCATCC
OVRT1_0045_G02.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGATGCGGAAGGGTAAAGCGGGCGCAACAGCC
OVRT1_0082_A12.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0098_F02.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0045_B04.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0087_B04.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0036_C01.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0078_B06.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGTCGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0082_B08.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
LNG01_0034_G12.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0040_E06.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
LNG01_0046_F07.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
TCH01_0046_A02.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0038_A03.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0069_A11.b : CCGGGCATGGAGTGCGTGAAGATCCGCTAGAGGCGGAGGGGTAAAGCGGGCGCAGCATCC
OVRT1_0036_C05.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
TCH01_0028_A06.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAGAGCGGGCGCAGCAGCC
OVRT1_0041_A04.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAGAGCGGGCGCAGCAGCC
OVRT1_0023_B04.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAGAGCGGGCGCAGCAGCC
OVRT1_0042_E01.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0036_G06.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0035_F07.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0074_C11.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0084_H08.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCATCAGCC
TCH01_0023_B08.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
TCH01_0039_H04.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
TCH01_0087_F04.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
TCH01_0011_H03.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAGAGCGGGCGCAGCAGCC
LNG01_0103_C05.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
TES01_0070_D01.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0123_G01.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCATCAGCC
CLNT1_0128_D11.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
TCH01_0093_B10.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCAGAAGGGTAAAGCGGGCGCAACGGCC
TCH01_0093_E09.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCTGCAGCC
CLNT1_0074_H09.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0033_A09.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
TCH01_0085_H10.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
TCH01_0039_E03.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGGGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
LNG01_0098_D07.b : CCGGGCATGGAGTGCGTGAAGAGCCGCTAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
THY01_0040_A10.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAACC
OVRT1_0106_F03.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCACCAGCC
OVRT1_0064_E08.b : CCGGGCATGGAGTGCGTGGAGAGCCGCAAGAGGCGGAGGGGTAGAGCGGGCGCATCATCC
OVRM1_0204_C10.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
UTR01_0075_C07.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
OVRM1_0206_H10.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0143_G01.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRM1_0154_A10.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAGAGCGGGCGCAGCAGCC
OVRT1_0141_A10.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCATCAGCC
OVRT1_0132_E08.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCATCAGCC
OVRT1_0136_B01.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0147_B03.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0143_E01.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
LNG01_0035_A11.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAGAGCGGGCGCAGCAGCC
LNG01_0080_G12.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
TCH01_0033_G03.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0008_G02.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
TCH01_0012_C01.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAACC
OVRM1_0059_H02.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0028_E11.b : CCGGGCATGGAGTGCGTGAAGAGCCCCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
CLNT1_0055_E08.b : CCGGGCATGGAGTGCGTGAAGAGCCTCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0141_A09.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0003_C10.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0147_C10.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGATGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0002_A05.b : CCGGGCATGGAGTGCGTGAAGAGCCTCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
SMG01_0092_C12.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0054_D09.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGATGCGTAAGGGTAAAGCGGGCGCACCATCC
HTMT1_0044_C07.b : CCGGGTATGGATTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
CLNT1_0064_G09.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCTGCC
UTR01_0045_A04.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
CLNT1_0061_A10.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAGAGCGGGCGCAGCAGCC
OVRT1_0085_E08.b : CCGGGCATGGAGTGCGTGTATAGCCCCAGGATGCGGAAGGGTTATGCGGGCGCAGCAGCC
LNG01_0042_H03.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGA**GGTAAAGCGGGCGCAGCAGCC
CLNT1_0064_F02.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0042_D12.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
CLNT1_0096_D04.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0058_D02.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
LNG01_0035_H02.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0073_E02.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGACGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0073_A09.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
MLN01_0069_C05.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
LNG01_0034_F12.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0043_F11.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
CLNT1_0051_H02.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0035_E03.b : CCGGGCATGGAGTGCGTGAAGGGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
TCH01_0037_B04.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
LNG01_0091_D10.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
UTR01_0043_B07.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
UTR01_0060_D01.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
MLN01_0101_H05.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
CLNT1_0066_E04.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAGAGCGGGCGCAGCAGCC
OVRT1_0048_F02.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
CLNT1_0064_E03.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0031_H01.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
CLNT1_0014_A11.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
UTR01_0052_H06.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
CLNT1_0074_E03.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
CLNT1_0064_B01.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
CLNT1_0062_A10.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAGAGCGGGCGCAGCAGCC
LNG01_0028_F08.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAGAGCGGGCGCAGCAGCC
CLNT1_0007_E05.b : CCGGGCATGGAGCGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0022_E11.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
LNG01_0002_H02.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
TCH01_0027_F05.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
ITT01_0012_E04.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
PST01_0044_E03.b : CCGGGCATGGAGTGCGTGAAGAGCCGCATGAGGCGGAGGGGTAGAGCGGGCGCACCAGCC
OVRT1_0005_G05.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCTTCATCC
KDN01_0005_A09.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
KDN01_0096_D09.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
KDN01_0091_A05.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
PST01_0042_G06.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
KDN01_0012_B08.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
KDN01_0035_D10.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
TES01_0056_A11.b : CCGGGCATGGAGTGCGTGAAGAGCCTCAAGAGGCTGAGGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0123_D02.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCATCAGCC
OVRT1_0100_F07.b : CCGGGCATGCAGTGCGTGAAGAGCCACCCGAAGCGGAAGGGTAAAGCGGGCGCAGCAGCC
TES01_0059_H04.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
PST01_0072_A08.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
PST01_0099_B11.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0120_H01.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAAGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0093_E08.b : CCAGGAATGGAGTGCGTGAACAGCCACAAGAAGCGGAGGGATAAAGCGGGCGCAGCAGCC
OVRT1_0019_D07.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
CLNT1_0150_E07.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0100_A06.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0072_D05.b : CCGGGCATGGAGTGCGTGAAGAGCCTCAAGAGGCTGAAGGGTAAAGCGGGCGCAGCATCC
OVR01_0090_D11.b : CCGGGCATGGAGTGCGTGAAGAGCCGCAAGAGGCGGAGGGGTAAAGCGGGCGCAGCAGCC
OVRT1_0111_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGGGCGCAGCAGCC
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : ggggacagggggtgcgtacgcgggggtctgggcactcgtcccccttgcgggatcggcaaa
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
20110601C-012214 : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
---------+---------+---------+---------+---------+---------+ 519
CLNT1_0151_F03.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
PST01_0033_B11.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGCGCAAGAGCCGCTACCCGGTGTGCGGCAGC
TES01_0020_A03.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0100_C01.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
TES01_0001_D08.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0044_E01.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
TES01_0040_A03.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0149_B12.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
TES01_0112_B01.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
CLNT1_0096_B04.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0025_C10.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
PST01_0042_A08.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
KDN01_0016_C12.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
CLNT1_0022_F10.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
KDN01_0093_D03.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
PST01_0054_E06.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
PST01_0098_A12.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
KDN01_0028_A09.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
PST01_0074_D09.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
LVR01_0057_C12.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0022_A06.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
KDN01_0079_F03.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
PST01_0039_F12.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
KDN01_0080_C12.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
PST01_0080_F02.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
KDN01_0028_B03.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
KDN01_0008_C02.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
CLNT1_0066_C04.b : GGCGGCCCGGGCGTACGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCTGC
OVRT1_0128_B05.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCTTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0124_B12.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0132_A05.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
PST01_0041_H08.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0001_E06.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0004_A04.b : GGCGGCCCGGGCGTATCCTGTGTGTGCGTGTGCAAGAGCTGCTACCCGGTGTGCGGCAGC
CLNT1_0041_F04.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0041_G09.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
SPLT1_0001_G07.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVR01_0043_B12.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
PST01_0064_F10.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0076_E05.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0126_H09.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCTAGAGCCGCTACCCGGTGTGCGGCATC
CLNT1_0113_G10.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
CLNT1_0146_A11.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
TES01_0101_A03.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
CLNT1_0115_D01.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0045_G02.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0082_A12.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0098_F02.b : GGCAGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGCGTGCGGCAGC
OVRT1_0045_B04.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0087_B04.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGATCCGCTACCCGGTGTGCGGCACC
OVRT1_0036_C01.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0078_B06.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCGAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0082_B08.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
LNG01_0034_G12.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0040_E06.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
LNG01_0046_F07.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
TCH01_0046_A02.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0038_A03.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0069_A11.b : TGCGGTCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0036_C05.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
TCH01_0028_A06.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0041_A04.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0023_B04.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0042_E01.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0036_G06.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0035_F07.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0074_C11.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0084_H08.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
TCH01_0023_B08.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
TCH01_0039_H04.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
TCH01_0087_F04.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
TCH01_0011_H03.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
LNG01_0103_C05.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
TES01_0070_D01.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0123_G01.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
CLNT1_0128_D11.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
TCH01_0093_B10.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGACCCGCTACCCGGTGTGCGGCAGC
TCH01_0093_E09.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
CLNT1_0074_H09.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0033_A09.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
TCH01_0085_H10.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
TCH01_0039_E03.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
LNG01_0098_D07.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
THY01_0040_A10.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0106_F03.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAATAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0064_E08.b : GGCGGCCCGGGCGTAATCGGTGTGTGCGTGTGCAACAGCCGCTACCCGGTGTGCGGCAGC
OVRM1_0204_C10.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
UTR01_0075_C07.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRM1_0206_H10.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0143_G01.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRM1_0154_A10.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0141_A10.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0132_E08.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCATC
OVRT1_0136_B01.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0147_B03.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0143_E01.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
LNG01_0035_A11.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
LNG01_0080_G12.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
TCH01_0033_G03.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCTGC
OVRT1_0008_G02.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
TCH01_0012_C01.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGAAGC
OVRM1_0059_H02.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0028_E11.b : GGCCGCCCGGGCGTAAGCTGTGTGTGCGTGTGCCATAGCCGCTACCCGGTGTGCGGCATC
CLNT1_0055_E08.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0141_A09.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0003_C10.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0147_C10.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0002_A05.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
SMG01_0092_C12.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0054_D09.b : GGCTGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
HTMT1_0044_C07.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGAATC
CLNT1_0064_G09.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
UTR01_0045_A04.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
CLNT1_0061_A10.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0085_E08.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
LNG01_0042_H03.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
CLNT1_0064_F02.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0042_D12.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
CLNT1_0096_D04.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0058_D02.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
LNG01_0035_H02.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0073_E02.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0073_A09.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
MLN01_0069_C05.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
LNG01_0034_F12.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0043_F11.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
CLNT1_0051_H02.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0035_E03.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAATAGCCGCTACCCGGTGTGCGGCAGC
TCH01_0037_B04.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
LNG01_0091_D10.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
UTR01_0043_B07.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
UTR01_0060_D01.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGCGCAAGAGCCGCTACCCGGTGTGCGGCAGC
MLN01_0101_H05.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
CLNT1_0066_E04.b : GGCGGCCCGGGCGTACGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0048_F02.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
CLNT1_0064_E03.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCTAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0031_H01.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
CLNT1_0014_A11.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
UTR01_0052_H06.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
CLNT1_0074_E03.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
CLNT1_0064_B01.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
CLNT1_0062_A10.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
LNG01_0028_F08.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
CLNT1_0007_E05.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0022_E11.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
LNG01_0002_H02.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
TCH01_0027_F05.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
ITT01_0012_E04.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
PST01_0044_E03.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCTTC
OVRT1_0005_G05.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCATC
KDN01_0005_A09.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
KDN01_0096_D09.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
KDN01_0091_A05.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
PST01_0042_G06.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
KDN01_0012_B08.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
KDN01_0035_D10.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
TES01_0056_A11.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGCGCGGCAGC
OVRT1_0123_D02.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0100_F07.b : GGCGGCCCGGGCGTAATCGGTGTGTGCGTGTGCAATAGCCGCTACCCGGTGTGCGGCACC
TES01_0059_H04.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
PST01_0072_A08.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
PST01_0099_B11.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0120_H01.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0093_E08.b : GGCGGCCCGGGCGTAAACGGTGTGTGTGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0019_D07.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
CLNT1_0150_E07.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0100_A06.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0072_D05.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCCAGAGCCGCTACCCGGTGTGCTGCAGC
OVR01_0090_D11.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAACAGCCGCTACCCGGTGTGCGGCAGC
OVRT1_0111_F01.b : GGCGGCCCGGGCGTAAGCGGTGTGTGCGTGTGCAAGAGCCGCTACCCGGTGTGCGGCAGC
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : cccacatttagaatctaagaactgacctcttttaaatgggaaaattcccgaattgaaaaa
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
20110601C-012214 : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
---------+---------+---------+---------+---------+---------+ 578
CLNT1_0151_F03.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
PST01_0033_B11.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
TES01_0020_A03.b : GACTGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCTGCCTGAGGGCCGAGAG
OVRT1_0100_C01.b : GACTGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
TES01_0001_D08.b : GACGGCGTCACCTACCCCAGCGGCTGCCTT*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0044_E01.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCTGCCTGAGGGCCGAGAG
TES01_0040_A03.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGATAG
OVRT1_0149_B12.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
TES01_0112_B01.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
CLNT1_0096_B04.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0025_C10.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
PST01_0042_A08.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
KDN01_0016_C12.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
CLNT1_0022_F10.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
KDN01_0093_D03.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
PST01_0054_E06.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
PST01_0098_A12.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
KDN01_0028_A09.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
PST01_0074_D09.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
LVR01_0057_C12.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0022_A06.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
KDN01_0079_F03.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
PST01_0039_F12.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
KDN01_0080_C12.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
PST01_0080_F02.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
KDN01_0028_B03.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
KDN01_0008_C02.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
CLNT1_0066_C04.b : GACGGCGTCTCCTACCCCGGCGGCTGCCAG*CTGCGCGCCGCCTGCCTGAGGGCCGAGAG
OVRT1_0128_B05.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0124_B12.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0132_A05.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
PST01_0041_H08.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0001_E06.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0004_A04.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCTCCAGCCTGAGGGCCGAGAG
CLNT1_0041_F04.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0041_G09.b : GACGGCGTCACCTACCCCAGCGGATGCCAT*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
SPLT1_0001_G07.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVR01_0043_B12.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
PST01_0064_F10.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0076_E05.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0126_H09.b : GACGGCGTCACCTACCCCAGCGGCTGCCAT*CTGCGCGCCGCCAGCCTGAGGGCCGATAG
CLNT1_0113_G10.b : TACGGCGTCACCTACCCCATCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
CLNT1_0146_A11.b : GACGGCGTCACCTACCCCAGCTGCTGCCAG*CTGCGCTCCGCCAGCCTGATGGCCGACAG
TES01_0101_A03.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGATAG
CLNT1_0115_D01.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0045_G02.b : AACTGCGTCACCTACCCCAGCGGCTGCCTG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0082_A12.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0098_F02.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0045_B04.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0087_B04.b : GACGGCGTCACCTACCCCAGCGGCTGCCTG*CTGCCCGCCGCCTGCCTGAGGGCCGAAAG
OVRT1_0036_C01.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0078_B06.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0082_B08.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
LNG01_0034_G12.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0040_E06.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
LNG01_0046_F07.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
TCH01_0046_A02.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGATGGCCGAGAG
OVRT1_0038_A03.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0069_A11.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGACAG
OVRT1_0036_C05.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
TCH01_0028_A06.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0041_A04.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0023_B04.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0042_E01.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0036_G06.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0035_F07.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0074_C11.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0084_H08.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
TCH01_0023_B08.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
TCH01_0039_H04.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
TCH01_0087_F04.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
TCH01_0011_H03.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
LNG01_0103_C05.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
TES01_0070_D01.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0123_G01.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCTCGCCGCCAGCCTGAGGGCCGAGAG
CLNT1_0128_D11.b : TACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
TCH01_0093_B10.b : GACGGCGTCACCTACCCCAGCGGCTGCCAT*CTGCGCGCCGCCAGCCTGATGGCCGAGAG
TCH01_0093_E09.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
CLNT1_0074_H09.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0033_A09.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
TCH01_0085_H10.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
TCH01_0039_E03.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
LNG01_0098_D07.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
THY01_0040_A10.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCCCCGCCAGCCTGAGGGCCCAGAG
OVRT1_0106_F03.b : GACGGCGTCACCTACCCCAGCGGCTGCCAA*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0064_E08.b : GACGGCGTCACTTACCCCAGCGGCTGCCAGTCTGCTCGCCGCCAGCCTGAGGGCCGAGAG
OVRM1_0204_C10.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
UTR01_0075_C07.b : GACGGCGTCACCTACCCCAGCGGCTGCCTG*CTGCGCGCCGCCTGCCTGAGGGCCGAGAG
OVRM1_0206_H10.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0143_G01.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCTGCCAGCCTGAGGGCCGAGAG
OVRM1_0154_A10.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0141_A10.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0132_E08.b : GACTGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0136_B01.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0147_B03.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0143_E01.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
LNG01_0035_A11.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
LNG01_0080_G12.b : TACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
TCH01_0033_G03.b : TACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCTCGCCGCCAGCCTGAGGGCCAAGAG
OVRT1_0008_G02.b : GACTGCGTCACCTACCCCAGCGGCTGCCAT*CTGCGCGCCGCCTGCCTGAGGGCCGAGAG
TCH01_0012_C01.b : GACGGCGTTACCTACCCCAGCGGCTGCCAA*CTGCTCGCCGCCAGCCTGAGGGCCGAGAG
OVRM1_0059_H02.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0028_E11.b : GACAGCGTCCCCTACCCCAGCGGTTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
CLNT1_0055_E08.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGATGGTCGAGAG
OVRT1_0141_A09.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0003_C10.b : GACGGCGTCACCTACCCCAGCTGCTGCCAG*CTGCGCGCCACCAGCCTGAGGGCCGAGAG
OVRT1_0147_C10.b : GACGGCGTCACCTACCCCAGCGGCTGCCAT*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0002_A05.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
SMG01_0092_C12.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0054_D09.b : GACTGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCTCCAGCCTGAGGGCCGAGAG
HTMT1_0044_C07.b : GACGGCGTCTCCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
CLNT1_0064_G09.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
UTR01_0045_A04.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
CLNT1_0061_A10.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0085_E08.b : GACTGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
LNG01_0042_H03.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
CLNT1_0064_F02.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0042_D12.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
CLNT1_0096_D04.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0058_D02.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
LNG01_0035_H02.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0073_E02.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0073_A09.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
MLN01_0069_C05.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
LNG01_0034_F12.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0043_F11.b : GACTGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
CLNT1_0051_H02.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0035_E03.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
TCH01_0037_B04.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
LNG01_0091_D10.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
UTR01_0043_B07.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
UTR01_0060_D01.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
MLN01_0101_H05.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
CLNT1_0066_E04.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0048_F02.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
CLNT1_0064_E03.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0031_H01.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
CLNT1_0014_A11.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
UTR01_0052_H06.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
CLNT1_0074_E03.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
CLNT1_0064_B01.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
CLNT1_0062_A10.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
LNG01_0028_F08.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
CLNT1_0007_E05.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0022_E11.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
LNG01_0002_H02.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
TCH01_0027_F05.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
ITT01_0012_E04.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
PST01_0044_E03.b : GACGGCGTCACCTACCCCAGCGGCTGCCTG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0005_G05.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
KDN01_0005_A09.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
KDN01_0096_D09.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
KDN01_0091_A05.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
PST01_0042_G06.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
KDN01_0012_B08.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
KDN01_0035_D10.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
TES01_0056_A11.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGACGGCCGAGAG
OVRT1_0123_D02.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCTGCCTGAGGGCCGAGAG
OVRT1_0100_F07.b : GACGGCGTCACCTACCCCAGCGGTTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
TES01_0059_H04.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
PST01_0072_A08.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
PST01_0099_B11.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0120_H01.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0093_E08.b : GACGGCGTCACCTACCCCAGCGGATGCCAG*CTGCGCGCCGCCAGCATGAGGGCCGAGAG
OVRT1_0019_D07.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
CLNT1_0150_E07.b : GACGGCGTCACCTACTCCATCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAAGGCCAAGAG
OVRT1_0100_A06.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVRT1_0072_D05.b : GACTGCGTCACCTACCCCATCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
OVR01_0090_D11.b : GACAGCCTCACCTACCCCAGCGGCTGCCAG*CTGCGCACCGCCTGCCTGAGGGCCGAAAG
OVRT1_0111_F01.b : GACGGCGTCACCTACCCCAGCGGCTGCCAG*CTGCGCGCCGCCAGCCTGAGGGCCGAGAG
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : ggggaacggttttctgtaatcggaaagttcgaacggaggatcccggaggggacctcccgc
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
20110601C-012214 : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
---------+---------+---------+---------+---------+---------+ 633
CLNT1_0151_F03.b : CCGCGGG*GAGAAAGCCGTCACC*CATGTCAGCTAGGGC*ACCTGCGAGCAT**GGTCCT
PST01_0033_B11.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
TES01_0020_A03.b : CCGCGGG*GAGAAAGCCGTCACC*CATGTCAGCAAGGGC*ATCTGCTAGCAA**GGTCCT
OVRT1_0100_C01.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
TES01_0001_D08.b : CCGCGGG*GAGAAAGCCGTCTCC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0044_E01.b : CCGCGGG*GAGAAAGCCGTCACC*CACGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
TES01_0040_A03.b : CCGCGGG*GAGAAAGCCGTCTCC*CATGTCTGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0149_B12.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
TES01_0112_B01.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
CLNT1_0096_B04.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0025_C10.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
PST01_0042_A08.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
KDN01_0016_C12.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
CLNT1_0022_F10.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
KDN01_0093_D03.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
PST01_0054_E06.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
PST01_0098_A12.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
KDN01_0028_A09.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCTT
PST01_0074_D09.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
LVR01_0057_C12.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0022_A06.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
KDN01_0079_F03.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
PST01_0039_F12.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
KDN01_0080_C12.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
PST01_0080_F02.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
KDN01_0028_B03.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
KDN01_0008_C02.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
CLNT1_0066_C04.b : CCGCGGG*GAGTAAGCCGTCTCC*CATGTCATCCAGGGC*TCCTGCGAGCAA**GGTCCT
OVRT1_0128_B05.b : CCGCGGG*GAGAAAGCCGTCACC*CATGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0124_B12.b : CCGCGGG*GAGAAAGCCTTCACC*CATGTCAGCTTGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0132_A05.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
PST01_0041_H08.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0001_E06.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0004_A04.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCTAGGGC*ACCTGCGAGCAA**TGTCCT
CLNT1_0041_F04.b : CCGCGGG*GAGATAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0041_G09.b : CCGCGGG*GAGAAATCCGTCACC*CAAGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
SPLT1_0001_G07.b : CCGCGGG*GAGAAAGCCGTCTCC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVR01_0043_B12.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
PST01_0064_F10.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0076_E05.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0126_H09.b : CCGCGGG*GAGAAAGCCGTCACC*CTAGTCAGCAAGGGC*ACCTGCGAGCAA**TGTCCT
CLNT1_0113_G10.b : CCTCGGG*GAGAAAGCCGTCACC*CAGGTCATCAAGGGC*ACCTGCGAGCAA**GGTCCT
CLNT1_0146_A11.b : CCGCGGG*GAGAAAGCCGTCACC*CTGGTCAGCAAGGGC*ACCTGCGAACAA**TGTCCT
TES01_0101_A03.b : CCGCGGG*GAGAAAGCCGTCTCC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**TGTCCT
CLNT1_0115_D01.b : CCGCGGG*GAGAAAGCCGTCACC*CTGGTCAGCAAGGGC*TCCTGCTAGCAA**GGTCCT
OVRT1_0045_G02.b : CCGCGGG*GAGAAAGCCGTCACC*CATGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0082_A12.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGTGAGCAA**GGTCCT
OVRT1_0098_F02.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0045_B04.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCTAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0087_B04.b : CCGCGGG*GAGAAAGCCGTCACC*TCTGTCAGCAAGGGC*ACCTGCTAGCAA**GGTCCT
OVRT1_0036_C01.b : CCGCGGG*GAGAAAGCCGTCACC*CACGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0078_B06.b : CCGCGGG*GAGAAAGCCGTCACC*CATGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0082_B08.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
LNG01_0034_G12.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0040_E06.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
LNG01_0046_F07.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
TCH01_0046_A02.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0038_A03.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0069_A11.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0036_C05.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
TCH01_0028_A06.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GATCCT
OVRT1_0041_A04.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0023_B04.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0042_E01.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0036_G06.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0035_F07.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0074_C11.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0084_H08.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
TCH01_0023_B08.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
TCH01_0039_H04.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
TCH01_0087_F04.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
TCH01_0011_H03.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GATCCT
LNG01_0103_C05.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
TES01_0070_D01.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCCAGCAA**GGTCCT
OVRT1_0123_G01.b : CCGCGGG*GAGAAAGCCGTCACC*CATGTTAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
CLNT1_0128_D11.b : CCGCGGG*GAGAAAGCCGTCTCC*CAGGTCAGCAAGGGC*ACCTGCTAGCAA**GGTCCT
TCH01_0093_B10.b : CCTCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
TCH01_0093_E09.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
CLNT1_0074_H09.b : CCGCGGG*GAGGAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0033_A09.b : CCGCGGGGGAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
TCH01_0085_H10.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
TCH01_0039_E03.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
LNG01_0098_D07.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
THY01_0040_A10.b : CCGCGGG*GAGATAGCCGTCACCCCACGTCATCAAGGGC*ACCTGCGAGCAATGGTCCCT
OVRT1_0106_F03.b : CCGTGGG*GAGAAAGCCGTCTCC*CTCGTCAGCAAGGGC*ACCTGCGATCAT**GGTCCT
OVRT1_0064_E08.b : CCGCGGG*GAGAAAGCCGTCACC*CAGTTCTGCTAGGGC*ACCTGCGAGCAA**GGTCCT
OVRM1_0204_C10.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCTA**GGTCCT
UTR01_0075_C07.b : CCGCGGG*GAGAAAGCCGTCTCC*CACGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRM1_0206_H10.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0143_G01.b : CCGCGGG*GAGAAAGCCGTCACC*CCCGTCAGCAAGGGC*ACCTGCGAGCAA**TGTCCT
OVRM1_0154_A10.b : CCGCGGG*GAGAAAGCCGTCACC*CAAGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0141_A10.b : CCGCGGG*GAGAAAGCCGTCACC*CATGTCAGCAAGGGC*ACCTGCTAACAA**TGTCCT
OVRT1_0132_E08.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGACCT
OVRT1_0136_B01.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0147_B03.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0143_E01.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**CGTCCT
LNG01_0035_A11.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
LNG01_0080_G12.b : CCGCGGG*GAGAAAGCCGTCACC*CACGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
TCH01_0033_G03.b : CCGCGGG*GAGAAAGCCGTCACC*CATGTCAGCACGGTC*ACCTGCTAGCAA**GGTCCT
OVRT1_0008_G02.b : CCGCGGG*GAGAAAGCCGTCACC*CACGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
TCH01_0012_C01.b : CCGCGGG*GAGAAAGCCGTCACC*CACGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRM1_0059_H02.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0028_E11.b : CCGCGGG*GAGAAAGCCGTCACC*CACGTCACCAAGGGCTACCTGACACCAA**GGTCCT
CLNT1_0055_E08.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0141_A09.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0003_C10.b : CCGCGGG*GAGAAAGCCGTCACC*CACGTCAGCATGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0147_C10.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0002_A05.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
SMG01_0092_C12.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0054_D09.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCCAGCAA**GGTCCT
HTMT1_0044_C07.b : CCGCGGG*GAGAAAGCCGTCACC*CACGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
CLNT1_0064_G09.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
UTR01_0045_A04.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
CLNT1_0061_A10.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0085_E08.b : CCGCGGG*GATAAAGCCGTCACC*CACGTCAGCAAGGGC*ACCTGCGAGCAT**GGTCCT
LNG01_0042_H03.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
CLNT1_0064_F02.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0042_D12.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
CLNT1_0096_D04.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0058_D02.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
LNG01_0035_H02.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0073_E02.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0073_A09.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
MLN01_0069_C05.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
LNG01_0034_F12.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0043_F11.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
CLNT1_0051_H02.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0035_E03.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
TCH01_0037_B04.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
LNG01_0091_D10.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
UTR01_0043_B07.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
UTR01_0060_D01.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
MLN01_0101_H05.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
CLNT1_0066_E04.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0048_F02.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
CLNT1_0064_E03.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0031_H01.b : CCGCGGG*GATAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
CLNT1_0014_A11.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
UTR01_0052_H06.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
CLNT1_0074_E03.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
CLNT1_0064_B01.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
CLNT1_0062_A10.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
LNG01_0028_F08.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
CLNT1_0007_E05.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0022_E11.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
LNG01_0002_H02.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
TCH01_0027_F05.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
ITT01_0012_E04.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
PST01_0044_E03.b : CCGCGCG*GAGAAAGCCGTCATC*CATGCCAGCAAGGGC*ACCTGCGAGCTC**GGTCCT
OVRT1_0005_G05.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
KDN01_0005_A09.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
KDN01_0096_D09.b : CCGCGGG*GAGAAAGCCGTCACC*CATGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
KDN01_0091_A05.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
PST01_0042_G06.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
KDN01_0012_B08.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
KDN01_0035_D10.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
TES01_0056_A11.b : CCGCGGG*GAGAAAGCCTTCACC*CTGGTCAGCAAGGGC*ACCTGCGAGCAA**CGTCCT
OVRT1_0123_D02.b : CCGCGGG*GAGAAAGCCGTCTCC*CATGTCAGCTAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0100_F07.b : CCGCGGG*GAGAAAGCCGTCACC*CATGTCAGCAAGGGC*ACCTGCGAGCAA**GGCCCT
TES01_0059_H04.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
PST01_0072_A08.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
PST01_0099_B11.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0120_H01.b : CCGCGGG*GAGAAAGCCGTCACC*CATGTCAGCAAGGGC*AGCTGCGAGCAA**GGTCCT
OVRT1_0093_E08.b : CCGCGGG*GATAAAGCCGTCACC*CAGATCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0019_D07.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
CLNT1_0150_E07.b : CCGCGGG*GAGAAAGCCTTCTCCTCATGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0100_A06.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCTAGGGC*ACCTGCGAGCAA**GGTCCT
OVRT1_0072_D05.b : CCGCGGG*GAGAGAGCCGTCACC*CAGGTCAGCCAGGGC*ACCTGCCAGCAA**GGTCCT
OVR01_0090_D11.b : CCGCGCG*GAGAAAGCCGTCACC*CATGTCAGCAAGGGC*ACCTGCTACCAA**GGTCCT
OVRT1_0111_F01.b : CCGCGGG*GAGAAAGCCGTCACC*CAGGTCAGCAAGGGC*ACCTGCGAGCAA**GGTCCT
BKFL1_0103_C07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : gtaaaaagacggaaaccttattgtcccctagggttggggcgcctctgacttaaggaccga
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
20110601C-012214 : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
---------+---------+---------+---------+---------+---------+ 690
CLNT1_0151_F03.b : TCCATCGTGACACCCC*CTAAGGACA*TCGGGAATGTCAAT*GGTGCCCAGGTGGAACTG
PST01_0033_B11.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
TES01_0020_A03.b : TCCATCGTGACACCCC*CTAAGGACATTCTGGAATGTCACT*GGTGCCCATGTGTACCTG
OVRT1_0100_C01.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGTATGTCACT*GGTGCCCAGGTGTACCTG
TES01_0001_D08.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0044_E01.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
TES01_0040_A03.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCTGGTGTACCTG
OVRT1_0149_B12.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
TES01_0112_B01.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
CLNT1_0096_B04.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0025_C10.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
PST01_0042_A08.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
KDN01_0016_C12.b : TCCATCGTGACACCCC*CTAAGGGCA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
CLNT1_0022_F10.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
KDN01_0093_D03.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
PST01_0054_E06.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
PST01_0098_A12.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
KDN01_0028_A09.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
PST01_0074_D09.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
LVR01_0057_C12.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0022_A06.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
KDN01_0079_F03.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
PST01_0039_F12.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
KDN01_0080_C12.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
PST01_0080_F02.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
KDN01_0028_B03.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
KDN01_0008_C02.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
CLNT1_0066_C04.b : TCCATCGTGACCCCCC*CTACCGACT*TCTGGATTGTCACT*GCTGCCCAGGTGTACCTG
OVRT1_0128_B05.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCTCT*GGTGCCCAAGTGTACCTG
OVRT1_0124_B12.b : TCCATCTTGACACCCC*CTAACGATT*TCTGGAATGTCACT*GGTGCCCAGTTGTACCTG
OVRT1_0132_A05.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
PST01_0041_H08.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0001_E06.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCATGTGTACCTG
OVRT1_0004_A04.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATATCACT*GGTGCCCAAGTGTACCTG
CLNT1_0041_F04.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0041_G09.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAAGTGTACCTG
SPLT1_0001_G07.b : TCCATCGTGACACCCC*CTAAAGACA*TCTGGAATGTCACT*GGTGCCCAAGTGTACCTG
OVR01_0043_B12.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
PST01_0064_F10.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0076_E05.b : TCCATCGTGATACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0126_H09.b : TCCATCGTGACACCCC*CTAATGACT*TCTGGAATGTCTCT*GGTGCCCTTGTGTCCCTG
CLNT1_0113_G10.b : TCTATCGTGACACCCC*CTAAAGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
CLNT1_0146_A11.b : TCCCTCGTGACACCCC*CTAACGACT*TCTGGACTGTCACT*GGTGCCCAGGTGTACCTG
TES01_0101_A03.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACTTGGTGCCCATGTGTACCTG
CLNT1_0115_D01.b : TCCTTCGTGACACCCC*CTAAGGACA*TCTGGAATGTTCACTGGTGCCCATGTGTACCTG
OVRT1_0045_G02.b : TCCATCGTGACACCCC*CTAAAGACA*TCTGGAATGTCACT*GGTGCCCAAGTGTACATG
OVRT1_0082_A12.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0098_F02.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0045_B04.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0087_B04.b : TCCATCGTGACACCCC*CTAAAGACA*TCTGGAATGTCTCT*GGTGCCCACTTGTACCTG
OVRT1_0036_C01.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0078_B06.b : TCCATCGTGACACCCC*CTAATGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0082_B08.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
LNG01_0034_G12.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0040_E06.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
LNG01_0046_F07.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
TCH01_0046_A02.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0038_A03.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0069_A11.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0036_C05.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
TCH01_0028_A06.b : TCCATCGTGACACCCC*CTAAGGACA*CCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0041_A04.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0023_B04.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0042_E01.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0036_G06.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0035_F07.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0074_C11.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0084_H08.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
TCH01_0023_B08.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
TCH01_0039_H04.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
TCH01_0087_F04.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
TCH01_0011_H03.b : TCCATCGTGACACCCC*CTAAGGACA*CCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
LNG01_0103_C05.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
TES01_0070_D01.b : TCCCTCGTGACACCCC*CTAAGGACA*TCTGGAATGGCCCT*GGTGCCCAGGTGTACCTG
OVRT1_0123_G01.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGATTGTCCCT*GGTGCCCAGGTGTACCTG
CLNT1_0128_D11.b : TCCATCGTGACCCCCC*CTAAGGACA*TCTGGAATGTCACTGGTTGCCCAAGTGTACCTG
TCH01_0093_B10.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
TCH01_0093_E09.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
CLNT1_0074_H09.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0033_A09.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
TCH01_0085_H10.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
TCH01_0039_E03.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
LNG01_0098_D07.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
THY01_0040_A10.b : TCCTTCGTGATCCCCC*CTATTGACA*TCTGTAATGTCACT*GCTGCCCATGCGCCCCTG
OVRT1_0106_F03.b : TCCTTCGTGACTTCCC*CTAATGACA*TCTGGAATGTCACT*GGTGCCCAGGTGCACTTG
OVRT1_0064_E08.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRM1_0204_C10.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGCCACT*GGTGCCCAGGTGTACCTG
UTR01_0075_C07.b : TCCATCTTGACACCCA*CTAAAGACA*TCTGGAATGTTACT*GGTGCCCAGGTGTACCTG
OVRM1_0206_H10.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0143_G01.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCATGTGTTCCTG
OVRM1_0154_A10.b : TCCATCGTGACACTCC*CTAAAGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTAACTG
OVRT1_0141_A10.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCATGTGTACCTG
OVRT1_0132_E08.b : TCCATCGTGACACCCC*CTAAGGACT*TCTGGAATGTCCCT*GGTGCCCAGGTGTACCTG
OVRT1_0136_B01.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0147_B03.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0143_E01.b : TCCCTCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTA
LNG01_0035_A11.b : TCCATCGTGACACCCCCCTAATGACA*TCTGGAATGTCACT*GGTGCCCACGTGTACCTG
LNG01_0080_G12.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGTAATGTCACT*GGTGCCCACGTGTAGCTG
TCH01_0033_G03.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGCGCCCAGGTGTACCTG
OVRT1_0008_G02.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
TCH01_0012_C01.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRM1_0059_H02.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0028_E11.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
CLNT1_0055_E08.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0141_A09.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0003_C10.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTACCCACGTGTACCTG
OVRT1_0147_C10.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0002_A05.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
SMG01_0092_C12.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0054_D09.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCATGTGTACCTG
HTMT1_0044_C07.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
CLNT1_0064_G09.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
UTR01_0045_A04.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
CLNT1_0061_A10.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0085_E08.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
LNG01_0042_H03.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
CLNT1_0064_F02.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0042_D12.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
CLNT1_0096_D04.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*AGTGCCCAGGTGTACCTG
OVRT1_0058_D02.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
LNG01_0035_H02.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0073_E02.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0073_A09.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
MLN01_0069_C05.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
LNG01_0034_F12.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0043_F11.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
CLNT1_0051_H02.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0035_E03.b : TCCATCGTGACTCCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
TCH01_0037_B04.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
LNG01_0091_D10.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
UTR01_0043_B07.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
UTR01_0060_D01.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
MLN01_0101_H05.b : TCCATCGTGACACCCC*TTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
CLNT1_0066_E04.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0048_F02.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
CLNT1_0064_E03.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*AGTGCCCAGGTGTACCTG
OVRT1_0031_H01.b : TCCATCGTGACACCCC*CTAAGGACA*TCTAGAATGTCACT*GGTGCCCAGGTGTACCTG
CLNT1_0014_A11.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
UTR01_0052_H06.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
CLNT1_0074_E03.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
CLNT1_0064_B01.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
CLNT1_0062_A10.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
LNG01_0028_F08.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
CLNT1_0007_E05.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0022_E11.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
LNG01_0002_H02.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
TCH01_0027_F05.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
ITT01_0012_E04.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
PST01_0044_E03.b : TCCATCGTGGCAACCC*CTTATGACC*TCTGGTATGTCTAT*GGTGCCCAGGTGTACTTG
OVRT1_0005_G05.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
KDN01_0005_A09.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
KDN01_0096_D09.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
KDN01_0091_A05.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
PST01_0042_G06.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
KDN01_0012_B08.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
KDN01_0035_D10.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
TES01_0056_A11.b : TCCATCGTGACTCCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0123_D02.b : TCCTTCGTGACACCCC*CTAATGACA*TCTGGAATGTCACTTGGTGCCCAGGTGTACCTG
OVRT1_0100_F07.b : TCCATCGTGACACCCC*CTAACGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
TES01_0059_H04.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
PST01_0072_A08.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
PST01_0099_B11.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0120_H01.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0093_E08.b : TCCATCGTGACACCCC*CTAAAGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0019_D07.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
CLNT1_0150_E07.b : TCCATCGAGACACCCCTCTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGTTGTACTTG
OVRT1_0100_A06.b : TCCTTCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0072_D05.b : TCCATCGTGACCCCCC*CTAACGACA*TCTGGAATGTCACT*GGTGCCTAGGTGTACCTG
OVR01_0090_D11.b : TCCATCGTGACACCCC*CTAACGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
OVRT1_0111_F01.b : TCCATCGTGACACCCC*CTAAGGACA*TCTGGAATGTCACT*GGTGCCCAGGTGTACCTG
BKFL1_0103_C07.b : nnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0056_C12.b : nnnnnnnnn
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : accgggaatgttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
20110601C-012214 : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
---------+---------+---------+---------+---------+---------+ 748
CLNT1_0151_F03.b : AACTGCGAGGTCATCGGGATTCCTA*CCCCTGCCCTCTTtttgggaaatagggacaaagg
PST01_0033_B11.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
TES01_0020_A03.b : AGCTGCGAGGTCATCGGATTCCCTA*CTCCTGCCCTCTTCTGG*AACAGGGTATAAAGGG
OVRT1_0100_C01.b : ACCTGCGAGGTCATCGGATTCCCAA*CCCCTGCCCTCTTCTGG*AACAAGGTACAAAGGG
TES01_0001_D08.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*TACATGGTACAAAGGG
OVRT1_0044_E01.b : AGCTGCGAGGTCATCGGAATCCCAACCCCCTGCCCTCATCTGG*AACCAGGTACACAGGG
TES01_0040_A03.b : AACTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACTAGGTACAAAGGG
OVRT1_0149_B12.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
TES01_0112_B01.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
CLNT1_0096_B04.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0025_C10.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
PST01_0042_A08.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
KDN01_0016_C12.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
CLNT1_0022_F10.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
KDN01_0093_D03.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
PST01_0054_E06.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
PST01_0098_A12.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
KDN01_0028_A09.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
PST01_0074_D09.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
LVR01_0057_C12.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0022_A06.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
KDN01_0079_F03.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
PST01_0039_F12.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
KDN01_0080_C12.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
PST01_0080_F02.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
KDN01_0028_B03.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
KDN01_0008_C02.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
CLNT1_0066_C04.b : AGCTGCGAGGTCTTCGGAATCCCCA*CCCCTGCCCTCCTCTGG*AACCTGGTTCAAAGGG
OVRT1_0128_B05.b : AGCTGCGAGGTCATCCGAATCCCAC*CCCCTGCCCTCATCTGG*AACAAGGTACTAGTGG
OVRT1_0124_B12.b : AGCTGCAAGGTCATTAGAATCCCTC*CCCCTGCCCTCTTTTCG*AACAAGGTATTAAGGG
OVRT1_0132_A05.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCCTCTGG*AACAAGGTACAAAGGG
PST01_0041_H08.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0001_E06.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0004_A04.b : AACTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
CLNT1_0041_F04.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*TACAAGGTACAAAGGG
OVRT1_0041_G09.b : AGCTGCAAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
SPLT1_0001_G07.b : ACCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCAGG*AACAAGGTACAAAGGG
OVR01_0043_B12.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
PST01_0064_F10.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0076_E05.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0126_H09.b : ATCTGCTTGGTCCTCCGAATCCCGA*CCCTGTCCCTCATCTGG*Accactgcaatatttg
CLNT1_0113_G10.b : AACTGCGATGTCATTGGAATCCCAA*CCCCTGCCCTCTTCTGG*TACAAGGTACATTGGG
CLNT1_0146_A11.b : AGCTGCTATGTCATCAGAATCCCAA*CCCCTGCCCTCATCTGGTAACAAGGTACATAGGG
TES01_0101_A03.b : AACTGCGAGGTCTTCGGAATCCCAT*CCCCCTGCCCTTCTCTGGAACAAGGTACAAAGGG
CLNT1_0115_D01.b : ACCTGCTAGGTCATCGGAATCCCAC*CTCTTGCCCTCTTCTGG*AACATGGTACAATGGG
OVRT1_0045_G02.b : ACCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAATGTACTAAGGG
OVRT1_0082_A12.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0098_F02.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0045_B04.b : AGCTGCGAGGTCATCGGAATCCCAT*CCCCTGCCCTCATCTGG*AACATGGTACAAAGGG
OVRT1_0087_B04.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0036_C01.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0078_B06.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0082_B08.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTAACAAGGG
LNG01_0034_G12.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0040_E06.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
LNG01_0046_F07.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
TCH01_0046_A02.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0038_A03.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0069_A11.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0036_C05.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
TCH01_0028_A06.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0041_A04.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0023_B04.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0042_E01.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0036_G06.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0035_F07.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0074_C11.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0084_H08.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
TCH01_0023_B08.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
TCH01_0039_H04.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
TCH01_0087_F04.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
TCH01_0011_H03.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
LNG01_0103_C05.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
TES01_0070_D01.b : ACCTtgcaaggcatcggaattcccacccccggcccctctctgggaacaaggtacaaaggg
OVRT1_0123_G01.b : ACtctgcgtggtcttcagaatccccatctcctgccctcttctggaactatttataatcgg
CLNT1_0128_D11.b : AGCTGCGAGGTCATCGGAATCCCTA*CCCCTGCCCCTCTCTGG*AACAAGGTACAAAGGG
TCH01_0093_B10.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
TCH01_0093_E09.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
CLNT1_0074_H09.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0033_A09.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
TCH01_0085_H10.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
TCH01_0039_E03.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
LNG01_0098_D07.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
THY01_0040_A10.b : ACCTGCGAGGTCcttcgaacccccacctctgccctcctcttgcatcaaggcactaagggg
OVRT1_0106_F03.b : AGCTGCGAAGTCATCTGATTCCCAA*CCCCTGCCCTCATCTGG*AACAAcgttcaaatgt
OVRT1_0064_E08.b : ACCTGCTATGTCATCCTGATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACTAAGGG
OVRM1_0204_C10.b : AGCTGCGAGGTCATCGGAATCCCAACCCCTGCTCCTCATCTGG*AACAAGGTCCAAAGGC
UTR01_0075_C07.b : ATCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRM1_0206_H10.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0143_G01.b : AGCTGCCAGGTTATCGGAATCTCAA*CCCCTGCCCTCATCTGG*AACCAGGTACAAAGGG
OVRM1_0154_A10.b : ATCTGCGAGGTCATCGGAATCC*AA*ACCCTGCCCTCTTCTGG*AACAAGTTACCAAAGG
OVRT1_0141_A10.b : AACTGCAAGGTCATCGTAATCCCTA*CCCCTGCCCTCATCTGG*TAAAAAGTACCAAGGG
OVRT1_0132_E08.b : AACTGCGAGGTCCATCGAATCCCCA*ACCCCGCCCTCATCTGG*AACAATGAACAAAAGG
OVRT1_0136_B01.b : AGCTGCGAGGTCCTCCGGATCCCTA*CCCCTGCCCTTCTCTGG*AACAAGGTACAACGGG
OVRT1_0147_B03.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCCTCTCTGG*AACATGGTACAAAGGG
OVRT1_0143_E01.b : AGCTGCGAGGTCTTCGAAATCCCAA*CCCCTGCCCTCATCTGG*AAAAAGGTACAAAAGG
LNG01_0035_A11.b : AACTGCCAGGTCATCGGAATCCCAA*CCCCTGTCCTCATCTGT*AACAATGTACAAAGGG
LNG01_0080_G12.b : AACTGCGAGGTCATCGGAATCCCCA*CTCCTGTCCTCATCTGG*TACAAGGTTCAAAGGG
TCH01_0033_G03.b : ATCTGCAAGGTCATCGTAATCCCTT*CCCCTGCCCTCATCTGG*AACAAGGTAAAATGGG
OVRT1_0008_G02.b : ATCTGCGAGGTCATCCGAATCCCAA*CCCCTGCCCTCATCTGG*AACCTGGTACAATGGG
TCH01_0012_C01.b : AGCTGCGAGGTCATCGGAATCTCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRM1_0059_H02.b : AGCTGCGAGGTCATCGGAGTTCCAA*CCTCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0028_E11.b : AGCTGCGAGGTCATCAGATTCCCAA*CCCCTGCCCTCTTCTGG*AACAAGGTACAAAGGG
CLNT1_0055_E08.b : AGCTGCGAGGTCATCGGATTCCCAA*CCCCTGCCCTCTTCTGG*AACAAGGTACAAAGGG
OVRT1_0141_A09.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0003_C10.b : AGCTGCGAGGTCATCGGAATCCCACCCCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0147_C10.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0002_A05.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
SMG01_0092_C12.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0054_D09.b : ACCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
HTMT1_0044_C07.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AAACAGGTACAAAGGG
CLNT1_0064_G09.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
UTR01_0045_A04.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
CLNT1_0061_A10.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0085_E08.b : AGCTGCAAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAATGGG
LNG01_0042_H03.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
CLNT1_0064_F02.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0042_D12.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
CLNT1_0096_D04.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0058_D02.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
LNG01_0035_H02.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0073_E02.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0073_A09.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
MLN01_0069_C05.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
LNG01_0034_F12.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0043_F11.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
CLNT1_0051_H02.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0035_E03.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
TCH01_0037_B04.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
LNG01_0091_D10.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
UTR01_0043_B07.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
UTR01_0060_D01.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
MLN01_0101_H05.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
CLNT1_0066_E04.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0048_F02.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
CLNT1_0064_E03.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0031_H01.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
CLNT1_0014_A11.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
UTR01_0052_H06.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
CLNT1_0074_E03.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
CLNT1_0064_B01.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
CLNT1_0062_A10.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
LNG01_0028_F08.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
CLNT1_0007_E05.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0022_E11.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
LNG01_0002_H02.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
TCH01_0027_F05.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
ITT01_0012_E04.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
PST01_0044_E03.b : AACTGTTTGGTCTATCGGAATCCCAAACCCTGCCCTCATCTGGtatctggcactattggg
OVRT1_0005_G05.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
KDN01_0005_A09.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
KDN01_0096_D09.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
KDN01_0091_A05.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
PST01_0042_G06.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
KDN01_0012_B08.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
KDN01_0035_D10.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
TES01_0056_A11.b : AGCTGCGAGGTCATCGGAATCCCAA*CTCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0123_D02.b : AGCTGCGAGGTCTTCGGAATCCCCA*CCCCTGCCCTCATCTGG*AATAAGTTCCGAGGGG
OVRT1_0100_F07.b : AGCTGCGAGGTCTTCGTACTCCCAC*CCCCTGCCCTCAGCTGG*AACAAGGTACTAAGGG
TES01_0059_H04.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
PST01_0072_A08.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
PST01_0099_B11.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0120_H01.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0093_E08.b : AGCTGCGAGGACATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0019_D07.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
CLNT1_0150_E07.b : AGCTGCGAGGTCATCTGAATCCCTA*TCCCTGCCCTCTTCTGT*AATAAGGTACAAAtgt
OVRT1_0100_A06.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0072_D05.b : AGCTGTGAGGTCATCGGAATCCCAC*CCGCTGCCCTCTTTTGG*AACAAGGGTACAAGGG
OVR01_0090_D11.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
OVRT1_0111_F01.b : AGCTGCGAGGTCATCGGAATCCCAA*CCCCTGCCCTCATCTGG*AACAAGGTACAAAGGG
BKFL1_0103_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0056_C12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxx
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
20110601C-012214 : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
---------+---------+---------+---------+---------+---------+ 804
CLNT1_0151_F03.b : gggtcctatgggaagctcaaaggaggggaactcttgccttggtgaccaagataacctggc
PST01_0033_B11.b : G*TCACTAT*GGA*GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
TES01_0020_A03.b : G*TCACTTTGGAGTTTcaaaggtacgaactcttgccctggtgactcttataacctggcca
OVRT1_0100_C01.b : G*TCACTATGGA**GTTCCAAGGACGGAAC*TCTTGCCTGGTGACCGACATActctgtcc
TES01_0001_D08.b : G*TCATTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0044_E01.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
TES01_0040_A03.b : G*TCACTATGGA**GTTCTAAGGATCGAAC*TCTTGCCTGGTGACCGAAATAACCTGTCC
OVRT1_0149_B12.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGATATATCCTGGCC
TES01_0112_B01.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
CLNT1_0096_B04.b : G*TCACTATGGA**GTTCCAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0025_C10.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAAATAACCTGGCC
PST01_0042_A08.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
KDN01_0016_C12.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
CLNT1_0022_F10.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
KDN01_0093_D03.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
PST01_0054_E06.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
PST01_0098_A12.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
KDN01_0028_A09.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
PST01_0074_D09.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCT
LVR01_0057_C12.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0022_A06.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
KDN01_0079_F03.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
PST01_0039_F12.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
KDN01_0080_C12.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
PST01_0080_F02.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
KDN01_0028_B03.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
KDN01_0008_C02.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
CLNT1_0066_C04.b : G*CCTCTATGccattcttaggacggcacctcttgcctggtgaccgacataccctgttctt
OVRT1_0128_B05.b : G*TTACTCTGGC**TTTCCAAGGACGGAATCTCTTGCCTGGTGACCGATATTACCTGccc
OVRT1_0124_B12.b : T*TCACTTTTGA**TTTCAAAGGAATGAAC*TCTTGCATGGGGACCTATAAAACCTGGCt
OVRT1_0132_A05.b : G*TCACTATGGA**GTTCAAAGGACGGACC*TCTTGCCTGGTGACCGAGATACCCTGTCC
PST01_0041_H08.b : G*TCTCTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0001_E06.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGAACGAAAAACCCTGGCC
OVRT1_0004_A04.b : G*TCACTTTGGA**TTTCAAAAGACGGAAT*TCTTTCCTGGTGACCGAGATAACCTGGCC
CLNT1_0041_F04.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0041_G09.b : G*TCACTAATGGA*GTTCAAAAGACCGAAC*TCTTGCCTGGTGACCGATATAACCTGGCC
SPLT1_0001_G07.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVR01_0043_B12.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
PST01_0064_F10.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0076_E05.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0126_H09.b : ggtttcttcggtactcaatggatgctattcctgccttgtgcctccaattacctcgtcctt
CLNT1_0113_G10.b : G*TCACTATGGGatttcaagggactgaattctttgcctggtgatcgattattacttggcc
CLNT1_0146_A11.b : G*TCACTATTGGA*TTTCAATGGACGGAAC*TCTTtgcctggttacaaagataacctggc
TES01_0101_A03.b : G*TCACTTTGGA**TTTCAAAGGACGGAAC*TCTTGCCTGGTGACCCATATAACCTGGCC
CLNT1_0115_D01.b : C*TCACTATGGA**GTTCATATGACCGCAC*TCTTTGCCGGTGACCGAAAataaccgggc
OVRT1_0045_G02.b : G*TCACCATTGGAAGTTCAAAGGAGGAAAC*TCTTGTCTGGTGACCCACATAACTTGGCC
OVRT1_0082_A12.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCCTGCC
OVRT1_0098_F02.b : G*TCACTATGGA**GTTCCAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0045_B04.b : G*TCCCTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGATATAACCTGGCC
OVRT1_0087_B04.b : G*TCACTATGGA**CTTCAAAGGACTGAAC*TCTTGCCTGGTGACCGAAATAACCTGGCC
OVRT1_0036_C01.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0078_B06.b : G*TCACTATGGA**GTTCAAAGGACTGAAC*TCTTGCCTGGTGACCGAGATTACCTGGCC
OVRT1_0082_B08.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCCGAATAACCTGGCC
LNG01_0034_G12.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0040_E06.b : G*TCACTATGGA**GTTCATAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
LNG01_0046_F07.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
TCH01_0046_A02.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0038_A03.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0069_A11.b : G*TCACTATGGA**GTTCTAAGGACGGAAC*TCTTGCCTGGTGACGGAGATAACCTGGCC
OVRT1_0036_C05.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
TCH01_0028_A06.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0041_A04.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0023_B04.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0042_E01.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGTCC
OVRT1_0036_G06.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0035_F07.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0074_C11.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0084_H08.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
TCH01_0023_B08.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
TCH01_0039_H04.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
TCH01_0087_F04.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
TCH01_0011_H03.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
LNG01_0103_C05.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
TES01_0070_D01.b : ggtccttatggaatttcaagggacgaactccttgcctggtggccccggataacccgggcc
OVRT1_0123_G01.b : gttcactattgattttcaaggactgatctcttgcctggtgaccttagatatcctgtccct
CLNT1_0128_D11.b : G*TCCCTATGA***TTTCAAAGGACGGTACCTCTTGCCTGGTGACCGAGATAACCTGGTC
TCH01_0093_B10.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAAATAACCTGGTC
TCH01_0093_E09.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
CLNT1_0074_H09.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0033_A09.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
TCH01_0085_H10.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
TCH01_0039_E03.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
LNG01_0098_D07.b : G*TCACTATGGG**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
THY01_0040_A10.b : tccctcctggagttctactgacgaacacttctttgccttgtgaccaatataaccttgact
OVRT1_0106_F03.b : gttcactatggagtttcataggaccagaatctcttgcctgtggccctatattttctggtt
OVRT1_0064_E08.b : G*TCTCTTTGGAG*TTTCAAGtgcaggatctcttgccctgctctcagttaacctgtccct
OVRM1_0204_C10.b : G*TCACTATGGAC**TTCAAAGGACGAAAC*TCTTGCCcggatgaccaatataccttgcc
UTR01_0075_C07.b : G*TCACTATGGG**ATTCAAAGtgacggaactctttgccttgtgaccgaaaaaacctggt
OVRM1_0206_H10.b : G*TCACTATGGA**GTTCAAAGGACGG*AC*TCTTGCCTGGTGACCGATATAcctggcca
OVRT1_0143_G01.b : G*TCCCTATGGGA*TTTCA*AGGACGGAAC*TCTTGCCTtggggacctaaataacctggc
OVRM1_0154_A10.b : C*GCCCTTTGGGA**TTCAAAAGACCGTAC*TCTTGCCTGGTGACCGAGAATACCTGaac
OVRT1_0141_A10.b : G*TCACCTATGAA*TTTCAAAGGACGGAAC*TCTTGCCctggggactaaattacctggcc
OVRT1_0132_E08.b : GGTCACTATGGA**ATTCAAAGGACGGAAC*TCTTGGCTGGgtgacaaaaataaccttgc
OVRT1_0136_B01.b : G*TCCCTATGGA**TTTCAAAGGACGGAAC*TCTTGCCTGGTGACCcaataaaacctggc
OVRT1_0147_B03.b : G*TTACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCTAGATAACCggcct
OVRT1_0143_E01.b : G*TCACTTTGGG**ATTCAAAGGACGGAAA*TCTTGCCTGGTGACCaaaaataacctggc
LNG01_0035_A11.b : G*TCACTATGGAA*TTTCAAGGGACGAAAC*TCTTGCCTGGTGACCcacaataacctggc
LNG01_0080_G12.b : G*TCACTATGAGA*TTTCT*AGGACTGACC*TTCTGCCTGGTGACGGATATAACCTGTCC
TCH01_0033_G03.b : G*TCACTATGGAA**TTCAAAGGACCGAAC*TCTTGCCTGGTGAACCAGATAACCTGGCC
OVRT1_0008_G02.b : G*TCACTTTGGA**GTTCAAAGGACGGATT*TCTTGCCTGCTGACCGATATAACCTGGCC
TCH01_0012_C01.b : G*TCACTAAGGA**GTTCAAAGGACAGAAC*TCTTGCCTGGTGACCGAGATAAACTGGCC
OVRM1_0059_H02.b : G*TCACTACGGA**GTTCAAAGGACGGAACTCTTTGCCTGGCGACCGAGATAATCTGGTC
OVRT1_0028_E11.b : G*TCTCTCT*GGA*GTTCCAACGACGGAAC*CCTTGCCTGGCGACCGAGATAACCTGAGC
CLNT1_0055_E08.b : G*TCACTATGGA**GTTCACAGGACGGAAC*TCTTGCCTGGTGACCGATATTACCTGGCC
OVRT1_0141_A09.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACGGAGATAACCTGGCC
OVRT1_0003_C10.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0147_C10.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATTACCTGGCC
OVRT1_0002_A05.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACGGAGATAACCTGGCC
SMG01_0092_C12.b : G*TCACTATGGA**GTTTCAAGGACGGACC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0054_D09.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGCCC
HTMT1_0044_C07.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
CLNT1_0064_G09.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGTC
UTR01_0045_A04.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
CLNT1_0061_A10.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0085_E08.b : G*TCACTTTGGA**GTTCAGAGGAGGGAAC*TCTTGCTTGGTGACCGAGATAACCTGACC
LNG01_0042_H03.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
CLNT1_0064_F02.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0042_D12.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
CLNT1_0096_D04.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGCGACCGAGATAACCTGGCC
OVRT1_0058_D02.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
LNG01_0035_H02.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0073_E02.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0073_A09.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAAATAACCTGGCC
MLN01_0069_C05.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
LNG01_0034_F12.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0043_F11.b : G*TCACTATGGA**GTTCACAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCT
CLNT1_0051_H02.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0035_E03.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
TCH01_0037_B04.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
LNG01_0091_D10.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
UTR01_0043_B07.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
UTR01_0060_D01.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
MLN01_0101_H05.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
CLNT1_0066_E04.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0048_F02.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
CLNT1_0064_E03.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGCGACCGAGATAACCTGGCC
OVRT1_0031_H01.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
CLNT1_0014_A11.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
UTR01_0052_H06.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
CLNT1_0074_E03.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
CLNT1_0064_B01.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
CLNT1_0062_A10.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
LNG01_0028_F08.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
CLNT1_0007_E05.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGACC
OVRT1_0022_E11.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
LNG01_0002_H02.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
TCH01_0027_F05.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
ITT01_0012_E04.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
PST01_0044_E03.b : tcactatggtatcttaaaggatctgattcttgcctggtgatcgagattaccctgatcctt
OVRT1_0005_G05.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
KDN01_0005_A09.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
KDN01_0096_D09.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
KDN01_0091_A05.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
PST01_0042_G06.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
KDN01_0012_B08.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
KDN01_0035_D10.b : G*TCACTATGGA**GTTCAAATGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
TES01_0056_A11.b : G*TCATTATGGA**GTTGTCAGGACGGACC*TCTTGCCCGGAGACCGACATAACCTGGCC
OVRT1_0123_D02.b : T*TCACTATGGA**GTTTTTAGGCCGGAAC*TCTTGCCTGGTGACCGAAATTACCTGGtc
OVRT1_0100_F07.b : T*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGATATTACCTGTCC
TES01_0059_H04.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
PST01_0072_A08.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
PST01_0099_B11.b : G*TCACTATGGA**GTTCATAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0120_H01.b : GGTCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGGACGAAAT*ACCTGGTC
OVRT1_0093_E08.b : G*TCACTATGGA**GTTCAAAGGACCGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0019_D07.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
CLNT1_0150_E07.b : gttacttatttatttcaattgaaagaactcttgcttggtgacctaaatatactgatcttt
OVRT1_0100_A06.b : G*TCACTATGGA**GTTTCAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0072_D05.b : G*TCACTGTGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGGGACCTATATTACCTGGTC
OVR01_0090_D11.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
OVRT1_0111_F01.b : G*TCACTATGGA**GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
BKFL1_0103_C07.b : xxxxxxxxxxxxA*GTTCAAAGGACGGAAC*TCTTGCCTGGTGACCGAGATAACCTGGCC
BKFL1_0056_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0049_E07.b : nnn
ILNT1_0020_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
20110601C-012214 : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
---------+---------+---------+---------+---------+---------+ 862
CLNT1_0151_F03.b : ctatcaaaagcaggggggcccaaaaatacctgatcggccggcctgggggctatcactcat
PST01_0033_B11.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
TES01_0020_A03.b : ttcgtactcgtggtggcccacaaaagcctgatttgtctgtctggttgcttgatatctccc
OVRT1_0100_C01.b : tttctacgccggggggcccataatactttgattgaccggctgggtgcttattttccctct
TES01_0001_D08.b : *ATTCTTACTCGGGGTGGCCTATAAAAACATGTATTGACT*GGCTGGGTGCTGAATTCTC
OVRT1_0044_E01.b : *ATTCAAACGCGGGGTGGCCCCtcaaaccctcgagtggacggactgggggctgatatcct
TES01_0040_A03.b : *TTTCTAACGCGGGGTGGCCCATAAAACCATGAATTGACGGGGCCGGGTGCTGATTTCCC
OVRT1_0149_B12.b : *TTTCAGACGCGGGTTGGCCCATATATCCCTGAATTGCCG*GGCTGGGTGCTtaattctc
TES01_0112_B01.b : *ATTCAGACGCGGGGTGGCCCAAGAAAGCATGAAGTTGACGGGCTGGGTGCTGATATCTC
CLNT1_0096_B04.b : *ATTCTGACGCCGGGTGGCCCAGAAAAGCATGTATTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0025_C10.b : *ATTCAGACGCGGGGTGGCCCCGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
PST01_0042_A08.b : *ATTCAGACGCGGGGTGGCCCACAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
KDN01_0016_C12.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
CLNT1_0022_F10.b : *ATTCAGACGCGGGGTGGCCCACAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
KDN01_0093_D03.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
PST01_0054_E06.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
PST01_0098_A12.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
KDN01_0028_A09.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
PST01_0074_D09.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
LVR01_0057_C12.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0022_A06.b : *ATTCAGACGCGGGGTGGCCCAATAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
KDN01_0079_F03.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
PST01_0039_F12.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
KDN01_0080_C12.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
PST01_0080_F02.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
KDN01_0028_B03.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
KDN01_0008_C02.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
CLNT1_0066_C04.b : cagacgcggggtggccccaaaatcctccattgacggcctggggtgcctgattccccctct
OVRT1_0128_B05.b : tttctaatgcggggtgccctccatacctgatttgccggcccggtgctgatatctccctct
OVRT1_0124_B12.b : ttcttacgctggtggggctttataaacatgatgttacgggcttgatgctgatccttctct
OVRT1_0132_A05.b : *ATTCAAACCCGGGGTGCCCCAGAAAAagcttgaactgccgggctgggtgcctgattctc
PST01_0041_H08.b : *ATTCATACGCGGGGTGGCCCACAAAAGCATGATTTGACG*AGCTGGGTGCTGATATCTC
OVRT1_0001_E06.b : **TTCAGACGCGGGGTGGCCTA*AAAAGCATGAATTGACG*CGTTGTGTGCTGATATCTC
OVRT1_0004_A04.b : AATTCAGACCCGGGGTGGCCCAAAAAAGCCTGAAGTGATCAGGCTGGGTGCTGATATCTC
CLNT1_0041_F04.b : *ATTCAAACCCGGGGTGGCCCAGTAAATCATGAAGTGACG*GGCTGCGTGCTGATATCTC
OVRT1_0041_G09.b : *ATTCAAACGTGGGGTGGCCCAAAAAAGCATGAAGTGACT*GGCTGGGTGCTAATATCTC
SPLT1_0001_G07.b : *ATTCAGACGCTGGGTGGCCCA*AAAATCATGAAATGACG*GGCTGGGTGCTGATATCTC
OVR01_0043_B12.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
PST01_0064_F10.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0076_E05.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAATGACA*GGCTGGGTGCTGATATCTC
OVRT1_0126_H09.b : ttatgagccggggtggctcttatattcaccacaccgcccggcccgttgtttcttttcttc
CLNT1_0113_G10.b : attcctaacccggggggtcctaaaaatcctgaagtgacggggctggtgctgatacctccc
CLNT1_0146_A11.b : ctttaaacgcggggcggcccaaaaaacctgcactgatgggctgggtgcctaaacctcctc
TES01_0101_A03.b : *CTTCATACCCGGGGTGGGCCCATAAAagcttgatttgtctggctgggtggctgtttctc
CLNT1_0115_D01.b : tttttcaacgctgggtggcccttaaaaatctgtatgtggcggcctgtgtgctgttatctc
OVRT1_0045_G02.b : *ATACATACacggtgtgggcccaaaaaaaaatgaaatgtctggctggatagcatatattt
OVRT1_0082_A12.b : CATTCCAACCCGGGGTGGCCCATAAA*GCATGATTTGACG*GGCTGGGgtgctgaattcc
OVRT1_0098_F02.b : *CTTCAGACGCGGGGTGGCCCAAAAAAGCTTGAATTGACG*GGCTGGATGCTGATACCCC
OVRT1_0045_B04.b : *TTTCTAACGCGGGGTGGCCCAGAAAATCATTAATTGACG*GGCTGGGGGCTGATATCTC
OVRT1_0087_B04.b : *ATTCAGACGCGGGGTGGCCCAAAAAAGCTTTAAGTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0036_C01.b : *ATTCAGACGCGGGGTGGCCCATAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0078_B06.b : *ATTCAGACGCCGGGTGGCCCAGAAAAGCCTGAAGTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0082_B08.b : *ATTCAGACCCGGGGTGGCCCAAAAAAGCATGAAATGACG*GGCTGGGTGCTGATATCTC
LNG01_0034_G12.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0040_E06.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAATGACG*GGCTGGGTGCTGATATCTC
LNG01_0046_F07.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAATGACG*GGCTGGGTGCTGATATCTC
TCH01_0046_A02.b : *ATTCAGACGCGGGGTGGCCCAGATAACCATGGAATGACG*GGCTGGGTGCTGATATCTC
OVRT1_0038_A03.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0069_A11.b : *ATTCAAACGCGGGGTGGCCCCCAAAAACATGAATTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0036_C05.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
TCH01_0028_A06.b : *ATTCATACCCGGGGTGGCCCATAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCCC
OVRT1_0041_A04.b : *ATTCAGACGCGGGGTGGCCCAAAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0023_B04.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0042_E01.b : *CTTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGCGTGCTGATATCTC
OVRT1_0036_G06.b : *ATTCAGACGCGGGGTAGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0035_F07.b : *ATTCAGACGTGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0074_C11.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAATTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0084_H08.b : *ATTCAGACGCGGGGTGGCCCAAAAAATCATGAAGTGACG*GGCTGGGTGCTGATATCTC
TCH01_0023_B08.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
TCH01_0039_H04.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
TCH01_0087_F04.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
TCH01_0011_H03.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
LNG01_0103_C05.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
TES01_0070_D01.b : tttcaaacccgggggggccccaaaaaaccttgaattaccgggcttgggggctaaatttcc
OVRT1_0123_G01.b : tctttactctggggtggctcataaacgctttaacttgacttgctgggtgtttatattttc
CLNT1_0128_D11.b : *TTTCTGACGCcgggggggcccatacaagcatgatttgaccggcctgggggccaatttcc
TCH01_0093_B10.b : *ATTCAGACTCGGGGTGGCCCAAAAAAACATGAAGTGACG*GGCTGGGTGCTGATATCTC
TCH01_0093_E09.b : *ATTTCGACGCGGGGTGGCCCATAAAAGCATGAAGTGACC*GGCTGGGTGCTGATATCTC
CLNT1_0074_H09.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0033_A09.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
TCH01_0085_H10.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
TCH01_0039_E03.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
LNG01_0098_D07.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
THY01_0040_A10.b : attcaaaccccacttcggccccacaaatacatttcaatgactggcctggccgtcagaatt
OVRT1_0106_F03.b : attttgcactcgggtggaccactaacacttgtacttccccgcctgtgttatcacattccc
OVRT1_0064_E08.b : tcagacgcggggtcggcccataaaagccttgactttaccgccctggttgctgatttcctc
OVRM1_0204_C10.b : attcttacgcagtgtggtccagaaatgcatcaatgccggctcgggtgctgcggaaggtgc
UTR01_0075_C07.b : ccattcaaacgcggggtggcccataaaaccaagaactgccgggcctggggtgctaattat
OVRM1_0206_H10.b : ttcaaaccggcgtggcccaaaaaacatgaactgacgggccggggctgatactcctcttac
OVRT1_0143_G01.b : cctttctaacgcggggtggccccataatatccttgaattggacgggtctgggctgcgatt
OVRM1_0154_A10.b : attcataagtcggggtgtcccaaaaaatctgaactgacgggtctggttcctgatt
OVRT1_0141_A10.b : ctttctaagcggggtgggccaaaaaatctgaagttgcgggcttggttcctttttccctct
OVRT1_0132_E08.b : cctttcaaacgcgggttgccacttaaaagcttgaatttgcccgccctggtgctattcccc
OVRT1_0136_B01.b : cttttcacacccggggtggcccacaaaagcttgaactgcccggctggggtcctaaattct
OVRT1_0147_B03.b : ttcaaacgcggggtggcccctataatctcgatttgacggggtggggggctgattacccct
OVRT1_0143_E01.b : catttcaaatgtggggtgggcccagaaaaaacttaattggacgggcttggttgctaaatt
LNG01_0035_A11.b : cctttcccaccccgggtggcccataaaaccattgaatgaccgggctgggtgctgatatcc
LNG01_0080_G12.b : *ATTCAGAatgcgggttgacccaaaaaaacattgacatgactggctggttgctgatttct
TCH01_0033_G03.b : *CTTCATACCCGAGGTGGtccctaaaaacctggatgtgactggctgaggtgctgatttct
OVRT1_0008_G02.b : *ATTCAGACGCGCGGTGGCCCAAAAAATCATGAATTtgatcggctgggtgctcatatctc
TCH01_0012_C01.b : *ATTCATAACCGGGGAGAGCAAAAAAAACATGAAaatgactggctgggtgctaaaatctc
OVRM1_0059_H02.b : *CATCAGACGCGGGGTGGCCCACATAACCATGAAGTGACC*GGCTGGGCGCTGACATCTC
OVRT1_0028_E11.b : *ATTCAGACGCGGGGTGGCCCATACCAGCATGAAATGACTTCCCTGGCTGCTGACATCTC
CLNT1_0055_E08.b : *ATTCAGACGCGGGGTGGCCCAAAAAAGCATGAAGTGACG*GGCTGGGTGCTGAAATCTC
OVRT1_0141_A09.b : *TTTCAAACGCGGGGTGGCCCAAAAAACCATGAAGTGCCG*GGCTGGGTGCTGATATCCt
OVRT1_0003_C10.b : *ATTCAGACCCGGGGTGGCCCACAAAAGCTTGAAGTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0147_C10.b : *ATTCAGACGCTGGGTGGCCCCTAAAAGCCTGAAGTGACG*GGCTGGGTGCTGATTCCTC
OVRT1_0002_A05.b : *ATTCAGACGCGGGGTGGCCCAAAAAAGCATGAATTGACG*GGCTGGGTGCTGATTTCTC
SMG01_0092_C12.b : *ATTCAGACGCGGGGTGGGCCAGAAAAGCATGAATTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0054_D09.b : *ATTCATACGCGTGGTGGCCCAAAAGAGCATGAAGTGACC*GGCTGGGTGCTGATATCTC
HTMT1_0044_C07.b : *ATTCAAACGCGAGGTGGCCCAAAAAACC*TGAAATGACG*GGTTGGGTGGTGATATCTC
CLNT1_0064_G09.b : *ATTCAGACGCGGGGTGGCCCACAAAAGCATGAACTGACG*GGCTGGGTGCTGATATCTC
UTR01_0045_A04.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
CLNT1_0061_A10.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0085_E08.b : *ATTCATACGCGGGGTGGCCCAGAAAAGCATGAAGTGACT*GGCTGGGTGCTGATACCTC
LNG01_0042_H03.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
CLNT1_0064_F02.b : *ATTCAGACGCGGGGTGGCCCAGACAAGCCTGAAGTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0042_D12.b : *ATTCAGACGCGGGGTGGCCCAAAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
CLNT1_0096_D04.b : *ATTCAGACGCGGGGTGGCCCAAAAAAGCATGAATTGACG*GGCTGGGTGCTGATATCCC
OVRT1_0058_D02.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
LNG01_0035_H02.b : *ATTCAGACGCGGGGTGGCCCAAAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0073_E02.b : *ATTCAGACGCGGGGTGGCCCACAAAAGCATGAAGTGACG*GGCTGGCTGCTGATATCTC
OVRT1_0073_A09.b : *ATTCAGACGCGGGGTGGCCCATAGAAAGCTGAAGTGACC*GGCTGGGTGCTGATATCTC
MLN01_0069_C05.b : *ATTCAGACGCGGGGTGGCCCACAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
LNG01_0034_F12.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0043_F11.b : *CTTCAGACGCGGGGTGGCCCAGAAAAGCCTGAAGTGACGGGCCTGGGTGCTGATATCTC
CLNT1_0051_H02.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0035_E03.b : *ATTCAGACGCGGGGTGGCCCAGAACAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
TCH01_0037_B04.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
LNG01_0091_D10.b : *ATTCAGACGCGGGGTGGCCCCAGAAAGCATGAAGTGACC*GGCTGGGTGCTGATATCTC
UTR01_0043_B07.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
UTR01_0060_D01.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
MLN01_0101_H05.b : *ATTCAGACGCGGGGTGGCCCAGANAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
CLNT1_0066_E04.b : *ATTCAGACGCGGGGTGGCCCACACAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0048_F02.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACGGGCCTGGGTGCTGATATCTC
CLNT1_0064_E03.b : *ATTCCGACGCGGGGTGGGCCAGAAAACCCTGAAGTGACG*GGCTGGGTGCTGATATCCC
OVRT1_0031_H01.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
CLNT1_0014_A11.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
UTR01_0052_H06.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
CLNT1_0074_E03.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
CLNT1_0064_B01.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
CLNT1_0062_A10.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
LNG01_0028_F08.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
CLNT1_0007_E05.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAATTGACT*GGCTGGGTGCTGATATCTC
OVRT1_0022_E11.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GACTGGGTGCTGATATCTC
LNG01_0002_H02.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
TCH01_0027_F05.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
ITT01_0012_E04.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
PST01_0044_E03.b : cttgactttgcttgtctcttattattttgttcggaatgtgtttgcgtctatatttcttct
OVRT1_0005_G05.b : *ATTCCGACGCGGGGTGGCCCCAAAAAACATGAAGTGACG*GGCTGGGTGCTGATATCTC
KDN01_0005_A09.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
KDN01_0096_D09.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
KDN01_0091_A05.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
PST01_0042_G06.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
KDN01_0012_B08.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
KDN01_0035_D10.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
TES01_0056_A11.b : *TTTCATACGCTGGGTGGCCCAAAAAtaccttgagttgagggctgggcgccgcaatcccc
OVRT1_0123_D02.b : ttttctcacgctgggtggcactttaaagcatgtttctactggttgggtgctgatttctcc
OVRT1_0100_F07.b : *ATTCCGACCCGGGTTGGCCCAAAtatcctgtactgaccggcttggtgctgattcccccc
TES01_0059_H04.b : *CTTCCGACCCGGGGTGGCCCAGATAAGCCTGAAGTGACC*GGCTGGGTGCTGATATCCC
PST01_0072_A08.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
PST01_0099_B11.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0120_H01.b : *ATTCATACCCGGGGTGGCCCATAAAAccttgcaatgcctggctgggtgcctgatttctc
OVRT1_0093_E08.b : *ATTCAAACGCTGGGTGGCCCAAAAAA*CATGAAATGACG*GGCTGGGTGCTGATATCAC
OVRT1_0019_D07.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
CLNT1_0150_E07.b : cataccgtgtggttgcacatataatctttaaatgtccgtcttgggttgctgatatctcct
OVRT1_0100_A06.b : *ATTCAGACGCGGGGTGGCCCCCAAAAGCATGAAGTTGACGGGCTGGGTGCTGATATCTC
OVRT1_0072_D05.b : *ATTCTTACGCGGGGTGGCCCAAAAAACATGATCTCGAC**GGCTTGGTGCTGATATCTC
OVR01_0090_D11.b : *ATTCAGATGCGGGGTGGCCCATAAAAACATCAAGTGACG*GGCTGGGTGCTGATATCTC
OVRT1_0111_F01.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
BKFL1_0103_C07.b : *ATTCAGACGCGGGGTGGCCCAGAAAAGCATGAAGTGACG*GGCTGGGTGCTGATATCTC
BKFL1_0056_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGCTGATATCTC
BKFL1_0049_E07.b : nccaataannnnnaaagaaacctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0020_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
20110601C-012214 : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
---------+---------+---------+---------+---------+---------+ 917
CLNT1_0151_F03.b : tttagcatggtaaaacccggtgaacttggactgccatgccccttatctcaggggatgggt
PST01_0033_B11.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
TES01_0020_A03.b : cctactttagatttaccctggatattttgattgccatgctcctttattcccatgtcctgc
OVRT1_0100_C01.b : tagtaagggaacacctggaaagtttgattgcctgccgcctaatccctaaggaccggcttc
TES01_0001_D08.b : CTC*TTTtttatgaatactcttgagattttgaattgccttgcactaaactcccatggaca
OVRT1_0044_E01.b : cctccttattaggaacacccctggatattattaatgccttgctccctaactcctcaagga
TES01_0040_A03.b : CTC*TTATTAAGGAA*GACTCTG*GAAAGTTT*GAATGCCCTtgcattaactcccaagga
OVRT1_0149_B12.b : ctccttacttagggagaaccttggaacttttgattgccttgccgttaactcccagggaag
TES01_0112_B01.b : CTC*TTAATTAAGAA*GACGCTGGGAGAGTAT*GAATTGCATGCAGCT*AACTCCCAAAG
CLNT1_0096_B04.b : CTC*TTTATTAGGAA*AACCCTT*GGAAGTAT*GATTGCCATGCCCCT*ACTTCCCCAGG
OVRT1_0025_C10.b : CTC*TTAGTAAGGA**GACGCTG*GAGAGTAT*GATTGCCATGCAGCT*AACTCCC*AGG
PST01_0042_A08.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GATTGCCATGCATCT*AACTCCCAAGG
KDN01_0016_C12.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*ACCTCCCAAGG
CLNT1_0022_F10.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCCAGG
KDN01_0093_D03.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
PST01_0054_E06.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
PST01_0098_A12.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
KDN01_0028_A09.b : CTC*TTNAGTAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
PST01_0074_D09.b : CTC*TTAATAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
LVR01_0057_C12.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
OVRT1_0022_A06.b : CTC*TTAGT*AGGAA*GACGCTG*GAGAGTAT*GATTGCCATGCAGCT*AACTCCCCAGG
KDN01_0079_F03.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCATCT*AACTCCCAAGG
PST01_0039_F12.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
KDN01_0080_C12.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
PST01_0080_F02.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
KDN01_0028_B03.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
KDN01_0008_C02.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
CLNT1_0066_C04.b : taccaagtgagaccctggcaagtatgaatgccatgccgattccttcccatggccgggctt
OVRT1_0128_B05.b : tctacaattatctcgattgttcattcccttgcattttattccctttgcccgcttctcctt
OVRT1_0124_B12.b : tataaagtatacccttggttattttatccccattgattctatttcccgctgttatgtttt
OVRT1_0132_A05.b : ctccttataaggaaaacgctgggaaatatgattgcctttgcactaactcccaaggacggg
PST01_0041_H08.b : CTC*TTTATAAGGAA*GACGCTG*GAGAATAT*GGATGCCATGCACCT*AACTCCCATGG
OVRT1_0001_E06.b : CTC*TTTATAGAGAA*AACGCTG*GAtaagtttgatgcccttgcaccaactcctcaggac
OVRT1_0004_A04.b : CTC*Tcataaagaacacactgaaagtttgagtgcctgcatctaacccccaggagggcttt
CLNT1_0041_F04.b : CTC*TTTATTAGGGA*TACCCTG*GTAAGTAT*GAGTGCCCTGCAGCT*ACTTCCCAGGt
OVRT1_0041_G09.b : CTC*TTTAGTAGGAA*GAAGCTG*GAGAGGAT*GAATGCCATGCACCT*AAATCCCAAGG
SPLT1_0001_G07.b : CTC*TTAGTAAGGAA*AAAGCTG*GAGTATAT*GAATGCCATGCAGCT*AACTCCCCAGG
OVR01_0043_B12.b : CTCCTTAGTAAGGAA*GACGCTG*GAAAGTAT*GAGTGCCTTGCAGCT*AACTCCCAAGG
PST01_0064_F10.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
OVRT1_0076_E05.b : CTC*TTATTAANGAA*GACCCTG*GAGAATAT*GAGTGCCATGCAACT*TAATCCCAAGG
OVRT1_0126_H09.b : tttccttcacgtacactctttcccgttttttttttctcccctcctttttcttcctggctg
CLNT1_0113_G10.b : cctttttaagtacaccttggataatatgtgttcctttctacttcacttcttaagacaggc
CLNT1_0146_A11.b : ttcttaaggataagctggacaatatgaatgccatgcctctaattcccaatgacttggttt
TES01_0101_A03.b : ccccttatttgggaaataccctgtatatttttgattgccttgcaatttatttccaaggga
CLNT1_0115_D01.b : ctcttaattaggaacattcctggaaattatcattgcttcctctcttacttccaggtcctg
OVRT1_0045_G02.b : acactaaataaagatataccctggtaaataataaatgcaattgcacctactcccaaggaa
OVRT1_0082_A12.b : tcctcttacttaggaaaaccctggacagtatgagtgcctggccccctattcccaaggaac
OVRT1_0098_F02.b : CCC*TTAATATGGGA*GACACTG*GAaaattttattgccttgccccctacttccctagga
OVRT1_0045_B04.b : CTC*CTAATAAGGGA*AACCCTG*GAGAGTAT*GATTGgcctgccagctaactcccaggg
OVRT1_0087_B04.b : CTC*TTTGTAAGGAA*AACGCTG*GAAATTTT*GAGTGCCATGCgtcttcactccccatg
OVRT1_0036_C01.b : CTC*TTA*TTAGGAA*GACGCTG*GAAAATAT*GATTGCCCTGCATCT*AATTCCCAAGG
OVRT1_0078_B06.b : CTC*TTTATAAGGAA*AACTCTT*GAAAGTAT*GAATGCCATGCAGCT*TACTCCCCTGG
OVRT1_0082_B08.b : CTC*TTACTAAGGAA*GACGCTG*GAGAGTAT*GACTGCCCTGCATTT*AACTCCCCAGG
LNG01_0034_G12.b : CTCTTAGTAAAGGAA*GACGCCTGGAGAGTAT*GAGTGCCATGCAGCTTAACTCCCAAGG
OVRT1_0040_E06.b : CTC*TTATTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTTCCAAGG
LNG01_0046_F07.b : CTC*TTAGTAAGGAAAGACGCTG*GAAAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
TCH01_0046_A02.b : CTC*TTAGTAAGGAA*GACCCTG*GAGAGTAT*GATTGCCCTGCACCT*TACTCCCCAGG
OVRT1_0038_A03.b : CTC*TTAGTAAGGAA*GACCCTG*GAGAGTAT*GACTGCCATGCGCCT*A*CTCCCAGGG
OVRT1_0069_A11.b : CTC*TTAGTAAGGAA*GACGCTG*GATAGTAT*GAATGCCATGCATCT*AACTCCCAAAG
OVRT1_0036_C05.b : CTC*TTAATAAGGAA*GACTCTG*GAAAGTAT*GAGTGCCATGCCACT*AACTCCCA*GG
TCH01_0028_A06.b : CTCTTTAATAAGGAA*AACGCTG*GAAAGTTA*TGATGCCATGCACCTAACTCCCCAAGG
OVRT1_0041_A04.b : CTC*TTATTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAACT*AACTCCCCAAG
OVRT1_0023_B04.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
OVRT1_0042_E01.b : CTC*TTAGTAAAGAA*AACGCTG*GAAAGTATTGAGTGCCCTGCACCT*AACTCCCAAGG
OVRT1_0036_G06.b : CTC*TTAATAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
OVRT1_0035_F07.b : CTC*TTANTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAAG
OVRT1_0074_C11.b : CTC*TTANTAAGGAA*AACGCTG*GAGAGTAT*GAGTGCCTTGCAGCT*AACTCCCAAGG
OVRT1_0084_H08.b : CTC*TTAGTAAGGAA*GACCCTG*GAAAGTAT*GATTGCCATGCTACT*AACTCCCAAGG
TCH01_0023_B08.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCC*AGG
TCH01_0039_H04.b : CTC*TTAGTAAAGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
TCH01_0087_F04.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
TCH01_0011_H03.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCCAAG
LNG01_0103_C05.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
TES01_0070_D01.b : cccttaataagaaaacaccctggaaatattaaatgcccttgcccctaacccccagggaaa
OVRT1_0123_G01.b : cttcttttttgggaaaccccttgaagtttgattttccttgctacttacttttctggatcc
CLNT1_0128_D11.b : cctccttatcaagaatactcttggatacttttagtgccctgccacttaacttcctagggt
TCH01_0093_B10.b : CTC*TTAATAAGGAA*GACGCTG*GAAAATAT*GATTGCCATGCAGCT*TAATCCCAAGG
TCH01_0093_E09.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCCTGCAGCT*ACCTCCCAATG
CLNT1_0074_H09.b : TTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
OVRT1_0033_A09.b : CTC*TTAGTAAGGAA*GACCCTG*GAGAGTAT*GAGTGCCATGCAGCT*TACTCCCAAGG
TCH01_0085_H10.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
TCH01_0039_E03.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
LNG01_0098_D07.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
THY01_0040_A10.b : tttccctccttcttagttaataccccttgtagtacaatgtcttgcccatgctttttaact
OVRT1_0106_F03.b : cctattttaggattatgccttatcaatatatgtccctgtaccctcctttttctgttgcct
OVRT1_0064_E08.b : ccctttgtataggatttaccctgtaaatttttatttccctgtcactttacttcccaaggt
OVRM1_0204_C10.b : tcatctgtaacctgcttactacattatctgcctacctaaca
UTR01_0075_C07.b : ttcctttaataaaaaaaaacctggtaaaaatgaatgcccatgcatctaaaacctaaagaa
OVRM1_0206_H10.b : aaggaaaacctggataa
OVRT1_0143_G01.b : ttctcctcttatttagggacaaccttggatatttttatggtccttgcttccttctcccca
OVRM1_0154_A10.b :
OVRT1_0141_A10.b : ttaacacgaaaattttgaaagatttattcccttcatttactccaatgtacagccttttca
OVRT1_0132_E08.b : cctcttatcaggaaaaacctgggaaattttgatttgccatggccctaatttccaaggcct
OVRT1_0136_B01.b : cccccttaccatggagacccctggacattttgattgccttgcttcctacccccacggaac
OVRT1_0147_B03.b : tctaatttaggaagacctcgggttttttgattctctgcggctaacttccaaggcgggctt
OVRT1_0143_E01.b : ctctcccttttttacggatcacccttgtaatttctaactcccatgcctattatctcccaa
LNG01_0035_A11.b : tcctcttcattaaggaagaactctgtgaactagaactgccatgcacccttaattccccag
LNG01_0080_G12.b : tctcctaagaaggaatacgctggatcatatgagtccccatgttcctatctcaaaggaccg
TCH01_0033_G03.b : cttctttaccaaggacaaagctggaaagtaggaattgtcctggcacctaactcccaagga
OVRT1_0008_G02.b : cctcttatatcgaagacgcttggatatcttgagcgccttgtaccttacctcccaggacag
TCH01_0012_C01.b : ctcataccaaaggaagacccttggacattaagagtgccatacatcaaaatccctaggaaa
OVRM1_0059_H02.b : CTC*TTACTAAGGcacn
OVRT1_0028_E11.b : CTC*TTAatatggaagaagctggatatcatgattgccatgcctctaaccccccaggaatg
CLNT1_0055_E08.b : CTC*CTTATAAGGAAcacccctggatagtttgaatgcctttgcgctaactccccaggacc
OVRT1_0141_A09.b : cttcctattaaggaagacgcctgaaaagtatgaatgccttgcaactaactccccaaggaa
OVRT1_0003_C10.b : CTC*TTAATAAAGAgacgctggatattttgagtgctctgccccttactcccaaggaacgg
OVRT1_0147_C10.b : CCC*TTATTAAGGAgaacctggaaattatgagtggccttcttcttaatcccgaaggaggg
OVRT1_0002_A05.b : CTC*TTATTAAGGAA*GACGCTG*GAGAGTAT*GAGTGGCATGCAACT*TAATCCCctag
SMG01_0092_C12.b : CCC*T*ANTAAGGAA*GAACCTG*GGAAATAT*GATTGCCCTGCAGCT*AACTCCCCAGG
OVRT1_0054_D09.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GGATGCCTTGCCGCT*CATTCCCCAGG
HTMT1_0044_C07.b : CTC*TTAGAAAGGAA*AACGCTG*GAAATTAT*GAGTGCCATGCACCT*TACTCCCAGGa
CLNT1_0064_G09.b : CCC*TTTGTAAGGAC*GACGCTG*GAGAGTAT*TAGTGCCATGCAGCT*AACTCCCAACG
UTR01_0045_A04.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
CLNT1_0061_A10.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCTTGCAGCT*AACTCCCAAGG
OVRT1_0085_E08.b : CTC*TTACTAAGGAA*GACGCTG*GAGAGTAT*GAATGCCATGCANCT*AACTCCCCAGG
LNG01_0042_H03.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*TACTCCCAAGG
CLNT1_0064_F02.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*ACCTCCCCAGG
OVRT1_0042_D12.b : CTC*TTTGTAAGGAA*GACCCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAAG
CLNT1_0096_D04.b : CTC*TTATTAAGGAA*GACGCTG*GAGAGTAT*GATTGCCATGCAGCT*TACTCCCAAGG
OVRT1_0058_D02.b : CTC*TTATTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
LNG01_0035_H02.b : CTC*TTAATAAGGAA*AACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
OVRT1_0073_E02.b : CTC*TTACTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCCAGG
OVRT1_0073_A09.b : CTC*TTACTAAGGCA*AACGCTT*GAGAATAT*GAGTGCCTTGCCGCT*AACTCCCAAGG
MLN01_0069_C05.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAACT*AACTCCCAAGG
LNG01_0034_F12.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
OVRT1_0043_F11.b : CTC*TTATTAAGGAA*GACGCTG*GAAAGTAT*GAGTGCCATGCATCT*TACTCCCAAGG
CLNT1_0051_H02.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*TACTCCCCAGG
OVRT1_0035_E03.b : CTC*TTAGTAAGGAA*GACGCTG*GATAGTAT*GAGTGCCATGCCGCC*TACTCCCAGGG
TCH01_0037_B04.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
LNG01_0091_D10.b : CTC*TTATTAAG*AA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*TACTCCCAAGG
UTR01_0043_B07.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAGGG
UTR01_0060_D01.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAATGCCATGCACCT*AACTCCCAAGG
MLN01_0101_H05.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
CLNT1_0066_E04.b : CTC*TTAGTAAGGAA*GACGCTG*GATAGTAT*GATTGCCATGCAGCT*ACTTCCCCACG
OVRT1_0048_F02.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
CLNT1_0064_E03.b : CCC*TTAGTAAGGAA*GACCCTG*GAGAGTAT*GAGTGCCATGCATCT*AACTCCCAAGG
OVRT1_0031_H01.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCCTGCAGCT*TACTCCCCAGG
CLNT1_0014_A11.b : CTC*TTAGTAAAGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCCCCT*AACTCCCCAGG
UTR01_0052_H06.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
CLNT1_0074_E03.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
CLNT1_0064_B01.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCN*TACTCCCCAGG
CLNT1_0062_A10.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
LNG01_0028_F08.b : CTCCTTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCCGCT*AACTCCCGAGG
CLNT1_0007_E05.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAGGG
OVRT1_0022_E11.b : CTC*TTAATAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
LNG01_0002_H02.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
TCH01_0027_F05.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
ITT01_0012_E04.b : CTC*TTAGNTAGGAA*GACCCTG*GATAGTAT*GAGTGCCATGCCCCT*AACTCCCAAGG
PST01_0044_E03.b : tacctttttttaccctctggatactttttatgcccagccttctcgctctacatttgccgg
OVRT1_0005_G05.b : CTC*TTATTAAGaaaacgctggaaatttgattgcctgtctctaattcccaaggacagctt
KDN01_0005_A09.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAGGG
KDN01_0096_D09.b : CTC*TTTATAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTTCCAAGG
KDN01_0091_A05.b : CTC*TTAGTAAGAAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
PST01_0042_G06.b : CTC*TTAGTAAGGAA*GACTCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
KDN01_0012_B08.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
KDN01_0035_D10.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
TES01_0056_A11.b : ccttattaaacgaaaatcctgggagagtatttattgtcatgctcctaactccccaggact
OVRT1_0123_D02.b : ctcttatcaataaagactcttgttagtttatttgcctttcttcttattccttattctggt
OVRT1_0100_F07.b : ttaattaggaatacgctggacagtatgattggcctggctcttaatcccatggtcaggctt
TES01_0059_H04.b : CTC*CTATTAAGGAA*GACCCTG*GAGAATAT*GAATGCCATGCAGCT*TACTCCCAAGG
PST01_0072_A08.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
PST01_0099_B11.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
OVRT1_0120_H01.b : cccctactaacgaaaactctggatattttgagtgccttgcttttacttcccaggaatggt
OVRT1_0093_E08.b : CTC*TTAATAAAGAA*AACGCTG*GAAAAAAT*GAATGCCATGCAACT*AACTCCCAAGG
OVRT1_0019_D07.b : CTC*CTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCTTGCAGCT*AACTCCCAAGG
CLNT1_0150_E07.b : ccctataacgaaaaatccttgaaagatttaattgccatttctttaaatccctcatgttat
OVRT1_0100_A06.b : CTC*TTTATAAGGAA*GACCCctggagagtatgaattgccatgccactaactcccaaggg
OVRT1_0072_D05.b : CTC*TTATTACGGAA*GACGCTG*GAtcattttattggcatgcattttactcccttggac
OVR01_0090_D11.b : CTC*TTAGTAAGGAA*AACCCTG*GATAGTAT*GAATGCCCTGCAACT*AACTCtccaag
OVRT1_0111_F01.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
BKFL1_0103_C07.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
BKFL1_0056_C12.b : CTC*TTAGTAAGGAA*GACGCTG*GAGAGTAT*GAGTGCCATGCAGCT*AACTCCCAAGG
BKFL1_0049_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0020_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
20110601C-012214 : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCAG
---------+---------+---------+---------+---------+---------+ 973
CLNT1_0151_F03.b : ttgtcgatagaaaaaactcaatggatgaacctttattagaaaaatccacgaaaaacaggt
PST01_0033_B11.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGGT*GACACTTTACAT*GAGATACCAG
TES01_0020_A03.b : ttcatccttcttcaaaaattccggttgttgactcctttaccgttcatccctctcactata
OVRT1_0100_C01.b : tgcttcttcaaaaatactgtggtttaccctttccttgaattacccttctaaaatggtaat
TES01_0001_D08.b : ggcttcacctttatctaaaatttatcgtggttgacccttttttttgtgatccctgtggta
OVRT1_0044_E01.b : ccggctttacctttcttcaaaattaccgcggcttgaccctttacctttaattccactgta
TES01_0040_A03.b : aaggccttcgccttctccaaaaattttgtgtgttgaacccttttccttgaaaaccctgta
OVRT1_0149_B12.b : gctttcccttttcgccaaaatttcccgtggttgacccttttacctgaattccccctctaa
TES01_0112_B01.b : ACCAGCTTTCGCA*TCAG*CAAAAATTCCGTGGGTT*GACACTTTACTT*GAGATACCCG
CLNT1_0096_B04.b : ACAGGCTTCCGCA*TC*GCCAAAAATAACGTGGGTT*GACACTTTTCctgaaatcccgtt
OVRT1_0025_C10.b : ACAGGCTTCAGCC*TCA**CCCAAATTACAGTGGTT*GAC*CTTTACAT*GAGATACCAG
PST01_0042_A08.b : ACTGGCTTCGGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAAATCCCAG
KDN01_0016_C12.b : ACAGGCTTCAGCA*TCAG*CCAAAATTACAGTGGTT*GACACTTTTACATGAAATACCAG
CLNT1_0022_F10.b : ACAGGCTTCCGCA*TCTG*CAAAAATTACAGTGGTT*GACCCTTTACCT*GAGATACCCC
KDN01_0093_D03.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACCT*GAGAATACCA
PST01_0054_E06.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCAG
PST01_0098_A12.b : ACAGGCTTCAGCA*CCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCAG
KDN01_0028_A09.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCAG
PST01_0074_D09.b : ACAGGCTTCAGCA*TCAG**CAAAATTACAGTGGTT*GAAACTTTACAT*GAGATACCCA
LVR01_0057_C12.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCAG
OVRT1_0022_A06.b : ACAGGCTTCACCA*TTCG**CAAAAATACAGTGGTT*GACNCTTTTACT*GAAATTC*AG
KDN01_0079_F03.b : ACAGGCTTTCGCA*TCAG*CAAAAATTACAGGGGTT*GACACTTTACAT*GAGATACCAG
PST01_0039_F12.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCAG
KDN01_0080_C12.b : ACAGGCTTCAGCA*TCAG**CAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCCG
PST01_0080_F02.b : ACAGGCTTCAGCC*ATCAGCAAAAATTACAGTGGTT*GACACTTTACCT*GAGATACCAG
KDN01_0028_B03.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCAG
KDN01_0008_C02.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCAG
CLNT1_0066_C04.b : ccccatcccatcttctccttgggttcctctttactggatttcccttgcaaaaggtgcagg
OVRT1_0128_B05.b : cgccaatttttcgtggtttacctttttcttcaatctctgtgttctagggcgagttgttta
OVRT1_0124_B12.b : atccttcctttatatttaacgtgtttgaaatttttatatgaaatccattcttaaacttgt
OVRT1_0132_A05.b : tttcaccttccgcaaattttccgtggtttcacctttacttgaaatccccgtgaaaaaagg
PST01_0041_H08.b : ACggcttcagctccagcaatattactttggttgacattttactggaaaacttgtgataaa
OVRT1_0001_E06.b : aggcttcagcatcgtcaaaattacgttggttcactctttcttggaataacattgaaaaaa
OVRT1_0004_A04.b : cacataacaaaattacaggctttacccttacttgaaacccttgaaaatgggggaaggccg
CLNT1_0041_F04.b : caggtttcctcctctccaaaaattccgtggttgaccctttttcatgacatacccctggaa
OVRT1_0041_G09.b : ACAGGTTTCccatcaacaaaaattacgtggttgaacctttactgagaaaccaaaaaaaaa
SPLT1_0001_G07.b : ATCGGGCTCGGCA*TTAGCAAAAATTcacgtgggtttaccctttacattagaataccatt
OVR01_0043_B12.b : ACAGGCTTCAGCA*TCAC*CAAAAATTACCGTGGTTtgacacttttactgaaaatacccg
PST01_0064_F10.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAAATACCAG
OVRT1_0076_E05.b : ACAGGCTTCACC**TCAG*CAAAAAT*ACCGTGGTT*GACACTTTTCAT*GAAAAACCAG
OVRT1_0126_H09.b : ggtcttcgtcctaatacactttctgtgtggtgctcatctttcttttttttcccttcccac
CLNT1_0113_G10.b : tttatcattataaaaaattatattgttgtacttttttatatcatactccgtacaaaacgg
CLNT1_0146_A11.b : caacttctccaaaatttcaggtgtttgacacttttttttaaattccctttaaaaaatgtt
TES01_0101_A03.b : cggctttatcctttttccataaatttcattggtttgacccttttcattgaatcccctgta
CLNT1_0115_D01.b : gttccgcttcgctattattcaattggtttgaccttttaccttatcatccattttaataag
OVRT1_0045_G02.b : caggattctacttttaaataaaattataacggagaaatactttagaataaaatccaaatg
OVRT1_0082_A12.b : gggtttcctcatcaccaaaaattacagttggttgacccttttcctgcaaattcctttgga
OVRT1_0098_F02.b : caggcttccgcttctgccaaaaatttccgtggttgacacttttccttgagattccagtgg
OVRT1_0045_B04.b : acggcttccgccttcaccaaaatttccggtggttgaccttttcatgaataaccattgaaa
OVRT1_0087_B04.b : gacagctttcatcatcccccaatatttaccggggttgaccttttccctgaattccctgtg
OVRT1_0036_C01.b : GCAGGGTTTAGCA*TCAGCAAAATTTAagtggtttgaccttttctgaaataccaatgaaa
OVRT1_0078_B06.b : ACAGGCTTCCGCT*TCTGCCAAAATTAACGTGGgttgaccttttacctgacatacccagt
OVRT1_0082_B08.b : ACAGGGTTCCACT*TCAG*CCAAAATTACTGTGGTT*GACcttttcctttatatcccagt
LNG01_0034_G12.b : ACAGGCTTCAGCA*TCCC*CAAAAATTACAGTGGgttgaccactttaccttgagatacca
OVRT1_0040_E06.b : ACAGGCTTCAGCC*TCAG**CAAAATTTCCGGGGTT*GACCCTTTAatgaaaataccatg
LNG01_0046_F07.b : ACAGGCTTCACCA*TCAG*CAAAAATTACAGTGGTT*Ggacacttttcatggaaaattcc
TCH01_0046_A02.b : ACAGGCTTCAGCA*TCAG*CCAAAATTCCCTGGGTT*GACACTTTTCCT*TAGATACCcc
OVRT1_0038_A03.b : ACCGGCTTCAGCA*TCTGAC*AAAATTACTGGGGTT*TGACCTTTTCAT*GGGATACCAT
OVRT1_0069_A11.b : ACAGGTTTCAGCA*TCCG*TAAAAATTACCGGGGTT*GACCTTTTTCAT*GAGTTACCCT
OVRT1_0036_C05.b : ACAGGCTTTCCCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACCT*GAGATACCCG
TCH01_0028_A06.b : ACAGGCTTCCCCA*TCAG*CAAAATTTACAGTGGTT*GACACTTTTCAT*GATATACCCT
OVRT1_0041_A04.b : ACAGGCTTCAGCA*TCAC*CAAAAATTCCAGTGGTT*GACCCTTTTACA*TGAATACCAA
OVRT1_0023_B04.b : ACAGGCTTCCGCA*TCAG*CAAAAATTTCGGTGGTT*GACACTTTTCAT*GAGATTCCAT
OVRT1_0042_E01.b : ACAGGCTTCCGCA*TCCG**CAAAAATACAGTGGGT*GACCCTTTTCCT*GAAATACCCA
OVRT1_0036_G06.b : ACAGGCTTCAGCT*TCAG*CAAAAATTACAGTGGTT*GAACCTTTTCATTGAATTCCCAG
OVRT1_0035_F07.b : ACAGGCTTCAGCA*TCAN*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCAG
OVRT1_0074_C11.b : ACAGGCTTCGCCA*TCCG*CAAAATTTCCGGTGGTT*GACCCTTTCC*T*GAGATACCCG
OVRT1_0084_H08.b : ACGGGCTTCCGCA*TCCGCCAAAAATTCCAGTGGTT*GACACTTTACTT*GAAATAC*AG
TCH01_0023_B08.b : ACAGGCTTCAGCA*TCA**CCAAAAATACAGTGGTT*GACACTTTACAT*GATATACCAG
TCH01_0039_H04.b : ACAGGCTTCACCA*TCAA*CAAAAATTACAATGGGT*GACACTTTACAT*GAGATACCAG
TCH01_0087_F04.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCCG
TCH01_0011_H03.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCAG
LNG01_0103_C05.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCAG
TES01_0070_D01.b : ggggttttctattccccaaaaatttaagggggttgacccttttacttgaaaaccctgtga
OVRT1_0123_G01.b : gcttttttttcatcccatttccagttgttttattttttactttcattccattcataaact
CLNT1_0128_D11.b : cggccttcccctctgtgcaaatttccggtggtgagcctttttcctggaattcccagttaa
TCH01_0093_B10.b : ACAGGgcttcacattaacaaaaatttaaatgggttgacacttttcatgaaaatcctggta
TCH01_0093_E09.b : ACAGGCTTCAGCT*TCAC*CTAAATTTACAGTGGTT*GACCCTTTACAT*GATATACCCG
CLNT1_0074_H09.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACGGTGGTT*GACACTTTACAT*GAGATACCAG
OVRT1_0033_A09.b : ACAGGCTTCAGCT*TCAG*CAAAAATTACAGTGGTT*GACACTTTACCT*GAAATACCAT
TCH01_0085_H10.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTTCAT*GAGATACCAG
TCH01_0039_E03.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACCGTGGTT*GACACTTTACAT*GAGATACCAG
LNG01_0098_D07.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCAG
THY01_0040_A10.b : tcctcatggccagttctttatcctctcccccaacatatacccttggttggaacccttttc
OVRT1_0106_F03.b : tccccctcttctttttttccggggtttatcttttcccgagtaccattaatacttgtcctt
OVRT1_0064_E08.b : cccgccttcagtttctttaataatttagagtcgttgtcccctttcattgtatcctactgt
OVRM1_0204_C10.b :
UTR01_0075_C07.b : aggcttttaaccatcgcaacaattactctgatttgacccttaactcacaatccctataaa
OVRM1_0206_H10.b :
OVRT1_0143_G01.b : tgtctgggcttcttctcttccctaaatttccctggtgtctctcttttcttgaattcccct
OVRM1_0154_A10.b :
OVRT1_0141_A10.b : tcatcaaaatttccggggtttaccctttcctataaatcccattaaaaaaagtttaggggc
OVRT1_0132_E08.b : ggcttcaccatcccaaaaaataccggggttgcccctttgccggaaatacccctggaaaaa
OVRT1_0136_B01.b : gtgcttctcctctaacaaaatttccgtggttgaaccctttccctgaaaactcctcaaaaa
OVRT1_0147_B03.b : ctgcttcctcaatatttccgtggttgactcttttcaggaaatcccatgaacaagttgaag
OVRT1_0143_E01.b : agataggtcttctacctaataaaaaaattcccgtgttatcccctttttcgtaatactctc
LNG01_0035_A11.b : gtcccggctttctctttcctctaaacatttacctggcttgaatccttttacatgacaata
LNG01_0080_G12.b : ggttccacatcagcaaaaattacttgggttttacaatttacataaaatcccagttaaaaa
TCH01_0033_G03.b : atgtcctttctcatcccccaaaatttctgtcggttgaaccttttcttgaaaaaccattga
OVRT1_0008_G02.b : gctttcatcatcatgcaaatatttccgtgtgtgactccttccctgcaaatacctttgaaa
TCH01_0012_C01.b : aggattaaccatcatcaaaaaattaaaagtagttaaaaacttaaatcaaaaaaaaaatta
OVRM1_0059_H02.b :
OVRT1_0028_E11.b : gttttaaccctccctaaaacttaaggggcctacccctttttctgaaattcattcgaaaac
CLNT1_0055_E08.b : ggcttccgccatcaccaaaattacaggggttggaccttttcatgaaaatcccatgaaaaa
OVRT1_0141_A09.b : gggcttcgcatcaaccaaaatttaccgtggtttgacctttaaatgaaatacccgtgaaaa
OVRT1_0003_C10.b : ttttcgcctttggcaaatttaccggggttgcattttttctgctaatcctgtcaaaaaagg
OVRT1_0147_C10.b : cgttcccatcccccaaaatttacgggggtggagctttaactgagatcccattaaaaatgg
OVRT1_0002_A05.b : gaagggcttcgacctcagcaaaaattaccggggttggaccttttaactgaaatacccttg
SMG01_0092_C12.b : GCAGGCTTCCCCA*TCGGCAAAAtttccggggtttgacccttttccttgaaacccctgta
OVRT1_0054_D09.b : ACAGGCTTCCGCT*TCctcacatttacagtggctgactctttccttgaaataccatgcaa
HTMT1_0044_C07.b : acggcttcctcatcaaaaaaattacatgggtagacactttcctgaaatacccgtgaaaaa
CLNT1_0064_G09.b : ACAGGCTTTCTCA*TCAG*CCAAAATTACAGTGGTTtgacactttccctgaaaacccagt
UTR01_0045_A04.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGT
CLNT1_0061_A10.b : ACCGGCTTCAGCA*TCAG*CAAAAATTCCAGTGGTT*GACACTTTcctgaaataccgtga
OVRT1_0085_E08.b : ACAGGCCTTCGCT*TCAG*CAAAGATTACAGTGGTT*GGACTTTTACAT*GAAATACCca
LNG01_0042_H03.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTTacttgaaatacctt
CLNT1_0064_F02.b : AACAGCTTCCGCC*TCCG*CAAAAATTACGGTGGTT*GACCCCTTTCCT*GAGATAACCG
OVRT1_0042_D12.b : ACAGGCTTCAGCC*TCAG**CAAAAATTACGTGGGT*GACCCTTTACTT*GAAATTCCCC
CLNT1_0096_D04.b : ACAGGCTTCACCT*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCCA
OVRT1_0058_D02.b : ACAGGCTTCATCT*TCCG**CAAAATTTCGGGGGTT*GACACTTTTCCT*GAAATACCAT
LNG01_0035_H02.b : AACAGCTTCACCC*TCAG*CAAAAATTACAGTGGTT*GACACTTTACCT*GAAAAACCCG
OVRT1_0073_E02.b : ACAGGCTTTCGCA*TCAG*CAAAAATTACAGTGGGT*GACCTTTTACCT*GAGATACCCA
OVRT1_0073_A09.b : ACAGGCTTCAGCA*TCA**ACAAAAATTCCGTGGTT*GACACTTTTCAT*GAAATACAAT
MLN01_0069_C05.b : ACAGGCTTCAGCA*TCAG**CAAAAATACAGTGGTT*GACACTTTACAT*GAAATACCAG
LNG01_0034_F12.b : ACAGGCTTCACCA*TCAGCAAAAATTACAGTGGTTT*GACACTTTACTT*GAGATACCAT
OVRT1_0043_F11.b : ACAGGCTTCCGCA*TCAG**CAAAATTTACGGGGTT*GACATTTTCCAT*GAAATACCCG
CLNT1_0051_H02.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCAG
OVRT1_0035_E03.b : *CAGGCTTCAGCC*TCCG*CAAAAATTACGGGGGTT*GACACTTTACAT*GAAATACCCG
TCH01_0037_B04.b : ACAGGCTTCAGCA*TCAG**CAAAAATACAGTGGTT*GACACTTTACAT*GAGATACCAG
LNG01_0091_D10.b : ACAGGCTTCAGCA*TTCG*CAAAAATTACAGTGGGT*TACACTTTTCTT*GAAATACCAG
UTR01_0043_B07.b : ACAGGCTTCAGCA*TCAC*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCAG
UTR01_0060_D01.b : ACAGGCTTCAGCATTCAGCAAAAAATTACAGTGGTTTGACACTTTACTT*GAGATACCAT
MLN01_0101_H05.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACCCTTTACTT*GAGATACCCG
CLNT1_0066_E04.b : ACAG*CTTCAGCA*TCCG**CAAAATTTAAGTGGTT*GACACTTT*CCT*GAGATACCAG
OVRT1_0048_F02.b : ACAGGCTTCAGCA*TCCG*CCAAAATTACAGTGGCT*GACCCTTTCCCT*GAAATACCAC
CLNT1_0064_E03.b : ACAGGCTTCCGCT*TCAG*CAAAAATTACCGTGGTT*GACCCTTTCC*T*GAGATCCCTG
OVRT1_0031_H01.b : ACAGGCTTCAGCT*TCAC*CAAAAATTACAGTGGTT*GACACTTTACCT*GAAATTCCCG
CLNT1_0014_A11.b : ACAGGCTCCCGCA*TCAG*CAAAAATTACCGTGGTT*GACCCTTTACAT*GAGATACCAG
UTR01_0052_H06.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACCCTTTACAT*GAAATACCAG
CLNT1_0074_E03.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGGGGTT*GACACTTTACAT*GAGATACCAG
CLNT1_0064_B01.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTT*ACAT*GAGATACCAG
CLNT1_0062_A10.b : ACAGGCTTCAGCA*TCCG**CAAAATTACAGTGGTT*GAACCTTTTACT*GAGATACCAG
LNG01_0028_F08.b : AAAGGCTTCAGCA*TCCGCAAAAAATTACAGTGGGT*GAAACTTTTCAT*GAAATTACCA
CLNT1_0007_E05.b : ACCGGCTTCAGCA*TC*GCCAAAAATTACAGTGGTT*GACACTTTACTT*GAGATCCCAG
OVRT1_0022_E11.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTTCAT*GAGATACCCG
LNG01_0002_H02.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCAG
TCH01_0027_F05.b : ACAAGCTTCACCA*TCA**CCAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCAG
ITT01_0012_E04.b : ACAGGCTTCAGCA*TCAGC**AAAATTACAGTGGTT*GACACTTTTCAT*GAGATACCAG
PST01_0044_E03.b : ctttcttattccatttaattcttgatttgttaggatctttcgtcagaatttgtgctcttt
OVRT1_0005_G05.b : cagcttcacaaaaaaaaaaaaaaaatgcccatgtgccttaactcaggttggggcccctta
KDN01_0005_A09.b : ACCGGCTTCAGCA*TCAG*CAAAATTTACAGTGGTT*GACACTTTACAT*GAGATACCAG
KDN01_0096_D09.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCCG
KDN01_0091_A05.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCAG
PST01_0042_G06.b : ACAGGCTTTCACA*TCAG*CATAAATTACAGTGGTT*GACACTTTACCT*GAGATACCAG
KDN01_0012_B08.b : ACAGGCTTCAGCA*TTC**ACAAAAATACAGTGGTT*GACACTTTACTT*GAGATACCAG
KDN01_0035_D10.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCAG
TES01_0056_A11.b : tgccttcagtcttcccaaaaatttcggggcttgacactttacatgaaattacctttgata
OVRT1_0123_D02.b : tttcgtcctcttctttaatgccgttgtttgctccttttctttctttcccttctatcattt
OVRT1_0100_F07.b : ccccgttagcaaaatttcagggggtttaccttttacttgagatcccatttataaaggtta
TES01_0059_H04.b : ACAGGGTTTCaccctccccaaaattaccgggggttgaaccttttcatgaaatccccttga
PST01_0072_A08.b : ACAGGCTTCAGCA*TCA**CCAAAAATACAGTGGTT*GACACTTTACAT*GAGATACCAG
PST01_0099_B11.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCAG
OVRT1_0120_H01.b : cttcccctcaccaaaattttctgtggtttaacttttccttgacatcctcctgaaaaacgg
OVRT1_0093_E08.b : ACAGGCTTCAGCA*TCAACAAAAATTTacatgggttgaccctttacataaaattccagtt
OVRT1_0019_D07.b : ACAGGCTTCCGCT*TCAG*CTAAAATTACAGTGGTT*GACACTTTTCCT*GAAATA*CAG
CLNT1_0150_E07.b : gcttagacctcttttaaaataacttggcttatatttttattataaataatattcaataaa
OVRT1_0100_A06.b : acaggcttccgcttctacaaaaatttcgggggttgacccttttcctggcaatacccctga
OVRT1_0072_D05.b : gggctttcatcattgcaaaattttcctgggtggacccttttctgaatatccacttaaaca
OVR01_0090_D11.b : aacgggcttaatcctcaaaaaaaattacaccggtttgacacttttcctgagattacaatg
OVRT1_0111_F01.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCAG
BKFL1_0103_C07.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCAG
BKFL1_0056_C12.b : ACAGGCTTCAGCA*TCAG*CAAAAATTACAGTGGTT*GACACTTTACAT*GAGATACCAG
BKFL1_0049_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGATACCAG
ILNT1_0020_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
20110601C-012214 : T*GAAAAAAGGTGAAGG*TGCTGAGCT*GTAAACCTGCAGAGTATATTAGTCTG*CGTAG
---------+---------+---------+---------+---------+---------+ 1029
CLNT1_0151_F03.b : atagtggtcataagtaaccccacttagtatctatctcgcctacaacatcaatggtatata
PST01_0033_B11.b : T*GAAAAAAGGTGAAGG*TGCTGAGCT*GTAAACCTGCAGAGTATATTAGTCTG*CGTAG
TES01_0020_A03.b : ttgttaacgtttctttgctttaatcctttccactttttcttatctgcctatctcatttct
OVRT1_0100_C01.b : ggtgcctatctttaaccctcccttattacttactctgcctaatctttatgcctgggatat
TES01_0001_D08.b : aaatggtgtatgtgctggacttataaacttggcctaatatatttaatcttgcgtattcta
OVRT1_0044_E01.b : caaaggtgaaggggcttaacctgttacctcgcaaagcatcttatctgcctagcctataat
TES01_0040_A03.b : aaaaaagtgtaaggggccttaatgtatacctgccaaatattattatcttcctaacctata
OVRT1_0149_B12.b : aaaagggtgatggcgcctaacctgtaaaccccccaaaaatatttaggctcggttacctaa
TES01_0112_B01.b : T*GGAAAAAGGTtgaaggggctgacctttaaacctgccaatttatttagccggcctaacc
CLNT1_0096_B04.b : gataaagggtgaggggcttaactgttaaccttgcaaattatttaatctggctacctatat
OVRT1_0025_C10.b : T*GAAAAAggtgaaggggctaactgtnaacccgccaagtatttagtctgcttaactaaaa
PST01_0042_A08.b : T*GAAAAAAGGTGAAGG*TGCTGAGCT*GGAAACCTGCCTATCATATTAATCTG*CGTAA
KDN01_0016_C12.b : T*GTAAAAAGGTGAAAG*GGCTGAGCT*GTAACCCTGCAAAATATATTAGTCTG*GCTAG
CLNT1_0022_F10.b : T*GAAAAAAGGTGAAGG*TGCTtgacctgtaacctgccgaggattttagtctgcgtagcc
KDN01_0093_D03.b : T*GAAAAAAGGTGAAGG*TGCTGAGCT*GTAAACCTGCAAAGTATATTAGTCTG*GCTAG
PST01_0054_E06.b : T*GAAAAAAGGTGAAGG*TGCTGAGCT*GTAAACCTGCAGAGTATATTAGTCTG*CGTAC
PST01_0098_A12.b : T*GAAAAAAAGTGAAGG*TGCTGAGCTGTTAACCCTGCAAAAGTTATTAGTCTG*CGTAA
KDN01_0028_A09.b : T*GAAAAAAGGTGAAGG*TGCTGAGCCTGTA*ACCTGCCGAGTATATTAGTCTG*CGTAG
PST01_0074_D09.b : GTGAAAAAAGGTGAAAG*TGCTGACCT*GTAACCTTGCAGAGTATATTATTCTG*CGTAG
LVR01_0057_C12.b : T*GAAAAAAAGGTGAAG*TGCTGAACT*GTAAACCTGCAGAATATATTtattctgcgtag
OVRT1_0022_A06.b : T*GAAAAAAGGTGAAGG*TGCTTAGCTTGT*ACCCTGCAAAATATATAAGTCTG*CGTAC
KDN01_0079_F03.b : T*GAAAAAAAGGGAAGG*TGCTGAGCT*GTAAACCTGCCAAATATATTAGTCCGCCGTAG
PST01_0039_F12.b : T*GAAAAAAGGTGAAGG*TGCTGAGCT*GTAAACCTGCAGAGTATATTAGTCTG*CGTAG
KDN01_0080_C12.b : T*GAAAAAAGGTGAAGG*TGCTGAGCT*GTAAACCTGCAAAGTATATTATTCTG*CCTAG
PST01_0080_F02.b : T*GAAAAAAGGTGAAGG*TGCTGAGCT*GTATACCTGCAGAGTATATTAGTCTG*CGTAA
KDN01_0028_B03.b : T*GAAAAAAGGTGAAGG*TGCTGAGCT*GTAAACCTGCAAAGTATATTAGTCTG*CGTAG
KDN01_0008_C02.b : T*GAAAAAAGGTGAAGG*TGCTGAGCT*GNTAACCTGCAGAGTATATTAGTCTG*CGTAG
CLNT1_0066_C04.b : tgctgacctcctacccgaccgtttctttgtcctccccctctttaccccggttagctccgc
OVRT1_0128_B05.b : cttctaccctcatttctttttctccgcttatcattataaccgactattcctccctgtttc
OVRT1_0124_B12.b : ttccgtgccttctagtttatctttataactctctatttctctcctctttttatctcttta
OVRT1_0132_A05.b : gaatgttccgaacctttaacccgccaaatattttactccgccggacctaaagtcgggata
PST01_0041_H08.b : agggaaagggttgacctgttaacctgcaaaaagacttttccgctattccatagtaaggga
OVRT1_0001_E06.b : gtgtaagtggtgacctgtaaccctccaagtattttagtccgcgtacttaaattcatggat
OVRT1_0004_A04.b : aaaataaacctgtaaagtatattatctcgccactaaaattttgtaacttctggcccggtt
CLNT1_0041_F04.b : aaatgggtgaagtgcttgactgttaccctgctaatattttatcctgctacttatagtcct
OVRT1_0041_G09.b : ggggaaggcgctgaacttgaaaccttgaaaaaaattaattcccctatcctaaaatctgga
SPLT1_0001_G07.b : ggaaaaaggtttaaagttcctgaacttgtaacccgcacaattatttaatccggcggttgc
OVR01_0043_B12.b : tgaaaaaaaggggaaggtgcttgatccttgacaccctggcaaaataattttatttctgct
PST01_0064_F10.b : T*GAAAAAAGGTGAGGG*TGCTGAGCT*GTAAACCTGCCAAGTATATTAGTCTG*CGTAG
OVRT1_0076_E05.b : T*GAAAAAAG*TGAAGG*TGCTaacctggtaacttgcaaatatataatctgcctagcaaa
OVRT1_0126_H09.b : gtttttacggtccctaattctctctttgccttgcatctccatcttccgtttcccactttc
CLNT1_0113_G10.b : ctagggcgctaacttttacctcgcctaatttttatttcttccttctttcatttattgtaa
CLNT1_0146_A11.b : gaggttcttaatcttaacctttcaaattttttttctgcctcctttattgttttgaataat
TES01_0101_A03.b : aaataaggttttggtccttaccttttaactttacatgttttttctctggccttcccattt
CLNT1_0115_D01.b : tttatggcgcctattttgatactttccacttttttcatccgcgctcctcttacttctgta
OVRT1_0045_G02.b : taaaatgtgaacgtgcctaatatgctaaacttgaaaagaaaatttatccgtgtaaaacat
OVRT1_0082_A12.b : aaaaagggcaaggggtctgaccttttaacccttgcaaagtattttattctggctatccca
OVRT1_0098_F02.b : aaaaagggtgaaagtgctgaacttgttaacctgccgaaatatttttggcctggcttaccc
OVRT1_0045_B04.b : ataagggaatgggcttaactggttaccctgctatttttttatcctgcggacctaatagtt
OVRT1_0087_B04.b : aaaaaaggtgaaggtgctgagctgtaatcttgctgaggattttcgtccgcggacctaaaa
OVRT1_0036_C01.b : aaggtgaatgtgctgaagtgttaactggcaaatattttaatctgcgtacctaaatccctg
OVRT1_0078_B06.b : aaaaaaggtgaaggtgcttaactgtaaccctgcgaagtttttaatctccctacttaatgt
OVRT1_0082_B08.b : gacaaaagggtgaaggggttgaactgtcaacctgccgagttattttaacctgtgtagctt
LNG01_0034_G12.b : gtgaaaaaaaggtgaaaggtgctgagcttgtaacctgccaaattattttaatctgcgtag
OVRT1_0040_E06.b : caaaaaggtgaaggtgctgacctgttaacctggcgaagtttattatccgcctagctaata
LNG01_0046_F07.b : agttgaaaaaaaaggtgaaaggtggctgaacttggaaaccttgccaaaatattttatatc
TCH01_0046_A02.b : ttgaaaaagggtgaagtgctgaaccgtaaacctgcataatatattactctgccctaccta
OVRT1_0038_A03.b : T*GAAAAAAGGGGAAGG*TGCTcagcctgtaaccctgccaatatattagtcggcctagct
OVRT1_0069_A11.b : T*AAAAAAAGGTGAAGG*TGCTtgaccttgtaacctgccaagaaaattaatctgcgtacc
OVRT1_0036_C05.b : T*GAAAAA*GGTGAAGG*TGCTGAGCgtaaacctgcagaatattttagtctgcgtactaa
TCH01_0028_A06.b : T*GAAAAACGGTGAAGG*TGCTGAacttgtcaacctgccaaattatttatcctggctacc
OVRT1_0041_A04.b : G*TGAAAAAGGTGAAGG*TGCTGAGCTGTAAcctggccaaaaatttagtcctgcgtacct
OVRT1_0023_B04.b : T*GAAAAA*GGTGAAGG*TGCTGAACT*GTAACCCTGCAAgtttattagtctgcgtacct
OVRT1_0042_E01.b : T*GAAAAAAGGTGAAGG*TGCGGACCT*GTTAACCTGCCAAATtttttaatctgcctagc
OVRT1_0036_G06.b : T*GAAAAAGGGTGGAAG*TGCTGAGCT*GTAAACCTGCAGAGTATttaatctgcgtacct
OVRT1_0035_F07.b : T*GAAAAAAGGTGAAGG*TGCTGACCT*GTAAACCTGCAAAGTAattaatctgcctaact
OVRT1_0074_C11.b : T*GGAAAAAGGTGAAGG*TGCTGAACTGGT*AACCTGCAAAGTAatttatccgccctcct
OVRT1_0084_H08.b : T*GAAAAAAGGGGAAAG*TGCTGACCT*TGTAACCTGCAAAATATACTAGTCctgcggta
TCH01_0023_B08.b : T*GAAAAAAGGTGAAGG*TGCTGAGCT*GTAAACCTGCCAAGTATATTtatccggcgtac
TCH01_0039_H04.b : TTGAAAAAAGGTGAAGG*TGCTGAACCTGTAAACCTGCAAAGTAAATTAGTCTG*CGTAC
TCH01_0087_F04.b : T*GAAAAAAGGTGAAGG*TGCTGAGCTTGTA*ACCTGCAGAGTATATTAGTCTG*CCTAG
TCH01_0011_H03.b : T*GAAAAAAGGTGAAGG*TGCTGAGCTTGTAA*CCTGCAGAGTATATTAGTCTG*CGTAG
LNG01_0103_C05.b : T*GAAAAAAGGTGAAGG*TGCTGAGCT*GTAAACCTGCAAAGTATATTAGTCTG*CGTAG
TES01_0070_D01.b : aaaaagggggaaagggctctaaccttttaacccccgaaatatattaaggccctccgctcc
OVRT1_0123_G01.b : gtattgggctcgcgttttatttcggctcagttatttctcttttttaatcccttctcagga
CLNT1_0128_D11.b : aaagggggacgggcttgatctttacctctcccaaactttttattttgcgctcctaaattt
TCH01_0093_B10.b : aaaaaggttaaagtggctgaactgtaaacctgctaaaattattaatcggcgaatctaaaa
TCH01_0093_E09.b : T*GATAAAAAGTGGAAG*TGCTGAACTTGTAACCTGCctaagtattttatctgggttcct
CLNT1_0074_H09.b : T*GAAAAAAGGTGAAGG*TGCTGAGCTGTTAACCCTGCAAAGTATATTATTCTG*CGTAG
OVRT1_0033_A09.b : T*GAAAAAAGGTGAAGG*GGCTGAACT*GTAACCTTGCCAAATATATTAATCCG*CGTAC
TCH01_0085_H10.b : T*GAAAAA*GGTGAAGG*TGCTGAGCTGT**AACCTGCAGAGTATATTAGTCTG*CGTAG
TCH01_0039_E03.b : T*GAAAAAAGGTGAAAG*TGCTGAGCT*GTAAACCTGCAGAATATATTAGTCTG*CGTAG
LNG01_0098_D07.b : T*GAAAAAAGGTGAAGG*TGCTGAGCT*GTAAACCTGCAGAGTATATTAGTCTG*CGTAG
THY01_0040_A10.b : tttctaaataccccccccacaaaaatcccctaaagggttcccctaaccctgtccacccct
OVRT1_0106_F03.b : tccttattattatcattttttcccattcccctttataaatccaatctctttttctgctta
OVRT1_0064_E08.b : ttgtacaacatttttatcgtgcttgatcttgtccccccggctaaaatattttattcttcc
OVRM1_0204_C10.b :
UTR01_0075_C07.b : aaaaggttaatcgtgctaacctctaaacctacatagatatttaaaatacaattaatataa
OVRM1_0206_H10.b :
OVRT1_0143_G01.b : ccccaaaacgggtaggtctctttacttttcttcccgccattatctttctttcccttatta
OVRM1_0154_A10.b :
OVRT1_0141_A10.b : ttacctttaaacctccctattatttatcccgcgatctaaaattctggcaaaatcctgccc
OVRT1_0132_E08.b : agtgtacggttctaaccattaaccccctaaaattaattaactctcgcttctatattccct
OVRT1_0136_B01.b : aggtgtaggtgctggactgttacccttgcaacttctttatcctccctaccctattctcat
OVRT1_0147_B03.b : gggcttactctttactctaaaatatatttctcccgttcaactatattccggggacacccc
OVRT1_0143_E01.b : tgctaaaaatgttaaggttctctcttttttatccttacaagtttttctctgttcctcttc
LNG01_0035_A11.b : ccagttgaaaaaaagggaaaggtgcctgaacctgataaccctgccaaagttctatcacct
LNG01_0080_G12.b : aaagggtagttgctaaactgtataccttccaaantattttattccggcattaccacgttc
TCH01_0033_G03.b : aatactgggaagggagcccaacttgtaaacctgcctagattatttgtccgcccacttaat
OVRT1_0008_G02.b : aacgtcaaggttctgaactgttaacctcccccatttttttattcggcgtacctgtcatgg
TCH01_0012_C01.b : aaaaaagtgaacaggtctcaagctgtaaaactgaaaaagcataataacttaggcgtacct
OVRM1_0059_H02.b :
OVRT1_0028_E11.b : agcgcaagcgccttactgttaacccttcaaataatttccgtggcctcaactaattatccc
CLNT1_0055_E08.b : aggcgaaggtgcctatcgttaacctgcaaatttattaatccggctactaatagcctgggt
OVRT1_0141_A09.b : aaggtgaaggtgctgagccgtaaacccgccgatttatttttccggctacctaaattccag
OVRT1_0003_C10.b : tgaaggtgctgtacctttaaccctgagaatatattatcccgcctagcctatattcatggt
OVRT1_0147_C10.b : ggacggtgcttgacttttaaccctgcaatttttttgtcttctgtgctattctcatggtta
OVRT1_0002_A05.b : gaataaggttaaggcggctgacctttaaacccgcctaattatttagtcggcttaccaaaa
SMG01_0092_C12.b : aaaaggtgaaggggctaaactttaaccctgcaaatttttagccgggctaactaaagcccg
OVRT1_0054_D09.b : taaggtgcaggtgtgaacttgtaaccctgcaaagtatattattctggcttgctaactgtc
HTMT1_0044_C07.b : aggggaggcgctgaactgtaaactgctaaaaaattagcttgcggaccaaaaatctggaaa
CLNT1_0064_G09.b : gtaaataggtgaaggcgctgaacctgtcccctgcccatttattagcctgccaacctattg
UTR01_0045_A04.b :
CLNT1_0061_A10.b : aaaaaggtgaagtgctgagctgtaaaccttgcaagtatatagtcctgcctacctatagtc
OVRT1_0085_E08.b : tgaaaaccgggtaaggtgcgtgatctgtaaccttgcaaataattttaggcgactttccta
LNG01_0042_H03.b : gaaaaaaagtgaaggtgctgaagctgaaaacctgccgaagaatattagtttggcttacct
CLNT1_0064_F02.b : T*GGAAAAAAGTGgaagtgcctagctttaaccccgccaaaattttagtcggcgtagctta
OVRT1_0042_D12.b : T*GAAAAAAagtggaaggtgcttaacctgtaaccctgccaagtattttagtctgcctaac
CLNT1_0096_D04.b : TGGAAAAAAGGggaaagggctgaacctgtaaacctgcaaataatattagcctgcgtaacc
OVRT1_0058_D02.b : T*GAAAAAGGGTGAggggctgacctgtaaccggcaagatatttgatctgccttcctaaat
LNG01_0035_H02.b : TGGAAAAAAaggtgaaggtgctgaagctgtaaaccctgcgaagtatttttattctgcgta
OVRT1_0073_E02.b : T*GAAAAAAGGTGAAAG*TGCTtgactgttaacctgcaaacatattactctgcgtaccta
OVRT1_0073_A09.b : T*GAAAAA*GGTGAAGG*TGCctgactgtaaacctgctaagaattttagtctgcctacct
MLN01_0069_C05.b : T*GAAAAAAGGTGAAAG*TGCgaacctgtaaactgcaaagtaaataatctgcgtaactaa
LNG01_0034_F12.b : TGAAAAAAGGGTGAAGgtgctgaacctgtaaaccctgcaaagtatattaattcttgctta
OVRT1_0043_F11.b : T*GAAAAACGGTGAAGG*GGCTGACCTGTTAACCcgcaaattattttatccgcctaacta
CLNT1_0051_H02.b : T*GAAAAAAGGTGAAGG*TGCTGAACTTGTAACCctgcgagtattttagcctgggtacct
OVRT1_0035_E03.b : T*GAAAAAAG*TGAAGG*TGCTAAGCT*GTAACCCTGCcaagttattaccctgcctggca
TCH01_0037_B04.b : T*GAAAAAAG*TGAAGG*TGCTGAGCTGTAACCtgcaaagtatatagtctgcgtagctat
LNG01_0091_D10.b : T*GAAAAAAGGTGAAGG*TGCTGTACTTGTAACCTGgcaagtattttattcctgctaact
UTR01_0043_B07.b : T*GAAAAAAGGTGAAGG*TGCTGACCTGTAAACCctgcaaagtatattagtcttgcgaac
UTR01_0060_D01.b : T*GAAAAAAGGTGAAGG*TGCTAAGCT*GTAAACCTGgcaaagtataattattctgccta
MLN01_0101_H05.b : T*GAAAAAAGGTGAAGG*TGCTGAACT*GTAAACTTGCAAAGTAattagtctgcgtaact
CLNT1_0066_E04.b : T*GAAAAAAGGTGAAGG*TGCTTACCT**GTAACCTGCCGAGTATATTAGTCTG*Cctaa
OVRT1_0048_F02.b : T*GAAAAAAGGTGAAGG*TGCTGAACT*GTAACCCTGCCAAGTTTTTTAGTCTG*Ccttg
CLNT1_0064_E03.b : T*GAAAAAAGGTGAAGG*TGCTGAACT*GTAAACCTGCCAAGTATATTGCTCTG*GGTAG
OVRT1_0031_H01.b : T*GAAAAAAGGTGAAGG*TGCTGAACT*GTAAACCTGCAAATAATTTTAGTCTG*CGTAG
CLNT1_0014_A11.b : T*GAAAAAAGGTGAAGG*TGCTGGACT*GTAAACCTGGCAAGTATTTTATCCTG*CGTAG
UTR01_0052_H06.b : T*GAAAAAAGGTGAAGG*TGGTGACCT*GTAAACCTGCAGAGTATATTATTCTG*Cctaa
CLNT1_0074_E03.b : T*GAAAAAAAGTGAAGG*TGCTGAGCT**GTAAACTGCCGAGTATATTAGTCTG*CGTAA
CLNT1_0064_B01.b : T*GAAAAAAAGTGAAGG*TGCTGAGCTGNT*AACCTGCCGAGTATATTAGTCTG*CGTAG
CLNT1_0062_A10.b : T*GCAAAAAGGTGAAGG*TGCTGAACT*GTAAACCTGCAAAGTAATTTAGCCTG*CGTAG
LNG01_0028_F08.b : T*GAAAAAAGGTGAAGG*TGCTGACCT*GTAAACCTGCAGAATATATTAGTCCG*CGTAG
CLNT1_0007_E05.b : T*GAAAAAAGGTGAAGG*TGCTGAACTTGTAACCCTGCCGAGTTTATTAATCTG*CCTAA
OVRT1_0022_E11.b : TGAAAAAAAGGGGAAGG*TGCTGACCT*TTAAACCTGCAAAAGTTATTATTCTG*CGTAG
LNG01_0002_H02.b : T*GAAAAAAGGTGAAGG*TGCTGAGCT*GTAAACCTGCAGAGTATATTAGTCTG*CGTAC
TCH01_0027_F05.b : T*GAAAAAAGGTGAAGG*TGCTGAGCT*GTAACCCTGCAGAGTATATTAGTCGG*CGTAA
ITT01_0012_E04.b : T*GAAAAAAGGTGAACG*TGCTGAGCT*GTAAACCTGCACAGTATATTAGTCCG*CGTAG
PST01_0044_E03.b : tatcatagaccgtttttaattttctccttctcgaatttttttccccagcttttttgtttc
OVRT1_0005_G05.b : aactttcaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0005_A09.b : T*GAAAAA*GGTGAAAG*TGCTGAGCT*GTAACCCTGCCAAGGATATTATCCTG*CGTAG
KDN01_0096_D09.b : T*GAAAAAAGGTGAAGG*TGCTGAGCT*GTAACCCTGCCGAGTATTTTAGTCTG*CGTAC
KDN01_0091_A05.b : TGAAAAAAGGGTGACAG*TGCTGAACT*GTAAACCTGCAAAGTATATTATTCTG*CGCAG
PST01_0042_G06.b : T*GACATAAGGAGAAGGGTGCTGAACTGTTAACCTGCTCAAGTAAATTATCTGG*CGTAG
KDN01_0012_B08.b : T*GAAAAAAG*TGAAAG*TGCTGAGCT*GTAAACCTGCAGAGTATTTTAGTCTG*CTTAG
KDN01_0035_D10.b : T*GAAAAAAGGTGAAGG*TGCTGAGCT*GTAAACCTGCAGAGTATATTAGTCTG*CGTAG
TES01_0056_A11.b : aaacgctatggtgcctaatctgattcccggccgagtatttttagctccgccttccttatt
OVRT1_0123_D02.b : tatatgcgctcctcttttatctcccctattttttattcttcacttctacctctttgtatt
OVRT1_0100_F07.b : aggggctgtaacctgacaccccctcaattctttactcctggctttctttctctcagggta
TES01_0059_H04.b : aaaaaggggaaaggggttgaacctgtaaccccgccaaattatttaatcctggtagcctaa
PST01_0072_A08.b : T*GAAAAAAAGTGAAGGGTGCTGACCTGTAAAACCGGCAGAGTATATTATTCTG*CGTAG
PST01_0099_B11.b : T*GAAAAAAGGTGAAAG*TGCTGAACT*GTAAACCTGCCAAGTATATTAGTCTG*CGTAC
OVRT1_0120_H01.b : tgatagtgcttccccttaaccccgcaaatttattattctggtgtaccttctcttcggcta
OVRT1_0093_E08.b : aaaaaaaggtgaaggtgcttaaattgaaaaccggaaaaaaaattaaactgccaaactaat
OVRT1_0019_D07.b : T*TGAAAAAGGTGAAAG*TGCctagctgtaacctgcaaaaaatattattctgcctaccta
CLNT1_0150_E07.b : atttaatcgtgataaacttatatcttataaatcccatataattcttctaattattaaatc
OVRT1_0100_A06.b : aaaaagggtgagggggctaacttgtaaccctgccaaatattttatccggggttcctaata
OVRT1_0072_D05.b : aggtgaaggtgacttgaccgtgaaacctgcctattatatagtctgccttggaaatattct
OVR01_0090_D11.b : aaacaatggagaaagtgcctgaaactttaatccctgaaaaaatctttattcccgcacacc
OVRT1_0111_F01.b : T*GAAAAAAGGTGAAGG*TGCTGAGCT*GTAAACCTGCAGAGTATATTAGTCTG*CGTAG
BKFL1_0103_C07.b : T*GAAAAAAGGTGAAGG*TGCTGAGCT*GTAAACCTGCAGAGTATATTAGTCTG*CGTAG
BKFL1_0056_C12.b : T*GAAAAAAGGTGAAGG*TGCTGAGCT*GTAAACCTGCAGAGTATATTAGTCTG*CGTAG
BKFL1_0049_E07.b : T*GAAAAAAGGTGAAGG*TGCTGAGCT*GTAAACCTGCAGAGTATATTAGTCTG*CGTAG
ILNT1_0020_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
20110601C-012214 : CTAATAGTCATGGAT*AACTACAGCCCTGGT*TCTCACCTAATAACCAGCTTCTTTTCAT
---------+---------+---------+---------+---------+---------+ 1087
CLNT1_0151_F03.b : ttcaccctgggttcgttcagatctaactttcttatatgggtgcaaattaattgattaatt
PST01_0033_B11.b : CTAATAGTCATGGAT*AACTACCGCCCTGGT*CCTCACCTAATAACCAGCTTCTTTTCCT
TES01_0020_A03.b : agtattactatattcccgtttttctccttatatacttttttcttttctggtcaacacttt
OVRT1_0100_C01.b : ttcgcccctggtttcaccctatatacctatctcctttcttgccgcgttataacccttcat
TES01_0001_D08.b : aatcctctgggataaatatctacccctggttttcaccttaaaaaccaatttcttttcttg
OVRT1_0044_E01.b : cagggaatacttcagccctggttttcccctataacccctttctttcatgcctaccccaac
TES01_0040_A03.b : atcctgggttactatcaccccgatttcccccctattaaccacttctttttttatgcctaa
OVRT1_0149_B12.b : aagccctggaatacttccccccccggtttttcccccttataaccatactttttttcttgg
TES01_0112_B01.b : tataatctcgggaaaaatacaggccctggttcctccctaaaaaccaacttctttttcctg
CLNT1_0096_B04.b : tcctggtaaccttacgccctgtgtttcacctaatatctggtttttttctggcagttcctt
OVRT1_0025_C10.b : ccttggataattcggccctgtttctccctaatacccagtttcttttctggggaccactcc
PST01_0042_A08.b : CTAATAtcctggatacctccagcctggttcttccctaataaccgcttcttttcagcagtg
KDN01_0016_C12.b : CTAATAGTCCTGGAatactcccgcccctggttctcccttataaaccagctttctttcctg
CLNT1_0022_F10.b : tattatcctgaataactatcaccctgtttctccccttattaccagcttcctttccgtgcg
KDN01_0093_D03.b : CTAATAGTCATGGgtactaccggccctggttctcactaattaccagcttcttttctggag
PST01_0054_E06.b : CTAATAGTCATGGAT*AACTACAGCCTTGGT*TCTCACCaataaccagcttctttcatgc
PST01_0098_A12.b : CTAATATTCAGGGAT*AACTACAGCCCTGGT*TCTCNACTAATACCCgcttcttttctgc
KDN01_0028_A09.b : CTTATAGTCATGGAA*TACTACGGCCCTGGT*TCTCACCTAATACCAGCTTctttttctt
PST01_0074_D09.b : CTAATATCCAGGGAT*AACTACCGCCCTGGT*TCTCACCTAATAACCCGCTTCTTTTtct
LVR01_0057_C12.b : cctaaaagtcatggataactaccagccctgggtcctcacctaataaacagccttcttttt
OVRT1_0022_A06.b : CTAATAGTCtggaatactaccgcccgtgttcctccctaaaaccccttcttttctggggta
KDN01_0079_F03.b : CTAATAGTCATGGATTAACTACCGCCCCGGT*TCTCACCTAATAACCGGCTTCTTTTCAG
PST01_0039_F12.b : CTAATAGTCATGGAT*AACTACGGCCCTGGT*TCTCACCTAATAACCAGCTTCT*TTCAT
KDN01_0080_C12.b : CTAATATTCATGGAT*AACTACAGCCCTGGT*TCTCACCTAATAACCAACTTCTTTTTCT
PST01_0080_F02.b : CTAATAGTCATGGAT*AACTACAGCCCTGGC*TCTCACCTAATAACC*GCTTCCTTTCAT
KDN01_0028_B03.b : CTAATAGTCATGGAT*AACTACAGCCCTGGT*TCTCACCTAATAACCAGCTTCTTTTCAT
KDN01_0008_C02.b : CTAATAGTCATGGAT*AACTACAGCCCTGGT*TCTCACCTAATAACCAGCTTTCTTTTCT
CLNT1_0066_C04.b : cctggtttaccccttaattccagtttcttttcggtgatcccttacccttttttctttctc
OVRT1_0128_B05.b : tactcatttcccctattctttgtgtctactctttacctttctattctctagtgggctttc
OVRT1_0124_B12.b : tttcctcccctctctcgatccctccattaattacctttctttcccccctctccttttctc
OVRT1_0132_A05.b : ctccccccctggttctccctaaaaacaggttttttttttgccttccctaaccctttattt
PST01_0041_H08.b : atcctagatccttgtttttatttaaaactactttcttcttggttaatgcctaatttaaat
OVRT1_0001_E06.b : aaataccccccggttctcccaaaaaccacttttttttctgggatcactaccccttttttt
OVRT1_0004_A04.b : tcccactaaaaactcttttttttatgacatataaaactttaattttatcggaggttttct
CLNT1_0041_F04.b : gtgaaactacgcccctggtttttcccctaataccacgctcttttcctgcgttcccttacc
OVRT1_0041_G09.b : aaaacaaaaccctggtttctccccaaaaacaattttctttttcggcaatacctaacattt
SPLT1_0001_G07.b : taaaaatctggaaaaattacgccctttggtctcccttaaaaacaagcttcttttcatgcg
OVR01_0043_B12.b : ataacctaaatactcatcggataacctaccgccccctggtctctcccccctaaaaacccc
PST01_0064_F10.b : CTAATAGTCATGGAT*Actacagccctggttctccctaatacccacttcttttctgcagt
OVRT1_0076_E05.b : catccgggataatcagccctggtttcccctataaacagtttttttcttgcaaaacctaac
OVRT1_0126_H09.b : ttctgtgcccttcttctgcttgtttcccccccgatttccctcttttcttttgctttcctt
CLNT1_0113_G10.b : accactctcctgcttttcccaatcactccctttctttttggcatacccctctctcttatc
CLNT1_0146_A11.b : tccctcccttgtttttctctaataccagtttctttttcgccaacttcttccctttctatt
TES01_0101_A03.b : ttcttggattatcttacccccttttttttacccttattacctacttttttttaggaatat
CLNT1_0115_D01.b : tactctcctctcctgtttctatttgcgtacctccttttttttttgcttttatataaatga
OVRT1_0045_G02.b : atatacatgagtaaattacagcctttgtttcacatcaaaatacacaatttttttttgtaa
OVRT1_0082_A12.b : tatgccttggattaccttcccccccggtttctcccctaattaccatgtttttttttcttg
OVRT1_0098_F02.b : taatggtcttggaataactccggcccctggttctccccttaaaaaccaactttctttttc
OVRT1_0045_B04.b : ttgggatacctacagccctgttctccccataatacccagtctcttttctgcatgtacata
OVRT1_0087_B04.b : ttttgggattatcacccccttggtctccccctatgacccactttttttcttgccatggca
OVRT1_0036_C01.b : gaaactaacaccctgttctcccaataaccagcttttttcctgcacaaccttaaaattttg
OVRT1_0078_B06.b : tctgggaaacaccccctgggttccacctattacctgcttttttttggaatacaactaccc
OVRT1_0082_B08.b : attatcatgtgttactactgcccgtggtttttcccttttaaccggctttcctttcttgtt
LNG01_0034_G12.b : cttaataatcctggattaactccagcccctggtttccccccctaataacccaccttcctt
OVRT1_0040_E06.b : gccttggaaaactacgccctggtttctcccctaaaacccgcttctttttttgcgttcacc
LNG01_0046_F07.b : ctggcttaacctaataagtccatggaaaaatttacagccccttggtttcccaccctaaat
TCH01_0046_A02.b : acatcctggattaattccgccctgggtcttcccctattacccgcttctttttttgccgtc
OVRT1_0038_A03.b : ataagtcttgggtaacttcgcccctggttttcccctaatacccactttcttttctggcat
OVRT1_0069_A11.b : taataatcatggataacttaccccctggtttttcccctaataaccgtttttcttttcatg
OVRT1_0036_C05.b : tattcttggataactccgccctggttctcccctataaccgctttttttccggcggaaact
TCH01_0028_A06.b : ctaaagccccgggatacttcaagccctggtttccacctaatatacagcctttctttcctt
OVRT1_0041_A04.b : atagccatggaatactaccgccctggttttcccctaataaccactttcttttctgcaaga
OVRT1_0023_B04.b : ataatcatggtaactccgccctggttctcacctattaccccttcttttcttgccgtaccc
OVRT1_0042_E01.b : taaaatccttgaataactccgccccggtttctcccttaataacccgcttctttttctgcg
OVRT1_0036_G06.b : ataataagggatacttcggccctgtttctccctataaacggcttcttttctgccttacct
OVRT1_0035_F07.b : taaaatcaggaataactacgccctggtttcccactaaaaacccacttcttttctgccata
OVRT1_0074_C11.b : tattatccgggataattccagcccctggtcttccctataaccggttttttttctgcagta
OVRT1_0084_H08.b : cctaatttcctggttaaatacaccctgggtctccccaataaccgacttcttttttgcagt
TCH01_0023_B08.b : ctataatcatgagtaactaccgccctggttccccctaataaaccgcttcttttcttgatt
TCH01_0039_H04.b : CTAATAGTCATGGAT*AAATACGGCCCCGGT*TCCCACCTAATAACCAGCTTtcttttaa
TCH01_0087_F04.b : CCTATAGTCATGGAT*AACTACAGCCCTGGGTCCCCACCTA*TAACCAGCTTCTTTTCAT
TCH01_0011_H03.b : CTAATAGTCATGGAT*AACTACAGCCCCTGT*TTTCACCTAATAA*CAGCTTCTTTTCTT
LNG01_0103_C05.b : CCTATAGTCATGGAT*AACTACAGCCCTGGG*TCTCACCTAATA*CCAGCTTCTTTTCAT
TES01_0070_D01.b : taaatctcttgggtaaaaaaaacaccctgggtttccccctcaataaacccgttttttttt
OVRT1_0123_G01.b : ttactttcttcttgtttcttcatttatatgcttttctatgtcacttttcctacctttatt
CLNT1_0128_D11.b : cagtgaataatccccccttggcttccactcaaataccagctcttcttttggcgcggtccc
TCH01_0093_B10.b : atccggaataatacaaccatggttctcaccttataacctgttcctttcgtgaataaacta
TCH01_0093_E09.b : aatatcctgggattcttctgccctgtttctcccctattaccaatttcttttctgcgttac
CLNT1_0074_H09.b : CTAATAGTCATGGAataactacggccctggttccccccctattaaccagcttctttttct
OVRT1_0033_A09.b : CTAATAATCATGGAT*AACTACCGCCCTGGgttctcacttattacccagtttcttttcct
TCH01_0085_H10.b : CTAATAGTCATGGAT*AACTACAGCCCTGGT*TCTCCCCTAATACCCgcttcttttcatg
TCH01_0039_E03.b : CTTATAGTCATGGAT*AACTTCAGCCCTGGT*TCTCACCTAATAACCAGCTTCTTTTtct
LNG01_0098_D07.b : CTAATAGTCATGGAT*AACTACAGCCCTGGT*TCTCACCTTATAACAAGCT*CNTTTCAT
THY01_0040_A10.b : cctaccattccttcttctttttcttcgttcgtcctttttctccccccatactatctcaaa
OVRT1_0106_F03.b : tcaatctaattccaaaaattctttgattcatcctttcaaaatttcttctcttttcgtcta
OVRT1_0064_E08.b : tctgcctatcagttatgtgtttccttccgtccctttttttcttcttacattagcagtttt
OVRM1_0204_C10.b :
UTR01_0075_C07.b : aactgagaaaattaaagtcccttaggcttaacccaaaaaacacaccttcattttaatgaa
OVRM1_0206_H10.b :
OVRT1_0143_G01.b : ccattgctttggttattttctcctcatttctctcccttatttccccccttattttctgtg
OVRM1_0154_A10.b :
OVRT1_0141_A10.b : ttgatcctccttaaaaaacccttttttctggcattctatataccccttcattaatctgtg
OVRT1_0132_E08.b : aggaataacacaccccttgttcttcctattacaccacttttttttccgccatattcaatt
OVRT1_0136_B01.b : gggttattccacccccggttcctcactaaatatcaccttcttttcgtgtcgaccccaccc
OVRT1_0147_B03.b : gccctgtttttctccatatctcctctcttttcttcttccccaacacttttttttttacgg
OVRT1_0143_E01.b : cgttaaaatctcatcaatttatgctcctgtttctccctcaatacttatccttcttcttct
LNG01_0035_A11.b : ccctccctaccctcactactacaggaatatacccttccgcccctgggttcttccacccta
LNG01_0080_G12.b : ccatgaaaaaattccaagccctgttggttcccaactaaacaattttttttttttgttctt
TCH01_0033_G03.b : atctctgggtcaaataccaccccgttttttcccttaataaccgatttctttccatccata
OVRT1_0008_G02.b : aatatatccccctggtttctccccttaaaaccacttctttttccggcatttctctatact
TCH01_0012_C01.b : aaaaatcaatggaaaaaataacaaacccttattttacaaaaaaatacaaaaattcatttt
OVRM1_0059_H02.b :
OVRT1_0028_E11.b : ggactaccacagccctggttctccctttatcaccaggtttcttttttcccgttacccccc
CLNT1_0055_E08.b : aactacggcctggttctcccttatacccgttttttttttgcgtacctaccctttatttta
OVRT1_0141_A09.b : ggataattcacccctggtttccaccttataccccccttcttttcctgcggaaaacaaacc
OVRT1_0003_C10.b : aaattcaaacccggttctcacctaaaaacagcctctttttcggtagacaccaaaccttta
OVRT1_0147_C10.b : ctctctgcccttttttcccttttaaccccctttttttctggattaacttacccttttttt
OVRT1_0002_A05.b : attctgggattcttccgcctgggttttaccctaaatacccttttcttttctgtagtttcc
SMG01_0092_C12.b : gggaacctaccccccggtctcccccaaaaacccctttttttcgggcgaaacctaaccttt
OVRT1_0054_D09.b : ctggataaataccgcccggggttctccccaataaccaccttcttttcttgcggaaccctt
HTMT1_0044_C07.b : actcagccctggttcccacaaaaaaagcttctttctgggagacccaacatttattttatt
CLNT1_0064_G09.b : tcctggataactccccgcctggtctcccctaaaaacccccctttcttttctggcggacac
UTR01_0045_A04.b :
CLNT1_0061_A10.b : tgggataactaccgccctggttttccacttatacccaccttctttcctgcggtaccctac
OVRT1_0085_E08.b : atagtctggataaattctgcccggggtttcccttaagaaccaggtcctttcaggcaaatc
LNG01_0042_H03.b : aaaaattctgggaaaaattcagcccctggtttctcccctaataacccagctttcttttcc
CLNT1_0064_F02.b : tagcctggattaactacgccccggtttctcccctaataacccgcttcttttccggccgta
OVRT1_0042_D12.b : ctaaatatcctggataactccgcccctggttcctcccctaataaccaccttctttttctg
CLNT1_0096_D04.b : tatagttcagggatactaccgccctggttttccacttataaccagcttcctttcatgcgt
OVRT1_0058_D02.b : atcctggatacttccgccctgtttttcccctaataacaccttcttttctggcaaacccta
LNG01_0035_H02.b : acctaatagtcctggattaactaccaccctgggtttccccccctaaaaacccacccttcc
OVRT1_0073_E02.b : aaatccatggataactccgccctggttccccactaataaccccctcttttcttgcgaacc
OVRT1_0073_A09.b : aaaatcatggaaaattaccccctggtttctccctaataaccgccttttttcttgcggtac
MLN01_0069_C05.b : tagtcatggataactacagcctggtctcaccaataaccagcttcttttctggcatacact
LNG01_0034_F12.b : ccttaataattcatggataaattaccgcccctggtttctccaccaaataacccacctttc
OVRT1_0043_F11.b : aatatctgggataaactccgccctggttttcccctaattacccactttctttttcttgcc
CLNT1_0051_H02.b : aatagtctgggattactccagcctggttcccccctaatacccagttctttcatgcggtac
OVRT1_0035_E03.b : ataatcatggataataccgccctggttttccctaataaccagttcttttcttgcatacac
TCH01_0037_B04.b : agtcatggaaactacagccctgggtctcacctaataacaagctcttttcatgcataaact
LNG01_0091_D10.b : aaagtctgggatacttccgcccttggttttacctaataacagctttttttctgccgtaca
UTR01_0043_B07.b : taatagtcatgggataacttccgcccctgggttctccccctataaacccaccttcctttt
UTR01_0060_D01.b : acctaatagtcttgggataactacagcccttggttttccccctaaaaaccagctttcttt
MLN01_0101_H05.b : tatattcatggatagcttcgccctgggttctcccctaataccagcttcttttcttgcggt
CLNT1_0066_E04.b : cttaaagccagggataacaccgccctgggtcctcccttataccagtttccttcttggctt
OVRT1_0048_F02.b : cctaatgttctgggataacttactgccctgtttcccccctaaaacccaccttcttttcat
CLNT1_0064_E03.b : CTtaaagcctgggataacttccgccccggttttcacctattaaccggtttcttttccgtg
OVRT1_0031_H01.b : CTtaatatcatgggatactcccgccttggtttctcccctaaaaaccagcttcttttctgg
CLNT1_0014_A11.b : CTAATAatctgggatacttccgccctgggttttcacctaattacccactttctttttctg
UTR01_0052_H06.b : cttataattcttggaaaactacggccctggtttctcccccaataacccaccttctttttc
CLNT1_0074_E03.b : CTAATAGTCATGGAT*AACTtacgcccgggtttcccctataaccacttctttttcctgcg
CLNT1_0064_B01.b : CTTATAGTCATGGAT*AACTACCGCCCTGTT*TCTCCCCTAtaaccgcttcttttctgca
CLNT1_0062_A10.b : CTTATAATCATGGAA*AACTACCGCCCTGGT*TCTCACCTAAaaccagcttcctttctgg
LNG01_0028_F08.b : CTAATAGTCCTGGAT*AACTACGGCCCTGGTTCTCcccctaataacccaccttctttttt
CLNT1_0007_E05.b : CTAATAGCCATGGAT*AACTTCCCCCCTGGT*TCTCACCTATTAACCAGttcttttcctg
OVRT1_0022_E11.b : CTTATAGTCCAGGGATAACTACAAGCCTGGT*TTTCCCCTATTAACCACCTTTTTTTCtg
LNG01_0002_H02.b : CTAATAATCATGGAT*AACTACACCCCTGGT*TCTCACCTAATAACCAagcttctttttc
TCH01_0027_F05.b : CTATTATTCATGGAT*AACTACGCCCCTGGT*TCTCACCTAATAACCAGCTTCCTTTCtg
ITT01_0012_E04.b : CTAATAGTCATGAAT*AACTACCCCCCTGGT*TCTCACCTAATAAACAACTTCTTTCCCT
PST01_0044_E03.b : tacccctttatactctaaaatcgtctttatgtataatcatactttttttctcctctcttt
OVRT1_0005_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtcattaaaccatactcccaatttccaa
KDN01_0005_A09.b : CTAATAATCTGGGAT*AACTCCGCCCCTGGT*TCTCCCCTAttaccagcttcctttcttg
KDN01_0096_D09.b : CTAATATTCATGGAT*AACTCCACCCCTGGT*TCTCACCTAAaaccagccttcttttctt
KDN01_0091_A05.b : CTAATAGTCTTGGAA*AACTACACCCTGGTT**CTCACCTAATAACCAGttcttttcatg
PST01_0042_G06.b : ATTATAGTCTTGGAT*AATTACGGCCCTGGTTTC*CACCTAATAACCCGCTTCTTTTCTT
KDN01_0012_B08.b : CTAAAA*TCCTGGAT*AACTACGGCCCTGGG*TCTCACCTAA*AACCAGCTTTCTTTCTT
KDN01_0035_D10.b : CTAATAGTCATGGAT*AACTACAGCCCTGGG*TCTCACTTAATACCCAGCTTCTTTTCAT
TES01_0056_A11.b : ttttttgtactaacttccgccctgggtcttccacctcttaaccaccttcttttcctgcct
OVRT1_0123_D02.b : tttcttgcctttgtctttccctataactttttttctttattcctcctgttatccttattt
OVRT1_0100_F07.b : atctccgcctatgttctccccatttaactgtttctttttccactgagccctcacacttta
TES01_0059_H04.b : aagcctgggataaattacccccctggttcccccctcaaaaacccgcttctttttctgccg
PST01_0072_A08.b : CTAATAGTCATGAAT*AACTACAGCCCTGGT*TCTCCACTAATAACCAGCTTCTTTTCAT
PST01_0099_B11.b : CTAATAGCCATGGAT*AACTACGGCCCTGGTTTCTCACTTAATAACCCGCTTCTTTTCCT
OVRT1_0120_H01.b : tacaccgcccttgtttcaccttaaaacccctttttcttttttgcattcaactaactcctt
OVRT1_0093_E08.b : agacatggaaaactacggccctggttctcacctaaaaccatctttttttacagcacaaac
OVRT1_0019_D07.b : aaatcctggaatactccagcccgggtttcacccaaaacccgcttcttttcttggagaaca
CLNT1_0150_E07.b : agtatactcaaccctctgttatcatactataatttaccttttttctctaattacatacat
OVRT1_0100_A06.b : tgctggggaaaccacctcctgggtttccccctaataccccgcttcttttctggctatacc
OVRT1_0072_D05.b : tggtaactaccgcccgggtctcccataatacttccttttttatgccgtatcctccatttt
OVR01_0090_D11.b : caaatatccattggataactaacgcccctggttctcccaccttaaaaaccggcttctttt
OVRT1_0111_F01.b : CTAATAGTCATGGAT*AACTACAGCCCTGGT*TCTCACCTAATAACCAGCTTCTTTTCAT
BKFL1_0103_C07.b : CTAATAGTCATGGAT*AACTACAGCCCTGGT*TCTCACCTAATAACCAGCTTCTTTTCAT
BKFL1_0056_C12.b : CTAATAGTCATGGAT*AACTACAGCCCTGGT*TCTCACCTAATAACCAGCTTCTTTTCAT
BKFL1_0049_E07.b : CTAATAGTCATGGAT*AACTACAGCCCTGGT*TCTCACCTAATAACCAGCTTCTTTTCAT
ILNT1_0020_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
20110601C-012214 : GCAGTACACTAACA*CTTTAGTTATATTCAGTGGTTTTTACACAGTGAAATATGAAATAA
---------+---------+---------+---------+---------+---------+ 1146
CLNT1_0151_F03.b : attggcgtacttactcagatgtgcaagaacgagtcactattatacatatattgtagcgta
PST01_0033_B11.b : GCAGTACACTAACA*CTTTAGTTATATTCAGTGGGTTTTACCCCGTGGAATTAGAAATAA
TES01_0020_A03.b : actcttttttttattttggggtctttctccttcgttaatgtattaacgtttcccttttct
OVRT1_0100_C01.b : tttttttcggggttttccaccgtggttattttgatatcacgttctccctctagatttctc
TES01_0001_D08.b : gctttaactttacctctctttatttttattctgggagtttttcacctttggtactattcg
OVRT1_0044_E01.b : ccttatttatattcccgtttttttcccgtttaattttgattttagccctccttcaaactt
TES01_0040_A03.b : acaatatcttttattttattccggtggttttttccccggtaaaattcaattaaaggaatt
OVRT1_0149_B12.b : cctaaacataccccttaattatttgtggggcgtctttccccccggtaatttttatatagg
TES01_0112_B01.b : gggaaaaccaacccctttattttttttcacggggtttttcccccgggaattttgaaatta
CLNT1_0096_B04.b : atacctttagttaatcctggggtttttccccggtaaatattatcttaggtaaccccttag
OVRT1_0025_C10.b : cctttattttttccctggttttttccgtgtaattgaattaaaggtccccttcggacttct
PST01_0042_A08.b : aactacacttagttttttccggggtttttaccgttaaattgaaaataaggactcttcgga
KDN01_0016_C12.b : cggtacccttacactttaattaatttccgcgggttttttccccgtgaaatttgcaataaa
CLNT1_0022_F10.b : tcacctaaccctttagtttatttcacggggtttttcccccgggaaatttgaaataaaggt
KDN01_0093_D03.b : tacaccaacctttagtttatttcaggggtttttcccgggaaatatgaataaagtaaccct
PST01_0054_E06.b : agtaactaacactttagttaattccgtggtttttaccagtgaaaatgaaattaaggtaac
PST01_0098_A12.b : agtacccctacacttttattatattcagtgggtttttaccccgggaatttgaaaataagg
KDN01_0028_A09.b : gccgtacctaacccttttagttattttcagtggtttttacaccgtggaatatgaaataaa
PST01_0074_D09.b : tggcgtacacaacacttttagtatttttcaggggttttaccccggggaaatttgtattaa
LVR01_0057_C12.b : cttgcatttaccctaaccacttttagtttttatttccgttgggtttttttcccccgttga
OVRT1_0022_A06.b : cactaccctttattatttctcgggtttttcccctggaatatgaataagggaacccttcgg
KDN01_0079_F03.b : GCAGTACCCTAACA*CTTTAGTTTTATTCATGGGTTTTTACCCCGTGAAtttgaaataaa
PST01_0039_F12.b : GCAGTACACTACCC*CT*TAGTTATATTCAGGGGGTTTT*CACAGTGAAATATGAAATAA
KDN01_0080_C12.b : GCAGTACACTACCC*CTTTAGTTTTATTCCGTGGTTTTTTCCCAGTG*AATATGAAATAA
PST01_0080_F02.b : GCCGTACACTAACC*CTTTAGTTAATTCCGGGGGTTTTTACCCGGGGAAATATGAAATTA
KDN01_0028_B03.b : GCAGTACACTAACACCTTTATTTATATTCAGTGGNTTTTTCACAGTGAAATATGAAATAA
KDN01_0008_C02.b : GCAGTACACTAACA*CTTTAGTTATATTCAGTGGTTTTTACCC*GTGGAATATGAAATTA
CLNT1_0066_C04.b : cggggtttttcccctgcaattcttattattggaatccctcccctctctccccatttcgtt
OVRT1_0128_B05.b : gcttttcgattgtgctcatcgtctattttgtccttcccactccctcttgtcctcgagctc
OVRT1_0124_B12.b : tcttcttttttcactatgtggtctcttcctctactattcctcagtttctttctcttcatc
OVRT1_0132_A05.b : ttttccggggttttctcccgggaaaattgaaaaagggggccctctcgcactctccaagag
PST01_0041_H08.b : tattccttttttctccactacggttatttaaccattttctactcaactaccctgcaatta
OVRT1_0001_E06.b : ttccggggttttccccttgaattgtaaatatggaccctttagacttttcccaattgtttt
OVRT1_0004_A04.b : ccctgaagatcaaaataggtcctcttccagatttgcaaaagtttttttctaaatctttct
CLNT1_0041_F04.b : cttattttttttcgtggtttttccccctggaatttgtccttaggttcccttccggacttt
OVRT1_0041_G09.b : tcttattttcatggtttttcacctgggaatttgaaataggggacccttcagaaatttttc
SPLT1_0001_G07.b : gcacactacgacttttatttatattcggtggtttttcaggataaattagaaaatacaggt
OVR01_0043_B12.b : acctttctttttcttgcagactcccctaaacccctttaaacttttttttccaccggcttt
PST01_0064_F10.b : aactaacccttaatattttcagtggtttttacccgggaatatgaataaaggtacccatca
OVRT1_0076_E05.b : ctttaattatttcagggtttttacccgtgaaatagaataaaggtaacccttaaatctttt
OVRT1_0126_H09.b : ctcctttataattcctctcgcggttctgtctcgtctagttgcctctatcgtgcatccttt
CLNT1_0113_G10.b : tttatgcgtgttttttacccttacatttttatttttctttactttaacttaattccccat
CLNT1_0146_A11.b : ttttccggggtttttcccttttttttttcattaagtttccttttctttctacttctgaac
TES01_0101_A03.b : cccatacgcttcttctttttttctgggttttttcaccctggataatatcatttatgtgta
CLNT1_0115_D01.b : cattttttttttcatcgtttttcctcccctgtatatttacattcccgtgattttatcttt
OVRT1_0045_G02.b : agatacaaaaaacttatcattaataccgagggtttttcaatattgaaaatacttaataaa
OVRT1_0082_A12.b : gcagtcaccctaacacttttagttttttttccttggtttttctccccctgtgaatttttt
OVRT1_0098_F02.b : ttgcatgacccaaaccctttcgttttttttcgggggtttttaccccgggaattttttctt
OVRT1_0045_B04.b : tcctttattttattctgtggttttatcccctgtaatcttaattctgggttcacctctccg
OVRT1_0087_B04.b : taatactttttttttttccgggttttctcccccgggaccttaaaatatcggtatactcca
OVRT1_0036_C01.b : ttaattccgggtttttccccgctgaattgaaacaagggttaccctcagaattctccaaaa
OVRT1_0078_B06.b : ttatgtatttttcggggtttttccccgtggaatttaataaaggttccccctcaaattctt
OVRT1_0082_B08.b : attgcattaaaattttattttcttcatggggtttttctcccggtgtatattgaattaggg
LNG01_0034_G12.b : tttccttccgttaccccctaacaccttttaatttttattttcgttgggttttttttcccc
OVRT1_0040_E06.b : taacttttgttttattactggttttttccccggtaaaattgaaataaggttccacctcaa
LNG01_0046_F07.b : aaaccagcctttcttttttcttggccgataaaacctaaaaccctttttagtttttttttt
TCH01_0046_A02.b : ccttacacttttatcttttttcgggggttttttcccgtggaaattttgaaataaagggta
OVRT1_0038_A03.b : acactaaaccttttatttatttcggggttttttccccgggaatatttaatataaggttac
OVRT1_0069_A11.b : caataaactaacccttttattatatctcgtggttttttccccctggaattttgaatttag
OVRT1_0036_C05.b : aactctttagtttattccggggtttttccccggtgaattgaaataaggtaccctttcgaa
TCH01_0028_A06.b : gcatttccctaaccctttttttttattccgaggtttttacccctgaaattatgaacttag
OVRT1_0041_A04.b : cacctaacttttattttaatccagggctttttccccgtggaatttgaataagggttccct
OVRT1_0023_B04.b : taccttttattattttccgggttttcccccggaatttaaattaggtaaccctcggacttt
OVRT1_0042_E01.b : gtacactacccttttattattttcggggttttttccccggaaatttgaataaagggtcac
OVRT1_0036_G06.b : taccctttatttaattcgggggttttccccgtgaaatttgaattaaggtaacctctctga
OVRT1_0035_F07.b : cactaacactttgtttttttccggggtttttaccggtgaaattgaaataaaggaaccctc
OVRT1_0074_C11.b : aattaccctttgattattttccggggtttcttccccggtaatttggaaataagggtaact
OVRT1_0084_H08.b : accctacccttttgtttatttccggggttttgccccgggaatttgtaattagggtaccct
TCH01_0023_B08.b : aacctaacactttagtttaattcatggttttacccgcgggaatttgaaataagggtaccc
TCH01_0039_H04.b : tgcaataaaaaaaactttaagttaaattccaggggttttaccccgggaaaaatgaaatta
TCH01_0087_F04.b : GCCGTACcctacactttagttatattcagtggttttaccccctgaaatttgaaataaggg
TCH01_0011_H03.b : GCAGTACACTAACA*CTTTAGTTAattccgtggttttaccccgtgaaattgaaataaagg
LNG01_0103_C05.b : GCANTACACTAACA*CTT*AGTTATATTCAGTGGTTTTacacagtgaattaggaataaag
TES01_0070_D01.b : ttggtgttaaaaacaatacattttttttttttttcggggggtttttctcccccgcatttt
OVRT1_0123_G01.b : gtaattttctctgctttctcttgattcatttctcttttatactctcttcttacttcttta
CLNT1_0128_D11.b : ctatctttttatttttttctggggtttttccctttgacatttgtttaaaggggacctctc
TCH01_0093_B10.b : aactttattttatcaaggtttttaacctttaatttaaataaagttatccatcatattact
TCH01_0093_E09.b : cccacccctttatttatttcagtggttttttccctgggattttgaataagggtcccctcc
CLNT1_0074_H09.b : gccgtaccctaaccctttagttattttcgtggttttttaccccgggaaatttgaatttaa
OVRT1_0033_A09.b : gcaataccctaaaacttttattttttttcgggggtttttccccgtggatttggaattaag
TCH01_0085_H10.b : cggtcactaaccctttatttattcggtggttttccccgtgaattatgaataagggtaccc
TCH01_0039_E03.b : gcgttaccctaccctttagttttattcagtggtttttaccccgggaaattttgaataaag
LNG01_0098_D07.b : GCAGTACACCTACA*CTTTAGTTATATTCAGTGGTTTTTA*CCAGTGGAATATGAAATAA
THY01_0040_A10.b : accccccctacccctctctcttcctccatctcaccctcccccccttttttctcttctttc
OVRT1_0106_F03.b : cctctattttccttctaattgttcctcttcttccccctgttgcttttctctccccctttg
OVRT1_0064_E08.b : ctttgtacgctttcctcctaattccttctcttgtctttctgtggtttttctctgactgca
OVRM1_0204_C10.b :
UTR01_0075_C07.b : ataaaaataaaaaattctttttttaatttccgggggtattattaaccatggaataaaaaa
OVRM1_0206_H10.b :
OVRT1_0143_G01.b : atttccctcactcctactttttcttcccgcggtttttacccggagcacttatatttcttg
OVRM1_0154_A10.b :
OVRT1_0141_A10.b : gttgttaatccggggaaattgaaataataggtccctcacgataggttttatttcttgttt
OVRT1_0132_E08.b : ttttttctttaaacatgggtttttccccacgaaatatgatataaggtgcctcttctgtat
OVRT1_0136_B01.b : cttttgcttattccggggtttttccccctgcaatttatacataagggtttcttccagatc
OVRT1_0147_B03.b : tttttccgattgtatttgttataggttaaaattgaattttttcatctctctttttcttta
OVRT1_0143_E01.b : tgctttactctaattctttttatttatatcaatttttttttctccttactctattatata
LNG01_0035_A11.b : attacatccccctcttactttctcttggccctccccctttaaacatctcttgccttctac
LNG01_0080_G12.b : aaattaaaactttcaattatatcaggggtttttacccggttattcccgaagatagtttac
TCH01_0033_G03.b : acctttccccttaatttatattcgggggtttttccccagctcatcttgatttttaggttt
OVRT1_0008_G02.b : tttatttttttacggggtttttcccctgttaattaccaataaggttaccccttcgtcttt
TCH01_0012_C01.b : tttgctgcaaaaaaaaaaaattaattttaaactcaaaggggttttaaacactgaaaaaaa
OVRM1_0059_H02.b :
OVRT1_0028_E11.b : ccatttatttttttcccggggtttttccccggaaaaatttaaattaaggctcccgctccc
CLNT1_0055_E08.b : ttcccggtttttccaccgtacttcgaaaacggccccttcaaatattacataggttttttc
OVRT1_0141_A09.b : ctttgattatttccggggtttttcccgcgggaaaatgaaaaaaggtaacactctggactt
OVRT1_0003_C10.b : tttatttccgtggtttcccccgtgaaaatgtaataaagtgtcccttcacgatcattctta
OVRT1_0147_C10.b : ttcttcaggggtttttacaccggaattcttaaaatgggtttctccttgtgcgtctttcaa
OVRT1_0002_A05.b : taacccttttttattttcctgggtttttccccggggattttcaaataatgttaccattca
SMG01_0092_C12.b : tttttatccggggttttcccccgggaatttgaaataggggtcccctccgacttttcccaa
OVRT1_0054_D09.b : acccttatatttatttcggggggtttttccccgtggaatttgaactaatggaacccttcg
HTMT1_0044_C07.b : taggggtttttccggggaaatagaaataagtgtcccttagaatttcttcaaaagttgttt
CLNT1_0064_G09.b : cacaccttttttttcttcgtggggtttttccccgcgcactttgaatttaggggaaccccc
UTR01_0045_A04.b :
CLNT1_0061_A10.b : ccctttgttatttttccggggttttccccgtggaattttgaataaaggtgaccctccggg
OVRT1_0085_E08.b : accatcctttaagttgtggggggcggtttcccccggcaattttgaattagggtaaccttt
LNG01_0042_H03.b : tggcagtacacctaaacccttttaatttaattttccctgggttttttttccccaggggga
CLNT1_0064_F02.b : ccctaaccctttagtttttttcacgggtttttccccggggatattgtgaataagggtccc
OVRT1_0042_D12.b : gctgtcacctaaccctttaatttaattcccggggtttttcccccgtgaaattataaaaat
CLNT1_0096_D04.b : tacactacccctttatttatttccgggggttttctcccttgcaattttaaataaggttac
OVRT1_0058_D02.b : ccctttaattatttccgggttttttccccgggaatttgcattaaggtaacccctctcgat
LNG01_0035_H02.b : tttttcctggcattaacccctaacccccttttaatttttttttttctcgttgggtttttt
OVRT1_0073_E02.b : ctacatttttttttttattcggggtttttcccggggaatttgcaatactgtgtcccctcc
OVRT1_0073_A09.b : cctcccgttttttttatttcggggtttttacacgcgaatttaaaaaaaggaacccttcga
MLN01_0069_C05.b : acacttatttaaatcatggtttttaccgtgaaaataaataagggaaccatcaaaacttct
LNG01_0034_F12.b : ttttttcttggcagttacacctaaacactttttaatttttattttcccgtggggtttttt
OVRT1_0043_F11.b : gaacctaaccttttagttaattcgggggtttttcaccgggaaatttggaaataaggtaac
CLNT1_0051_H02.b : cttaccctttatttatttccggggttttacccgcggaaattgaattaaggtaacccttca
OVRT1_0035_E03.b : tacccttttttttattccgggttttttcccgtggatatgaattagggtccccttcagact
TCH01_0037_B04.b : aacactttatttaattccgtggttttacacagtgaatatgaattaaggtaaccatcaaaa
LNG01_0091_D10.b : taaccctttatttttttcctggtttttccccgggaaattgaatataagttaccctctaaa
UTR01_0043_B07.b : tcttgccgttacccctaacccctttttattttttttttcagtgggttttttttccccccg
UTR01_0060_D01.b : tcctggccgataccctaaaccttttattttattttccattgggtttttttaccagtggaa
MLN01_0101_H05.b : acactaaccctttaggttttttccgtgggtttttccccgtgaaatttaaaataaagttaa
CLNT1_0066_E04.b : acctaacctttagtttattcggggtttttaccccggaaaattgattaaggtaacctttga
OVRT1_0048_F02.b : gccttacccttacccttttatttttttccgggggtttttcccccgggaatttggaataag
CLNT1_0064_E03.b : gggtaccctaacactttattttatttccggggtttttcccccgggaattttgaattaagg
OVRT1_0031_H01.b : aatacactaaccctttagttttttccggtggttttacccggggaaattgaaattaaggta
CLNT1_0014_A11.b : ccataacctaacccctttaatttttttccgggggtttttttccccgggaaatttggaatt
UTR01_0052_H06.b : tgccgttaccttaactcctttattttaatttcagtggttttttaccccggtgaaaatttg
CLNT1_0074_E03.b : tacactacccttttgttttattcggtggtttttcacgggggaattgaaataagggaccct
CLNT1_0064_B01.b : gtaccctaacccttagnttttttccgggttttttccccggggaattggaaataagggtac
CLNT1_0062_A10.b : catacccttaccctttagtttttttccggggttttttcccggggaatttgaattagaggt
LNG01_0028_F08.b : atgccgtacactaacccctttaatttttttttccggggtttttttccccccgtggaaaat
CLNT1_0007_E05.b : gcgtaacctaaccctttaatttaattccgggggtttttccccatggaattgggattaaag
OVRT1_0022_E11.b : gcagaaactaacccttttgtatatttcagggtttttaccccgggaaattggaattaaggt
LNG01_0002_H02.b : atgcagtaacactaacccttttatttatttttcagtggttttttaccccgttgaaaaaat
TCH01_0027_F05.b : tgcgtacctaaccctttatttatattcggtggttttttcccgtgaattttaaataaaggt
ITT01_0012_E04.b : GCCCTACCCTAACA*CTTTAGTTATTTTCCGTGGTTTTTcccccggcatttggaataaga
PST01_0044_E03.b : ttgagttttttctcaatccgttgactttatccctgtagttttcatccgttagttcctcat
OVRT1_0005_G05.b : taagcattttttcccgcttctcttggggtggccaacccccaatgttttaacggtcggacc
KDN01_0005_A09.b : cggtacctaaccccttaatttaattccgtggtttttacccgggaaatttgaaataaggga
KDN01_0096_D09.b : gcggtaccttacccttttttttatattccggggtttttcccagtgaaatatgaaataaag
KDN01_0091_A05.b : cggtaccctaacctttagttttatccgcggttttttacccggggaatttgaaataagggt
PST01_0042_G06.b : GCAGTACACTAACA*CTTTAATTATATTCAGGGGTTTTTTCCCAGTGATATAggaattaa
KDN01_0012_B08.b : GGGGGACACTAACC*CTTTAGTTATATTCAGGGGGTTTTACCCCGGGGAATATGAAATAA
KDN01_0035_D10.b : GCAGTACACTAACA*CTTTATTTATATTCAGTGGTTTTTACACCAGTGAATATGAAATAA
TES01_0056_A11.b : cacattcttcaattctttgtgttttccgggggtttctcccaatggtatatttctctttgg
OVRT1_0123_D02.b : tttatctttctttttctccctattttcatcctcttatcttcctctcctttcatcttacca
OVRT1_0100_F07.b : tcttatctcctggcttctccccccctacttgaacctatggtaccctttaatccattccct
TES01_0059_H04.b : aacctctaccctttgagtttatttcgggggtttttccaccgggaattttgaaataagggg
PST01_0072_A08.b : GCAGgtcccttaacccttaattgtattcaggggtttttacccggtgaatttgaaattaag
PST01_0099_B11.b : GCAGTACACTAACA*CTTTtattttattccgagggtttttacccagtgaaatttggaatt
OVRT1_0120_H01.b : ttttatttcgttgcttttcacagcggcatttgtaaattcatggcactctctagttacttt
OVRT1_0093_E08.b : caaccctttattttattcaagggttttacctctgaaaatttaaataaaggatcccataaa
OVRT1_0019_D07.b : ccacctttaattttttcaggggttttaccccgggaattggaataaaggaaaccctcggac
CLNT1_0150_E07.b : tcataattatgtccatggtatcctcacccttaaattctatattatatatgttgccaaaat
OVRT1_0100_A06.b : caaacctttacttttttctccgggtttttcccccggcaaattgtaattaaggttaccctt
OVRT1_0072_D05.b : gttttttcctcgttttccccccgaatttgaatgaagtttcgtttcagcttttatataatc
OVR01_0090_D11.b : tcccgtcactacactaaacccttttaagttaaattccaaggggttttttcccccgtggaa
OVRT1_0111_F01.b : GCAGTACACTAACA*CTTTAGTTATATTCAGTGGTTTTTACACAGTGAAATATGAAAATA
BKFL1_0103_C07.b : GCAGTACACTAACA*CTTTAGTTATATTCAGTGGTTTTTACACAGTGAAATATGAAATAA
BKFL1_0056_C12.b : GCAGTACACTAACA*CTTTAGTTATATTCAGTGGTTTTTACACAGTGAAATATGAAATAA
BKFL1_0049_E07.b : GCAGTACACTAACA*CTTTAGTTATATTCAGTGGTTTTTACACAGTGAAATATGAAATAA
ILNT1_0020_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxtatgcggtattttttttttttttttttttttttttt
ILNT1_0056_D06.b : ta
SKNB1_0013_E01.b :
20110601C-012214 : AGGTAACACATCAAGACTATCTACAAAAGCTGTATTTACAGAAAAGCATGCTTATCATGA
---------+---------+---------+---------+---------+---------+ 1206
CLNT1_0151_F03.b : tgctaaagactgcctctcaagcaaaaaatagaccttatctctaaggagatattctcttcg
PST01_0033_B11.b : AGGTAACCCATCAAGACTATCTACAAAAGCTGTTTTTACAGAAAAGCATGCTTTTCTTGA
TES01_0020_A03.b : ctattttacaagcctgctttctcctaattcagcttttccggagactaatatttatatgcc
OVRT1_0100_C01.b : actaaactttttgtcacataaatctggctttttgtgaacaattatttatgagtctttttt
TES01_0001_D08.b : aattcaaagtgtaccccttcttaactattcccctataccttttttttccaagaaaacccg
OVRT1_0044_E01.b : ttctcatagtcctttttctagaaagctgcttcttcttgatacacgaccttatggtttttc
TES01_0040_A03.b : cctctgtaatcttccaccaaatctgttttttttaataatctccctttctggaaccaatca
OVRT1_0149_B12.b : gtgtcgcctttcgtattctccctctacctgtgtttttccaaaaaactctcttttcctcac
TES01_0112_B01.b : agggttacccctctgaaacttctccaaaagactgtttttttacaaaaacccttggttttt
CLNT1_0096_B04.b : acctttttcacaagctgttttttcaaaatccgtttttttgaaacaaacactaaagtgttt
OVRT1_0025_C10.b : cccaaatcttttttacgaaatctttcttattaaaaaaaaaataaattttttttcccaatc
PST01_0042_A08.b : ctttttacaagttgtttttctatatacggctttctgaacaaaacaatgaagggtttttcc
KDN01_0016_C12.b : gggtaccccttcaggcatattcttcaaagctgtgatttccgaaaaacatggcttttctgg
CLNT1_0022_F10.b : aacactctcgacctttcctccaaggtggtttttccaaaaacctggcttttctctgaacaa
KDN01_0093_D03.b : ccggacttttacaaaactgtatttaaagaaagctgtttttctggaacaaaaaataaaagg
PST01_0054_E06.b : catccagacatcttcaaagctgtttttacgaaagcttgcttacttgaaacaaacaataaa
PST01_0098_A12.b : tacccctcccggatattttcaaaacctgttttttccaaaaaactggcttttcttgaacaa
KDN01_0028_A09.b : ggtaacccatcaagactttctccaaagcttgttttaagaaaagcctgcttatcttgaacc
PST01_0074_D09.b : gggtacccctctagactttcctcaaaaccttattttccgataaccttgcttttcctgaaa
LVR01_0057_C12.b : aaatattaaaattaaaagggtaaaccacattcaaagacctatttctacaaaaaaacctgt
OVRT1_0022_A06.b : actttccccaagctgttattaaaaaacctggctttctgaaaaaaaaaaaaaatgtttttc
KDN01_0079_F03.b : gtgacatctccaaacttctacaaaggctgtttttacgaaaacctggccttctgaaacaaa
PST01_0039_F12.b : AGGTAACccttcagactatctacaaaagctgttttacagaaaagcttgcttttcttggaa
KDN01_0080_C12.b : AGGTTACACttcagactatcttcaaagcttgtttttccgaagaacctgccttttctggaa
PST01_0080_F02.b : AGGTAACCC*TCTAGACTATCTTCAAAAGCTGTATTTACGAAAAAcctggctattctgaa
KDN01_0028_B03.b : AGGT*ACACTTCAGGACTATCTACAAAAGCTGTATTTACAGAAAgcttgctattctaaaa
KDN01_0008_C02.b : GAGTAACACATCAAGACTATCTACAAA*GCTGTATTTACAAAAAAGCATGCTTATCtaaa
CLNT1_0066_C04.b : tttcgacaccctggtttcttggaataaaacataaatggtttttccccctaacggtatttt
OVRT1_0128_B05.b : gcccctcctccctttcactttctcctttctttccccttctctttcttcgcttattattat
OVRT1_0124_B12.b : atccttttcatacttcttttttttacccctttttcttcctcttattcaatctctgatttt
OVRT1_0132_A05.b : tgtttttccgaaacctgccttctgtaaacaaaaaataactgttttttccaaacagatttt
PST01_0041_H08.b : ttttctataaatcgctcttattttaccataccacatggttgtttatctctagccaatatt
OVRT1_0001_E06.b : tcgaatactgtctttcgaaaccatatataattctttttacaatagaatacttctcaataa
OVRT1_0004_A04.b : actggaacaataataatttcttttctcctaaataaaaagaacttgtctctatttagtccc
CLNT1_0041_F04.b : tccaaggctttttttcaaaaagatgcgttctctgtacaaagcattaacaggtttttccca
OVRT1_0041_G09.b : acaactgttttttcaatataaggtcttttttaaaagaaataaaaaagtgttttccccaat
SPLT1_0001_G07.b : aaccatttggattctttgacaagtcgttttttagggaaaacctccgtatttgaacctaaa
OVR01_0043_B12.b : tttttacccccctctgtcaaaattttcaaaaaatcaaacgggttacccccttttcccaaa
PST01_0064_F10.b : agactacctcaaagccggatttccaaaaagctggttatctgaaacaaacaaaaaaatgct
OVRT1_0076_E05.b : acaaaatttttttacaaaaaacctgtttccgtaaaaaacaaataaattgtttttcccaaa
OVRT1_0126_H09.b : ttttcctccgtttcctgcttcaccatttaagatatctctcttcccctctcttaattgctt
CLNT1_0113_G10.b : tcctttttcttgagcccgtctttttatgtcttctcacttcctgtttttctccattgtttc
CLNT1_0146_A11.b : cattttttcaatttgctcgttcttctgataattacaaattaaattcttttttcccatcat
TES01_0101_A03.b : cattcttctgttttttttcatagttctttttttttttaaaaacgcttctttttccgcatt
CLNT1_0115_D01.b : ctcttattattcttctctctctctcttatgttctctctccctatttaccacttgctagtt
OVRT1_0045_G02.b : tatgtaagcattaagtaacattataaaaatatatttttaattataaaaggtcggttaacc
OVRT1_0082_A12.b : atctatggggttaccccttctcaaatttttttccaaaatctttttttttcttagaaacct
OVRT1_0098_F02.b : taaggtttccccctcaggcctttctctatagcctgttttttcagaaaagcttgtttttct
OVRT1_0045_B04.b : aaccttgcccaaagcgtgattcgccaaaatgccttgttttctttatctcactctctctaa
OVRT1_0087_B04.b : gcttttttacagtgtttttttgtcgaaaactttttttcttgagcatatataaaatgcttt
OVRT1_0036_C01.b : ctgttttctcgaaagctgctttacataaacaaataataaaggtttttccacagataactt
OVRT1_0078_B06.b : cataaactgtttttccaaaaacctgcttctttttacaaaaaaaaaatgcgtttctcccaa
OVRT1_0082_B08.b : ttcctcttcactatattctttacagttgttttttttaaaaaaatggtttttcttgataat
LNG01_0034_G12.b : agggggaaaattttgaaaaattaaaagggttaaaccccctttccaaaaaaacctttttct
OVRT1_0040_E06.b : gactcttacaaagctgttttttctaaagcctggttttctggaaacaaaaaaaaaatgttt
LNG01_0046_F07.b : tcgggggggttttttttcaccccggggggaaaaaattttaaaaaaaaaaaaggggggaaa
TCH01_0046_A02.b : accctccagtactttttccaaagggtttttttcgcaaaaacttgccttctcttggaccca
OVRT1_0038_A03.b : cctcaaacctttcttcaaagttgtttttcaaaaatactggttttcttgaaaaacaaataa
OVRT1_0069_A11.b : ggtgacatctctcgacttttctccaaagctttttttccaaaaaaccttctttttctaaaa
OVRT1_0036_C05.b : cttttttaaaagcgtttttccaaaaacctgttttccttaacaaaacaaataaaggttttt
TCH01_0028_A06.b : aggaaccactacagccattctctatatcttgttattactgcacaagctgcttttcctgta
OVRT1_0041_A04.b : tcggacttctccaaattgttttttcacaaaacttgcttttgtgaaaaaaaaaataatgct
OVRT1_0023_B04.b : ttcaaagttttttacgaaaacctccttctgaaaaaaaaaataaatgttttctcccaaaaa
OVRT1_0042_E01.b : ctccaaactttttccaaatctgttttttagaaaccctgttttctgaaacaaaaaaaaaat
OVRT1_0036_G06.b : ctttcccaaagctgtatttccaaaacctgttttcttgacacaaaaaatattgtttttttc
OVRT1_0035_F07.b : aaaaatttctacaagtgttttttccaaaaacttgttatttggaacaaaaaataaaaggtt
OVRT1_0074_C11.b : ttccaacttatttccaaagcttttttttagaaaacttgtcttttttgaaacaaaccaaaa
OVRT1_0084_H08.b : ttaggctattttacaagcttttttttactaaaaccttgcttttttgaaacaaaaataata
TCH01_0023_B08.b : ccaggattttctccaaacctgtatttccgaaaacctgctttcttgaaacaaaccaatata
TCH01_0039_H04.b : aggtaacacctctaggactttctacaaaaggcttaattaacgaaaaaccaggcttactcc
TCH01_0087_F04.b : tacccattcagactttccccaaggctgttttcccgaaaagctgcttatctgaaacaaacc
TCH01_0011_H03.b : gtaccctccagactatctacaaagctgtattttcagaaagcctgcttttcctgaaacaaa
LNG01_0103_C05.b : gtaacactcagaactactacaaagctgtattaccgaaaacttgctatctgaaacaaacaa
TES01_0070_D01.b : tttaaattatgggcaacctttcgggaccttcttaaaattctttttttttaaaaaagaagt
OVRT1_0123_G01.b : cttcttcctttttatttacactttctatctcctctataactctttattgttctttccctg
CLNT1_0128_D11.b : cacactgctccaaattcttgttttactaaaatacgctttttccgcaacctaaaaaataaa
TCH01_0093_B10.b : tcaaaagttgtttttaaaaaactgctttttgaaaaaaactataatattttttttcattat
TCH01_0093_E09.b : gacttcttccaaggctgtttttacaaaagctggctttctgtaacaacacaataaagcttt
CLNT1_0074_H09.b : gggaacccttcaagattttctcaaaagcgtgttttccagaaaaccttgcttttcttgaaa
OVRT1_0033_A09.b : ggtaccctttcagcttttttcaaagtttgtttttcgaaaaagctggttttctgtaaaaaa
TCH01_0085_H10.b : ctcagcacttctccaaagctgttttttcgaaaagctggctttctggaacaaacaataaag
TCH01_0039_E03.b : ttacccttccagactttctccaaagcttgtatttacggaaaacctgcctttcctggaaca
LNG01_0098_D07.b : AGGTAcacatccagactatctacaaagctgtattacggaaagcctgcttatctggaacaa
THY01_0040_A10.b : tactccaacccacctaccccccctcttcttacttcttacttacttccctccgccgtgtcc
OVRT1_0106_F03.b : acgactatctcgttttctctgtttctctcattcgccccttactctgtatatctttctttt
OVRT1_0064_E08.b : ttctttaaattattctaccctcttaggttatctcctctccatttgctttttttcctatca
OVRM1_0204_C10.b :
UTR01_0075_C07.b : aaataaaaaagagctaacccactctacatgtctctatccacaacaaccacctgcaatttt
OVRM1_0206_H10.b :
OVRT1_0143_G01.b : gaccttcctcctcctcttctcccatgttctttttcttagacactccactctcctttgtct
OVRM1_0154_A10.b :
OVRT1_0141_A10.b : tatcaaaaccctcttcttcgtataaacaaataaataacttttttctataaaacaaaaaaa
OVRT1_0132_E08.b : actttccattcttgttttattgcaactctgtgtttttataacacaaccctataagtcttt
OVRT1_0136_B01.b : cccttaacatcttgtttttcaaaatcctgcttttttataacaataattcaactgcctttt
OVRT1_0147_B03.b : atgtcttttatggcacttaattttggttctttctcattgatgaattttttttattaataa
OVRT1_0143_E01.b : ctcgtatcactcacaaaacattctcacttcatttcttccaaatcaatcatttacctcaat
LNG01_0035_A11.b : ttctttcttggttttttttccccccccctgtcacaattctttaaaaaatcatacagccgc
LNG01_0080_G12.b : cctccaaccctttttggaaagtctttcttctaaaacagtctttttttttaaaaataacaa
TCH01_0033_G03.b : catctaaccctttctccctaacctgttttccccaaaacccggtgtttttggaaaacaaca
OVRT1_0008_G02.b : cccctatagcttttttccgatacccttgctttcttgttaataccactaaaatgcttcttc
TCH01_0012_C01.b : aaaattaacgtaatctacacataacaaatttacaaaattgatatttttcaaaaaaaactg
OVRM1_0059_H02.b :
OVRT1_0028_E11.b : tactttccccgaaagctgttttccccaaatcctgtttttttggaaaaaaaaaacataatg
CLNT1_0055_E08.b : gcaaacgtgctttcctgaccacacatttatgtttttcccataactttttttcttatccta
OVRT1_0141_A09.b : cttcccaaggctttttttcaaaaaactgcgttttatttaaaaaaaaaaaaaggtgttttt
OVRT1_0003_C10.b : aatctttttttaccgaaatctgcttttttgaaacaaaaaaaaaatgctttttctcctcct
OVRT1_0147_C10.b : agctgtttttttaaaaccctgttctccgtaaacatataaacaatgtgttttttcacataa
OVRT1_0002_A05.b : gacattccccacagcttgttttaacaaaacctgctttttctgaaacaaatcagaaatcgt
SMG01_0092_C12.b : aggtttttttcgaaaaagtgttttttttaaaaaaaaaaaaaaaggttttttccaaaaaaa
OVRT1_0054_D09.b : gactttttccaaactttttttttcaatagggtgtttttcatgaaaccaacgattaaagct
HTMT1_0044_C07.b : tcaaaaaaatggttttatgaaacaaaaaaaaaaggtttttccccttttctaaaccataat
CLNT1_0064_G09.b : cccgccttttctacaaagtctgttttccccaaaagctgttttttcttcaacccaccaaag
UTR01_0045_A04.b :
CLNT1_0061_A10.b : actttctccaaagcttgttttcctgaaaacctgccttttctgaaacaaacaaataaaggc
OVRT1_0085_E08.b : tggcttatctcatgggttttttcaaaaaagttgtttacttgaaccacacataaaatgttt
LNG01_0042_H03.b : aaaaaatgaaaaaaaaaagggtaaccccaacttcaaaaacttttcttccaaaaaaagcct
CLNT1_0064_F02.b : ctcgagactttcctacaaagctgttttccggaaaagcgggtttctttgaacaaacaaaaa
OVRT1_0042_D12.b : aaagtaaccctcccaaaatttcttcaaaagctttttttttcaaaaaaccttgcttttttg
CLNT1_0096_D04.b : ccctccggccttcttccaaggtgttttttctgaaaccctgttttctttgaacaaacaaac
OVRT1_0058_D02.b : ttctttcaacctttttttctgaaaacctggttttcttgaacaaaaaaataagtctttttt
LNG01_0035_H02.b : tttccccccggtggaaaaattatttaaaaaaataaaaaggggttaaaacccccccttccc
OVRT1_0073_E02.b : cgactttttcaaaattgtttttcccaaaaacttttttttcggaaaaaaacaataaagctt
OVRT1_0073_A09.b : catttttcaatccggttttcaaaaagctgcttttttgaaccaaccattaagtgttttctc
MLN01_0069_C05.b : aaaaagctgttttacaaaaacctgcttatttgaaaaaaaattaatgctttttctaaaaaa
LNG01_0034_F12.b : tttccacccagttggaaaattattgaaaaattaaaaggggttaaaacccccctctccaaa
OVRT1_0043_F11.b : tcttccagacttctctccaagcttgtttttcagaaaactttgtttcttgaaacaacaaat
CLNT1_0051_H02.b : gacttcttcaaagcttgttttcagaaaaccggtttacctgaaccaaaaataaaaggtttt
OVRT1_0035_E03.b : tccccaagcttgatttacaaaatctgctttctttaacaaacaaaaaagtttttttccaat
TCH01_0037_B04.b : catctacaaaactgtttttcagaaaacatgctttcataaacaaacaaaaaaaagcttttt
LNG01_0091_D10.b : ctttttccaaactttttttacaaaaacttgcttatctttaanaaacaattaaagcttttt
UTR01_0043_B07.b : ggggaaatttttaaaaataaaaggggtaaaccccccctccaaacaacctttttttttccc
UTR01_0060_D01.b : attttgaaataaaagggtaacccatttcaagacttattcttccaaaaagcctgttttttt
MLN01_0101_H05.b : ccctctcagactttcttcaaaagctttatttaccaaatacctgccttttctggaaccaaa
CLNT1_0066_E04.b : actattccaaagctgttttttcgaaaaactgctttctggaaccaactataaaggcgtttc
OVRT1_0048_F02.b : ggtaacccttcccgactttctccaaagcctgttttacagaaaagctggctttccttgaaa
CLNT1_0064_E03.b : gataccctctcagactttctcccaagctgtttttaccgaaaaccttgcttttctggaacc
OVRT1_0031_H01.b : cccctccagacttcctcaaaagctgtttttatcaaaaaccttccttttcctgaaacaaaa
CLNT1_0014_A11.b : aagggtaacacttccggaatttttctccaaaagctgttttttcccaaaaaacttgccttt
UTR01_0052_H06.b : aaaaaaaaggtaaaccctttcaaaaaatttttctccaaaaaaccttgtttttttcaaaaa
CLNT1_0074_E03.b : tccngactttctccaaagctgtttttccgaaacctggtttctctgaacaaccaaaaaaag
CLNT1_0064_B01.b : ccttccgaccttcttcaaagctgtttttcacaaaaccctgctttcttggaacaaacaaat
CLNT1_0062_A10.b : accccctcggactttcttcaaaagcgttttttcccgaaagactggcttttcttaaaaaaa
LNG01_0028_F08.b : tttgaaaaaaaagggtaaacccattccaaaaaacatttttttcacaaaaaacctgtttat
CLNT1_0007_E05.b : ggtccccttcagacttttctcaaaggttgtgtttcagaaaagctggttttctggaacaaa
OVRT1_0022_E11.b : aaccccttagaactttttcaaaaccttttttatcgaaaagcttggttttcctgaaccaaa
LNG01_0002_H02.b : gaaaaataaaagggtaaacacattcaaaaaacttttccttacaaaaaagcc
TCH01_0027_F05.b : tacccttcaggactttctccaaagctgtttttcagaaaagcttgctttcttgaacaaacc
ITT01_0012_E04.b : gtaccctctcgactttccccaaaccgtttttcggaaaacctgctttactgaaaaaacaaa
PST01_0044_E03.b : tttatttactatcttatgtagttttccttctactgtttcggctatgatgactccgtatgt
OVRT1_0005_G05.b : ccggaacaaacaaaatattttcttccttccgccaaaatacctccccggatctccgccgga
KDN01_0005_A09.b : accctccagactttctcaaagcctgttttccgaaaagctggctttcctgaaacaaacaaa
KDN01_0096_D09.b : gtaacctttcagacctatcctcaaagctggatttaaaaaaaacctgtttttctgaaaaaa
KDN01_0091_A05.b : accctccagacttatctcaaaaccggattttcacaaaccaggcttatcagaaacaaaaaa
PST01_0042_G06.b : gggtaaacattcggatatttaacatatttgatttccgtaaaacctgggttttcgttaaca
KDN01_0012_B08.b : AGGTAACccttcagaattttttctaaagctggtcttaccgaaaagcatgcttatcctgaa
KDN01_0035_D10.b : AGGGTAACCATTCAGACTACCTCCAAA*GCTGTATTTTCGGA*AAGCATGCTTATCCTGA
TES01_0056_A11.b : ggctacttctccaggccttttttcgctaacttggtttttttttaaaactctccccttctg
OVRT1_0123_D02.b : tcttgtgctttctccattctttctctcttttaaactagtcccctctattttttttctcct
OVRT1_0100_F07.b : caaccggtttttcctgaaggatgcttttcttgtaactcccattatacggctttttcccct
TES01_0059_H04.b : aacacccccgactttttctcaaacgtttattttccaaaaagccgtctttttcttaaaaaa
PST01_0072_A08.b : gtaacccttctagacattctccaaaggcggttttacggaaaacttgcctttctttaaaac
PST01_0099_B11.b : aaggtaacccttccagaactttcttcaaaagctgttttttcagaaaaacctggcttttct
OVRT1_0120_H01.b : catcagctttttttcattaaacctgcttatcctccaaccaattttaattttgctttttcc
OVRT1_0093_E08.b : atttctcctatacctttttaagaaattctccttaattaaaaaaaaaaaaaatggttatcc
OVRT1_0019_D07.b : tttttcaaaactgtttttcagaaaacttgcttttttaaaaaaaaaaaaaatgttttttcc
CLNT1_0150_E07.b : tttctaacatccttttttactcaatctctttttttttaaataaactactatctcttttac
OVRT1_0100_A06.b : ccctgacatttttaaatggttgtttttccaaaaccctgtcttttctgaaaacaaacaatt
OVRT1_0072_D05.b : tgttttcggaaatccttttttctgtctctaacaaaaatctttttctccacgctttttttc
OVR01_0090_D11.b : ataatgaatatacaagggtaaaaactttcttaaaaatttttacacacaacctttttattt
OVRT1_0111_F01.b : AGGGTACACATCCAGACTATCTACAAAAGCTGTATTTACAGAAAAGCATGCTTATCATGA
BKFL1_0103_C07.b : AGGTAACACATCAAGACTATCTACAAAAGCTGTATTTACAGAAAAGCATGCTTATCATGA
BKFL1_0056_C12.b : AGGTAACACATCAAGACTATCTACAAAAGCTGTATTTACAGAAAAGCATGCTTATCATGA
BKFL1_0049_E07.b : AGGTAACACATCAAGACTATCTACAAAAGCTGTATTTACAGAAAAGCATGCTTATCATGA
ILNT1_0020_C05.b : ttttttttttttttGACTATCTACAAAAGCTGTATTTACAGAAAAGCATGCTTATCATGA
ILNT1_0056_D06.b : ttttttttttttttttttatCTACAAAAGCTGTATTTACAGAAAAGCATGCTTATCATGA
SKNB1_0013_E01.b :
20110601C-012214 : AACAAAACAAATAAAATGCTTTTTCTCACAATACAGTACATTTTCATTAATT*AAAAAAA
---------+---------+---------+---------+---------+---------+ 1265
CLNT1_0151_F03.b : ttgatacacgattattgatgtctaaacgcgcctcgctcatcatggacaaccacctattct
PST01_0033_B11.b : AACAAAACAAATAAAATGCTTTTTCTCCCATTCACGTCCTTTTTCtttatta*aaaaaaa
TES01_0020_A03.b : tttctctaaccttcttattttctcctttacaaaaattaaatcgttccctttttcctttct
OVRT1_0100_C01.b : tctcacattgtttttttctttcttttaaaaagaacattaagggcccttgtcgctctgtct
TES01_0001_D08.b : cctttatctttatatacaatactatttgatattgtttttttcttctaaaaataaatcaat
OVRT1_0044_E01.b : tctccctacccttttttatatattaatataaaaaatatcggccctcttctccctttctgt
TES01_0040_A03.b : cattaatggcttttcttcctctttattatactgaatttcattttttatatgtggttcttt
OVRT1_0149_B12.b : ataaaatacaattaattggctttttttctcaacatagactttattttctttatataaaaa
TES01_0112_B01.b : ttgtgaaccaaacaaaaaaaaagggcttttttccccaaaaaaaaaaaaaaaataataagg
CLNT1_0096_B04.b : tctccctaagtgttttttttattataaacaaaaaaagggcccttgttttattcgggctgg
OVRT1_0025_C10.b : cgtcttttttttttttaaaaaacaaaaagatcccttgtgccccatctcgtcggcccccat
PST01_0042_A08.b : caaatggtacttttcttatttaaaaaaaaatataggccattgactaaattctaaatccct
KDN01_0016_C12.b : gaaccaaccaaataaaattgctttttctcccaatccagtacatttctcttaattaaaaaa
CLNT1_0022_F10.b : caaaataaatgccttctctcaaaatgagaaactttctcttttttaaaaataaaaaaaggg
KDN01_0093_D03.b : ctttttctcccaaccgtccattttcttattaaaaaaaaaaaataaggcccatgtgtccta
PST01_0054_E06.b : tgttttttccaaaaaaaaaaaataaaaggcccttggctccatctgatgtccggcgcctaa
PST01_0098_A12.b : aacaataaaaagcgttttttccaaaaacagtaacttttttttttttaaaaaaaaaaaaaa
KDN01_0028_A09.b : aaacaaataaatgctttttctcccaatccgtccttttccttaattacaaaaaaaaaaaag
PST01_0074_D09.b : caaacaaataaatgcttttttctcccaaaaaaaaataaaaaaaaaaaggcccttgggccc
LVR01_0057_C12.b : tttttttttacaaaaaaaaaccctttcctttttttc
OVRT1_0022_A06.b : cccaacacgtattttctttattaaaaaaaaaaaggcccttgtttcaaactgggtccgccc
KDN01_0079_F03.b : caaaaaaatggtttttctcccaaaaaaaaaaaataaggcccttgtgcctcacttgcggtt
PST01_0039_F12.b : caaaccaataaaatgcttttttccccataccgtcctttttctttatttaaaaaaaaaaaa
KDN01_0080_C12.b : acaaaccaataaaaggcttttctcccgnnggaagaaaaacactaaatatacacgaaccct
PST01_0080_F02.b : aaaaacaaaaaaatgggtttttctcccaaaaaaaaaaaaaaagccacttgggctccaact
KDN01_0028_B03.b : caaacaattaaatgcttttcctcacaaaaaaaaaaaaaggcccatgtgctcaactgcagg
KDN01_0008_C02.b : caaacaaataaatgctttttccccacaaaaaaaaaaaaaaggccatgggctcagctgagg
CLNT1_0066_C04.b : ttttttttataaataaaaatcgccctgtttcacttttccgtcctgcctctctttttctta
OVRT1_0128_B05.b : acacgcccttttctctcttcgttccccccttttttccaccaacatccttctcttgtgtct
OVRT1_0124_B12.b : tttttctctacactacctctctatttctatttaacataaattttttccacttttttctat
OVRT1_0132_A05.b : tttttttttaataaaaaaggcgccttgtttccttcggggggggccccactttttataaaa
PST01_0041_H08.b : ttttaaaaatctaactatatgccttcttatactcatttttactcacattattctgtgcat
OVRT1_0001_E06.b : aaaaaaaaaatgctctgctcactttgggtgtgcctattatttgaaatatcccaccccccg
OVRT1_0004_A04.b : ctccaataaactaaaaaaatccccccccccctctaacacaaggtgccttgtttgattcag
CLNT1_0041_F04.b : ttaagttttttttcttatttataagaaacaaaacgccttggtctcccttcgggcgcggcc
OVRT1_0041_G09.b : actaattttaattaaaaaaaaaaaaaaaggccaaatcttcaattctgtctgcgccctaaa
SPLT1_0001_G07.b : caaataattgtttttcttcccggtagagatatagttagaaaattatatcgatcttatatt
OVR01_0043_B12.b : aacctttttttcattcacaaaaacccttt
PST01_0064_F10.b : ttttcccccatcggtcatttccttaattaaaaaaaaaaaaaggcccatgtgtccaatgag
OVRT1_0076_E05.b : attaattttttatttaaacataaaaaaaggccctgttctatcttagtcgccgccaataat
OVRT1_0126_H09.b : attccccgatcttcatctttctttttacgccatatctcttcttcattgtccgccctacta
CLNT1_0113_G10.b : ctttctatcattattacttcaactgtctcccgtgtttcctactttctgctccctactatt
CLNT1_0146_A11.b : aaatttttcttatcatatgaaaactaaactccttttctccctacttttacccgcccatct
TES01_0101_A03.b : atatccatataaggttctttttccccttattatttactcataactttatcgtcgcttttt
CLNT1_0115_D01.b : gttccccccttatcgtcttattttacttaactattatccttttaccttcctctatccgca
OVRT1_0045_G02.b : ttgatataaaaaaaatttcatgctctttctctaccaaataattctcattataatatactc
OVRT1_0082_A12.b : ttgtctttttcttgttaacacgtacccaattacaggtccttttttctacaattcctattc
OVRT1_0098_F02.b : tggaacaaaaaacattaaaggttctttctccaccatcgggatttttttctttttttaaaa
OVRT1_0045_B04.b : ggtcttttctccatactaactcctttttttttattcaaaaaataaaattatggttacgtg
OVRT1_0087_B04.b : tccctctacgtcattttcttatttaagaacaacaatatgccatgtctcttctcacaccct
OVRT1_0036_C01.b : ttttttattataaaaaaaaaaaaagccatgttctcctcctgtttgcccgcctaaatatta
OVRT1_0078_B06.b : actatattccttttataaaaaaaaaaaggtcctgttctccctctcggtcgcccctaaaaa
OVRT1_0082_B08.b : atcaattaatgttttttccacaatccgtccgttttctattttttacaaaaaaaataatgc
LNG01_0034_G12.b : ttcccaaaaaaagccctgttttttttttttttcccagaaaaaaaaaaaccccattgggcc
OVRT1_0040_E06.b : ttcttcaaacaagatcttttttttaataaataaaaaaaaaaggcctttggtcctgactga
LNG01_0046_F07.b : aacacctttccaggaacaactacttttttctcaaaaaaaaagccccttggtttatttttt
TCH01_0046_A02.b : cacaataaaatggctttttctccaccaacaggcacttttctcttattataaaaaaaataa
OVRT1_0038_A03.b : agtggttttcccccatagctcctttttcttttttaaaaaaagaaaaaggtcccgtgtttc
OVRT1_0069_A11.b : ccaaaccaataatgtcttttttccctanaccgagttcttcttctcactataaaaacaaat
OVRT1_0036_C05.b : cccaaaaattctttttcttaataaaaaaaaaaaatggccctctttttccccttaggccgg
TCH01_0028_A06.b : acaaaaactaatctatgctcttttctcccaacaaaaactaaattaagctccacttgtcct
OVRT1_0041_A04.b : ttttccctccaaacacctttaaaaaaaaatatatttaattgcccctggtccatttccggg
OVRT1_0023_B04.b : aaaaaaaaaaaaaaaaanangnaannnnnnnnanggggcgcccgcaggaagggggggggn
OVRT1_0042_E01.b : tgttttttctccaacagataatttttttttattaaaaaaaaaaaaaaagggccctttcct
OVRT1_0036_G06.b : caaaaaaaaaaaaaaggcccttgtttcacctgggtccggcccctaaaattttgtaaaaac
OVRT1_0035_F07.b : tttcccaaatagtactttttttatttaaaaaaaaaaaagcccttttctccattgaggccg
OVRT1_0074_C11.b : aaggctttttctccaaaacaattttttttattttaaaaaaaaaaaagaggccagggctca
OVRT1_0084_H08.b : aatgttttcccccatacctccctttcttttttaaaaaaaataaaagcccttttttctctt
TCH01_0023_B08.b : tcttttttctcccnnggaaaaaaaaaaacaagccacactatagggagaaaaaacaaaaaa
TCH01_0039_H04.b : tgaaacaaaacaaataaaatgcctttttccaaccananaacacacacaatcttaaaaagg
TCH01_0087_F04.b : ataaaggctttttctccacaaatnnncctccggaacccctttagtgcaaccatcctttcc
TCH01_0011_H03.b : ccaattaattgcttttcctccaaaaaaaaaaaaaagggcactttgtccaactgtaggtcc
LNG01_0103_C05.b : aaaagcttttctcaaaaagtaattttcttattaaaaaaaaaaggcctgggtcaactgagg
TES01_0070_D01.b : tcttttttttatcacacaaattatggttttttttctctaaataaaataaaaaagtgctct
OVRT1_0123_G01.b : tatatttattttaatctcttactttttcacctctttctgtcatctcttcatcccttccat
CLNT1_0128_D11.b : tttttttccccatcactcacttctctttattataaaaaccacacgccctcgtttctcttt
TCH01_0093_B10.b : aaaaaaanataatactcttttatactctaatctctgccttataatatctctagagacaaa
TCH01_0093_E09.b : tctccctataaaaataaaaaaaaggccttgtttcttatcctggtccgccgccttatttcc
CLNT1_0074_H09.b : caaacaaaataaatgctttttttcccaaatcagttatttttcttattttaaaaaaaaaaa
OVRT1_0033_A09.b : acaattaaaagtttttttcccccaaaaaaaaaaaaaaaggcccattttgtctcattccgg
TCH01_0085_H10.b : tgtttttctcccaaaaaaaaaaaaaggccctttgctccacttcgggtcggcccctctaat
TCH01_0039_E03.b : aacacatataatgcttttttccccaaaaaaaaaaaaaaaaaaagggccctggtgtcagac
LNG01_0098_D07.b : aacaataaatgctttttccccatacaatattttccttaattaaaaaaaaaaaaggcccat
THY01_0040_A10.b : tttcttccctctcacgcttcacgtctcatcttttgactcacaccctatcaaccggccgat
OVRT1_0106_F03.b : tgtttccctccattttccttacctcccctctttatctcctccttcattacattttgcttt
OVRT1_0064_E08.b : tagctgtttttttttgtaaacaacaattatatgtttttttcctctcctcttaatgattat
OVRM1_0204_C10.b :
UTR01_0075_C07.b : ttctataaagaacaaaccacaatactttataaattaagataatactacaaacaaaacaaa
OVRM1_0206_H10.b :
OVRT1_0143_G01.b : cgattcttactgctctcttttctccctctcatctcttttttttttatacccatactccca
OVRM1_0154_A10.b :
OVRT1_0141_A10.b : aatggcatttttactttttccttacctcgcgtctatcataaaaaaattaataccctccct
OVRT1_0132_E08.b : cttctccatacaaaactcaaatacattatagattcccccttttctttctgctacagtccc
OVRT1_0136_B01.b : tcctcacaaaatataataatagagcccctgtcttcaccccacggttgtcccccattttcc
OVRT1_0147_B03.b : aactgtttctttttttcttcttaggggtgtctatttataatataaatctcccttccccaa
OVRT1_0143_E01.b : atcttctacgaccatattctgttcctgccacctgtctcttctacttatccattcactaaa
LNG01_0035_A11.b : acaacacccctctcccctacaccaccactccccctcactcccaaaaatacgccctcccct
LNG01_0080_G12.b : aataaattttttttttccaaataaaaaaaaaaaaaaggccactggttaaaatactttgtc
TCH01_0033_G03.b : aatataaggtctttttccaatctacacacttttcttttttatataacaattaaatgttat
OVRT1_0008_G02.b : tcacccctattttttctctttgtaactaaaaaaacacacgccatttgtctcactctcggt
TCH01_0012_C01.b : ttttttctttaaaaaaaacaaaataaatgtttttttcctataataaaaatcatacaaaaa
OVRM1_0059_H02.b :
OVRT1_0028_E11.b : ctttttccccaccccgcccttctatttaccccaacaaaaaaaaaaccccctttgttgaac
CLNT1_0055_E08.b : aaaaataaaaggcctgttctttatttgtgccccccttttttttcagaaaacccccccccc
OVRT1_0141_A09.b : ctcccaaaaattattttttttatttaaaaaaaaaaataagacttttgttcctcgattggg
OVRT1_0003_C10.b : aaaattttcttttttaaaaaataataaccctctttcccacttccgtttgggccctatatt
OVRT1_0147_C10.b : tttcttttttctttaaaaagaaacaatagcctatttctcctcatcatgtcggctactaat
OVRT1_0002_A05.b : tttctcccactgaactttttcctttttaaaaacaataaacgccccatttcctcatcctgg
SMG01_0092_C12.b : aatttttttttttttaaaaaaaatttttccctttttaaaaaaagcccccggtttttaaaa
OVRT1_0054_D09.b : tttttcccaaaaaggtaattttttttttttaaaaaaaaataaaaggcctctttgcccagg
HTMT1_0044_C07.b : cttaatagagaannnganannnnnnnnnnnnnatttttngggggggcaaattccaccacc
CLNT1_0064_G09.b : aatgtgtttttctcccaatcacagcacttttctctattaaaaaaaataaaataggccctt
UTR01_0045_A04.b :
CLNT1_0061_A10.b : tttttccccaaaaaaaaaaaaaaggcccattgtcccaccttccggtcgggccctttatta
OVRT1_0085_E08.b : tttctcctccatacttttttttttaaaaaaaaaaaaaaaggcttctttgtccacctgggt
LNG01_0042_H03.b : ggtttttttttaaaaaaaaaaaaccctgggccttttattttccgtgggaaaaaaaaaaaa
CLNT1_0064_F02.b : agggcttttccccatcacagaattttttttatttaaaaacaaaaaaaaggccctttgctc
OVRT1_0042_D12.b : aaacacaaaaaataaaatgtcttttcccccaattaaaaaaaaaaaaaggcccctgttttt
CLNT1_0096_D04.b : aaaggcttttctcaacacagtactttccttttataaaaaaaaaaaaggccctttgtccaa
OVRT1_0058_D02.b : ccaaataaatatttttttattataaaaaaaaaaaaaaggccctttgtccttatttcaggg
LNG01_0035_H02.b : aaaaaaacccttatttcctctccccaaaaaaaaaacccttttgtttattttttttttttt
OVRT1_0073_E02.b : ttctctccaaactatcttttctttaataaaaaaaaaaaagaggccctgttcccagagccg
OVRT1_0073_A09.b : ccgaatgaaaataaaaacatatctatattactattggcccttgtctcccttgtggccgcg
MLN01_0069_C05.b : aaaaaaaaaggccaatggctcaattggggtcggcgcttaaaaatccctaggggccaatta
LNG01_0034_F12.b : gaaaacattatttccctcccaaaaaaaaaacccttgttttttttttttttttaccaagaa
OVRT1_0043_F11.b : aaatgtttttttcccaaatcagattttttttttttaaaaaaaaaaaaaaggccctttgtt
CLNT1_0051_H02.b : tccccaacagtcattttcttttttaaaaaaaaaaaagcccttgtttctactcggtccggc
OVRT1_0035_E03.b : aaatttttttttattaaaaaaaaaaaagcccctttcccatttcggggccgccctttttat
TCH01_0037_B04.b : cccaaaaaataattttcttaataaaaaaaaaaaaaaggcacttgtgcccaactcaggtcg
LNG01_0091_D10.b : ccccaaaaaaaaaaaaggcccatttcctatatttagtccgccccccttaaatccctcagg
UTR01_0043_B07.b : caaaaaaccccttgtttttttttttttcccaaaaaaaaaaaaccccctttttctcttttt
UTR01_0060_D01.b : ttccaaaaaaaaacccttgccttttttttttta
MLN01_0101_H05.b : caaataaaagccttttcccaccaaaaagaaaaaataaaaggccacttgtcctcaacttag
CLNT1_0066_E04.b : tccacacaagcccttttttttttaaaaaaaaaaaaggcccttgctcaatctcgcccggcc
OVRT1_0048_F02.b : caaaacatataaatggtttttctccccaatagagacttttcctttattataaaaaaaaaa
CLNT1_0064_E03.b : acccaataaaaggtttttctcccatcacactacttttctttatataaaataaaaaaaaag
OVRT1_0031_H01.b : caattaatgggttttttctcccaaaaaaaaaaaaaaaaagggcccatttgtcctcaactg
CLNT1_0014_A11.b : cctggaaccaaacaattaaatggcttttttccccaaaaaaaaaaaaaaaagcgccccttg
UTR01_0052_H06.b : aaaacctttgctttttttcatgaaaaaaaaaaaaacacaaattaaaaaaggtgctttttt
CLNT1_0074_E03.b : gtttttcccaaaacgttattttcctttttaaaaaaaaaaaaaggccctttgttccatctc
CLNT1_0064_B01.b : aaaaccttttttcaccaaaaanngnnngnggnngngaaggaagaaaaaacaagagccana
CLNT1_0062_A10.b : aacaataaaggcttttcttcccaaaaaaaaaaaaaaagcgccctttgtcccgctctgggg
LNG01_0028_F08.b : ttttccacaaaaaaaaacactggcctttttttctccgtgaaaaaaaaaaaaaaaaaaaaa
CLNT1_0007_E05.b : acaattaaggctttctcccaaaaaataacttttctttatttaaaaaaaaaaaaggcccct
OVRT1_0022_E11.b : caaaaaaggcgtttttctcccataaaatattttttttttataaaaaaaaaaaaaggccct
LNG01_0002_H02.b :
TCH01_0027_F05.b : aattaaatgg
ITT01_0012_E04.b : taatgtttttccccaaaaaaaaaaaaaggccttgtcccaactgaggccgggcctctaatt
PST01_0044_E03.b : cttcttttttaatatatctcttttttcctctctttacttcttactttctatcctttctaa
OVRT1_0005_G05.b : agtttattcccacgggtgtatcttttcacatcggaatatcgaaaaatggtaaatgctcaa
KDN01_0005_A09.b : ataatgctttttccccgaaaaaaaaaaaaaagaagaattaacccatttttcaaaaaaaaa
KDN01_0096_D09.b : acaaataaaaggtttttctccaatcggttaatttttcttatttaaataaaaaaaaaaggc
KDN01_0091_A05.b : taaaatggttttccccaaaacggaattttccttaattaaaaaaaaaaaaaaaagcgcctg
PST01_0042_G06.b : aacatataattgttttttcacacaacattattttcctttattaaaaaataaatataagtc
KDN01_0012_B08.b : acaaacaaataaaaggttatttctcccatacgtccctttctttatttacaaaaataaaat
KDN01_0035_D10.b : AACCAAACAAATAAAATGCTTTTTCTCACAAaaaaaaaaaaaaggccccttgtgcctcaa
TES01_0056_A11.b : tggtacaaaaccactttatatgcctttttccctcttccatttattaatacctccattagg
OVRT1_0123_D02.b : catctccctttactttctacattattatacggacccttttttgtttcttttctactctcc
OVRT1_0100_F07.b : aatagaaccttctctctctactcataaaataactggcttatgtcctcatttgttttcgca
TES01_0059_H04.b : aaaaaaaaaaagcttttttcccccaaaaaaaaaaaaaaaaaaaaaggccctttgtcccaa
PST01_0072_A08.b : aaacaaattaaatgtcttttcccacaatacgtacaatttctttatttaaaaaaaaaataa
PST01_0099_B11.b : ggaaaaaaaacaaataaaaggcttttccccccacatacgtcacttttccttttttaacaa
OVRT1_0120_H01.b : ctctgactttttcactatgttctctcttcttgctcgcccctctttctctctttatatcca
OVRT1_0093_E08.b : caatacagatttttttttttaaaaaaaaaaaagccaactgttctttttccggtcgaccaa
OVRT1_0019_D07.b : ccctatatcagtatacacgataattaccatcaaacggctttttctgttgtggttttatga
CLNT1_0150_E07.b : tatcctatttttctattctctatttaaaaatactctaacacccatcctcctatctctttg
OVRT1_0100_A06.b : acagttctttttccccaaaaaaaaaaaaaaagcccatgtgctctactgcgtggtcgggct
OVRT1_0072_D05.b : ttttaaaaacattaaaggtccatgtctgctcttgctcgtcctattaattaaaaacctccc
OVR01_0090_D11.b : aaan
OVRT1_0111_F01.b : AACAAAACAAATAAAATGCTTTTTCctcacaaaaaaaaaaaaa
BKFL1_0103_C07.b : AACAAAACAAATAAAATGCTTTTTCTCACAATACAGTACATTTTCattaatt*aaaaaaa
BKFL1_0056_C12.b : AACAAAACAAATAAAATGCTTTTTCTCACAATACAGTACATTTTCATTAATcaa
BKFL1_0049_E07.b : AACAAAACAAATAAAATGCTTTTTCTCACAATACAGTACATTTTCattaatt*aaaaaaa
ILNT1_0020_C05.b : AACAAAACAAATAAAATGCTTTTTCTCACAATACAGTACATTTTCattaattaaaaaaaa
ILNT1_0056_D06.b : AACAAAACAAATAAAATGCTTTTTCTCACAATACAGTACATTTTCattaattaaaaaaaa
SKNB1_0013_E01.b : nnnccctcgctg
20110601C-012214 : AAAATTTAAAGCCATATCATAGAAACAAGACACACAGAGTTGTAAGAGAGCTAAACACTC
---------+---------+---------+---------+---------+---------+ 1325
CLNT1_0151_F03.b : ttattaaatgaactatgttgttcgcgttataaattttataaaatcctatacactccctct
PST01_0033_B11.b : aaaaaaaggcccatgggtctcacttgcggtccgggcccctaaactatctaaagaaaaccc
TES01_0020_A03.b : ggtttcagtcctttctaaatttttaaaataatcttcctttcttccttttctttatcatta
OVRT1_0100_C01.b : acagttgcccctcaataatctctaataaaacctccctcccccccggtaacttattataat
TES01_0001_D08.b : attactttggtccctttgttcctaaattctcctttccgtgctctcttaaattttttaatt
OVRT1_0044_E01.b : cgtccccgttaatactttataaacacccctccccttccctagatgccattagtgagatgt
TES01_0040_A03.b : gttcccatttttgttcgcgagccttatataacttaaaaaaaaccctctccccctcccgta
OVRT1_0149_B12.b : aaaataataggcgcacctcttttctacatttgggtggcgctcctaccttttactgaggaa
TES01_0112_B01.b : cccatttggccccaactttcaaggctcggccctccttaatatttcttagaaaaaaaatct
CLNT1_0096_B04.b : cgcctttctttttaagaaaatcccctctcccccgccaaaaaatataaggtatgtgtgttc
OVRT1_0025_C10.b : actatttaaaaaaacctctcccccccccgaacccaaataaaaaagccagtggttttattt
PST01_0042_A08.b : tcacttattaataaatctcccacctcccgtataggaaatatgaggcatgttttgaacatg
KDN01_0016_C12.b : aaaaaaaaagaggccactttgtctccaaatttacaggtcccgccccctaaaataatttta
CLNT1_0022_F10.b : cccttgggttctaatatgggtccggccccttaaattcttatataaaaacccccacccccc
KDN01_0093_D03.b : cttcggttccggcccataatatttaagaaaaccccccaccccccccgaccgaaacaaaag
PST01_0054_E06.b : aattctaaaaaaacctccaccctccccgaccgaaaaaaagaaggattggggtgtattgtt
PST01_0098_A12.b : agcgcccttggtttctaaacggaggtctggggcccttaatttttttatgaaaaaaacccc
KDN01_0028_A09.b : gccccttgtgttcaactgtagtcccggccctaacatatctaaaaaaacctcccccccccc
PST01_0074_D09.b : taccttgaggtccggccccctaactacttataaaaaacccccccccctctcccggaccct
LVR01_0057_C12.b :
OVRT1_0022_A06.b : taattttttaaaaaaacctccccccccccgaataaaaaaaagagggctgtgtgtactttt
KDN01_0079_F03.b : gggcccccaactactctaaaaaaaacacccccacccccccgaaactgaacaataagaaga
PST01_0039_F12.b : aaaaaaaggcccattgtcctcaactctcaagtccgcggcccttaacattttttaagaaaa
KDN01_0080_C12.b : cctgtatatatatttaaaaactattatttatngggccccttggtcttaaactgggggccg
PST01_0080_F02.b : gacggtccggcccctaaactattctaaaaaaaaacctccccccccccccgtaaccgaaaa
KDN01_0028_B03.b : tccggcccctatactttcttaaaaaaccctcccccccccctgaactgaaaaaaagagagg
KDN01_0008_C02.b : tccgggccctaactatctaagaaaaaactcccacctcccctgaaccgaaaaaagaaggca
CLNT1_0066_C04.b : gagaatacaccccctctcctatccaaaaaatataaagctttgtgtttcactcgttttccc
OVRT1_0128_B05.b : aatctattctgttctctttttctctttgcctcctgtcattcctcgcactttgaaccagaa
OVRT1_0124_B12.b : atttcccttctctacactatttctactttagactcctcttcctccttactatattaaatt
OVRT1_0132_A05.b : aaccccccctcccccacgcaaaaataagagatgtgtgtgatatttctccctcagggcgca
PST01_0041_H08.b : tgttcccatcagcttgtgaatatttatcctaatttttctgttatcgttcttttattaaat
OVRT1_0001_E06.b : accaacaaagtggttttgtgtctgtttgcctttggaccattcatcccttcaaaacttttt
OVRT1_0004_A04.b : tccccttatgtcacaaccatatctttcaaaaaaatttcttctatgtgggaacacaaattt
CLNT1_0041_F04.b : tcatacatttcaaaaaaccccccccctccccgcgtgccataaataaagccctgggtggtt
OVRT1_0041_G09.b : ttcaaaaaaacctcccccccctcaacaaataaaaaaaaaatgggttgctattttatccca
SPLT1_0001_G07.b : tcccttcccgatcctgtaaagttcagatatccggtcgcccttattcactctattggggct
OVR01_0043_B12.b :
PST01_0064_F10.b : gtcgggcccctacatatataaaaaaaacccccccccccccgggactaaaaaaaaaaaggg
OVRT1_0076_E05.b : ataagaaaaactccctctccctcaacctacaaaaaaagaatttttttaatgcttttcctt
OVRT1_0126_H09.b : tcttgtctatcttcctcacactattccctcttaccttcgttatttccgacctttcctatt
CLNT1_0113_G10.b : tttatagaactctccccttcttctagtatcaatgtatcttattgcatgttacactttact
CLNT1_0146_A11.b : ttctctaaaaaaccctccctcccctaactttcacctagctctctgttgctttttcttctt
TES01_0101_A03.b : ggtccttcctactttgcttacgcctctttatctccctaaaagagtactccccctgtccct
CLNT1_0115_D01.b : tcttgtcccatcattctatctcattactactccccttcttctttgcattcttgttttctt
OVRT1_0045_G02.b : aaagactatatgcctcattcttcattaacctcatattttgtgcctccaaaattactctag
OVRT1_0082_A12.b : tttttctctttatcttaatacaaaaaaaaaaacagtgccacctttgttcttctctcttgc
OVRT1_0098_F02.b : aagaataaaagggcccatgtgtccggaccgggtggcagggtccaacatatacttcaatat
OVRT1_0045_B04.b : tttctattctctgggcggcggcctcttcttttatagaataacactctcctcccctccccg
OVRT1_0087_B04.b : ccccaaatattataaaaaactccccaatccctccaagaacaaaaaaagcgtggtgactca
OVRT1_0036_C01.b : taaaaacccccacacccccccaacaaaaaaaaaaaagaatgtttgtatctgttttcccct
OVRT1_0078_B06.b : ttctagaaaactctccaccctctctttctaataatataaaacgttgtgttactttttttc
OVRT1_0082_B08.b : ctatgtgtctcatgttgggtcgtccctacaaatttagaaaatacccccaccccccctgta
LNG01_0034_G12.b : cttttttatttcttcttttgggtaaaaaaaaaacaaaaaaaac
OVRT1_0040_E06.b : gggcgggccctttatattctgaaaaaccccccccacctcctctaacgaaaaagagaaaga
LNG01_0046_F07.b : tatcccagaaaaaaaaaaaaacccatttggggctcttttttttatttttctatagggtaa
TCH01_0046_A02.b : atatagccccttgttctctactttccgtctcccgccccctcttatattcctccggaggcc
OVRT1_0038_A03.b : cactcggtccggccctcttatattatgaaaaaccccctcctccccctgactaaataaaga
OVRT1_0069_A11.b : aaagtggccccttttcctcccacgaggttgccgcccctaacattttctagaaacactctc
OVRT1_0036_C05.b : gcctctaatatttaaaaaaaacctccccctccccccacacaaaataaaagagaaattgtt
TCH01_0028_A06.b : aaacctctggtttctgtccccctttattatctctcgaggggtccacctttcttctatcca
OVRT1_0041_A04.b : tcgccccttatttttaaaaaaaactccccccccccgccccaaacaaaaaaggtttgtgtt
OVRT1_0023_B04.b : cccccccccccggccgcccaaaaaaacaagaacccccccccctcggaaagaacggaacgg
OVRT1_0042_E01.b : cagttggggggccccccctatttgtttaaaaaaccccccccccccctaccgaaaaaaaaa
OVRT1_0036_G06.b : ccccccccccccgaaccaaacaagaagagagtttttttatgttttttccctttagggcaa
OVRT1_0035_F07.b : ccccttaattttaaaaaaacccccacccccccacccaaaaaaaaaaaaattggtttactt
OVRT1_0074_C11.b : actgggggcggccccctaccttttataaaaatcctccccccccctaaccctaaaataaga
OVRT1_0084_H08.b : tggtgccggtccttatttattcataaaaaccctcccctccccttgcatcagaaaaaaaga
TCH01_0023_B08.b : ggcgctttgtccaactggggggcgcccctttaatatccccggggccaacttacgccccat
TCH01_0039_H04.b : gcccctgttcctccagacttccaggttccggccccccc
TCH01_0087_F04.b : cccttatctatataaataaaaaaggggccatgttctcgctgggtggccctttatatcccg
TCH01_0011_H03.b : cggccccttcaatatccctcgggggccaaacc
LNG01_0103_C05.b : ccgccgcccaaatccctaagggcaacttcctacccttttttaaaggcccaaaggaccata
TES01_0070_D01.b : tttttttctcatggggtgggcgccccttattttctttaaataaaatccctcccccccccc
OVRT1_0123_G01.b : tcagtttgctcttttacctcactttccccatccgactctttacttcctccatctgctccc
CLNT1_0128_D11.b : tctttcccccccctcttacttttattaacatcccccctccctgctccacgaaaaaagaaa
TCH01_0093_B10.b : ttaatataacnttctaatatttgcttaatataatataaaataaattctctatttatatt
TCH01_0093_E09.b : ttaggggccatttttcgtccccgtttctttacaaggccccttttgggctatataccgagc
CLNT1_0074_H09.b : aaaggcccctttgtttcaaccttgggtgcggcccgcttaattttttaaaaaaaaactccc
OVRT1_0033_A09.b : tgccgccccctaatatattaaaaaaaaccccccaccccccccgtacggaaaaaaaaaaag
TCH01_0085_H10.b : tccccgaggggcccagctttcgtcacacttttttgta
TCH01_0039_E03.b : tgcaggtccggccgctcttaatttccctcagggggccan
LNG01_0098_D07.b : gtttcgactgcggtcgcgccctcttaatatcctcagggccagttaccgacccctttttta
THY01_0040_A10.b : cccccactcccccctctctcctcctgatgctactctctctcttcctcctccttaaacaac
OVRT1_0106_F03.b : gcttcttttttcactctctttctttactttgtctaactttcctaactttactgttctctc
OVRT1_0064_E08.b : ttctttttcttctgccctccttgcttatctctggctgctgcttcctttattctatatatt
OVRM1_0204_C10.b :
UTR01_0075_C07.b : taaataaatacaaatattgctcacttctttttttttttcctactcattcaataacaaata
OVRM1_0206_H10.b :
OVRT1_0143_G01.b : tgtcgccccttctctcttttacttcacctccttccctccttttattctttactatacctt
OVRM1_0154_A10.b :
OVRT1_0141_A10.b : cctccatncctagaatatgtaatttctgtgctaattcgacgacctctaatgatcattaat
OVRT1_0132_E08.b : tctctatataataaaatatctctcctctcccgaagtaaaaataaaaagaaatttgtgtta
OVRT1_0136_B01.b : cacagaaaatcccccctcctcgaatcgccataaagagagagtgtgtttttcttcttactc
OVRT1_0147_B03.b : gttcactagaacacgcttggtcatatacttcgctatggaactaaatgtaattccactccc
OVRT1_0143_E01.b : cgatgtctcccttttctattactatctgcgcgttaactacaatgtcatgaaaattcgcac
LNG01_0035_A11.b : ttctactttttctttcaccacgaacaaaaaaaaaatac
LNG01_0080_G12.b : cgggcggctttgaaaatccccgagggctaaatttacccacaacatttttttaaaggggcc
TCH01_0033_G03.b : ttgtttctaaacttccggcccgcctcctataatattctcctagcggtcaaa
OVRT1_0008_G02.b : tccgccccccatatatttaaacaactctccctcctcctctcacccaaattaaaagagact
TCH01_0012_C01.b : aaaaatgtccaaattttctataattaaaattatgaacacatataaaag
OVRM1_0059_H02.b :
OVRT1_0028_E11.b : caatgtcgtgccctacccatcttaaaaaataacccccccttcccggatcccaacaaaaag
CLNT1_0055_E08.b : ctactaaaaaaaaagccctttttttcttttttccccataggttaaaataagtccttccaa
OVRT1_0141_A09.b : gcgcgcctataaatatataaaaaccccccccccccccccccaaaaaaaaaaaaagagttt
OVRT1_0003_C10.b : cctaataaaatccccccctccctcaacaaaaaaaaggaagccctggtttttctttctgcc
OVRT1_0147_C10.b : tattatattaatccctctcccgccgtgcttgaaaattggtatgtgtgtttcctattgttt
OVRT1_0002_A05.b : tccgccctataaattctataaaaaactccacctccccgtaactaaaaaaaaagagctgtg
SMG01_0092_C12.b : aataaccctcttcccggggggatctttggaaattccctaaaaccttttggggtatgttcc
OVRT1_0054_D09.b : tggggtccgcccacaatatttttataaaaacctccccctccccccggcctaaaaataaag
HTMT1_0044_C07.b : atcctttcttctttttnnnnnngnnnnnnnnnnnntntgttggngntntgantnatatac
CLNT1_0064_G09.b : gttgtccaggttcagactcgcgctcaatatattattcaataaacctcccaccccccccct
UTR01_0045_A04.b :
CLNT1_0061_A10.b : tttaaaaaaaaactcccccctccccgaaccgaaaaaaaaagaggcacttgttttttctgt
OVRT1_0085_E08.b : tggggcttttatttcataaaaaccctcctcccccatacaaaaaaatacgcctccggtgaa
LNG01_0042_H03.b : aacaaaaaattaaaaaaaatgggcttcttttttttttttttctcccccacaataaaataa
CLNT1_0064_F02.b : acttggagctcgggcccttattattttgaaaaacccccccccctcccggaccaaaaaaaa
OVRT1_0042_D12.b : tcagcttggggttcgggccctttaacttctctaaaaaaaacctcccacaccccccctggg
CLNT1_0096_D04.b : ctgagtccggcgtctaatttctaaaaatccccccccccccccgaaccgacaaaaataaga
OVRT1_0058_D02.b : cgcccctatatttattataaaacccctcccccccccgttccgaaaatatagaagactttt
LNG01_0035_H02.b : ctcccaagaaaaaaaaaaaaaaa
OVRT1_0073_E02.b : ctgccggccctattatttttaaaaaaactcccccctcccccgcacaaaaaaaagagacat
OVRT1_0073_A09.b : ccttataattaataaaaactcccctccccctcccccaaataaaggcgccttgtgtttatt
MLN01_0069_C05.b : ccgacaccctttttaaaagagcccaagagagatataacaagcgggcgcctttaaaaccta
LNG01_0034_F12.b : aaaaaaaaaaaaaaccccatgttggtcctctttttttattt
OVRT1_0043_F11.b : tccagtgcggccccccctattatattttaagaaaaccctccctcccccctaaacgaaaat
CLNT1_0051_H02.b : cctatttttttaaaaaaccccccaccccccgaccgaaaaaaaaagcatgtgtggtcttgt
OVRT1_0035_E03.b : ctaaaaaaactcccacccccccacccaaaaaaaaaagccttgtttgttatctttttcacc
TCH01_0037_B04.b : ggcccctctaaaatcctcaagggcccaacttacttc
LNG01_0091_D10.b : gcccacttacgataccacttttttaaaagggtcctattgagcattaaaatcgcctgcgcc
UTR01_0043_B07.b : tttttttctctttgtgtagaaaaaaaaccaaaaac
UTR01_0060_D01.b :
MLN01_0101_H05.b : ggcgcgcccctcttaaattacctttgggggccaaagtttcccatcc
CLNT1_0066_E04.b : ctttatttttaaaaaaaccccccccctcccgacctaaaaaagaagaattgttgttacttg
OVRT1_0048_F02.b : aaaaggccccttttgtcctactcttcggtgcggccccctatatttttttataaaaaactc
CLNT1_0064_E03.b : ccctatgtcccaacttcggctccgcgcccctaaattttcaaataaaaccccccctccccc
OVRT1_0031_H01.b : taggttcggggccccttaaaatattataaaaaaaaactccccacccctcccccgaaacct
CLNT1_0014_A11.b : tctccgatttcagggtcccgcccccttaaatattctctaaaaaaaaacccccccccaccc
UTR01_0052_H06.b :
CLNT1_0074_E03.b : gggccgcccttaatattttaaaaaacccccaccctcccgaaccgaaaaaaagaggacttg
CLNT1_0064_B01.b : ccttccacccnnnnnnnnncnaaaaggcccctgtggttcacctctttgcccgccctaaaa
CLNT1_0062_A10.b : tcgggccccaaattttcttaaaaaaaacccccccacctcccccgaacgaaacaaaagaga
LNG01_0028_F08.b : aaaaaaaaaagaaggcgcctttttttttttttcttccctcct
CLNT1_0007_E05.b : ttctccactggggtccggccgctacatatttaaaaaacccctccccccccgcgacggaaa
OVRT1_0022_E11.b : gtttctcaatcggggtcggcgccctaaaattttagaaaaaaccctccaccccccccgacc
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b : tcctcgggggagttcccgtaccccttttgaaaagggcccaagggatcttaacccggccgg
PST01_0044_E03.b : ttcttctctcgatctcttcctcaacttgactgcatctctatgcccatctactcttgatac
OVRT1_0005_G05.b : agcaaaaataagagcctttggtttattaaccccccacagccaattccgctcctgatggct
KDN01_0005_A09.b : aggggccctttctcaagtggggcgcgcccctaaattttgaaaaaaaccctcccccccccc
KDN01_0096_D09.b : ccatttggtccaactccgggcgcgccccctacaatattttaaaaaaaccccccccccccc
KDN01_0091_A05.b : ggctccactgtaggtccggcccctaatttacttaaaaaaaacctccccactcccccgaac
PST01_0042_G06.b : attgtgttctactcagtcacgccctaatattataacaaaactccctcttccccggcagca
KDN01_0012_B08.b : aggcccctgtgtccaactgcagttccgcccctaaacatctaaaaaaaaccctcccctccc
KDN01_0035_D10.b : ctgcagtccgcccgctaactagtctaagaaaaaacttccacacttccccggaactgaacc
TES01_0056_A11.b : gttctttgtgccctcagtgacctgtcctggcccctcaatttttttataataaaatctccc
OVRT1_0123_D02.b : ctctactatgtctatttcttctctccctcttctgccactttgtattcctgctctcctctt
OVRT1_0100_F07.b : ccctatttatatttaataactccctcaccccctgcatttgatcaaagaatcattgtggtt
TES01_0059_H04.b : tttcggggtcggccccttaattttcttagaaaaaaaccccccacccccctcgcgacggaa
PST01_0072_A08.b : aaggccactttggctccaattgcgggtgcggcccacaaattatcttaaaaaaacctcccc
PST01_0099_B11.b : aaaaaataaaaggcccattgtgtctcaacctcaaggcccgggccctctaaaatattctaa
OVRT1_0120_H01.b : cctttcttgctatcatcgctctgtttgtactgcccaccctactctcttgatttatcgcct
OVRT1_0093_E08.b : aaaatcataaaaaccccccccccccctctcaaaaagaaaagatttgtagtaactttttag
OVRT1_0019_D07.b : aaaatgccccttttcccctcggcccccccaaaatattaaaaaccccccccccccaaaaaa
CLNT1_0150_E07.b : cgcaccccctttatattatatatttatctacatcttgcctcttcacacttactaatagat
OVRT1_0100_A06.b : ttaatttcttagtaaaacccccccccctccccaaagcagaattaaagagggcttgtgtgt
OVRT1_0072_D05.b : ccttcccaaaaataaatagaaatctttgtttacctttattcctataggtaaaacgctgcc
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b : aaaatttaaaGCCATATCATAGAAACAAGACACACAGAGTTGTAAGAGAGCTAAACACTC
BKFL1_0056_C12.b :
BKFL1_0049_E07.b : aaaatttaaaGCCATATCATAGAAACAAGACACACAGAGTTGTAAGAGAGCTAAACACTC
ILNT1_0020_C05.b : aaaatttaaaGCCATATCATAGAAACAAGACACACAGAGTTGTAAGAGAGCTAAACACTC
ILNT1_0056_D06.b : aaaatttaaaGCCATATCATAGAAAxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0013_E01.b : tggctcggattaagcctatctagaaacAGACACACAGAGTTGTAAGAGAGCTAAACACTC
20110601C-012214 : ATCATCCGAGGTGCAATACTCATGGACATGAGCTCCTGAAACAGCAGCTTGCAGGCATAC
---------+---------+---------+---------+---------+---------+ 1385
CLNT1_0151_F03.b : accgactgcgtattcccatattacatgcgggtgcgctgtatatctacattcaattcaatc
PST01_0033_B11.b : ctccccacccccccgaaccggaaacaaaaggaaagcaatggtgggttaactgttttgtgc
TES01_0020_A03.b : ttctcccttctttctctctatatatctttctttcttactccataatgattttcacctttc
OVRT1_0100_C01.b : cgatcttgttttttacattttcttcgtctctctgggttcattaaaatttatctcttttct
TES01_0001_D08.b : aaaataatccctctatccattccccc
OVRT1_0044_E01.b : gctgcttttctctgttctgctccctccatggtacacaactatcttctcctccccaatcac
TES01_0040_A03.b : cggaaaataataaataacttctggttcttacctttttttccccttcaagtttataattac
OVRT1_0149_B12.b : atactcccctccctccccctccatatcaataaaaaatatcctccttgttgtgttccttct
TES01_0112_B01.b : cccaccccttcccccggaaccgtaaaatataaagggagccaataggtgtttg
CLNT1_0096_B04.b : ttttctcctctttcggccctataatgtccccactcctcaacaacttttcctctttttgtg
OVRT1_0025_C10.b : ttttgcccatacggggcaaaacaacaaccccattctcacaaactttttccgctcttggtg
PST01_0042_A08.b : ttatatcttatgtgtaataacctaatatacatttcaagagaatttcccttttataggggt
KDN01_0016_C12.b : gaaaaaaacctccccaaccctcccccggaacggaagaaataaagaaagcgcttttgttgt
CLNT1_0022_F10.b : ccgcaacgagaaataataatggaatgtgggttgttctttagttgcccttatgggtgacac
KDN01_0093_D03.b : gatgccttgtttgttacttgtttgcccttaagggtcaaaaaagaagcgcacatttccaaa
PST01_0054_E06.b : ttcgcctatggtcaaaaacgagacccaatttcaaagacttttccgcttaggggtgccaca
PST01_0098_A12.b : cccccctcccccgtgcccgtgaaaaaaaaaaaaagggaattgtggtggtacactgttttt
KDN01_0028_A09.b : cgaaccggaaaaaaaaggaggctgtgttggtaattgtttttgcccttatggttcaaatag
PST01_0074_D09.b : aaaacaaaaagaaagaatgttggttgtcacttgttttggcccaaagggggccaataaggc
LVR01_0057_C12.b :
OVRT1_0022_A06.b : ttcccctctaggtgaaaaaaacactcactttcaaaaagtttttctccctctgtgtgtgcc
KDN01_0079_F03.b : cgctgtgttgttaatgttttagggcccttaagggtcaaaatacgctacctccaatttctc
PST01_0039_F12.b : aacctccccaccctccccggaaccggagaacaaaaggaaggcgcatgttggtgttcactt
KDN01_0080_C12.b : cgccccttatatttcaaaaaaaaaccccccacccccccccgaaccgaaaataaaagaagc
PST01_0080_F02.b : taaaggaaggcattgtggtgttaacttgtttatggcgcttaatgtgttacaataagcaat
KDN01_0028_B03.b : cattgtgtggtaactgtttttggccttaaaggttcaaaaagcaatcctccaatttccaaa
KDN01_0008_C02.b : tgttgtgttactttttgtgcctttaggttcaaaaacaaatctccattttccaaagctttt
CLNT1_0066_C04.b : ctaaagatacacaaagaacatcacctatccccaatgtcttctcccttcctgggtgggtac
OVRT1_0128_B05.b : atactctttcgttgtctctccatctttttcacttatttccttttttctctctcttcttat
OVRT1_0124_B12.b : ttagtaccttttcttgtattatcttattttcctcttactctatttccttctgctacttat
OVRT1_0132_A05.b : aacaaccacatactaaaatgttttcttctcgtggtggacaaattttttttgggcggctta
PST01_0041_H08.b : ctgtatacatttctttttttttctctccagatctttattaacctacctacattttaatat
OVRT1_0001_E06.b : cttttgggttccccattttttttgtgtcggggaatattctttctcctatcttcttgtggg
OVRT1_0004_A04.b : ctgtttcgcgacacaatttccttccatcaccctatcaggagactctctctctcgacaaaa
CLNT1_0041_F04.b : acctgttcgtgccttagggtcataatacaatcctcctttctacaacatttcttccgcttt
OVRT1_0041_G09.b : taaggacaaaaaccacccccccttccaaaaatttttctcccttctttgttgccacctcac
SPLT1_0001_G07.b : acgttattcgagctcacaaattctttttttgatgtctaccacatcgtttactaattgaga
OVR01_0043_B12.b :
PST01_0064_F10.b : attgtgtggtaatggttaagggcttaaggggacaanaagaactctcccaatttccaaaag
OVRT1_0076_E05.b : cagggaacaaacacacccaactgcaaagccttttccttacttggagaacctatagataat
OVRT1_0126_H09.b : tttctgtctcttctcgcgctattatttcattcggctcttcctcctctctctttatgtatc
CLNT1_0113_G10.b : cactctagtgaccattattctcctacttttctatctattttttcccctattcgctatcta
CLNT1_0146_A11.b : ccatcctaatgtatcaacactttccttcacttttaaaactttcttcctctgtatt
TES01_0101_A03.b : tccgttctataaatatctcatttatgctatgctgtgtgattcactcttcactgtcttcat
CLNT1_0115_D01.b : tatcccctatctttatactcatctctctgtagctccctctcacgtacatcatagaactta
OVRT1_0045_G02.b : ataaaatttccctccactctctccctga
OVRT1_0082_A12.b : gtccgcgcgcctttcttcatccttcttgttataaact
OVRT1_0098_F02.b : atacccccccctcccccgtgatcgaaaataaaaggggacctggttgctttaatgtctttt
OVRT1_0045_B04.b : acctattaaaatagagagcctgcgttgtctttattttttattccgccttgtacgtgctca
OVRT1_0087_B04.b : tttttgcccttccggcgaaaaagactcattttcaccagctttctcggaatttgtgtatat
OVRT1_0036_C01.b : cgtgagaaaacctaacctcattctaaaattttttcctttattggtataccctgaatattt
OVRT1_0078_B06.b : ccattagtggacaataccctccccattcaaaatgtttttcttctcctgggtgttcaacct
OVRT1_0082_B08.b : agaataacaaaacattactcttattattttcatatcttaatgctacaaaatacacttcaa
LNG01_0034_G12.b :
OVRT1_0040_E06.b : ttggtttttcatgttttgtcctcttggcacaaataacaaactcctttccaaaagtttttc
LNG01_0046_F07.b : a
TCH01_0046_A02.b : taactttacctactccgctttcttttaaaatgggccccttttgag
OVRT1_0038_A03.b : agaaattgtgtgttcgttttctggcccaagaggccacatataatgtcgcccattctcaca
OVRT1_0069_A11.b : cctccccctccggaccaaaaataaaatgactctgtgtgggatacttttctgccccttaag
OVRT1_0036_C05.b : gtatttgtttttccctatagggtaaaaaacatctcccattcccaaaacgtttttctcttt
TCH01_0028_A06.b : ttttttctgtatacaagtgtcat
OVRT1_0041_A04.b : gctctttttgcccataggtgcagagacatccgccatttctccaaacttttctccggtttg
OVRT1_0023_B04.b : catgcccactcccagatatttacgaagatttttctatttattttttttgaatggggtttc
OVRT1_0042_E01.b : agggactttgttttcttctttttccccatttggtccaaaagagagcctcctttcccacaa
OVRT1_0036_G06.b : aaaaaacagctctattccaaaagttttttctgctcattgtgttccaccacagttttaatg
OVRT1_0035_F07.b : ttatccctaaaggtaaaaaagaatccccatttcaaaagcttttcccaatagggtggcaaa
OVRT1_0074_C11.b : agccctggtggttactttttatgcccttagggcctaaaacacaccccctttttccaaact
OVRT1_0084_H08.b : gacatggtttaacatgattgcgcctcatggctacatacgttcccccattctcaaatattt
TCH01_0023_B08.b : tttttaaaagggcccatagagccatatacaagaccggccn
TCH01_0039_H04.b :
TCH01_0087_F04.b : ggggcccttctccccccttctttaaggcccttaggttatataaacggccccttttacccg
TCH01_0011_H03.b :
LNG01_0103_C05.b : aaaagacggccgttaacccgagggaaaacttgggtttgagaacttctggggcattgaacc
TES01_0070_D01.b : ctttcgttaatataatcaagagtgagtggctgtacacacttttgtctcatttatgtgtct
OVRT1_0123_G01.b : tactgacctccattcttcttcttttcttctattatttgtcctgccgttctgccttctttc
CLNT1_0128_D11.b : atgtgttgttgatttatttcctctctgtctcattctccatactatataaactatttcttc
TCH01_0093_B10.b :
TCH01_0093_E09.b : acggccccttttcctcggtctggtaaagtcttgtggt
CLNT1_0074_H09.b : acctcccccgaaccggaaaaaaaagaagacatgtgggtttcctcgtttttgcccctttgg
OVRT1_0033_A09.b : acatttggtttttcactttttttcgcctttgggttcaaanagcacaactcctcttctcca
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b : aaaggcccttaagagccttataaaaagcgggccctttactctgcggaaacaccttgtatt
THY01_0040_A10.b : acatatcctcttctttttatctcctttctttcttccaacccacctctaccgctaa
OVRT1_0106_F03.b : ttactcctgaactccatttatattatcctcttgatcttctatttctacttctccctccca
OVRT1_0064_E08.b : ataaattgtctcttcttccccgctttcataataatattactgtgcatctctttttctata
OVRM1_0204_C10.b :
UTR01_0075_C07.b : aa
OVRM1_0206_H10.b :
OVRT1_0143_G01.b : ctctcctctctccgtatctgattaataatctacttctatatacgttcttatactaactct
OVRM1_0154_A10.b :
OVRT1_0141_A10.b : tcttcccaaacaataaattatatgtttttaatactggtagaacatcctacctcctttctt
OVRT1_0132_E08.b : cttctgcggtccttctcaccacactccccactactataaaataccttttctactcctgtt
OVRT1_0136_B01.b : cctctagtcatcagtccctaccccattacctactcttttttctcgtctctggggagccaa
OVRT1_0147_B03.b : tctctttcatttggtgttttctcaaataaactgctgtgactgttatttatttcttcttct
OVRT1_0143_E01.b : ttactctctcctagtaacaccatattatcttgtcatgtacatactcttactatcagtaac
LNG01_0035_A11.b :
LNG01_0080_G12.b : catcaggcgntatacactcacgcaggcgtcttttaacctctatgcataccgcctccggcc
TCH01_0033_G03.b :
OVRT1_0008_G02.b : gtgtatactacctttctgcctaatagggatcaaaaacatccccactatcaaaaccatttt
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b : cagtttgtgttgtgaaaattatatcccccacaccgccataaacacaactcccctattttc
CLNT1_0055_E08.b : aaatttcttctgttttggtgtcccattagttttcgggcgcgggaacaaattttctttccc
OVRT1_0141_A09.b : ggtttcttttctcgccctgagggcaaaaacaacaccacctcacaaaatttttctctctat
OVRT1_0003_C10.b : ctttaggctcacagactacgctccctctctcatactttctctctcctcgggttgggtcac
OVRT1_0147_C10.b : gctctgatcgtaattaggtccggtctttctagaatattgttgtgtctttggcgccacttt
OVRT1_0002_A05.b : ttttcctctccgcccttcagggcacaacacacccccattacaaaaattttccctcatggg
SMG01_0092_C12.b : ccccccatttttttgggaaaaggtttttgagaaaaacccccctctgcccccccccctttg
OVRT1_0054_D09.b : ggcgattttgtgttatctttattgcgccttgggggcccaagagcagatccctattttcaa
HTMT1_0044_C07.b : atttcttggaaaataccactctctttttctccggggggatttttttattacgggggaatt
CLNT1_0064_G09.b : cctaaaaaaataaaacgccctctgcggtaaactgttttctcctcatatgtcccaatggcc
UTR01_0045_A04.b :
CLNT1_0061_A10.b : ttttgcccttatgggtcaaaaacgaacccccactttcaaaaggtttttttcgg
OVRT1_0085_E08.b : atgttttgcctttaggcccccattcacgccaaatctcaaatatttttctgccctggggtc
LNG01_0042_H03.b : acaca
CLNT1_0064_F02.b : aaagaaatgtggttgtttctttttccgcctttgggttacaaaacaagtccccatctccaa
OVRT1_0042_D12.b : aggaaaataaaaaagagcccttttgtgtttttcctttttttcccccttttaaggtctcaa
CLNT1_0096_D04.b : ctttgtgtacactttttcgcctcaaggacaaaagccgccccactttcagaaccttttcgc
OVRT1_0058_D02.b : gtgttctctttctgcgccaaaggggcacaagacacaccccttttcacaaccttttcttcc
LNG01_0035_H02.b :
OVRT1_0073_E02.b : ttgtgttatttgtttagccctttggttacaacacccccccctttccaaaactttttctgc
OVRT1_0073_A09.b : ttgtcccttacgggtaaaaaacatccctttctcacaccttttctcttcttgtgttgcctc
MLN01_0069_C05.b : aagaaaaccacttgaattagaaacatctctgtggaacgca
LNG01_0034_F12.b :
OVRT1_0043_F11.b : aaaaagggcctgtgtttcatcttttatccccctaggtattaaaaaaaatcccccttttta
CLNT1_0051_H02.b : ttggccttagggcacaaaaaaaacccaattcaaaaatttttcccctcgtgggtgcacaca
OVRT1_0035_E03.b : ctggggccacatgacatccctccttcacaaatttttttcctttgtgtgttcccctaattt
TCH01_0037_B04.b :
LNG01_0091_D10.b : ctttacctctgcgggaaattccgtggtctggaaacacttttgtgggaatgttaactctca
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b : ttttgcccttaggcttaaacaactctctttctccaagtcttctgccctgtgggccccccc
OVRT1_0048_F02.b : cccccccccccccgaacataaaaaaaaagagggactttgtgctttcacttttattggccc
CLNT1_0064_E03.b : ccaccgaaacatatagaacaagtggtgttatcttttattcctcttaatgcgtacaaaaac
OVRT1_0031_H01.b : taaaaa
CLNT1_0014_A11.b : ccctcgaagcctgaaaataaataa
UTR01_0052_H06.b :
CLNT1_0074_E03.b : tttttctttttttgcctttagggcaaaagaacaccccattccacaaactttttcgccctg
CLNT1_0064_B01.b : ataataaaaaaaccccccccccccacgcaaaaaaaaaagaagagttgtgtgttttttttt
CLNT1_0062_A10.b : ggcctctttggtttcctttttttgtgccctttagtgtccacaaaagagaatctccacatt
LNG01_0028_F08.b :
CLNT1_0007_E05.b : taagagagggtggttttgttcttttggcccttatggtcaaaaagagaccccattccaaaa
OVRT1_0022_E11.b : cgaaacaaaaagaacaatgtgtttttattgttgtgcgctataagggacacaangacagcc
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b : cccctttcactccgcgggaaccgcccttgatcttgaaaacctttctggggccttggaacc
PST01_0044_E03.b : ttcgcttgatctctctttatctctaatggtagcatctacctctggttaactctgttgtct
OVRT1_0005_G05.b : atggaaaaaagaggtctgatactgagctttctctgtttaatttcttctcgagaggttaac
KDN01_0005_A09.b : gaccgaaacaaaaagaagcatttgtttttcttttttcgcccttagggtcaaaaaacaacc
KDN01_0096_D09.b : cttgcctgaacaataatgaagcatttgtttttaaattgatatgcgcttaacggttcaaaa
KDN01_0091_A05.b : ctaaaaaaaaggaggcatgtgttgttatttgttttcgcctttaaggttcaaaagacaata
PST01_0042_G06.b : aataaaaatatggtgtgtgcatgttctatcactataggcaaaacaaatttccactttcga
KDN01_0012_B08.b : cctgcactgaaaaaaaaggagcatttgttgttaactttttgtcctattagggacaaagac
KDN01_0035_D10.b : aaaaatgatgccatgttgtggtacctggttttgccccttaaagggtcacaaaaggcatac
TES01_0056_A11.b : tctttcccctcgttatcttatcacatatttatcttttttgctgctgcctctttttctccc
OVRT1_0123_D02.b : cctgctcttcttcttcatcactctttacctctctctttcctttcccgtcctctctcttct
OVRT1_0100_F07.b : ctcttgttatcttgacctgttggttatatgccctaataattagttaccaatctcttatct
TES01_0059_H04.b : acaaaagaaaggcccttggtttgtaactgtttttggcccctaagggtcaaaaaagacccc
PST01_0072_A08.b : acctcccccggacctgaacctaaaggaaggcattgtgtgttaactgtttttgcccttaaa
PST01_0099_B11.b : aaaaaaacccccccacctctccccgaactggaaactaaaagaaggcaattttgtttgtaa
OVRT1_0120_H01.b : cccttattgcattcgatctctccctttatatctatattctcttttagctcactcattcgt
OVRT1_0093_E08.b : cctctagggaaaagaacactccaatacaaaacttttctcctccgagtgtccacctttctt
OVRT1_0019_D07.b : aaaaaggacaaggttgttcttttgccttagggtcatccacctcccggtggaacatttttg
CLNT1_0150_E07.b : ctatgtactcctctcactaactcctatttcatagatgatacataccgctcccgcactttc
OVRT1_0100_A06.b : ttctcttttccgccccttagcggcccaaacgaacacttccatttttctaagaacttcttc
OVRT1_0072_D05.b : ctttcttacattttcgttctgtgtttcccctatatacgtgatccctatatatccttctct
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b : ATCATCCGAGGTGCAATACTCATGGACATGAGCTCCTGAAACAGCAGCTTGCAGGCATAC
BKFL1_0056_C12.b :
BKFL1_0049_E07.b : ATCATCCGAGGTGCAATACTCATGGACATGAGCTCCTGAAACAGCAGCTTGCAGGCATAC
ILNT1_0020_C05.b : ATCATCCGAGGTGCAATACTCATGGACATGAGCTCCTGAAACAGCAGCTTGCAGGCATAC
ILNT1_0056_D06.b : xxxxxxxxxxxxcgtactagccnn
SKNB1_0013_E01.b : ATCATCCGAGGTGCAATACTCATGGACATGAGCTCCTGAAACAGCAGCTTGCAGGCATAC
20110601C-012214 : GGCATCCGCACCAGCGAGATCTAGGGTAGAGAGAAGGCCATTAGCGAGGACAGACAGCAG
---------+---------+---------+---------+---------+---------+ 1445
CLNT1_0151_F03.b : ngncagngttgtcgcgtattgccgtgaatcgtggc
PST01_0033_B11.b : ccttatagggtcacaataaacaaggcccccaattttcacaaaggctttttttcggcgctc
TES01_0020_A03.b : ctatcctcatctctctctcatttgggtcactaactatctat
OVRT1_0100_C01.b : aactaatattttcctt
TES01_0001_D08.b :
OVRT1_0044_E01.b : ttttttttctgtagcgtcttcttcaaccccttttctttcttgcactctgcctccttctct
TES01_0040_A03.b : aaaaccatccattcttaaagaatttttttctccgtctactgtgtggtcacacctccaac
OVRT1_0149_B12.b : tctcttccacccaacct
TES01_0112_B01.b :
CLNT1_0096_B04.b : ttgccccatattctattgc
OVRT1_0025_C10.b : tgcgcaccactggtttctattgtgtcgggcgcgacctacttcct
PST01_0042_A08.b : gccacataagttttgaaatttatgagatcttaatattctttatactctacactcttttag
KDN01_0016_C12.b : gtacatgtttttgtcccttaaaag
CLNT1_0022_F10.b : aaaacactcccccctctttg
KDN01_0093_D03.b : aacttttctcgggtcgttgggtgtccaccaacagatttagtgggaccggggggagataat
PST01_0054_E06.b : aagatctaggtgaccgggaaggaatattctcttccccacaccccggtttgggggggctcc
PST01_0098_A12.b : tggccaacca
KDN01_0028_A09.b : gaaatccccactttcacaaaggttttttccggcttatgggggttgccacccaaggatttt
PST01_0074_D09.b : ttcccctcattttccaaaaagctcttttccgcctctaaggtgggtccgacaccccggatt
LVR01_0057_C12.b :
OVRT1_0022_A06.b : cccatatttattgggccccggccatatttcctcctttc
KDN01_0079_F03.b : aaaagcttttttcccccccttgtgggggtggcgcaccccgagtatttaattgtgggcccc
PST01_0039_F12.b : tttaatgggccccttaaggggttcaaaatacccataac
KDN01_0080_C12.b : gcgttttgtttatattgtttttacaccat
PST01_0080_F02.b : agcccccattttcaccaaaggctttttctccggctcccatgggggtgccacaccacagag
KDN01_0028_B03.b : aagctttttccgcgctctaggggggtgcacacacggggtttaaggggggtcgcggcgggc
KDN01_0008_C02.b : tcggctctatggggtgcaacccaggatttaagtggtcccgggagggatattttcttcttc
CLNT1_0066_C04.b : atacactctcttgggtctggcgcacactacattcn
OVRT1_0128_B05.b : ttcttcactactgcgctatcttttttctttntcctnnnnnnnnnnnntaatctttcatgt
OVRT1_0124_B12.b : tctn
OVRT1_0132_A05.b : tttccctctccctcctccgctctctccgtatannannnnnnnnnnnnnnnnnnnnnnnnn
PST01_0041_H08.b : ctaatatacatctattgcaagccgcgttttgagaggatactaaaattatcactattagct
OVRT1_0001_E06.b : tctctctttttcgtgcaaattaaanaaaaaannnnnnnnnnnnntnntcctctcctcttg
OVRT1_0004_A04.b : a
CLNT1_0041_F04.b : agtgtttaccaccatttcctcttgtcg
OVRT1_0041_G09.b : tttttatggttcccgcaccacaatttccctc
SPLT1_0001_G07.b : ccttctaattatacctcttcatccatctaattacgccacc
OVR01_0043_B12.b :
PST01_0064_F10.b : cttttttccgggctccggtgggtgccaacccaaggttttttggtgggcccgggagagcat
OVRT1_0076_E05.b : tgccccgcgaaaatatatccttctaccaatcctctttgcggggtttccacgntctcttgc
OVRT1_0126_H09.b : tgttccttcccgcccctccgccctcttatttaattcttctccatccctcctca
CLNT1_0113_G10.b : tatttcttttcttctactaaatccatcttttgttcatctgtctttctacactgtgtcgtg
CLNT1_0146_A11.b :
TES01_0101_A03.b : tgggccgtaacatatactttctccctcttctn
CLNT1_0115_D01.b : tttctcttctttatctcgtgcttgtactgttgctatttcgtccatcgtcactattttatc
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b : gcacaatg
OVRT1_0045_B04.b : aacaccgaccttcccg
OVRT1_0087_B04.b : acttatttcttgcgacggtaccgttgatcctctctctccaaccttcttttgcggtcctct
OVRT1_0036_C01.b : ttgtccgctaaaaaatcttttcctcctacct
OVRT1_0078_B06.b : atcttcttttggccggttagccaaattctctccttcatcatcctgctggctggtgtttcc
OVRT1_0082_B08.b : tctccatactcttttgctccatgtgttgttccccaactttctacgtttctccagccgtat
LNG01_0034_G12.b :
OVRT1_0040_E06.b : tcgcctcgtgtgtgtgccaccaatgttttagtgcgcgggcgacaaatatttctctctcca
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b : agctttttcgcctctttgtggtgtgcccaccggagacttgagggccgccggcgacattta
OVRT1_0069_A11.b : tgtacccacagaagtctccccattcc
OVRT1_0036_C05.b : ttgtgggtgccaccattttaatggggctcgggcgcaatttttcttctctccnaacgttgn
TCH01_0028_A06.b :
OVRT1_0041_A04.b : ggtgaccaccaagattatttggtgcctagacactattattttctttcttttg
OVRT1_0023_B04.b : aatttttttttactaaactattctttctcctctccgttgtgggtgttccgggggaaaaag
OVRT1_0042_E01.b : cacttctccgcccctctggggtgcaccccacgtatatgttgtgcccccgcccagctatt
OVRT1_0036_G06.b : ggccccgggagaaattttttctctccccaaaaccggctgtgtgggtgtttctgtgttttt
OVRT1_0035_F07.b : caagtatataggggccgcacaaaatattctctttcagaagctagagag
OVRT1_0074_C11.b : tttttttcgctct
OVRT1_0084_H08.b : tttcgttctctgtgtctctccccgtaattttcgtggtccgctcgagaaaaaatctcctct
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b : ggga
TCH01_0011_H03.b :
LNG01_0103_C05.b : ccaaaaccccgaaaatttttttgtacaccctccgcggttcgaataaaaaccgttttttac
TES01_0070_D01.b : tatatatttcagactcttctcct
OVRT1_0123_G01.b : ctttttctttgttcgctcccgttg
CLNT1_0128_D11.b : cccttccgttgtgccttcgtcatttctattcgttgccaatctatttctctctcttattcc
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b : ggccacaaaaaaagttctcccttt
OVRT1_0033_A09.b : aaaactttttcgcgcctccgtgggttgccaccacaaagaattaatga
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b : ttaaaaccttcttggggcattggaaccccaattacccggaaaattttgtaggtacccccc
THY01_0040_A10.b :
OVRT1_0106_F03.b : cccctgnnnnnnnnnnnnnctaacactatacacgctatctatccgattcattnaacanct
OVRT1_0064_E08.b : tactccatgcttatctgttcacctttagcacatcatactatctgactctttatttatta
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b : tctcttgcttctcctcatcattacttctcgcatcttattcta
OVRM1_0154_A10.b :
OVRT1_0141_A10.b : ctccactatcatcttatttt
OVRT1_0132_E08.b : tctcccgcatatcttttatctactatagtattatctctctcctcctctttgtcgtatcaa
OVRT1_0136_B01.b : ccaatcctttctgatccgcgccgcaaacatctttcctctttctcctctccgctgccagct
OVRT1_0147_B03.b : ttgcgtagctatagggactatcgcttactctttctgcag
OVRT1_0143_E01.b : acatctagacactgttatagcttgatattatatctcttctactatat
LNG01_0035_A11.b :
LNG01_0080_G12.b : tctcatagagattttctggtgggccaatatccaacccccacagtttctttcacaccccat
TCH01_0033_G03.b :
OVRT1_0008_G02.b : ctcgctttggtgtctcctcctcaactctatttgcgccgccgtccctctttctctcctccg
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b : aaa
CLNT1_0055_E08.b : acgtctggggtgaagaaccacggactc
OVRT1_0141_A09.b : gggttgtccaccaaactatttgcgcgcgaggaattctcctctt
OVRT1_0003_C10.b : ccaaaatatggtggtactcgggtgtaatttctccttccctacatccctctctgcgaaact
OVRT1_0147_C10.b : gtatatatagtagcgtgtaataggtatctttatctcaattttcttattgctttatatgta
OVRT1_0002_A05.b : tctcacattgatataagtggcgctcggcatatttctttcctctttactcgtctctggggc
SMG01_0092_C12.b : tgggggggggggggcccccaaagcgcgcgggggggcccctcgggggtattttctcctcaa
OVRT1_0054_D09.b : gagacttttctctccctgtgggttccacccatatttttttgggcc
HTMT1_0044_C07.b : tgtgctctaatattaatcataagacaaaaaaat
CLNT1_0064_G09.b : ttactcactctccagaacacctgtttctgcctcttcgtggcggg
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b : tacctctttttataagtccggcacaaaaatttcttttcctacaccccctgtctgggaact
LNG01_0042_H03.b :
CLNT1_0064_F02.b : aagttttttggg
OVRT1_0042_D12.b : cataaccan
CLNT1_0096_D04.b : ccctggggtgcgcccctgatatatatggtgccgggccg
OVRT1_0058_D02.b : actttgggtgccacccaaaatatt
LNG01_0035_H02.b :
OVRT1_0073_E02.b : ttatgttgtccccccagatctttggcgccgcggaagatatttctctctccaaactgcggt
OVRT1_0073_A09.b : cctttttttctctcgcccggaatat
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b : aaaatattttt
CLNT1_0051_H02.b : tgtttttggcccggcgcagatttctctccttcacccctgcgtgggagaacaacagaaaaa
OVRT1_0035_E03.b : ttgtggggcggggcgatatatttctttccctatctctagttggggaatcacgatttatat
TCH01_0037_B04.b :
LNG01_0091_D10.b : attatgcccgaaaaaattatgtagttaaaccctcgttcggatttcgatatttcatttccg
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b : cgcttcatcggggcgggagcgaatatttctccccccactccttcggggggaacacactaa
OVRT1_0048_F02.b : tctagggctcaaaaaaga
CLNT1_0064_E03.b : attctactttcccaaaagcttcttctccctttctgggtgggcccccaccagtgtttactg
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b : tggggtcaccccgggtttaatgggccggccggcaatttttctttcc
CLNT1_0064_B01.b : tcccttttaggtgaaacacccacctctccttctaaagttttttc
CLNT1_0062_A10.b : ctcaaaaaagttttttctgcgttt
LNG01_0028_F08.b :
CLNT1_0007_E05.b : ctttttcgcgctgggggggccc
OVRT1_0022_E11.b : caaattccaacaaatttttttccgcgctttggg
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b : ctccaattagcccggaaataattttcgtaggtacaccccctcgccgccgctcttcccaat
PST01_0044_E03.b : ctttctatatatatcgtacattcgatctctctctctgtccgctatctctactggcgtagt
OVRT1_0005_G05.b : ccactctatttttctgaggacccaccatacatatataaaa
KDN01_0005_A09.b : ccaatttcaaagaattttttctccttttttgggtggcaccctaagtgtattgtggggccc
KDN01_0096_D09.b : agcaatatcccaatttcaaaaactttttttcccgtccttgtgggtggcaaaccaaatatt
KDN01_0091_A05.b : tctccatattcacaaaacgtttttcccggtctgagtgggtgtcccaacacagggtattat
PST01_0042_G06.b : attatttttccgccttgcgggtgtctacctaaataatttacgctaccatttacatataac
KDN01_0012_B08.b : gaaccctcaatttccaaagaatttttcgcgccatttgtgttgcccccacggtgttagtgt
KDN01_0035_D10.b : ctcccatttcccaaaagccttttttccgcattcaatggggttgccaaccaccaagatata
TES01_0056_A11.b : tttcatgtctctaccttcccattttcctcctcccttcttctcatccttttactcgtattc
OVRT1_0123_D02.b : cttttcttctctttgactccgttgtatacgttatactcatgctcctttgctctttttaat
OVRT1_0100_F07.b : cgctctaagatgtttggtactctcatttactgtgtatagcgtagcacttca
TES01_0059_H04.b : ccctctgtttcccaaagaactttcttctgcccctctgtgtgtgggtaccacccctatttc
PST01_0072_A08.b : ggtaccaaaaaagaaaacccccaatttccagaaaactttcctccggctacgtggggtgtc
PST01_0099_B11.b : ctttgtctttgccccttaataggggtcaaaaaaccaatgacctctcattttccaaataag
OVRT1_0120_H01.b : tctactccacctgctccactcttcttgttn
OVRT1_0093_E08.b : ttgtgaacacaaaaaataacttcttctaaatacggttgagaaatatataataaa
OVRT1_0019_D07.b : tctgtgggtcaacaattattattggtcgcacctttttcttcttttctattactgtgcggc
CLNT1_0150_E07.b : cttattgattgtataatatcatacccgcgatttcctttcctgagcatattgcaacacaat
OVRT1_0100_A06.b : cgcttttngtgggtgcccccactagctattacgtg
OVRT1_0072_D05.b : agcctcttgggggggtttctctgttctattnttnattatncacccnccccctcacgccgc
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b : GGCATCCGCACCAGCGAGATCTAGGGTAGAGAGAAGGCCATTAGCGAGGACAGACAGCAG
BKFL1_0056_C12.b :
BKFL1_0049_E07.b : GGCATCCGCACCAGCGAGATCTAGGGTAGAGAGAAGGCCATTAGCGAGGACAGACAGCAG
ILNT1_0020_C05.b : GGCATCCGCACCAGCGAGATCTgagtcttattccggcagcctctgcattcaxxxxxxxxx
ILNT1_0056_D06.b :
SKNB1_0013_E01.b : GGCATCCGCACCAGCGAGATCTAGGGTAGAGAGAAGGCCATTAGCGAGGACAGACAGCAG
20110601C-012214 : CGCCCTCATGGCCCTTAACCCACTCGCTTAGGTTGTGAGTGCGTGACTGGTGCCAGCACT
---------+---------+---------+---------+---------+---------+ 1505
CLNT1_0151_F03.b :
PST01_0033_B11.b : gag
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b : cn
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b : tagatgtcacggaacattatatgtctaatagatataacctctagactttattaacactca
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b : tctttcctccccaagacggccggcgtttggggggggccctcagggtaatgtcacacggaa
PST01_0054_E06.b : gcgggttttctcttggagaaatgagaagaagagagggggttttcccccgnnnnnnnncaa
PST01_0098_A12.b :
KDN01_0028_A09.b : tgtggggcccgcccaccaaatatcttcttctcccaaacacgccgggtgggggggggtctc
PST01_0074_D09.b : ttaatggtcggccgcg
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b : ggggccgcccatatttcttcttccctcctcctaaatggcctggtgtggggcgccgagttc
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b : tcttatgtgtgtgcccgggaga
KDN01_0028_B03.b : ataaatttctccttctctcctacagtgcgggggtgtgggggggttctcctcgggtgtctt
KDN01_0008_C02.b : ccaaaggcggggtggggggggcctcggtttttccttgttagaaagaaaaagangngggnn
CLNT1_0066_C04.b :
OVRT1_0128_B05.b : agctcctctttcttt
OVRT1_0124_B12.b :
OVRT1_0132_A05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0041_H08.b : caagtattaatcgcttcgtct
OVRT1_0001_E06.b : tttttcggtctctannnn
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b : aattctct
OVRT1_0076_E05.b : tgtgatagactatgtaacaagctgctctcccacatag
OVRT1_0126_H09.b :
CLNT1_0113_G10.b : cc
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b : atatactttatctatctttacttctatctcatccttcactcactttct
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b : cgtgtttctttgctggatccttccttttcttttttgtgt
OVRT1_0036_C01.b :
OVRT1_0078_B06.b : cgcgatactctcacggataagagac
OVRT1_0082_B08.b : tatacttattctacatcttcggttatcagagc
LNG01_0034_G12.b :
OVRT1_0040_E06.b : cgtccccccggttgtgggggttcctcgtgtgcttcttcgatcacatatatcacacca
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b : tcctttcttctctccccg
OVRT1_0069_A11.b :
OVRT1_0036_C05.b : gtggggggtcactctggtttctctcgataattatcnataccgcctc
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b : agaaaggaccatt
OVRT1_0042_E01.b :
OVRT1_0036_G06.b : ccggggaaatgagagggcg
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b : cttctacgggctgtggtgg
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b : cctccccctcccttcccnnnnnnnnnnnnnntttnnaataatcttcctacactcccgcan
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b : tcctcttattctcattatcattatacatg
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b : cgcccatgttgaattaaaaacagcgttttgtttcacccttccccttactttttccccccn
THY01_0040_A10.b :
OVRT1_0106_F03.b : atccatctcctttca
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b : tctcctgtannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRT1_0136_B01.b : ttcgttgtctcacccgtccc
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b : ctccgttagtacacccactcctcatatttactt
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b : ccctagaattaata
OVRT1_0147_C10.b : atcgag
OVRT1_0002_A05.b : ttccctgctcttctccctcagaatcatacccaccactcttcttctc
SMG01_0092_C12.b : aatttctccctgagaccccccccct
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b : ttgagttgtatatatatttat
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b : tggagagatacgaggtatctagag
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b : tagaa
OVRT1_0035_E03.b : agg
TCH01_0037_B04.b :
LNG01_0091_D10.b : aaagattttataattccactttccctctttgtgtcccctttatttacccaccctaagtgt
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b : aata
OVRT1_0048_F02.b :
CLNT1_0064_E03.b : cgcccgccgccccgcttcttcg
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b : taaatcacgccggttttgtttttccccccctcc
PST01_0044_E03.b : catcactcccgctgtactctcctccttacatgatatgttcagcttcacactcatatcctc
OVRT1_0005_G05.b :
KDN01_0005_A09.b : cggccccgcaaaattttctccctctcaaaaacgcgggttttggggggagatctcccggag
KDN01_0096_D09.b : atttggggtaccgcggacaatatatatccttcttctctccagaaacgggcg
KDN01_0091_A05.b : ggggtgcccggaggacctaattttcttcctctcctcaaatgtgcggtgtcgtggcaggtt
PST01_0042_G06.b : ttattttctcatttacttgtgttcgtggttcacaatatatacatcttctctcatatgact
KDN01_0012_B08.b : tggtccgggggacaattatctctatcctcaacaatctggtgtcggggggtgtccttcgtg
KDN01_0035_D10.b : aggtggaacccgggaccacgcaaataatcttctctctccccaaaacacgcgcganngtgg
TES01_0056_A11.b : tatgtgtttctcctan
OVRT1_0123_D02.b : tttaccacctgcctcatgcatctctctctatatgtcattctcacctctn
OVRT1_0100_F07.b :
TES01_0059_H04.b : tctactttgggccc
PST01_0072_A08.b : acacctcagttcttctgggagacccgggcaaactgattatcttctctccccaaacacacc
PST01_0099_B11.b : gatttttttc
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b : aactcattactctaagaagaaac
CLNT1_0150_E07.b : atgattagcctgcataattctctctattgtcttctatttcctcctttanatntaatnnnn
OVRT1_0100_A06.b :
OVRT1_0072_D05.b : cacgggccaccccc
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b : CGCCCTCATGGCCCTTAACCCACTCGCTTAGGTTGTGAGTGCGTGACTGGTGCCGGCACT
BKFL1_0056_C12.b :
BKFL1_0049_E07.b : CGCCCTCATGGCCCTTAACCCACTCGCTTANGTTGTGAGTGCGTGACTGGTGCCAGCACT
ILNT1_0020_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxtacggcctctacctgcgnnnn
ILNT1_0056_D06.b :
SKNB1_0013_E01.b : CGCCCTCATGGCCCTTAACCCACTCGCTTAGGTTGTGAGTGCGTGACTGGTGCCAGCACT
20110601C-012214 : CAGCCTATGACCTTGGCCTCTGGTGGTTCCCTCTCTTAACTGGCTTCGGTATTTCACTCT
---------+---------+---------+---------+---------+---------+ 1565
CLNT1_0151_F03.b :
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b :
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b : t
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b : gataaa
PST01_0054_E06.b : aaanncnccccccccatataaagagatcacgtgaaannnnnnnnnnnnnnnnnnngcgag
PST01_0098_A12.b :
KDN01_0028_A09.b : tcgcggggtctcctccgaggcagatatc
PST01_0074_D09.b :
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b : tccagaggggagtgttctcaaggg
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b : ctccancaaaaaaaaacaaacaacacacccgctcctctccc
KDN01_0008_C02.b : gnnnnnntannnnnacggcaganngnagngaccgcgctttgtagtttc
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b :
PST01_0041_H08.b :
OVRT1_0001_E06.b :
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b :
OVRT1_0076_E05.b :
OVRT1_0126_H09.b :
CLNT1_0113_G10.b :
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b :
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b :
OVRT1_0036_C01.b :
OVRT1_0078_B06.b :
OVRT1_0082_B08.b :
LNG01_0034_G12.b :
OVRT1_0040_E06.b :
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b :
OVRT1_0069_A11.b :
OVRT1_0036_C05.b :
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b :
OVRT1_0042_E01.b :
OVRT1_0036_G06.b :
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b :
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b :
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b : nnnnnnnnnnnannnnccacatgttcttgtcggagccccnnnnnnnnnnnnnnnnnnnnn
THY01_0040_A10.b :
OVRT1_0106_F03.b :
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b : nnnnnnnnnnnnnnnnnn
OVRT1_0136_B01.b :
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b :
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b :
OVRT1_0147_C10.b :
OVRT1_0002_A05.b :
SMG01_0092_C12.b :
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b :
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b :
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b :
OVRT1_0035_E03.b :
TCH01_0037_B04.b :
LNG01_0091_D10.b : ttttnnnaaaannnnnctnnnnnnaattatatcttctgatttctnnaaattnnttgtctc
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b :
OVRT1_0048_F02.b :
CLNT1_0064_E03.b :
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b :
PST01_0044_E03.b : ctattagtgtatatccgctatactcg
OVRT1_0005_G05.b :
KDN01_0005_A09.b : gtgtttctcccggtacaaataatgaacgccagaccaaaggtgtttttctccccc
KDN01_0096_D09.b :
KDN01_0091_A05.b : tgctctcgggttgttctccctgggctaaaatttaagcctagagacaatggtgtcttttcc
PST01_0042_G06.b : cgtaatcactgtgtgtatgtctacacnnncccnnntnnantattatcatcgtacagttag
KDN01_0012_B08.b : gntctctctttatttaagttataatgacacacgtctttttttcttcttctcc
KDN01_0035_D10.b : cggaagaa
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b : ggtggcggtggggagggttctcccggggtggtgtctccagtgatacggaag
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b :
CLNT1_0150_E07.b : nactaagcgtatgaaccagaactcagatacaactcctccnnn
OVRT1_0100_A06.b :
OVRT1_0072_D05.b :
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b : CAGCCTATGACCTTGGCCTCTGGNTGTTTCCCTCTCTNACTGGCTTCGGTATTcactctt
BKFL1_0056_C12.b :
BKFL1_0049_E07.b : CAGCCTATGACCTTGGCCTCTGGTGGTTCCCTCTCTTTACTGGCTTCGGTATTTCACTCT
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
SKNB1_0013_E01.b : CAGCCTATGACCTTGGCCTCTGGTGGTTCCCTCTCTTAACTGGCTTCGGTATTTCACTCT
20110601C-012214 : TTCTGCTAGACCTAATTTATATTCACCTTCATGATTTAAAGTTCCTTCTACAAGTCCTTA
---------+---------+---------+---------+---------+---------+ 1625
CLNT1_0151_F03.b :
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b :
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b :
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b :
PST01_0054_E06.b : ngnnnnn
PST01_0098_A12.b :
KDN01_0028_A09.b :
PST01_0074_D09.b :
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b :
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b :
KDN01_0008_C02.b :
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b :
PST01_0041_H08.b :
OVRT1_0001_E06.b :
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b :
OVRT1_0076_E05.b :
OVRT1_0126_H09.b :
CLNT1_0113_G10.b :
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b :
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b :
OVRT1_0036_C01.b :
OVRT1_0078_B06.b :
OVRT1_0082_B08.b :
LNG01_0034_G12.b :
OVRT1_0040_E06.b :
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b :
OVRT1_0069_A11.b :
OVRT1_0036_C05.b :
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b :
OVRT1_0042_E01.b :
OVRT1_0036_G06.b :
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b :
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b :
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
THY01_0040_A10.b :
OVRT1_0106_F03.b :
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b :
OVRT1_0136_B01.b :
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b :
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b :
OVRT1_0147_C10.b :
OVRT1_0002_A05.b :
SMG01_0092_C12.b :
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b :
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b :
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b :
OVRT1_0035_E03.b :
TCH01_0037_B04.b :
LNG01_0091_D10.b : ctannt
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b :
OVRT1_0048_F02.b :
CLNT1_0064_E03.b :
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b :
PST01_0044_E03.b :
OVRT1_0005_G05.b :
KDN01_0005_A09.b :
KDN01_0096_D09.b :
KDN01_0091_A05.b : cc
PST01_0042_G06.b : tgaactttgtca
KDN01_0012_B08.b :
KDN01_0035_D10.b :
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b :
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b :
CLNT1_0150_E07.b :
OVRT1_0100_A06.b :
OVRT1_0072_D05.b :
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b : nctgctagacctatttatattcacctcatgatttaagtccntctacagtccttatacttc
BKFL1_0056_C12.b :
BKFL1_0049_E07.b : TTCTGCTAGACCTAAT*TATATTCACCTTCATGATTTAAAGTccttctacaagtcttaat
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
SKNB1_0013_E01.b : TTCTGCTAGACCTAATTTATATTCACCTTCATGATTTAAAGTTCCTTCTACAAGTCCTTA
20110601C-012214 : TTACTTCCAAAAGATGAACAGCCAAGAGGAATTCTAAGGTAAAACTTACACTGGTTTTTT
---------+---------+---------+---------+---------+---------+ 1685
CLNT1_0151_F03.b :
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b :
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b :
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b :
PST01_0054_E06.b :
PST01_0098_A12.b :
KDN01_0028_A09.b :
PST01_0074_D09.b :
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b :
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b :
KDN01_0008_C02.b :
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b :
PST01_0041_H08.b :
OVRT1_0001_E06.b :
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b :
OVRT1_0076_E05.b :
OVRT1_0126_H09.b :
CLNT1_0113_G10.b :
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b :
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b :
OVRT1_0036_C01.b :
OVRT1_0078_B06.b :
OVRT1_0082_B08.b :
LNG01_0034_G12.b :
OVRT1_0040_E06.b :
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b :
OVRT1_0069_A11.b :
OVRT1_0036_C05.b :
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b :
OVRT1_0042_E01.b :
OVRT1_0036_G06.b :
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b :
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b :
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b :
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b : nnnnnnnnnnnn
THY01_0040_A10.b :
OVRT1_0106_F03.b :
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b :
OVRT1_0136_B01.b :
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b :
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b :
OVRT1_0147_C10.b :
OVRT1_0002_A05.b :
SMG01_0092_C12.b :
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b :
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b :
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b :
OVRT1_0035_E03.b :
TCH01_0037_B04.b :
LNG01_0091_D10.b :
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b :
OVRT1_0048_F02.b :
CLNT1_0064_E03.b :
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b :
PST01_0044_E03.b :
OVRT1_0005_G05.b :
KDN01_0005_A09.b :
KDN01_0096_D09.b :
KDN01_0091_A05.b :
PST01_0042_G06.b :
KDN01_0012_B08.b :
KDN01_0035_D10.b :
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b :
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b :
CLNT1_0150_E07.b :
OVRT1_0100_A06.b :
OVRT1_0072_D05.b :
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b : aaaagatgacagccnagagattctaggtaaactaccctggttttgaaaacctattgtact
BKFL1_0056_C12.b :
BKFL1_0049_E07.b : acttnccaaagatgacagccaaaaggattctaaggtaaactaacctgggtttttgaaaac
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
SKNB1_0013_E01.b : TTACTTCCAAAAGATGAACAGCCAAGAGGAATTCTAAGGTAAAACTTACACTGGTTTTTT
20110601C-012214 : GAAAAACCTAATTGTTACCTTTTCCCTCATTTCAAACTAGGAATCTGACAGAAGCTTGCT
---------+---------+---------+---------+---------+---------+ 1745
CLNT1_0151_F03.b :
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b :
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b :
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b :
PST01_0054_E06.b :
PST01_0098_A12.b :
KDN01_0028_A09.b :
PST01_0074_D09.b :
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b :
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b :
KDN01_0008_C02.b :
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b :
PST01_0041_H08.b :
OVRT1_0001_E06.b :
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b :
OVRT1_0076_E05.b :
OVRT1_0126_H09.b :
CLNT1_0113_G10.b :
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b :
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b :
OVRT1_0036_C01.b :
OVRT1_0078_B06.b :
OVRT1_0082_B08.b :
LNG01_0034_G12.b :
OVRT1_0040_E06.b :
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b :
OVRT1_0069_A11.b :
OVRT1_0036_C05.b :
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b :
OVRT1_0042_E01.b :
OVRT1_0036_G06.b :
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b :
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b :
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b :
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b :
THY01_0040_A10.b :
OVRT1_0106_F03.b :
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b :
OVRT1_0136_B01.b :
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b :
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b :
OVRT1_0147_C10.b :
OVRT1_0002_A05.b :
SMG01_0092_C12.b :
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b :
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b :
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b :
OVRT1_0035_E03.b :
TCH01_0037_B04.b :
LNG01_0091_D10.b :
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b :
OVRT1_0048_F02.b :
CLNT1_0064_E03.b :
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b :
PST01_0044_E03.b :
OVRT1_0005_G05.b :
KDN01_0005_A09.b :
KDN01_0096_D09.b :
KDN01_0091_A05.b :
PST01_0042_G06.b :
KDN01_0012_B08.b :
KDN01_0035_D10.b :
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b :
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b :
CLNT1_0150_E07.b :
OVRT1_0100_A06.b :
OVRT1_0072_D05.b :
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b : tttcccctttcactagatctacnaagctgctgtcaatggcatcgttctccctaaacgccc
BKFL1_0056_C12.b :
BKFL1_0049_E07.b : cnattggttactttcccctcattcagctaggatctaacgaagctgctgtcaacctgccat
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
SKNB1_0013_E01.b : GAAAAACCTAATTGTTACCTTTTCCCTCATTTCAAACTAGGAATCTGACAGAAGCTTGCT
20110601C-012214 : GTCAAAACTGCCCATCTGTTCCATCCCACTAAATCTGCCCACATGGTCAGACCAGCAGGG
---------+---------+---------+---------+---------+---------+ 1805
CLNT1_0151_F03.b :
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b :
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b :
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b :
PST01_0054_E06.b :
PST01_0098_A12.b :
KDN01_0028_A09.b :
PST01_0074_D09.b :
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b :
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b :
KDN01_0008_C02.b :
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b :
PST01_0041_H08.b :
OVRT1_0001_E06.b :
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b :
OVRT1_0076_E05.b :
OVRT1_0126_H09.b :
CLNT1_0113_G10.b :
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b :
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b :
OVRT1_0036_C01.b :
OVRT1_0078_B06.b :
OVRT1_0082_B08.b :
LNG01_0034_G12.b :
OVRT1_0040_E06.b :
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b :
OVRT1_0069_A11.b :
OVRT1_0036_C05.b :
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b :
OVRT1_0042_E01.b :
OVRT1_0036_G06.b :
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b :
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b :
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b :
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b :
THY01_0040_A10.b :
OVRT1_0106_F03.b :
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b :
OVRT1_0136_B01.b :
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b :
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b :
OVRT1_0147_C10.b :
OVRT1_0002_A05.b :
SMG01_0092_C12.b :
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b :
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b :
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b :
OVRT1_0035_E03.b :
TCH01_0037_B04.b :
LNG01_0091_D10.b :
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b :
OVRT1_0048_F02.b :
CLNT1_0064_E03.b :
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b :
PST01_0044_E03.b :
OVRT1_0005_G05.b :
KDN01_0005_A09.b :
KDN01_0096_D09.b :
KDN01_0091_A05.b :
PST01_0042_G06.b :
KDN01_0012_B08.b :
KDN01_0035_D10.b :
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b :
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b :
CLNT1_0150_E07.b :
OVRT1_0100_A06.b :
OVRT1_0072_D05.b :
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b : atggcaacccaggtcctctgaaaaaacccgccggggtagccctaatttatcgacccgctt
BKFL1_0056_C12.b :
BKFL1_0049_E07.b : ccgttccacccaaaatctgccccatggcaaacaccgggtcctcctaaaaaaaccccgccg
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
SKNB1_0013_E01.b : GTCAAAACTGCCCATCTGTTCCATCCCACTAAATCTGCCCACATGGTCAGACCAGCAGGG
20110601C-012214 : TCCCATCCTGAACAAGAGCACCTGCCCGTGAGGTCTAGCGCACCTGAGTCTTATTCCGGC
---------+---------+---------+---------+---------+---------+ 1865
CLNT1_0151_F03.b :
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b :
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b :
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b :
PST01_0054_E06.b :
PST01_0098_A12.b :
KDN01_0028_A09.b :
PST01_0074_D09.b :
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b :
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b :
KDN01_0008_C02.b :
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b :
PST01_0041_H08.b :
OVRT1_0001_E06.b :
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b :
OVRT1_0076_E05.b :
OVRT1_0126_H09.b :
CLNT1_0113_G10.b :
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b :
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b :
OVRT1_0036_C01.b :
OVRT1_0078_B06.b :
OVRT1_0082_B08.b :
LNG01_0034_G12.b :
OVRT1_0040_E06.b :
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b :
OVRT1_0069_A11.b :
OVRT1_0036_C05.b :
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b :
OVRT1_0042_E01.b :
OVRT1_0036_G06.b :
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b :
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b :
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b :
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b :
THY01_0040_A10.b :
OVRT1_0106_F03.b :
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b :
OVRT1_0136_B01.b :
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b :
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b :
OVRT1_0147_C10.b :
OVRT1_0002_A05.b :
SMG01_0092_C12.b :
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b :
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b :
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b :
OVRT1_0035_E03.b :
TCH01_0037_B04.b :
LNG01_0091_D10.b :
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b :
OVRT1_0048_F02.b :
CLNT1_0064_E03.b :
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b :
PST01_0044_E03.b :
OVRT1_0005_G05.b :
KDN01_0005_A09.b :
KDN01_0096_D09.b :
KDN01_0091_A05.b :
PST01_0042_G06.b :
KDN01_0012_B08.b :
KDN01_0035_D10.b :
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b :
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b :
CLNT1_0150_E07.b :
OVRT1_0100_A06.b :
OVRT1_0072_D05.b :
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b : taaggggcgggtaggaccctttccccgtgaaaaacgaaagagaccaaattcctaaagggg
BKFL1_0056_C12.b :
BKFL1_0049_E07.b : gaggttaccccccgattttttccgggcccggatttacatgggccgggggtacctcccttt
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
SKNB1_0013_E01.b : TCCCATCCTGAACAAGAGCACCTGCCCGTGAGGTCTAGCGCACCTGAGTCTTATTCCGGC
20110601C-012214 : AGCCTCTGCATTCATACGTATGGGTCCGGGTGTTAGCGATCGCCATTATGCCACACAGGT
---------+---------+---------+---------+---------+---------+ 1925
CLNT1_0151_F03.b :
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b :
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b :
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b :
PST01_0054_E06.b :
PST01_0098_A12.b :
KDN01_0028_A09.b :
PST01_0074_D09.b :
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b :
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b :
KDN01_0008_C02.b :
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b :
PST01_0041_H08.b :
OVRT1_0001_E06.b :
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b :
OVRT1_0076_E05.b :
OVRT1_0126_H09.b :
CLNT1_0113_G10.b :
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b :
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b :
OVRT1_0036_C01.b :
OVRT1_0078_B06.b :
OVRT1_0082_B08.b :
LNG01_0034_G12.b :
OVRT1_0040_E06.b :
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b :
OVRT1_0069_A11.b :
OVRT1_0036_C05.b :
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b :
OVRT1_0042_E01.b :
OVRT1_0036_G06.b :
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b :
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b :
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b :
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b :
THY01_0040_A10.b :
OVRT1_0106_F03.b :
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b :
OVRT1_0136_B01.b :
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b :
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b :
OVRT1_0147_C10.b :
OVRT1_0002_A05.b :
SMG01_0092_C12.b :
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b :
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b :
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b :
OVRT1_0035_E03.b :
TCH01_0037_B04.b :
LNG01_0091_D10.b :
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b :
OVRT1_0048_F02.b :
CLNT1_0064_E03.b :
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b :
PST01_0044_E03.b :
OVRT1_0005_G05.b :
KDN01_0005_A09.b :
KDN01_0096_D09.b :
KDN01_0091_A05.b :
PST01_0042_G06.b :
KDN01_0012_B08.b :
KDN01_0035_D10.b :
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b :
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b :
CLNT1_0150_E07.b :
OVRT1_0100_A06.b :
OVRT1_0072_D05.b :
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b : ccggaaagatctcttcaacgcccccttaaacatttgttttttcttcgcaaaatgaaaaaa
BKFL1_0056_C12.b :
BKFL1_0049_E07.b : tcccccgggtaaaaaacctaaaggttgggcccaaatttcctaaaaggggccccggaataa
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
SKNB1_0013_E01.b : AGCCTCTGCATTCATACGTATGGGTCCGGGTGTTAGCGATCGCCATTATGCCACACAGGT
20110601C-012214 : TGCAGACATGAACCTGATAAGGATCTGATGCCTCAAATAGTCTTTCCCTTAAAAACTGGG
---------+---------+---------+---------+---------+---------+ 1985
CLNT1_0151_F03.b :
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b :
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b :
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b :
PST01_0054_E06.b :
PST01_0098_A12.b :
KDN01_0028_A09.b :
PST01_0074_D09.b :
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b :
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b :
KDN01_0008_C02.b :
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b :
PST01_0041_H08.b :
OVRT1_0001_E06.b :
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b :
OVRT1_0076_E05.b :
OVRT1_0126_H09.b :
CLNT1_0113_G10.b :
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b :
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b :
OVRT1_0036_C01.b :
OVRT1_0078_B06.b :
OVRT1_0082_B08.b :
LNG01_0034_G12.b :
OVRT1_0040_E06.b :
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b :
OVRT1_0069_A11.b :
OVRT1_0036_C05.b :
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b :
OVRT1_0042_E01.b :
OVRT1_0036_G06.b :
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b :
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b :
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b :
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b :
THY01_0040_A10.b :
OVRT1_0106_F03.b :
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b :
OVRT1_0136_B01.b :
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b :
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b :
OVRT1_0147_C10.b :
OVRT1_0002_A05.b :
SMG01_0092_C12.b :
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b :
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b :
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b :
OVRT1_0035_E03.b :
TCH01_0037_B04.b :
LNG01_0091_D10.b :
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b :
OVRT1_0048_F02.b :
CLNT1_0064_E03.b :
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b :
PST01_0044_E03.b :
OVRT1_0005_G05.b :
KDN01_0005_A09.b :
KDN01_0096_D09.b :
KDN01_0091_A05.b :
PST01_0042_G06.b :
KDN01_0012_B08.b :
KDN01_0035_D10.b :
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b :
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b :
CLNT1_0150_E07.b :
OVRT1_0100_A06.b :
OVRT1_0072_D05.b :
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b : acccannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0056_C12.b :
BKFL1_0049_E07.b : aaatttttttttcaaaaggcgtccttttaaaaaaaaaaatttgttttttttaagcctttc
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
SKNB1_0013_E01.b : TGCAGACATGAACCTGATAAGGATCTGATGCCTCAAATAGTCTTTCCCTTAAAAACTGGG
20110601C-012214 : CTGCTCCATGGGCAATCTGACAGTCTCGTTTCATTTCTCCCAAACGCAGGCCACCGTCAC
---------+---------+---------+---------+---------+---------+ 2045
CLNT1_0151_F03.b :
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b :
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b :
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b :
PST01_0054_E06.b :
PST01_0098_A12.b :
KDN01_0028_A09.b :
PST01_0074_D09.b :
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b :
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b :
KDN01_0008_C02.b :
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b :
PST01_0041_H08.b :
OVRT1_0001_E06.b :
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b :
OVRT1_0076_E05.b :
OVRT1_0126_H09.b :
CLNT1_0113_G10.b :
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b :
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b :
OVRT1_0036_C01.b :
OVRT1_0078_B06.b :
OVRT1_0082_B08.b :
LNG01_0034_G12.b :
OVRT1_0040_E06.b :
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b :
OVRT1_0069_A11.b :
OVRT1_0036_C05.b :
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b :
OVRT1_0042_E01.b :
OVRT1_0036_G06.b :
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b :
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b :
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b :
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b :
THY01_0040_A10.b :
OVRT1_0106_F03.b :
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b :
OVRT1_0136_B01.b :
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b :
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b :
OVRT1_0147_C10.b :
OVRT1_0002_A05.b :
SMG01_0092_C12.b :
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b :
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b :
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b :
OVRT1_0035_E03.b :
TCH01_0037_B04.b :
LNG01_0091_D10.b :
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b :
OVRT1_0048_F02.b :
CLNT1_0064_E03.b :
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b :
PST01_0044_E03.b :
OVRT1_0005_G05.b :
KDN01_0005_A09.b :
KDN01_0096_D09.b :
KDN01_0091_A05.b :
PST01_0042_G06.b :
KDN01_0012_B08.b :
KDN01_0035_D10.b :
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b :
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b :
CLNT1_0150_E07.b :
OVRT1_0100_A06.b :
OVRT1_0072_D05.b :
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b : nnnnnnnnnnnnnnnnnnn
BKFL1_0056_C12.b :
BKFL1_0049_E07.b : gggaaaaaaattttggggggnnnnnnnnnnnnnnaaaaaaaaaaaaaaaaaaaaaaaggg
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
SKNB1_0013_E01.b : CTGCTCCATGGGCAATCTGACAGTCTCGTTTCATTTCTCCCAAACGCAGGCCACCGTCAC
20110601C-012214 : TGTTAAGAGAAAAACAGCTGACTATTTTGTGCTTATTTTCTATTATCCATGCTACTTTGA
---------+---------+---------+---------+---------+---------+ 2105
CLNT1_0151_F03.b :
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b :
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b :
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b :
PST01_0054_E06.b :
PST01_0098_A12.b :
KDN01_0028_A09.b :
PST01_0074_D09.b :
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b :
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b :
KDN01_0008_C02.b :
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b :
PST01_0041_H08.b :
OVRT1_0001_E06.b :
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b :
OVRT1_0076_E05.b :
OVRT1_0126_H09.b :
CLNT1_0113_G10.b :
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b :
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b :
OVRT1_0036_C01.b :
OVRT1_0078_B06.b :
OVRT1_0082_B08.b :
LNG01_0034_G12.b :
OVRT1_0040_E06.b :
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b :
OVRT1_0069_A11.b :
OVRT1_0036_C05.b :
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b :
OVRT1_0042_E01.b :
OVRT1_0036_G06.b :
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b :
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b :
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b :
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b :
THY01_0040_A10.b :
OVRT1_0106_F03.b :
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b :
OVRT1_0136_B01.b :
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b :
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b :
OVRT1_0147_C10.b :
OVRT1_0002_A05.b :
SMG01_0092_C12.b :
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b :
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b :
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b :
OVRT1_0035_E03.b :
TCH01_0037_B04.b :
LNG01_0091_D10.b :
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b :
OVRT1_0048_F02.b :
CLNT1_0064_E03.b :
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b :
PST01_0044_E03.b :
OVRT1_0005_G05.b :
KDN01_0005_A09.b :
KDN01_0096_D09.b :
KDN01_0091_A05.b :
PST01_0042_G06.b :
KDN01_0012_B08.b :
KDN01_0035_D10.b :
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b :
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b :