
[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-012214

Length: 2,150

Sequence [FASTA format sequence]

SNP mapping information
SNP IDRel.Chr.Location (cM)

Assembly Overview:      TOP
Change score limit to  

BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinIGFBP7insulin-like growth factor-binding protein 7 [Homo sapiens]. 3428e-94O
Contig/Assembly ProteinIGFBPL1insulin-like growth factor-binding protein-like 1 precursor [Homo sapiens]. 1473e-35O
Contig/Assembly ProteinPOLR2BDNA-directed RNA polymerase II subunit RPB2 [Homo sapiens]. 1406e-33
Contig/Assembly ProteinKAZALD1kazal-type serine protease inhibitor domain-containing protein 1 precursor [Homo sapiens]. 1113e-24O
Contig/Assembly ProteinPOLR3BDNA-directed RNA polymerase III subunit RPC2 isoform 1 [Homo sapiens]. 60.85e-09
Contig/Assembly ProteinPOLR3BDNA-directed RNA polymerase III subunit RPC2 isoform 2 [Homo sapiens]. 60.85e-09
Contig/Assembly ProteinPOLR1BDNA-directed RNA polymerase I subunit RPA2 isoform 2 [Homo sapiens]. 522e-06
Contig/Assembly ProteinPOLR1BDNA-directed RNA polymerase I subunit RPA2 isoform 1 [Homo sapiens]. 522e-06
Contig/Assembly ProteinHTRA1serine protease HTRA1 precursor [Homo sapiens]. 51.24e-06O

BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinIgfbp7insulin-like growth factor-binding protein 7 isoform 2 [Mus musculus]. 3356e-92O
Contig/Assembly ProteinIgfbp7insulin-like growth factor-binding protein 7 isoform 1 [Mus musculus]. 3195e-87O
Contig/Assembly ProteinIgfbpl1insulin-like growth factor-binding protein-like 1 precursor [Mus musculus]. 1466e-35O
Contig/Assembly ProteinPolr2bDNA-directed RNA polymerase II subunit RPB2 [Mus musculus]. 1405e-33
Contig/Assembly ProteinKazald1kazal-type serine protease inhibitor domain-containing protein 1 [Mus musculus]. 1073e-23O
Contig/Assembly ProteinPolr3bDNA-directed RNA polymerase III subunit RPC2 [Mus musculus]. 60.84e-09
Contig/Assembly ProteinHtra1serine protease HTRA1 precursor [Mus musculus]. 52.81e-06O
Contig/Assembly ProteinPolr1bDNA-directed RNA polymerase I subunit RPA2 [Mus musculus]. 50.45e-06

BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC608559PREDICTED: similar to Insulin-like growth factor binding protein 7 precursor (IGFBP-7) (IBP-7) (IGF-binding protein 7) (MAC25 protein) (Prostacyclin-stimulating factor) (PGI2-stimulating factor) isoform 1 [Canis familiaris]. 3472e-95O
Contig/Assembly ProteinLOC608559PREDICTED: similar to Insulin-like growth factor binding protein 7 precursor (IGFBP-7) (IBP-7) (IGF-binding protein 7) (MAC25 protein) (Prostacyclin-stimulating factor) (PGI2-stimulating factor) isoform 3 [Canis familiaris]. 3396e-93O
Contig/Assembly ProteinLOC608559PREDICTED: similar to Insulin-like growth factor binding protein 7 precursor (IGFBP-7) (IBP-7) (IGF-binding protein 7) (MAC25 protein) (Prostacyclin-stimulating factor) (PGI2-stimulating factor) isoform 2 [Canis familiaris]. 2329e-61O
Contig/Assembly ProteinLOC475152PREDICTED: similar to DNA-directed RNA polymerase II 140 kDa polypeptide (RNA polymerase II subunit 2) (RPB2) isoform 13 [Canis familiaris]. 1406e-33
Contig/Assembly ProteinLOC475152PREDICTED: similar to DNA-directed RNA polymerase II 140 kDa polypeptide (RNA polymerase II subunit 2) (RPB2) isoform 12 [Canis familiaris]. 1406e-33
Contig/Assembly ProteinLOC475152PREDICTED: similar to DNA-directed RNA polymerase II 140 kDa polypeptide (RNA polymerase II subunit 2) (RPB2) isoform 16 [Canis familiaris]. 1406e-33
Contig/Assembly ProteinLOC475152PREDICTED: similar to DNA-directed RNA polymerase II 140 kDa polypeptide (RNA polymerase II subunit 2) (RPB2) isoform 11 [Canis familiaris]. 1406e-33
Contig/Assembly ProteinLOC475152PREDICTED: similar to DNA-directed RNA polymerase II 140 kDa polypeptide (RNA polymerase II subunit 2) (RPB2) isoform 15 [Canis familiaris]. 1406e-33
Contig/Assembly ProteinLOC475152PREDICTED: similar to DNA-directed RNA polymerase II 140 kDa polypeptide (RNA polymerase II subunit 2) (RPB2) isoform 14 [Canis familiaris]. 1406e-33
Contig/Assembly ProteinLOC475152PREDICTED: similar to DNA-directed RNA polymerase II 140 kDa polypeptide (RNA polymerase II subunit 2) (RPB2) isoform 17 [Canis familiaris]. 1406e-33

BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinIGFBP7insulin-like growth factor-binding protein 7 [Bos taurus]. 3481e-95O
Contig/Assembly ProteinIGFBPL1insulin-like growth factor-binding protein-like 1 precursor [Bos taurus]. 1575e-38O
Contig/Assembly ProteinPOLR2BDNA-directed RNA polymerase II subunit RPB2 [Bos taurus]. 1406e-33
Contig/Assembly ProteinLOC781250PREDICTED: insulin-like growth factor-binding protein-like 1-like, partial [Bos taurus]. 1252e-28O
Contig/Assembly ProteinKAZALD1PREDICTED: Kazal-type serine peptidase inhibitor domain 1-like [Bos taurus]. 1052e-22O
Contig/Assembly ProteinKAZALD1PREDICTED: Kazal-type serine peptidase inhibitor domain 1-like [Bos taurus]. 1052e-22O
Contig/Assembly ProteinPOLR3BDNA-directed RNA polymerase III subunit RPC2 [Bos taurus]. 60.85e-09
Contig/Assembly ProteinPOLR3BPREDICTED: polymerase (RNA) III (DNA directed) polypeptide B [Bos taurus]. 60.85e-09
Contig/Assembly ProteinHTRA1PREDICTED: HtrA serine peptidase 1 [Bos taurus]. 52.42e-06
Contig/Assembly ProteinHTRA1PREDICTED: HtrA serine peptidase 1 [Bos taurus]. 52.42e-06

BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinIGFBP7insulin-like growth factor-binding protein 7 [Sus scrofa]. 3557e-98O
Contig/Assembly ProteinLOC100155070PREDICTED: insulin-like growth factor-binding protein-like 1-like [Sus scrofa]. 1504e-36O
Contig/Assembly ProteinPOLR2BPREDICTED: DNA-directed RNA polymerase II subunit RPB2 [Sus scrofa]. 1404e-33
Contig/Assembly ProteinLOC100624902PREDICTED: kazal-type serine protease inhibitor domain-containing protein 1-like [Sus scrofa]. 1103e-24O
Contig/Assembly ProteinLOC100524232PREDICTED: insulin-like growth factor-binding protein-like 1-like [Sus scrofa]. 1012e-21O
Contig/Assembly ProteinLOC100523122PREDICTED: DNA-directed RNA polymerase III subunit RPC2-like [Sus scrofa]. 60.83e-09
Contig/Assembly ProteinLOC100620767PREDICTED: DNA-directed RNA polymerase III subunit RPC2-like [Sus scrofa]. 60.83e-09O
Contig/Assembly ProteinLOC100515628PREDICTED: serine protease HTRA1-like [Sus scrofa]. 521e-06O
Contig/Assembly ProteinPOLR1BPREDICTED: DNA-directed RNA polymerase I subunit RPA2 isoform 1 [Sus scrofa]. 521e-06

Assembly Members: 176      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
KDN010005A09KDN01_0005_A09.bFS671529 AK393112
TES010001D08TES01_0001_D08.bCJ030051 AK351135


SNPs: 4      TOP
Loc.AlleleIndividualsFreq.TypeAA Change

Alignment:      TOP

20110601C-012214 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
CLNT1_0151_F03.b : nnncccgttctgcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b :
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b :
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b :
PST01_0054_E06.b :
PST01_0098_A12.b :
KDN01_0028_A09.b :
PST01_0074_D09.b :
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b :
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b :
KDN01_0008_C02.b :
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b :
PST01_0041_H08.b :
OVRT1_0001_E06.b :
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b :
OVRT1_0076_E05.b :
OVRT1_0126_H09.b :
CLNT1_0113_G10.b :
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b :
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b :
OVRT1_0036_C01.b :
OVRT1_0078_B06.b :
OVRT1_0082_B08.b :
LNG01_0034_G12.b :
OVRT1_0040_E06.b :
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b :
OVRT1_0069_A11.b :
OVRT1_0036_C05.b :
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b :
OVRT1_0042_E01.b :
OVRT1_0036_G06.b :
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b :
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b :
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b :
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b :
THY01_0040_A10.b :
OVRT1_0106_F03.b :
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b :
OVRT1_0136_B01.b :
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b :
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b :
OVRT1_0147_C10.b :
OVRT1_0002_A05.b :
SMG01_0092_C12.b :
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b :
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b :
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b :
OVRT1_0035_E03.b :
TCH01_0037_B04.b :
LNG01_0091_D10.b :
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b :
OVRT1_0048_F02.b :
CLNT1_0064_E03.b :
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b :
PST01_0044_E03.b :
OVRT1_0005_G05.b :
KDN01_0005_A09.b :
KDN01_0096_D09.b :
KDN01_0091_A05.b :
PST01_0042_G06.b :
KDN01_0012_B08.b :
KDN01_0035_D10.b :
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b :
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b :
CLNT1_0150_E07.b :
OVRT1_0100_A06.b :
OVRT1_0072_D05.b :
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
---------+---------+---------+---------+---------+---------+ 43
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b : g
TES01_0001_D08.b :
OVRT1_0044_E01.b : ggg
TES01_0040_A03.b :
OVRT1_0149_B12.b : nnncttcg
TES01_0112_B01.b :
CLNT1_0096_B04.b : ng
OVRT1_0025_C10.b : g
PST01_0042_A08.b :
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b :
PST01_0054_E06.b :
PST01_0098_A12.b :
KDN01_0028_A09.b :
PST01_0074_D09.b :
LVR01_0057_C12.b : tccgagcxxxxxxxxx
OVRT1_0022_A06.b : tt
KDN01_0079_F03.b :
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b :
KDN01_0008_C02.b :
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b : ncgtttcnnnnn
PST01_0041_H08.b :
OVRT1_0001_E06.b : n
OVRT1_0004_A04.b : nggactcgttctgcgcacgxxxxxxxxxxxxxx
CLNT1_0041_F04.b :
OVRT1_0041_G09.b : ntgga
SPLT1_0001_G07.b :
OVR01_0043_B12.b : ggggcattatggtgx
PST01_0064_F10.b :
OVRT1_0076_E05.b : tt
OVRT1_0126_H09.b : nt
CLNT1_0113_G10.b : n
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b : nn
OVRT1_0045_G02.b : n
OVRT1_0082_A12.b : ngga
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b : ng
OVRT1_0036_C01.b : ng
OVRT1_0078_B06.b : ngggatcga
OVRT1_0082_B08.b : ngg
LNG01_0034_G12.b : cgccttttgg
OVRT1_0040_E06.b : ng
LNG01_0046_F07.b : tttttagttgattatatgatacgt
TCH01_0046_A02.b : gggact
OVRT1_0038_A03.b : gg
OVRT1_0069_A11.b : nntttt
OVRT1_0036_C05.b : ng
TCH01_0028_A06.b : nttttc
OVRT1_0041_A04.b : ngg
OVRT1_0023_B04.b :
OVRT1_0042_E01.b : nggg
OVRT1_0036_G06.b : ng
OVRT1_0035_F07.b : nngg
OVRT1_0074_C11.b : ngggact
OVRT1_0084_H08.b : ngg
TCH01_0023_B08.b : nccgctagtgacttgacxxxxx
TCH01_0039_H04.b : nnng
TCH01_0087_F04.b : nnnggctt
TCH01_0011_H03.b : nnnnng
LNG01_0103_C05.b : nnnttag
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b : gg
TCH01_0093_B10.b : ttttg
TCH01_0093_E09.b :
CLNT1_0074_H09.b : nggt
OVRT1_0033_A09.b : tg
TCH01_0085_H10.b : ngggttg
TCH01_0039_E03.b : nnnggc
LNG01_0098_D07.b : nnnnn
THY01_0040_A10.b : xxxxxxxxxxxxxx
OVRT1_0106_F03.b :
OVRT1_0064_E08.b : nnc
OVRM1_0204_C10.b :
UTR01_0075_C07.b : gttgaactat
OVRM1_0206_H10.b :
OVRT1_0143_G01.b : nnngtc
OVRM1_0154_A10.b :
OVRT1_0141_A10.b : nnncccttcnnnnnnnn
OVRT1_0132_E08.b : aaccccccnnnnnnc
OVRT1_0136_B01.b : gctccctnnnnc
OVRT1_0147_B03.b : nnn
OVRT1_0143_E01.b : accccttnnnnncc
LNG01_0035_A11.b : catxxxxxxxxxxxxxx
LNG01_0080_G12.b : nnnggtggctg
TCH01_0033_G03.b : nggccttggcact
OVRT1_0008_G02.b : gg
TCH01_0012_C01.b : nnnnggatag
OVRM1_0059_H02.b :
OVRT1_0028_E11.b : g
CLNT1_0055_E08.b :
OVRT1_0141_A09.b : nnnccgttccnnnnnn
OVRT1_0003_C10.b : g
OVRT1_0147_C10.b : nn
OVRT1_0002_A05.b : gg
SMG01_0092_C12.b :
OVRT1_0054_D09.b : ngg
HTMT1_0044_C07.b : ttttggcaggtagaggccgtx
CLNT1_0064_G09.b :
UTR01_0045_A04.b : gxxxxxxxxx
CLNT1_0061_A10.b : gg
OVRT1_0085_E08.b : nggt
LNG01_0042_H03.b : gggctgtnctcgcatagtgxx
CLNT1_0064_F02.b :
OVRT1_0042_D12.b : nggg
CLNT1_0096_D04.b : ng
OVRT1_0058_D02.b : ccggg
LNG01_0035_H02.b : gttttgggtgacta
OVRT1_0073_E02.b : ngg
OVRT1_0073_A09.b : nggga
MLN01_0069_C05.b : gggatag
LNG01_0034_F12.b : gcattatggtgxxxx
OVRT1_0043_F11.b : gg
CLNT1_0051_H02.b : ngggc
OVRT1_0035_E03.b : nn
TCH01_0037_B04.b : nnnnggcatag
LNG01_0091_D10.b : nggggtgct
UTR01_0043_B07.b : gggggcxxxxxxx
UTR01_0060_D01.b : ggcxxxxxxxxxxx
MLN01_0101_H05.b : ncctgctgt
CLNT1_0066_E04.b :
OVRT1_0048_F02.b : g
CLNT1_0064_E03.b :
OVRT1_0031_H01.b : ntg
CLNT1_0014_A11.b : a
UTR01_0052_H06.b : ctttttagtgcacxxx
CLNT1_0074_E03.b : tggg
CLNT1_0064_B01.b : g
CLNT1_0062_A10.b : gg
LNG01_0028_F08.b : ctxxxxxxxxxxxx
CLNT1_0007_E05.b : ng
OVRT1_0022_E11.b : ngg
LNG01_0002_H02.b : ggcatttcgtgxxx
TCH01_0027_F05.b : nnnggcttg
ITT01_0012_E04.b :
PST01_0044_E03.b :
OVRT1_0005_G05.b : ngg
KDN01_0005_A09.b :
KDN01_0096_D09.b :
KDN01_0091_A05.b :
PST01_0042_G06.b :
KDN01_0012_B08.b :
KDN01_0035_D10.b :
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b :
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b : nngg
OVRT1_0019_D07.b : ntttc
CLNT1_0150_E07.b :
OVRT1_0100_A06.b : nn
OVRT1_0072_D05.b :
OVR01_0090_D11.b : tttggctag
OVRT1_0111_F01.b :
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
---------+---------+---------+---------+---------+---------+ 103
PST01_0033_B11.b : cgc
TES01_0020_A03.b : g
OVRT1_0100_C01.b : actacttctgcgtacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0001_D08.b : ncctgcggt
OVRT1_0044_E01.b : ctccgttctgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0040_A03.b : agc
OVRT1_0149_B12.b : ttangcgtcngxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0112_B01.b : nnaactgc
CLNT1_0096_B04.b : gactcgtttgcgccggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0025_C10.b : gatccttctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0042_A08.b : nnnnctcgc
KDN01_0016_C12.b : cgc
CLNT1_0022_F10.b : ntttctattgcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0093_D03.b : nnncctgcg
PST01_0054_E06.b : ctcgc
PST01_0098_A12.b : tcgc
KDN01_0028_A09.b : naatcgc
PST01_0074_D09.b : cgc
LVR01_0057_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0022_A06.b : ggtactcgtttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0079_F03.b : nttcgc
PST01_0039_F12.b : ctggc
KDN01_0080_C12.b : tggc
PST01_0080_F02.b : nccggc
KDN01_0028_B03.b : nnnccccgc
KDN01_0008_C02.b : nttttggtcgc
CLNT1_0066_C04.b : nccttcttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0128_B05.b : ncttttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0124_B12.b : natccttctgcgnaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0132_A05.b : nnccgtttgcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0041_H08.b :
OVRT1_0001_E06.b : ctccctctgctgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0004_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggcaggcccgcag
CLNT1_0041_F04.b : tctgctgtcgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0041_G09.b : ctcctttangcgtangagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SPLT1_0001_G07.b : ncctgcgagtagacgccgtagtaxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0043_B12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0064_F10.b : gc
OVRT1_0076_E05.b : ggatgcatttgctgcatgatgcaagactgttcatatcggaxxxxxxxxxxxxxxxxxxxx
OVRT1_0126_H09.b : tttcgtttgctgtggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0113_G10.b : cctctttcagcgtaagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0146_A11.b : ntctcgtctgcgttggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0101_A03.b : catcgcggt
CLNT1_0115_D01.b : aatctttctgcgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0045_G02.b : actccgtcatgcgtacgatgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0082_A12.b : ctccatagtgcgcatgagtgtgacactgcttcatttcggcggtcagccccaggccctgtt
OVRT1_0098_F02.b : cccttctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0045_B04.b : aaaccgtctgctgtcgnatgttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0087_B04.b : gaatcgtctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0036_C01.b : aactctttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0078_B06.b : tcctctgtcatgaggacggcgaccatttcatttcgcgcgtgacgcccaggcaccgtggat
OVRT1_0082_B08.b : accactcggcgccacgagtgtgctacagctcgxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0034_G12.b : ggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0040_E06.b : gactcgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0046_F07.b : gacttataacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0046_A02.b : tgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0038_A03.b : actcgttggctgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0069_A11.b : cgcactancgcgtgattaccacgagagggactatttcgggggnnntcctgaaggccngtt
OVRT1_0036_C05.b : gactcgtctgcgccggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0028_A06.b : tagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0041_A04.b : cttcgttctgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0023_B04.b : nnnaactcgtttgcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0042_E01.b : actcctctggcgccggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0036_G06.b : gactcgtttgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0035_F07.b : tcttcgtcagcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0074_C11.b : ccgttttggctgccxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0084_H08.b : gactcttcggctgcagagtgcgctaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0023_B08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtc
TCH01_0039_H04.b : tgataggatataaacagtttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0087_F04.b : gtgactttacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0011_H03.b : ctagtgacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0103_C05.b : ctggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0070_D01.b : ntttcatg
OVRT1_0123_G01.b : ccttctgctgtggagtgttctttgctcxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0128_D11.b : actccttctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0093_B10.b : gctaggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0093_E09.b : gtttggacttatacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0074_H09.b : tctccttctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0033_A09.b : gactccgtctgctgccgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0085_H10.b : ttgtgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0039_E03.b : ttggactatnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0098_D07.b : aagctggacttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0040_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0106_F03.b : nccgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0064_E08.b : cctcgtctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0204_C10.b : gagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0075_C07.b : taacaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0206_H10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0143_G01.b : ttcgttctgctgtcagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0154_A10.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0141_A10.b : cccgtttgcgntcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0132_E08.b : ctccttcgcgcacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0136_B01.b : catctcttgcgctcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0147_B03.b : tttcgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0143_E01.b : ctcgtttagcgntacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0035_A11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0080_G12.b : gtacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0033_G03.b : tacacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0008_G02.b : atcctctctgcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0012_C01.b : tactaagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0059_H02.b : cgttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0028_E11.b : actccttctgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0055_E08.b : agtttagctgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0141_A09.b : nnccgtttgcgttacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0003_C10.b : atcctctctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0147_C10.b : ccccgttcngcgtcagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0002_A05.b : actcgttttgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SMG01_0092_C12.b : nttaattgactaaagcagcggntcgxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0054_D09.b : gcttctcttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0044_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxgagggccccttgggaggcccgcag
CLNT1_0064_G09.b : attcttctgcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0045_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0061_A10.b : actccgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0085_E08.b : ctcattcatcttgacggttgcccctcacctcaaaacggggggattccccnggcccggttt
LNG01_0042_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0064_F02.b : ntacttctgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0042_D12.b : ctgctttcggctgcagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0096_D04.b : gactcgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0058_D02.b : actcgtcttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0035_H02.b : ctcagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0073_E02.b : gactctattgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0073_A09.b : ctcgtctctgcgtcagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0069_C05.b : tataagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0034_F12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0043_F11.b : actcgtcttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0051_H02.b : actcgttctgcgttcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0035_E03.b : ccccgtctgcgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0037_B04.b : tactaagacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0091_D10.b : ggccttgacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0043_B07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0060_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
MLN01_0101_H05.b : gacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0066_E04.b : nccttctgctgtcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0048_F02.b : actacgtctgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0064_E03.b : actcttctgcggcggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0031_H01.b : acttacgtctgcgttacgatgttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0014_A11.b : ctccgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
UTR01_0052_H06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0074_E03.b : acccgtctgnctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0064_B01.b : aatccgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0062_A10.b : gttccgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0028_F08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CLNT1_0007_E05.b : ggctcgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0022_E11.b : actcctcttgcgnacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LNG01_0002_H02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TCH01_0027_F05.b : tgacttnacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ITT01_0012_E04.b : gtgtaacaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0044_E03.b : taac
OVRT1_0005_G05.b : actcgttcagcgcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
KDN01_0005_A09.b : tcgc
KDN01_0096_D09.b : nnccctgc
KDN01_0091_A05.b : nnnnncctg
PST01_0042_G06.b : nctcac
KDN01_0012_B08.b : nnnccgctgc
KDN01_0035_D10.b : ttttccggc
TES01_0056_A11.b : ncccg
OVRT1_0123_D02.b : acgctttttgcgtaagxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0100_F07.b : ggggcttcttgcgcacgatgttxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0059_H04.b : nttttctgc
PST01_0072_A08.b : ncctg
PST01_0099_B11.b : nngtggc
OVRT1_0120_H01.b : taccgtttgctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0093_E08.b : aacactatctgctcacgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0019_D07.b : cgcacttcgggatgatctgccggagagtgttatattttggggnnntntcnngnnantgnt
CLNT1_0150_E07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxx
OVRT1_0100_A06.b : nttcgctcctcttatgattatccgccagggctatttcgtgggggnnnntgggnnnntgnt
OVRT1_0072_D05.b : nggtacgactancgcatgattatcaggcagctctanatcgtggggnnnnntnnggnnn
OVR01_0090_D11.b : tactattacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0111_F01.b :
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : ctagatcatgcgtgcttctcttctaagcatnatgatac
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
---------+---------+---------+---------+---------+---------+ 163
OVR01_0090_D11.b : xxxxxxxxxxxcaccccctggtggggaacgtgttgcggCCGCGCCCCGATATGGACCGGC
OVRT1_0111_F01.b :
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : agagcgaggggcgggtacatcctcaaactctattagtgctctcggccgagaggagaaaaa
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
---------+---------+---------+---------+---------+---------+ 220
OVRT1_0069_A11.b : cgcc**gctgcccgccctgctgctgggcgccgccgcggctgctgctcctgctgctgcCCC
OVRT1_0111_F01.b :
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : aaacttaacaccttttcgtgtacaaaaaaaacacagaaaacacctctcgggggggaggtc
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
---------+---------+---------+---------+---------+---------+ 280
OVRT1_0111_F01.b :
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : ggatcggcaacagattttctttagtaagggtaacagacacatatccaaattgttttgtgg
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
---------+---------+---------+---------+---------+---------+ 340
OVRT1_0111_F01.b :
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : tgccgtataagctttcacagccgcttcggacccctcttttccttattccttattcattaa
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
---------+---------+---------+---------+---------+---------+ 399
CLNT1_0151_F03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
PST01_0033_B11.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TES01_0020_A03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0100_C01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TES01_0001_D08.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0044_E01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TES01_0040_A03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0149_B12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TES01_0112_B01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0096_B04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0025_C10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
PST01_0042_A08.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0016_C12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0022_F10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0093_D03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
PST01_0054_E06.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
PST01_0098_A12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0028_A09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
PST01_0074_D09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
LVR01_0057_C12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0022_A06.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0079_F03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
PST01_0039_F12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0080_C12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
PST01_0080_F02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0028_B03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0008_C02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0128_B05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0124_B12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0132_A05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
PST01_0041_H08.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRT1_0001_E06.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0041_F04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0041_G09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCACG
PST01_0064_F10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0076_E05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCA
OVRT1_0126_H09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0113_G10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TES01_0101_A03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0115_D01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRT1_0082_A12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0098_F02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0045_B04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0036_C01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0078_B06.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0082_B08.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
LNG01_0034_G12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRT1_0040_E06.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
LNG01_0046_F07.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TCH01_0046_A02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRT1_0038_A03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0036_C05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TCH01_0028_A06.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0041_A04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0023_B04.b : gcgcgcg**gcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRT1_0042_E01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0036_G06.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0035_F07.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0074_C11.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0084_H08.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TCH01_0023_B08.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TCH01_0039_H04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TCH01_0087_F04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TCH01_0011_H03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
LNG01_0103_C05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TES01_0070_D01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0123_G01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0128_D11.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TCH01_0093_E09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0074_H09.b : Acgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0033_A09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TCH01_0085_H10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TCH01_0039_E03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
LNG01_0098_D07.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
THY01_0040_A10.b : gcgcgcgcggcgagggccagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0106_F03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0064_E08.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRM1_0204_C10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
UTR01_0075_C07.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggTAGGGGGCACTGCGCG
OVRM1_0206_H10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRT1_0143_G01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRM1_0154_A10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0141_A10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0136_B01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0147_B03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0143_E01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
LNG01_0035_A11.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
LNG01_0080_G12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0008_G02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TCH01_0012_C01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRM1_0059_H02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0055_E08.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRT1_0141_A09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0003_C10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0147_C10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgcccgcAGGGGGCACTGCGCG
OVRT1_0002_A05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcTGGGGGCACTGCGCG
SMG01_0092_C12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0054_D09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
HTMT1_0044_C07.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
CLNT1_0064_G09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
UTR01_0045_A04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0061_A10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
LNG01_0042_H03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
CLNT1_0064_F02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0042_D12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0096_D04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0058_D02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
LNG01_0035_H02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0073_E02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0073_A09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
MLN01_0069_C05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
LNG01_0034_F12.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRT1_0043_F11.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0051_H02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0035_E03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
TCH01_0037_B04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
LNG01_0091_D10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
UTR01_0043_B07.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
UTR01_0060_D01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
MLN01_0101_H05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0066_E04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0048_F02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0064_E03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCTCTGCGCG
OVRT1_0031_H01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0014_A11.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGAGCACTGCGCG
UTR01_0052_H06.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0074_E03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
CLNT1_0064_B01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGTGCG
CLNT1_0062_A10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
LNG01_0028_F08.b : GTgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
CLNT1_0007_E05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRT1_0022_E11.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
LNG01_0002_H02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
TCH01_0027_F05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
ITT01_0012_E04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
PST01_0044_E03.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0005_G05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0005_A09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0096_D09.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0091_A05.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGTGGCACTGCGCG
PST01_0042_G06.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0012_B08.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
KDN01_0035_D10.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TES01_0056_A11.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
OVRT1_0123_D02.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
TES01_0059_H04.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
PST01_0072_A08.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
PST01_0099_B11.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0120_H01.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0019_D07.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcggggggcACTGCGCG
CLNT1_0150_E07.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0100_A06.b : gcgcgcgcggcgagggcgagccgtgcgggggcggcg*gcgccggcAGGGGGCACTGCGCG
OVRT1_0111_F01.b : ttttnccgtcagcgnacgxxxxxxxxxxxxxx
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : cagggttaagcgtgtggncaaggggtgtctcacggtatgttcaggaaaataacccgatta
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
---------+---------+---------+---------+---------+---------+ 459
OVRT1_0111_F01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCGGGCGCAGCAGCC
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : ggggacagggggtgcgtacgcgggggtctgggcactcgtcccccttgcgggatcggcaaa
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
---------+---------+---------+---------+---------+---------+ 519
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : cccacatttagaatctaagaactgacctcttttaaatgggaaaattcccgaattgaaaaa
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
---------+---------+---------+---------+---------+---------+ 578
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : ggggaacggttttctgtaatcggaaagttcgaacggaggatcccggaggggacctcccgc
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
---------+---------+---------+---------+---------+---------+ 633
BKFL1_0103_C07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0056_C12.b :
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : gtaaaaagacggaaaccttattgtcccctagggttggggcgcctctgacttaaggaccga
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
---------+---------+---------+---------+---------+---------+ 690
BKFL1_0103_C07.b : nnnnnnnnxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0056_C12.b : nnnnnnnnn
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : accgggaatgttaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
---------+---------+---------+---------+---------+---------+ 748
TES01_0070_D01.b : ACCTtgcaaggcatcggaattcccacccccggcccctctctgggaacaaggtacaaaggg
OVRT1_0123_G01.b : ACtctgcgtggtcttcagaatccccatctcctgccctcttctggaactatttataatcgg
THY01_0040_A10.b : ACCTGCGAGGTCcttcgaacccccacctctgccctcctcttgcatcaaggcactaagggg
BKFL1_0103_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0056_C12.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxxxxxxxx
BKFL1_0049_E07.b :
ILNT1_0020_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
---------+---------+---------+---------+---------+---------+ 804
CLNT1_0151_F03.b : gggtcctatgggaagctcaaaggaggggaactcttgccttggtgaccaagataacctggc
TES01_0020_A03.b : G*TCACTTTGGAGTTTcaaaggtacgaactcttgccctggtgactcttataacctggcca
CLNT1_0066_C04.b : G*CCTCTATGccattcttaggacggcacctcttgcctggtgaccgacataccctgttctt
OVRT1_0126_H09.b : ggtttcttcggtactcaatggatgctattcctgccttgtgcctccaattacctcgtcctt
CLNT1_0113_G10.b : G*TCACTATGGGatttcaagggactgaattctttgcctggtgatcgattattacttggcc
CLNT1_0146_A11.b : G*TCACTATTGGA*TTTCAATGGACGGAAC*TCTTtgcctggttacaaagataacctggc
TES01_0070_D01.b : ggtccttatggaatttcaagggacgaactccttgcctggtggccccggataacccgggcc
OVRT1_0123_G01.b : gttcactattgattttcaaggactgatctcttgcctggtgaccttagatatcctgtccct
THY01_0040_A10.b : tccctcctggagttctactgacgaacacttctttgccttgtgaccaatataaccttgact
OVRT1_0106_F03.b : gttcactatggagtttcataggaccagaatctcttgcctgtggccctatattttctggtt
OVRT1_0064_E08.b : G*TCTCTTTGGAG*TTTCAAGtgcaggatctcttgccctgctctcagttaacctgtccct
OVRM1_0204_C10.b : G*TCACTATGGAC**TTCAAAGGACGAAAC*TCTTGCCcggatgaccaatataccttgcc
UTR01_0075_C07.b : G*TCACTATGGG**ATTCAAAGtgacggaactctttgccttgtgaccgaaaaaacctggt
PST01_0044_E03.b : tcactatggtatcttaaaggatctgattcttgcctggtgatcgagattaccctgatcctt
CLNT1_0150_E07.b : gttacttatttatttcaattgaaagaactcttgcttggtgacctaaatatactgatcttt
BKFL1_0056_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BKFL1_0049_E07.b : nnn
ILNT1_0020_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
---------+---------+---------+---------+---------+---------+ 862
CLNT1_0151_F03.b : ctatcaaaagcaggggggcccaaaaatacctgatcggccggcctgggggctatcactcat
TES01_0020_A03.b : ttcgtactcgtggtggcccacaaaagcctgatttgtctgtctggttgcttgatatctccc
OVRT1_0100_C01.b : tttctacgccggggggcccataatactttgattgaccggctgggtgcttattttccctct
OVRT1_0044_E01.b : *ATTCAAACGCGGGGTGGCCCCtcaaaccctcgagtggacggactgggggctgatatcct
CLNT1_0066_C04.b : cagacgcggggtggccccaaaatcctccattgacggcctggggtgcctgattccccctct
OVRT1_0128_B05.b : tttctaatgcggggtgccctccatacctgatttgccggcccggtgctgatatctccctct
OVRT1_0124_B12.b : ttcttacgctggtggggctttataaacatgatgttacgggcttgatgctgatccttctct
OVRT1_0132_A05.b : *ATTCAAACCCGGGGTGCCCCAGAAAAagcttgaactgccgggctgggtgcctgattctc
OVRT1_0126_H09.b : ttatgagccggggtggctcttatattcaccacaccgcccggcccgttgtttcttttcttc
CLNT1_0113_G10.b : attcctaacccggggggtcctaaaaatcctgaagtgacggggctggtgctgatacctccc
CLNT1_0146_A11.b : ctttaaacgcggggcggcccaaaaaacctgcactgatgggctgggtgcctaaacctcctc
TES01_0101_A03.b : *CTTCATACCCGGGGTGGGCCCATAAAagcttgatttgtctggctgggtggctgtttctc
CLNT1_0115_D01.b : tttttcaacgctgggtggcccttaaaaatctgtatgtggcggcctgtgtgctgttatctc
OVRT1_0045_G02.b : *ATACATACacggtgtgggcccaaaaaaaaatgaaatgtctggctggatagcatatattt
TES01_0070_D01.b : tttcaaacccgggggggccccaaaaaaccttgaattaccgggcttgggggctaaatttcc
OVRT1_0123_G01.b : tctttactctggggtggctcataaacgctttaacttgacttgctgggtgtttatattttc
CLNT1_0128_D11.b : *TTTCTGACGCcgggggggcccatacaagcatgatttgaccggcctgggggccaatttcc
THY01_0040_A10.b : attcaaaccccacttcggccccacaaatacatttcaatgactggcctggccgtcagaatt
OVRT1_0106_F03.b : attttgcactcgggtggaccactaacacttgtacttccccgcctgtgttatcacattccc
OVRT1_0064_E08.b : tcagacgcggggtcggcccataaaagccttgactttaccgccctggttgctgatttcctc
OVRM1_0204_C10.b : attcttacgcagtgtggtccagaaatgcatcaatgccggctcgggtgctgcggaaggtgc
UTR01_0075_C07.b : ccattcaaacgcggggtggcccataaaaccaagaactgccgggcctggggtgctaattat
OVRM1_0206_H10.b : ttcaaaccggcgtggcccaaaaaacatgaactgacgggccggggctgatactcctcttac
OVRT1_0143_G01.b : cctttctaacgcggggtggccccataatatccttgaattggacgggtctgggctgcgatt
OVRM1_0154_A10.b : attcataagtcggggtgtcccaaaaaatctgaactgacgggtctggttcctgatt
OVRT1_0141_A10.b : ctttctaagcggggtgggccaaaaaatctgaagttgcgggcttggttcctttttccctct
OVRT1_0132_E08.b : cctttcaaacgcgggttgccacttaaaagcttgaatttgcccgccctggtgctattcccc
OVRT1_0136_B01.b : cttttcacacccggggtggcccacaaaagcttgaactgcccggctggggtcctaaattct
OVRT1_0147_B03.b : ttcaaacgcggggtggcccctataatctcgatttgacggggtggggggctgattacccct
OVRT1_0143_E01.b : catttcaaatgtggggtgggcccagaaaaaacttaattggacgggcttggttgctaaatt
LNG01_0035_A11.b : cctttcccaccccgggtggcccataaaaccattgaatgaccgggctgggtgctgatatcc
LNG01_0080_G12.b : *ATTCAGAatgcgggttgacccaaaaaaacattgacatgactggctggttgctgatttct
TCH01_0033_G03.b : *CTTCATACCCGAGGTGGtccctaaaaacctggatgtgactggctgaggtgctgatttct
TCH01_0012_C01.b : *ATTCATAACCGGGGAGAGCAAAAAAAACATGAAaatgactggctgggtgctaaaatctc
PST01_0044_E03.b : cttgactttgcttgtctcttattattttgttcggaatgtgtttgcgtctatatttcttct
TES01_0056_A11.b : *TTTCATACGCTGGGTGGCCCAAAAAtaccttgagttgagggctgggcgccgcaatcccc
OVRT1_0123_D02.b : ttttctcacgctgggtggcactttaaagcatgtttctactggttgggtgctgatttctcc
OVRT1_0100_F07.b : *ATTCCGACCCGGGTTGGCCCAAAtatcctgtactgaccggcttggtgctgattcccccc
OVRT1_0120_H01.b : *ATTCATACCCGGGGTGGCCCATAAAAccttgcaatgcctggctgggtgcctgatttctc
CLNT1_0150_E07.b : cataccgtgtggttgcacatataatctttaaatgtccgtcttgggttgctgatatctcct
BKFL1_0056_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTGCTGATATCTC
BKFL1_0049_E07.b : nccaataannnnnaaagaaacctaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0020_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
---------+---------+---------+---------+---------+---------+ 917
CLNT1_0151_F03.b : tttagcatggtaaaacccggtgaacttggactgccatgccccttatctcaggggatgggt
TES01_0020_A03.b : cctactttagatttaccctggatattttgattgccatgctcctttattcccatgtcctgc
OVRT1_0100_C01.b : tagtaagggaacacctggaaagtttgattgcctgccgcctaatccctaaggaccggcttc
TES01_0001_D08.b : CTC*TTTtttatgaatactcttgagattttgaattgccttgcactaaactcccatggaca
OVRT1_0044_E01.b : cctccttattaggaacacccctggatattattaatgccttgctccctaactcctcaagga
OVRT1_0149_B12.b : ctccttacttagggagaaccttggaacttttgattgccttgccgttaactcccagggaag
CLNT1_0066_C04.b : taccaagtgagaccctggcaagtatgaatgccatgccgattccttcccatggccgggctt
OVRT1_0128_B05.b : tctacaattatctcgattgttcattcccttgcattttattccctttgcccgcttctcctt
OVRT1_0124_B12.b : tataaagtatacccttggttattttatccccattgattctatttcccgctgttatgtttt
OVRT1_0132_A05.b : ctccttataaggaaaacgctgggaaatatgattgcctttgcactaactcccaaggacggg
OVRT1_0001_E06.b : CTC*TTTATAGAGAA*AACGCTG*GAtaagtttgatgcccttgcaccaactcctcaggac
OVRT1_0004_A04.b : CTC*Tcataaagaacacactgaaagtttgagtgcctgcatctaacccccaggagggcttt
OVRT1_0126_H09.b : tttccttcacgtacactctttcccgttttttttttctcccctcctttttcttcctggctg
CLNT1_0113_G10.b : cctttttaagtacaccttggataatatgtgttcctttctacttcacttcttaagacaggc
CLNT1_0146_A11.b : ttcttaaggataagctggacaatatgaatgccatgcctctaattcccaatgacttggttt
TES01_0101_A03.b : ccccttatttgggaaataccctgtatatttttgattgccttgcaatttatttccaaggga
CLNT1_0115_D01.b : ctcttaattaggaacattcctggaaattatcattgcttcctctcttacttccaggtcctg
OVRT1_0045_G02.b : acactaaataaagatataccctggtaaataataaatgcaattgcacctactcccaaggaa
OVRT1_0082_A12.b : tcctcttacttaggaaaaccctggacagtatgagtgcctggccccctattcccaaggaac
OVRT1_0098_F02.b : CCC*TTAATATGGGA*GACACTG*GAaaattttattgccttgccccctacttccctagga
OVRT1_0045_B04.b : CTC*CTAATAAGGGA*AACCCTG*GAGAGTAT*GATTGgcctgccagctaactcccaggg
TES01_0070_D01.b : cccttaataagaaaacaccctggaaatattaaatgcccttgcccctaacccccagggaaa
OVRT1_0123_G01.b : cttcttttttgggaaaccccttgaagtttgattttccttgctacttacttttctggatcc
CLNT1_0128_D11.b : cctccttatcaagaatactcttggatacttttagtgccctgccacttaacttcctagggt
THY01_0040_A10.b : tttccctccttcttagttaataccccttgtagtacaatgtcttgcccatgctttttaact
OVRT1_0106_F03.b : cctattttaggattatgccttatcaatatatgtccctgtaccctcctttttctgttgcct
OVRT1_0064_E08.b : ccctttgtataggatttaccctgtaaatttttatttccctgtcactttacttcccaaggt
OVRM1_0204_C10.b : tcatctgtaacctgcttactacattatctgcctacctaaca
UTR01_0075_C07.b : ttcctttaataaaaaaaaacctggtaaaaatgaatgcccatgcatctaaaacctaaagaa
OVRM1_0206_H10.b : aaggaaaacctggataa
OVRT1_0143_G01.b : ttctcctcttatttagggacaaccttggatatttttatggtccttgcttccttctcccca
OVRM1_0154_A10.b :
OVRT1_0141_A10.b : ttaacacgaaaattttgaaagatttattcccttcatttactccaatgtacagccttttca
OVRT1_0132_E08.b : cctcttatcaggaaaaacctgggaaattttgatttgccatggccctaatttccaaggcct
OVRT1_0136_B01.b : cccccttaccatggagacccctggacattttgattgccttgcttcctacccccacggaac
OVRT1_0147_B03.b : tctaatttaggaagacctcgggttttttgattctctgcggctaacttccaaggcgggctt
OVRT1_0143_E01.b : ctctcccttttttacggatcacccttgtaatttctaactcccatgcctattatctcccaa
LNG01_0035_A11.b : tcctcttcattaaggaagaactctgtgaactagaactgccatgcacccttaattccccag
LNG01_0080_G12.b : tctcctaagaaggaatacgctggatcatatgagtccccatgttcctatctcaaaggaccg
TCH01_0033_G03.b : cttctttaccaaggacaaagctggaaagtaggaattgtcctggcacctaactcccaagga
OVRT1_0008_G02.b : cctcttatatcgaagacgcttggatatcttgagcgccttgtaccttacctcccaggacag
TCH01_0012_C01.b : ctcataccaaaggaagacccttggacattaagagtgccatacatcaaaatccctaggaaa
OVRM1_0059_H02.b : CTC*TTACTAAGGcacn
OVRT1_0028_E11.b : CTC*TTAatatggaagaagctggatatcatgattgccatgcctctaaccccccaggaatg
CLNT1_0055_E08.b : CTC*CTTATAAGGAAcacccctggatagtttgaatgcctttgcgctaactccccaggacc
OVRT1_0141_A09.b : cttcctattaaggaagacgcctgaaaagtatgaatgccttgcaactaactccccaaggaa
OVRT1_0003_C10.b : CTC*TTAATAAAGAgacgctggatattttgagtgctctgccccttactcccaaggaacgg
OVRT1_0147_C10.b : CCC*TTATTAAGGAgaacctggaaattatgagtggccttcttcttaatcccgaaggaggg
PST01_0044_E03.b : tacctttttttaccctctggatactttttatgcccagccttctcgctctacatttgccgg
OVRT1_0005_G05.b : CTC*TTATTAAGaaaacgctggaaatttgattgcctgtctctaattcccaaggacagctt
TES01_0056_A11.b : ccttattaaacgaaaatcctgggagagtatttattgtcatgctcctaactccccaggact
OVRT1_0123_D02.b : ctcttatcaataaagactcttgttagtttatttgcctttcttcttattccttattctggt
OVRT1_0100_F07.b : ttaattaggaatacgctggacagtatgattggcctggctcttaatcccatggtcaggctt
OVRT1_0120_H01.b : cccctactaacgaaaactctggatattttgagtgccttgcttttacttcccaggaatggt
CLNT1_0150_E07.b : ccctataacgaaaaatccttgaaagatttaattgccatttctttaaatccctcatgttat
OVRT1_0100_A06.b : CTC*TTTATAAGGAA*GACCCctggagagtatgaattgccatgccactaactcccaaggg
OVRT1_0072_D05.b : CTC*TTATTACGGAA*GACGCTG*GAtcattttattggcatgcattttactcccttggac
BKFL1_0049_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0020_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
---------+---------+---------+---------+---------+---------+ 973
CLNT1_0151_F03.b : ttgtcgatagaaaaaactcaatggatgaacctttattagaaaaatccacgaaaaacaggt
TES01_0020_A03.b : ttcatccttcttcaaaaattccggttgttgactcctttaccgttcatccctctcactata
OVRT1_0100_C01.b : tgcttcttcaaaaatactgtggtttaccctttccttgaattacccttctaaaatggtaat
TES01_0001_D08.b : ggcttcacctttatctaaaatttatcgtggttgacccttttttttgtgatccctgtggta
OVRT1_0044_E01.b : ccggctttacctttcttcaaaattaccgcggcttgaccctttacctttaattccactgta
TES01_0040_A03.b : aaggccttcgccttctccaaaaattttgtgtgttgaacccttttccttgaaaaccctgta
OVRT1_0149_B12.b : gctttcccttttcgccaaaatttcccgtggttgacccttttacctgaattccccctctaa
CLNT1_0066_C04.b : ccccatcccatcttctccttgggttcctctttactggatttcccttgcaaaaggtgcagg
OVRT1_0128_B05.b : cgccaatttttcgtggtttacctttttcttcaatctctgtgttctagggcgagttgttta
OVRT1_0124_B12.b : atccttcctttatatttaacgtgtttgaaatttttatatgaaatccattcttaaacttgt
OVRT1_0132_A05.b : tttcaccttccgcaaattttccgtggtttcacctttacttgaaatccccgtgaaaaaagg
PST01_0041_H08.b : ACggcttcagctccagcaatattactttggttgacattttactggaaaacttgtgataaa
OVRT1_0001_E06.b : aggcttcagcatcgtcaaaattacgttggttcactctttcttggaataacattgaaaaaa
OVRT1_0004_A04.b : cacataacaaaattacaggctttacccttacttgaaacccttgaaaatgggggaaggccg
CLNT1_0041_F04.b : caggtttcctcctctccaaaaattccgtggttgaccctttttcatgacatacccctggaa
OVRT1_0041_G09.b : ACAGGTTTCccatcaacaaaaattacgtggttgaacctttactgagaaaccaaaaaaaaa
SPLT1_0001_G07.b : ATCGGGCTCGGCA*TTAGCAAAAATTcacgtgggtttaccctttacattagaataccatt
OVR01_0043_B12.b : ACAGGCTTCAGCA*TCAC*CAAAAATTACCGTGGTTtgacacttttactgaaaatacccg
OVRT1_0126_H09.b : ggtcttcgtcctaatacactttctgtgtggtgctcatctttcttttttttcccttcccac
CLNT1_0113_G10.b : tttatcattataaaaaattatattgttgtacttttttatatcatactccgtacaaaacgg
CLNT1_0146_A11.b : caacttctccaaaatttcaggtgtttgacacttttttttaaattccctttaaaaaatgtt
TES01_0101_A03.b : cggctttatcctttttccataaatttcattggtttgacccttttcattgaatcccctgta
CLNT1_0115_D01.b : gttccgcttcgctattattcaattggtttgaccttttaccttatcatccattttaataag
OVRT1_0045_G02.b : caggattctacttttaaataaaattataacggagaaatactttagaataaaatccaaatg
OVRT1_0082_A12.b : gggtttcctcatcaccaaaaattacagttggttgacccttttcctgcaaattcctttgga
OVRT1_0098_F02.b : caggcttccgcttctgccaaaaatttccgtggttgacacttttccttgagattccagtgg
OVRT1_0045_B04.b : acggcttccgccttcaccaaaatttccggtggttgaccttttcatgaataaccattgaaa
OVRT1_0087_B04.b : gacagctttcatcatcccccaatatttaccggggttgaccttttccctgaattccctgtg
OVRT1_0036_C01.b : GCAGGGTTTAGCA*TCAGCAAAATTTAagtggtttgaccttttctgaaataccaatgaaa
OVRT1_0078_B06.b : ACAGGCTTCCGCT*TCTGCCAAAATTAACGTGGgttgaccttttacctgacatacccagt
LNG01_0034_G12.b : ACAGGCTTCAGCA*TCCC*CAAAAATTACAGTGGgttgaccactttaccttgagatacca
LNG01_0046_F07.b : ACAGGCTTCACCA*TCAG*CAAAAATTACAGTGGTT*Ggacacttttcatggaaaattcc
TES01_0070_D01.b : ggggttttctattccccaaaaatttaagggggttgacccttttacttgaaaaccctgtga
OVRT1_0123_G01.b : gcttttttttcatcccatttccagttgttttattttttactttcattccattcataaact
CLNT1_0128_D11.b : cggccttcccctctgtgcaaatttccggtggtgagcctttttcctggaattcccagttaa
TCH01_0093_B10.b : ACAGGgcttcacattaacaaaaatttaaatgggttgacacttttcatgaaaatcctggta
THY01_0040_A10.b : tcctcatggccagttctttatcctctcccccaacatatacccttggttggaacccttttc
OVRT1_0106_F03.b : tccccctcttctttttttccggggtttatcttttcccgagtaccattaatacttgtcctt
OVRT1_0064_E08.b : cccgccttcagtttctttaataatttagagtcgttgtcccctttcattgtatcctactgt
OVRM1_0204_C10.b :
UTR01_0075_C07.b : aggcttttaaccatcgcaacaattactctgatttgacccttaactcacaatccctataaa
OVRM1_0206_H10.b :
OVRT1_0143_G01.b : tgtctgggcttcttctcttccctaaatttccctggtgtctctcttttcttgaattcccct
OVRM1_0154_A10.b :
OVRT1_0141_A10.b : tcatcaaaatttccggggtttaccctttcctataaatcccattaaaaaaagtttaggggc
OVRT1_0132_E08.b : ggcttcaccatcccaaaaaataccggggttgcccctttgccggaaatacccctggaaaaa
OVRT1_0136_B01.b : gtgcttctcctctaacaaaatttccgtggttgaaccctttccctgaaaactcctcaaaaa
OVRT1_0147_B03.b : ctgcttcctcaatatttccgtggttgactcttttcaggaaatcccatgaacaagttgaag
OVRT1_0143_E01.b : agataggtcttctacctaataaaaaaattcccgtgttatcccctttttcgtaatactctc
LNG01_0035_A11.b : gtcccggctttctctttcctctaaacatttacctggcttgaatccttttacatgacaata
LNG01_0080_G12.b : ggttccacatcagcaaaaattacttgggttttacaatttacataaaatcccagttaaaaa
TCH01_0033_G03.b : atgtcctttctcatcccccaaaatttctgtcggttgaaccttttcttgaaaaaccattga
OVRT1_0008_G02.b : gctttcatcatcatgcaaatatttccgtgtgtgactccttccctgcaaatacctttgaaa
TCH01_0012_C01.b : aggattaaccatcatcaaaaaattaaaagtagttaaaaacttaaatcaaaaaaaaaatta
OVRM1_0059_H02.b :
OVRT1_0028_E11.b : gttttaaccctccctaaaacttaaggggcctacccctttttctgaaattcattcgaaaac
CLNT1_0055_E08.b : ggcttccgccatcaccaaaattacaggggttggaccttttcatgaaaatcccatgaaaaa
OVRT1_0141_A09.b : gggcttcgcatcaaccaaaatttaccgtggtttgacctttaaatgaaatacccgtgaaaa
OVRT1_0003_C10.b : ttttcgcctttggcaaatttaccggggttgcattttttctgctaatcctgtcaaaaaagg
OVRT1_0147_C10.b : cgttcccatcccccaaaatttacgggggtggagctttaactgagatcccattaaaaatgg
OVRT1_0002_A05.b : gaagggcttcgacctcagcaaaaattaccggggttggaccttttaactgaaatacccttg
SMG01_0092_C12.b : GCAGGCTTCCCCA*TCGGCAAAAtttccggggtttgacccttttccttgaaacccctgta
OVRT1_0054_D09.b : ACAGGCTTCCGCT*TCctcacatttacagtggctgactctttccttgaaataccatgcaa
HTMT1_0044_C07.b : acggcttcctcatcaaaaaaattacatgggtagacactttcctgaaatacccgtgaaaaa
CLNT1_0064_G09.b : ACAGGCTTTCTCA*TCAG*CCAAAATTACAGTGGTTtgacactttccctgaaaacccagt
PST01_0044_E03.b : ctttcttattccatttaattcttgatttgttaggatctttcgtcagaatttgtgctcttt
OVRT1_0005_G05.b : cagcttcacaaaaaaaaaaaaaaaatgcccatgtgccttaactcaggttggggcccctta
TES01_0056_A11.b : tgccttcagtcttcccaaaaatttcggggcttgacactttacatgaaattacctttgata
OVRT1_0123_D02.b : tttcgtcctcttctttaatgccgttgtttgctccttttctttctttcccttctatcattt
OVRT1_0100_F07.b : ccccgttagcaaaatttcagggggtttaccttttacttgagatcccatttataaaggtta
TES01_0059_H04.b : ACAGGGTTTCaccctccccaaaattaccgggggttgaaccttttcatgaaatccccttga
OVRT1_0120_H01.b : cttcccctcaccaaaattttctgtggtttaacttttccttgacatcctcctgaaaaacgg
OVRT1_0093_E08.b : ACAGGCTTCAGCA*TCAACAAAAATTTacatgggttgaccctttacataaaattccagtt
CLNT1_0150_E07.b : gcttagacctcttttaaaataacttggcttatatttttattataaataatattcaataaa
OVRT1_0100_A06.b : acaggcttccgcttctacaaaaatttcgggggttgacccttttcctggcaatacccctga
OVRT1_0072_D05.b : gggctttcatcattgcaaaattttcctgggtggacccttttctgaatatccacttaaaca
OVR01_0090_D11.b : aacgggcttaatcctcaaaaaaaattacaccggtttgacacttttcctgagattacaatg
BKFL1_0049_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGATACCAG
ILNT1_0020_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
---------+---------+---------+---------+---------+---------+ 1029
CLNT1_0151_F03.b : atagtggtcataagtaaccccacttagtatctatctcgcctacaacatcaatggtatata
TES01_0020_A03.b : ttgttaacgtttctttgctttaatcctttccactttttcttatctgcctatctcatttct
OVRT1_0100_C01.b : ggtgcctatctttaaccctcccttattacttactctgcctaatctttatgcctgggatat
TES01_0001_D08.b : aaatggtgtatgtgctggacttataaacttggcctaatatatttaatcttgcgtattcta
OVRT1_0044_E01.b : caaaggtgaaggggcttaacctgttacctcgcaaagcatcttatctgcctagcctataat
TES01_0040_A03.b : aaaaaagtgtaaggggccttaatgtatacctgccaaatattattatcttcctaacctata
OVRT1_0149_B12.b : aaaagggtgatggcgcctaacctgtaaaccccccaaaaatatttaggctcggttacctaa
TES01_0112_B01.b : T*GGAAAAAGGTtgaaggggctgacctttaaacctgccaatttatttagccggcctaacc
CLNT1_0096_B04.b : gataaagggtgaggggcttaactgttaaccttgcaaattatttaatctggctacctatat
OVRT1_0025_C10.b : T*GAAAAAggtgaaggggctaactgtnaacccgccaagtatttagtctgcttaactaaaa
CLNT1_0022_F10.b : T*GAAAAAAGGTGAAGG*TGCTtgacctgtaacctgccgaggattttagtctgcgtagcc
CLNT1_0066_C04.b : tgctgacctcctacccgaccgtttctttgtcctccccctctttaccccggttagctccgc
OVRT1_0128_B05.b : cttctaccctcatttctttttctccgcttatcattataaccgactattcctccctgtttc
OVRT1_0124_B12.b : ttccgtgccttctagtttatctttataactctctatttctctcctctttttatctcttta
OVRT1_0132_A05.b : gaatgttccgaacctttaacccgccaaatattttactccgccggacctaaagtcgggata
PST01_0041_H08.b : agggaaagggttgacctgttaacctgcaaaaagacttttccgctattccatagtaaggga
OVRT1_0001_E06.b : gtgtaagtggtgacctgtaaccctccaagtattttagtccgcgtacttaaattcatggat
OVRT1_0004_A04.b : aaaataaacctgtaaagtatattatctcgccactaaaattttgtaacttctggcccggtt
CLNT1_0041_F04.b : aaatgggtgaagtgcttgactgttaccctgctaatattttatcctgctacttatagtcct
OVRT1_0041_G09.b : ggggaaggcgctgaacttgaaaccttgaaaaaaattaattcccctatcctaaaatctgga
SPLT1_0001_G07.b : ggaaaaaggtttaaagttcctgaacttgtaacccgcacaattatttaatccggcggttgc
OVR01_0043_B12.b : tgaaaaaaaggggaaggtgcttgatccttgacaccctggcaaaataattttatttctgct
OVRT1_0076_E05.b : T*GAAAAAAG*TGAAGG*TGCTaacctggtaacttgcaaatatataatctgcctagcaaa
OVRT1_0126_H09.b : gtttttacggtccctaattctctctttgccttgcatctccatcttccgtttcccactttc
CLNT1_0113_G10.b : ctagggcgctaacttttacctcgcctaatttttatttcttccttctttcatttattgtaa
CLNT1_0146_A11.b : gaggttcttaatcttaacctttcaaattttttttctgcctcctttattgttttgaataat
TES01_0101_A03.b : aaataaggttttggtccttaccttttaactttacatgttttttctctggccttcccattt
CLNT1_0115_D01.b : tttatggcgcctattttgatactttccacttttttcatccgcgctcctcttacttctgta
OVRT1_0045_G02.b : taaaatgtgaacgtgcctaatatgctaaacttgaaaagaaaatttatccgtgtaaaacat
OVRT1_0082_A12.b : aaaaagggcaaggggtctgaccttttaacccttgcaaagtattttattctggctatccca
OVRT1_0098_F02.b : aaaaagggtgaaagtgctgaacttgttaacctgccgaaatatttttggcctggcttaccc
OVRT1_0045_B04.b : ataagggaatgggcttaactggttaccctgctatttttttatcctgcggacctaatagtt
OVRT1_0087_B04.b : aaaaaaggtgaaggtgctgagctgtaatcttgctgaggattttcgtccgcggacctaaaa
OVRT1_0036_C01.b : aaggtgaatgtgctgaagtgttaactggcaaatattttaatctgcgtacctaaatccctg
OVRT1_0078_B06.b : aaaaaaggtgaaggtgcttaactgtaaccctgcgaagtttttaatctccctacttaatgt
OVRT1_0082_B08.b : gacaaaagggtgaaggggttgaactgtcaacctgccgagttattttaacctgtgtagctt
LNG01_0034_G12.b : gtgaaaaaaaggtgaaaggtgctgagcttgtaacctgccaaattattttaatctgcgtag
OVRT1_0040_E06.b : caaaaaggtgaaggtgctgacctgttaacctggcgaagtttattatccgcctagctaata
LNG01_0046_F07.b : agttgaaaaaaaaggtgaaaggtggctgaacttggaaaccttgccaaaatattttatatc
TCH01_0046_A02.b : ttgaaaaagggtgaagtgctgaaccgtaaacctgcataatatattactctgccctaccta
OVRT1_0038_A03.b : T*GAAAAAAGGGGAAGG*TGCTcagcctgtaaccctgccaatatattagtcggcctagct
OVRT1_0069_A11.b : T*AAAAAAAGGTGAAGG*TGCTtgaccttgtaacctgccaagaaaattaatctgcgtacc
OVRT1_0036_C05.b : T*GAAAAA*GGTGAAGG*TGCTGAGCgtaaacctgcagaatattttagtctgcgtactaa
TCH01_0028_A06.b : T*GAAAAACGGTGAAGG*TGCTGAacttgtcaacctgccaaattatttatcctggctacc
OVRT1_0041_A04.b : G*TGAAAAAGGTGAAGG*TGCTGAGCTGTAAcctggccaaaaatttagtcctgcgtacct
TES01_0070_D01.b : aaaaagggggaaagggctctaaccttttaacccccgaaatatattaaggccctccgctcc
OVRT1_0123_G01.b : gtattgggctcgcgttttatttcggctcagttatttctcttttttaatcccttctcagga
CLNT1_0128_D11.b : aaagggggacgggcttgatctttacctctcccaaactttttattttgcgctcctaaattt
TCH01_0093_B10.b : aaaaaggttaaagtggctgaactgtaaacctgctaaaattattaatcggcgaatctaaaa
TCH01_0093_E09.b : T*GATAAAAAGTGGAAG*TGCTGAACTTGTAACCTGCctaagtattttatctgggttcct
THY01_0040_A10.b : tttctaaataccccccccacaaaaatcccctaaagggttcccctaaccctgtccacccct
OVRT1_0106_F03.b : tccttattattatcattttttcccattcccctttataaatccaatctctttttctgctta
OVRT1_0064_E08.b : ttgtacaacatttttatcgtgcttgatcttgtccccccggctaaaatattttattcttcc
OVRM1_0204_C10.b :
UTR01_0075_C07.b : aaaaggttaatcgtgctaacctctaaacctacatagatatttaaaatacaattaatataa
OVRM1_0206_H10.b :
OVRT1_0143_G01.b : ccccaaaacgggtaggtctctttacttttcttcccgccattatctttctttcccttatta
OVRM1_0154_A10.b :
OVRT1_0141_A10.b : ttacctttaaacctccctattatttatcccgcgatctaaaattctggcaaaatcctgccc
OVRT1_0132_E08.b : agtgtacggttctaaccattaaccccctaaaattaattaactctcgcttctatattccct
OVRT1_0136_B01.b : aggtgtaggtgctggactgttacccttgcaacttctttatcctccctaccctattctcat
OVRT1_0147_B03.b : gggcttactctttactctaaaatatatttctcccgttcaactatattccggggacacccc
OVRT1_0143_E01.b : tgctaaaaatgttaaggttctctcttttttatccttacaagtttttctctgttcctcttc
LNG01_0035_A11.b : ccagttgaaaaaaagggaaaggtgcctgaacctgataaccctgccaaagttctatcacct
LNG01_0080_G12.b : aaagggtagttgctaaactgtataccttccaaantattttattccggcattaccacgttc
TCH01_0033_G03.b : aatactgggaagggagcccaacttgtaaacctgcctagattatttgtccgcccacttaat
OVRT1_0008_G02.b : aacgtcaaggttctgaactgttaacctcccccatttttttattcggcgtacctgtcatgg
TCH01_0012_C01.b : aaaaaagtgaacaggtctcaagctgtaaaactgaaaaagcataataacttaggcgtacct
OVRM1_0059_H02.b :
OVRT1_0028_E11.b : agcgcaagcgccttactgttaacccttcaaataatttccgtggcctcaactaattatccc
CLNT1_0055_E08.b : aggcgaaggtgcctatcgttaacctgcaaatttattaatccggctactaatagcctgggt
OVRT1_0141_A09.b : aaggtgaaggtgctgagccgtaaacccgccgatttatttttccggctacctaaattccag
OVRT1_0003_C10.b : tgaaggtgctgtacctttaaccctgagaatatattatcccgcctagcctatattcatggt
OVRT1_0147_C10.b : ggacggtgcttgacttttaaccctgcaatttttttgtcttctgtgctattctcatggtta
OVRT1_0002_A05.b : gaataaggttaaggcggctgacctttaaacccgcctaattatttagtcggcttaccaaaa
SMG01_0092_C12.b : aaaaggtgaaggggctaaactttaaccctgcaaatttttagccgggctaactaaagcccg
OVRT1_0054_D09.b : taaggtgcaggtgtgaacttgtaaccctgcaaagtatattattctggcttgctaactgtc
HTMT1_0044_C07.b : aggggaggcgctgaactgtaaactgctaaaaaattagcttgcggaccaaaaatctggaaa
CLNT1_0064_G09.b : gtaaataggtgaaggcgctgaacctgtcccctgcccatttattagcctgccaacctattg
UTR01_0045_A04.b :
CLNT1_0061_A10.b : aaaaaggtgaagtgctgagctgtaaaccttgcaagtatatagtcctgcctacctatagtc
OVRT1_0085_E08.b : tgaaaaccgggtaaggtgcgtgatctgtaaccttgcaaataattttaggcgactttccta
LNG01_0042_H03.b : gaaaaaaagtgaaggtgctgaagctgaaaacctgccgaagaatattagtttggcttacct
CLNT1_0064_F02.b : T*GGAAAAAAGTGgaagtgcctagctttaaccccgccaaaattttagtcggcgtagctta
OVRT1_0042_D12.b : T*GAAAAAAagtggaaggtgcttaacctgtaaccctgccaagtattttagtctgcctaac
CLNT1_0096_D04.b : TGGAAAAAAGGggaaagggctgaacctgtaaacctgcaaataatattagcctgcgtaacc
OVRT1_0058_D02.b : T*GAAAAAGGGTGAggggctgacctgtaaccggcaagatatttgatctgccttcctaaat
LNG01_0035_H02.b : TGGAAAAAAaggtgaaggtgctgaagctgtaaaccctgcgaagtatttttattctgcgta
OVRT1_0073_E02.b : T*GAAAAAAGGTGAAAG*TGCTtgactgttaacctgcaaacatattactctgcgtaccta
OVRT1_0073_A09.b : T*GAAAAA*GGTGAAGG*TGCctgactgtaaacctgctaagaattttagtctgcctacct
MLN01_0069_C05.b : T*GAAAAAAGGTGAAAG*TGCgaacctgtaaactgcaaagtaaataatctgcgtaactaa
LNG01_0034_F12.b : TGAAAAAAGGGTGAAGgtgctgaacctgtaaaccctgcaaagtatattaattcttgctta
OVRT1_0043_F11.b : T*GAAAAACGGTGAAGG*GGCTGACCTGTTAACCcgcaaattattttatccgcctaacta
CLNT1_0051_H02.b : T*GAAAAAAGGTGAAGG*TGCTGAACTTGTAACCctgcgagtattttagcctgggtacct
OVRT1_0035_E03.b : T*GAAAAAAG*TGAAGG*TGCTAAGCT*GTAACCCTGCcaagttattaccctgcctggca
TCH01_0037_B04.b : T*GAAAAAAG*TGAAGG*TGCTGAGCTGTAACCtgcaaagtatatagtctgcgtagctat
LNG01_0091_D10.b : T*GAAAAAAGGTGAAGG*TGCTGTACTTGTAACCTGgcaagtattttattcctgctaact
UTR01_0043_B07.b : T*GAAAAAAGGTGAAGG*TGCTGACCTGTAAACCctgcaaagtatattagtcttgcgaac
UTR01_0060_D01.b : T*GAAAAAAGGTGAAGG*TGCTAAGCT*GTAAACCTGgcaaagtataattattctgccta
PST01_0044_E03.b : tatcatagaccgtttttaattttctccttctcgaatttttttccccagcttttttgtttc
OVRT1_0005_G05.b : aactttcaaaaxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0056_A11.b : aaacgctatggtgcctaatctgattcccggccgagtatttttagctccgccttccttatt
OVRT1_0123_D02.b : tatatgcgctcctcttttatctcccctattttttattcttcacttctacctctttgtatt
OVRT1_0100_F07.b : aggggctgtaacctgacaccccctcaattctttactcctggctttctttctctcagggta
TES01_0059_H04.b : aaaaaggggaaaggggttgaacctgtaaccccgccaaattatttaatcctggtagcctaa
OVRT1_0120_H01.b : tgatagtgcttccccttaaccccgcaaatttattattctggtgtaccttctcttcggcta
OVRT1_0093_E08.b : aaaaaaaggtgaaggtgcttaaattgaaaaccggaaaaaaaattaaactgccaaactaat
OVRT1_0019_D07.b : T*TGAAAAAGGTGAAAG*TGCctagctgtaacctgcaaaaaatattattctgcctaccta
CLNT1_0150_E07.b : atttaatcgtgataaacttatatcttataaatcccatataattcttctaattattaaatc
OVRT1_0100_A06.b : aaaaagggtgagggggctaacttgtaaccctgccaaatattttatccggggttcctaata
OVRT1_0072_D05.b : aggtgaaggtgacttgaccgtgaaacctgcctattatatagtctgccttggaaatattct
OVR01_0090_D11.b : aaacaatggagaaagtgcctgaaactttaatccctgaaaaaatctttattcccgcacacc
ILNT1_0020_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
---------+---------+---------+---------+---------+---------+ 1087
CLNT1_0151_F03.b : ttcaccctgggttcgttcagatctaactttcttatatgggtgcaaattaattgattaatt
TES01_0020_A03.b : agtattactatattcccgtttttctccttatatacttttttcttttctggtcaacacttt
OVRT1_0100_C01.b : ttcgcccctggtttcaccctatatacctatctcctttcttgccgcgttataacccttcat
TES01_0001_D08.b : aatcctctgggataaatatctacccctggttttcaccttaaaaaccaatttcttttcttg
OVRT1_0044_E01.b : cagggaatacttcagccctggttttcccctataacccctttctttcatgcctaccccaac
TES01_0040_A03.b : atcctgggttactatcaccccgatttcccccctattaaccacttctttttttatgcctaa
OVRT1_0149_B12.b : aagccctggaatacttccccccccggtttttcccccttataaccatactttttttcttgg
TES01_0112_B01.b : tataatctcgggaaaaatacaggccctggttcctccctaaaaaccaacttctttttcctg
CLNT1_0096_B04.b : tcctggtaaccttacgccctgtgtttcacctaatatctggtttttttctggcagttcctt
OVRT1_0025_C10.b : ccttggataattcggccctgtttctccctaatacccagtttcttttctggggaccactcc
PST01_0042_A08.b : CTAATAtcctggatacctccagcctggttcttccctaataaccgcttcttttcagcagtg
KDN01_0016_C12.b : CTAATAGTCCTGGAatactcccgcccctggttctcccttataaaccagctttctttcctg
CLNT1_0022_F10.b : tattatcctgaataactatcaccctgtttctccccttattaccagcttcctttccgtgcg
KDN01_0093_D03.b : CTAATAGTCATGGgtactaccggccctggttctcactaattaccagcttcttttctggag
LVR01_0057_C12.b : cctaaaagtcatggataactaccagccctgggtcctcacctaataaacagccttcttttt
OVRT1_0022_A06.b : CTAATAGTCtggaatactaccgcccgtgttcctccctaaaaccccttcttttctggggta
CLNT1_0066_C04.b : cctggtttaccccttaattccagtttcttttcggtgatcccttacccttttttctttctc
OVRT1_0128_B05.b : tactcatttcccctattctttgtgtctactctttacctttctattctctagtgggctttc
OVRT1_0124_B12.b : tttcctcccctctctcgatccctccattaattacctttctttcccccctctccttttctc
OVRT1_0132_A05.b : ctccccccctggttctccctaaaaacaggttttttttttgccttccctaaccctttattt
PST01_0041_H08.b : atcctagatccttgtttttatttaaaactactttcttcttggttaatgcctaatttaaat
OVRT1_0001_E06.b : aaataccccccggttctcccaaaaaccacttttttttctgggatcactaccccttttttt
OVRT1_0004_A04.b : tcccactaaaaactcttttttttatgacatataaaactttaattttatcggaggttttct
CLNT1_0041_F04.b : gtgaaactacgcccctggtttttcccctaataccacgctcttttcctgcgttcccttacc
OVRT1_0041_G09.b : aaaacaaaaccctggtttctccccaaaaacaattttctttttcggcaatacctaacattt
SPLT1_0001_G07.b : taaaaatctggaaaaattacgccctttggtctcccttaaaaacaagcttcttttcatgcg
OVR01_0043_B12.b : ataacctaaatactcatcggataacctaccgccccctggtctctcccccctaaaaacccc
PST01_0064_F10.b : CTAATAGTCATGGAT*Actacagccctggttctccctaatacccacttcttttctgcagt
OVRT1_0076_E05.b : catccgggataatcagccctggtttcccctataaacagtttttttcttgcaaaacctaac
OVRT1_0126_H09.b : ttctgtgcccttcttctgcttgtttcccccccgatttccctcttttcttttgctttcctt
CLNT1_0113_G10.b : accactctcctgcttttcccaatcactccctttctttttggcatacccctctctcttatc
CLNT1_0146_A11.b : tccctcccttgtttttctctaataccagtttctttttcgccaacttcttccctttctatt
TES01_0101_A03.b : ttcttggattatcttacccccttttttttacccttattacctacttttttttaggaatat
CLNT1_0115_D01.b : tactctcctctcctgtttctatttgcgtacctccttttttttttgcttttatataaatga
OVRT1_0045_G02.b : atatacatgagtaaattacagcctttgtttcacatcaaaatacacaatttttttttgtaa
OVRT1_0082_A12.b : tatgccttggattaccttcccccccggtttctcccctaattaccatgtttttttttcttg
OVRT1_0098_F02.b : taatggtcttggaataactccggcccctggttctccccttaaaaaccaactttctttttc
OVRT1_0045_B04.b : ttgggatacctacagccctgttctccccataatacccagtctcttttctgcatgtacata
OVRT1_0087_B04.b : ttttgggattatcacccccttggtctccccctatgacccactttttttcttgccatggca
OVRT1_0036_C01.b : gaaactaacaccctgttctcccaataaccagcttttttcctgcacaaccttaaaattttg
OVRT1_0078_B06.b : tctgggaaacaccccctgggttccacctattacctgcttttttttggaatacaactaccc
OVRT1_0082_B08.b : attatcatgtgttactactgcccgtggtttttcccttttaaccggctttcctttcttgtt
LNG01_0034_G12.b : cttaataatcctggattaactccagcccctggtttccccccctaataacccaccttcctt
OVRT1_0040_E06.b : gccttggaaaactacgccctggtttctcccctaaaacccgcttctttttttgcgttcacc
LNG01_0046_F07.b : ctggcttaacctaataagtccatggaaaaatttacagccccttggtttcccaccctaaat
TCH01_0046_A02.b : acatcctggattaattccgccctgggtcttcccctattacccgcttctttttttgccgtc
OVRT1_0038_A03.b : ataagtcttgggtaacttcgcccctggttttcccctaatacccactttcttttctggcat
OVRT1_0069_A11.b : taataatcatggataacttaccccctggtttttcccctaataaccgtttttcttttcatg
OVRT1_0036_C05.b : tattcttggataactccgccctggttctcccctataaccgctttttttccggcggaaact
TCH01_0028_A06.b : ctaaagccccgggatacttcaagccctggtttccacctaatatacagcctttctttcctt
OVRT1_0041_A04.b : atagccatggaatactaccgccctggttttcccctaataaccactttcttttctgcaaga
OVRT1_0023_B04.b : ataatcatggtaactccgccctggttctcacctattaccccttcttttcttgccgtaccc
OVRT1_0042_E01.b : taaaatccttgaataactccgccccggtttctcccttaataacccgcttctttttctgcg
OVRT1_0036_G06.b : ataataagggatacttcggccctgtttctccctataaacggcttcttttctgccttacct
OVRT1_0035_F07.b : taaaatcaggaataactacgccctggtttcccactaaaaacccacttcttttctgccata
OVRT1_0074_C11.b : tattatccgggataattccagcccctggtcttccctataaccggttttttttctgcagta
OVRT1_0084_H08.b : cctaatttcctggttaaatacaccctgggtctccccaataaccgacttcttttttgcagt
TCH01_0023_B08.b : ctataatcatgagtaactaccgccctggttccccctaataaaccgcttcttttcttgatt
TES01_0070_D01.b : taaatctcttgggtaaaaaaaacaccctgggtttccccctcaataaacccgttttttttt
OVRT1_0123_G01.b : ttactttcttcttgtttcttcatttatatgcttttctatgtcacttttcctacctttatt
CLNT1_0128_D11.b : cagtgaataatccccccttggcttccactcaaataccagctcttcttttggcgcggtccc
TCH01_0093_B10.b : atccggaataatacaaccatggttctcaccttataacctgttcctttcgtgaataaacta
TCH01_0093_E09.b : aatatcctgggattcttctgccctgtttctcccctattaccaatttcttttctgcgttac
CLNT1_0074_H09.b : CTAATAGTCATGGAataactacggccctggttccccccctattaaccagcttctttttct
OVRT1_0033_A09.b : CTAATAATCATGGAT*AACTACCGCCCTGGgttctcacttattacccagtttcttttcct
THY01_0040_A10.b : cctaccattccttcttctttttcttcgttcgtcctttttctccccccatactatctcaaa
OVRT1_0106_F03.b : tcaatctaattccaaaaattctttgattcatcctttcaaaatttcttctcttttcgtcta
OVRT1_0064_E08.b : tctgcctatcagttatgtgtttccttccgtccctttttttcttcttacattagcagtttt
OVRM1_0204_C10.b :
UTR01_0075_C07.b : aactgagaaaattaaagtcccttaggcttaacccaaaaaacacaccttcattttaatgaa
OVRM1_0206_H10.b :
OVRT1_0143_G01.b : ccattgctttggttattttctcctcatttctctcccttatttccccccttattttctgtg
OVRM1_0154_A10.b :
OVRT1_0141_A10.b : ttgatcctccttaaaaaacccttttttctggcattctatataccccttcattaatctgtg
OVRT1_0132_E08.b : aggaataacacaccccttgttcttcctattacaccacttttttttccgccatattcaatt
OVRT1_0136_B01.b : gggttattccacccccggttcctcactaaatatcaccttcttttcgtgtcgaccccaccc
OVRT1_0147_B03.b : gccctgtttttctccatatctcctctcttttcttcttccccaacacttttttttttacgg
OVRT1_0143_E01.b : cgttaaaatctcatcaatttatgctcctgtttctccctcaatacttatccttcttcttct
LNG01_0035_A11.b : ccctccctaccctcactactacaggaatatacccttccgcccctgggttcttccacccta
LNG01_0080_G12.b : ccatgaaaaaattccaagccctgttggttcccaactaaacaattttttttttttgttctt
TCH01_0033_G03.b : atctctgggtcaaataccaccccgttttttcccttaataaccgatttctttccatccata
OVRT1_0008_G02.b : aatatatccccctggtttctccccttaaaaccacttctttttccggcatttctctatact
TCH01_0012_C01.b : aaaaatcaatggaaaaaataacaaacccttattttacaaaaaaatacaaaaattcatttt
OVRM1_0059_H02.b :
OVRT1_0028_E11.b : ggactaccacagccctggttctccctttatcaccaggtttcttttttcccgttacccccc
CLNT1_0055_E08.b : aactacggcctggttctcccttatacccgttttttttttgcgtacctaccctttatttta
OVRT1_0141_A09.b : ggataattcacccctggtttccaccttataccccccttcttttcctgcggaaaacaaacc
OVRT1_0003_C10.b : aaattcaaacccggttctcacctaaaaacagcctctttttcggtagacaccaaaccttta
OVRT1_0147_C10.b : ctctctgcccttttttcccttttaaccccctttttttctggattaacttacccttttttt
OVRT1_0002_A05.b : attctgggattcttccgcctgggttttaccctaaatacccttttcttttctgtagtttcc
SMG01_0092_C12.b : gggaacctaccccccggtctcccccaaaaacccctttttttcgggcgaaacctaaccttt
OVRT1_0054_D09.b : ctggataaataccgcccggggttctccccaataaccaccttcttttcttgcggaaccctt
HTMT1_0044_C07.b : actcagccctggttcccacaaaaaaagcttctttctgggagacccaacatttattttatt
CLNT1_0064_G09.b : tcctggataactccccgcctggtctcccctaaaaacccccctttcttttctggcggacac
UTR01_0045_A04.b :
CLNT1_0061_A10.b : tgggataactaccgccctggttttccacttatacccaccttctttcctgcggtaccctac
OVRT1_0085_E08.b : atagtctggataaattctgcccggggtttcccttaagaaccaggtcctttcaggcaaatc
LNG01_0042_H03.b : aaaaattctgggaaaaattcagcccctggtttctcccctaataacccagctttcttttcc
CLNT1_0064_F02.b : tagcctggattaactacgccccggtttctcccctaataacccgcttcttttccggccgta
OVRT1_0042_D12.b : ctaaatatcctggataactccgcccctggttcctcccctaataaccaccttctttttctg
CLNT1_0096_D04.b : tatagttcagggatactaccgccctggttttccacttataaccagcttcctttcatgcgt
OVRT1_0058_D02.b : atcctggatacttccgccctgtttttcccctaataacaccttcttttctggcaaacccta
LNG01_0035_H02.b : acctaatagtcctggattaactaccaccctgggtttccccccctaaaaacccacccttcc
OVRT1_0073_E02.b : aaatccatggataactccgccctggttccccactaataaccccctcttttcttgcgaacc
OVRT1_0073_A09.b : aaaatcatggaaaattaccccctggtttctccctaataaccgccttttttcttgcggtac
MLN01_0069_C05.b : tagtcatggataactacagcctggtctcaccaataaccagcttcttttctggcatacact
LNG01_0034_F12.b : ccttaataattcatggataaattaccgcccctggtttctccaccaaataacccacctttc
OVRT1_0043_F11.b : aatatctgggataaactccgccctggttttcccctaattacccactttctttttcttgcc
CLNT1_0051_H02.b : aatagtctgggattactccagcctggttcccccctaatacccagttctttcatgcggtac
OVRT1_0035_E03.b : ataatcatggataataccgccctggttttccctaataaccagttcttttcttgcatacac
TCH01_0037_B04.b : agtcatggaaactacagccctgggtctcacctaataacaagctcttttcatgcataaact
LNG01_0091_D10.b : aaagtctgggatacttccgcccttggttttacctaataacagctttttttctgccgtaca
UTR01_0043_B07.b : taatagtcatgggataacttccgcccctgggttctccccctataaacccaccttcctttt
UTR01_0060_D01.b : acctaatagtcttgggataactacagcccttggttttccccctaaaaaccagctttcttt
MLN01_0101_H05.b : tatattcatggatagcttcgccctgggttctcccctaataccagcttcttttcttgcggt
CLNT1_0066_E04.b : cttaaagccagggataacaccgccctgggtcctcccttataccagtttccttcttggctt
OVRT1_0048_F02.b : cctaatgttctgggataacttactgccctgtttcccccctaaaacccaccttcttttcat
CLNT1_0064_E03.b : CTtaaagcctgggataacttccgccccggttttcacctattaaccggtttcttttccgtg
OVRT1_0031_H01.b : CTtaatatcatgggatactcccgccttggtttctcccctaaaaaccagcttcttttctgg
CLNT1_0014_A11.b : CTAATAatctgggatacttccgccctgggttttcacctaattacccactttctttttctg
UTR01_0052_H06.b : cttataattcttggaaaactacggccctggtttctcccccaataacccaccttctttttc
CLNT1_0074_E03.b : CTAATAGTCATGGAT*AACTtacgcccgggtttcccctataaccacttctttttcctgcg
LNG01_0028_F08.b : CTAATAGTCCTGGAT*AACTACGGCCCTGGTTCTCcccctaataacccaccttctttttt
PST01_0044_E03.b : tacccctttatactctaaaatcgtctttatgtataatcatactttttttctcctctcttt
OVRT1_0005_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtcattaaaccatactcccaatttccaa
TES01_0056_A11.b : ttttttgtactaacttccgccctgggtcttccacctcttaaccaccttcttttcctgcct
OVRT1_0123_D02.b : tttcttgcctttgtctttccctataactttttttctttattcctcctgttatccttattt
OVRT1_0100_F07.b : atctccgcctatgttctccccatttaactgtttctttttccactgagccctcacacttta
TES01_0059_H04.b : aagcctgggataaattacccccctggttcccccctcaaaaacccgcttctttttctgccg
OVRT1_0120_H01.b : tacaccgcccttgtttcaccttaaaacccctttttcttttttgcattcaactaactcctt
OVRT1_0093_E08.b : agacatggaaaactacggccctggttctcacctaaaaccatctttttttacagcacaaac
OVRT1_0019_D07.b : aaatcctggaatactccagcccgggtttcacccaaaacccgcttcttttcttggagaaca
CLNT1_0150_E07.b : agtatactcaaccctctgttatcatactataatttaccttttttctctaattacatacat
OVRT1_0100_A06.b : tgctggggaaaccacctcctgggtttccccctaataccccgcttcttttctggctatacc
OVRT1_0072_D05.b : tggtaactaccgcccgggtctcccataatacttccttttttatgccgtatcctccatttt
OVR01_0090_D11.b : caaatatccattggataactaacgcccctggttctcccaccttaaaaaccggcttctttt
ILNT1_0020_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
ILNT1_0056_D06.b :
SKNB1_0013_E01.b :
---------+---------+---------+---------+---------+---------+ 1146
CLNT1_0151_F03.b : attggcgtacttactcagatgtgcaagaacgagtcactattatacatatattgtagcgta
TES01_0020_A03.b : actcttttttttattttggggtctttctccttcgttaatgtattaacgtttcccttttct
OVRT1_0100_C01.b : tttttttcggggttttccaccgtggttattttgatatcacgttctccctctagatttctc
TES01_0001_D08.b : gctttaactttacctctctttatttttattctgggagtttttcacctttggtactattcg
OVRT1_0044_E01.b : ccttatttatattcccgtttttttcccgtttaattttgattttagccctccttcaaactt
TES01_0040_A03.b : acaatatcttttattttattccggtggttttttccccggtaaaattcaattaaaggaatt
OVRT1_0149_B12.b : cctaaacataccccttaattatttgtggggcgtctttccccccggtaatttttatatagg
TES01_0112_B01.b : gggaaaaccaacccctttattttttttcacggggtttttcccccgggaattttgaaatta
CLNT1_0096_B04.b : atacctttagttaatcctggggtttttccccggtaaatattatcttaggtaaccccttag
OVRT1_0025_C10.b : cctttattttttccctggttttttccgtgtaattgaattaaaggtccccttcggacttct
PST01_0042_A08.b : aactacacttagttttttccggggtttttaccgttaaattgaaaataaggactcttcgga
KDN01_0016_C12.b : cggtacccttacactttaattaatttccgcgggttttttccccgtgaaatttgcaataaa
CLNT1_0022_F10.b : tcacctaaccctttagtttatttcacggggtttttcccccgggaaatttgaaataaaggt
KDN01_0093_D03.b : tacaccaacctttagtttatttcaggggtttttcccgggaaatatgaataaagtaaccct
PST01_0054_E06.b : agtaactaacactttagttaattccgtggtttttaccagtgaaaatgaaattaaggtaac
PST01_0098_A12.b : agtacccctacacttttattatattcagtgggtttttaccccgggaatttgaaaataagg
KDN01_0028_A09.b : gccgtacctaacccttttagttattttcagtggtttttacaccgtggaatatgaaataaa
PST01_0074_D09.b : tggcgtacacaacacttttagtatttttcaggggttttaccccggggaaatttgtattaa
LVR01_0057_C12.b : cttgcatttaccctaaccacttttagtttttatttccgttgggtttttttcccccgttga
OVRT1_0022_A06.b : cactaccctttattatttctcgggtttttcccctggaatatgaataagggaacccttcgg
CLNT1_0066_C04.b : cggggtttttcccctgcaattcttattattggaatccctcccctctctccccatttcgtt
OVRT1_0128_B05.b : gcttttcgattgtgctcatcgtctattttgtccttcccactccctcttgtcctcgagctc
OVRT1_0124_B12.b : tcttcttttttcactatgtggtctcttcctctactattcctcagtttctttctcttcatc
OVRT1_0132_A05.b : ttttccggggttttctcccgggaaaattgaaaaagggggccctctcgcactctccaagag
PST01_0041_H08.b : tattccttttttctccactacggttatttaaccattttctactcaactaccctgcaatta
OVRT1_0001_E06.b : ttccggggttttccccttgaattgtaaatatggaccctttagacttttcccaattgtttt
OVRT1_0004_A04.b : ccctgaagatcaaaataggtcctcttccagatttgcaaaagtttttttctaaatctttct
CLNT1_0041_F04.b : cttattttttttcgtggtttttccccctggaatttgtccttaggttcccttccggacttt
OVRT1_0041_G09.b : tcttattttcatggtttttcacctgggaatttgaaataggggacccttcagaaatttttc
SPLT1_0001_G07.b : gcacactacgacttttatttatattcggtggtttttcaggataaattagaaaatacaggt
OVR01_0043_B12.b : acctttctttttcttgcagactcccctaaacccctttaaacttttttttccaccggcttt
PST01_0064_F10.b : aactaacccttaatattttcagtggtttttacccgggaatatgaataaaggtacccatca
OVRT1_0076_E05.b : ctttaattatttcagggtttttacccgtgaaatagaataaaggtaacccttaaatctttt
OVRT1_0126_H09.b : ctcctttataattcctctcgcggttctgtctcgtctagttgcctctatcgtgcatccttt
CLNT1_0113_G10.b : tttatgcgtgttttttacccttacatttttatttttctttactttaacttaattccccat
CLNT1_0146_A11.b : ttttccggggtttttcccttttttttttcattaagtttccttttctttctacttctgaac
TES01_0101_A03.b : cccatacgcttcttctttttttctgggttttttcaccctggataatatcatttatgtgta
CLNT1_0115_D01.b : cattttttttttcatcgtttttcctcccctgtatatttacattcccgtgattttatcttt
OVRT1_0045_G02.b : agatacaaaaaacttatcattaataccgagggtttttcaatattgaaaatacttaataaa
OVRT1_0082_A12.b : gcagtcaccctaacacttttagttttttttccttggtttttctccccctgtgaatttttt
OVRT1_0098_F02.b : ttgcatgacccaaaccctttcgttttttttcgggggtttttaccccgggaattttttctt
OVRT1_0045_B04.b : tcctttattttattctgtggttttatcccctgtaatcttaattctgggttcacctctccg
OVRT1_0087_B04.b : taatactttttttttttccgggttttctcccccgggaccttaaaatatcggtatactcca
OVRT1_0036_C01.b : ttaattccgggtttttccccgctgaattgaaacaagggttaccctcagaattctccaaaa
OVRT1_0078_B06.b : ttatgtatttttcggggtttttccccgtggaatttaataaaggttccccctcaaattctt
OVRT1_0082_B08.b : attgcattaaaattttattttcttcatggggtttttctcccggtgtatattgaattaggg
LNG01_0034_G12.b : tttccttccgttaccccctaacaccttttaatttttattttcgttgggttttttttcccc
OVRT1_0040_E06.b : taacttttgttttattactggttttttccccggtaaaattgaaataaggttccacctcaa
LNG01_0046_F07.b : aaaccagcctttcttttttcttggccgataaaacctaaaaccctttttagtttttttttt
TCH01_0046_A02.b : ccttacacttttatcttttttcgggggttttttcccgtggaaattttgaaataaagggta
OVRT1_0038_A03.b : acactaaaccttttatttatttcggggttttttccccgggaatatttaatataaggttac
OVRT1_0069_A11.b : caataaactaacccttttattatatctcgtggttttttccccctggaattttgaatttag
OVRT1_0036_C05.b : aactctttagtttattccggggtttttccccggtgaattgaaataaggtaccctttcgaa
TCH01_0028_A06.b : gcatttccctaaccctttttttttattccgaggtttttacccctgaaattatgaacttag
OVRT1_0041_A04.b : cacctaacttttattttaatccagggctttttccccgtggaatttgaataagggttccct
OVRT1_0023_B04.b : taccttttattattttccgggttttcccccggaatttaaattaggtaaccctcggacttt
OVRT1_0042_E01.b : gtacactacccttttattattttcggggttttttccccggaaatttgaataaagggtcac
OVRT1_0036_G06.b : taccctttatttaattcgggggttttccccgtgaaatttgaattaaggtaacctctctga
OVRT1_0035_F07.b : cactaacactttgtttttttccggggtttttaccggtgaaattgaaataaaggaaccctc
OVRT1_0074_C11.b : aattaccctttgattattttccggggtttcttccccggtaatttggaaataagggtaact
OVRT1_0084_H08.b : accctacccttttgtttatttccggggttttgccccgggaatttgtaattagggtaccct
TCH01_0023_B08.b : aacctaacactttagtttaattcatggttttacccgcgggaatttgaaataagggtaccc
TCH01_0039_H04.b : tgcaataaaaaaaactttaagttaaattccaggggttttaccccgggaaaaatgaaatta
TCH01_0087_F04.b : GCCGTACcctacactttagttatattcagtggttttaccccctgaaatttgaaataaggg
TCH01_0011_H03.b : GCAGTACACTAACA*CTTTAGTTAattccgtggttttaccccgtgaaattgaaataaagg
TES01_0070_D01.b : ttggtgttaaaaacaatacattttttttttttttcggggggtttttctcccccgcatttt
OVRT1_0123_G01.b : gtaattttctctgctttctcttgattcatttctcttttatactctcttcttacttcttta
CLNT1_0128_D11.b : ctatctttttatttttttctggggtttttccctttgacatttgtttaaaggggacctctc
TCH01_0093_B10.b : aactttattttatcaaggtttttaacctttaatttaaataaagttatccatcatattact
TCH01_0093_E09.b : cccacccctttatttatttcagtggttttttccctgggattttgaataagggtcccctcc
CLNT1_0074_H09.b : gccgtaccctaaccctttagttattttcgtggttttttaccccgggaaatttgaatttaa
OVRT1_0033_A09.b : gcaataccctaaaacttttattttttttcgggggtttttccccgtggatttggaattaag
TCH01_0085_H10.b : cggtcactaaccctttatttattcggtggttttccccgtgaattatgaataagggtaccc
TCH01_0039_E03.b : gcgttaccctaccctttagttttattcagtggtttttaccccgggaaattttgaataaag
THY01_0040_A10.b : accccccctacccctctctcttcctccatctcaccctcccccccttttttctcttctttc
OVRT1_0106_F03.b : cctctattttccttctaattgttcctcttcttccccctgttgcttttctctccccctttg
OVRT1_0064_E08.b : ctttgtacgctttcctcctaattccttctcttgtctttctgtggtttttctctgactgca
OVRM1_0204_C10.b :
UTR01_0075_C07.b : ataaaaataaaaaattctttttttaatttccgggggtattattaaccatggaataaaaaa
OVRM1_0206_H10.b :
OVRT1_0143_G01.b : atttccctcactcctactttttcttcccgcggtttttacccggagcacttatatttcttg
OVRM1_0154_A10.b :
OVRT1_0141_A10.b : gttgttaatccggggaaattgaaataataggtccctcacgataggttttatttcttgttt
OVRT1_0132_E08.b : ttttttctttaaacatgggtttttccccacgaaatatgatataaggtgcctcttctgtat
OVRT1_0136_B01.b : cttttgcttattccggggtttttccccctgcaatttatacataagggtttcttccagatc
OVRT1_0147_B03.b : tttttccgattgtatttgttataggttaaaattgaattttttcatctctctttttcttta
OVRT1_0143_E01.b : tgctttactctaattctttttatttatatcaatttttttttctccttactctattatata
LNG01_0035_A11.b : attacatccccctcttactttctcttggccctccccctttaaacatctcttgccttctac
LNG01_0080_G12.b : aaattaaaactttcaattatatcaggggtttttacccggttattcccgaagatagtttac
TCH01_0033_G03.b : acctttccccttaatttatattcgggggtttttccccagctcatcttgatttttaggttt
OVRT1_0008_G02.b : tttatttttttacggggtttttcccctgttaattaccaataaggttaccccttcgtcttt
TCH01_0012_C01.b : tttgctgcaaaaaaaaaaaattaattttaaactcaaaggggttttaaacactgaaaaaaa
OVRM1_0059_H02.b :
OVRT1_0028_E11.b : ccatttatttttttcccggggtttttccccggaaaaatttaaattaaggctcccgctccc
CLNT1_0055_E08.b : ttcccggtttttccaccgtacttcgaaaacggccccttcaaatattacataggttttttc
OVRT1_0141_A09.b : ctttgattatttccggggtttttcccgcgggaaaatgaaaaaaggtaacactctggactt
OVRT1_0003_C10.b : tttatttccgtggtttcccccgtgaaaatgtaataaagtgtcccttcacgatcattctta
OVRT1_0147_C10.b : ttcttcaggggtttttacaccggaattcttaaaatgggtttctccttgtgcgtctttcaa
OVRT1_0002_A05.b : taacccttttttattttcctgggtttttccccggggattttcaaataatgttaccattca
SMG01_0092_C12.b : tttttatccggggttttcccccgggaatttgaaataggggtcccctccgacttttcccaa
OVRT1_0054_D09.b : acccttatatttatttcggggggtttttccccgtggaatttgaactaatggaacccttcg
HTMT1_0044_C07.b : taggggtttttccggggaaatagaaataagtgtcccttagaatttcttcaaaagttgttt
CLNT1_0064_G09.b : cacaccttttttttcttcgtggggtttttccccgcgcactttgaatttaggggaaccccc
UTR01_0045_A04.b :
CLNT1_0061_A10.b : ccctttgttatttttccggggttttccccgtggaattttgaataaaggtgaccctccggg
OVRT1_0085_E08.b : accatcctttaagttgtggggggcggtttcccccggcaattttgaattagggtaaccttt
LNG01_0042_H03.b : tggcagtacacctaaacccttttaatttaattttccctgggttttttttccccaggggga
CLNT1_0064_F02.b : ccctaaccctttagtttttttcacgggtttttccccggggatattgtgaataagggtccc
OVRT1_0042_D12.b : gctgtcacctaaccctttaatttaattcccggggtttttcccccgtgaaattataaaaat
CLNT1_0096_D04.b : tacactacccctttatttatttccgggggttttctcccttgcaattttaaataaggttac
OVRT1_0058_D02.b : ccctttaattatttccgggttttttccccgggaatttgcattaaggtaacccctctcgat
LNG01_0035_H02.b : tttttcctggcattaacccctaacccccttttaatttttttttttctcgttgggtttttt
OVRT1_0073_E02.b : ctacatttttttttttattcggggtttttcccggggaatttgcaatactgtgtcccctcc
OVRT1_0073_A09.b : cctcccgttttttttatttcggggtttttacacgcgaatttaaaaaaaggaacccttcga
MLN01_0069_C05.b : acacttatttaaatcatggtttttaccgtgaaaataaataagggaaccatcaaaacttct
LNG01_0034_F12.b : ttttttcttggcagttacacctaaacactttttaatttttattttcccgtggggtttttt
OVRT1_0043_F11.b : gaacctaaccttttagttaattcgggggtttttcaccgggaaatttggaaataaggtaac
CLNT1_0051_H02.b : cttaccctttatttatttccggggttttacccgcggaaattgaattaaggtaacccttca
OVRT1_0035_E03.b : tacccttttttttattccgggttttttcccgtggatatgaattagggtccccttcagact
TCH01_0037_B04.b : aacactttatttaattccgtggttttacacagtgaatatgaattaaggtaaccatcaaaa
LNG01_0091_D10.b : taaccctttatttttttcctggtttttccccgggaaattgaatataagttaccctctaaa
UTR01_0043_B07.b : tcttgccgttacccctaacccctttttattttttttttcagtgggttttttttccccccg
UTR01_0060_D01.b : tcctggccgataccctaaaccttttattttattttccattgggtttttttaccagtggaa
MLN01_0101_H05.b : acactaaccctttaggttttttccgtgggtttttccccgtgaaatttaaaataaagttaa
CLNT1_0066_E04.b : acctaacctttagtttattcggggtttttaccccggaaaattgattaaggtaacctttga
OVRT1_0048_F02.b : gccttacccttacccttttatttttttccgggggtttttcccccgggaatttggaataag
CLNT1_0064_E03.b : gggtaccctaacactttattttatttccggggtttttcccccgggaattttgaattaagg
OVRT1_0031_H01.b : aatacactaaccctttagttttttccggtggttttacccggggaaattgaaattaaggta
CLNT1_0014_A11.b : ccataacctaacccctttaatttttttccgggggtttttttccccgggaaatttggaatt
UTR01_0052_H06.b : tgccgttaccttaactcctttattttaatttcagtggttttttaccccggtgaaaatttg
CLNT1_0074_E03.b : tacactacccttttgttttattcggtggtttttcacgggggaattgaaataagggaccct
CLNT1_0064_B01.b : gtaccctaacccttagnttttttccgggttttttccccggggaattggaaataagggtac
CLNT1_0062_A10.b : catacccttaccctttagtttttttccggggttttttcccggggaatttgaattagaggt
LNG01_0028_F08.b : atgccgtacactaacccctttaatttttttttccggggtttttttccccccgtggaaaat
CLNT1_0007_E05.b : gcgtaacctaaccctttaatttaattccgggggtttttccccatggaattgggattaaag
OVRT1_0022_E11.b : gcagaaactaacccttttgtatatttcagggtttttaccccgggaaattggaattaaggt
LNG01_0002_H02.b : atgcagtaacactaacccttttatttatttttcagtggttttttaccccgttgaaaaaat
TCH01_0027_F05.b : tgcgtacctaaccctttatttatattcggtggttttttcccgtgaattttaaataaaggt
PST01_0044_E03.b : ttgagttttttctcaatccgttgactttatccctgtagttttcatccgttagttcctcat
OVRT1_0005_G05.b : taagcattttttcccgcttctcttggggtggccaacccccaatgttttaacggtcggacc
KDN01_0005_A09.b : cggtacctaaccccttaatttaattccgtggtttttacccgggaaatttgaaataaggga
KDN01_0096_D09.b : gcggtaccttacccttttttttatattccggggtttttcccagtgaaatatgaaataaag
KDN01_0091_A05.b : cggtaccctaacctttagttttatccgcggttttttacccggggaatttgaaataagggt
TES01_0056_A11.b : cacattcttcaattctttgtgttttccgggggtttctcccaatggtatatttctctttgg
OVRT1_0123_D02.b : tttatctttctttttctccctattttcatcctcttatcttcctctcctttcatcttacca
OVRT1_0100_F07.b : tcttatctcctggcttctccccccctacttgaacctatggtaccctttaatccattccct
TES01_0059_H04.b : aacctctaccctttgagtttatttcgggggtttttccaccgggaattttgaaataagggg
PST01_0072_A08.b : GCAGgtcccttaacccttaattgtattcaggggtttttacccggtgaatttgaaattaag
PST01_0099_B11.b : GCAGTACACTAACA*CTTTtattttattccgagggtttttacccagtgaaatttggaatt
OVRT1_0120_H01.b : ttttatttcgttgcttttcacagcggcatttgtaaattcatggcactctctagttacttt
OVRT1_0093_E08.b : caaccctttattttattcaagggttttacctctgaaaatttaaataaaggatcccataaa
OVRT1_0019_D07.b : ccacctttaattttttcaggggttttaccccgggaattggaataaaggaaaccctcggac
CLNT1_0150_E07.b : tcataattatgtccatggtatcctcacccttaaattctatattatatatgttgccaaaat
OVRT1_0100_A06.b : caaacctttacttttttctccgggtttttcccccggcaaattgtaattaaggttaccctt
OVRT1_0072_D05.b : gttttttcctcgttttccccccgaatttgaatgaagtttcgtttcagcttttatataatc
OVR01_0090_D11.b : tcccgtcactacactaaacccttttaagttaaattccaaggggttttttcccccgtggaa
ILNT1_0020_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxtatgcggtattttttttttttttttttttttttttt
ILNT1_0056_D06.b : ta
SKNB1_0013_E01.b :
---------+---------+---------+---------+---------+---------+ 1206
CLNT1_0151_F03.b : tgctaaagactgcctctcaagcaaaaaatagaccttatctctaaggagatattctcttcg
TES01_0020_A03.b : ctattttacaagcctgctttctcctaattcagcttttccggagactaatatttatatgcc
OVRT1_0100_C01.b : actaaactttttgtcacataaatctggctttttgtgaacaattatttatgagtctttttt
TES01_0001_D08.b : aattcaaagtgtaccccttcttaactattcccctataccttttttttccaagaaaacccg
OVRT1_0044_E01.b : ttctcatagtcctttttctagaaagctgcttcttcttgatacacgaccttatggtttttc
TES01_0040_A03.b : cctctgtaatcttccaccaaatctgttttttttaataatctccctttctggaaccaatca
OVRT1_0149_B12.b : gtgtcgcctttcgtattctccctctacctgtgtttttccaaaaaactctcttttcctcac
TES01_0112_B01.b : agggttacccctctgaaacttctccaaaagactgtttttttacaaaaacccttggttttt
CLNT1_0096_B04.b : acctttttcacaagctgttttttcaaaatccgtttttttgaaacaaacactaaagtgttt
OVRT1_0025_C10.b : cccaaatcttttttacgaaatctttcttattaaaaaaaaaataaattttttttcccaatc
PST01_0042_A08.b : ctttttacaagttgtttttctatatacggctttctgaacaaaacaatgaagggtttttcc
KDN01_0016_C12.b : gggtaccccttcaggcatattcttcaaagctgtgatttccgaaaaacatggcttttctgg
CLNT1_0022_F10.b : aacactctcgacctttcctccaaggtggtttttccaaaaacctggcttttctctgaacaa
KDN01_0093_D03.b : ccggacttttacaaaactgtatttaaagaaagctgtttttctggaacaaaaaataaaagg
PST01_0054_E06.b : catccagacatcttcaaagctgtttttacgaaagcttgcttacttgaaacaaacaataaa
PST01_0098_A12.b : tacccctcccggatattttcaaaacctgttttttccaaaaaactggcttttcttgaacaa
KDN01_0028_A09.b : ggtaacccatcaagactttctccaaagcttgttttaagaaaagcctgcttatcttgaacc
PST01_0074_D09.b : gggtacccctctagactttcctcaaaaccttattttccgataaccttgcttttcctgaaa
LVR01_0057_C12.b : aaatattaaaattaaaagggtaaaccacattcaaagacctatttctacaaaaaaacctgt
OVRT1_0022_A06.b : actttccccaagctgttattaaaaaacctggctttctgaaaaaaaaaaaaaatgtttttc
KDN01_0079_F03.b : gtgacatctccaaacttctacaaaggctgtttttacgaaaacctggccttctgaaacaaa
PST01_0039_F12.b : AGGTAACccttcagactatctacaaaagctgttttacagaaaagcttgcttttcttggaa
KDN01_0080_C12.b : AGGTTACACttcagactatcttcaaagcttgtttttccgaagaacctgccttttctggaa
CLNT1_0066_C04.b : tttcgacaccctggtttcttggaataaaacataaatggtttttccccctaacggtatttt
OVRT1_0128_B05.b : gcccctcctccctttcactttctcctttctttccccttctctttcttcgcttattattat
OVRT1_0124_B12.b : atccttttcatacttcttttttttacccctttttcttcctcttattcaatctctgatttt
OVRT1_0132_A05.b : tgtttttccgaaacctgccttctgtaaacaaaaaataactgttttttccaaacagatttt
PST01_0041_H08.b : ttttctataaatcgctcttattttaccataccacatggttgtttatctctagccaatatt
OVRT1_0001_E06.b : tcgaatactgtctttcgaaaccatatataattctttttacaatagaatacttctcaataa
OVRT1_0004_A04.b : actggaacaataataatttcttttctcctaaataaaaagaacttgtctctatttagtccc
CLNT1_0041_F04.b : tccaaggctttttttcaaaaagatgcgttctctgtacaaagcattaacaggtttttccca
OVRT1_0041_G09.b : acaactgttttttcaatataaggtcttttttaaaagaaataaaaaagtgttttccccaat
SPLT1_0001_G07.b : aaccatttggattctttgacaagtcgttttttagggaaaacctccgtatttgaacctaaa
OVR01_0043_B12.b : tttttacccccctctgtcaaaattttcaaaaaatcaaacgggttacccccttttcccaaa
PST01_0064_F10.b : agactacctcaaagccggatttccaaaaagctggttatctgaaacaaacaaaaaaatgct
OVRT1_0076_E05.b : acaaaatttttttacaaaaaacctgtttccgtaaaaaacaaataaattgtttttcccaaa
OVRT1_0126_H09.b : ttttcctccgtttcctgcttcaccatttaagatatctctcttcccctctcttaattgctt
CLNT1_0113_G10.b : tcctttttcttgagcccgtctttttatgtcttctcacttcctgtttttctccattgtttc
CLNT1_0146_A11.b : cattttttcaatttgctcgttcttctgataattacaaattaaattcttttttcccatcat
TES01_0101_A03.b : cattcttctgttttttttcatagttctttttttttttaaaaacgcttctttttccgcatt
CLNT1_0115_D01.b : ctcttattattcttctctctctctcttatgttctctctccctatttaccacttgctagtt
OVRT1_0045_G02.b : tatgtaagcattaagtaacattataaaaatatatttttaattataaaaggtcggttaacc
OVRT1_0082_A12.b : atctatggggttaccccttctcaaatttttttccaaaatctttttttttcttagaaacct
OVRT1_0098_F02.b : taaggtttccccctcaggcctttctctatagcctgttttttcagaaaagcttgtttttct
OVRT1_0045_B04.b : aaccttgcccaaagcgtgattcgccaaaatgccttgttttctttatctcactctctctaa
OVRT1_0087_B04.b : gcttttttacagtgtttttttgtcgaaaactttttttcttgagcatatataaaatgcttt
OVRT1_0036_C01.b : ctgttttctcgaaagctgctttacataaacaaataataaaggtttttccacagataactt
OVRT1_0078_B06.b : cataaactgtttttccaaaaacctgcttctttttacaaaaaaaaaatgcgtttctcccaa
OVRT1_0082_B08.b : ttcctcttcactatattctttacagttgttttttttaaaaaaatggtttttcttgataat
LNG01_0034_G12.b : agggggaaaattttgaaaaattaaaagggttaaaccccctttccaaaaaaacctttttct
OVRT1_0040_E06.b : gactcttacaaagctgttttttctaaagcctggttttctggaaacaaaaaaaaaatgttt
LNG01_0046_F07.b : tcgggggggttttttttcaccccggggggaaaaaattttaaaaaaaaaaaaggggggaaa
TCH01_0046_A02.b : accctccagtactttttccaaagggtttttttcgcaaaaacttgccttctcttggaccca
OVRT1_0038_A03.b : cctcaaacctttcttcaaagttgtttttcaaaaatactggttttcttgaaaaacaaataa
OVRT1_0069_A11.b : ggtgacatctctcgacttttctccaaagctttttttccaaaaaaccttctttttctaaaa
OVRT1_0036_C05.b : cttttttaaaagcgtttttccaaaaacctgttttccttaacaaaacaaataaaggttttt
TCH01_0028_A06.b : aggaaccactacagccattctctatatcttgttattactgcacaagctgcttttcctgta
OVRT1_0041_A04.b : tcggacttctccaaattgttttttcacaaaacttgcttttgtgaaaaaaaaaataatgct
OVRT1_0023_B04.b : ttcaaagttttttacgaaaacctccttctgaaaaaaaaaataaatgttttctcccaaaaa
OVRT1_0042_E01.b : ctccaaactttttccaaatctgttttttagaaaccctgttttctgaaacaaaaaaaaaat
OVRT1_0036_G06.b : ctttcccaaagctgtatttccaaaacctgttttcttgacacaaaaaatattgtttttttc
OVRT1_0035_F07.b : aaaaatttctacaagtgttttttccaaaaacttgttatttggaacaaaaaataaaaggtt
OVRT1_0074_C11.b : ttccaacttatttccaaagcttttttttagaaaacttgtcttttttgaaacaaaccaaaa
OVRT1_0084_H08.b : ttaggctattttacaagcttttttttactaaaaccttgcttttttgaaacaaaaataata
TCH01_0023_B08.b : ccaggattttctccaaacctgtatttccgaaaacctgctttcttgaaacaaaccaatata
TCH01_0039_H04.b : aggtaacacctctaggactttctacaaaaggcttaattaacgaaaaaccaggcttactcc
TCH01_0087_F04.b : tacccattcagactttccccaaggctgttttcccgaaaagctgcttatctgaaacaaacc
TCH01_0011_H03.b : gtaccctccagactatctacaaagctgtattttcagaaagcctgcttttcctgaaacaaa
LNG01_0103_C05.b : gtaacactcagaactactacaaagctgtattaccgaaaacttgctatctgaaacaaacaa
TES01_0070_D01.b : tttaaattatgggcaacctttcgggaccttcttaaaattctttttttttaaaaaagaagt
OVRT1_0123_G01.b : cttcttcctttttatttacactttctatctcctctataactctttattgttctttccctg
CLNT1_0128_D11.b : cacactgctccaaattcttgttttactaaaatacgctttttccgcaacctaaaaaataaa
TCH01_0093_B10.b : tcaaaagttgtttttaaaaaactgctttttgaaaaaaactataatattttttttcattat
TCH01_0093_E09.b : gacttcttccaaggctgtttttacaaaagctggctttctgtaacaacacaataaagcttt
CLNT1_0074_H09.b : gggaacccttcaagattttctcaaaagcgtgttttccagaaaaccttgcttttcttgaaa
OVRT1_0033_A09.b : ggtaccctttcagcttttttcaaagtttgtttttcgaaaaagctggttttctgtaaaaaa
TCH01_0085_H10.b : ctcagcacttctccaaagctgttttttcgaaaagctggctttctggaacaaacaataaag
TCH01_0039_E03.b : ttacccttccagactttctccaaagcttgtatttacggaaaacctgcctttcctggaaca
LNG01_0098_D07.b : AGGTAcacatccagactatctacaaagctgtattacggaaagcctgcttatctggaacaa
THY01_0040_A10.b : tactccaacccacctaccccccctcttcttacttcttacttacttccctccgccgtgtcc
OVRT1_0106_F03.b : acgactatctcgttttctctgtttctctcattcgccccttactctgtatatctttctttt
OVRT1_0064_E08.b : ttctttaaattattctaccctcttaggttatctcctctccatttgctttttttcctatca
OVRM1_0204_C10.b :
UTR01_0075_C07.b : aaataaaaaagagctaacccactctacatgtctctatccacaacaaccacctgcaatttt
OVRM1_0206_H10.b :
OVRT1_0143_G01.b : gaccttcctcctcctcttctcccatgttctttttcttagacactccactctcctttgtct
OVRM1_0154_A10.b :
OVRT1_0141_A10.b : tatcaaaaccctcttcttcgtataaacaaataaataacttttttctataaaacaaaaaaa
OVRT1_0132_E08.b : actttccattcttgttttattgcaactctgtgtttttataacacaaccctataagtcttt
OVRT1_0136_B01.b : cccttaacatcttgtttttcaaaatcctgcttttttataacaataattcaactgcctttt
OVRT1_0147_B03.b : atgtcttttatggcacttaattttggttctttctcattgatgaattttttttattaataa
OVRT1_0143_E01.b : ctcgtatcactcacaaaacattctcacttcatttcttccaaatcaatcatttacctcaat
LNG01_0035_A11.b : ttctttcttggttttttttccccccccctgtcacaattctttaaaaaatcatacagccgc
LNG01_0080_G12.b : cctccaaccctttttggaaagtctttcttctaaaacagtctttttttttaaaaataacaa
TCH01_0033_G03.b : catctaaccctttctccctaacctgttttccccaaaacccggtgtttttggaaaacaaca
OVRT1_0008_G02.b : cccctatagcttttttccgatacccttgctttcttgttaataccactaaaatgcttcttc
TCH01_0012_C01.b : aaaattaacgtaatctacacataacaaatttacaaaattgatatttttcaaaaaaaactg
OVRM1_0059_H02.b :
OVRT1_0028_E11.b : tactttccccgaaagctgttttccccaaatcctgtttttttggaaaaaaaaaacataatg
CLNT1_0055_E08.b : gcaaacgtgctttcctgaccacacatttatgtttttcccataactttttttcttatccta
OVRT1_0141_A09.b : cttcccaaggctttttttcaaaaaactgcgttttatttaaaaaaaaaaaaaggtgttttt
OVRT1_0003_C10.b : aatctttttttaccgaaatctgcttttttgaaacaaaaaaaaaatgctttttctcctcct
OVRT1_0147_C10.b : agctgtttttttaaaaccctgttctccgtaaacatataaacaatgtgttttttcacataa
OVRT1_0002_A05.b : gacattccccacagcttgttttaacaaaacctgctttttctgaaacaaatcagaaatcgt
SMG01_0092_C12.b : aggtttttttcgaaaaagtgttttttttaaaaaaaaaaaaaaaggttttttccaaaaaaa
OVRT1_0054_D09.b : gactttttccaaactttttttttcaatagggtgtttttcatgaaaccaacgattaaagct
HTMT1_0044_C07.b : tcaaaaaaatggttttatgaaacaaaaaaaaaaggtttttccccttttctaaaccataat
CLNT1_0064_G09.b : cccgccttttctacaaagtctgttttccccaaaagctgttttttcttcaacccaccaaag
UTR01_0045_A04.b :
CLNT1_0061_A10.b : actttctccaaagcttgttttcctgaaaacctgccttttctgaaacaaacaaataaaggc
OVRT1_0085_E08.b : tggcttatctcatgggttttttcaaaaaagttgtttacttgaaccacacataaaatgttt
LNG01_0042_H03.b : aaaaaatgaaaaaaaaaagggtaaccccaacttcaaaaacttttcttccaaaaaaagcct
CLNT1_0064_F02.b : ctcgagactttcctacaaagctgttttccggaaaagcgggtttctttgaacaaacaaaaa
OVRT1_0042_D12.b : aaagtaaccctcccaaaatttcttcaaaagctttttttttcaaaaaaccttgcttttttg
CLNT1_0096_D04.b : ccctccggccttcttccaaggtgttttttctgaaaccctgttttctttgaacaaacaaac
OVRT1_0058_D02.b : ttctttcaacctttttttctgaaaacctggttttcttgaacaaaaaaataagtctttttt
LNG01_0035_H02.b : tttccccccggtggaaaaattatttaaaaaaataaaaaggggttaaaacccccccttccc
OVRT1_0073_E02.b : cgactttttcaaaattgtttttcccaaaaacttttttttcggaaaaaaacaataaagctt
OVRT1_0073_A09.b : catttttcaatccggttttcaaaaagctgcttttttgaaccaaccattaagtgttttctc
MLN01_0069_C05.b : aaaaagctgttttacaaaaacctgcttatttgaaaaaaaattaatgctttttctaaaaaa
LNG01_0034_F12.b : tttccacccagttggaaaattattgaaaaattaaaaggggttaaaacccccctctccaaa
OVRT1_0043_F11.b : tcttccagacttctctccaagcttgtttttcagaaaactttgtttcttgaaacaacaaat
CLNT1_0051_H02.b : gacttcttcaaagcttgttttcagaaaaccggtttacctgaaccaaaaataaaaggtttt
OVRT1_0035_E03.b : tccccaagcttgatttacaaaatctgctttctttaacaaacaaaaaagtttttttccaat
TCH01_0037_B04.b : catctacaaaactgtttttcagaaaacatgctttcataaacaaacaaaaaaaagcttttt
LNG01_0091_D10.b : ctttttccaaactttttttacaaaaacttgcttatctttaanaaacaattaaagcttttt
UTR01_0043_B07.b : ggggaaatttttaaaaataaaaggggtaaaccccccctccaaacaacctttttttttccc
UTR01_0060_D01.b : attttgaaataaaagggtaacccatttcaagacttattcttccaaaaagcctgttttttt
MLN01_0101_H05.b : ccctctcagactttcttcaaaagctttatttaccaaatacctgccttttctggaaccaaa
CLNT1_0066_E04.b : actattccaaagctgttttttcgaaaaactgctttctggaaccaactataaaggcgtttc
OVRT1_0048_F02.b : ggtaacccttcccgactttctccaaagcctgttttacagaaaagctggctttccttgaaa
CLNT1_0064_E03.b : gataccctctcagactttctcccaagctgtttttaccgaaaaccttgcttttctggaacc
OVRT1_0031_H01.b : cccctccagacttcctcaaaagctgtttttatcaaaaaccttccttttcctgaaacaaaa
CLNT1_0014_A11.b : aagggtaacacttccggaatttttctccaaaagctgttttttcccaaaaaacttgccttt
UTR01_0052_H06.b : aaaaaaaaggtaaaccctttcaaaaaatttttctccaaaaaaccttgtttttttcaaaaa
CLNT1_0074_E03.b : tccngactttctccaaagctgtttttccgaaacctggtttctctgaacaaccaaaaaaag
CLNT1_0064_B01.b : ccttccgaccttcttcaaagctgtttttcacaaaaccctgctttcttggaacaaacaaat
CLNT1_0062_A10.b : accccctcggactttcttcaaaagcgttttttcccgaaagactggcttttcttaaaaaaa
LNG01_0028_F08.b : tttgaaaaaaaagggtaaacccattccaaaaaacatttttttcacaaaaaacctgtttat
CLNT1_0007_E05.b : ggtccccttcagacttttctcaaaggttgtgtttcagaaaagctggttttctggaacaaa
OVRT1_0022_E11.b : aaccccttagaactttttcaaaaccttttttatcgaaaagcttggttttcctgaaccaaa
LNG01_0002_H02.b : gaaaaataaaagggtaaacacattcaaaaaacttttccttacaaaaaagcc
TCH01_0027_F05.b : tacccttcaggactttctccaaagctgtttttcagaaaagcttgctttcttgaacaaacc
ITT01_0012_E04.b : gtaccctctcgactttccccaaaccgtttttcggaaaacctgctttactgaaaaaacaaa
PST01_0044_E03.b : tttatttactatcttatgtagttttccttctactgtttcggctatgatgactccgtatgt
OVRT1_0005_G05.b : ccggaacaaacaaaatattttcttccttccgccaaaatacctccccggatctccgccgga
KDN01_0005_A09.b : accctccagactttctcaaagcctgttttccgaaaagctggctttcctgaaacaaacaaa
KDN01_0096_D09.b : gtaacctttcagacctatcctcaaagctggatttaaaaaaaacctgtttttctgaaaaaa
KDN01_0091_A05.b : accctccagacttatctcaaaaccggattttcacaaaccaggcttatcagaaacaaaaaa
PST01_0042_G06.b : gggtaaacattcggatatttaacatatttgatttccgtaaaacctgggttttcgttaaca
KDN01_0012_B08.b : AGGTAACccttcagaattttttctaaagctggtcttaccgaaaagcatgcttatcctgaa
TES01_0056_A11.b : ggctacttctccaggccttttttcgctaacttggtttttttttaaaactctccccttctg
OVRT1_0123_D02.b : tcttgtgctttctccattctttctctcttttaaactagtcccctctattttttttctcct
OVRT1_0100_F07.b : caaccggtttttcctgaaggatgcttttcttgtaactcccattatacggctttttcccct
TES01_0059_H04.b : aacacccccgactttttctcaaacgtttattttccaaaaagccgtctttttcttaaaaaa
PST01_0072_A08.b : gtaacccttctagacattctccaaaggcggttttacggaaaacttgcctttctttaaaac
PST01_0099_B11.b : aaggtaacccttccagaactttcttcaaaagctgttttttcagaaaaacctggcttttct
OVRT1_0120_H01.b : catcagctttttttcattaaacctgcttatcctccaaccaattttaattttgctttttcc
OVRT1_0093_E08.b : atttctcctatacctttttaagaaattctccttaattaaaaaaaaaaaaaatggttatcc
OVRT1_0019_D07.b : tttttcaaaactgtttttcagaaaacttgcttttttaaaaaaaaaaaaaatgttttttcc
CLNT1_0150_E07.b : tttctaacatccttttttactcaatctctttttttttaaataaactactatctcttttac
OVRT1_0100_A06.b : ccctgacatttttaaatggttgtttttccaaaaccctgtcttttctgaaaacaaacaatt
OVRT1_0072_D05.b : tgttttcggaaatccttttttctgtctctaacaaaaatctttttctccacgctttttttc
OVR01_0090_D11.b : ataatgaatatacaagggtaaaaactttcttaaaaatttttacacacaacctttttattt
SKNB1_0013_E01.b :
---------+---------+---------+---------+---------+---------+ 1265
CLNT1_0151_F03.b : ttgatacacgattattgatgtctaaacgcgcctcgctcatcatggacaaccacctattct
TES01_0020_A03.b : tttctctaaccttcttattttctcctttacaaaaattaaatcgttccctttttcctttct
OVRT1_0100_C01.b : tctcacattgtttttttctttcttttaaaaagaacattaagggcccttgtcgctctgtct
TES01_0001_D08.b : cctttatctttatatacaatactatttgatattgtttttttcttctaaaaataaatcaat
OVRT1_0044_E01.b : tctccctacccttttttatatattaatataaaaaatatcggccctcttctccctttctgt
TES01_0040_A03.b : cattaatggcttttcttcctctttattatactgaatttcattttttatatgtggttcttt
OVRT1_0149_B12.b : ataaaatacaattaattggctttttttctcaacatagactttattttctttatataaaaa
TES01_0112_B01.b : ttgtgaaccaaacaaaaaaaaagggcttttttccccaaaaaaaaaaaaaaaataataagg
CLNT1_0096_B04.b : tctccctaagtgttttttttattataaacaaaaaaagggcccttgttttattcgggctgg
OVRT1_0025_C10.b : cgtcttttttttttttaaaaaacaaaaagatcccttgtgccccatctcgtcggcccccat
PST01_0042_A08.b : caaatggtacttttcttatttaaaaaaaaatataggccattgactaaattctaaatccct
KDN01_0016_C12.b : gaaccaaccaaataaaattgctttttctcccaatccagtacatttctcttaattaaaaaa
CLNT1_0022_F10.b : caaaataaatgccttctctcaaaatgagaaactttctcttttttaaaaataaaaaaaggg
KDN01_0093_D03.b : ctttttctcccaaccgtccattttcttattaaaaaaaaaaaataaggcccatgtgtccta
PST01_0054_E06.b : tgttttttccaaaaaaaaaaaataaaaggcccttggctccatctgatgtccggcgcctaa
PST01_0098_A12.b : aacaataaaaagcgttttttccaaaaacagtaacttttttttttttaaaaaaaaaaaaaa
KDN01_0028_A09.b : aaacaaataaatgctttttctcccaatccgtccttttccttaattacaaaaaaaaaaaag
PST01_0074_D09.b : caaacaaataaatgcttttttctcccaaaaaaaaataaaaaaaaaaaggcccttgggccc
LVR01_0057_C12.b : tttttttttacaaaaaaaaaccctttcctttttttc
OVRT1_0022_A06.b : cccaacacgtattttctttattaaaaaaaaaaaggcccttgtttcaaactgggtccgccc
KDN01_0079_F03.b : caaaaaaatggtttttctcccaaaaaaaaaaaataaggcccttgtgcctcacttgcggtt
PST01_0039_F12.b : caaaccaataaaatgcttttttccccataccgtcctttttctttatttaaaaaaaaaaaa
KDN01_0080_C12.b : acaaaccaataaaaggcttttctcccgnnggaagaaaaacactaaatatacacgaaccct
PST01_0080_F02.b : aaaaacaaaaaaatgggtttttctcccaaaaaaaaaaaaaaagccacttgggctccaact
KDN01_0028_B03.b : caaacaattaaatgcttttcctcacaaaaaaaaaaaaaggcccatgtgctcaactgcagg
KDN01_0008_C02.b : caaacaaataaatgctttttccccacaaaaaaaaaaaaaaggccatgggctcagctgagg
CLNT1_0066_C04.b : ttttttttataaataaaaatcgccctgtttcacttttccgtcctgcctctctttttctta
OVRT1_0128_B05.b : acacgcccttttctctcttcgttccccccttttttccaccaacatccttctcttgtgtct
OVRT1_0124_B12.b : tttttctctacactacctctctatttctatttaacataaattttttccacttttttctat
OVRT1_0132_A05.b : tttttttttaataaaaaaggcgccttgtttccttcggggggggccccactttttataaaa
PST01_0041_H08.b : ttttaaaaatctaactatatgccttcttatactcatttttactcacattattctgtgcat
OVRT1_0001_E06.b : aaaaaaaaaatgctctgctcactttgggtgtgcctattatttgaaatatcccaccccccg
OVRT1_0004_A04.b : ctccaataaactaaaaaaatccccccccccctctaacacaaggtgccttgtttgattcag
CLNT1_0041_F04.b : ttaagttttttttcttatttataagaaacaaaacgccttggtctcccttcgggcgcggcc
OVRT1_0041_G09.b : actaattttaattaaaaaaaaaaaaaaaggccaaatcttcaattctgtctgcgccctaaa
SPLT1_0001_G07.b : caaataattgtttttcttcccggtagagatatagttagaaaattatatcgatcttatatt
OVR01_0043_B12.b : aacctttttttcattcacaaaaacccttt
PST01_0064_F10.b : ttttcccccatcggtcatttccttaattaaaaaaaaaaaaaggcccatgtgtccaatgag
OVRT1_0076_E05.b : attaattttttatttaaacataaaaaaaggccctgttctatcttagtcgccgccaataat
OVRT1_0126_H09.b : attccccgatcttcatctttctttttacgccatatctcttcttcattgtccgccctacta
CLNT1_0113_G10.b : ctttctatcattattacttcaactgtctcccgtgtttcctactttctgctccctactatt
CLNT1_0146_A11.b : aaatttttcttatcatatgaaaactaaactccttttctccctacttttacccgcccatct
TES01_0101_A03.b : atatccatataaggttctttttccccttattatttactcataactttatcgtcgcttttt
CLNT1_0115_D01.b : gttccccccttatcgtcttattttacttaactattatccttttaccttcctctatccgca
OVRT1_0045_G02.b : ttgatataaaaaaaatttcatgctctttctctaccaaataattctcattataatatactc
OVRT1_0082_A12.b : ttgtctttttcttgttaacacgtacccaattacaggtccttttttctacaattcctattc
OVRT1_0098_F02.b : tggaacaaaaaacattaaaggttctttctccaccatcgggatttttttctttttttaaaa
OVRT1_0045_B04.b : ggtcttttctccatactaactcctttttttttattcaaaaaataaaattatggttacgtg
OVRT1_0087_B04.b : tccctctacgtcattttcttatttaagaacaacaatatgccatgtctcttctcacaccct
OVRT1_0036_C01.b : ttttttattataaaaaaaaaaaaagccatgttctcctcctgtttgcccgcctaaatatta
OVRT1_0078_B06.b : actatattccttttataaaaaaaaaaaggtcctgttctccctctcggtcgcccctaaaaa
OVRT1_0082_B08.b : atcaattaatgttttttccacaatccgtccgttttctattttttacaaaaaaaataatgc
LNG01_0034_G12.b : ttcccaaaaaaagccctgttttttttttttttcccagaaaaaaaaaaaccccattgggcc
OVRT1_0040_E06.b : ttcttcaaacaagatcttttttttaataaataaaaaaaaaaggcctttggtcctgactga
LNG01_0046_F07.b : aacacctttccaggaacaactacttttttctcaaaaaaaaagccccttggtttatttttt
TCH01_0046_A02.b : cacaataaaatggctttttctccaccaacaggcacttttctcttattataaaaaaaataa
OVRT1_0038_A03.b : agtggttttcccccatagctcctttttcttttttaaaaaaagaaaaaggtcccgtgtttc
OVRT1_0069_A11.b : ccaaaccaataatgtcttttttccctanaccgagttcttcttctcactataaaaacaaat
OVRT1_0036_C05.b : cccaaaaattctttttcttaataaaaaaaaaaaatggccctctttttccccttaggccgg
TCH01_0028_A06.b : acaaaaactaatctatgctcttttctcccaacaaaaactaaattaagctccacttgtcct
OVRT1_0041_A04.b : ttttccctccaaacacctttaaaaaaaaatatatttaattgcccctggtccatttccggg
OVRT1_0023_B04.b : aaaaaaaaaaaaaaaaanangnaannnnnnnnanggggcgcccgcaggaagggggggggn
OVRT1_0042_E01.b : tgttttttctccaacagataatttttttttattaaaaaaaaaaaaaaagggccctttcct
OVRT1_0036_G06.b : caaaaaaaaaaaaaaggcccttgtttcacctgggtccggcccctaaaattttgtaaaaac
OVRT1_0035_F07.b : tttcccaaatagtactttttttatttaaaaaaaaaaaagcccttttctccattgaggccg
OVRT1_0074_C11.b : aaggctttttctccaaaacaattttttttattttaaaaaaaaaaaagaggccagggctca
OVRT1_0084_H08.b : aatgttttcccccatacctccctttcttttttaaaaaaaataaaagcccttttttctctt
TCH01_0023_B08.b : tcttttttctcccnnggaaaaaaaaaaacaagccacactatagggagaaaaaacaaaaaa
TCH01_0039_H04.b : tgaaacaaaacaaataaaatgcctttttccaaccananaacacacacaatcttaaaaagg
TCH01_0087_F04.b : ataaaggctttttctccacaaatnnncctccggaacccctttagtgcaaccatcctttcc
TCH01_0011_H03.b : ccaattaattgcttttcctccaaaaaaaaaaaaaagggcactttgtccaactgtaggtcc
LNG01_0103_C05.b : aaaagcttttctcaaaaagtaattttcttattaaaaaaaaaaggcctgggtcaactgagg
TES01_0070_D01.b : tcttttttttatcacacaaattatggttttttttctctaaataaaataaaaaagtgctct
OVRT1_0123_G01.b : tatatttattttaatctcttactttttcacctctttctgtcatctcttcatcccttccat
CLNT1_0128_D11.b : tttttttccccatcactcacttctctttattataaaaaccacacgccctcgtttctcttt
TCH01_0093_B10.b : aaaaaaanataatactcttttatactctaatctctgccttataatatctctagagacaaa
TCH01_0093_E09.b : tctccctataaaaataaaaaaaaggccttgtttcttatcctggtccgccgccttatttcc
CLNT1_0074_H09.b : caaacaaaataaatgctttttttcccaaatcagttatttttcttattttaaaaaaaaaaa
OVRT1_0033_A09.b : acaattaaaagtttttttcccccaaaaaaaaaaaaaaaggcccattttgtctcattccgg
TCH01_0085_H10.b : tgtttttctcccaaaaaaaaaaaaaggccctttgctccacttcgggtcggcccctctaat
TCH01_0039_E03.b : aacacatataatgcttttttccccaaaaaaaaaaaaaaaaaaagggccctggtgtcagac
LNG01_0098_D07.b : aacaataaatgctttttccccatacaatattttccttaattaaaaaaaaaaaaggcccat
THY01_0040_A10.b : tttcttccctctcacgcttcacgtctcatcttttgactcacaccctatcaaccggccgat
OVRT1_0106_F03.b : tgtttccctccattttccttacctcccctctttatctcctccttcattacattttgcttt
OVRT1_0064_E08.b : tagctgtttttttttgtaaacaacaattatatgtttttttcctctcctcttaatgattat
OVRM1_0204_C10.b :
UTR01_0075_C07.b : ttctataaagaacaaaccacaatactttataaattaagataatactacaaacaaaacaaa
OVRM1_0206_H10.b :
OVRT1_0143_G01.b : cgattcttactgctctcttttctccctctcatctcttttttttttatacccatactccca
OVRM1_0154_A10.b :
OVRT1_0141_A10.b : aatggcatttttactttttccttacctcgcgtctatcataaaaaaattaataccctccct
OVRT1_0132_E08.b : cttctccatacaaaactcaaatacattatagattcccccttttctttctgctacagtccc
OVRT1_0136_B01.b : tcctcacaaaatataataatagagcccctgtcttcaccccacggttgtcccccattttcc
OVRT1_0147_B03.b : aactgtttctttttttcttcttaggggtgtctatttataatataaatctcccttccccaa
OVRT1_0143_E01.b : atcttctacgaccatattctgttcctgccacctgtctcttctacttatccattcactaaa
LNG01_0035_A11.b : acaacacccctctcccctacaccaccactccccctcactcccaaaaatacgccctcccct
LNG01_0080_G12.b : aataaattttttttttccaaataaaaaaaaaaaaaaggccactggttaaaatactttgtc
TCH01_0033_G03.b : aatataaggtctttttccaatctacacacttttcttttttatataacaattaaatgttat
OVRT1_0008_G02.b : tcacccctattttttctctttgtaactaaaaaaacacacgccatttgtctcactctcggt
TCH01_0012_C01.b : ttttttctttaaaaaaaacaaaataaatgtttttttcctataataaaaatcatacaaaaa
OVRM1_0059_H02.b :
OVRT1_0028_E11.b : ctttttccccaccccgcccttctatttaccccaacaaaaaaaaaaccccctttgttgaac
CLNT1_0055_E08.b : aaaaataaaaggcctgttctttatttgtgccccccttttttttcagaaaacccccccccc
OVRT1_0141_A09.b : ctcccaaaaattattttttttatttaaaaaaaaaaataagacttttgttcctcgattggg
OVRT1_0003_C10.b : aaaattttcttttttaaaaaataataaccctctttcccacttccgtttgggccctatatt
OVRT1_0147_C10.b : tttcttttttctttaaaaagaaacaatagcctatttctcctcatcatgtcggctactaat
OVRT1_0002_A05.b : tttctcccactgaactttttcctttttaaaaacaataaacgccccatttcctcatcctgg
SMG01_0092_C12.b : aatttttttttttttaaaaaaaatttttccctttttaaaaaaagcccccggtttttaaaa
OVRT1_0054_D09.b : tttttcccaaaaaggtaattttttttttttaaaaaaaaataaaaggcctctttgcccagg
HTMT1_0044_C07.b : cttaatagagaannnganannnnnnnnnnnnnatttttngggggggcaaattccaccacc
CLNT1_0064_G09.b : aatgtgtttttctcccaatcacagcacttttctctattaaaaaaaataaaataggccctt
UTR01_0045_A04.b :
CLNT1_0061_A10.b : tttttccccaaaaaaaaaaaaaaggcccattgtcccaccttccggtcgggccctttatta
OVRT1_0085_E08.b : tttctcctccatacttttttttttaaaaaaaaaaaaaaaggcttctttgtccacctgggt
LNG01_0042_H03.b : ggtttttttttaaaaaaaaaaaaccctgggccttttattttccgtgggaaaaaaaaaaaa
CLNT1_0064_F02.b : agggcttttccccatcacagaattttttttatttaaaaacaaaaaaaaggccctttgctc
OVRT1_0042_D12.b : aaacacaaaaaataaaatgtcttttcccccaattaaaaaaaaaaaaaggcccctgttttt
CLNT1_0096_D04.b : aaaggcttttctcaacacagtactttccttttataaaaaaaaaaaaggccctttgtccaa
OVRT1_0058_D02.b : ccaaataaatatttttttattataaaaaaaaaaaaaaggccctttgtccttatttcaggg
LNG01_0035_H02.b : aaaaaaacccttatttcctctccccaaaaaaaaaacccttttgtttattttttttttttt
OVRT1_0073_E02.b : ttctctccaaactatcttttctttaataaaaaaaaaaaagaggccctgttcccagagccg
OVRT1_0073_A09.b : ccgaatgaaaataaaaacatatctatattactattggcccttgtctcccttgtggccgcg
MLN01_0069_C05.b : aaaaaaaaaggccaatggctcaattggggtcggcgcttaaaaatccctaggggccaatta
LNG01_0034_F12.b : gaaaacattatttccctcccaaaaaaaaaacccttgttttttttttttttttaccaagaa
OVRT1_0043_F11.b : aaatgtttttttcccaaatcagattttttttttttaaaaaaaaaaaaaaggccctttgtt
CLNT1_0051_H02.b : tccccaacagtcattttcttttttaaaaaaaaaaaagcccttgtttctactcggtccggc
OVRT1_0035_E03.b : aaatttttttttattaaaaaaaaaaaagcccctttcccatttcggggccgccctttttat
TCH01_0037_B04.b : cccaaaaaataattttcttaataaaaaaaaaaaaaaggcacttgtgcccaactcaggtcg
LNG01_0091_D10.b : ccccaaaaaaaaaaaaggcccatttcctatatttagtccgccccccttaaatccctcagg
UTR01_0043_B07.b : caaaaaaccccttgtttttttttttttcccaaaaaaaaaaaaccccctttttctcttttt
UTR01_0060_D01.b : ttccaaaaaaaaacccttgccttttttttttta
MLN01_0101_H05.b : caaataaaagccttttcccaccaaaaagaaaaaataaaaggccacttgtcctcaacttag
CLNT1_0066_E04.b : tccacacaagcccttttttttttaaaaaaaaaaaaggcccttgctcaatctcgcccggcc
OVRT1_0048_F02.b : caaaacatataaatggtttttctccccaatagagacttttcctttattataaaaaaaaaa
CLNT1_0064_E03.b : acccaataaaaggtttttctcccatcacactacttttctttatataaaataaaaaaaaag
OVRT1_0031_H01.b : caattaatgggttttttctcccaaaaaaaaaaaaaaaaagggcccatttgtcctcaactg
CLNT1_0014_A11.b : cctggaaccaaacaattaaatggcttttttccccaaaaaaaaaaaaaaaagcgccccttg
UTR01_0052_H06.b : aaaacctttgctttttttcatgaaaaaaaaaaaaacacaaattaaaaaaggtgctttttt
CLNT1_0074_E03.b : gtttttcccaaaacgttattttcctttttaaaaaaaaaaaaaggccctttgttccatctc
CLNT1_0064_B01.b : aaaaccttttttcaccaaaaanngnnngnggnngngaaggaagaaaaaacaagagccana
CLNT1_0062_A10.b : aacaataaaggcttttcttcccaaaaaaaaaaaaaaagcgccctttgtcccgctctgggg
LNG01_0028_F08.b : ttttccacaaaaaaaaacactggcctttttttctccgtgaaaaaaaaaaaaaaaaaaaaa
CLNT1_0007_E05.b : acaattaaggctttctcccaaaaaataacttttctttatttaaaaaaaaaaaaggcccct
OVRT1_0022_E11.b : caaaaaaggcgtttttctcccataaaatattttttttttataaaaaaaaaaaaaggccct
LNG01_0002_H02.b :
TCH01_0027_F05.b : aattaaatgg
ITT01_0012_E04.b : taatgtttttccccaaaaaaaaaaaaaggccttgtcccaactgaggccgggcctctaatt
PST01_0044_E03.b : cttcttttttaatatatctcttttttcctctctttacttcttactttctatcctttctaa
OVRT1_0005_G05.b : agtttattcccacgggtgtatcttttcacatcggaatatcgaaaaatggtaaatgctcaa
KDN01_0005_A09.b : ataatgctttttccccgaaaaaaaaaaaaaagaagaattaacccatttttcaaaaaaaaa
KDN01_0096_D09.b : acaaataaaaggtttttctccaatcggttaatttttcttatttaaataaaaaaaaaaggc
KDN01_0091_A05.b : taaaatggttttccccaaaacggaattttccttaattaaaaaaaaaaaaaaaagcgcctg
PST01_0042_G06.b : aacatataattgttttttcacacaacattattttcctttattaaaaaataaatataagtc
KDN01_0012_B08.b : acaaacaaataaaaggttatttctcccatacgtccctttctttatttacaaaaataaaat
KDN01_0035_D10.b : AACCAAACAAATAAAATGCTTTTTCTCACAAaaaaaaaaaaaaggccccttgtgcctcaa
TES01_0056_A11.b : tggtacaaaaccactttatatgcctttttccctcttccatttattaatacctccattagg
OVRT1_0123_D02.b : catctccctttactttctacattattatacggacccttttttgtttcttttctactctcc
OVRT1_0100_F07.b : aatagaaccttctctctctactcataaaataactggcttatgtcctcatttgttttcgca
TES01_0059_H04.b : aaaaaaaaaaagcttttttcccccaaaaaaaaaaaaaaaaaaaaaggccctttgtcccaa
PST01_0072_A08.b : aaacaaattaaatgtcttttcccacaatacgtacaatttctttatttaaaaaaaaaataa
PST01_0099_B11.b : ggaaaaaaaacaaataaaaggcttttccccccacatacgtcacttttccttttttaacaa
OVRT1_0120_H01.b : ctctgactttttcactatgttctctcttcttgctcgcccctctttctctctttatatcca
OVRT1_0093_E08.b : caatacagatttttttttttaaaaaaaaaaaagccaactgttctttttccggtcgaccaa
OVRT1_0019_D07.b : ccctatatcagtatacacgataattaccatcaaacggctttttctgttgtggttttatga
CLNT1_0150_E07.b : tatcctatttttctattctctatttaaaaatactctaacacccatcctcctatctctttg
OVRT1_0100_A06.b : acagttctttttccccaaaaaaaaaaaaaaagcccatgtgctctactgcgtggtcgggct
OVRT1_0072_D05.b : ttttaaaaacattaaaggtccatgtctgctcttgctcgtcctattaattaaaaacctccc
OVR01_0090_D11.b : aaan
OVRT1_0111_F01.b : AACAAAACAAATAAAATGCTTTTTCctcacaaaaaaaaaaaaa
SKNB1_0013_E01.b : nnnccctcgctg
---------+---------+---------+---------+---------+---------+ 1325
CLNT1_0151_F03.b : ttattaaatgaactatgttgttcgcgttataaattttataaaatcctatacactccctct
PST01_0033_B11.b : aaaaaaaggcccatgggtctcacttgcggtccgggcccctaaactatctaaagaaaaccc
TES01_0020_A03.b : ggtttcagtcctttctaaatttttaaaataatcttcctttcttccttttctttatcatta
OVRT1_0100_C01.b : acagttgcccctcaataatctctaataaaacctccctcccccccggtaacttattataat
TES01_0001_D08.b : attactttggtccctttgttcctaaattctcctttccgtgctctcttaaattttttaatt
OVRT1_0044_E01.b : cgtccccgttaatactttataaacacccctccccttccctagatgccattagtgagatgt
TES01_0040_A03.b : gttcccatttttgttcgcgagccttatataacttaaaaaaaaccctctccccctcccgta
OVRT1_0149_B12.b : aaaataataggcgcacctcttttctacatttgggtggcgctcctaccttttactgaggaa
TES01_0112_B01.b : cccatttggccccaactttcaaggctcggccctccttaatatttcttagaaaaaaaatct
CLNT1_0096_B04.b : cgcctttctttttaagaaaatcccctctcccccgccaaaaaatataaggtatgtgtgttc
OVRT1_0025_C10.b : actatttaaaaaaacctctcccccccccgaacccaaataaaaaagccagtggttttattt
PST01_0042_A08.b : tcacttattaataaatctcccacctcccgtataggaaatatgaggcatgttttgaacatg
KDN01_0016_C12.b : aaaaaaaaagaggccactttgtctccaaatttacaggtcccgccccctaaaataatttta
CLNT1_0022_F10.b : cccttgggttctaatatgggtccggccccttaaattcttatataaaaacccccacccccc
KDN01_0093_D03.b : cttcggttccggcccataatatttaagaaaaccccccaccccccccgaccgaaacaaaag
PST01_0054_E06.b : aattctaaaaaaacctccaccctccccgaccgaaaaaaagaaggattggggtgtattgtt
PST01_0098_A12.b : agcgcccttggtttctaaacggaggtctggggcccttaatttttttatgaaaaaaacccc
KDN01_0028_A09.b : gccccttgtgttcaactgtagtcccggccctaacatatctaaaaaaacctcccccccccc
PST01_0074_D09.b : taccttgaggtccggccccctaactacttataaaaaacccccccccctctcccggaccct
LVR01_0057_C12.b :
OVRT1_0022_A06.b : taattttttaaaaaaacctccccccccccgaataaaaaaaagagggctgtgtgtactttt
KDN01_0079_F03.b : gggcccccaactactctaaaaaaaacacccccacccccccgaaactgaacaataagaaga
PST01_0039_F12.b : aaaaaaaggcccattgtcctcaactctcaagtccgcggcccttaacattttttaagaaaa
KDN01_0080_C12.b : cctgtatatatatttaaaaactattatttatngggccccttggtcttaaactgggggccg
PST01_0080_F02.b : gacggtccggcccctaaactattctaaaaaaaaacctccccccccccccgtaaccgaaaa
KDN01_0028_B03.b : tccggcccctatactttcttaaaaaaccctcccccccccctgaactgaaaaaaagagagg
KDN01_0008_C02.b : tccgggccctaactatctaagaaaaaactcccacctcccctgaaccgaaaaaagaaggca
CLNT1_0066_C04.b : gagaatacaccccctctcctatccaaaaaatataaagctttgtgtttcactcgttttccc
OVRT1_0128_B05.b : aatctattctgttctctttttctctttgcctcctgtcattcctcgcactttgaaccagaa
OVRT1_0124_B12.b : atttcccttctctacactatttctactttagactcctcttcctccttactatattaaatt
OVRT1_0132_A05.b : aaccccccctcccccacgcaaaaataagagatgtgtgtgatatttctccctcagggcgca
PST01_0041_H08.b : tgttcccatcagcttgtgaatatttatcctaatttttctgttatcgttcttttattaaat
OVRT1_0001_E06.b : accaacaaagtggttttgtgtctgtttgcctttggaccattcatcccttcaaaacttttt
OVRT1_0004_A04.b : tccccttatgtcacaaccatatctttcaaaaaaatttcttctatgtgggaacacaaattt
CLNT1_0041_F04.b : tcatacatttcaaaaaaccccccccctccccgcgtgccataaataaagccctgggtggtt
OVRT1_0041_G09.b : ttcaaaaaaacctcccccccctcaacaaataaaaaaaaaatgggttgctattttatccca
SPLT1_0001_G07.b : tcccttcccgatcctgtaaagttcagatatccggtcgcccttattcactctattggggct
OVR01_0043_B12.b :
PST01_0064_F10.b : gtcgggcccctacatatataaaaaaaacccccccccccccgggactaaaaaaaaaaaggg
OVRT1_0076_E05.b : ataagaaaaactccctctccctcaacctacaaaaaaagaatttttttaatgcttttcctt
OVRT1_0126_H09.b : tcttgtctatcttcctcacactattccctcttaccttcgttatttccgacctttcctatt
CLNT1_0113_G10.b : tttatagaactctccccttcttctagtatcaatgtatcttattgcatgttacactttact
CLNT1_0146_A11.b : ttctctaaaaaaccctccctcccctaactttcacctagctctctgttgctttttcttctt
TES01_0101_A03.b : ggtccttcctactttgcttacgcctctttatctccctaaaagagtactccccctgtccct
CLNT1_0115_D01.b : tcttgtcccatcattctatctcattactactccccttcttctttgcattcttgttttctt
OVRT1_0045_G02.b : aaagactatatgcctcattcttcattaacctcatattttgtgcctccaaaattactctag
OVRT1_0082_A12.b : tttttctctttatcttaatacaaaaaaaaaaacagtgccacctttgttcttctctcttgc
OVRT1_0098_F02.b : aagaataaaagggcccatgtgtccggaccgggtggcagggtccaacatatacttcaatat
OVRT1_0045_B04.b : tttctattctctgggcggcggcctcttcttttatagaataacactctcctcccctccccg
OVRT1_0087_B04.b : ccccaaatattataaaaaactccccaatccctccaagaacaaaaaaagcgtggtgactca
OVRT1_0036_C01.b : taaaaacccccacacccccccaacaaaaaaaaaaaagaatgtttgtatctgttttcccct
OVRT1_0078_B06.b : ttctagaaaactctccaccctctctttctaataatataaaacgttgtgttactttttttc
OVRT1_0082_B08.b : ctatgtgtctcatgttgggtcgtccctacaaatttagaaaatacccccaccccccctgta
LNG01_0034_G12.b : cttttttatttcttcttttgggtaaaaaaaaaacaaaaaaaac
OVRT1_0040_E06.b : gggcgggccctttatattctgaaaaaccccccccacctcctctaacgaaaaagagaaaga
LNG01_0046_F07.b : tatcccagaaaaaaaaaaaaacccatttggggctcttttttttatttttctatagggtaa
TCH01_0046_A02.b : atatagccccttgttctctactttccgtctcccgccccctcttatattcctccggaggcc
OVRT1_0038_A03.b : cactcggtccggccctcttatattatgaaaaaccccctcctccccctgactaaataaaga
OVRT1_0069_A11.b : aaagtggccccttttcctcccacgaggttgccgcccctaacattttctagaaacactctc
OVRT1_0036_C05.b : gcctctaatatttaaaaaaaacctccccctccccccacacaaaataaaagagaaattgtt
TCH01_0028_A06.b : aaacctctggtttctgtccccctttattatctctcgaggggtccacctttcttctatcca
OVRT1_0041_A04.b : tcgccccttatttttaaaaaaaactccccccccccgccccaaacaaaaaaggtttgtgtt
OVRT1_0023_B04.b : cccccccccccggccgcccaaaaaaacaagaacccccccccctcggaaagaacggaacgg
OVRT1_0042_E01.b : cagttggggggccccccctatttgtttaaaaaaccccccccccccctaccgaaaaaaaaa
OVRT1_0036_G06.b : ccccccccccccgaaccaaacaagaagagagtttttttatgttttttccctttagggcaa
OVRT1_0035_F07.b : ccccttaattttaaaaaaacccccacccccccacccaaaaaaaaaaaaattggtttactt
OVRT1_0074_C11.b : actgggggcggccccctaccttttataaaaatcctccccccccctaaccctaaaataaga
OVRT1_0084_H08.b : tggtgccggtccttatttattcataaaaaccctcccctccccttgcatcagaaaaaaaga
TCH01_0023_B08.b : ggcgctttgtccaactggggggcgcccctttaatatccccggggccaacttacgccccat
TCH01_0039_H04.b : gcccctgttcctccagacttccaggttccggccccccc
TCH01_0087_F04.b : cccttatctatataaataaaaaaggggccatgttctcgctgggtggccctttatatcccg
TCH01_0011_H03.b : cggccccttcaatatccctcgggggccaaacc
LNG01_0103_C05.b : ccgccgcccaaatccctaagggcaacttcctacccttttttaaaggcccaaaggaccata
TES01_0070_D01.b : tttttttctcatggggtgggcgccccttattttctttaaataaaatccctcccccccccc
OVRT1_0123_G01.b : tcagtttgctcttttacctcactttccccatccgactctttacttcctccatctgctccc
CLNT1_0128_D11.b : tctttcccccccctcttacttttattaacatcccccctccctgctccacgaaaaaagaaa
TCH01_0093_B10.b : ttaatataacnttctaatatttgcttaatataatataaaataaattctctatttatatt
TCH01_0093_E09.b : ttaggggccatttttcgtccccgtttctttacaaggccccttttgggctatataccgagc
CLNT1_0074_H09.b : aaaggcccctttgtttcaaccttgggtgcggcccgcttaattttttaaaaaaaaactccc
OVRT1_0033_A09.b : tgccgccccctaatatattaaaaaaaaccccccaccccccccgtacggaaaaaaaaaaag
TCH01_0085_H10.b : tccccgaggggcccagctttcgtcacacttttttgta
TCH01_0039_E03.b : tgcaggtccggccgctcttaatttccctcagggggccan
LNG01_0098_D07.b : gtttcgactgcggtcgcgccctcttaatatcctcagggccagttaccgacccctttttta
THY01_0040_A10.b : cccccactcccccctctctcctcctgatgctactctctctcttcctcctccttaaacaac
OVRT1_0106_F03.b : gcttcttttttcactctctttctttactttgtctaactttcctaactttactgttctctc
OVRT1_0064_E08.b : ttctttttcttctgccctccttgcttatctctggctgctgcttcctttattctatatatt
OVRM1_0204_C10.b :
UTR01_0075_C07.b : taaataaatacaaatattgctcacttctttttttttttcctactcattcaataacaaata
OVRM1_0206_H10.b :
OVRT1_0143_G01.b : tgtcgccccttctctcttttacttcacctccttccctccttttattctttactatacctt
OVRM1_0154_A10.b :
OVRT1_0141_A10.b : cctccatncctagaatatgtaatttctgtgctaattcgacgacctctaatgatcattaat
OVRT1_0132_E08.b : tctctatataataaaatatctctcctctcccgaagtaaaaataaaaagaaatttgtgtta
OVRT1_0136_B01.b : cacagaaaatcccccctcctcgaatcgccataaagagagagtgtgtttttcttcttactc
OVRT1_0147_B03.b : gttcactagaacacgcttggtcatatacttcgctatggaactaaatgtaattccactccc
OVRT1_0143_E01.b : cgatgtctcccttttctattactatctgcgcgttaactacaatgtcatgaaaattcgcac
LNG01_0035_A11.b : ttctactttttctttcaccacgaacaaaaaaaaaatac
LNG01_0080_G12.b : cgggcggctttgaaaatccccgagggctaaatttacccacaacatttttttaaaggggcc
TCH01_0033_G03.b : ttgtttctaaacttccggcccgcctcctataatattctcctagcggtcaaa
OVRT1_0008_G02.b : tccgccccccatatatttaaacaactctccctcctcctctcacccaaattaaaagagact
TCH01_0012_C01.b : aaaaatgtccaaattttctataattaaaattatgaacacatataaaag
OVRM1_0059_H02.b :
OVRT1_0028_E11.b : caatgtcgtgccctacccatcttaaaaaataacccccccttcccggatcccaacaaaaag
CLNT1_0055_E08.b : ctactaaaaaaaaagccctttttttcttttttccccataggttaaaataagtccttccaa
OVRT1_0141_A09.b : gcgcgcctataaatatataaaaaccccccccccccccccccaaaaaaaaaaaaagagttt
OVRT1_0003_C10.b : cctaataaaatccccccctccctcaacaaaaaaaaggaagccctggtttttctttctgcc
OVRT1_0147_C10.b : tattatattaatccctctcccgccgtgcttgaaaattggtatgtgtgtttcctattgttt
OVRT1_0002_A05.b : tccgccctataaattctataaaaaactccacctccccgtaactaaaaaaaaagagctgtg
SMG01_0092_C12.b : aataaccctcttcccggggggatctttggaaattccctaaaaccttttggggtatgttcc
OVRT1_0054_D09.b : tggggtccgcccacaatatttttataaaaacctccccctccccccggcctaaaaataaag
HTMT1_0044_C07.b : atcctttcttctttttnnnnnngnnnnnnnnnnnntntgttggngntntgantnatatac
CLNT1_0064_G09.b : gttgtccaggttcagactcgcgctcaatatattattcaataaacctcccaccccccccct
UTR01_0045_A04.b :
CLNT1_0061_A10.b : tttaaaaaaaaactcccccctccccgaaccgaaaaaaaaagaggcacttgttttttctgt
OVRT1_0085_E08.b : tggggcttttatttcataaaaaccctcctcccccatacaaaaaaatacgcctccggtgaa
LNG01_0042_H03.b : aacaaaaaattaaaaaaaatgggcttcttttttttttttttctcccccacaataaaataa
CLNT1_0064_F02.b : acttggagctcgggcccttattattttgaaaaacccccccccctcccggaccaaaaaaaa
OVRT1_0042_D12.b : tcagcttggggttcgggccctttaacttctctaaaaaaaacctcccacaccccccctggg
CLNT1_0096_D04.b : ctgagtccggcgtctaatttctaaaaatccccccccccccccgaaccgacaaaaataaga
OVRT1_0058_D02.b : cgcccctatatttattataaaacccctcccccccccgttccgaaaatatagaagactttt
LNG01_0035_H02.b : ctcccaagaaaaaaaaaaaaaaa
OVRT1_0073_E02.b : ctgccggccctattatttttaaaaaaactcccccctcccccgcacaaaaaaaagagacat
OVRT1_0073_A09.b : ccttataattaataaaaactcccctccccctcccccaaataaaggcgccttgtgtttatt
MLN01_0069_C05.b : ccgacaccctttttaaaagagcccaagagagatataacaagcgggcgcctttaaaaccta
LNG01_0034_F12.b : aaaaaaaaaaaaaaccccatgttggtcctctttttttattt
OVRT1_0043_F11.b : tccagtgcggccccccctattatattttaagaaaaccctccctcccccctaaacgaaaat
CLNT1_0051_H02.b : cctatttttttaaaaaaccccccaccccccgaccgaaaaaaaaagcatgtgtggtcttgt
OVRT1_0035_E03.b : ctaaaaaaactcccacccccccacccaaaaaaaaaagccttgtttgttatctttttcacc
TCH01_0037_B04.b : ggcccctctaaaatcctcaagggcccaacttacttc
LNG01_0091_D10.b : gcccacttacgataccacttttttaaaagggtcctattgagcattaaaatcgcctgcgcc
UTR01_0043_B07.b : tttttttctctttgtgtagaaaaaaaaccaaaaac
UTR01_0060_D01.b :
MLN01_0101_H05.b : ggcgcgcccctcttaaattacctttgggggccaaagtttcccatcc
CLNT1_0066_E04.b : ctttatttttaaaaaaaccccccccctcccgacctaaaaaagaagaattgttgttacttg
OVRT1_0048_F02.b : aaaaggccccttttgtcctactcttcggtgcggccccctatatttttttataaaaaactc
CLNT1_0064_E03.b : ccctatgtcccaacttcggctccgcgcccctaaattttcaaataaaaccccccctccccc
OVRT1_0031_H01.b : taggttcggggccccttaaaatattataaaaaaaaactccccacccctcccccgaaacct
CLNT1_0014_A11.b : tctccgatttcagggtcccgcccccttaaatattctctaaaaaaaaacccccccccaccc
UTR01_0052_H06.b :
CLNT1_0074_E03.b : gggccgcccttaatattttaaaaaacccccaccctcccgaaccgaaaaaaagaggacttg
CLNT1_0064_B01.b : ccttccacccnnnnnnnnncnaaaaggcccctgtggttcacctctttgcccgccctaaaa
CLNT1_0062_A10.b : tcgggccccaaattttcttaaaaaaaacccccccacctcccccgaacgaaacaaaagaga
LNG01_0028_F08.b : aaaaaaaaaagaaggcgcctttttttttttttcttccctcct
CLNT1_0007_E05.b : ttctccactggggtccggccgctacatatttaaaaaacccctccccccccgcgacggaaa
OVRT1_0022_E11.b : gtttctcaatcggggtcggcgccctaaaattttagaaaaaaccctccaccccccccgacc
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b : tcctcgggggagttcccgtaccccttttgaaaagggcccaagggatcttaacccggccgg
PST01_0044_E03.b : ttcttctctcgatctcttcctcaacttgactgcatctctatgcccatctactcttgatac
OVRT1_0005_G05.b : agcaaaaataagagcctttggtttattaaccccccacagccaattccgctcctgatggct
KDN01_0005_A09.b : aggggccctttctcaagtggggcgcgcccctaaattttgaaaaaaaccctcccccccccc
KDN01_0096_D09.b : ccatttggtccaactccgggcgcgccccctacaatattttaaaaaaaccccccccccccc
KDN01_0091_A05.b : ggctccactgtaggtccggcccctaatttacttaaaaaaaacctccccactcccccgaac
PST01_0042_G06.b : attgtgttctactcagtcacgccctaatattataacaaaactccctcttccccggcagca
KDN01_0012_B08.b : aggcccctgtgtccaactgcagttccgcccctaaacatctaaaaaaaaccctcccctccc
KDN01_0035_D10.b : ctgcagtccgcccgctaactagtctaagaaaaaacttccacacttccccggaactgaacc
TES01_0056_A11.b : gttctttgtgccctcagtgacctgtcctggcccctcaatttttttataataaaatctccc
OVRT1_0123_D02.b : ctctactatgtctatttcttctctccctcttctgccactttgtattcctgctctcctctt
OVRT1_0100_F07.b : ccctatttatatttaataactccctcaccccctgcatttgatcaaagaatcattgtggtt
TES01_0059_H04.b : tttcggggtcggccccttaattttcttagaaaaaaaccccccacccccctcgcgacggaa
PST01_0072_A08.b : aaggccactttggctccaattgcgggtgcggcccacaaattatcttaaaaaaacctcccc
PST01_0099_B11.b : aaaaaataaaaggcccattgtgtctcaacctcaaggcccgggccctctaaaatattctaa
OVRT1_0120_H01.b : cctttcttgctatcatcgctctgtttgtactgcccaccctactctcttgatttatcgcct
OVRT1_0093_E08.b : aaaatcataaaaaccccccccccccctctcaaaaagaaaagatttgtagtaactttttag
OVRT1_0019_D07.b : aaaatgccccttttcccctcggcccccccaaaatattaaaaaccccccccccccaaaaaa
CLNT1_0150_E07.b : cgcaccccctttatattatatatttatctacatcttgcctcttcacacttactaatagat
OVRT1_0100_A06.b : ttaatttcttagtaaaacccccccccctccccaaagcagaattaaagagggcttgtgtgt
OVRT1_0072_D05.b : ccttcccaaaaataaatagaaatctttgtttacctttattcctataggtaaaacgctgcc
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0056_C12.b :
ILNT1_0056_D06.b : aaaatttaaaGCCATATCATAGAAAxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
SKNB1_0013_E01.b : tggctcggattaagcctatctagaaacAGACACACAGAGTTGTAAGAGAGCTAAACACTC
---------+---------+---------+---------+---------+---------+ 1385
CLNT1_0151_F03.b : accgactgcgtattcccatattacatgcgggtgcgctgtatatctacattcaattcaatc
PST01_0033_B11.b : ctccccacccccccgaaccggaaacaaaaggaaagcaatggtgggttaactgttttgtgc
TES01_0020_A03.b : ttctcccttctttctctctatatatctttctttcttactccataatgattttcacctttc
OVRT1_0100_C01.b : cgatcttgttttttacattttcttcgtctctctgggttcattaaaatttatctcttttct
TES01_0001_D08.b : aaaataatccctctatccattccccc
OVRT1_0044_E01.b : gctgcttttctctgttctgctccctccatggtacacaactatcttctcctccccaatcac
TES01_0040_A03.b : cggaaaataataaataacttctggttcttacctttttttccccttcaagtttataattac
OVRT1_0149_B12.b : atactcccctccctccccctccatatcaataaaaaatatcctccttgttgtgttccttct
TES01_0112_B01.b : cccaccccttcccccggaaccgtaaaatataaagggagccaataggtgtttg
CLNT1_0096_B04.b : ttttctcctctttcggccctataatgtccccactcctcaacaacttttcctctttttgtg
OVRT1_0025_C10.b : ttttgcccatacggggcaaaacaacaaccccattctcacaaactttttccgctcttggtg
PST01_0042_A08.b : ttatatcttatgtgtaataacctaatatacatttcaagagaatttcccttttataggggt
KDN01_0016_C12.b : gaaaaaaacctccccaaccctcccccggaacggaagaaataaagaaagcgcttttgttgt
CLNT1_0022_F10.b : ccgcaacgagaaataataatggaatgtgggttgttctttagttgcccttatgggtgacac
KDN01_0093_D03.b : gatgccttgtttgttacttgtttgcccttaagggtcaaaaaagaagcgcacatttccaaa
PST01_0054_E06.b : ttcgcctatggtcaaaaacgagacccaatttcaaagacttttccgcttaggggtgccaca
PST01_0098_A12.b : cccccctcccccgtgcccgtgaaaaaaaaaaaaagggaattgtggtggtacactgttttt
KDN01_0028_A09.b : cgaaccggaaaaaaaaggaggctgtgttggtaattgtttttgcccttatggttcaaatag
PST01_0074_D09.b : aaaacaaaaagaaagaatgttggttgtcacttgttttggcccaaagggggccaataaggc
LVR01_0057_C12.b :
OVRT1_0022_A06.b : ttcccctctaggtgaaaaaaacactcactttcaaaaagtttttctccctctgtgtgtgcc
KDN01_0079_F03.b : cgctgtgttgttaatgttttagggcccttaagggtcaaaatacgctacctccaatttctc
PST01_0039_F12.b : aacctccccaccctccccggaaccggagaacaaaaggaaggcgcatgttggtgttcactt
KDN01_0080_C12.b : cgccccttatatttcaaaaaaaaaccccccacccccccccgaaccgaaaataaaagaagc
PST01_0080_F02.b : taaaggaaggcattgtggtgttaacttgtttatggcgcttaatgtgttacaataagcaat
KDN01_0028_B03.b : cattgtgtggtaactgtttttggccttaaaggttcaaaaagcaatcctccaatttccaaa
KDN01_0008_C02.b : tgttgtgttactttttgtgcctttaggttcaaaaacaaatctccattttccaaagctttt
CLNT1_0066_C04.b : ctaaagatacacaaagaacatcacctatccccaatgtcttctcccttcctgggtgggtac
OVRT1_0128_B05.b : atactctttcgttgtctctccatctttttcacttatttccttttttctctctcttcttat
OVRT1_0124_B12.b : ttagtaccttttcttgtattatcttattttcctcttactctatttccttctgctacttat
OVRT1_0132_A05.b : aacaaccacatactaaaatgttttcttctcgtggtggacaaattttttttgggcggctta
PST01_0041_H08.b : ctgtatacatttctttttttttctctccagatctttattaacctacctacattttaatat
OVRT1_0001_E06.b : cttttgggttccccattttttttgtgtcggggaatattctttctcctatcttcttgtggg
OVRT1_0004_A04.b : ctgtttcgcgacacaatttccttccatcaccctatcaggagactctctctctcgacaaaa
CLNT1_0041_F04.b : acctgttcgtgccttagggtcataatacaatcctcctttctacaacatttcttccgcttt
OVRT1_0041_G09.b : taaggacaaaaaccacccccccttccaaaaatttttctcccttctttgttgccacctcac
SPLT1_0001_G07.b : acgttattcgagctcacaaattctttttttgatgtctaccacatcgtttactaattgaga
OVR01_0043_B12.b :
PST01_0064_F10.b : attgtgtggtaatggttaagggcttaaggggacaanaagaactctcccaatttccaaaag
OVRT1_0076_E05.b : cagggaacaaacacacccaactgcaaagccttttccttacttggagaacctatagataat
OVRT1_0126_H09.b : tttctgtctcttctcgcgctattatttcattcggctcttcctcctctctctttatgtatc
CLNT1_0113_G10.b : cactctagtgaccattattctcctacttttctatctattttttcccctattcgctatcta
CLNT1_0146_A11.b : ccatcctaatgtatcaacactttccttcacttttaaaactttcttcctctgtatt
TES01_0101_A03.b : tccgttctataaatatctcatttatgctatgctgtgtgattcactcttcactgtcttcat
CLNT1_0115_D01.b : tatcccctatctttatactcatctctctgtagctccctctcacgtacatcatagaactta
OVRT1_0045_G02.b : ataaaatttccctccactctctccctga
OVRT1_0082_A12.b : gtccgcgcgcctttcttcatccttcttgttataaact
OVRT1_0098_F02.b : atacccccccctcccccgtgatcgaaaataaaaggggacctggttgctttaatgtctttt
OVRT1_0045_B04.b : acctattaaaatagagagcctgcgttgtctttattttttattccgccttgtacgtgctca
OVRT1_0087_B04.b : tttttgcccttccggcgaaaaagactcattttcaccagctttctcggaatttgtgtatat
OVRT1_0036_C01.b : cgtgagaaaacctaacctcattctaaaattttttcctttattggtataccctgaatattt
OVRT1_0078_B06.b : ccattagtggacaataccctccccattcaaaatgtttttcttctcctgggtgttcaacct
OVRT1_0082_B08.b : agaataacaaaacattactcttattattttcatatcttaatgctacaaaatacacttcaa
LNG01_0034_G12.b :
OVRT1_0040_E06.b : ttggtttttcatgttttgtcctcttggcacaaataacaaactcctttccaaaagtttttc
LNG01_0046_F07.b : a
TCH01_0046_A02.b : taactttacctactccgctttcttttaaaatgggccccttttgag
OVRT1_0038_A03.b : agaaattgtgtgttcgttttctggcccaagaggccacatataatgtcgcccattctcaca
OVRT1_0069_A11.b : cctccccctccggaccaaaaataaaatgactctgtgtgggatacttttctgccccttaag
OVRT1_0036_C05.b : gtatttgtttttccctatagggtaaaaaacatctcccattcccaaaacgtttttctcttt
TCH01_0028_A06.b : ttttttctgtatacaagtgtcat
OVRT1_0041_A04.b : gctctttttgcccataggtgcagagacatccgccatttctccaaacttttctccggtttg
OVRT1_0023_B04.b : catgcccactcccagatatttacgaagatttttctatttattttttttgaatggggtttc
OVRT1_0042_E01.b : agggactttgttttcttctttttccccatttggtccaaaagagagcctcctttcccacaa
OVRT1_0036_G06.b : aaaaaacagctctattccaaaagttttttctgctcattgtgttccaccacagttttaatg
OVRT1_0035_F07.b : ttatccctaaaggtaaaaaagaatccccatttcaaaagcttttcccaatagggtggcaaa
OVRT1_0074_C11.b : agccctggtggttactttttatgcccttagggcctaaaacacaccccctttttccaaact
OVRT1_0084_H08.b : gacatggtttaacatgattgcgcctcatggctacatacgttcccccattctcaaatattt
TCH01_0023_B08.b : tttttaaaagggcccatagagccatatacaagaccggccn
TCH01_0039_H04.b :
TCH01_0087_F04.b : ggggcccttctccccccttctttaaggcccttaggttatataaacggccccttttacccg
TCH01_0011_H03.b :
LNG01_0103_C05.b : aaaagacggccgttaacccgagggaaaacttgggtttgagaacttctggggcattgaacc
TES01_0070_D01.b : ctttcgttaatataatcaagagtgagtggctgtacacacttttgtctcatttatgtgtct
OVRT1_0123_G01.b : tactgacctccattcttcttcttttcttctattatttgtcctgccgttctgccttctttc
CLNT1_0128_D11.b : atgtgttgttgatttatttcctctctgtctcattctccatactatataaactatttcttc
TCH01_0093_B10.b :
TCH01_0093_E09.b : acggccccttttcctcggtctggtaaagtcttgtggt
CLNT1_0074_H09.b : acctcccccgaaccggaaaaaaaagaagacatgtgggtttcctcgtttttgcccctttgg
OVRT1_0033_A09.b : acatttggtttttcactttttttcgcctttgggttcaaanagcacaactcctcttctcca
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b : aaaggcccttaagagccttataaaaagcgggccctttactctgcggaaacaccttgtatt
THY01_0040_A10.b : acatatcctcttctttttatctcctttctttcttccaacccacctctaccgctaa
OVRT1_0106_F03.b : ttactcctgaactccatttatattatcctcttgatcttctatttctacttctccctccca
OVRT1_0064_E08.b : ataaattgtctcttcttccccgctttcataataatattactgtgcatctctttttctata
OVRM1_0204_C10.b :
UTR01_0075_C07.b : aa
OVRM1_0206_H10.b :
OVRT1_0143_G01.b : ctctcctctctccgtatctgattaataatctacttctatatacgttcttatactaactct
OVRM1_0154_A10.b :
OVRT1_0141_A10.b : tcttcccaaacaataaattatatgtttttaatactggtagaacatcctacctcctttctt
OVRT1_0132_E08.b : cttctgcggtccttctcaccacactccccactactataaaataccttttctactcctgtt
OVRT1_0136_B01.b : cctctagtcatcagtccctaccccattacctactcttttttctcgtctctggggagccaa
OVRT1_0147_B03.b : tctctttcatttggtgttttctcaaataaactgctgtgactgttatttatttcttcttct
OVRT1_0143_E01.b : ttactctctcctagtaacaccatattatcttgtcatgtacatactcttactatcagtaac
LNG01_0035_A11.b :
LNG01_0080_G12.b : catcaggcgntatacactcacgcaggcgtcttttaacctctatgcataccgcctccggcc
TCH01_0033_G03.b :
OVRT1_0008_G02.b : gtgtatactacctttctgcctaatagggatcaaaaacatccccactatcaaaaccatttt
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b : cagtttgtgttgtgaaaattatatcccccacaccgccataaacacaactcccctattttc
CLNT1_0055_E08.b : aaatttcttctgttttggtgtcccattagttttcgggcgcgggaacaaattttctttccc
OVRT1_0141_A09.b : ggtttcttttctcgccctgagggcaaaaacaacaccacctcacaaaatttttctctctat
OVRT1_0003_C10.b : ctttaggctcacagactacgctccctctctcatactttctctctcctcgggttgggtcac
OVRT1_0147_C10.b : gctctgatcgtaattaggtccggtctttctagaatattgttgtgtctttggcgccacttt
OVRT1_0002_A05.b : ttttcctctccgcccttcagggcacaacacacccccattacaaaaattttccctcatggg
SMG01_0092_C12.b : ccccccatttttttgggaaaaggtttttgagaaaaacccccctctgcccccccccctttg
OVRT1_0054_D09.b : ggcgattttgtgttatctttattgcgccttgggggcccaagagcagatccctattttcaa
HTMT1_0044_C07.b : atttcttggaaaataccactctctttttctccggggggatttttttattacgggggaatt
CLNT1_0064_G09.b : cctaaaaaaataaaacgccctctgcggtaaactgttttctcctcatatgtcccaatggcc
UTR01_0045_A04.b :
CLNT1_0061_A10.b : ttttgcccttatgggtcaaaaacgaacccccactttcaaaaggtttttttcgg
OVRT1_0085_E08.b : atgttttgcctttaggcccccattcacgccaaatctcaaatatttttctgccctggggtc
LNG01_0042_H03.b : acaca
CLNT1_0064_F02.b : aaagaaatgtggttgtttctttttccgcctttgggttacaaaacaagtccccatctccaa
OVRT1_0042_D12.b : aggaaaataaaaaagagcccttttgtgtttttcctttttttcccccttttaaggtctcaa
CLNT1_0096_D04.b : ctttgtgtacactttttcgcctcaaggacaaaagccgccccactttcagaaccttttcgc
OVRT1_0058_D02.b : gtgttctctttctgcgccaaaggggcacaagacacaccccttttcacaaccttttcttcc
LNG01_0035_H02.b :
OVRT1_0073_E02.b : ttgtgttatttgtttagccctttggttacaacacccccccctttccaaaactttttctgc
OVRT1_0073_A09.b : ttgtcccttacgggtaaaaaacatccctttctcacaccttttctcttcttgtgttgcctc
MLN01_0069_C05.b : aagaaaaccacttgaattagaaacatctctgtggaacgca
LNG01_0034_F12.b :
OVRT1_0043_F11.b : aaaaagggcctgtgtttcatcttttatccccctaggtattaaaaaaaatcccccttttta
CLNT1_0051_H02.b : ttggccttagggcacaaaaaaaacccaattcaaaaatttttcccctcgtgggtgcacaca
OVRT1_0035_E03.b : ctggggccacatgacatccctccttcacaaatttttttcctttgtgtgttcccctaattt
TCH01_0037_B04.b :
LNG01_0091_D10.b : ctttacctctgcgggaaattccgtggtctggaaacacttttgtgggaatgttaactctca
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b : ttttgcccttaggcttaaacaactctctttctccaagtcttctgccctgtgggccccccc
OVRT1_0048_F02.b : cccccccccccccgaacataaaaaaaaagagggactttgtgctttcacttttattggccc
CLNT1_0064_E03.b : ccaccgaaacatatagaacaagtggtgttatcttttattcctcttaatgcgtacaaaaac
OVRT1_0031_H01.b : taaaaa
CLNT1_0014_A11.b : ccctcgaagcctgaaaataaataa
UTR01_0052_H06.b :
CLNT1_0074_E03.b : tttttctttttttgcctttagggcaaaagaacaccccattccacaaactttttcgccctg
CLNT1_0064_B01.b : ataataaaaaaaccccccccccccacgcaaaaaaaaaagaagagttgtgtgttttttttt
CLNT1_0062_A10.b : ggcctctttggtttcctttttttgtgccctttagtgtccacaaaagagaatctccacatt
LNG01_0028_F08.b :
CLNT1_0007_E05.b : taagagagggtggttttgttcttttggcccttatggtcaaaaagagaccccattccaaaa
OVRT1_0022_E11.b : cgaaacaaaaagaacaatgtgtttttattgttgtgcgctataagggacacaangacagcc
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b : cccctttcactccgcgggaaccgcccttgatcttgaaaacctttctggggccttggaacc
PST01_0044_E03.b : ttcgcttgatctctctttatctctaatggtagcatctacctctggttaactctgttgtct
OVRT1_0005_G05.b : atggaaaaaagaggtctgatactgagctttctctgtttaatttcttctcgagaggttaac
KDN01_0005_A09.b : gaccgaaacaaaaagaagcatttgtttttcttttttcgcccttagggtcaaaaaacaacc
KDN01_0096_D09.b : cttgcctgaacaataatgaagcatttgtttttaaattgatatgcgcttaacggttcaaaa
KDN01_0091_A05.b : ctaaaaaaaaggaggcatgtgttgttatttgttttcgcctttaaggttcaaaagacaata
PST01_0042_G06.b : aataaaaatatggtgtgtgcatgttctatcactataggcaaaacaaatttccactttcga
KDN01_0012_B08.b : cctgcactgaaaaaaaaggagcatttgttgttaactttttgtcctattagggacaaagac
KDN01_0035_D10.b : aaaaatgatgccatgttgtggtacctggttttgccccttaaagggtcacaaaaggcatac
TES01_0056_A11.b : tctttcccctcgttatcttatcacatatttatcttttttgctgctgcctctttttctccc
OVRT1_0123_D02.b : cctgctcttcttcttcatcactctttacctctctctttcctttcccgtcctctctcttct
OVRT1_0100_F07.b : ctcttgttatcttgacctgttggttatatgccctaataattagttaccaatctcttatct
TES01_0059_H04.b : acaaaagaaaggcccttggtttgtaactgtttttggcccctaagggtcaaaaaagacccc
PST01_0072_A08.b : acctcccccggacctgaacctaaaggaaggcattgtgtgttaactgtttttgcccttaaa
PST01_0099_B11.b : aaaaaaacccccccacctctccccgaactggaaactaaaagaaggcaattttgtttgtaa
OVRT1_0120_H01.b : cccttattgcattcgatctctccctttatatctatattctcttttagctcactcattcgt
OVRT1_0093_E08.b : cctctagggaaaagaacactccaatacaaaacttttctcctccgagtgtccacctttctt
OVRT1_0019_D07.b : aaaaaggacaaggttgttcttttgccttagggtcatccacctcccggtggaacatttttg
CLNT1_0150_E07.b : ctatgtactcctctcactaactcctatttcatagatgatacataccgctcccgcactttc
OVRT1_0100_A06.b : ttctcttttccgccccttagcggcccaaacgaacacttccatttttctaagaacttcttc
OVRT1_0072_D05.b : ctttcttacattttcgttctgtgtttcccctatatacgtgatccctatatatccttctct
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0056_C12.b :
ILNT1_0056_D06.b : xxxxxxxxxxxxcgtactagccnn
---------+---------+---------+---------+---------+---------+ 1445
CLNT1_0151_F03.b : ngncagngttgtcgcgtattgccgtgaatcgtggc
PST01_0033_B11.b : ccttatagggtcacaataaacaaggcccccaattttcacaaaggctttttttcggcgctc
TES01_0020_A03.b : ctatcctcatctctctctcatttgggtcactaactatctat
OVRT1_0100_C01.b : aactaatattttcctt
TES01_0001_D08.b :
OVRT1_0044_E01.b : ttttttttctgtagcgtcttcttcaaccccttttctttcttgcactctgcctccttctct
TES01_0040_A03.b : aaaaccatccattcttaaagaatttttttctccgtctactgtgtggtcacacctccaac
OVRT1_0149_B12.b : tctcttccacccaacct
TES01_0112_B01.b :
CLNT1_0096_B04.b : ttgccccatattctattgc
OVRT1_0025_C10.b : tgcgcaccactggtttctattgtgtcgggcgcgacctacttcct
PST01_0042_A08.b : gccacataagttttgaaatttatgagatcttaatattctttatactctacactcttttag
KDN01_0016_C12.b : gtacatgtttttgtcccttaaaag
CLNT1_0022_F10.b : aaaacactcccccctctttg
KDN01_0093_D03.b : aacttttctcgggtcgttgggtgtccaccaacagatttagtgggaccggggggagataat
PST01_0054_E06.b : aagatctaggtgaccgggaaggaatattctcttccccacaccccggtttgggggggctcc
PST01_0098_A12.b : tggccaacca
KDN01_0028_A09.b : gaaatccccactttcacaaaggttttttccggcttatgggggttgccacccaaggatttt
PST01_0074_D09.b : ttcccctcattttccaaaaagctcttttccgcctctaaggtgggtccgacaccccggatt
LVR01_0057_C12.b :
OVRT1_0022_A06.b : cccatatttattgggccccggccatatttcctcctttc
KDN01_0079_F03.b : aaaagcttttttcccccccttgtgggggtggcgcaccccgagtatttaattgtgggcccc
PST01_0039_F12.b : tttaatgggccccttaaggggttcaaaatacccataac
KDN01_0080_C12.b : gcgttttgtttatattgtttttacaccat
PST01_0080_F02.b : agcccccattttcaccaaaggctttttctccggctcccatgggggtgccacaccacagag
KDN01_0028_B03.b : aagctttttccgcgctctaggggggtgcacacacggggtttaaggggggtcgcggcgggc
KDN01_0008_C02.b : tcggctctatggggtgcaacccaggatttaagtggtcccgggagggatattttcttcttc
CLNT1_0066_C04.b : atacactctcttgggtctggcgcacactacattcn
OVRT1_0128_B05.b : ttcttcactactgcgctatcttttttctttntcctnnnnnnnnnnnntaatctttcatgt
OVRT1_0124_B12.b : tctn
OVRT1_0132_A05.b : tttccctctccctcctccgctctctccgtatannannnnnnnnnnnnnnnnnnnnnnnnn
PST01_0041_H08.b : ctaatatacatctattgcaagccgcgttttgagaggatactaaaattatcactattagct
OVRT1_0001_E06.b : tctctctttttcgtgcaaattaaanaaaaaannnnnnnnnnnnntnntcctctcctcttg
OVRT1_0004_A04.b : a
CLNT1_0041_F04.b : agtgtttaccaccatttcctcttgtcg
OVRT1_0041_G09.b : tttttatggttcccgcaccacaatttccctc
SPLT1_0001_G07.b : ccttctaattatacctcttcatccatctaattacgccacc
OVR01_0043_B12.b :
PST01_0064_F10.b : cttttttccgggctccggtgggtgccaacccaaggttttttggtgggcccgggagagcat
OVRT1_0076_E05.b : tgccccgcgaaaatatatccttctaccaatcctctttgcggggtttccacgntctcttgc
OVRT1_0126_H09.b : tgttccttcccgcccctccgccctcttatttaattcttctccatccctcctca
CLNT1_0113_G10.b : tatttcttttcttctactaaatccatcttttgttcatctgtctttctacactgtgtcgtg
CLNT1_0146_A11.b :
TES01_0101_A03.b : tgggccgtaacatatactttctccctcttctn
CLNT1_0115_D01.b : tttctcttctttatctcgtgcttgtactgttgctatttcgtccatcgtcactattttatc
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b : gcacaatg
OVRT1_0045_B04.b : aacaccgaccttcccg
OVRT1_0087_B04.b : acttatttcttgcgacggtaccgttgatcctctctctccaaccttcttttgcggtcctct
OVRT1_0036_C01.b : ttgtccgctaaaaaatcttttcctcctacct
OVRT1_0078_B06.b : atcttcttttggccggttagccaaattctctccttcatcatcctgctggctggtgtttcc
OVRT1_0082_B08.b : tctccatactcttttgctccatgtgttgttccccaactttctacgtttctccagccgtat
LNG01_0034_G12.b :
OVRT1_0040_E06.b : tcgcctcgtgtgtgtgccaccaatgttttagtgcgcgggcgacaaatatttctctctcca
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b : agctttttcgcctctttgtggtgtgcccaccggagacttgagggccgccggcgacattta
OVRT1_0069_A11.b : tgtacccacagaagtctccccattcc
OVRT1_0036_C05.b : ttgtgggtgccaccattttaatggggctcgggcgcaatttttcttctctccnaacgttgn
TCH01_0028_A06.b :
OVRT1_0041_A04.b : ggtgaccaccaagattatttggtgcctagacactattattttctttcttttg
OVRT1_0023_B04.b : aatttttttttactaaactattctttctcctctccgttgtgggtgttccgggggaaaaag
OVRT1_0042_E01.b : cacttctccgcccctctggggtgcaccccacgtatatgttgtgcccccgcccagctatt
OVRT1_0036_G06.b : ggccccgggagaaattttttctctccccaaaaccggctgtgtgggtgtttctgtgttttt
OVRT1_0035_F07.b : caagtatataggggccgcacaaaatattctctttcagaagctagagag
OVRT1_0074_C11.b : tttttttcgctct
OVRT1_0084_H08.b : tttcgttctctgtgtctctccccgtaattttcgtggtccgctcgagaaaaaatctcctct
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b : ggga
TCH01_0011_H03.b :
LNG01_0103_C05.b : ccaaaaccccgaaaatttttttgtacaccctccgcggttcgaataaaaaccgttttttac
TES01_0070_D01.b : tatatatttcagactcttctcct
OVRT1_0123_G01.b : ctttttctttgttcgctcccgttg
CLNT1_0128_D11.b : cccttccgttgtgccttcgtcatttctattcgttgccaatctatttctctctcttattcc
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b : ggccacaaaaaaagttctcccttt
OVRT1_0033_A09.b : aaaactttttcgcgcctccgtgggttgccaccacaaagaattaatga
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b : ttaaaaccttcttggggcattggaaccccaattacccggaaaattttgtaggtacccccc
THY01_0040_A10.b :
OVRT1_0106_F03.b : cccctgnnnnnnnnnnnnnctaacactatacacgctatctatccgattcattnaacanct
OVRT1_0064_E08.b : tactccatgcttatctgttcacctttagcacatcatactatctgactctttatttatta
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b : tctcttgcttctcctcatcattacttctcgcatcttattcta
OVRM1_0154_A10.b :
OVRT1_0141_A10.b : ctccactatcatcttatttt
OVRT1_0132_E08.b : tctcccgcatatcttttatctactatagtattatctctctcctcctctttgtcgtatcaa
OVRT1_0136_B01.b : ccaatcctttctgatccgcgccgcaaacatctttcctctttctcctctccgctgccagct
OVRT1_0147_B03.b : ttgcgtagctatagggactatcgcttactctttctgcag
OVRT1_0143_E01.b : acatctagacactgttatagcttgatattatatctcttctactatat
LNG01_0035_A11.b :
LNG01_0080_G12.b : tctcatagagattttctggtgggccaatatccaacccccacagtttctttcacaccccat
TCH01_0033_G03.b :
OVRT1_0008_G02.b : ctcgctttggtgtctcctcctcaactctatttgcgccgccgtccctctttctctcctccg
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b : aaa
CLNT1_0055_E08.b : acgtctggggtgaagaaccacggactc
OVRT1_0141_A09.b : gggttgtccaccaaactatttgcgcgcgaggaattctcctctt
OVRT1_0003_C10.b : ccaaaatatggtggtactcgggtgtaatttctccttccctacatccctctctgcgaaact
OVRT1_0147_C10.b : gtatatatagtagcgtgtaataggtatctttatctcaattttcttattgctttatatgta
OVRT1_0002_A05.b : tctcacattgatataagtggcgctcggcatatttctttcctctttactcgtctctggggc
SMG01_0092_C12.b : tgggggggggggggcccccaaagcgcgcgggggggcccctcgggggtattttctcctcaa
OVRT1_0054_D09.b : gagacttttctctccctgtgggttccacccatatttttttgggcc
HTMT1_0044_C07.b : tgtgctctaatattaatcataagacaaaaaaat
CLNT1_0064_G09.b : ttactcactctccagaacacctgtttctgcctcttcgtggcggg
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b : tacctctttttataagtccggcacaaaaatttcttttcctacaccccctgtctgggaact
LNG01_0042_H03.b :
CLNT1_0064_F02.b : aagttttttggg
OVRT1_0042_D12.b : cataaccan
CLNT1_0096_D04.b : ccctggggtgcgcccctgatatatatggtgccgggccg
OVRT1_0058_D02.b : actttgggtgccacccaaaatatt
LNG01_0035_H02.b :
OVRT1_0073_E02.b : ttatgttgtccccccagatctttggcgccgcggaagatatttctctctccaaactgcggt
OVRT1_0073_A09.b : cctttttttctctcgcccggaatat
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b : aaaatattttt
CLNT1_0051_H02.b : tgtttttggcccggcgcagatttctctccttcacccctgcgtgggagaacaacagaaaaa
OVRT1_0035_E03.b : ttgtggggcggggcgatatatttctttccctatctctagttggggaatcacgatttatat
TCH01_0037_B04.b :
LNG01_0091_D10.b : attatgcccgaaaaaattatgtagttaaaccctcgttcggatttcgatatttcatttccg
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b : cgcttcatcggggcgggagcgaatatttctccccccactccttcggggggaacacactaa
OVRT1_0048_F02.b : tctagggctcaaaaaaga
CLNT1_0064_E03.b : attctactttcccaaaagcttcttctccctttctgggtgggcccccaccagtgtttactg
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b : tggggtcaccccgggtttaatgggccggccggcaatttttctttcc
CLNT1_0064_B01.b : tcccttttaggtgaaacacccacctctccttctaaagttttttc
CLNT1_0062_A10.b : ctcaaaaaagttttttctgcgttt
LNG01_0028_F08.b :
CLNT1_0007_E05.b : ctttttcgcgctgggggggccc
OVRT1_0022_E11.b : caaattccaacaaatttttttccgcgctttggg
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b : ctccaattagcccggaaataattttcgtaggtacaccccctcgccgccgctcttcccaat
PST01_0044_E03.b : ctttctatatatatcgtacattcgatctctctctctgtccgctatctctactggcgtagt
OVRT1_0005_G05.b : ccactctatttttctgaggacccaccatacatatataaaa
KDN01_0005_A09.b : ccaatttcaaagaattttttctccttttttgggtggcaccctaagtgtattgtggggccc
KDN01_0096_D09.b : agcaatatcccaatttcaaaaactttttttcccgtccttgtgggtggcaaaccaaatatt
KDN01_0091_A05.b : tctccatattcacaaaacgtttttcccggtctgagtgggtgtcccaacacagggtattat
PST01_0042_G06.b : attatttttccgccttgcgggtgtctacctaaataatttacgctaccatttacatataac
KDN01_0012_B08.b : gaaccctcaatttccaaagaatttttcgcgccatttgtgttgcccccacggtgttagtgt
KDN01_0035_D10.b : ctcccatttcccaaaagccttttttccgcattcaatggggttgccaaccaccaagatata
TES01_0056_A11.b : tttcatgtctctaccttcccattttcctcctcccttcttctcatccttttactcgtattc
OVRT1_0123_D02.b : cttttcttctctttgactccgttgtatacgttatactcatgctcctttgctctttttaat
OVRT1_0100_F07.b : cgctctaagatgtttggtactctcatttactgtgtatagcgtagcacttca
TES01_0059_H04.b : ccctctgtttcccaaagaactttcttctgcccctctgtgtgtgggtaccacccctatttc
PST01_0072_A08.b : ggtaccaaaaaagaaaacccccaatttccagaaaactttcctccggctacgtggggtgtc
PST01_0099_B11.b : ctttgtctttgccccttaataggggtcaaaaaaccaatgacctctcattttccaaataag
OVRT1_0120_H01.b : tctactccacctgctccactcttcttgttn
OVRT1_0093_E08.b : ttgtgaacacaaaaaataacttcttctaaatacggttgagaaatatataataaa
OVRT1_0019_D07.b : tctgtgggtcaacaattattattggtcgcacctttttcttcttttctattactgtgcggc
CLNT1_0150_E07.b : cttattgattgtataatatcatacccgcgatttcctttcctgagcatattgcaacacaat
OVRT1_0100_A06.b : cgcttttngtgggtgcccccactagctattacgtg
OVRT1_0072_D05.b : agcctcttgggggggtttctctgttctattnttnattatncacccnccccctcacgccgc
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0056_C12.b :
ILNT1_0020_C05.b : GGCATCCGCACCAGCGAGATCTgagtcttattccggcagcctctgcattcaxxxxxxxxx
ILNT1_0056_D06.b :
---------+---------+---------+---------+---------+---------+ 1505
CLNT1_0151_F03.b :
PST01_0033_B11.b : gag
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b : cn
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b : tagatgtcacggaacattatatgtctaatagatataacctctagactttattaacactca
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b : tctttcctccccaagacggccggcgtttggggggggccctcagggtaatgtcacacggaa
PST01_0054_E06.b : gcgggttttctcttggagaaatgagaagaagagagggggttttcccccgnnnnnnnncaa
PST01_0098_A12.b :
KDN01_0028_A09.b : tgtggggcccgcccaccaaatatcttcttctcccaaacacgccgggtgggggggggtctc
PST01_0074_D09.b : ttaatggtcggccgcg
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b : ggggccgcccatatttcttcttccctcctcctaaatggcctggtgtggggcgccgagttc
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b : tcttatgtgtgtgcccgggaga
KDN01_0028_B03.b : ataaatttctccttctctcctacagtgcgggggtgtgggggggttctcctcgggtgtctt
KDN01_0008_C02.b : ccaaaggcggggtggggggggcctcggtttttccttgttagaaagaaaaagangngggnn
CLNT1_0066_C04.b :
OVRT1_0128_B05.b : agctcctctttcttt
OVRT1_0124_B12.b :
OVRT1_0132_A05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnn
PST01_0041_H08.b : caagtattaatcgcttcgtct
OVRT1_0001_E06.b : tttttcggtctctannnn
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b : aattctct
OVRT1_0076_E05.b : tgtgatagactatgtaacaagctgctctcccacatag
OVRT1_0126_H09.b :
CLNT1_0113_G10.b : cc
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b : atatactttatctatctttacttctatctcatccttcactcactttct
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b : cgtgtttctttgctggatccttccttttcttttttgtgt
OVRT1_0036_C01.b :
OVRT1_0078_B06.b : cgcgatactctcacggataagagac
OVRT1_0082_B08.b : tatacttattctacatcttcggttatcagagc
LNG01_0034_G12.b :
OVRT1_0040_E06.b : cgtccccccggttgtgggggttcctcgtgtgcttcttcgatcacatatatcacacca
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b : tcctttcttctctccccg
OVRT1_0069_A11.b :
OVRT1_0036_C05.b : gtggggggtcactctggtttctctcgataattatcnataccgcctc
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b : agaaaggaccatt
OVRT1_0042_E01.b :
OVRT1_0036_G06.b : ccggggaaatgagagggcg
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b : cttctacgggctgtggtgg
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b : cctccccctcccttcccnnnnnnnnnnnnnntttnnaataatcttcctacactcccgcan
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b : tcctcttattctcattatcattatacatg
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b : cgcccatgttgaattaaaaacagcgttttgtttcacccttccccttactttttccccccn
THY01_0040_A10.b :
OVRT1_0106_F03.b : atccatctcctttca
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b : tctcctgtannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
OVRT1_0136_B01.b : ttcgttgtctcacccgtccc
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b : ctccgttagtacacccactcctcatatttactt
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b : ccctagaattaata
OVRT1_0147_C10.b : atcgag
OVRT1_0002_A05.b : ttccctgctcttctccctcagaatcatacccaccactcttcttctc
SMG01_0092_C12.b : aatttctccctgagaccccccccct
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b : ttgagttgtatatatatttat
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b : tggagagatacgaggtatctagag
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b : tagaa
OVRT1_0035_E03.b : agg
TCH01_0037_B04.b :
LNG01_0091_D10.b : aaagattttataattccactttccctctttgtgtcccctttatttacccaccctaagtgt
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b : aata
OVRT1_0048_F02.b :
CLNT1_0064_E03.b : cgcccgccgccccgcttcttcg
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b : taaatcacgccggttttgtttttccccccctcc
PST01_0044_E03.b : catcactcccgctgtactctcctccttacatgatatgttcagcttcacactcatatcctc
OVRT1_0005_G05.b :
KDN01_0005_A09.b : cggccccgcaaaattttctccctctcaaaaacgcgggttttggggggagatctcccggag
KDN01_0096_D09.b : atttggggtaccgcggacaatatatatccttcttctctccagaaacgggcg
KDN01_0091_A05.b : ggggtgcccggaggacctaattttcttcctctcctcaaatgtgcggtgtcgtggcaggtt
PST01_0042_G06.b : ttattttctcatttacttgtgttcgtggttcacaatatatacatcttctctcatatgact
KDN01_0012_B08.b : tggtccgggggacaattatctctatcctcaacaatctggtgtcggggggtgtccttcgtg
KDN01_0035_D10.b : aggtggaacccgggaccacgcaaataatcttctctctccccaaaacacgcgcganngtgg
TES01_0056_A11.b : tatgtgtttctcctan
OVRT1_0123_D02.b : tttaccacctgcctcatgcatctctctctatatgtcattctcacctctn
OVRT1_0100_F07.b :
TES01_0059_H04.b : tctactttgggccc
PST01_0072_A08.b : acacctcagttcttctgggagacccgggcaaactgattatcttctctccccaaacacacc
PST01_0099_B11.b : gatttttttc
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b : aactcattactctaagaagaaac
CLNT1_0150_E07.b : atgattagcctgcataattctctctattgtcttctatttcctcctttanatntaatnnnn
OVRT1_0100_A06.b :
OVRT1_0072_D05.b : cacgggccaccccc
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0056_C12.b :
ILNT1_0020_C05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxtacggcctctacctgcgnnnn
ILNT1_0056_D06.b :
---------+---------+---------+---------+---------+---------+ 1565
CLNT1_0151_F03.b :
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b :
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b : t
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b : gataaa
PST01_0054_E06.b : aaanncnccccccccatataaagagatcacgtgaaannnnnnnnnnnnnnnnnnngcgag
PST01_0098_A12.b :
KDN01_0028_A09.b : tcgcggggtctcctccgaggcagatatc
PST01_0074_D09.b :
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b : tccagaggggagtgttctcaaggg
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b : ctccancaaaaaaaaacaaacaacacacccgctcctctccc
KDN01_0008_C02.b : gnnnnnntannnnnacggcaganngnagngaccgcgctttgtagtttc
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b :
PST01_0041_H08.b :
OVRT1_0001_E06.b :
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b :
OVRT1_0076_E05.b :
OVRT1_0126_H09.b :
CLNT1_0113_G10.b :
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b :
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b :
OVRT1_0036_C01.b :
OVRT1_0078_B06.b :
OVRT1_0082_B08.b :
LNG01_0034_G12.b :
OVRT1_0040_E06.b :
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b :
OVRT1_0069_A11.b :
OVRT1_0036_C05.b :
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b :
OVRT1_0042_E01.b :
OVRT1_0036_G06.b :
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b :
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b :
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b : nnnnnnnnnnnannnnccacatgttcttgtcggagccccnnnnnnnnnnnnnnnnnnnnn
THY01_0040_A10.b :
OVRT1_0106_F03.b :
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b : nnnnnnnnnnnnnnnnnn
OVRT1_0136_B01.b :
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b :
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b :
OVRT1_0147_C10.b :
OVRT1_0002_A05.b :
SMG01_0092_C12.b :
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b :
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b :
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b :
OVRT1_0035_E03.b :
TCH01_0037_B04.b :
LNG01_0091_D10.b : ttttnnnaaaannnnnctnnnnnnaattatatcttctgatttctnnaaattnnttgtctc
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b :
OVRT1_0048_F02.b :
CLNT1_0064_E03.b :
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b :
PST01_0044_E03.b : ctattagtgtatatccgctatactcg
OVRT1_0005_G05.b :
KDN01_0005_A09.b : gtgtttctcccggtacaaataatgaacgccagaccaaaggtgtttttctccccc
KDN01_0096_D09.b :
KDN01_0091_A05.b : tgctctcgggttgttctccctgggctaaaatttaagcctagagacaatggtgtcttttcc
PST01_0042_G06.b : cgtaatcactgtgtgtatgtctacacnnncccnnntnnantattatcatcgtacagttag
KDN01_0012_B08.b : gntctctctttatttaagttataatgacacacgtctttttttcttcttctcc
KDN01_0035_D10.b : cggaagaa
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b : ggtggcggtggggagggttctcccggggtggtgtctccagtgatacggaag
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b :
CLNT1_0150_E07.b : nactaagcgtatgaaccagaactcagatacaactcctccnnn
OVRT1_0100_A06.b :
OVRT1_0072_D05.b :
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0056_C12.b :
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
---------+---------+---------+---------+---------+---------+ 1625
CLNT1_0151_F03.b :
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b :
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b :
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b :
PST01_0054_E06.b : ngnnnnn
PST01_0098_A12.b :
KDN01_0028_A09.b :
PST01_0074_D09.b :
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b :
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b :
KDN01_0008_C02.b :
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b :
PST01_0041_H08.b :
OVRT1_0001_E06.b :
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b :
OVRT1_0076_E05.b :
OVRT1_0126_H09.b :
CLNT1_0113_G10.b :
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b :
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b :
OVRT1_0036_C01.b :
OVRT1_0078_B06.b :
OVRT1_0082_B08.b :
LNG01_0034_G12.b :
OVRT1_0040_E06.b :
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b :
OVRT1_0069_A11.b :
OVRT1_0036_C05.b :
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b :
OVRT1_0042_E01.b :
OVRT1_0036_G06.b :
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b :
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b :
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
THY01_0040_A10.b :
OVRT1_0106_F03.b :
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b :
OVRT1_0136_B01.b :
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b :
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b :
OVRT1_0147_C10.b :
OVRT1_0002_A05.b :
SMG01_0092_C12.b :
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b :
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b :
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b :
OVRT1_0035_E03.b :
TCH01_0037_B04.b :
LNG01_0091_D10.b : ctannt
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b :
OVRT1_0048_F02.b :
CLNT1_0064_E03.b :
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b :
PST01_0044_E03.b :
OVRT1_0005_G05.b :
KDN01_0005_A09.b :
KDN01_0096_D09.b :
KDN01_0091_A05.b : cc
PST01_0042_G06.b : tgaactttgtca
KDN01_0012_B08.b :
KDN01_0035_D10.b :
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b :
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b :
CLNT1_0150_E07.b :
OVRT1_0100_A06.b :
OVRT1_0072_D05.b :
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b : nctgctagacctatttatattcacctcatgatttaagtccntctacagtccttatacttc
BKFL1_0056_C12.b :
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
---------+---------+---------+---------+---------+---------+ 1685
CLNT1_0151_F03.b :
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b :
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b :
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b :
PST01_0054_E06.b :
PST01_0098_A12.b :
KDN01_0028_A09.b :
PST01_0074_D09.b :
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b :
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b :
KDN01_0008_C02.b :
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b :
PST01_0041_H08.b :
OVRT1_0001_E06.b :
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b :
OVRT1_0076_E05.b :
OVRT1_0126_H09.b :
CLNT1_0113_G10.b :
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b :
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b :
OVRT1_0036_C01.b :
OVRT1_0078_B06.b :
OVRT1_0082_B08.b :
LNG01_0034_G12.b :
OVRT1_0040_E06.b :
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b :
OVRT1_0069_A11.b :
OVRT1_0036_C05.b :
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b :
OVRT1_0042_E01.b :
OVRT1_0036_G06.b :
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b :
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b :
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b :
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b : nnnnnnnnnnnn
THY01_0040_A10.b :
OVRT1_0106_F03.b :
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b :
OVRT1_0136_B01.b :
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b :
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b :
OVRT1_0147_C10.b :
OVRT1_0002_A05.b :
SMG01_0092_C12.b :
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b :
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b :
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b :
OVRT1_0035_E03.b :
TCH01_0037_B04.b :
LNG01_0091_D10.b :
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b :
OVRT1_0048_F02.b :
CLNT1_0064_E03.b :
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b :
PST01_0044_E03.b :
OVRT1_0005_G05.b :
KDN01_0005_A09.b :
KDN01_0096_D09.b :
KDN01_0091_A05.b :
PST01_0042_G06.b :
KDN01_0012_B08.b :
KDN01_0035_D10.b :
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b :
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b :
CLNT1_0150_E07.b :
OVRT1_0100_A06.b :
OVRT1_0072_D05.b :
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b : aaaagatgacagccnagagattctaggtaaactaccctggttttgaaaacctattgtact
BKFL1_0056_C12.b :
BKFL1_0049_E07.b : acttnccaaagatgacagccaaaaggattctaaggtaaactaacctgggtttttgaaaac
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
---------+---------+---------+---------+---------+---------+ 1745
CLNT1_0151_F03.b :
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b :
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b :
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b :
PST01_0054_E06.b :
PST01_0098_A12.b :
KDN01_0028_A09.b :
PST01_0074_D09.b :
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b :
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b :
KDN01_0008_C02.b :
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b :
PST01_0041_H08.b :
OVRT1_0001_E06.b :
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b :
OVRT1_0076_E05.b :
OVRT1_0126_H09.b :
CLNT1_0113_G10.b :
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b :
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b :
OVRT1_0036_C01.b :
OVRT1_0078_B06.b :
OVRT1_0082_B08.b :
LNG01_0034_G12.b :
OVRT1_0040_E06.b :
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b :
OVRT1_0069_A11.b :
OVRT1_0036_C05.b :
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b :
OVRT1_0042_E01.b :
OVRT1_0036_G06.b :
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b :
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b :
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b :
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b :
THY01_0040_A10.b :
OVRT1_0106_F03.b :
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b :
OVRT1_0136_B01.b :
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b :
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b :
OVRT1_0147_C10.b :
OVRT1_0002_A05.b :
SMG01_0092_C12.b :
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b :
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b :
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b :
OVRT1_0035_E03.b :
TCH01_0037_B04.b :
LNG01_0091_D10.b :
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b :
OVRT1_0048_F02.b :
CLNT1_0064_E03.b :
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b :
PST01_0044_E03.b :
OVRT1_0005_G05.b :
KDN01_0005_A09.b :
KDN01_0096_D09.b :
KDN01_0091_A05.b :
PST01_0042_G06.b :
KDN01_0012_B08.b :
KDN01_0035_D10.b :
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b :
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b :
CLNT1_0150_E07.b :
OVRT1_0100_A06.b :
OVRT1_0072_D05.b :
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b : tttcccctttcactagatctacnaagctgctgtcaatggcatcgttctccctaaacgccc
BKFL1_0056_C12.b :
BKFL1_0049_E07.b : cnattggttactttcccctcattcagctaggatctaacgaagctgctgtcaacctgccat
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
---------+---------+---------+---------+---------+---------+ 1805
CLNT1_0151_F03.b :
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b :
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b :
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b :
PST01_0054_E06.b :
PST01_0098_A12.b :
KDN01_0028_A09.b :
PST01_0074_D09.b :
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b :
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b :
KDN01_0008_C02.b :
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b :
PST01_0041_H08.b :
OVRT1_0001_E06.b :
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b :
OVRT1_0076_E05.b :
OVRT1_0126_H09.b :
CLNT1_0113_G10.b :
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b :
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b :
OVRT1_0036_C01.b :
OVRT1_0078_B06.b :
OVRT1_0082_B08.b :
LNG01_0034_G12.b :
OVRT1_0040_E06.b :
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b :
OVRT1_0069_A11.b :
OVRT1_0036_C05.b :
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b :
OVRT1_0042_E01.b :
OVRT1_0036_G06.b :
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b :
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b :
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b :
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b :
THY01_0040_A10.b :
OVRT1_0106_F03.b :
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b :
OVRT1_0136_B01.b :
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b :
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b :
OVRT1_0147_C10.b :
OVRT1_0002_A05.b :
SMG01_0092_C12.b :
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b :
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b :
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b :
OVRT1_0035_E03.b :
TCH01_0037_B04.b :
LNG01_0091_D10.b :
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b :
OVRT1_0048_F02.b :
CLNT1_0064_E03.b :
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b :
PST01_0044_E03.b :
OVRT1_0005_G05.b :
KDN01_0005_A09.b :
KDN01_0096_D09.b :
KDN01_0091_A05.b :
PST01_0042_G06.b :
KDN01_0012_B08.b :
KDN01_0035_D10.b :
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b :
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b :
CLNT1_0150_E07.b :
OVRT1_0100_A06.b :
OVRT1_0072_D05.b :
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b : atggcaacccaggtcctctgaaaaaacccgccggggtagccctaatttatcgacccgctt
BKFL1_0056_C12.b :
BKFL1_0049_E07.b : ccgttccacccaaaatctgccccatggcaaacaccgggtcctcctaaaaaaaccccgccg
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
---------+---------+---------+---------+---------+---------+ 1865
CLNT1_0151_F03.b :
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b :
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b :
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b :
PST01_0054_E06.b :
PST01_0098_A12.b :
KDN01_0028_A09.b :
PST01_0074_D09.b :
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b :
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b :
KDN01_0008_C02.b :
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b :
PST01_0041_H08.b :
OVRT1_0001_E06.b :
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b :
OVRT1_0076_E05.b :
OVRT1_0126_H09.b :
CLNT1_0113_G10.b :
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b :
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b :
OVRT1_0036_C01.b :
OVRT1_0078_B06.b :
OVRT1_0082_B08.b :
LNG01_0034_G12.b :
OVRT1_0040_E06.b :
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b :
OVRT1_0069_A11.b :
OVRT1_0036_C05.b :
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b :
OVRT1_0042_E01.b :
OVRT1_0036_G06.b :
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b :
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b :
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b :
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b :
THY01_0040_A10.b :
OVRT1_0106_F03.b :
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b :
OVRT1_0136_B01.b :
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b :
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b :
OVRT1_0147_C10.b :
OVRT1_0002_A05.b :
SMG01_0092_C12.b :
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b :
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b :
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b :
OVRT1_0035_E03.b :
TCH01_0037_B04.b :
LNG01_0091_D10.b :
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b :
OVRT1_0048_F02.b :
CLNT1_0064_E03.b :
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b :
PST01_0044_E03.b :
OVRT1_0005_G05.b :
KDN01_0005_A09.b :
KDN01_0096_D09.b :
KDN01_0091_A05.b :
PST01_0042_G06.b :
KDN01_0012_B08.b :
KDN01_0035_D10.b :
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b :
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b :
CLNT1_0150_E07.b :
OVRT1_0100_A06.b :
OVRT1_0072_D05.b :
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b : taaggggcgggtaggaccctttccccgtgaaaaacgaaagagaccaaattcctaaagggg
BKFL1_0056_C12.b :
BKFL1_0049_E07.b : gaggttaccccccgattttttccgggcccggatttacatgggccgggggtacctcccttt
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
---------+---------+---------+---------+---------+---------+ 1925
CLNT1_0151_F03.b :
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b :
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b :
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b :
PST01_0054_E06.b :
PST01_0098_A12.b :
KDN01_0028_A09.b :
PST01_0074_D09.b :
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b :
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b :
KDN01_0008_C02.b :
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b :
PST01_0041_H08.b :
OVRT1_0001_E06.b :
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b :
OVRT1_0076_E05.b :
OVRT1_0126_H09.b :
CLNT1_0113_G10.b :
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b :
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b :
OVRT1_0036_C01.b :
OVRT1_0078_B06.b :
OVRT1_0082_B08.b :
LNG01_0034_G12.b :
OVRT1_0040_E06.b :
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b :
OVRT1_0069_A11.b :
OVRT1_0036_C05.b :
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b :
OVRT1_0042_E01.b :
OVRT1_0036_G06.b :
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b :
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b :
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b :
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b :
THY01_0040_A10.b :
OVRT1_0106_F03.b :
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b :
OVRT1_0136_B01.b :
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b :
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b :
OVRT1_0147_C10.b :
OVRT1_0002_A05.b :
SMG01_0092_C12.b :
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b :
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b :
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b :
OVRT1_0035_E03.b :
TCH01_0037_B04.b :
LNG01_0091_D10.b :
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b :
OVRT1_0048_F02.b :
CLNT1_0064_E03.b :
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b :
PST01_0044_E03.b :
OVRT1_0005_G05.b :
KDN01_0005_A09.b :
KDN01_0096_D09.b :
KDN01_0091_A05.b :
PST01_0042_G06.b :
KDN01_0012_B08.b :
KDN01_0035_D10.b :
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b :
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b :
CLNT1_0150_E07.b :
OVRT1_0100_A06.b :
OVRT1_0072_D05.b :
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b : ccggaaagatctcttcaacgcccccttaaacatttgttttttcttcgcaaaatgaaaaaa
BKFL1_0056_C12.b :
BKFL1_0049_E07.b : tcccccgggtaaaaaacctaaaggttgggcccaaatttcctaaaaggggccccggaataa
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
---------+---------+---------+---------+---------+---------+ 1985
CLNT1_0151_F03.b :
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b :
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b :
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b :
PST01_0054_E06.b :
PST01_0098_A12.b :
KDN01_0028_A09.b :
PST01_0074_D09.b :
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b :
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b :
KDN01_0008_C02.b :
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b :
PST01_0041_H08.b :
OVRT1_0001_E06.b :
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b :
OVRT1_0076_E05.b :
OVRT1_0126_H09.b :
CLNT1_0113_G10.b :
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b :
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b :
OVRT1_0036_C01.b :
OVRT1_0078_B06.b :
OVRT1_0082_B08.b :
LNG01_0034_G12.b :
OVRT1_0040_E06.b :
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b :
OVRT1_0069_A11.b :
OVRT1_0036_C05.b :
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b :
OVRT1_0042_E01.b :
OVRT1_0036_G06.b :
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b :
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b :
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b :
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b :
THY01_0040_A10.b :
OVRT1_0106_F03.b :
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b :
OVRT1_0136_B01.b :
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b :
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b :
OVRT1_0147_C10.b :
OVRT1_0002_A05.b :
SMG01_0092_C12.b :
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b :
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b :
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b :
OVRT1_0035_E03.b :
TCH01_0037_B04.b :
LNG01_0091_D10.b :
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b :
OVRT1_0048_F02.b :
CLNT1_0064_E03.b :
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b :
PST01_0044_E03.b :
OVRT1_0005_G05.b :
KDN01_0005_A09.b :
KDN01_0096_D09.b :
KDN01_0091_A05.b :
PST01_0042_G06.b :
KDN01_0012_B08.b :
KDN01_0035_D10.b :
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b :
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b :
CLNT1_0150_E07.b :
OVRT1_0100_A06.b :
OVRT1_0072_D05.b :
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b : acccannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
BKFL1_0056_C12.b :
BKFL1_0049_E07.b : aaatttttttttcaaaaggcgtccttttaaaaaaaaaaatttgttttttttaagcctttc
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
---------+---------+---------+---------+---------+---------+ 2045
CLNT1_0151_F03.b :
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b :
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b :
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b :
PST01_0054_E06.b :
PST01_0098_A12.b :
KDN01_0028_A09.b :
PST01_0074_D09.b :
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b :
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b :
KDN01_0008_C02.b :
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b :
PST01_0041_H08.b :
OVRT1_0001_E06.b :
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b :
OVRT1_0076_E05.b :
OVRT1_0126_H09.b :
CLNT1_0113_G10.b :
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b :
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b :
OVRT1_0036_C01.b :
OVRT1_0078_B06.b :
OVRT1_0082_B08.b :
LNG01_0034_G12.b :
OVRT1_0040_E06.b :
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b :
OVRT1_0069_A11.b :
OVRT1_0036_C05.b :
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b :
OVRT1_0042_E01.b :
OVRT1_0036_G06.b :
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b :
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b :
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b :
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b :
THY01_0040_A10.b :
OVRT1_0106_F03.b :
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b :
OVRT1_0136_B01.b :
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b :
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b :
OVRT1_0147_C10.b :
OVRT1_0002_A05.b :
SMG01_0092_C12.b :
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b :
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b :
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b :
OVRT1_0035_E03.b :
TCH01_0037_B04.b :
LNG01_0091_D10.b :
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b :
OVRT1_0048_F02.b :
CLNT1_0064_E03.b :
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b :
PST01_0044_E03.b :
OVRT1_0005_G05.b :
KDN01_0005_A09.b :
KDN01_0096_D09.b :
KDN01_0091_A05.b :
PST01_0042_G06.b :
KDN01_0012_B08.b :
KDN01_0035_D10.b :
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b :
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b :
CLNT1_0150_E07.b :
OVRT1_0100_A06.b :
OVRT1_0072_D05.b :
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b : nnnnnnnnnnnnnnnnnnn
BKFL1_0056_C12.b :
BKFL1_0049_E07.b : gggaaaaaaattttggggggnnnnnnnnnnnnnnaaaaaaaaaaaaaaaaaaaaaaaggg
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
---------+---------+---------+---------+---------+---------+ 2105
CLNT1_0151_F03.b :
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :
TES01_0001_D08.b :
OVRT1_0044_E01.b :
TES01_0040_A03.b :
OVRT1_0149_B12.b :
TES01_0112_B01.b :
CLNT1_0096_B04.b :
OVRT1_0025_C10.b :
PST01_0042_A08.b :
KDN01_0016_C12.b :
CLNT1_0022_F10.b :
KDN01_0093_D03.b :
PST01_0054_E06.b :
PST01_0098_A12.b :
KDN01_0028_A09.b :
PST01_0074_D09.b :
LVR01_0057_C12.b :
OVRT1_0022_A06.b :
KDN01_0079_F03.b :
PST01_0039_F12.b :
KDN01_0080_C12.b :
PST01_0080_F02.b :
KDN01_0028_B03.b :
KDN01_0008_C02.b :
CLNT1_0066_C04.b :
OVRT1_0128_B05.b :
OVRT1_0124_B12.b :
OVRT1_0132_A05.b :
PST01_0041_H08.b :
OVRT1_0001_E06.b :
OVRT1_0004_A04.b :
CLNT1_0041_F04.b :
OVRT1_0041_G09.b :
SPLT1_0001_G07.b :
OVR01_0043_B12.b :
PST01_0064_F10.b :
OVRT1_0076_E05.b :
OVRT1_0126_H09.b :
CLNT1_0113_G10.b :
CLNT1_0146_A11.b :
TES01_0101_A03.b :
CLNT1_0115_D01.b :
OVRT1_0045_G02.b :
OVRT1_0082_A12.b :
OVRT1_0098_F02.b :
OVRT1_0045_B04.b :
OVRT1_0087_B04.b :
OVRT1_0036_C01.b :
OVRT1_0078_B06.b :
OVRT1_0082_B08.b :
LNG01_0034_G12.b :
OVRT1_0040_E06.b :
LNG01_0046_F07.b :
TCH01_0046_A02.b :
OVRT1_0038_A03.b :
OVRT1_0069_A11.b :
OVRT1_0036_C05.b :
TCH01_0028_A06.b :
OVRT1_0041_A04.b :
OVRT1_0023_B04.b :
OVRT1_0042_E01.b :
OVRT1_0036_G06.b :
OVRT1_0035_F07.b :
OVRT1_0074_C11.b :
OVRT1_0084_H08.b :
TCH01_0023_B08.b :
TCH01_0039_H04.b :
TCH01_0087_F04.b :
TCH01_0011_H03.b :
LNG01_0103_C05.b :
TES01_0070_D01.b :
OVRT1_0123_G01.b :
CLNT1_0128_D11.b :
TCH01_0093_B10.b :
TCH01_0093_E09.b :
CLNT1_0074_H09.b :
OVRT1_0033_A09.b :
TCH01_0085_H10.b :
TCH01_0039_E03.b :
LNG01_0098_D07.b :
THY01_0040_A10.b :
OVRT1_0106_F03.b :
OVRT1_0064_E08.b :
OVRM1_0204_C10.b :
UTR01_0075_C07.b :
OVRM1_0206_H10.b :
OVRT1_0143_G01.b :
OVRM1_0154_A10.b :
OVRT1_0141_A10.b :
OVRT1_0132_E08.b :
OVRT1_0136_B01.b :
OVRT1_0147_B03.b :
OVRT1_0143_E01.b :
LNG01_0035_A11.b :
LNG01_0080_G12.b :
TCH01_0033_G03.b :
OVRT1_0008_G02.b :
TCH01_0012_C01.b :
OVRM1_0059_H02.b :
OVRT1_0028_E11.b :
CLNT1_0055_E08.b :
OVRT1_0141_A09.b :
OVRT1_0003_C10.b :
OVRT1_0147_C10.b :
OVRT1_0002_A05.b :
SMG01_0092_C12.b :
OVRT1_0054_D09.b :
HTMT1_0044_C07.b :
CLNT1_0064_G09.b :
UTR01_0045_A04.b :
CLNT1_0061_A10.b :
OVRT1_0085_E08.b :
LNG01_0042_H03.b :
CLNT1_0064_F02.b :
OVRT1_0042_D12.b :
CLNT1_0096_D04.b :
OVRT1_0058_D02.b :
LNG01_0035_H02.b :
OVRT1_0073_E02.b :
OVRT1_0073_A09.b :
MLN01_0069_C05.b :
LNG01_0034_F12.b :
OVRT1_0043_F11.b :
CLNT1_0051_H02.b :
OVRT1_0035_E03.b :
TCH01_0037_B04.b :
LNG01_0091_D10.b :
UTR01_0043_B07.b :
UTR01_0060_D01.b :
MLN01_0101_H05.b :
CLNT1_0066_E04.b :
OVRT1_0048_F02.b :
CLNT1_0064_E03.b :
OVRT1_0031_H01.b :
CLNT1_0014_A11.b :
UTR01_0052_H06.b :
CLNT1_0074_E03.b :
CLNT1_0064_B01.b :
CLNT1_0062_A10.b :
LNG01_0028_F08.b :
CLNT1_0007_E05.b :
OVRT1_0022_E11.b :
LNG01_0002_H02.b :
TCH01_0027_F05.b :
ITT01_0012_E04.b :
PST01_0044_E03.b :
OVRT1_0005_G05.b :
KDN01_0005_A09.b :
KDN01_0096_D09.b :
KDN01_0091_A05.b :
PST01_0042_G06.b :
KDN01_0012_B08.b :
KDN01_0035_D10.b :
TES01_0056_A11.b :
OVRT1_0123_D02.b :
OVRT1_0100_F07.b :
TES01_0059_H04.b :
PST01_0072_A08.b :
PST01_0099_B11.b :
OVRT1_0120_H01.b :
OVRT1_0093_E08.b :
OVRT1_0019_D07.b :
CLNT1_0150_E07.b :
OVRT1_0100_A06.b :
OVRT1_0072_D05.b :
OVR01_0090_D11.b :
OVRT1_0111_F01.b :
BKFL1_0103_C07.b :
BKFL1_0056_C12.b :
BKFL1_0049_E07.b : ggaaaaaaaaaggcccccaaaattttgggggggtgttttttttgttctaccccaaaaaaa
ILNT1_0020_C05.b :
ILNT1_0056_D06.b :
---------+---------+---------+---------+---------+---------+ 2150
CLNT1_0151_F03.b :
PST01_0033_B11.b :
TES01_0020_A03.b :
OVRT1_0100_C01.b :