[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-012764

Length: 1,010

Sequence [FASTA format sequence]
GTCTTGGTGT TCCGCCCTCC CTGCCGGCAA AGGGTGGCAG AGTAGCCTGC AAACATCGGC
GGCGAGTGGG GATGGCGGCA GTGGCAGCGG CAGCGGCGGT TGCTGTGGGA CGGCTACTGC
GGCTCCGGGT GGCCCGGGTG GAGGGACACT GGCATCCCCT GAGTGGCGGG GGGCTGCTGC
GGGGCTTCCT GCAACCTGCC TCAGCCGACG GGGATGCGGC CCAGAAGCGG CAGGTGGCTC
ACTTCACTTT CCAGCCCGAC CCGGAGACCG TGGAGTACGG GCAAACTCAG AAAATGAATC
TCTTCCAGGC AGTAACAAGT GCCTTGGATA ACTCATTGGC CAAAGATCCT ACTGCAGTAA
TATTTGGTGA AGATGTGGCC TTTGGTGGAG TCTTTAGATG TACTGTTGGC TTGCGAGACA
AGTATGGTAA AGATAGAGTT TTTAATACCC CACTGTGTGA ACAGGGAATT GTTGGATTTG
GAATCGGGAT TGCAGTCACT GGTGCTACTG CCATTGCGGA AATTCAGTTT GCAGATTATA
TTTTCCCTGC TTTTGATCAG ATAGTTAATG AAGCTGCCAA GTATCGTTAT CGCTCTGGGG
ATCTCTTTAA TTGTGGCAGC CTCACGATCC GGTCCCCTTG GGGCTGTGTC GGCCATGGGG
CTCTCTATCA TTCCCAGAGT CCTGAAGCAT TCTTTGCCCA CTGCCCAGGA ATCAAGGTGG
TTGTACCCAG AAGCCCTTTC CAAGCTAAGG GACTTCTCTT GTCATGCATA GAGGATAAAA
ATCCTTGTAT ATTTTTTGAA CCTAAAATAC TTTACAGAGC AGCAGTGGAA CAGGTTCCCA
TAGAACCATA CACTATCCCT CTGTCCCAGG CCGAAGTCAT CCAAGAAGGG AGTGATGTGA
CTCTTGTTGC CTGGGGCACT CAGGTTCATG TGATCCGAGA GGTTGCTTCC ATGGCTCGGG
AGAAGCTTGG AGTGTCCTGT GAGGTCATTG ATCTGAGGAC TATAATTCCT


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinBCKDHB2-oxoisovalerate dehydrogenase subunit beta, mitochondrial precursor [Homo sapiens]. 516e-146O
Contig/Assembly ProteinBCKDHB2-oxoisovalerate dehydrogenase subunit beta, mitochondrial precursor [Homo sapiens]. 516e-146O
Contig/Assembly ProteinPDHBpyruvate dehydrogenase E1 component subunit beta, mitochondrial isoform 1 precursor [Homo sapiens]. 1301e-30O
Contig/Assembly ProteinPDHBpyruvate dehydrogenase E1 component subunit beta, mitochondrial isoform 2 precursor [Homo sapiens]. 1202e-27O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinBckdhb2-oxoisovalerate dehydrogenase subunit beta, mitochondrial [Mus musculus]. 438e-123O
Contig/Assembly ProteinPdhbpyruvate dehydrogenase E1 component subunit beta, mitochondrial precursor [Mus musculus]. 1332e-31O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC474978PREDICTED: similar to 2-oxoisovalerate dehydrogenase beta subunit, mitochondrial precursor (Branched-chain alpha-keto acid dehydrogenase E1 component beta chain) (BCKDH E1-beta) [Canis familiaris]. 501e-142O
Contig/Assembly ProteinLOC476574PREDICTED: similar to Pyruvate dehydrogenase E1 component beta subunit, mitochondrial precursor (PDHE1-B) isoform 4 [Canis familiaris]. 1319e-31O
Contig/Assembly ProteinLOC476574PREDICTED: similar to Pyruvate dehydrogenase E1 component beta subunit, mitochondrial precursor (PDHE1-B) isoform 1 [Canis familiaris]. 1302e-30O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinBCKDHB2-oxoisovalerate dehydrogenase subunit beta, mitochondrial precursor [Bos taurus]. 514e-146O
Contig/Assembly ProteinPDHBpyruvate dehydrogenase E1 component subunit beta, mitochondrial precursor [Bos taurus]. 1341e-31O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinBCKDHB2-oxoisovalerate dehydrogenase subunit beta, mitochondrial [Sus scrofa]. 553e-158O
Contig/Assembly ProteinLOC100516042PREDICTED: pyruvate dehydrogenase E1 component subunit beta, mitochondrial-like [Sus scrofa]. 1315e-31O


Assembly Members: 42      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
CBLT10043E10CBLT1_0043_E10.bHX214732 
CBLT10066F03CBLT1_0066_F03.bHX216406 
CLNT10084E05CLNT1_0084_E05.b  
HTMT10023A12HTMT1_0023_A12.bFS665883 AK391788
KDN010087D11KDN01_0087_D11.bFS677339 
LVRM10039D06LVRM1_0039_D06.bCJ001752 
LVRM10040E05LVRM1_0040_E05.bBW962861 
LVRM10070G05LVRM1_0070_G05.bBP453253 
LVRM10094B01LVRM1_0094_B01.bCJ003507 
LVRM10178E03LVRM1_0178_E03.bCJ005281 
OVR010030A03OVR01_0030_A03.b  
OVR010070D09OVR01_0070_D09.bBW965854 
OVR010073E09OVR01_0073_E09.bBW966123 
OVRM10015A05OVRM1_0015_A05.bBP145263 
OVRM10016A08OVRM1_0016_A08.bBP145592 
OVRM10019H12OVRM1_0019_H12.bBP462226 
OVRM10036C06OVRM1_0036_C06.bBP147919 
OVRM10072B03OVRM1_0072_B03.bBP146387 
OVRM10114G02OVRM1_0114_G02.bBP152544 AK235778
OVRM10133E07OVRM1_0133_E07.bBP150604 
OVRM10151G02OVRM1_0151_G02.bBP460498 
OVRM10179B06OVRM1_0179_B06.bBW968545 
OVRM10185B04OVRM1_0185_B04.bBP455838 
OVRM10193A04OVRM1_0193_A04.bBP454929 
OVRM10197G07OVRM1_0197_G07.bBP460944 
OVRT10023D10OVRT1_0023_D10.bFS688280 
OVRT10023H03OVRT1_0023_H03.bFS688319 
OVRT10074F05OVRT1_0074_F05.bFS692451 
OVRT10074H04OVRT1_0074_H04.bFS692471 
OVRT10077F03OVRT1_0077_F03.bFS692694 
OVRT10096F11OVRT1_0096_F11.bFS694257 
OVRT10098E11OVRT1_0098_E11.bFS694417 
OVRT10114A10OVRT1_0114_A10.bHX235913 
OVRT10118H08OVRT1_0118_H08.bHX236325 
PST010038E04PST01_0038_E04.bFS699814 
PST010043F10PST01_0043_F10.bFS700236 
PST010074B05PST01_0074_B05.bFS702636 
PST010075D01PST01_0075_D01.bFS702741 
PTG010094E02PTG01_0094_E02.bFS712178 
THY010034F11THY01_0034_F11.bBP166638 
THY010086E09THY01_0086_E09.bBP165223 
THY010111E05THY01_0111_E05.bBP164836 

  

SNP: 1      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
215C060.154MSGAC/D
T2490.846GAT/D


Alignment:      TOP

20110601C-012764 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRM1_0114_G02.b : cagttgtc
OVRM1_0036_C06.b : gccccccnnntnccccccccnnncccncgnncttttttatatattatnttncncacaxxx
LVRM1_0040_E05.b : c
CBLT1_0066_F03.b :
CBLT1_0043_E10.b :
HTMT1_0023_A12.b :
OVRM1_0072_B03.b :
OVRM1_0019_H12.b :
PST01_0038_E04.b :
OVRT1_0096_F11.b :
LVRM1_0070_G05.b :
OVRT1_0074_H04.b :
OVRT1_0023_D10.b :
OVR01_0030_A03.b :
OVR01_0073_E09.b :
LVRM1_0039_D06.b :
OVRT1_0114_A10.b :
PTG01_0094_E02.b :
PST01_0074_B05.b :
PST01_0075_D01.b :
KDN01_0087_D11.b :
PST01_0043_F10.b :
OVRM1_0193_A04.b :
LVRM1_0094_B01.b :
LVRM1_0178_E03.b :
OVRM1_0151_G02.b :
OVRM1_0197_G07.b :
OVRM1_0133_E07.b :
OVRM1_0179_B06.b :
OVRM1_0015_A05.b :
OVRM1_0185_B04.b :
OVRM1_0016_A08.b :
OVRT1_0118_H08.b :
OVR01_0070_D09.b :
THY01_0034_F11.b :
THY01_0086_E09.b :
OVRT1_0074_F05.b :
OVRT1_0098_E11.b :
OVRT1_0023_H03.b :
CLNT1_0084_E05.b :
OVRT1_0077_F03.b :
THY01_0111_E05.b :
20110601C-012764 : ....................................................GTCTTGGT
---------+---------+---------+---------+---------+---------+ 8
OVRM1_0114_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTCTTGGT
OVRM1_0036_C06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxggt
LVRM1_0040_E05.b : agttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxt
CBLT1_0066_F03.b : tttttnggacggtagaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
CBLT1_0043_E10.b : ttttccaggtagaggxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
HTMT1_0023_A12.b : nntttagacaggtacgaggccgtxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0072_B03.b : atxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRM1_0019_H12.b : tagttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
PST01_0038_E04.b :
OVRT1_0096_F11.b : nttccttctgcgcacgxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0070_G05.b : nagttgtcxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0074_H04.b : nnnaatacgttagctgacgxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0023_D10.b : nntttcctatagctgtcggxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0030_A03.b : ggaacttattgtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVR01_0073_E09.b : tagcttttagtgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
LVRM1_0039_D06.b : gcgttgtcxxxxxxxxxxx
OVRT1_0114_A10.b : nntttccgtcagcgnacgxxxxxxxxxxxxxx
PTG01_0094_E02.b : nnnnnnnnnnnnnnnnnnnnnnn
PST01_0074_B05.b :
PST01_0075_D01.b :
KDN01_0087_D11.b :
PST01_0043_F10.b :
OVRM1_0193_A04.b : agttgtcatxxxxxxxxxx
LVRM1_0094_B01.b : xxxx
LVRM1_0178_E03.b : gtcxxxxxxxxxxxx
OVRM1_0151_G02.b : agttgtcxxxxxxxxxxx
OVRM1_0197_G07.b : agttgtcatxxxxxxxxx
OVRM1_0133_E07.b : nagtttgtcxxxxxxxxxxxxx
OVRM1_0179_B06.b : cgttgtcxxxxxxxxxxx
OVRM1_0015_A05.b : agattgxxxxxxxxxxxxxx
OVRM1_0185_B04.b : gagtttgtcxxxxxxxxxx
OVRM1_0016_A08.b : xxxxxxxxxxxxxxxxxxxx
OVRT1_0118_H08.b : nncctcttttgctgtcgxxxxxxxxxxxxx
OVR01_0070_D09.b : gtttggxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0034_F11.b : ttttggctgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
THY01_0086_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
OVRT1_0074_F05.b : nggaccctattgcgnacgxxxxxxxxxxxx
OVRT1_0098_E11.b : nnncccttcgcgcacgaggttxxxx
OVRT1_0023_H03.b : nncctcctcttgcgnacgxxxxxxxx
CLNT1_0084_E05.b : ntttctcnnnnnncccttcgcgtcgagtgtxxx
OVRT1_0077_F03.b : nnccctctatctgcgt
THY01_0111_E05.b :
20110601C-012764 : GTTCCGCCCTCCCTGCCGGCAAAGGGTGGCAGAGTAGCCTGCAAACATCGGCGGCGAGTG
---------+---------+---------+---------+---------+---------+ 68
OVRM1_0114_G02.b : GTTCCGCCCTCCCTGCCGGCAAAGGGTGGCAGAGTAGCCTGCAAACATCGGCGGCGAGTG
OVRM1_0036_C06.b : gctccGCCCTCCCTGCCGGCAAAGGGTGGCAGAGTAGCCTGCAAACATCGGCGGCGAGTG
LVRM1_0040_E05.b : cttccGCCCTCCCTGCCGGCAAAGGGTGGCAGAGTAGCCTGCAAACATCGGCGGCGAGTG
CBLT1_0066_F03.b : xxtggGCCCTCCCTGCCGGCAAAGGGTGGCAGAGTAGCCTGCAAACATCGGCGGCGAGTG
CBLT1_0043_E10.b : xxtggGCCCTCCCTGCCCGTA*AGGGTGGCAGAGTAGCCTGCAAACATCGGCGGCGAGTG
HTMT1_0023_A12.b : xxxxxxxxxgCCCTGCCGGCAAAGGGTGGCAGAGTAGCCTGCAAACATCGGCGGCGAGTG
OVRM1_0072_B03.b : xxxxxxxxxxxxxxxxxxxxxxxGGGTGGCAGAGTAGCCTGCAAACATcggcggcgagtg
OVRM1_0019_H12.b : xxxxxxxxxxxxxxxxxxxxxxxGGGTGGCAGAGTAGCCTGCAAACATCGGCGGCGAGTG
PST01_0038_E04.b : cgcgttggctctgggaaaggtggAGAGTAGCCTGCA*ACATCGGCGGCGAGTG
OVRT1_0096_F11.b : xxxxxxxxxxxxxxxxxxxxxxxcctttggAGAGTAGCCTGCAAACATCGGCGGCGAGTG
LVRM1_0070_G05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGTAGCCTGCAAACATCGGCGGCGAGTG
OVRT1_0074_H04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGTAGCCTGCAAACATCGGCGGCGAGTG
OVRT1_0023_D10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGAGTAGCCTGCAAACATCGGCGGCGAGTG
OVR01_0030_A03.b : xxxxxxxxxxxxxxxxxxxxxxcgtttaactggGTAGCCTGCAAACATCGGCGGCGAGTG
OVR01_0073_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAAACATCGGCGGCGAGTG
LVRM1_0039_D06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAAACATCGGCGGCGAGTG
OVRT1_0114_A10.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAAACATCGGCGGCGAGTG
PTG01_0094_E02.b : nnnnnnnnnnnnnnnnnnnnnnnnnnnnnxxxxxxxxxxxxGCAACATCGGCGGCGAGTG
PST01_0074_B05.b : nnnctgcgttggctctggaagtacctGCAACATCGGCGGCGAGTG
PST01_0075_D01.b : nttttcctgcggtggctatggGCAACATCGGCGGCGAGTG
KDN01_0087_D11.b : tttttgctgcgttggctctggaagggtggcgaaagcctGCAACATCGGCGGCGAGTG
PST01_0043_F10.b : ntttcctggctgtggctactggAACATCGGCGGCGAGTG
OVRM1_0193_A04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCGGCGGCGAGTG
LVRM1_0094_B01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCGGCGGCGAGTG
LVRM1_0178_E03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCGGCGGCGAGTG
OVRM1_0151_G02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCGGCGGCGAGTG
OVRM1_0197_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCGGCGGCGAGTG
OVRM1_0133_E07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCGGCGGCGAGTG
OVRM1_0179_B06.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCGGCGGCGAGTG
OVRM1_0015_A05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCGGCGGCGAGTG
OVRM1_0185_B04.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCGGCGGCGAGTG
OVRM1_0016_A08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCGGCGGCGAGTG
OVRT1_0118_H08.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCGGCGGCGAGTG
OVR01_0070_D09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCGGCGGCGAGTG
THY01_0034_F11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCGGCGGCGAGTG
THY01_0086_E09.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCGGCGGCGAGTG
OVRT1_0074_F05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCATCGGCGGCGAGTG
OVRT1_0098_E11.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxttaaaATCGGCGGCGAGTG
OVRT1_0023_H03.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCGGCGGCGAGTG
CLNT1_0084_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxcatttaaatTCGGCGGCGAGTG
OVRT1_0077_F03.b : ctgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGTG
THY01_0111_E05.b :
20110601C-012764 : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
---------+---------+---------+---------+---------+---------+ 128
OVRM1_0114_G02.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
OVRM1_0036_C06.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
LVRM1_0040_E05.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
CBLT1_0066_F03.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
CBLT1_0043_E10.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
HTMT1_0023_A12.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
OVRM1_0072_B03.b : gggatggcggcagtggcagcggcggcggcggttgctgtgggacggctactgcggcTCCGG
OVRM1_0019_H12.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
PST01_0038_E04.b : GGGATGGCGGTAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
OVRT1_0096_F11.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
LVRM1_0070_G05.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
OVRT1_0074_H04.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
OVRT1_0023_D10.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
OVR01_0030_A03.b : GGGACGTCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
OVR01_0073_E09.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
LVRM1_0039_D06.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
OVRT1_0114_A10.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
PTG01_0094_E02.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
PST01_0074_B05.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
PST01_0075_D01.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
KDN01_0087_D11.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
PST01_0043_F10.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
OVRM1_0193_A04.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
LVRM1_0094_B01.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
LVRM1_0178_E03.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
OVRM1_0151_G02.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
OVRM1_0197_G07.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
OVRM1_0133_E07.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCCGTGGGACGGCTACTGCGGCTCCGG
OVRM1_0179_B06.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
OVRM1_0015_A05.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
OVRM1_0185_B04.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
OVRM1_0016_A08.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
OVRT1_0118_H08.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
OVR01_0070_D09.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
THY01_0034_F11.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
THY01_0086_E09.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
OVRT1_0074_F05.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
OVRT1_0098_E11.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
OVRT1_0023_H03.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
CLNT1_0084_E05.b : GGGATGGCGGCAGTGGCACCCTCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
OVRT1_0077_F03.b : GGGATGGCGGCAGTGGCAGCGGCAGCGGCGGTTGCTGTGGGACGGCTACTGCGGCTCCGG
THY01_0111_E05.b :
20110601C-012764 : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
---------+---------+---------+---------+---------+---------+ 188
OVRM1_0114_G02.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
OVRM1_0036_C06.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
LVRM1_0040_E05.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
CBLT1_0066_F03.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
CBLT1_0043_E10.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
HTMT1_0023_A12.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
OVRM1_0072_B03.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
OVRM1_0019_H12.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
PST01_0038_E04.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
OVRT1_0096_F11.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
LVRM1_0070_G05.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
OVRT1_0074_H04.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
OVRT1_0023_D10.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
OVR01_0030_A03.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
OVR01_0073_E09.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
LVRM1_0039_D06.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
OVRT1_0114_A10.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
PTG01_0094_E02.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
PST01_0074_B05.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
PST01_0075_D01.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
KDN01_0087_D11.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
PST01_0043_F10.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
OVRM1_0193_A04.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
LVRM1_0094_B01.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
LVRM1_0178_E03.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
OVRM1_0151_G02.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
OVRM1_0197_G07.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
OVRM1_0133_E07.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
OVRM1_0179_B06.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
OVRM1_0015_A05.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
OVRM1_0185_B04.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
OVRM1_0016_A08.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
OVRT1_0118_H08.b : GTGGCCCGGGTGGAGGGACGCTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
OVR01_0070_D09.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
THY01_0034_F11.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
THY01_0086_E09.b : GTGGCCCGGGTGGGGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
OVRT1_0074_F05.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
OVRT1_0098_E11.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
OVRT1_0023_H03.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
CLNT1_0084_E05.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGACGGGGGGCTGCTGCGGGGCTTC
OVRT1_0077_F03.b : GTGGCCCGGGTGGAGGGACACTGGCATCCCCTGAGTGGCGGGGGGCTGCTGCGGGGCTTC
THY01_0111_E05.b : gttgcaaaaacaggctggtacggtcggaatcctcagcactgttggcctatgggctt
20110601C-012764 : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
---------+---------+---------+---------+---------+---------+ 248
OVRM1_0114_G02.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVRM1_0036_C06.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTNACT
LVRM1_0040_E05.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
CBLT1_0066_F03.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
CBLT1_0043_E10.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
HTMT1_0023_A12.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVRM1_0072_B03.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVRM1_0019_H12.b : CTGCAACCTGCCTCAGCCGACGGGGACGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
PST01_0038_E04.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVRT1_0096_F11.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
LVRM1_0070_G05.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVRT1_0074_H04.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVRT1_0023_D10.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVR01_0030_A03.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVR01_0073_E09.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
LVRM1_0039_D06.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVRT1_0114_A10.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
PTG01_0094_E02.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
PST01_0074_B05.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
PST01_0075_D01.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
KDN01_0087_D11.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
PST01_0043_F10.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVRM1_0193_A04.b : CTGCAACCTGCCTCAGCCGACGGGGACGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
LVRM1_0094_B01.b : CTGCAACCTGCCTCAGCCGACGGGGACGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
LVRM1_0178_E03.b : CTGCAACCTGCCTCAGCCGACGGGGACGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVRM1_0151_G02.b : CTGCAACCTGCCTCAGCCGACGGGGACGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVRM1_0197_G07.b : CTGCAACCTGCCTCAGCCGACGGGGACGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVRM1_0133_E07.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVRM1_0179_B06.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVRM1_0015_A05.b : CTGCAACCTGCCTCAGCCGACGGGGACGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVRM1_0185_B04.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVRM1_0016_A08.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVRT1_0118_H08.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVR01_0070_D09.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
THY01_0034_F11.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
THY01_0086_E09.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVRT1_0074_F05.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVRT1_0098_E11.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVRT1_0023_H03.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
CLNT1_0084_E05.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
OVRT1_0077_F03.b : CTGCAACCTGCCTCAGCCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
THY01_0111_E05.b : CTGCAACCTGCCTCA*CCGACGGGGATGCGGCCCAGAAGCGGCAGGTGGCTCACTTCACT
20110601C-012764 : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
---------+---------+---------+---------+---------+---------+ 308
OVRM1_0114_G02.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
OVRM1_0036_C06.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
LVRM1_0040_E05.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
CBLT1_0066_F03.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
CBLT1_0043_E10.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
HTMT1_0023_A12.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
OVRM1_0072_B03.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
OVRM1_0019_H12.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
PST01_0038_E04.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
OVRT1_0096_F11.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
LVRM1_0070_G05.b : TTCCAGCCCGACCCGGAGACCATGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
OVRT1_0074_H04.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTTCAG
OVRT1_0023_D10.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
OVR01_0030_A03.b : TTCCAGCCAGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
OVR01_0073_E09.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
LVRM1_0039_D06.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
OVRT1_0114_A10.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
PTG01_0094_E02.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
PST01_0074_B05.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
PST01_0075_D01.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
KDN01_0087_D11.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
PST01_0043_F10.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
OVRM1_0193_A04.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
LVRM1_0094_B01.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
LVRM1_0178_E03.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
OVRM1_0151_G02.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
OVRM1_0197_G07.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
OVRM1_0133_E07.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
OVRM1_0179_B06.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCATAAAATGAATCTCTTCCAG
OVRM1_0015_A05.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
OVRM1_0185_B04.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
OVRM1_0016_A08.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
OVRT1_0118_H08.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
OVR01_0070_D09.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
THY01_0034_F11.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
THY01_0086_E09.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
OVRT1_0074_F05.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
OVRT1_0098_E11.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
OVRT1_0023_H03.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
CLNT1_0084_E05.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
OVRT1_0077_F03.b : TTCCAGCCCGACCCGGAGACCGTGGAGTCCGGGCAAACTCAGAAAATGAATCTCTTCCAG
THY01_0111_E05.b : TTCCAGCCCGACCCGGAGACCGTGGAGTACGGGCAAACTCAGAAAATGAATCTCTTCCAG
20110601C-012764 : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
---------+---------+---------+---------+---------+---------+ 368
OVRM1_0114_G02.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVRM1_0036_C06.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAATAATATTTGGC
LVRM1_0040_E05.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
CBLT1_0066_F03.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
CBLT1_0043_E10.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
HTMT1_0023_A12.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVRM1_0072_B03.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVRM1_0019_H12.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
PST01_0038_E04.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVRT1_0096_F11.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
LVRM1_0070_G05.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVRT1_0074_H04.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVRT1_0023_D10.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVR01_0030_A03.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVR01_0073_E09.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
LVRM1_0039_D06.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVRT1_0114_A10.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
PTG01_0094_E02.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
PST01_0074_B05.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
PST01_0075_D01.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
KDN01_0087_D11.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
PST01_0043_F10.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVRM1_0193_A04.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
LVRM1_0094_B01.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
LVRM1_0178_E03.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVRM1_0151_G02.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVRM1_0197_G07.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVRM1_0133_E07.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVRM1_0179_B06.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVRM1_0015_A05.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVRM1_0185_B04.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVRM1_0016_A08.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVRT1_0118_H08.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVR01_0070_D09.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
THY01_0034_F11.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
THY01_0086_E09.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVRT1_0074_F05.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVRT1_0098_E11.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVRT1_0023_H03.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
CLNT1_0084_E05.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
OVRT1_0077_F03.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
THY01_0111_E05.b : GCAGTAACAAGTGCCTTGGATAACTCATTGGCCAAAGATCCTACTGCAGTAATATTTGGT
20110601C-012764 : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
---------+---------+---------+---------+---------+---------+ 428
OVRM1_0114_G02.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVRM1_0036_C06.b : GAAGATGTGGCCTTTGGCGGAGTCTTTACATGTACTGTTGGCTTGCGAGACACGTATGGT
LVRM1_0040_E05.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
CBLT1_0066_F03.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
CBLT1_0043_E10.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
HTMT1_0023_A12.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVRM1_0072_B03.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVRM1_0019_H12.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
PST01_0038_E04.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVRT1_0096_F11.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
LVRM1_0070_G05.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVRT1_0074_H04.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVRT1_0023_D10.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVR01_0030_A03.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVR01_0073_E09.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
LVRM1_0039_D06.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVRT1_0114_A10.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
PTG01_0094_E02.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGGACAGTATGGT
PST01_0074_B05.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGNCAAGTATGGT
PST01_0075_D01.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
KDN01_0087_D11.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
PST01_0043_F10.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVRM1_0193_A04.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
LVRM1_0094_B01.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
LVRM1_0178_E03.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVRM1_0151_G02.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVRM1_0197_G07.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVRM1_0133_E07.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVRM1_0179_B06.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVRM1_0015_A05.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVRM1_0185_B04.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVRM1_0016_A08.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVRT1_0118_H08.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVR01_0070_D09.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
THY01_0034_F11.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
THY01_0086_E09.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVRT1_0074_F05.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVRT1_0098_E11.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVRT1_0023_H03.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
CLNT1_0084_E05.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
OVRT1_0077_F03.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
THY01_0111_E05.b : GAAGATGTGGCCTTTGGTGGAGTCTTTAGATGTACTGTTGGCTTGCGAGACAAGTATGGT
20110601C-012764 : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
---------+---------+---------+---------+---------+---------+ 486
OVRM1_0114_G02.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
OVRM1_0036_C06.b : AAAGATAGAGTTTT*AATACCCCACTGTGTGAAACAGGGAATTG*TTGGATTTGGAATCG
LVRM1_0040_E05.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
CBLT1_0066_F03.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
CBLT1_0043_E10.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
HTMT1_0023_A12.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
OVRM1_0072_B03.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
OVRM1_0019_H12.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
PST01_0038_E04.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
OVRT1_0096_F11.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
LVRM1_0070_G05.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
OVRT1_0074_H04.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
OVRT1_0023_D10.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
OVR01_0030_A03.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
OVR01_0073_E09.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
LVRM1_0039_D06.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
OVRT1_0114_A10.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
PTG01_0094_E02.b : NAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTGTTTGGATTTGGATCGG
PST01_0074_B05.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
PST01_0075_D01.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
KDN01_0087_D11.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
PST01_0043_F10.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
OVRM1_0193_A04.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
LVRM1_0094_B01.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
LVRM1_0178_E03.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
OVRM1_0151_G02.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
OVRM1_0197_G07.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
OVRM1_0133_E07.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
OVRM1_0179_B06.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
OVRM1_0015_A05.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
OVRM1_0185_B04.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
OVRM1_0016_A08.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
OVRT1_0118_H08.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
OVR01_0070_D09.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
THY01_0034_F11.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
THY01_0086_E09.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
OVRT1_0074_F05.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
OVRT1_0098_E11.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACGGGGAATTG*TTGGATTTGGAATCG
OVRT1_0023_H03.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
CLNT1_0084_E05.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
OVRT1_0077_F03.b : AAAGATAGAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
THY01_0111_E05.b : AAAGATAAAGTTTTTAATACCCCACTGTGTG*AACAGGGAATTG*TTGGATTTGGAATCG
20110601C-012764 : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
---------+---------+---------+---------+---------+---------+ 545
OVRM1_0114_G02.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
OVRM1_0036_C06.b : GGATTGCAGCGCCTGGTGCTACTGCC*ATCGCGAAAATT*AGTTCGCAGATTATATCCTC
LVRM1_0040_E05.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
CBLT1_0066_F03.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
CBLT1_0043_E10.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
HTMT1_0023_A12.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
OVRM1_0072_B03.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
OVRM1_0019_H12.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
PST01_0038_E04.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
OVRT1_0096_F11.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
LVRM1_0070_G05.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
OVRT1_0074_H04.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
OVRT1_0023_D10.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
OVR01_0030_A03.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
OVR01_0073_E09.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
LVRM1_0039_D06.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
OVRT1_0114_A10.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
PTG01_0094_E02.b : GGATTGCAGTCACTGGTGCTGCTGCCCATTGCGGAAATTCAGTTTGCAGAATAATATTTC
PST01_0074_B05.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
PST01_0075_D01.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
KDN01_0087_D11.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
PST01_0043_F10.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
OVRM1_0193_A04.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
LVRM1_0094_B01.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
LVRM1_0178_E03.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
OVRM1_0151_G02.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
OVRM1_0197_G07.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
OVRM1_0133_E07.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
OVRM1_0179_B06.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
OVRM1_0015_A05.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
OVRM1_0185_B04.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
OVRM1_0016_A08.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
OVRT1_0118_H08.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
OVR01_0070_D09.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
THY01_0034_F11.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
THY01_0086_E09.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
OVRT1_0074_F05.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTATGCAGATTATATTTTC
OVRT1_0098_E11.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
OVRT1_0023_H03.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
CLNT1_0084_E05.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
OVRT1_0077_F03.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
THY01_0111_E05.b : GGATTGCAGTCACTGGTGCTACTGCC*ATTGCGGAAATTCAGTTTGCAGATTATATTTTC
20110601C-012764 : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
---------+---------+---------+---------+---------+---------+ 605
OVRM1_0114_G02.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVRM1_0036_C06.b : CCTGCTTTTGATagatcgtcaatgaatctgcctaggctcgttaccgatctggggctctcc
LVRM1_0040_E05.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
CBLT1_0066_F03.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
CBLT1_0043_E10.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
HTMT1_0023_A12.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVRM1_0072_B03.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVRM1_0019_H12.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
PST01_0038_E04.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVRT1_0096_F11.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
LVRM1_0070_G05.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVRT1_0074_H04.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVRT1_0023_D10.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVR01_0030_A03.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVR01_0073_E09.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
LVRM1_0039_D06.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVRT1_0114_A10.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
PTG01_0094_E02.b : CCTGCTTTTGATCAAATAGTTAATGAAGCTGCCAAGTATCGTatccctctggggattcct
PST01_0074_B05.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
PST01_0075_D01.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
KDN01_0087_D11.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
PST01_0043_F10.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVRM1_0193_A04.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
LVRM1_0094_B01.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
LVRM1_0178_E03.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVRM1_0151_G02.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVRM1_0197_G07.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVRM1_0133_E07.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVRM1_0179_B06.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVRM1_0015_A05.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVRM1_0185_B04.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVRM1_0016_A08.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVRT1_0118_H08.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVR01_0070_D09.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
THY01_0034_F11.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
THY01_0086_E09.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVRT1_0074_F05.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVRT1_0098_E11.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVRT1_0023_H03.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
CLNT1_0084_E05.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
OVRT1_0077_F03.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
THY01_0111_E05.b : CCTGCTTTTGATCAGATAGTTAATGAAGCTGCCAAGTATCGTTATCGCTCTGGGGATCTC
20110601C-012764 : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
---------+---------+---------+---------+---------+---------+ 665
OVRM1_0114_G02.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
OVRM1_0036_C06.b : ttaaaggcgcaaactaacgataccggtccctaggagctgcgacggtcatgggctctgtat
LVRM1_0040_E05.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
CBLT1_0066_F03.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
CBLT1_0043_E10.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
HTMT1_0023_A12.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
OVRM1_0072_B03.b : TTTAATTGTGGCAGCCTTACGATCCGGTCTCCTTGGAGCTGTGTCGGCCATGGGGCTCTC
OVRM1_0019_H12.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
PST01_0038_E04.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
OVRT1_0096_F11.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
LVRM1_0070_G05.b : TTTAATTGTGtcggccatggggctctctatcattcccagagtccttgagcattttttgcc
OVRT1_0074_H04.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
OVRT1_0023_D10.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
OVR01_0030_A03.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTAGGGCTGTGTCGGCCATGGGGCTCTC
OVR01_0073_E09.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
LVRM1_0039_D06.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
OVRT1_0114_A10.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
PTG01_0094_E02.b : ttaattgggccacctcccaatccggtcccttggggctgggtccgccatgggggtctccta
PST01_0074_B05.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
PST01_0075_D01.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
KDN01_0087_D11.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
PST01_0043_F10.b : TTTAATTGTGGCAGCCACACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
OVRM1_0193_A04.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGAGGCTCTC
LVRM1_0094_B01.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
LVRM1_0178_E03.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
OVRM1_0151_G02.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
OVRM1_0197_G07.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
OVRM1_0133_E07.b : TTTTATTGTGGCAGCCTCACGATCCCGGTCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
OVRM1_0179_B06.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
OVRM1_0015_A05.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
OVRM1_0185_B04.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
OVRM1_0016_A08.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
OVRT1_0118_H08.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
OVR01_0070_D09.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
THY01_0034_F11.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
THY01_0086_E09.b : TTTAATTGTGGCAGCCTCACGATCCGGT*CCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
OVRT1_0074_F05.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
OVRT1_0098_E11.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
OVRT1_0023_H03.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
CLNT1_0084_E05.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
OVRT1_0077_F03.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
THY01_0111_E05.b : TTTAATTGTGGCAGCCTCACGATCCGGTCCCCTTGGGGCTGTGTCGGCCATGGGGCTCTC
20110601C-012764 : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
---------+---------+---------+---------+---------+---------+ 725
OVRM1_0114_G02.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCGAGGTGGTTGTA
OVRM1_0036_C06.b : aataccggagtcctgcaacactcattgcccttgccaagaattaaggtggtgatacccaaa
LVRM1_0040_E05.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
CBLT1_0066_F03.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
CBLT1_0043_E10.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
HTMT1_0023_A12.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
OVRM1_0072_B03.b : TATCATTACCAGAGTCCTGGAGCATTCTTTAGCCCCTGCCCATGGATCAAGGCGGTTGCT
OVRM1_0019_H12.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAAATCAGGTGGTTGTA
PST01_0038_E04.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
OVRT1_0096_F11.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
LVRM1_0070_G05.b : cactgcccacggatcaaggtggttgtacccagaaaccctttcctagctaagggacttctc
OVRT1_0074_H04.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCTAGGAATCAAGGTGGTTGTA
OVRT1_0023_D10.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
OVR01_0030_A03.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
OVR01_0073_E09.b : TATCATTCCCATAGTCCTGAAGCATTCTTTGCCCACTGCCCATAAATCAAGGTGGATGTA
LVRM1_0039_D06.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAAATCAAGTGGTTGTA
OVRT1_0114_A10.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
PTG01_0094_E02.b : tcatccccaaatcctgaaaacttctttgccccctggcccaaaaccaagggggtttgtccc
PST01_0074_B05.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
PST01_0075_D01.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
KDN01_0087_D11.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
PST01_0043_F10.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
OVRM1_0193_A04.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCCAGGTGGTTGTA
LVRM1_0094_B01.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
LVRM1_0178_E03.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAAATCAAGTGGTTGTA
OVRM1_0151_G02.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
OVRM1_0197_G07.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAATGTGGTTGTA
OVRM1_0133_E07.b : TATCATTCCCAGGGTCC*GAAGCATTCTTTGCC*ACTGCCCACGAATCAAGGGGTTGGTA
OVRM1_0179_B06.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
OVRM1_0015_A05.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
OVRM1_0185_B04.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
OVRM1_0016_A08.b : TATCATTCCCAGAGTCCTAAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
OVRT1_0118_H08.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
OVR01_0070_D09.b : TATCATTCCCAGAGTCCTGAAGCACTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
THY01_0034_F11.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
THY01_0086_E09.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
OVRT1_0074_F05.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
OVRT1_0098_E11.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
OVRT1_0023_H03.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
CLNT1_0084_E05.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
OVRT1_0077_F03.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATCAAGGTGGTTGTA
THY01_0111_E05.b : TATCATTCCCAGAGTCCTGAAGCATTCTTTGCCCACTGCCCAGGAATTAAGGTGGTTGT*
20110601C-012764 : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
---------+---------+---------+---------+---------+---------+ 785
OVRM1_0114_G02.b : CCCAGAAGCCCTTTCCA*GCTAAGGGACTTCTCTTGTCATGCAT
OVRM1_0036_C06.b : cccc
LVRM1_0040_E05.b : CCCAGAAACCCTTTC
CBLT1_0066_F03.b : CCCAGAAGCCCTTTCCAAGCTA*GGGACTTCTCTTGTCATGCATAAAGGATAAAAATCCT
CBLT1_0043_E10.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
HTMT1_0023_A12.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
OVRM1_0072_B03.b : CCCAaaacccattactaggttacggacttctttcgtcatcatataggataaaattcttgc
OVRM1_0019_H12.b : CCCAGAAGCCCTTTTCAAGCTAANGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
PST01_0038_E04.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
OVRT1_0096_F11.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
LVRM1_0070_G05.b : ttgtcatggctaaagggataaaatccttgtacatttgttagccaacatacttacagagc
OVRT1_0074_H04.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
OVRT1_0023_D10.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
OVR01_0030_A03.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
OVR01_0073_E09.b : Cgctcaatcctttcctagcccaggtacttctcttgtcatgc
LVRM1_0039_D06.b : CCCAGAAGCCCTTTTCCAGCTAAGGNACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
OVRT1_0114_A10.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
PTG01_0094_E02.b : aaaaacccctttcaaacctaggggatttccccttgcttgcataaaggaaaaaaaaccctt
PST01_0074_B05.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
PST01_0075_D01.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
KDN01_0087_D11.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
PST01_0043_F10.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
OVRM1_0193_A04.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACa
LVRM1_0094_B01.b : CCCAGAAGCCCTTTTCCAGCTAAGGGACTTCTCTTGTCATGCATANAGGATAAAAA
LVRM1_0178_E03.b : CCCAGAAGCCCTTTCC*AGCTAAGGGAACTCTCTTGTCATGCATANAGGA
OVRM1_0151_G02.b : CCCAGAAGCCCTTTCCAAGCTAANGGACTTCTCTTGTCATGCATAGAGGAataaaat
OVRM1_0197_G07.b : CCCAGAAGCCCTTTCCGAGCTAAAGGACTTCTCTTGTCATGCATAGAGGATAAAAtcctt
OVRM1_0133_E07.b : CCAAAA**CCCTTTTCCAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAAacct
OVRM1_0179_B06.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
OVRM1_0015_A05.b : CCCAGAAGCCCTTTCCA*GCTAAGGGACTTCTCTTGTCATGCATAGAGGACTAAAATCCT
OVRM1_0185_B04.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGAT*AAAATCCT
OVRM1_0016_A08.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATGGAGGATAAAAATCCC
OVRT1_0118_H08.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
OVR01_0070_D09.b : CCCAGAAGCCCTTTCCCAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
THY01_0034_F11.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
THY01_0086_E09.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
OVRT1_0074_F05.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
OVRT1_0098_E11.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
OVRT1_0023_H03.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
CLNT1_0084_E05.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
OVRT1_0077_F03.b : CCCAGAAGCCCTTTCCAAGCTAAGGGACTTCTCTTGTCATGCATAGAGGATAAAAATCCT
THY01_0111_E05.b : CCCAGAACCCCTTTCCA*GCTAAGGGAttttcttggtttgctta
20110601C-012764 : TGTATATTTTTTGAACCTAAAATACTTTACAGAGCAGCAGTGGAACAGGTT*CCCATAG*
---------+---------+---------+---------+---------+---------+ 843
OVRM1_0114_G02.b :
OVRM1_0036_C06.b :
LVRM1_0040_E05.b :
CBLT1_0066_F03.b : TGTATATTTTTTaacctaaaatcttttcagagcaaccgtggaacaagtttccatagaacc
CBLT1_0043_E10.b : TGTATATTTTTTGAACCTAAAATACTTTACAGAGCAGCAGTGGAACAGGTT*CCCATAG*
HTMT1_0023_A12.b : TGTATATTTTTTGAACCTAAAATACTTTACAGAGCAGCAGTGGAACAGGTT*CCCATAG*
OVRM1_0072_B03.b : tttctttg
OVRM1_0019_H12.b : TGTATATTTTTTGGACCTAAAATACTTTACAGA
PST01_0038_E04.b : TGTATATTTTTTGAACCTAAAATACTTTACAGAGCAGCAGTGGAACAGGTT*CCCATAG*
OVRT1_0096_F11.b : TGTATATTTTTTGAACCTAAAATACTTTACAGAGCAGCAGTGGAACAGGTTCCCCATAA*
LVRM1_0070_G05.b :
OVRT1_0074_H04.b : TGTATATTTTTTGAACCTAAAATACTTTACAGAGCAGCAGTGGAACAGGTT*CCCATAG*
OVRT1_0023_D10.b : TGTATATTTTTTGAACCTAAAATACTTTACAGAGCAGCAGTGGAACAGGGT*CCCATAG*
OVR01_0030_A03.b : TGTATATTTTTTGAACCTAAAATACTTTACAGAGCAGCAGTGGAACAGGTT*CCCATAG*
OVR01_0073_E09.b :
LVRM1_0039_D06.b : TGTAn
OVRT1_0114_A10.b : TGTATATTTTTTGAACCTAAAATACTTTACAGAGCAGCAGTGGAACAGGTTTCCCATAG*
PTG01_0094_E02.b : ggtttttttttaacccaaaaaatttttaaaaaaacccttggaaaaggttctccataaaaa
PST01_0074_B05.b : TGTATATTTTTTGAACCTAAAATACTTTACAGAGCAGCAGTGGAACAGGTT*CCCATAG*
PST01_0075_D01.b : TGTATATTTTTTGAACCTAAAATACTTTACAGAGCAGCAGTGGAACAGGTT*CCCATAG*
KDN01_0087_D11.b : TGTATATTTTTTGAACCTAAAATACTTTACAGAGCAGCAGTGGAACAGGTT*CCCATAG*
PST01_0043_F10.b : TGTATATTTTTTGAACCTAAAATACTTTACAGAGCAGCAGTGGAACAGGTT*CCCATAG*
OVRM1_0193_A04.b :
LVRM1_0094_B01.b :
LVRM1_0178_E03.b :
OVRM1_0151_G02.b :
OVRM1_0197_G07.b : gtatattttn
OVRM1_0133_E07.b : ggatattttttgaacctaaatactttcagaccagcg
OVRM1_0179_B06.b : TGTATATTTTTTGAACCc
OVRM1_0015_A05.b : TGTATATTTTTTGAACCTAAAtact
OVRM1_0185_B04.b : TGTATATTTTTTGAACCTAAAATACTTTACAn
OVRM1_0016_A08.b : TGTATATTTTTTGAACCTAAA*TACCTTACAGAGCAGCAGTGGGACAGGTTCt
OVRT1_0118_H08.b : TGTATATTTTTTTGAACTAAAATACTTTACAGAGCAGCAGTGGAACAGTTC*CCCATAG*
OVR01_0070_D09.b : TGTATATTTTTTGAACCTAAAATACTTTTCAGAACAGCCATGGAACAGGTT*CCCCTAAA
THY01_0034_F11.b : TGTATATTTTTTGAACCTAAAATACTTTACAGAGCAGCAGTGGAACAGGTT*CCCATAG*
THY01_0086_E09.b : TGTATATTTTTTGAACCTAAAATACTTTACAGAGCAGCAGTGGAACAGGTT*CCCATAG*
OVRT1_0074_F05.b : TGTATATTTTTTGAACCTAAAATACTTTACAGAGCAGCAGTGGAACAGGTT*CCCATAG*
OVRT1_0098_E11.b : TGTATATTTTTTGAACCTAAAATACTTTACAGAGCAGCAGTGGGACAGGTT*CCCATAG*
OVRT1_0023_H03.b : TGTATATTTTTTGAACCTAAAATACTTTACAGAGCAGCAGTGGAACAGGTT*CCCATAG*
CLNT1_0084_E05.b : TGTATATTTTTTGAACCTAAAATACTTTACAGAGCAGCAGTGGAACAGGTT*CCCATAG*
OVRT1_0077_F03.b : TGTATATTTTTTGAACCTAAAATACTTTACAGAGCAGCAGTGGAACAGGTT*CCCATAG*
THY01_0111_E05.b :
20110601C-012764 : AACCATACACTATCCCTCTGTCCCAGGCCGAAGTCATCCAAGAAGGGAGTGATGTGACTC
---------+---------+---------+---------+---------+---------+ 903
OVRM1_0114_G02.b :
OVRM1_0036_C06.b :
LVRM1_0040_E05.b :
CBLT1_0066_F03.b : ataacctatccctctgtccaggccgaaatctccaaaaaagnaatgaattgctcttgttgc
CBLT1_0043_E10.b : AACCATACACTATCCCTCTGTCCCAGGCCGAAGTCATCCCAGA*GGGAGTGATGTGACTC
HTMT1_0023_A12.b : AACCATACACTATCCCTCTGTCCCANGNCGAAGTCATCCNAGAAGGNAGTGATGTGACTC
OVRM1_0072_B03.b :
OVRM1_0019_H12.b :
PST01_0038_E04.b : AACCATACACTATCCCTCTGTCCCAGGCCGAAGTCATCCAAGAAGGGAGTGATGTGACTC
OVRT1_0096_F11.b : AACC*TACACTATCCCTCTGTCCCAG*CCGAAGTCTTCCAA*AAGGGAGTGATGTGACTC
LVRM1_0070_G05.b :
OVRT1_0074_H04.b : AACCATACACTATCCCTCTGTCCCANGCCGAAGTCATCCAAGA*GGGAGTGATGTGACTC
OVRT1_0023_D10.b : AACCATACACTATCCCTCTGTNCCCAGCCGAAGTCATCCCAGAAGGGAGTGATGTGACTC
OVR01_0030_A03.b : AACCATACACTATCCCTCTGTCCCAGGCCGAAGTCATCCAAGAAGGGAGTGATGTGACTC
OVR01_0073_E09.b :
LVRM1_0039_D06.b :
OVRT1_0114_A10.b : *ACCATACACTATCCCTCTGTCCCAGGCCGAAGTCATCCCAGAAGGGAGTGATGTGACTC
PTG01_0094_E02.b : aaaaaatattacccctttgccccgggggaatattttcccaaaaggggggggtgtggtctt
PST01_0074_B05.b : AACCATACACTATCCCTCTGTCCCAGGCCGAAGTCATCCAAGAAAGGAGTGATGTGACTC
PST01_0075_D01.b : AACCATACACTATCCCTCTGTCCCAGGCCGAAGTCATCCAAGAAGGGAGTGATGTGACTC
KDN01_0087_D11.b : AACCATACACTATCCCTCTGTCCCAGGCCGAAGTCATCCAAGAAGGGAGTGATGTGACTC
PST01_0043_F10.b : AACCATACACTATCCCTCTGTCCCAGGCCGAAGTCATCCAAGAAAGGAGTGATGTGACTC
OVRM1_0193_A04.b :
LVRM1_0094_B01.b :
LVRM1_0178_E03.b :
OVRM1_0151_G02.b :
OVRM1_0197_G07.b :
OVRM1_0133_E07.b :
OVRM1_0179_B06.b :
OVRM1_0015_A05.b :
OVRM1_0185_B04.b :
OVRM1_0016_A08.b :
OVRT1_0118_H08.b : *AACATACACTATCCCTCTGGTCCAGGCCGAGTTC*TCCAAGAAGGGAGTGATGTGACTC
OVR01_0070_D09.b : AACCCTACACTATTCCTCTGTCCCGGGCCCAATTCTTCCCAGAAGGGGATGATGTGACTC
THY01_0034_F11.b : AACCATACACTATCCCTCTGTCCCAGGCCGAAGTCATCCAAGAAGGGAGTGATGTGACTC
THY01_0086_E09.b : AACCATACACTATCCCTCTGTCCCAGGCCGAAGTCATCCAAGAAGGGAGTGATGTGACTC
OVRT1_0074_F05.b : AACCATACACTATCCCTCTGTCCCAGGCCGAAGTCATCCAAGAAGGGAGTGATGTGACTC
OVRT1_0098_E11.b : AACCATACACTATCCCTCTGTCCCAGGCCGAAGTCATCAAAAAAGGGAGTGATGTGACTC
OVRT1_0023_H03.b : AACCATACACTATCCCTCTGTCCCAGGCCGAAGTCAT*CAAGAAGGGAGTGATGTGACTC
CLNT1_0084_E05.b : AACCATACACTATCCCTCTGTCCCAGGCCGAAGTCATCCCAGAAGGGAGTGATGTGACTC
OVRT1_0077_F03.b : AACCATACACTATCCCCTCTGTCCCAGCCGAAGTCATCCAAGAAAGGAGTGATGTGACTC
THY01_0111_E05.b :
20110601C-012764 : TT*GTTGCCTGGGGCACTCAGGTTCATGTGATCCGAGAGGTTGCTTCCATG*GCTCGGGA
---------+---------+---------+---------+---------+---------+ 961
OVRM1_0114_G02.b :
OVRM1_0036_C06.b :
LVRM1_0040_E05.b :
CBLT1_0066_F03.b : cgggggcccccggttcctgtgtaccaaaagttccttccttggctcggaaaaacttgaatg
CBLT1_0043_E10.b : TT*GTTGCCGGGGGCACTCAGGTTCATGTGATCCGAGAGGGTGCTTCCATG*GCTCGGGA
HTMT1_0023_A12.b : TT*GTTGCCTGGGGCACTCANGTTCATGTGATCCGAGAGGTTGCTTCCATG*GCTCGGGA
OVRM1_0072_B03.b :
OVRM1_0019_H12.b :
PST01_0038_E04.b : TT*GGTGCCTGGGGCACTCAGGTTCATGTGATCCGAGAGGTTGCTTCCATG*GCTCGGGA
OVRT1_0096_F11.b : TT*GTTGCCTGGGGCA*TCCGGTTCATGGGATCCGAAAGGGTGCTTCCATGCCTCCGG**
LVRM1_0070_G05.b :
OVRT1_0074_H04.b : TT*GTTGCCTGNNGCACTCANGTTCATGTGATCCGAGAG*TTGCTTCCATG*GCTCGGGA
OVRT1_0023_D10.b : TT*GTTGCCTGGGGCACTCAGGTTCATGTGATCCGAAGAGGTGCTTCCATGGCTCGGGNA
OVR01_0030_A03.b : TT*GTTGCCTGGGGCACTCAAGTTCATGTGATCCGGGAGGTTGCTTCCATG*GCTCGGGA
OVR01_0073_E09.b :
LVRM1_0039_D06.b :
OVRT1_0114_A10.b : TT*TGTTGCTGGGGCACTCAGGTTCATGTGATCCGAGGAGTTGCTTCCATG*GCTCGGGG
PTG01_0094_E02.b : tttttttccgggggcccccctgttttttttatctccaaggggtttttttccggcgcccgg
PST01_0074_B05.b : TT*GTTGCCTGGGGCACTCAGGTTCATGTGATCCGAGAGGTTGCTTCCATG*GCTCGGGA
PST01_0075_D01.b : TT*GTTGCCTGGGGCACTCAGGTTCATGTGATCCGAGAGGTTGCTTCCATG*GCTCGGGA
KDN01_0087_D11.b : TT*GTTGCCTGGGGCACTCAGGTTCATGTGATCCGAGAGGTTGCTTCCATG*GCTCGGGA
PST01_0043_F10.b : TT*GGTGCCTGGGGCACTCAGGTTCATGTGATCCGAGAGGTTGCTTTCATG*GCTCGGGA
OVRM1_0193_A04.b :
LVRM1_0094_B01.b :
LVRM1_0178_E03.b :
OVRM1_0151_G02.b :
OVRM1_0197_G07.b :
OVRM1_0133_E07.b :
OVRM1_0179_B06.b :
OVRM1_0015_A05.b :
OVRM1_0185_B04.b :
OVRM1_0016_A08.b :
OVRT1_0118_H08.b : TT*GTTGCCTGGGGCACTCggttcttgtgattcgagagtttctttccttgccccgggaaa
OVR01_0070_D09.b : TT*GTTGCCTGGGGCccttcgggtcctgtgatcccaaagggtgccttccctggctcggga
THY01_0034_F11.b : TT*GTTGCCTGGGGCACTCAAGTTCATGTGATCCGAGAGGTTGCTTCCATG*GCTCGGGA
THY01_0086_E09.b : TT*GTTGC*TGGGGCACTCAAGTTCATGTGATCCCAGAAGTTGCCTCCATG*GCTCGGGA
OVRT1_0074_F05.b : TT*GTTGCCTGGGGCACTCANGTTCATGTGATCCGAGAGGGTGCTTCCAT**GCCTCGGG
OVRT1_0098_E11.b : TTTGTTGCCTGGGGCACTCAGGTTTCTGTGATCCGAGAGGTTGCCTTCATGGGCTCGGGA
OVRT1_0023_H03.b : TT*GTTGCCTGGGGCACTCAGGTTCATGTGATCCGAGAGGTTGCTTCCATG*GCTCGGGA
CLNT1_0084_E05.b : TT*GTTGCCTGGGGCACTCAGGTTCATGTGATCCGAGAGGTTGCTTCCATG*GCTCGGGA
OVRT1_0077_F03.b : TT*GTTGCCTGGGGCACTCAGGTTCATGTGATCCGAGAGGTTGCCTCCATG*GCTCGGGA
THY01_0111_E05.b :
20110601C-012764 : GAAG*CTTGGAGTGTCCTGTGAG*GTCATTGATCTGAGGACTATAATTCCT.........
---------+---------+---------+---------+---------+---------+ 1010
OVRM1_0114_G02.b :
OVRM1_0036_C06.b :
LVRM1_0040_E05.b :
CBLT1_0066_F03.b : tccgtggaagccattttttaagaaaaaaattccctggaaataaaaaaatttttaaacctt
CBLT1_0043_E10.b : AAAA*CTTGGAGTGTCCTGTGAA*GTTCTTGATCTGAggaacatatttcttggggattaa
HTMT1_0023_A12.b : GAAGCTggagtgtccctgtgagtcattgatctgaagactattattccttgggatgtaaat
OVRM1_0072_B03.b :
OVRM1_0019_H12.b :
PST01_0038_E04.b : GAAG*CT*GGAGTGTCCTGTGAG*GTCATgatctgaggactataattccttgggatgtag
OVRT1_0096_F11.b : AAAACCTTGGAGTGTCCCGTGAG*Gctcttgatttaagaatataatcccttgggaagtaa
LVRM1_0070_G05.b :
OVRT1_0074_H04.b : AAAG*CTTGGAGTGcctgtgaagtcattgatctgaagactaaatttcttggggagtaaat
OVRT1_0023_D10.b : GAG**CCTGGAATGTCCTGTGAA*GTCATTGATCTGGAGACTATAttcccttgggatgta
OVR01_0030_A03.b : GAAG*CTTGGAGTGTCCTGTGAG*GGTCTTGATCTTAGGACTATAtttccttgggatgga
OVR01_0073_E09.b :
LVRM1_0039_D06.b :
OVRT1_0114_A10.b : AAAA*Ccttggaatgccctgtgaggtccttgatctcgagactatatttccttgggattta
PTG01_0094_E02.b : aaaaaaaatggggtgccctggggggggtttttttttaagaaaatatttttttcgggggag
PST01_0074_B05.b : GAAG*CTTGGAGTGTCCTGTGAG*GTCATTGATCTGAGGACTATAAttccttgggatgta
PST01_0075_D01.b : GAAG*CTTGGAGTGTCCTGTGAG*GTCATTGATCTGAGGACTATAATTCCTtgggatgta
KDN01_0087_D11.b : GAAAGCTTGGAGTGTCCTGTGAGGGTCATTGATCTGAGactataattccttgggatgtag
PST01_0043_F10.b : GAAgcttggagtgtcctgtgaggtcattgatctgaagactataaatccttgggatgtana
OVRM1_0193_A04.b :
LVRM1_0094_B01.b :
LVRM1_0178_E03.b :
OVRM1_0151_G02.b :
OVRM1_0197_G07.b :
OVRM1_0133_E07.b :
OVRM1_0179_B06.b :
OVRM1_0015_A05.b :
OVRM1_0185_B04.b :
OVRM1_0016_A08.b :
OVRT1_0118_H08.b : accttggattgcccttggaggtccttgttttgaggactaaaattcctggggagtaaaata
OVR01_0070_D09.b : gaaactttgaagggcccttgtgaggctcttgattttaagggactataatttcccttggga
THY01_0034_F11.b : GAAaccttggagtgtcctggggaggtcattgatctgaggactataattcctttgggattg
THY01_0086_E09.b : GAAG*CTTGAATTGTCCTGTGAG*GTCATTGATtctgaagactataattcccttgggatg
OVRT1_0074_F05.b : AGAGCCTTGGAGTGTCTTGTTGA*GTCATTGATCTGAGGACTATAattcttggggatgaa
OVRT1_0098_E11.b : AAAACCTTGGAGTGTCCTGTGgagtcattgatctgaggactataatccctggggatgaaa
OVRT1_0023_H03.b : aaacttgggatgtcctgtgaagtcttgatctgaggactataatccctgggatgtaaatca
CLNT1_0084_E05.b : GAAG*CTTGGAGTGTCCTGTGAGtcattgatctgaggactataattcctgggatgtaaat
OVRT1_0077_F03.b : GAgcttgnagtgttctgtgaggtcatgatctgaggactatattccttgggatgtaaaaac
THY01_0111_E05.b :
20110601C-012764 : ............................................................
---------+---------+---------+---------+---------+---------+ 1010
OVRM1_0114_G02.b :
OVRM1_0036_C06.b :
LVRM1_0040_E05.b :
CBLT1_0066_F03.b : gtataaaacagggcaatgttttttttccaaaggtccccttaagggggtttccccgaaata
CBLT1_0043_E10.b : aaacagtttgtaagtctgtaatcaaaacaggcgaccgctatttattcccaggctcccctg
HTMT1_0023_A12.b : acagtttgtaagtctgtgatcaaaacagggcgactgctanttattcacaaggctccctta
OVRM1_0072_B03.b :
OVRM1_0019_H12.b :
PST01_0038_E04.b : atcagtttggtagtctgtgatcaaaacaggcgacggctattagtcccaagcttcccttga
OVRT1_0096_F11.b : aacaaattgtgaaattctggaatcaaaaccgggccactgcttttttatcccgaaggtccc
LVRM1_0070_G05.b :
OVRT1_0074_H04.b : acagttgtaagtctggatcaaaacagggcaactgctatttattccaagcctccttgaacg
OVRT1_0023_D10.b : aaaacanttgttaatctgtgatcaaaacagggcgactgctagttagtccgaggcttcctt
OVR01_0030_A03.b : aatacagtttgtaagtctgggaatcaaaacagggccaactggctaatttaatcccgaagg
OVR01_0073_E09.b :
LVRM1_0039_D06.b :
OVRT1_0114_A10.b : aatacagtttgaaagtcttggatcaaaccgggccacggctatttattccgagggctcctt
PTG01_0094_E02.b : aaaaaacaattttgtggtgggtgtgtaaaaagagggggccgcgtgtttttttttccaccc
PST01_0074_B05.b : gatacagttttgtaatcctgtgatcaaaacagggcgactgctatttagtcacgaggctcc
PST01_0075_D01.b : gatacagnttgtaaatctgtgaatcaaacaaggcgactgctagtaagtcacgaagctccc
KDN01_0087_D11.b : atacagtttgtaggtctgtgaatcaaacagggcgactgctaattagtcccgaagcctcct
PST01_0043_F10.b : tacagtttggtagtctgtgatcaaaacaaggcgactgctagntaatcccgaagctccctt
OVRM1_0193_A04.b :
LVRM1_0094_B01.b :
LVRM1_0178_E03.b :
OVRM1_0151_G02.b :
OVRM1_0197_G07.b :
OVRM1_0133_E07.b :
OVRM1_0179_B06.b :
OVRM1_0015_A05.b :
OVRM1_0185_B04.b :
OVRM1_0016_A08.b :
OVRT1_0118_H08.b : catttgtaagtctggataacaaaaagggccactgctttttattccaaaggctccttgaag
OVR01_0070_D09.b : agtaaaacccctttttgtaagtcctgggaatcaaaaccggggcgcctgcctattttttcc
THY01_0034_F11.b : taaatacggtttgtaaggtctggtgatcaaaaacaggggcaactggcttatttaatcccc
THY01_0086_E09.b : taaatacag
OVRT1_0074_F05.b : aatcagtttgtaagtccgtgatcaaaacaggcgactgctaattagtcacgagcttccttg
OVRT1_0098_E11.b : aaacggtttggaagtctgtgatcaaaaagggcgactgcttattttccccgaggttccctt
OVRT1_0023_H03.b : gtttgtaatctgggatcaaacaggccaatgctattagtcacaggctccttgaagggggct
CLNT1_0084_E05.b : ccatttgtaagtccgtgatcaaacaggccgactgctattagtcacgaggtccctggaagg
OVRT1_0077_F03.b : agtttgtaattctgtgatcaaaacaaggcgactgctattagtcacgaggttccctgaaag
THY01_0111_E05.b :
20110601C-012764 : ............................................................
---------+---------+---------+---------+---------+---------+ 1010
OVRM1_0114_G02.b :
OVRM1_0036_C06.b :
LVRM1_0040_E05.b :
CBLT1_0066_F03.b : acctacggttaggaaaaattttccaaacttttaccctctatccaaattttggggaaacaa
CBLT1_0043_E10.b : aagggcggctttccctggaaatcccctcaacggttaagaaaaattttcctgaaactttaa
HTMT1_0023_A12.b : caaggcggcttgcctcggaaataacctcaacggtcaagaaaaaggttcttgaaccctgga
OVRM1_0072_B03.b :
OVRM1_0019_H12.b :
PST01_0038_E04.b : cggcggctttggctcggaaatcactcacggttcaggagaatggttccggaccttgaagct
OVRT1_0096_F11.b : ttgaaggggggcttgtccctcgaataacactcaacgtttcaggaaaggttttccggaccc
LVRM1_0070_G05.b :
OVRT1_0074_H04.b : ggggtttgctccgaaatcactcaacgttcaggaaaatgttccgaaccttaacctcctatt
OVRT1_0023_D10.b : gaacagcgcttggcctccgaaatcacctaacgggtcaggaaaaatgtttcctgaacctga
OVR01_0030_A03.b : ttcccttgaacagggcgggtttttccctcggaaaatccaccttcaacgggtttaaggaaa
OVR01_0073_E09.b :
LVRM1_0039_D06.b :
OVRT1_0114_A10.b : tgcggggggctttcccccgaaaataccccacgtttccgggaaaagttttccgaaccttta
PTG01_0094_E02.b : cccttttaggggggggttttttcccccaaaaaaaacaccccggcgtgagaaaaaaaattt
PST01_0074_B05.b : ctgaacagggggcttgcctcggagatcagctcaacggttcaggaaaaaggtttcctgaac
PST01_0075_D01.b : ttgacggccggcttgcttcggagatcagctcaacggttcagggagaatgtttcctgaact
KDN01_0087_D11.b : tgacaggccgctttgcctcgagatcagctcaacgggtcagaaagaagtttcctgaacctg
PST01_0043_F10.b : gacggcggctttgcctccgaatcagctcaacggttcaggaagatgtttcctgaacttgaa
OVRM1_0193_A04.b :
LVRM1_0094_B01.b :
LVRM1_0178_E03.b :
OVRM1_0151_G02.b :
OVRM1_0197_G07.b :
OVRM1_0133_E07.b :
OVRM1_0179_B06.b :
OVRM1_0015_A05.b :
OVRM1_0185_B04.b :
OVRM1_0016_A08.b :
OVRT1_0118_H08.b : ggcggtttttccccggaaatatccccacgggttcaggaaaaagtttccgaaactctaaac
OVR01_0070_D09.b : cccaggtttccctttgaaaggggggtttttgctctccgagaatcccccttcccggtctta
THY01_0034_F11.b : gagggcttccctttaacagggcggctttttgccctccgaaaaattcgccctccaaccggg
THY01_0086_E09.b :
OVRT1_0074_F05.b : aacaggggctttgcctcgaattcactccacggttcaggagaatgttcctgaccctgaaac
OVRT1_0098_E11.b : taaaggcgggtttgccccggaaaaccccccaccggttccggaaaaatgttcccggaacct
OVRT1_0023_H03.b : ttccctcgaaataactccacgttcaggaaaatgtttccgaacttgaacctccatatccaa
CLNT1_0084_E05.b : ggctttgcctcgaaaccacttcaggttcaggaaaaagttcctggaacttgacctccatac
OVRT1_0077_F03.b : gggttttgctccgaaaatacctcacggttcaggaaaatgtttctgaaccttgaactccca
THY01_0111_E05.b :
20110601C-012764 : ............................................................
---------+---------+---------+---------+---------+---------+ 1010
OVRM1_0114_G02.b :
OVRM1_0036_C06.b :
LVRM1_0040_E05.b :
CBLT1_0066_F03.b : ccttccccccattttggccgttttttccaaaaaagaaatgcttgtgcccttccaaatacc
CBLT1_0043_E10.b : cctccaaatcccaagttgggggttaaaacccccatcccctcaattttagaccgtttttat
HTMT1_0023_A12.b : acccctaatcccaaatttgggggaaaaacccccattccccccatttttgacccttttatc
OVRM1_0072_B03.b :
OVRM1_0019_H12.b :
PST01_0038_E04.b : ctatttcagaatttggggaatgacacgcattccctccacttttgaccggtcttatcccaa
OVRT1_0096_F11.b : ttaactctctattcccaatttgggggttataaccccttctccccatttttgggcgctctt
LVRM1_0070_G05.b :
OVRT1_0074_H04.b : caaagttgtggttgaccgcctttcccccttttttagcgttcttttcccaaaagtgaatgg
OVRT1_0023_D10.b : actcctaattccaaattgtggggtaaacccccatctcccccattgttgacccttcctttc
OVR01_0030_A03.b : aaaaatgttttcccttaaaacctttt
OVR01_0073_E09.b :
LVRM1_0039_D06.b :
OVRT1_0114_A10.b : acccctttccaaaatttgggggttaaccccccctccccccttttttacccgtttttcccc
PTG01_0094_E02.b : tttttacaaaaaaaccccttcaaaaagagggggggggggggaaaacaccccccccccctt
PST01_0074_B05.b : cttggaactcctaatatccaaattggggggtagaaccgcccttccctcccattttaaccc
PST01_0075_D01.b : ttaaagctctattcccgaagttgttggtatgaccccccatcccctccatttttgagcgtt
KDN01_0087_D11.b : aaactcctatttccaaagtttgggggtagacaagccatcccctccatttttgaaccgttc
PST01_0043_F10.b : gctcctaattccaagttgggggatagaccccccatcccccatttttgagcgtcctaatcc
OVRM1_0193_A04.b :
LVRM1_0094_B01.b :
LVRM1_0178_E03.b :
OVRM1_0151_G02.b :
OVRM1_0197_G07.b :
OVRM1_0133_E07.b :
OVRM1_0179_B06.b :
OVRM1_0015_A05.b :
OVRM1_0185_B04.b :
OVRM1_0016_A08.b :
OVRT1_0118_H08.b : cccttttccaaattttgggggtgtacaccccctccccccaatttttgcccttcttttccc
OVR01_0070_D09.b : ggaaaaaagtttttctctcaaacctttggagctcctctctttttcctaagatttgtgggg
THY01_0034_F11.b : tttccagggaaaaaaaatggtttttcccttgaaaaaccctttggaaaaacctttcccttt
THY01_0086_E09.b :
OVRT1_0074_F05.b : ctcttattcaaattgtgggttaacagccttcccctcattttgaccgtcttatcccaaaaa
OVRT1_0098_E11.b : ttaaccccctatttcaaattttggggtatacacccccttcccccccatttttggaccgtt
OVRT1_0023_H03.b : attgggggttaaccccctttccccatttttggacctttttttcccaaaaagggaagcttt
CLNT1_0084_E05.b : ccaagttgggggttgaaacccttcctcaattttgaacctttttttcccaaagtggaaggt
OVRT1_0077_F03.b : atccagattgggggatgaaccccattccccaattttgaccgttttttttcaaaaaaggaa
THY01_0111_E05.b :
20110601C-012764 : ............................................................
---------+---------+---------+---------+---------+---------+ 1010
OVRM1_0114_G02.b :
OVRM1_0036_C06.b :
LVRM1_0040_E05.b :
CBLT1_0066_F03.b : cttttgccgggaaaaacttgaagtgggcaaacgaaattttcttatttttttatctccccc
CBLT1_0043_E10.b : cccaaaaaatggaagtcattaagtccttctcaaaagttaacatttgcccggggaaaacac
HTMT1_0023_A12.b : cccaaaaagggaag
OVRM1_0072_B03.b :
OVRM1_0019_H12.b :
PST01_0038_E04.b : caatgggaagcttgaaggcctcccaaatgttcactttgaccgggaaaaacttgaaatggg
OVRT1_0096_F11.b : tttcccacaaatggaaggccttgaccctcccaaaagttccttttttccggggaaaacatg
LVRM1_0070_G05.b :
OVRT1_0074_H04.b : ctgagcccttcaaaagtccctttgtcccgggaaaactgtaaatggcaaaccggaaatttc
OVRT1_0023_D10.b : ccaaaaagggaatggctgagcgcctttccaaatttccttttggccggggaaaaaattgaa
OVR01_0030_A03.b :
OVR01_0073_E09.b :
LVRM1_0039_D06.b :
OVRT1_0114_A10.b : caaaattggaaaggttttggcccttccaaagtttctttttttccccggaaaaaactgaaa
PTG01_0094_E02.b : ttttgtgcgccccccccacaaaaaaaaaagaaggaaggggtcccccccccccaaaaatat
PST01_0074_B05.b : gtctatatcccaaacaaaggaattgcttgaggccctttccaaaggtctacctttgtccac
PST01_0075_D01.b : tctattcccagacaaatgaaatgcttggagcccttccaaaatgattcactttgagccggg
KDN01_0087_D11.b : atttcccaaaaaaatggaaaggccttgaggcctttcccaaagggtcaattttgcccaggg
PST01_0043_F10.b : caaaaaatggaaaggcttgaagccctccgcaaggtcaacttggcccgggaaaaactggaa
OVRM1_0193_A04.b :
LVRM1_0094_B01.b :
LVRM1_0178_E03.b :
OVRM1_0151_G02.b :
OVRM1_0197_G07.b :
OVRM1_0133_E07.b :
OVRM1_0179_B06.b :
OVRM1_0015_A05.b :
OVRM1_0185_B04.b :
OVRM1_0016_A08.b :
OVRT1_0118_H08.b : caaaaggggaaggttttggtcctctcccaaaatctcttttgccgggggaaacacggaggt
OVR01_0070_D09.b : gn
THY01_0034_F11.b : tttttctcc
THY01_0086_E09.b :
OVRT1_0074_F05.b : tggaaatgcttagccctctccaaggctccttgtccggggaaaattgaattgtggccaccg
OVRT1_0098_E11.b : tttattccccaaaaaggggaaatgcttgatgcccttcccaaatagtatccttttcccggg
OVRT1_0023_H03.b : ggccctctccaagttcccttgtccgggaaaaacttgaattgtgcccaccgaaatttccga
CLNT1_0084_E05.b : tgggcctttccaaatgtactttgcccggggaaaaaatgagatggcaaaacggaaaattct
OVRT1_0077_F03.b : atgcttagcccttccaaaggtccactttgccgggaaaaaactaaaatgtgcacaaccgaa
THY01_0111_E05.b :
20110601C-012764 : ............................................................
---------+---------+---------+---------+---------+---------+ 1010
OVRM1_0114_G02.b :
OVRM1_0036_C06.b :
LVRM1_0040_E05.b :
CBLT1_0066_F03.b : ccaaaaggtttttaaaacaccccgggctgtaaaaatatattttctaaagaaatttttttc
CBLT1_0043_E10.b : tagagtgtggcacaatcgcaaaattttccgaattttttcaaactcccctctcgaaggaga
HTMT1_0023_A12.b :
OVRM1_0072_B03.b :
OVRM1_0019_H12.b :
PST01_0038_E04.b : ccgaaatcgaaaatttccagaattttctcaattccccccggaagggagtttagaaagacc
OVRT1_0096_F11.b : tgaatggccaatactcgagaattttccaattttttcaatctccccctcgaaaggggtttt
LVRM1_0070_G05.b :
OVRT1_0074_H04.b : gatttttttcaatccccccagaagggtttaagaaaccctgttatgtggaaataaattttt
OVRT1_0023_D10.b : atgggccaacaccgaaaatttccaattttttccaatccccctttgaaagggttttttaaa
OVR01_0030_A03.b :
OVR01_0073_E09.b :
LVRM1_0039_D06.b :
OVRT1_0114_A10.b : ttgggacaaacggaaaatttccgattttttctcaatccccccgcgaaggagttttataaa
PTG01_0094_E02.b : tttttggggggagaaaaaataaaaagggaggggccaacaaattttttttttttttttttt
PST01_0074_B05.b : gggaaaaactggaaatgggcacagaaccgaaaattttcagaattttttccatattccccc
PST01_0075_D01.b : gaaaaaacttgaatatgggacaaaacggaaaaatttcccgaatttttttccaattccccc
KDN01_0087_D11.b : aaaaaacttgaaaattggacaaaaaccgaaaattttccgatttttttcccaattcccccc
PST01_0043_F10.b : attgggaaaaaagggaaaaattccgaattttttcaaattcccctctgaaagggagttaag
OVRM1_0193_A04.b :
LVRM1_0094_B01.b :
LVRM1_0178_E03.b :
OVRM1_0151_G02.b :
OVRM1_0197_G07.b :
OVRM1_0133_E07.b :
OVRM1_0179_B06.b :
OVRM1_0015_A05.b :
OVRM1_0185_B04.b :
OVRM1_0016_A08.b :
OVRT1_0118_H08.b : tgcgcaaaccgaaatttttccattttttttcctctcccccccaaaagtgttttataaaca
OVR01_0070_D09.b :
THY01_0034_F11.b :
THY01_0086_E09.b :
OVRT1_0074_F05.b : gaaatttccgattttccaatcccccccagagaggttttagaaaaccctgattgtgtaaat
OVRT1_0098_E11.b : ggaaaaatttttaa
OVRT1_0023_H03.b : atttttccattcccccccgaagggtttttaaaaaaccctcgattgggaaaataaattggt
CLNT1_0084_E05.b : gaatttttccattcccccccaaagggtttttaaagaccccgggatgtggaaaataatatt
OVRT1_0077_F03.b : aatttcgaatttttccaatccccctcgaaagggtttttaagagaccctctaattggggaa
THY01_0111_E05.b :
20110601C-012764 : ............................................................
---------+---------+---------+---------+---------+---------+ 1010
OVRM1_0114_G02.b :
OVRM1_0036_C06.b :
LVRM1_0040_E05.b :
CBLT1_0066_F03.b : ttcaaatacaaatttatatcccgcgggct
CBLT1_0043_E10.b : ttttaaaagaaacccctgagatggtttaaaattaaatctctattacagtatg
HTMT1_0023_A12.b :
OVRM1_0072_B03.b :
OVRM1_0019_H12.b :
PST01_0038_E04.b : cctggaatggtgaaattgaatctggttaaaggaatgtctttcctaaattcaagattttag
OVRT1_0096_F11.b : aataaacc
LVRM1_0070_G05.b :
OVRT1_0074_H04.b : ataagaaatttttccctagattaaatatttatcccggggtattatttctgtcttgttggg
OVRT1_0023_D10.b : aaccctctgatttgggaaaaattatattgttaaaaagaatgtttttcttaaaaattaaat
OVR01_0030_A03.b :
OVR01_0073_E09.b :
LVRM1_0039_D06.b :
OVRT1_0114_A10.b : aaccccggtggtggtggaaaatatttcgtataaaagaattttttcccaaattcaaatttt
PTG01_0094_E02.b : ttctcccccccccccccggggggaggtataaaaccaaccccttgtgtt
PST01_0074_B05.b : tctggaaagggatttataaaagaaccccttggagtgtggtgaatattatatttgttataa
PST01_0075_D01.b : cctggaaaaggattttttaaaat
KDN01_0087_D11.b : ctgaaaaggggttt
PST01_0043_F10.b : aaagaacaccgtgaatggggaaaattgaatatggttaaacaggagtggcttccttaagtt
OVRM1_0193_A04.b :
LVRM1_0094_B01.b :
LVRM1_0178_E03.b :
OVRM1_0151_G02.b :
OVRM1_0197_G07.b :
OVRM1_0133_E07.b :
OVRM1_0179_B06.b :
OVRM1_0015_A05.b :
OVRM1_0185_B04.b :
OVRM1_0016_A08.b :
OVRT1_0118_H08.b : cacctggatgtggaaataatattgttatacaaacatttgtttcccagagaaagaaattta
OVR01_0070_D09.b :
THY01_0034_F11.b :
THY01_0086_E09.b :
OVRT1_0074_F05.b : taaatggttaagatattttttctcaacacaaatatttgtccgggggaatctcttctccat
OVRT1_0098_E11.b :
OVRT1_0023_H03.b : taaacacatttttcccacgattcaatatttaacccggggggaaattttttcttttgg
CLNT1_0084_E05.b : ttaaaagagatttcctcccaaaataaatttaatgccgggggggatatcttagtttctggg
OVRT1_0077_F03.b : tataaaactttaaacaaaatgttctcctaaatataaaattttacgccgggggttattcct
THY01_0111_E05.b :
20110601C-012764 : ............................................................
---------+---------+---------+---------+---------+---------+ 1010
OVRM1_0114_G02.b :
OVRM1_0036_C06.b :
LVRM1_0040_E05.b :
CBLT1_0066_F03.b :
CBLT1_0043_E10.b :
HTMT1_0023_A12.b :
OVRM1_0072_B03.b :
OVRM1_0019_H12.b :
PST01_0038_E04.b : gctccgggggttaatcctattctctattggggaggttcagaaaatctcaaaaaag
OVRT1_0096_F11.b :
LVRM1_0070_G05.b :
OVRT1_0074_H04.b :
OVRT1_0023_D10.b : tttttct
OVR01_0030_A03.b :
OVR01_0073_E09.b :
LVRM1_0039_D06.b :
OVRT1_0114_A10.b :
PTG01_0094_E02.b :
PST01_0074_B05.b : acatgaattgtcttctcctaaatttccaagaattttaatgtccgctgtggcgttaat
PST01_0075_D01.b :
KDN01_0087_D11.b :
PST01_0043_F10.b : tcaagatttttaggtgcgggggggtaatctctattcgcgacatggggggaag
OVRM1_0193_A04.b :
LVRM1_0094_B01.b :
LVRM1_0178_E03.b :
OVRM1_0151_G02.b :
OVRM1_0197_G07.b :
OVRM1_0133_E07.b :
OVRM1_0179_B06.b :
OVRM1_0015_A05.b :
OVRM1_0185_B04.b :
OVRM1_0016_A08.b :
OVRT1_0118_H08.b : tctccggcggggtatatttctccgtcg
OVR01_0070_D09.b :
THY01_0034_F11.b :
THY01_0086_E09.b :
OVRT1_0074_F05.b : tggggagtaagaaaatcttaaaaaaagagtggggggcgggnccccccccccaatttttgt
OVRT1_0098_E11.b :
OVRT1_0023_H03.b :
CLNT1_0084_E05.b : gggggaaaaaaaataaaaaaaaacgcggg
OVRT1_0077_F03.b : ttctttcttggggggttcaaaaaatcttacaaaaacaggtgccccc
THY01_0111_E05.b :
20110601C-012764 : ............................................................
---------+---------+---------+---------+---------+---------+ 1010
OVRM1_0114_G02.b :
OVRM1_0036_C06.b :
LVRM1_0040_E05.b :
CBLT1_0066_F03.b :
CBLT1_0043_E10.b :
HTMT1_0023_A12.b :
OVRM1_0072_B03.b :
OVRM1_0019_H12.b :
PST01_0038_E04.b :
OVRT1_0096_F11.b :
LVRM1_0070_G05.b :
OVRT1_0074_H04.b :
OVRT1_0023_D10.b :
OVR01_0030_A03.b :
OVR01_0073_E09.b :
LVRM1_0039_D06.b :
OVRT1_0114_A10.b :
PTG01_0094_E02.b :
PST01_0074_B05.b :
PST01_0075_D01.b :
KDN01_0087_D11.b :
PST01_0043_F10.b :
OVRM1_0193_A04.b :
LVRM1_0094_B01.b :
LVRM1_0178_E03.b :
OVRM1_0151_G02.b :
OVRM1_0197_G07.b :
OVRM1_0133_E07.b :
OVRM1_0179_B06.b :
OVRM1_0015_A05.b :
OVRM1_0185_B04.b :
OVRM1_0016_A08.b :
OVRT1_0118_H08.b :
OVR01_0070_D09.b :
THY01_0034_F11.b :
THY01_0086_E09.b :
OVRT1_0074_F05.b : tttttttatttttcttt
OVRT1_0098_E11.b :
OVRT1_0023_H03.b :
CLNT1_0084_E05.b :
OVRT1_0077_F03.b :
THY01_0111_E05.b :