[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20110601C-013331

Length: 1,275

Sequence [FASTA format sequence]
CTTCCTCGAG GAGGGGTTGG GGCCGCGCTC CCACTCGCCC ACACAGTCCG TGTGCAGCCG
GCAGCCTAGC CGGTAGCTCG CTCGGCCCCG CTCGGCCTGG CCCGCAGGTA GGAGCCGCCG
AGGGACGCGG CCCCGGCTGC CCGGCCCTCC CTGCTCGAGC GCCGCGCCTC GCTCCCGCCG
CCCGCTTCGA GGGCTCCATC ACAGCCACCA TGAGCGAGAC CTTTGACTGT GCAAAATGCA
GCGAGTCCCT GTACGGGCGC AAATACATTC AGACGGACAA CGGCCCCTAC TGTGTGCCCT
GCTATGACAA CACCTTTGCC AACACGTGCG CTGAGTGCCA GCAGCTTATC GGGCATGACT
CAAGGGAGCT GTTTTACGAG GATCGCCACT TCCACGAGGG CTGTTTCCGC TGCTGCCGCT
GCCAGCGCTC CCTCGCCGAC GAGCCCTTCA CCTGCCAGGA TAGCGAGCTG CTCTGTAACG
ACTGCTACTG CAGCGCCTTC TCCTCTCAGT GCTCCGCCTG CGGAGAGACC GTCATGCCTG
GGTCCCGGAA GCTGGAGTAC GGAGGCCAGA CGTGGCATGA GCACTGCTTC CTGTGCAGCG
GCTGTGAGCA GCCGCTGGGC TCCTGTTCCT TTGTGCCCGA CAAGGGTGCT CACTACTGCG
TGCCCTGCTA TGAGAACAAG TTCGCGCCTC GCTGCGCCCG CTGCAGCAAG ACGCTGACAC
AGGGTGGCGT GACGTACCGT GACCAACCCT GGCATCGAGA ATGCCTGGTC TGCACAGGGT
GCCAGACGCC CCTGGCAGGG CAGCAGTTCA CCTCCCGGGA CGATGATCCT TATTGTGTGG
CCTGTTTTGG AGAACTCTTT GCACCCAAGT GCAGCAGCTG CAAGCGCCCC ATCACAGGAC
TCGGCGGAGG CAAGTATGTG TCCTTTGAAG ACCGCCACTG GCACCACAGC TGCTTCTCCT
GTGCCCGCTG CTCCACCTCC CTGGTGGGTC AAGGCTTCGT GCCGGATGGA GACCAAGTGC
TGTGCCAGGG TTGCAGCCAG GCAGGGCCCT GAGCCAGGGC TCCTGGGCCC AGGCCCTCCC
ATACCAGGGC TCCAGGACTA AGGCTCCTCT TCCAGAACAC CTCTGGGTCC CAGCCCCGCC
CCAAATGGGG TTCCCCCTAG GCTCCAGGAT TCAGCCTCCC CACTCCAACA TCCCCAATCT
GGTACCTCAG GCTTAATGGA GCCTCCATCA TTTAAATCCC CCCCAAACCA GGACCCCAGA
ACTCAGTCTA TATGG


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFHL3four and a half LIM domains protein 3 isoform 1 [Homo sapiens]. 615e-176O
Contig/Assembly ProteinFHL2four and a half LIM domains protein 2 [Homo sapiens]. 378e-105O
Contig/Assembly ProteinFHL3four and a half LIM domains protein 3 isoform 2 [Homo sapiens]. 378e-105O
Contig/Assembly ProteinFHL2four and a half LIM domains protein 2 [Homo sapiens]. 378e-105O
Contig/Assembly ProteinFHL2four and a half LIM domains protein 2 [Homo sapiens]. 378e-105O
Contig/Assembly ProteinFHL2four and a half LIM domains protein 2 [Homo sapiens]. 378e-105O
Contig/Assembly ProteinFHL5four and a half LIM domains protein 5 [Homo sapiens]. 3394e-93O
Contig/Assembly ProteinFHL5four and a half LIM domains protein 5 [Homo sapiens]. 3394e-93O
Contig/Assembly ProteinFHL1four and a half LIM domains protein 1 isoform 5 [Homo sapiens]. 3017e-82O
Contig/Assembly ProteinFHL1four and a half LIM domains protein 1 isoform 3 [Homo sapiens]. 3017e-82O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFhl3four and a half LIM domains protein 3 [Mus musculus]. 608e-174O
Contig/Assembly ProteinFhl2four and a half LIM domains protein 2 [Mus musculus]. 382e-106O
Contig/Assembly ProteinFhl5four and a half LIM domains protein 5 [Mus musculus]. 3402e-93O
Contig/Assembly ProteinFhl1four and a half LIM domains protein 1 isoform 2 [Mus musculus]. 3019e-82O
Contig/Assembly ProteinFhl1four and a half LIM domains protein 1 isoform 3 [Mus musculus]. 2994e-81O
Contig/Assembly ProteinFhl4four and a half LIM domains 4 [Mus musculus]. 2823e-76O
Contig/Assembly ProteinFhl1four and a half LIM domains protein 1 isoform 1 [Mus musculus]. 2602e-69O
Contig/Assembly ProteinPdlim5PDZ and LIM domain protein 5 isoform ENH1c [Mus musculus]. 1211e-27
Contig/Assembly ProteinPdlim5PDZ and LIM domain protein 5 isoform ENH1d [Mus musculus]. 1211e-27
Contig/Assembly ProteinTgfb1i1transforming growth factor beta-1-induced transcript 1 protein [Mus musculus]. 1211e-27


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC608080PREDICTED: similar to four and a half LIM domains 3 [Canis familiaris]. 629e-180O
Contig/Assembly ProteinLOC474544PREDICTED: similar to four and a half LIM domains 2 isoform 1 [Canis familiaris]. 383e-106
Contig/Assembly ProteinLOC475000PREDICTED: similar to activator of cAMP-responsive element modulator (CREM) in testis [Canis familiaris]. 3457e-95O
Contig/Assembly ProteinLOC492162PREDICTED: similar to four and a half LIM domains 1 isoform 6 [Canis familiaris]. 3025e-82O
Contig/Assembly ProteinLOC492162PREDICTED: similar to four and a half LIM domains 1 isoform 5 [Canis familiaris]. 3002e-81O
Contig/Assembly ProteinLOC492162PREDICTED: similar to Four and a half LIM domains protein 1 (FHL-1) (Skeletal muscle LIM-protein 1) (SLIM 1) (SLIM) isoform 1 [Canis familiaris]. 2641e-70O
Contig/Assembly ProteinLOC492162PREDICTED: similar to Four and a half LIM domains protein 1 (FHL-1) (Skeletal muscle LIM-protein 1) (SLIM 1) (SLIM) (KyoT) (RBP associated molecule 14-1) (RAM14-1) isoform 4 [Canis familiaris]. 1896e-48O
Contig/Assembly ProteinLOC492162PREDICTED: similar to four and a half LIM domains 1 isoform 3 [Canis familiaris]. 1833e-46O
Contig/Assembly ProteinLOC478482PREDICTED: similar to PDZ and LIM domain 5 isoform b isoform 12 [Canis familiaris]. 1227e-28
Contig/Assembly ProteinLOC478482PREDICTED: similar to Enigma homolog (Enigma-like PDZ and LIM domains protein) isoform 13 [Canis familiaris]. 1227e-28


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinFHL3four and a half LIM domains protein 3 [Bos taurus]. 618e-177O
Contig/Assembly ProteinFHL2four and a half LIM domains protein 2 [Bos taurus]. 381e-106O
Contig/Assembly ProteinFHL5four and a half LIM domains protein 5 [Bos taurus]. 3393e-93O
Contig/Assembly ProteinFHL1four and a half LIM domains 1 isoform 1 [Bos taurus]. 3001e-81O
Contig/Assembly ProteinFHL1four and a half LIM domains 1 isoform 2 [Bos taurus]. 2985e-81O
Contig/Assembly ProteinFHL1four and a half LIM domains 1 isoform 3 [Bos taurus]. 1795e-45O
Contig/Assembly ProteinPXNPREDICTED: paxillin-like [Bos taurus]. 1198e-27
Contig/Assembly ProteinPXNPREDICTED: paxillin-like [Bos taurus]. 1198e-27
Contig/Assembly ProteinTGFB1I1transforming growth factor beta-1-induced transcript 1 protein [Bos taurus]. 1194e-27
Contig/Assembly ProteinPDLIM7PDZ and LIM domain protein 7 isoform 2 [Bos taurus]. 1156e-26


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100512841PREDICTED: four and a half LIM domains protein 3-like [Sus scrofa]. 6290.0O
Contig/Assembly ProteinFHL3four and a half LIM domains protein 3 [Sus scrofa]. 624e-179O
Contig/Assembly ProteinFHL5four and a half LIM domains protein 5 [Sus scrofa]. 3471e-95O
Contig/Assembly ProteinLOC100513532PREDICTED: four and a half LIM domains protein 2-like isoform 2 [Sus scrofa]. 3179e-87O
Contig/Assembly ProteinFHL1Cfour and a half LIM domains 1 protein, isoform C [Sus scrofa]. 3032e-82O
Contig/Assembly ProteinLDB3PREDICTED: hypothetical protein LOC100151883 [Sus scrofa]. 1202e-27
Contig/Assembly ProteinPDLIM5PREDICTED: PDZ and LIM domain protein 5, partial [Sus scrofa]. 1193e-27O
Contig/Assembly ProteinLOC100517009PREDICTED: LIM and senescent cell antigen-like-containing domain protein 2-like isoform 1 [Sus scrofa]. 1186e-27O
Contig/Assembly ProteinLOC100517009PREDICTED: LIM and senescent cell antigen-like-containing domain protein 2-like isoform 2 [Sus scrofa]. 1155e-26O
Contig/Assembly ProteinLIMS1LIM and senescent cell antigen-like domains 1 [Sus scrofa]. 1155e-26O


Assembly Members: 20      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
ADR010085H04ADR01_0085_H04.bDB789091 
BFLT10116B02BFLT1_0116_B02.bHX203036 
LNG010071B02LNG01_0071_B02.bBP434100 
OVRM10007C12OVRM1_0007_C12.bBP148547 
OVRM10045C10OVRM1_0045_C10.bBP457253 
OVRM10077G02OVRM1_0077_G02.bBP152511 
OVRM10101B07OVRM1_0101_B07.bBP146832 AK235646
OVRT10015B12OVRT1_0015_B12.bFS687608 AK395477
OVRT10068G08OVRT1_0068_G08.bFS692002 
OVRT10100E01OVRT1_0100_E01.bFS694574 
OVRT10134H03OVRT1_0134_H03.bHX237570 
PBL010094D01PBL01_0094_D01.bBW974440 
PST010043G01PST01_0043_G01.bFS700238 
PST010057A02PST01_0057_A02.bFS701304 
TCH010096E05TCH01_0096_E05.bCJ029466 
TES010053E05TES01_0053_E05.b  
TES010088B07TES01_0088_B07.bCJ035679 
TES010102E08TES01_0102_E08.bCJ036714 
UTR010084C07UTR01_0084_C07.bCJ037736 
UTR010085G07UTR01_0085_G07.bCJ037877 

  

SNPs: 2      TOP
Loc.AlleleIndividualsFreq.TypeAA Change
WesternMeishan
522A500.250WNAGA/R
G1140.750GGA/G
530C1600.842BSACC/T
T030.158ACT/T


Alignment:      TOP

20110601C-013331 : ............................................................
---------+---------+---------+---------+---------+---------+ 0
OVRT1_0015_B12.b : nncttccgttagctgtcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
BFLT1_0116_B02.b : nnnnnccgtctgctgtcgxxxxxx
OVRM1_0045_C10.b : cgtt
OVRM1_0101_B07.b : nagtt
OVRM1_0007_C12.b : cxxxxxxx
UTR01_0085_G07.b : nnnggcttgtgactttacxxxxxx
TCH01_0096_E05.b : nnggggctggactatnacxxx
OVRT1_0068_G08.b : ngggatacgtctgcgc
OVRT1_0134_H03.b : nnggctttccnnnnnnnccgttcgcgt
OVRT1_0100_E01.b : gttttccgtctgcgcac
UTR01_0084_C07.b : nngggctgtgacttnacxxxx
ADR01_0085_H04.b :
LNG01_0071_B02.b : ttttnnggctgtacttgacagt
OVRM1_0077_G02.b :
TES01_0053_E05.b :
TES01_0088_B07.b :
PST01_0057_A02.b :
PST01_0043_G01.b :
TES01_0102_E08.b :
PBL01_0094_D01.b :
20110601C-013331 : .............CTTCCTCGAGGAGGGGTTGGGGCCGCGCTCCCACTCGCCCACACAGT
---------+---------+---------+---------+---------+---------+ 47
OVRT1_0015_B12.b : xxxxxxxxxxxxxCTTCCTCGAGGAGGGGTTGGGGCCGCGCTCCCACTCGCCCACACAGT
BFLT1_0116_B02.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxACTCGCCCACACAGT
OVRM1_0045_C10.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGT
OVRM1_0101_B07.b : gtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGT
OVRM1_0007_C12.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGT
UTR01_0085_G07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxCAGT
TCH01_0096_E05.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAGT
OVRT1_0068_G08.b : acgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtAGT
OVRT1_0134_H03.b : tcgxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGT
OVRT1_0100_E01.b : gxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxtgacGT
UTR01_0084_C07.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGT
ADR01_0085_H04.b : nnnggactaacxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGT
LNG01_0071_B02.b : ttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGT
OVRM1_0077_G02.b : acxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxctcT
TES01_0053_E05.b : gctcgctgtggctatgga
TES01_0088_B07.b : ncctgcgttggctctggaag
PST01_0057_A02.b : nnnnggctgctgtggctatggacg
PST01_0043_G01.b : nntttgtcactgtggctatgga
TES01_0102_E08.b :
PBL01_0094_D01.b :
20110601C-013331 : CCGTGTGCAGCCGGCAGCCTAGCCGGTAGCTCGCTCGGCCCCGCTCGGCCTG*GCCCGCA
---------+---------+---------+---------+---------+---------+ 106
OVRT1_0015_B12.b : CCGTGTGCAGCCGGCAGCCTAGCCGGTAGCTCGCTCGGCCCCGCTCGGCCTG*GCCCGCA
BFLT1_0116_B02.b : CCGTGTGCAGCCGGCAGCCTAGCCGGTAGCTCGCTCGGCCCCGCTCGGCCTG*GCCCGCA
OVRM1_0045_C10.b : CCGTGTGCAGCCGGCAGCCTAGCCGGTAGCTCGCTCGGCCCCGCTCGGCCTG*GCCCGCA
OVRM1_0101_B07.b : CCGTGTGCAGCCGGCAGCCTAGCCGGTAGCTCGCTCGGCCCCGCTCGGCCTG*GCCCGCA
OVRM1_0007_C12.b : CCGTGTGCAGCCGGCAGCCTAGCCGGTAGCTCGCTCGGCCCCGCTCGGCCTG*GCCCGCA
UTR01_0085_G07.b : CCGTGTGCAGCCGGCAGCCTAGCCGGTAGCTCGCTCGGCCCCGCTCGGCCTG*GCCCGCA
TCH01_0096_E05.b : CCGTGTGCAGCCGGCAGCCTAGCCGGTAGCTCGCTCGGCCCCGCTCGGCCTG*GCCCGCA
OVRT1_0068_G08.b : CCGTGTGCAGCCGGCAGCCTAGCCGGTAGCTCGCTCGGCCCCGCTCGGCCTG*GCCCGCA
OVRT1_0134_H03.b : CCGTGTGCAGCCGGCAGCCTAGCCGGTAGCTCGCTCGGCCCCGCTCGGCCTG*GCCCGCA
OVRT1_0100_E01.b : CCGTGTGCAGCCGGCAGCCTAGCCGGTAGCTCGCTCGGCCCCGCTCGGCCTG*GCCCGCA
UTR01_0084_C07.b : CCGTGTGCAGCCGGCAGCCTAGCCGGTAGCTCGCTCGGCCCCGCTCGGCCTG*GCCCGCA
ADR01_0085_H04.b : CCGTGTGCAGCCGGCAGCCTAGCCGGTAGCTCGCTCGGCCCCGCTCGGCCTG*GCCCGCA
LNG01_0071_B02.b : CCGTGTGCAGCCGGCAGCCTAGCCGGTAGCTCGCTCGGCCCCGCTCGGCCTG*GCCCGCA
OVRM1_0077_G02.b : CCGTGTGCAGACGGCAGCCTAGCCGGTAGCTCGCTCGGCCCCGCTCGGCCTG*GCCCGCA
TES01_0053_E05.b : gtcgtgtgcGCCGGCAGCCTAGCCGGTAGCTCGCTCGGCCCCGCTCGGCCTGTGAACGCA
TES01_0088_B07.b : tccgtgtgcGCCGGCAGCCTAGCCGGTAGCTCGCTCGGCCCCGCTCGGCCTG*GCCCGCA
PST01_0057_A02.b : tccgtgtgcGCCGGCAGCCCAGCCGGTAGCTCGCTCGGCCCCGCTCGGTCTG*GCCCGCA
PST01_0043_G01.b : nccgtgtgcaCCGGCAGCCTAGCCGGTAGCTCGCTCGGCCCCGCTCGTCCTG*GCCCGCA
TES01_0102_E08.b :
PBL01_0094_D01.b :
20110601C-013331 : GGTAGGAGCCGCCGAGGGACGCGGCCCCGGCTGCCCGGCCCTCCCTGCTCGAGCGCCGCG
---------+---------+---------+---------+---------+---------+ 166
OVRT1_0015_B12.b : GGTAGGAGCCGCCGAGGGACGCGGCCCCGGCTGCCCGGCCCTCCCTGCTCGAGCGCCGCG
BFLT1_0116_B02.b : GGTAGGAGCCGCCGAGGGACGCGGCCCCGGCTGCCCGGCCCTCCCTGCTCGAGCGCCGCG
OVRM1_0045_C10.b : GGTAGGAGCCGCCGAGGGACGCGGCCCCGGCTGCCCGGCCCTCCCTGCTCGAGCGCCGCG
OVRM1_0101_B07.b : GGTAGGAGCCGCCGAGGGACGCGGCCCCGGCTGCCCGGCCCTCCCTGCTCGAGCGCCGCG
OVRM1_0007_C12.b : GGTAGGAGCCGCCGAGGGACGCGGCCCCGGCTGCCCGGCCCTCCCTGCTCGAGCGCCGCG
UTR01_0085_G07.b : GGTAGGAGCCGCCGAGGGACGCGGCCCCGGCTGCCCGGCCCTCCCTGCTCGAGCGCCGCG
TCH01_0096_E05.b : GGTAGGAGCCGCCGAGGGACGCGGCCCCGGCTGCCCGGCCCTCCCTGCTCGAGCGCCGCG
OVRT1_0068_G08.b : GGTAGGAGCCGCCGAGGGACGCGGCCCCGGCTGCCCGGCCCTCCCTGCTCGAGCGCCGCG
OVRT1_0134_H03.b : GGTAGGAGCCGCCGAGGGACGCGGCCCCGGCTGCCCGGCCCTCCCTGCTCGAGCGCCGCG
OVRT1_0100_E01.b : GGTAGGAGCCGCCGAGGGACGCGGCCCCGGCTGCCCGGCCCTCCCTGCTCGAGCGCCGCG
UTR01_0084_C07.b : GGTAGGAGCCGCCGAGGGACGCGGCCCCGGCTGCCCGGCCCTCCCTGCTCGAGCGCCGCG
ADR01_0085_H04.b : GGTAGGAGCCGCCGAGGGACGCGGCCCCGGCTGCCCGGCCCTCCCTGCTCGAGCGCCGCG
LNG01_0071_B02.b : GGTAGGAGCCGCCGAGGGACGCGGCCCCGGCTGCCCGGCCCTCCCTGCTCGAGCGCCGCG
OVRM1_0077_G02.b : GGTAGGAGCCGCCGAGGGACGCGGCCCCGGCTGCCCGGCCCTCCCTGCTCGAGCGCCGCG
TES01_0053_E05.b : GGTAGGAGCCGCCGAGGGACGCGGCCCCGGCCGCTCGGCCCTCCCTGCTCGAGCGCCGCG
TES01_0088_B07.b : GGTAGGAGCCGCCGAGGGACGCGGCCCCGGCTGCCCGGCCCTCCCTGCTCGAGCGCCGCG
PST01_0057_A02.b : GGTAGGAGCCGCCGAGGGACGCGGCCCCGGCTGCCCGGCCCTCCCTGCTCGAGCGCCGCG
PST01_0043_G01.b : GGTAGGAGCCGCCGAGGGACGCGGCCCCGGCTGCCCGGCCCTCCCTGCTCGAGCGCCGCG
TES01_0102_E08.b :
PBL01_0094_D01.b :
20110601C-013331 : CCTCGCTCCCGCCGCCCGCTTCGAGGGCTCCATCACAGCCACCATGAGCGAGACCTTTGA
---------+---------+---------+---------+---------+---------+ 226
OVRT1_0015_B12.b : CCTCGCTCCCGCCGCCCGCTTCGAGGGCTCCATCACAGCCACCATGAGCGAGACCTTTGA
BFLT1_0116_B02.b : CCTCGCTCCCGCCGCCCGCTTCGAGGGCTCCATCACAGCCACCATGAGCGAGACCTTTGA
OVRM1_0045_C10.b : CCTCGCTCCCGCCGCCCGCTTCGAGGGCTCCATCACAGCCACCATGAGCGAGACCTTTGA
OVRM1_0101_B07.b : CCTCGCTCCCGCCGCCCGCTTCGAGGGCTCCATCACAGCCACCATGAGCGAGACCTTTGA
OVRM1_0007_C12.b : CCTCGCTCCCGCCGCCCGCTTCGAGGGCTCCATCACAGCCACCATGAGCGAGACCTTTGA
UTR01_0085_G07.b : CCTCGCTCCCGCCGCCCGCTTCGAGGGCTCCATCACAGCCACCATGAGCGAGACCTTTGA
TCH01_0096_E05.b : CCTCGCTCCCGCCGCCCGCTTCGAGGGCTCCATCACAGCCACCATGAGCGAGACCTTTGA
OVRT1_0068_G08.b : CCTCGCTCCCGCCGCCCGCTTCGAGGGCTCCATCACAGCCACCATGAGCGAGACCTTTGA
OVRT1_0134_H03.b : CCTCGCTCCCGCCGCCCGCTTCGAGGGCTCCATCACAGCCACCATGAGCGAGACCTTTGA
OVRT1_0100_E01.b : CCTCGCTCCCGCCGCCCGCTTCGAGGGCTCCATCACAGCCACCATGAGCGAGACCTTTGA
UTR01_0084_C07.b : CCTCGCTCCCGCCGCCCGGTTCGAGGGCTCCATCACAGCCACCATGAGCGAGACCTTTGA
ADR01_0085_H04.b : CCTCGCTCCCGCCGCCCGCTTCGAGGGCTCCATCACAGCCACCATGAGCGAGACCTTTGA
LNG01_0071_B02.b : CCTCGCTCCCGCCGCCCGCTTCGAGGGCTCCATCACAGCCACCATGAGCGAGACCTTTGA
OVRM1_0077_G02.b : CCTCGCTCCCGCCGCCCGCTTCGAGGGCTCCATCACAGCCACCATGAGCGAGACCTTTGA
TES01_0053_E05.b : CCTCGCTCCCGCCGCCCGCTTCGAGGGCTCCATCACAGCCACCATGAGCGAGACCTTTGA
TES01_0088_B07.b : CCTCGCTCCCGCCGCCCGCTTCGAGGGCTCCATCACAGCCACCATGAGCGAGACCTTTGA
PST01_0057_A02.b : CCTCGCTCCCGCCGCCCGCTTCGAGGGCTCCATCACAGCCACCATGAGCGAGACCTTTGA
PST01_0043_G01.b : CCTCGCTCCCGCCGCCCGCTTCGAGGGCTCCATCACAGCCACCATGAGCGAGACCTTTGA
TES01_0102_E08.b : ntttatttgcgtgg
PBL01_0094_D01.b :
20110601C-013331 : CTGTGCAAAATGCAGCGAGTCCCTGTACGGGCGCAAATACATTCAGACGGACAACGGCCC
---------+---------+---------+---------+---------+---------+ 286
OVRT1_0015_B12.b : CTGTGCAAAATGCAGCGAGTCCCTGTACGGGCGCAAATACATTCAGACGGACAACGGCCC
BFLT1_0116_B02.b : CTGTGCAAAATGCAGCGAGTCCCTGTACGGGCGCAAATACATTCAGACGGACAACGGCCC
OVRM1_0045_C10.b : CTGTGCAAAATGCAGCGAGTCCCTGTACGGGCGCAAATACATTCAGACGGACAACGGCCC
OVRM1_0101_B07.b : CTGTGCAAAATGCAGCGAGTCCCTGTACGGGCGCAAATACATTCAGACGGACAACGGCCC
OVRM1_0007_C12.b : CTGTGCAAAATGCAGCGAGTCCCTGTACGGGCGCAAATACATTCAGACGGACAACGGCCC
UTR01_0085_G07.b : CTGTGCAAAATGCAGCGAGTCCCTGTACGGGCGCAAATACATTCAGACGGACAACGGCCC
TCH01_0096_E05.b : CTGTGCAAAATGCAGCGAGTCCCTGTACGGGCGCAAATACATTCAGACGGACAACGGCCC
OVRT1_0068_G08.b : CTGTGCAAAATGCAGCGAGTCCCTGTACGGGCGCAAATACATTCAGACGGACAACGGCCC
OVRT1_0134_H03.b : CTGTGCAAAATGCAGCGAGTCCCTGTACGGGCGCAAATACATTCAGACGGACAACGGCCC
OVRT1_0100_E01.b : CTGTGCAAAATGCAGCGAGTCCCTGTACGGGCGCAAATACATTCAGACGGACAACGGCCC
UTR01_0084_C07.b : CTGTGCAAAATGCAGCGAGTCCCTGTACGGGCGCAAATACATTCAGACGGACAACGGCCC
ADR01_0085_H04.b : CTGTGCAAAATGCAGCGAGTCCCTGTACGGGCGCAAATACATTCAGACGGACAACGGCCC
LNG01_0071_B02.b : CTGTGCAAAATGCAGCGAGTCCCTGTACGGGCGCAAATACATTCAGACGGACAACGGCCC
OVRM1_0077_G02.b : CTGTGCAAAATGCAGCGAGTCCCTGTACGGGCGCAAATACATTCAGACGGACAACGGCCC
TES01_0053_E05.b : CTGTGCAAAATGCAGCGAGTCCCTGTACGGGCGCAAATACATTCAGACGGACAACGGCCC
TES01_0088_B07.b : CTGTGCAAAATGCAGCGAGTCCCTGTACGGGCGCAAATAC*****GACGGACAACGGCCC
PST01_0057_A02.b : CTGTGCAAAATGCAGCGAGTCCCTGTACGGGCGCAAATACATTCAGACGGACAACGGCCC
PST01_0043_G01.b : CTGTGCAAAATGCAGCGAGTCCCTGTACGGGCGCAAATACATTCAGACGGACAACGGCCC
TES01_0102_E08.b : ctatggcAAATGCAGCGAGTCCCTGTACGGGCGCAA*TACATTCAGACGGACAACGGCTC
PBL01_0094_D01.b : nnnggtgaacaxxxxxxxxxxxxxxx
20110601C-013331 : CTACTGTGTGCCCTGCTATGACAACACCTTTGCCAACACGTGCGCTGAGTGCCAGCAGCT
---------+---------+---------+---------+---------+---------+ 346
OVRT1_0015_B12.b : CTACTGTGTGCCCTGCTATGACAACACCTTTGCCAACACGTGCGCTGAGTGCCAGCAGCT
BFLT1_0116_B02.b : CTACTGTGTGCCCTGCTATGACAACACCTTTGCCAACACGTGCGCTGAGTGCCAGCAGCT
OVRM1_0045_C10.b : CTACTGTGTGCCCTGCTATGACAACACCTTTGCCAACACGTGCGCTGAGTGCCAGCAGCT
OVRM1_0101_B07.b : CTACTGTGTGCCCTGCTATGACAACACCTTTGCCAACACGTGCGCTGAGTGCCAGCAGCT
OVRM1_0007_C12.b : CTACTGTGTGCCTTGCTATGACAACACCTTTGCCAACACGTGCGCTGAGTGCCAGCAGCT
UTR01_0085_G07.b : CTACTGTGTGCCCTGCTATGACAACACCTTTGCCAACACGTGCGCTGAGTGCCAGCAGCT
TCH01_0096_E05.b : CTACTGTGTGCCCTGCTATGACAACACCTTTGCCAACACGTGCGCTGAGTGCCAGCAGCT
OVRT1_0068_G08.b : CTACTGTGTGCCCTGCTATGACAACACCTTTGCCAACACGTGCGCTGAGTGCCAGCAGCT
OVRT1_0134_H03.b : CTACTGTGTGCCCTGCTATGACAACACCTTTGCCAACACGTGCGCTGAGTGCCAGCAGCT
OVRT1_0100_E01.b : CTACTGTGTGCCCTGCTATGACAACACCTTTGCCAACACGTGCGCTGAGTGCCAGCAGTT
UTR01_0084_C07.b : CTACTGTGTGCCCTGCTATGACAACACCTTTGCCAACACGTGCGCTGAGTGCCAGCAGCT
ADR01_0085_H04.b : CTACTGTGTGCCCTGCTATGACAACACCTTTGCCAACACGTGCGCTGAGTGCCAGCAGCT
LNG01_0071_B02.b : CTACTGTGTGCCCTGCTATGACAACACCTTTGCCAACACGTGCGCTGAGTGCCAGCAGCT
OVRM1_0077_G02.b : CTACTGTGTGCCCTGCTATGACAACACCTTTGCCAACACGTGCGCTGAGTGCCAGCAGCT
TES01_0053_E05.b : CTACTGTGTGCCCTGCTATGACAACACCTTTGCCAACACGTGCGCTGAGTGCCAGCAGCT
TES01_0088_B07.b : CTACTGTGTGCCCTGCTATGACAACACCTTTGCCAGCACGTGCGCTGAGTGCCAGCAGCT
PST01_0057_A02.b : CTACTGTGTGCCCTGCTATGACAACACCTTTGCCAACACGTGCGCTGAGTGCCAGCAGCT
PST01_0043_G01.b : CTACTGTGTGCCCTGCTATGACAACACCTTTGCCAACACGTGCGCTGAGTGCCAGCAGCT
TES01_0102_E08.b : CTACTGTGTGCCCTGCTATGACAACACCTTTGCCAACACGTGCGCTGAGTGCCAGCAGCT
PBL01_0094_D01.b : xxxxxxxxxxxxxxxxxxxxxxxxxxxCTTTGCCA*CACGTGCGCTGAGTGCCAGCAGCT
20110601C-013331 : TATCGGGCATGACTCAAGGGAGCTGTTTTACGAGGATCGCCACTTCCACGAGGGCTGTTT
---------+---------+---------+---------+---------+---------+ 406
OVRT1_0015_B12.b : TATCGGGCATGACTCAAGGGAGCTGTTTTACGAGGATCGCCACTTCCACGAGGGCTGTTT
BFLT1_0116_B02.b : TATCGGGCATGACTCAAGGGAGCTGTTTTACGAGGATCGCCACTTCCACGAGGGCTGTTT
OVRM1_0045_C10.b : TATCGGGCATGACTCAAGGGAGCTGTTTTACGAGGATCGCCACTTCCACGAGGGCTGTTT
OVRM1_0101_B07.b : TATCGGGCATGACTCAAGGGAGCTGTTTTACGAGGATCGCCACTTCCACGAGGGCTGTTT
OVRM1_0007_C12.b : TATCGGGCATGACTCAAGGGAGCTGTTTTACGAGGATCGCCACTTCCACGAGGGCTGTTT
UTR01_0085_G07.b : TATCGGGCATGACTCAAGGGAGCTGTTTTACGAGGATCGCCACTTCCACGAGGGCTGTTT
TCH01_0096_E05.b : TATCGGGCATGACTCAAGGGAGCTGTTTTACGAGGATCGCCACTTCCACGAGGGCTGTTT
OVRT1_0068_G08.b : TATCGGGCATGACTCAAGGGAGCTGTTTTACGAGGATCGCCACTTCCACGAGGGCTGTTT
OVRT1_0134_H03.b : TATCGGGCATGACTCAAGGGAGCTGTTTTACGAGGATCGCCACTTCCACGAGGGCTGTTT
OVRT1_0100_E01.b : TATCGGGCATGACTCAAGGGAGCTGTTTTACGAGGATCGCCACTTCCACGAGGGCTGTTT
UTR01_0084_C07.b : TATCGGGCATGACTCAAGGGAGCTGTTTTACGAGGATCGCCACTTCCGCGAGGGCTGTTT
ADR01_0085_H04.b : TATCGGGCATGACTCAAGGGAGCTGTTTTACGAGGATCGCCACTTCCACGAGGGCTGTTT
LNG01_0071_B02.b : TATCGGGCATGACTCAAGGGAGCTGTTTTACGAGGATCGCCACTTCCACGAGGGCTGTTT
OVRM1_0077_G02.b : TATCGGGCATGACTCAAGGGAGCTGTTTTACGAGGATCGCCACTTCCACGAGGGCTGTTT
TES01_0053_E05.b : TATCGGGCATGACTCAAGGGAGCTGTTTTACGAGGATCGCCACTTCCACGAGGGCTGTTT
TES01_0088_B07.b : TATCGGGCATGACTCAAGGGAGCTGTTTTACGAGGATCGCCACTTCCACGAGGGCTGTTT
PST01_0057_A02.b : TATCGGGCATGACTCAAGGGAGCTGTTTTACGAGGATCGCCACTTCCACGAGGGCTGTTT
PST01_0043_G01.b : TATCGGGCATGACTCAAGGGAGCTGTTTTACGAGGATCGCCACTTCCACGAGGGCTGTTT
TES01_0102_E08.b : TATCGGGCATGACTCAAGGGAGCTGTTTTACGAGGATCGCCACTTCCACGAGGGCTGTTT
PBL01_0094_D01.b : TATCGGGCATGACTCAAGGGAGCTGTTTTACGAGGATCGCCACTTCCACGAGGGCTGTTT
20110601C-013331 : CCGCTGCTGCCGCTGCCAGCGCTCCCTCGCCGACGAGCCCTTCACCTGCCAGGATAGCGA
---------+---------+---------+---------+---------+---------+ 466
OVRT1_0015_B12.b : CCGCTGCTGCCGCTGCCAGCGCTCCCTCGCCGACGAGCCCTTCACCTGCCAGGATAGCGA
BFLT1_0116_B02.b : CCGCTGCTGCCGCTGCCAGCGCTCCCTCGCCGACGAGCCCTTCACCTGCCAGGATAGCGA
OVRM1_0045_C10.b : CCGCTGCTGCCGCCGCCAGCGCTCCCTCGCCGACGAGCCCTTCACCTGCCAGGATAGCGA
OVRM1_0101_B07.b : CCGCTGCTGCCGCTGCCAGCGCTCCCTCGCCGACGAGCCCTTCACCTGCCAGGATAGCGA
OVRM1_0007_C12.b : CCGCTGCTGCCGCTGCCAGCGCTCCCTCGCCGACGAGCCCTTCACCTGCCAGGATAGCGA
UTR01_0085_G07.b : CCGCTGCTGCCGCTGCCAGCGCTCCCTCGCCGACGAGCCCTTCACCTGCCAGGATAGCGA
TCH01_0096_E05.b : CCG*TGCTGCCGCTGCCAGCGCTCCCTCGCCGACGAGCCCTTCACCTGCCAGGATAGCGA
OVRT1_0068_G08.b : CCGCTGCTGCCGCTGCCAGCGCTCCCTCGCCGACGAGCCCTTCACCTGCCAGGATAGCGA
OVRT1_0134_H03.b : CCGCTGCTGCCGCTGCCAGCGCTCCCTCGCCGACGAGCCCTTCACCTGCCAGGATAGCGA
OVRT1_0100_E01.b : CCGCTGCTGCCGCTGCCAGCGCTCCCTCGCCGACGAGCCCTTCACCTGCCAGGATAGCGA
UTR01_0084_C07.b : CCGCTGCTGCCGCTGCCAGCGCTCCCTCGCCGACGAGCCCTTCACCTGCCAGGATAGCGA
ADR01_0085_H04.b : CCGCTGCTGCCGCTGCCAGCGCTCCCTCGCCGACGAGCCCTTCACCTGCCAGGATAGCGA
LNG01_0071_B02.b : CCGCTGCTGCCGCTGCCAGCGCTCCCTCGCCGACGAGCCCTTCACCTGCCAGGATAGCGA
OVRM1_0077_G02.b : CCGCTGCTGCCGCTGCCAGCGCTCCCTCGCCGACGAGCCCTTCACCTGCCAGGACAGCGA
TES01_0053_E05.b : CCGCTGCTGCCGCTGCCAGCGCTCCCTCGCCGACGAGCCCTTCACCTGCCAGGATAGCGA
TES01_0088_B07.b : CCGCTGCTGCCGCTGCCAGCGCTCCCTCGCCGACGAGCCCTTCACCTGCCAGGATAGCGA
PST01_0057_A02.b : CCGCTGCTGCCGCTGCCAGCGCTCCCTCGCCGACGAGCCCTTCACCTGCCAGGATAGCGA
PST01_0043_G01.b : CCGCTGCTGCCGCTGCCAGCGCTCCCTCGCCGACGAGCCCTTCACCTGCCAGGATAGCGA
TES01_0102_E08.b : CCGCTGCTGCCGCTGCCAGCGCTCCCTCGCCGACGAGCCCTTCACCTGCCAGGATAGCGA
PBL01_0094_D01.b : CCGCTGCTGCCGCTGCCAGCGCTCCCTCGCCGACGAGCCCTTCACCTGCCAGGATAGCGA
20110601C-013331 : GCTGCTCTGTAACGACTGCTACTGCAGCGCCTTCTCCTCTCAGTGCTCCGCCTGCGGAGA
---------+---------+---------+---------+---------+---------+ 526
OVRT1_0015_B12.b : GCTGCTCTGTAACGACTGCTACTGCAGCGCCTTCTCCTCTCAGTGCTCCGCCTGCGGAGA
BFLT1_0116_B02.b : GCTGCTCTGTAACGACTGCTACTGCAGCGCCTTCTCCTCTCAGTGCTCCGCCTGCGGAGA
OVRM1_0045_C10.b : GCTGCTCTGTAACGACTGCTACTGCAGCGCCTTCTCCTCTCAGTGCTCCGCCTGCGGAGA
OVRM1_0101_B07.b : GCTGCTCTGTAACGACTGCTACTGCAGCGCCTTCTCCTCTCAGTGCTCCGCCTGCGGAGA
OVRM1_0007_C12.b : GCTGCTCTGTAACGACTGCTACTGCAGCGCCTTCTCCTCTCAGTGCTCCGCCTGCGGAGA
UTR01_0085_G07.b : GCTGCTCTGTAACGACTGCTACTGCAGCGCCTTCTCCTCTCAGTGCTCCGCCTGCAGAGA
TCH01_0096_E05.b : GCTGCTCTGTAACGACTGCTACTGCAGCGCCTTCTCCTCTCAGTGCTCCGCCTGCAGAGA
OVRT1_0068_G08.b : GCTGCTCTGTAACGACTGCTACTGCAGCGCCTTCTCCTCACAGTGCTCCGCCTGCGGAGA
OVRT1_0134_H03.b : GCTGCTCTGTAACGACTGCTACTGCAGCGCCTTCTCCTCTCAGTGCTCCGCCTGCGGAGA
OVRT1_0100_E01.b : GCTGCTCTGTAACGACTGCTACTGCAGCGCCTTCTCCTCTCAGTGCTCCGCCTGCGGAGA
UTR01_0084_C07.b : GCTGCTCTGTAACGACTGCTACTGCAGCGCCTTCTCCTCTCAGTGCTCCGCCTGCAGAGA
ADR01_0085_H04.b : GCTGCTCTGTAACGACTGCTACTGCAGCGCCTTCTCCTCTCAGTGCTCCGCCTGCAGAGA
LNG01_0071_B02.b : GCTGCTCTGTAACGACTGCTACTGCAGCGCCTTCTCCTCTCAGTGCTCCGCCTGCGGAGA
OVRM1_0077_G02.b : GCTGCTCTGTAACGACTGCTACTGCAGCGCCTTCTCCTCTCAGTGCTCCGCCTGCGGAGA
TES01_0053_E05.b : GCTGCTCTGTAACGACTGCTACTGCAGCGCCTTCTCCTCTCAGTGCTCCGCCTGCGGAGA
TES01_0088_B07.b : GCTGCTCTGTAACGACTGCTACTGCAGCGCCTTCTCCTCTCAGTGCTCCGCCTGCAGAGA
PST01_0057_A02.b : GCTGCTCTGTAACGACTGCTACTGCAGCGCCTTCTCCTCTCAGTGCTCCGCCTGCGGAGA
PST01_0043_G01.b : GCTGCTCTGTAACGACTGCTACTGCAGCGCCTTCTCCTCTCAGTGCTCCGCCTGCGGAGA
TES01_0102_E08.b : GCTGCTCTGTAACGACTGCTACTGCAGCGCCTTCTCCTCTCAGTGCTCCGCCTGCGGAGA
PBL01_0094_D01.b : GCTGCTCTGTAACGACTGCTACTGCAGCGCCTTCTCCTCTCAGTGCTCCGCCTGCGGAGA
20110601C-013331 : GACCGTCATGCCTGGGTCCCGGAAGCTGGAGTACGGAGGCCAGACGTGGCATGAGCACTG
---------+---------+---------+---------+---------+---------+ 586
OVRT1_0015_B12.b : GACCGTCATGCCTGGGTCCCGGAAGCTGGAGTACGGAGGCCAGACGTGGCATGAGCACTG
BFLT1_0116_B02.b : GACCGTCATGCCTGGGTCCCGGAAGCTGGAGTACGGAGGCCAGACGTGGCATGAGCACTG
OVRM1_0045_C10.b : GACTGTCATGCCTGGGTCCCGGAAGCTGGAGTACGGAGGCCAGACGTGGCATGAGCACTG
OVRM1_0101_B07.b : GACTGTCATGCCTGGGTCCCGGAAGCTGGAGTACGGAGGCCAGACGTGGCATGAGCACTG
OVRM1_0007_C12.b : GACTGTCATGCCTGGGTCCCGGAAGCTGGAGTACGGAGGCCAGACGTGGCATGAGCACTG
UTR01_0085_G07.b : GACCGTCATGCCTGGGTCCCGGAAGCTGGAGTACGGAGGCCAGACGTGGCATGAGCACTG
TCH01_0096_E05.b : GACCGTCATGCCTGGGTCCCGGAAGCTGGAGTACGGAGGCCAGACGTGGCATGAGCACTG
OVRT1_0068_G08.b : GACCGTCATGCCTGGGTCCCGGAAGCTGGAGTACGGAGGCCAGACGTGGCATGAGCACTG
OVRT1_0134_H03.b : GACCGTCATGCCTGGGTCCCGGAAGCTGGAGTACGGAGGCCAGACGTGGCATGAGCACTG
OVRT1_0100_E01.b : GACCGTCATGCCTGGGTCCCGGAAGCTGGAGTACGGAGGCCAGACGTGGCATGAGCACTG
UTR01_0084_C07.b : GACCGTCATGCCTGGGTCCCGGAAGCTGGAGTACGGAGGCCAGACGTGGCATGAGCACTG
ADR01_0085_H04.b : GACCGTCATGCCTGGGTCCCGGAAGCTGGAGTACGGAGGCCAGACGTGGCATGAGCACTG
LNG01_0071_B02.b : GACCGTCATGCCTGGGTCCCGGAAGCTGGAGTACGGAGGCCAGACGTGGCATGAGCACTG
OVRM1_0077_G02.b : GACTGTCATGCCTGGGTCCCGGAAGCTGGAGTACGGAGGCCAGACGTGGCATGAGCACTG
TES01_0053_E05.b : GGCCGTCATGCCTGGGTCCCGGAAGCTGGAGTACGGAGGCCAGACTTGGCATGAGCACTG
TES01_0088_B07.b : GACCGTCATGCCTGGGTCCCGGAAGCTGGAGTACGGAGGCCAGACGTGGCATGAGCACTG
PST01_0057_A02.b : GACCGTCATGCCTGGGTCCCGGAAGCTGGAGTACGGAGGCCAGACGTGGCATGAGCACTG
PST01_0043_G01.b : GACCGTCATGCCTGGGTCCCGGAAGCTGGAGTACGGAGGCCAGACGTGGCATGAGCACTG
TES01_0102_E08.b : GACCGTCATGCCTGGGTCCCGGAAGCTGGAGTACGGAGGCCAGACGTGGCATGAGCATTG
PBL01_0094_D01.b : GACCGTCATGCCTGGGTCCCGGAAGCCGGAGTACGGAGGCCAGACGTGGCATGAGCACTG
20110601C-013331 : CTTCCTGTGCAGCGGCTGTGAGCAGCCGCTGGGCTCCTGTTCCTTTGTGCCCGACAAGGG
---------+---------+---------+---------+---------+---------+ 646
OVRT1_0015_B12.b : CTTCCTGTGCAGCGGCTGTGAGCAGCCGCTGGGCTCCTGTTCCTTTGTGCCCGACAAGGG
BFLT1_0116_B02.b : CTTCCTGTGCAGCGGCTGTGAGCAGCCGCTGGGCTCCTGTTCCTTTGTGCCCGACAAGGG
OVRM1_0045_C10.b : CTTCCTGTGCAGCGGCTGTGAGCATCCGCTGGGCTCCTGTTCCTTTGTGCCCGACCAGGG
OVRM1_0101_B07.b : CTTCCTGTGCAGCGGCTGTGAGCAGCCGCTGGGCTCCTGTTCCTTTGTGCCCGACNAGGG
OVRM1_0007_C12.b : CTTCCTGTGCAGCGGCTGTGAGCAGCCGCTGGGCTCCTGTTCCTTTGTGCCCGACAAGGG
UTR01_0085_G07.b : CTTCCTGTGCAGCGGCTGTGAGCAGCCGCTGGGCTCCTGTTCCTTTGTGCCCGACAAGGG
TCH01_0096_E05.b : CTTCCTGTGCAGCGGCTGTGAGCAGCCGCTGGGCTCCTGTTCCTTTGTGCCCGACAAGGG
OVRT1_0068_G08.b : CTTCCTGTGCAGCGGCTGTGAGCAGCCGCTGGGCTCCTGTTCCTTTGTGCCCGACAAGGG
OVRT1_0134_H03.b : CTTCCTGTGCAGCGGCTGTGAGCAGCCGCTGGGCTCCTGTTCCTTTGTGCCCGACAAGGG
OVRT1_0100_E01.b : CTTCCTGTGCAGCGGCTGTGAGCAGCCGCTGGGCTCCTGTTCCTTTGTGCCCGACAAGGG
UTR01_0084_C07.b : CTTCCTGTGCAGCGGCTGTGAGCAGCCGCTGGGCTCCTGTTCCTTTGTGCCCGACAAGGG
ADR01_0085_H04.b : CTTCCTGTGCAGCGGCTGTGAGCAGCCGCTGGGCTCCTGTTCCTTTGTGCCCGACAAGGG
LNG01_0071_B02.b : CTTCCTGTGCAGCGGCTGTGAGCAGCCGCTGGGCTCCTGTTCCTTTGTGCCCGACAAGGG
OVRM1_0077_G02.b : CTTCCTGTGCAGCGGCTGTGAGCAGCCGCTGGGCTCCTGTTCCTTTGTGCCCGACAAGGG
TES01_0053_E05.b : CTTCCTGTGCAGCGACTGTGAGCAGCCGCTGGGCTCCTGTTCCTTTGTGCCCGACAAGGG
TES01_0088_B07.b : CTTCCTGTGCAGCGGCTGTGAGCAGCCGCTGGGCTCCTGTTCCTTTGTGCCCGACAAGGG
PST01_0057_A02.b : CTTCCTGTGCAGCGGCTGTGAGCAGCCGCTGGGCTCCTGTTCCTTTGTGCCCGACAAGGG
PST01_0043_G01.b : CTTCCTGTGCAGCGGCTGTGAGCAGCCGCTGGGCTCCTGTTCCTTTGTGCCCGACAAGGG
TES01_0102_E08.b : CTTCCTGTGCAGCGGCTGTGAGCAGCCGCTGGGCTCCTGTTCCTTTGTGCCCGACAAGGG
PBL01_0094_D01.b : CTTCCTGTGCAGCGGCTGTGAGCAGCCGCTGGGCTCCTGTTCCTTTGTGCCCGACGAGGG
20110601C-013331 : TGCTCACTACTGCGTGCCCTGCTATGAGAACAAGTTCGCGCCTCGCTGCGCCCGCTGCAG
---------+---------+---------+---------+---------+---------+ 706
OVRT1_0015_B12.b : TGCTCACTACTGCGTGCCCTGCTATGAGAACAAGTTCGCGCCTCGCTGCGCCCGCTGCAG
BFLT1_0116_B02.b : TGCTCACTACTGCGTGCCCTGCTATGAGAACAAGTTCGCGCCTCGCTGCGCCCGCTGCAG
OVRM1_0045_C10.b : TGCTCACTACTGCCTGCCCTGCTATGA*TACCAGTTTGCGGCTCGCTGCGCTTGCTGCCG
OVRM1_0101_B07.b : TGCTCACTACTGCGTGCCCTGCTATGAGAACAAGTTCGCGCCTCGCTGCGCCCGCTGCAG
OVRM1_0007_C12.b : TGCTCACTACTGCGTGCCCTGCTATGAGAACAAGTTCGCGCCTCGCTGCGCCCGCTGCAG
UTR01_0085_G07.b : TGCTCACTACTGCGTGCCCTGCTATGAGAACAAGTTCGCGCCTCGCTGCGCCCGCTGCAG
TCH01_0096_E05.b : TGCTCACTACTGCGTGCCCTGCTATGAGAACAAGTTCGCGCCTCGCTGCGCCCGCTGCAG
OVRT1_0068_G08.b : TGCTCACTACTGCGTGCCCTGCTATGAGAACAAGTTCGCGCCTCGCTGCGCCCGCTGCAG
OVRT1_0134_H03.b : TGCTCACTACTGCGTGCCCTGCTATGAGAACAAGTTCGCGCCTCGCTGCGCCCGCTGCAG
OVRT1_0100_E01.b : TGCTCACTACTGCGTGCCCTGCTATGAGAACAAGTTCGCGCCTCGCTGCGCCCGCTGCAG
UTR01_0084_C07.b : TGCTCACTACTGCGTGCCCTGCTATGAGAACAAGTTCGCGCCTCGCTGCGCCCGCTGCAG
ADR01_0085_H04.b : TGCTCACTACTGCGTGCCCTGCTATGAGAACAAGTTCGCGCCTCGCTGCGCCCGCTGCAG
LNG01_0071_B02.b : TGCTCACTACTGCGTGCCCTGCTATGAGAACAAGTTCGCGCCTCGCTGCGCCCGCTGCAG
OVRM1_0077_G02.b : TGCTCACTACTGCGTGCCCTGCTATGAGAACAAGTTCGCGCCTCGCTGCGCCCGCTGCAG
TES01_0053_E05.b : TGCTCACTACTGCGTGCCCTGCTATGAGAACAAGTTCGCGCCTCGCTGCGCCCGCTGCAC
TES01_0088_B07.b : TGCTCACTACTGCGTGCCCTGCTATGAGAACAAGTTCGCGCCTCGCTGCGCCCGCTGCAG
PST01_0057_A02.b : TGCTCACTACTGCGTGCCCTGCTATGAGAACAAGTTCGCGCCTCGCTGCGCCCGCTGCAG
PST01_0043_G01.b : TGCTCACTACTGCGTGCCCTGCTATGAGAACAAGTTCGCGCCTCGCTGCGCCCGCTGCAG
TES01_0102_E08.b : TGCTCACTACTGCGTGCCCTGCTATGAGAACAAGTTCGCGCCTCGCTGCGCCCGCTGCAG
PBL01_0094_D01.b : TGCTCACTACTGCGTGCCCTGCTATGAGAACAAGTTCGCGCCTCGCTGCGCCCGCTGCAG
20110601C-013331 : CAAGACGCTGACACAGGGTGGCGTGACGTACCGTGACCAACCCTGGCATCGAGAATGCCT
---------+---------+---------+---------+---------+---------+ 766
OVRT1_0015_B12.b : CAAGACGCTGACACAGGGTGGCGTGACGTACCGTGACCAACCCTGGCATCGAGAATGCCT
BFLT1_0116_B02.b : CAAGACGCTGACACAGGGTGGCGTGACGTACCGTGACCAACCCTGGCATCGAGAATGCCT
OVRM1_0045_C10.b : CTGGACGCTGACACTGGGTGGTATGACTAACCGTGACCAACCCCTGTATCCAGAATGCAT
OVRM1_0101_B07.b : CNAGACGCTGACACAGGGTGGCGTGACGTACCGTGACCAACCCTGGCATCGAGAATGCCT
OVRM1_0007_C12.b : CAAGACGCTGACACAGGGTGGCGTGACGTACCGTGACCAACCCTGGCATCGAGAATGCCT
UTR01_0085_G07.b : CAAGACGCTGACACAGGGTGGCGTGACGTACCGTGACCAACCCTGGCATCGAGAATGCCT
TCH01_0096_E05.b : CAAGACGCTGACACAGGGTGGCGTGACGTACCGTGACCAACCCTGGCATCGAGAATGCCT
OVRT1_0068_G08.b : CAAGACGCTGACACAGGGTGGCGTGACGTACCGTGACCAACCCTGGCATCGAGAATGCCT
OVRT1_0134_H03.b : CAAGACGCTGACACAGGGTGGCGTGACGTACCGTGACCAACCCTGGCATCGAGAATGCCT
OVRT1_0100_E01.b : CAAGACGCTGACACAGGGTGGCGTGACGTACCGTGACCAACCCTGGCATCGAGAATGCCT
UTR01_0084_C07.b : CAAGACGCTGACACAGGGTGGCGTGACGTACCGTGACCAACCCTGGCATCGAGAATGCCT
ADR01_0085_H04.b : CAAGACGCTGACACAGGGTGGCGTGACGTACCGTGACCAACCCTGGCATCGAGAATGCCT
LNG01_0071_B02.b : CAAGACGCTGACACAGGGTGGCGTGACGTACCGTGACCAACCCTGGCATCGAGAATGCCT
OVRM1_0077_G02.b : CAAGgactcggcggaggcaagtatgtgtcctttgaagaccgccactggcaccacagctgc
TES01_0053_E05.b : CAAGACGCTGACACAGGGTGGCGTGACGTTCCGTGACCAACCCTGGCATCAAGTATGCCC
TES01_0088_B07.b : CAAGACGCTGACACAGGGTGGCGTGACGTACCGTGACCAACCCTGGCATCGAGAATGCCT
PST01_0057_A02.b : CAAGACGCTGACACAGGGTGGCGTGACGTACCGTGACCAACCCTGGCATCGAGAATGCCT
PST01_0043_G01.b : CAAGACGCTGACACAGGGTGGCGTGACGTACCGTGACCAACCCTGGCATCGAGAATGCCT
TES01_0102_E08.b : CAAGACGCTGACACAGGGTGGCGTGACGTACCGTGACCAACCCTGGCATCGAGAATGCCT
PBL01_0094_D01.b : CAAGACGCTGACACAGGGTGGCGTGACGTACCGTGACCAACCCTGGCATCGAGAATGCCT
20110601C-013331 : GGTCTGCACAGGGTGCCAGACGCCCCTGGCAGGGCAGCAGTTCACCTCCC*GGGACGATG
---------+---------+---------+---------+---------+---------+ 825
OVRT1_0015_B12.b : GGTCTGCACAGGGTGCCAGACGCCCCTGGCAGGNCAGCAGTTCACCTCCC*GGGACGATG
BFLT1_0116_B02.b : GGTCTGCACAGGGTGCCAGACGCCCCTGGCAGGGCAGCAGTTCACCTCCCCGGGACGATG
OVRM1_0045_C10.b : GGTCCGCCCGGGGTGCCgcacgcccttgccattgtccc
OVRM1_0101_B07.b : GGTCTGCACAGGGTGGCAGACGCCCCTGGCAGGNCAGCAGTTCACCTCCC*GGGACGATG
OVRM1_0007_C12.b : GGTCTGCACAGGGTGCCAGACGCCCCTGGCAGGGGCAGCAGTCACCTCCC*GGGACGATG
UTR01_0085_G07.b : GGTCTGCACAGGGTGCCAGACGCCCCTGGCAGGGCAGCAGTTCACCTCCC*GGGACGATG
TCH01_0096_E05.b : GGTCTGCACAGGGTGCCAGACGCCCCTGGCAGGGCAGCAGTTCACCTCCC*GGGACGATG
OVRT1_0068_G08.b : GGTCTGCACAGGGTGCCAGACGCCCCTGGCAGGGCAGCAGTTCACCTCCC*GGGACGATG
OVRT1_0134_H03.b : GGTCTGCACAGGGTGCCAGACGCCCCTGGCAGGGCAGCAGTTCACCTCCC*GGGACGATG
OVRT1_0100_E01.b : GGTCTGCACAGGGTGCCAGACGCCCCTGGCCGGCCAGCAGTTCCCCTCCG*GGGACAATG
UTR01_0084_C07.b : GGTCTGCACAGGGTGCCAGACGCCCCTGGCAGGGCAGCAGTTCACCTCCC*GGGACGATG
ADR01_0085_H04.b : GGTCTGCACAGGGTGCCAGACGCCCCTGGCAGGGCAGCAGTTCACCTCCC*GGGACGATG
LNG01_0071_B02.b : GGTCTGCACAGGGTGCCAGACGCCCCTGGCAGGGCAGCAGTTCACCTCCC*GGGACGATG
OVRM1_0077_G02.b : ttctcctgtgcccgctgctccacctccctggtgagtncaggcttcgtg
TES01_0053_E05.b : GGTCTGCTCAGGGTGgccaaacccccctggctgggcaaccagttaacctcccgggaacaa
TES01_0088_B07.b : GGTCTGCACAGGGTGCCAGACGCCCCTGGCAGGGCAGCAGTTCACCTCCC*GGGACGATG
PST01_0057_A02.b : GGTCTGCACAGGGTGCCAGACGCCCCTGGCAGGGCAGCAGTTCACCTCCC*GGGACGATG
PST01_0043_G01.b : GGTCTGCACAGGGTGCCAGACGCCCCTGGCAGGGCAGCAGTTCACCTCCC*GGGACGATG
TES01_0102_E08.b : GGTCTGCACAGGGTGCCAGACGCCCCTGGCAGGGCAGCAGTTCACCTCCC*GGGACGATG
PBL01_0094_D01.b : GGTCTGCACAGGGTGCCAGACGCCCCTGGCAGGGCAGCAGTTCACCTCCC*GGGACGATG
20110601C-013331 : ATCCTTATTGTGTGGCCTGTTTTGGAGAACTCTTTGCACCCAAGTGCAGCAGCTGCAAGC
---------+---------+---------+---------+---------+---------+ 885
OVRT1_0015_B12.b : ATCCTTATTGTGTGGCCTGTTTTGGAGA*CTCTTTGCAC*CAAGTGCAGCAGCTGCAAGC
BFLT1_0116_B02.b : ATCCTTAATGTGTGGCCTGTTTTGGAAAACTCTTTGCACCCAAGTGCAGCAGCTGCAAGC
OVRM1_0045_C10.b :
OVRM1_0101_B07.b : ATCCTT
OVRM1_0007_C12.b : ATCCTTATTGTGTG
UTR01_0085_G07.b : ATCCTTATTGTGTGGCCTGTTTTGGAGAACTCTTTGCACCCA*GTGCAGCAGCTGCAAGC
TCH01_0096_E05.b : ATCCTTATTGTGTGGCCTGTTTTGGAGAACTCTTTGCACCCAAGTGCAGCAGCTGCAAGC
OVRT1_0068_G08.b : ATCCTTATTGTGTGGCCTGTTTTGGAGAACTCTTTGCA*CCAAGTGCAGCAGCTGCAAGC
OVRT1_0134_H03.b : ATCCTTATTGTGTGGGCCTGTTTGGAGA*CTCTTTGCACCCA*GTGCAGCAGCTGCAGCC
OVRT1_0100_E01.b : ATCCTTATTGTGTGCCCTGTTTGGAATACTCCTTTGCACCCA*GTGCAGCAGCTGCAAGC
UTR01_0084_C07.b : ATCCTTATTGTGTGGCCTGTTTTGGAGAACTCTTTGCACCCAAGTGCAGCAGCTGCAAGC
ADR01_0085_H04.b : ATCCTTATTGTGTGGCCTGTTTTGGAGAACTCTTTGCACCCAAGTGCAGCAGCTGCAAGC
LNG01_0071_B02.b : ATCCTTATTGTGTGGCCTGTTTTGGAGAACTCTTTGCACCCA*GTGCAGCAGCTGCAAGC
OVRM1_0077_G02.b :
TES01_0053_E05.b : gaatcttattgtggggcccgttttggaaaactcctttgctcccatgtccaacagctgcaa
TES01_0088_B07.b : ATTCTTATTGTGTGGCCTGTTTTtggagaactcttttgcaccccagtgcagcagctgcca
PST01_0057_A02.b : ATCCTTATTGTGTGGCCTGTTTTGGAGAACTCTTTGCACCCAAGTGCAGCAGCTGCAAGC
PST01_0043_G01.b : ATCCTTATTGTGTGGCCTGTTTTGGAGAACTCTTTGCACCCAAGTGCAGCAGCTGCAAGC
TES01_0102_E08.b : ATCCTTATTGTGTGGCCTGTTTTGGAGAACTCTTTGCACCCAAGTGCAGCAGCTGCAAGC
PBL01_0094_D01.b : ATCCTTATTGTGTGGCCTGTTTTGGAGAACTCTTTGCACCCAAGTGCAGCAGCTGCAAGC
20110601C-013331 : *GCCCCATCACAGGACTCGGCGGAGGCAAGTATGTGTCCTTTGAAGACCGCCACTGGCAC
---------+---------+---------+---------+---------+---------+ 944
OVRT1_0015_B12.b : *GCCCCATCACAGGACTTCGCCGAAGGCAGTATGTGTCCTTTTGAGACCGCAACTGCCA*
BFLT1_0116_B02.b : *GCCCCATCAaggactccgcggagccagtatgtgtcctttgagaacgccatgggcaccaa
OVRM1_0045_C10.b :
OVRM1_0101_B07.b :
OVRM1_0007_C12.b :
UTR01_0085_G07.b : *GCCCCATCACAGGACTCCGCGGAGGCAAGTATGgtgtctttgaagaacgcccccgggca
TCH01_0096_E05.b : *GCCCCATCACAGGACTCGGCGGAAGCAAGTATGTGTCCTTTGAAaacgcccctggccca
OVRT1_0068_G08.b : *GCCCCATCACAGGACTCGGCGGAGGCAAATATGTGTTCTTTGAAGACCGCCACTGGCA*
OVRT1_0134_H03.b : *GCCCatcacaggactcggcggaggcaaatatgtgtcttttgagacccgcactggaaccc
OVRT1_0100_E01.b : *GCCCCTTCAAAGGATCCGGCCGAGGCAAtttgtgtccttttgaaaacggccctggcacc
UTR01_0084_C07.b : CGCCCCATCACAGGACTCGGCGGAAGCCAGTATGTGTtccttttgagaccgcccctggga
ADR01_0085_H04.b : *GCCCCATCACAGGACTCGGCGGAGGCAAGTATGTGTCCCTTTGAGACCGCCACTGGCAC
LNG01_0071_B02.b : *GCCCCATCACAGGACTCGGCGGAAGGCAGTATGTGTCCCTTGAAGACCGCCACTGGGCA
OVRM1_0077_G02.b :
TES01_0053_E05.b : gccgccccatcaaaggactctgtgggaagcaagtatgtgtccctttaaaaacgcccccgg
TES01_0088_B07.b : gcgccccctccacaggacccgggggaggcaaatagtgtccttttgaaacccgccctgggc
PST01_0057_A02.b : *GCCCCATCACAGGACTCGGCGGAGGCAAGTATGTGTCCTTTGAAGAACGCCACTGGCAC
PST01_0043_G01.b : *GCCCCATCACAGGACTCGGCGGAGGCAAGTATGTGTCCTTTTGAGACCGCCACTGGCAC
TES01_0102_E08.b : *GCCCCATCACAGGACTCGGCGGAGGCAAGTATGTGTCCTTTGAAGACCCGCACTGGCAC
PBL01_0094_D01.b : *GCCCCATCACAGGACTCGGCGGAGGCAAGTATGTGTCCTTTGAAGACCGCCACTGGCAC
20110601C-013331 : CACAGCTGCTTCTCCTGTGCCCGCTGCTCCACCTCCCTGGTGGGTCAAGGCTTCGTGCCG
---------+---------+---------+---------+---------+---------+ 1004
OVRT1_0015_B12.b : CACAGCTGCTTCTCCTGTGCCgctgctccacctcctgtgggtcaaggctcntgccggagg
BFLT1_0116_B02.b : gctggctccctgggcccgtgcccccctccctgggggtcagggttctgccgaatgaacaca
OVRM1_0045_C10.b :
OVRM1_0101_B07.b :
OVRM1_0007_C12.b :
UTR01_0085_G07.b : ccacaagctgctttcccctgtggcccgcggctcccaccccctggnggggtccaggccttc
TCH01_0096_E05.b : cagctgctttctctgtgcccgctgctcaccctccttgtgggtcaagcttcctgccggatg
OVRT1_0068_G08.b : CACAGCTGCTTCTCCTGTGCCCGCTGCTCCCCCTCCCTGGTGGGTCAAGGC*Tcctgccg
OVRT1_0134_H03.b : agctggcttctctgtgccgctgcctcactccctgggtggtcaaggctcntgcccgatgga
OVRT1_0100_E01.b : ccagctgcttcttctggggccggttggcccacccccctggggggccagggcttcggggcc
UTR01_0084_C07.b : ccacagctgcctcctcctgtgcccgctggctccccctccctgggggggtcaagggcttcc
ADR01_0085_H04.b : CACAGCTGCTTCTCCTGTGCCCGCTGCTCCACCTCCCTGGTGGGTCCAGGC*Tcttgccg
LNG01_0071_B02.b : CACAGCTGCTTCTCTTGTGCCCGCTGCTCCACttcctggtgggtccaggcttcctgcccg
OVRM1_0077_G02.b :
TES01_0053_E05.b : gcacacagctgcttatcctggggccgctgttccaccaccctggggggcaaggacttctgg
TES01_0088_B07.b : accccagctgcttctcctgtggcccgcggctccccccccctgggggggccaaggctttcc
PST01_0057_A02.b : CACAGCTGCTTCTCCTGTGCCCGCTGCTCCACCTCCCTGGTGGGTCAAGCT*TCGTGCGG
PST01_0043_G01.b : CACAGCTGCTTCTCCTGTGCCCGCTGCTCCNACTCCCTGGTGGGTCAAGGCTTCGTGCCG
TES01_0102_E08.b : CACAGCTGCTTCTCCTGTGCCCGCTGCTCCACCTCCCTGGTGGGTCAGGGCTTCNTGCCG
PBL01_0094_D01.b : CACAGCTGCTTCTCCTGTGCCCGCTGCTCCACCTCCCTGGTGGGTCAAGGCTTCGTGCCG
20110601C-013331 : GATGGAGACCAAGTGCTGTGCCAGGGTTGCAGCCAGGCAGGGCCCTGAGCCAGGGCTCCT
---------+---------+---------+---------+---------+---------+ 1064
OVRT1_0015_B12.b : aaaccaatgctgtgcaggttgcaccaggcagggcttgaccagggtcttggcccagccttc
BFLT1_0116_B02.b : ttctgtgccaggttgcaccagcagggccctaccagggttcttgggcccgcctccctacag
OVRM1_0045_C10.b :
OVRM1_0101_B07.b :
OVRM1_0007_C12.b :
UTR01_0085_G07.b : ctgcccggaaggaaaacaaatggctggcccggggtttgccacccggccaggccccctgaa
TCH01_0096_E05.b : aaacccattgctgtgcaagggtgcccccggcagggccctgacccgggcttctgggcccgg
OVRT1_0068_G08.b : gatggaaacaaatggctggctagggttgcagccggcagggccctgaccagggctcctggg
OVRT1_0134_H03.b : aacaattgctggccaggtttccaccaggagggcctgaacagggttcctgggccaggccct
OVRT1_0100_E01.b : gaaggaaaccaagtgctggcccagggttgcaccaggctgggcccttaacccggggtccgg
UTR01_0084_C07.b : tggcccgatgggaacacaagtgcctgtgcccagggtttgcccccacggccagggccctga
ADR01_0085_H04.b : gatggagacaagtgctgtgccagggttgcacccaggcaggccctgagccagggctcttgg
LNG01_0071_B02.b : atggaaaccaattgctgttgccngttgtcacccagcaaggccctgagccaggctctgggc
OVRM1_0077_G02.b :
TES01_0053_E05.b : ccggatggaaaccacatgctggtccagggtgtcaccaagctgggccctaaaccaggttcc
TES01_0088_B07.b : ggcccgaaaggaaaaccaatggcctgtccccagggttgccacccgggcaggggcccttaa
PST01_0057_A02.b : GATGGAGACCAA*TGCTGTGCCAAGGTTGCAACCAGGCAGGGCCCTGAGCCA*GGCTCCT
PST01_0043_G01.b : GATGGANNACAAGTGCTGTGCCCAGGTTGCAGCCAGGCAGGGCCTTGAGCCA*GGgctcc
TES01_0102_E08.b : GATGGAGACCAAGTGCTGTGCCAGGTTTGCAGCCAGGCAGGGCCCTGAGCCcaggcttct
PBL01_0094_D01.b : GATGGAGACCAAGTGCTGTGCCAGGGTTGCAGCCAGGCAGGGCCCTGAGCCAGGGCTCCT
20110601C-013331 : GGGCCCAGGCCCTCCCATACCAGGGCTCCAGGACTAAGGCTCCTCTTCCAGAACACCTCT
---------+---------+---------+---------+---------+---------+ 1124
OVRT1_0015_B12.b : atacagggttcaggaataggtcccttccaaccctttgggtccacccccccaatggggtcc
BFLT1_0116_B02.b : ggtctcggatagggtccttttcaaacacctgggtcccccccccccaatgggttcccctgg
OVRM1_0045_C10.b :
OVRM1_0101_B07.b :
OVRM1_0007_C12.b :
UTR01_0085_G07.b : cccggggttccggggcccacggccctccccataccggggttccccggaactaaggctccc
TCH01_0096_E05.b : ccctcccttaccgggcctcgggactagggtcctcttcaaacaccctgggttccaccccgc
OVRT1_0068_G08.b : ccaggccctccataccagggctccggaataaggccccctttcaacccctcgtggtccagc
OVRT1_0134_H03.b : ccctacaggctccaggaaaagctccccttccaacccttggggtccccccccccccaaggg
OVRT1_0100_E01.b : ggcccaggcctcccttaacagggggcccggaataaggtcccctttcaaaaacccttgggt
UTR01_0084_C07.b : aacccaggcctcctggggccccggcccctctccctacccaggggctcc
ADR01_0085_H04.b : gcccagncctcccatacagggctccagactaagctcctcttcaaacacctcgggtccagc
LNG01_0071_B02.b : ccagccctccaatacagggttccgggattagggctctcttccaaccactctggttccagc
OVRM1_0077_G02.b :
TES01_0053_E05.b : tgagcccttaccccttaatagaggggtctgggaataagggctccctcttctaaaaacccc
TES01_0088_B07.b : accaggggctcctggggcccggccccccccaataaccaggggtccccggaaaaaaagggc
PST01_0057_A02.b : GGGCCC*GGCCCTCCCATACAGGGGCTCCAGGACTAggctcctctccagaacactctggg
PST01_0043_G01.b : tgggcccaagcctcccatacagggctccagactaaggctcctcttcgaacaactctgggt
TES01_0102_E08.b : gggcccaggcccttccctaccagggctccaggactaaggctcttcctccagacaacctcg
PBL01_0094_D01.b : GGGCCCAGGCCCTCCCATACCAGGGCTCCAGGACTAAGGCTCCTCTTCCAGAACACCTCT
20110601C-013331 : GGGTCCCAGCCCCGCCCCAAATGGGGTTCCCCCTAGGCTCCAGGATTCAGCCTCCCCACT
---------+---------+---------+---------+---------+---------+ 1184
OVRT1_0015_B12.b : cccgggccagtttacccccccccaatcccaatttgttcgggttaggagccccttttaatc
BFLT1_0116_B02.b : cccgatttccccccccccaatcccatttggtctccctttaggaccctttttttcccccaa
OVRM1_0045_C10.b :
OVRM1_0101_B07.b :
OVRM1_0007_C12.b :
UTR01_0085_G07.b : ctcttccaaaaccccctccggggtcccagcccccccccccaatgggggttcccccccggg
TCH01_0096_E05.b : cccaaggggttcccctgggcccggaattggccccccatccaattcccaattgggtacccg
OVRT1_0068_G08.b : cccccccatggggttccccaggctcggattacccccccctccaatcccattgggatccgg
OVRT1_0134_H03.b : gttcccccaggcccaatatacccccccccccccacccccttggggcccgggtttggggcc
OVRT1_0100_E01.b : cccacccccgcccaaagggggttccccccggcccgaaattttccccccccactcaaatcc
UTR01_0084_C07.b :
ADR01_0085_H04.b : ccgccccaaatgggttcccctagcccaagaattacctccccctccaaattcccattggat
LNG01_0071_B02.b : ccgccccaatggggttccctaggctcggattaactcccccttcaattccaattggtatca
OVRM1_0077_G02.b :
TES01_0053_E05.b : agggtttcccccctcccacatggggcgtcccccggcacctgtaaacacctcctcattcaa
TES01_0088_B07.b : ccctcttccaaaacccccttgggggtcccaaccccccccccccaagggggggtcccccca
PST01_0057_A02.b : cccagccccgccccaagggggttcccccaagctccagaatagccttcccattccacatcc
PST01_0043_G01.b : ccaagcccgcccaaatggggtccccctaggctcagaatcagcttccaatccaaatcccaa
TES01_0102_E08.b : gggtctcagccccgccccaaatggggttccccctaggctccaggattcaccttccccctt
PBL01_0094_D01.b : GGGTCCCAGCCCCGCCCCAAATGGGGTTCCCCCTAGGCTCCAGGATTCAGCCTCCCCACT
20110601C-013331 : CCAACATCCCCAATCTGGTACCTCAGGCTTAATGGAGCCTCCATCATTTAAATCCCCCCC
---------+---------+---------+---------+---------+---------+ 1244
OVRT1_0015_B12.b : ccccaccgaaccaatatttttttgggtaaaaatcca
BFLT1_0116_B02.b : cggaccaaacctttttggggaggaaaccaaagggcccccccccctccccccccgggggtt
OVRM1_0045_C10.b :
OVRM1_0101_B07.b :
OVRM1_0007_C12.b :
UTR01_0085_G07.b : ctccccgaattttgaccctccccctctcaaaatccc
TCH01_0096_E05.b : ggttttggaccctcctttttatcccccaaaccggaccggaactttttttggggactgaaa
OVRT1_0068_G08.b : gtttagggccctctatttatccccccaaaaaacccaaactttttatgggggggaagtccc
OVRT1_0134_H03.b : cccattttaacccccccaagcacccaaaattttttggggtgaaaacccccaagggccccc
OVRT1_0100_E01.b : aatattgggtttccgggtatagggcccccccccttatatccccctacacaggccccaaaa
UTR01_0084_C07.b :
ADR01_0085_H04.b : tcggctaatggacccccttttttaatccccccaccggaacccaacttgttttggggtatg
LNG01_0071_B02.b : ggttagggaccccctcttttatcccccaaccggaccccgaccgtctttggggacgaaaat
OVRM1_0077_G02.b :
TES01_0053_E05.b : attcccaattagggaacaagggtaagtgggcatctttatatattccccccacacagagtc
TES01_0088_B07.b : gggctcccggaaaattacccccccccctctccaaaattcccaaattgtggaattccccgg
PST01_0057_A02.b : caattgggactccggtttatgaagcccctcattaatccccccaaccgggacccgaacccg
PST01_0043_G01.b : cgggaatccagcttatggacctcctctttaatccccccaaccggaccccaactctttcat
TES01_0102_E08.b : caaaatccccaatctgggatcccaggcttaaggagcctcctcctttaaaccccccccaac
PBL01_0094_D01.b : CCAACATCCCCAATCTGGTACCTCAGGCTTAATGGAGCCTCCATCATTTAAATCCCCCCC
20110601C-013331 : AAACCAGGACCCCAGAACTCAGTCTATATGG.............................
---------+---------+---------+---------+---------+---------+ 1275
OVRT1_0015_B12.b :
BFLT1_0116_B02.b : tcggcaaaaattttttgggggggaatttcccccttttttttttcttttctttcaaagggg
OVRM1_0045_C10.b :
OVRM1_0101_B07.b :
OVRM1_0007_C12.b :
UTR01_0085_G07.b :
TCH01_0096_E05.b : ccccaaagggacccccccctcccccccccccgggagtggttttggg
OVRT1_0068_G08.b : aaggggacccccccccctcccctcctccggggggctttgccacaaaagattgtgttgggc
OVRT1_0134_H03.b : cccctcccccctccccggaggttttggcacaaaaaatctttgggggcgcgggaatttccc
OVRT1_0100_E01.b : ctcttttttggggggaagaaacctcccaaagagaacccccctcttttccctttctcggga
UTR01_0084_C07.b :
ADR01_0085_H04.b : aaaccccaaaaggaccctcccccttcccccttctccaggagggctttggcacaaaaagtt
LNG01_0071_B02.b : cccaaggaccccccccctccccctctccaagaggggcttctggcaaataaagttcgcttg
OVRM1_0077_G02.b :
TES01_0053_E05.b : aaaaatcttcaatgggggatagaaatctttttaagggactccctccctgctcaacccctc
TES01_0088_B07.b : gcttttaggggaacccctcctccttataaatcccccccccaaccagaaacccccaaaaca
PST01_0057_A02.b : tctattggtgaaggaaagcctcggagggaacttcccccccttcccctctcccagggatgg
PST01_0043_G01.b : tggggacggaaagccccaaaggacctccccaccctccccctctcccaggagggcttcggt
TES01_0102_E08.b : aggaaccccgaaactcatcctttgggggaagaaaaatcccccaaaagggaacctcccccc
PBL01_0094_D01.b : AAACCAGGACCCCAGAACTCAGTCTATATGGgtgactngaaagtcctcaaaagtggaacc
20110601C-013331 : ............................................................
---------+---------+---------+---------+---------+---------+ 1275
OVRT1_0015_B12.b :
BFLT1_0116_B02.b : gggtgccccctcttaacgaaaaaaagaccgngccacaccccccccgagagatctttttgt
OVRM1_0045_C10.b :
OVRM1_0101_B07.b :
OVRM1_0007_C12.b :
UTR01_0085_G07.b :
TCH01_0096_E05.b :
OVRT1_0068_G08.b : ccaagaaaattccccccgtagggttttttctcccctcttccaaggagagggggttcccct
OVRT1_0134_H03.b : gctgtatgtttcttttctttccttgaggggggggggcccctccccatcaaaaaaaaaaag
OVRT1_0100_E01.b : gaggtgtttggggaat
UTR01_0084_C07.b :
ADR01_0085_H04.b : cttgttgggggtcttgtatattccccccgggcaggttctcttcctcccttttcccagggc
LNG01_0071_B02.b : gggggctaggaatttctccccgttcgggttttccttaccccttttctcacaggggagtgg
OVRM1_0077_G02.b :
TES01_0053_E05.b : tcaagatgaggatttcttaaataataattattatgctcgaggggctcataataattctac
TES01_0088_B07.b : ccccgccataggggggaacacgaaaaaacc
PST01_0057_A02.b : gtttttggcacaaagaaagtctcggcttggggggcccaggaaattttccacccgtgtgag
PST01_0043_G01.b : acaaaaaaagtttgtgtagggggccaggaaattttcaccccggtaaaggttctttcctcc
TES01_0102_E08.b : ctttttcccctttttccaaagggatggggctttcggggaaccaataaaagttccggccta
PBL01_0094_D01.b : tccccaccttcatcccacctcttttcacaaggatggggctttctgggcacaaatgaaagt
20110601C-013331 : ............................................................
---------+---------+---------+---------+---------+---------+ 1275
OVRT1_0015_B12.b :
BFLT1_0116_B02.b : gtttttttttctt
OVRM1_0045_C10.b :
OVRM1_0101_B07.b :
OVRM1_0007_C12.b :
UTR01_0085_G07.b :
TCH01_0096_E05.b :
OVRT1_0068_G08.b : ctctttaagataaaaaaaggtggtcgcggcgccaacaacac
OVRT1_0134_H03.b : ccgcgccgccccac
OVRT1_0100_E01.b :
UTR01_0084_C07.b :
ADR01_0085_H04.b : agggtgtggtcccccctaattctaaaaaaaa
LNG01_0071_B02.b : tggcccccctcttctaacgttgaaaaaagcccttccccgtggcctttt
OVRM1_0077_G02.b :
TES01_0053_E05.b : ccctgcggtcatgatatatttttatacacctttcttctatgaatgagggagaatcccacc
TES01_0088_B07.b :
PST01_0057_A02.b : gtttctcttatcaccttttcccaagagggaggggtagttcccccctttatc
PST01_0043_G01.b : ctgtttccaaaagaaggggatgtgtccctctaactct
TES01_0102_E08.b : aggggggcccttggtaacattttgccccccccgggggccagggttttccctttcattccc
PBL01_0094_D01.b : tcantgcttaaggggggtcctaggggtacagtttgccccacccggggtgtcaagggtttt
20110601C-013331 : ............................................................
---------+---------+---------+---------+---------+---------+ 1275
OVRT1_0015_B12.b :
BFLT1_0116_B02.b :
OVRM1_0045_C10.b :
OVRM1_0101_B07.b :
OVRM1_0007_C12.b :
UTR01_0085_G07.b :
TCH01_0096_E05.b :
OVRT1_0068_G08.b :
OVRT1_0134_H03.b :
OVRT1_0100_E01.b :
UTR01_0084_C07.b :
ADR01_0085_H04.b :
LNG01_0071_B02.b :
OVRM1_0077_G02.b :
TES01_0053_E05.b : actgattcgaaagatgata
TES01_0088_B07.b :
PST01_0057_A02.b :
PST01_0043_G01.b :
TES01_0102_E08.b : ctgttttccccaaatgggcaaagggtgggaatgttccccccccttctatctcgcaaaaga
PBL01_0094_D01.b : ctcgttcaattcactccgttttgcccaaaaatggccaaagggtgggaatggctcaccccc
20110601C-013331 : ............................................................
---------+---------+---------+---------+---------+---------+ 1275
OVRT1_0015_B12.b :
BFLT1_0116_B02.b :
OVRM1_0045_C10.b :
OVRM1_0101_B07.b :
OVRM1_0007_C12.b :
UTR01_0085_G07.b :
TCH01_0096_E05.b :
OVRT1_0068_G08.b :
OVRT1_0134_H03.b :
OVRT1_0100_E01.b :
UTR01_0084_C07.b :
ADR01_0085_H04.b :
LNG01_0071_B02.b :
OVRM1_0077_G02.b :
TES01_0053_E05.b :
TES01_0088_B07.b :
PST01_0057_A02.b :
PST01_0043_G01.b :
TES01_0102_E08.b : ggtggaaaaaaaaaaaaaaaggc
PBL01_0094_D01.b : ccttcnaattcgccataaagcnttgagaaaaaaaaaaaaaaaggccctgtggctcaacta
20110601C-013331 : ............................................................
---------+---------+---------+---------+---------+---------+ 1275
OVRT1_0015_B12.b :
BFLT1_0116_B02.b :
OVRM1_0045_C10.b :
OVRM1_0101_B07.b :
OVRM1_0007_C12.b :
UTR01_0085_G07.b :
TCH01_0096_E05.b :
OVRT1_0068_G08.b :
OVRT1_0134_H03.b :
OVRT1_0100_E01.b :
UTR01_0084_C07.b :
ADR01_0085_H04.b :
LNG01_0071_B02.b :
OVRM1_0077_G02.b :
TES01_0053_E05.b :
TES01_0088_B07.b :
PST01_0057_A02.b :
PST01_0043_G01.b :
TES01_0102_E08.b :
PBL01_0094_D01.b : aggtccggccctctaaatatccctgggggccaagttacgcacccgttttgggaaaagggc
20110601C-013331 : ............................................................
---------+---------+---------+---------+---------+---------+ 1275
OVRT1_0015_B12.b :
BFLT1_0116_B02.b :
OVRM1_0045_C10.b :
OVRM1_0101_B07.b :
OVRM1_0007_C12.b :
UTR01_0085_G07.b :
TCH01_0096_E05.b :
OVRT1_0068_G08.b :
OVRT1_0134_H03.b :
OVRT1_0100_E01.b :
UTR01_0084_C07.b :
ADR01_0085_H04.b :
LNG01_0071_B02.b :
OVRM1_0077_G02.b :
TES01_0053_E05.b :
TES01_0088_B07.b :
PST01_0057_A02.b :
PST01_0043_G01.b :
TES01_0102_E08.b :
PBL01_0094_D01.b : cctaaggagccttataaaagggaggcccttttaaccctgcgggaacattcctgggatttg
20110601C-013331 : ............................................................
---------+---------+---------+---------+---------+---------+ 1275
OVRT1_0015_B12.b :
BFLT1_0116_B02.b :
OVRM1_0045_C10.b :
OVRM1_0101_B07.b :
OVRM1_0007_C12.b :
UTR01_0085_G07.b :
TCH01_0096_E05.b :
OVRT1_0068_G08.b :
OVRT1_0134_H03.b :
OVRT1_0100_E01.b :
UTR01_0084_C07.b :
ADR01_0085_H04.b :
LNG01_0071_B02.b :
OVRM1_0077_G02.b :
TES01_0053_E05.b :
TES01_0088_B07.b :
PST01_0057_A02.b :
PST01_0043_G01.b :
TES01_0102_E08.b :
PBL01_0094_D01.b : aaaactctcttggttaa