[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  OVRT1_0096_D07

Library: OVRT1 (Ovary)
Individual: D2-14C, Duroc

Nucleotide sequence:   (length: 1,405)  [FASTA format sequence]
TTTCCAGCTT TGTGGCTTTC ACTTCCACTT CTCCCAGGTG GGCGGAGTGG CCTCCTGTGG
ACGAATCAGA TTGCTCCTCC GCCCCAACTT CAGGAGGCGA GCCCGGGGCT TGGGGTCCCA
GACGTGCCGC CGCCGCCGCC ACAGCAGCAT CCGCAGCAGC AGCAGCAGCA GGACGACTAG
GAAAGACCCC AGGCCAGAAC C
ATGGAGGAC CAGCGCGACC TCATCTCCAA CCATGAGCAG
CTGCCCATGC TGGGCCAGCG CCCCGGGGCC CCGGAGAGCA AGTGCAGCCG TGGAGCTCTG
TACACAGGCT TTTCTGTCCT GGTGGCTCTG CTCCTGGCTG GCCAGGCCAC CACCGCCTAC
TTCCTGTACC AGCAGCAGGG CCGGCTGGAC AAGCTGACGG TCACCTCTCA GAACTTGCAG
CTGGAGAGCC TGCGGATGAA GCTTCCCAAG CCCTCCAAGC CTTTGAGCAA GATGCGGGTT
TCCGCCCCCA TGCTGATGCA GGCCCTGCCC ATGGAAGGCC CGGAGCCTAT GCGCAACGCC
ACCAAGTACG GCAACATGAC CCAGGACCAC GTGATGCACC TGCTCCTGAA GTCTGACCCC
CTGGGAGTGT ACCCGAAGCT GAAGGGGAGC CTCCCAGAAA ACCTGAAGCA CCTCAAGAAC
ACCATGGACG GTGTGAACTG GAAGCTCTTT GAGAACTGGC TGCGTCAGTG GCTCTTGTTT
GAAATGAGCA AGAACTCGCT GGAGGAGACA CCCTTTGAGG TTCCGCCAAA AGACCCACTG
GAGACGGAGG ACCTGTCGTC CGGGCTGGGC GTGACCAAGC AGGATCTCGG CCAAGTCATC
CTGTAAGAGC AGCAGACGCC AGCCCCCAGC CCTGCGTGGC CACAGCTTGC CTGCCCCCCA
CCCTCCCTGC CGCCCCCACC TGCACTTCAT CCCATGGGCC TCTGGCACCT GGCTCGCCGT
CCTCCCTGGA CACCTCACGT CTCTTCAGAA GGCCAAGGAT GAACGACACA GGGAGGCCCT
GCTGCCCACA GCTCCATCCG CTAGCAGGGA CACAGGGCCC CGGGGACAGC CCGTGAGCGG
GGCTGGTGCC ACTCCTGACA CCTTGAGCTC CAACATGGCG GCTGTCCATG GATGAGGCGG
GCAGGTGCCT GGGGACGGGT CCGCTCGATC CCAAACCCCC ACAAGGACAG CTCTGCTGTC
TCCTCCCCTG GTGGCCTCAG CTTCGCTGCC CGTTACCTGG GGAGACGGGC CAAGCCTTTG
TGTGTCCCCA GCATCAGCCA CCCACGGCCC CTCCTCACCC CCTGCCCGCC CCACATCCCT
GTGCACAGTC AGGCTCGGCT CAGCCCCTGG CCACGGCTTC TGTGAGAATA AAAGGTAGTG
AGTAGGAAAA AAAGAAAAAA AAAAA

Deduced amino acid sequence:  (length: 214) [FASTA format sequence]
MEDQRDLISN HEQLPMLGQR PGAPESKCSR GALYTGFSVL VALLLAGQAT TAYFLYQQQG
RLDKLTVTSQ NLQLESLRMK LPKPSKPLSK MRVSAPMLMQ ALPMEGPEPM RNATKYGNMT
QDHVMHLLLK SDPLGVYPKL KGSLPENLKH LKNTMDGVNW KLFENWLRQW LLFEMSKNSL
EETPFEVPPK DPLETEDLSS GLGVTKQDLG QVIL


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCD74HLA class II histocompatibility antigen gamma chain isoform b [Homo sapiens]. 3086e-84


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCd74H-2 class II histocompatibility antigen gamma chain isoform 2 [Mus musculus]. 2963e-80


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC479329PREDICTED: similar to HLA class II histocompatibility antigen, gamma chain (HLA-DR antigens associated invariant chain) (Ia antigen-associated invariant chain) (Ii) (p33) (CD74 antigen) [Canis familiaris]. 2895e-78


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCD74CD74 antigen [Bos taurus]. 3333e-91


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCD74CD74 antigen [Sus scrofa]. 394e-110


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-218564.1GCTCGGCTCAGCCCCTGGCCACGGCTTCTGTGAGAATAAAAGGTAGTGAGTAGGAAAAAA


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2010100120101001C-006333295fwd
2011060120110601C-001078356fwd