Oligo Array Probe Information


Probe name: AGPOA4-21896

Probe sequence: TGATCAACAATGCTGGAGTGATGTTGTGTCCATATTCCAAGACAGCGGATGGCTTTGAGA

RefSeq (Sus scrofa):

Accession #Gene symbol
NM_001243402RDH12

PEDE cDNA clone:

Clone IDAccession #Corresponding gene in RefSeq (rel. 49)
HumanCattlePig
SymbolScoreSymbolScoreSymbolScore
OVRT1_0146_C03AK400729RDH12424RDH12419RDH12461
TES01_0048_A11AK400987RDH12550RDH12549RDH12597

Additional gene locus: