Animal-Genome cDNA Clone 20060611/20060611S-4/20060611S-046491


Query

>20060611S-046491 (20060611S-046491) 20060611S-046491
TGCAAGTTGG CTTCTGATTT TGAAGGCTTT CTGATCTATC AGGAGACACC
TTTTTGTTTG CTTGACATCA TCTTTCCCTT ATTGAAAAAG TGACCTTTCC
CCAAGCACTT GGTTTCTGTT GTTGACCCTG TAAGGTATTT CCTTGATGAG
TTCTGTTTGG ATACCCCATC ACCTGGCTTG TCTCCCACCC GACTGACATT
TTCAAGTAAA TAATCAAATT GCTATACTTT CCTCCCATCA TCCGGTTCCT
GAATGAAGGG GCTGGGGGTG GGGAGGGCAC CTCAGGTTGT GCTTAGTTCG
CAGGACATTC ACCGGTTACA TGGTGCACAT GCCCCAGAGT TGACCAAAAA
GGTTCAGCGA CATGCGTCCA GCAGCTCTTT CCCATCTGGC GGTAGCGAGC
ACCTGAAAGA AGACCTCAGC CTTCGCCTGA AGAAGCTGAC CCACGCTGCC
CCCTGCATGC TGTTCATGAA GGGAACACCC CAGGAGCCGC GCTGCGGTTT
CAGCAAGCAA ATGGTGGAAG TTCTTAACAA ACATAATATC CAGTTTAGCA
GTTTTGATAT CTTCTCAGAT GAAGAAGTTC GCCAAGGCCT CAAAACCTAT
TCCAATTGGC CCACCTACCC CCAGCTCTAT GTTTCTGGAG AGCTCATACG
AGGACTTGAT ATAATCAAGG AGCTAGAAGC ATCTAAAGAA CTAGATACAA
TTTGCCCCAC AGCTCCCAAA TTAGAGGAAA GGCTCAAAGT ACTGACAAAT
AAAGCTTCTG TGATGCTCTA TATGAAGGGA AACAAACAGG AAGCCAAGTG
TGGTTTCAGC AGACAAATCC TGCAAATTCT AAATAGTACT GGTGTCGACT
ACGAGACGTT CGACATACTG GAGGATGAGG TAGTCCGGCA GGGGGTTGAA
ACCTACTCCA ACTGGCCGAC GTACCCTCAG CTGTATGTGA AAGGTGAGCT
GGGTCGAGGC CTGAATATTG TTAAGGACTA AAAGAAAACG GTGAGCTGCT
GCCTATCCTG AAAGACAAAA TAATCATTGG GGGACTGGGG GCTAGCTACT
GCCAGAAGCC CGTCCTCCCT TAAAGACCAG TCCCTGAGTT GCCAAGGATA
AGAAAAGCTT ATCCCCGGTA CCCGGGGGAT TTTCCGAGAC TGCCCTAAAA
ACCGTAAAAC AGGGGTTCCC CCC

Search to ncbiHGDS database

Query= 20060611S-046491 (20060611S-046491) 20060611S-046491
         (1173 letters)

Database: Homo Sapiens Gene(masked sequence)
           545 sequences; 2,866,452,029 total letters

Searching...................................................done

                                                                             Score    E
            Sequences producing significant alignments:                      (bits) Value

Alignment   gi|27483683|ref|NT_034880.2|Hs6_35042 Homo sapiens chromosome 6 ...   428   e-117
Alignment   gi|29741420|ref|NT_008818.14|Hs10_8975 Homo sapiens chromosome 1...   228   6e-57
Alignment   gi|29800185|ref|NT_030059.10|Hs10_30314 Homo sapiens chromosome ...    62   7e-07
Alignment   gi|29805814|ref|NT_011362.8|Hs20_11519 Homo sapiens chromosome 2...    44   0.17
Alignment   gi|29823167|ref|NT_010966.13|Hs18_11123 Homo sapiens chromosome ...    44   0.17
Alignment   gi|29795229|ref|NT_008470.15|Hs9_8627 Homo sapiens chromosome 9 ...    42   0.69
Alignment   gi|29794559|ref|NT_008413.15|Hs9_8570 Homo sapiens chromosome 9 ...    42   0.69
Alignment   gi|29797939|ref|NT_034772.4|Hs5_34934 Homo sapiens chromosome 5 ...    42   0.69
Alignment   gi|29791697|ref|NT_005825.15|Hs3_5982 Homo sapiens chromosome 3 ...    42   0.69
Alignment   gi|29800594|ref|NT_011109.15|Hs19_11266 Homo sapiens chromosome ...    42   0.69
Alignment   gi|29799437|ref|NT_024871.10|Hs17_25027 Homo sapiens chromosome ...    42   0.69
Alignment   gi|29807454|ref|NT_009237.15|Hs11_9394 Homo sapiens chromosome 1...    42   0.69
Alignment   gi|29804170|ref|NT_011812.12|HsX_11969 Homo sapiens chromosome X...    40   2.7
Alignment   gi|29803300|ref|NT_011757.12|HsX_11914 Homo sapiens chromosome X...    40   2.7
Alignment   gi|29793892|ref|NT_078083.1|Hs9_78152 Homo sapiens chromosome 9 ...    40   2.7
Alignment   gi|29806267|ref|NT_011512.8|Hs21_11669 Homo sapiens chromosome 2...    40   2.7
Alignment   gi|29736559|ref|NT_026437.10|Hs14_26604 Homo sapiens chromosome ...    40   2.7
Alignment   gi|29803948|ref|NT_029419.10|Hs12_29578 Homo sapiens chromosome ...    40   2.7


>gi|27483683|ref|NT_034880.2|Hs6_35042 Homo sapiens chromosome 6 genomic
               contig
          Length = 9104288

 Score =  428 bits (216), Expect = e-117
 Identities = 465/547 (85%), Gaps = 2/547 (0%)
 Strand = Plus / Plus


Query: 406     aaagaagacctcagccttcgcctgaagaagctgacccacgctgccccctgcatgctgttc 465
               |||||||| |||| ||||||| |  |||| ||||| || ||||||||||||||||||||
Sbjct: 3918714 aaagaagatctcaaccttcgcttacagaaactgactcatgctgccccctgcatgctgttt 3918773


Query: 466     atgaagggaacaccccaggagccgcgctgcggtttcagcaagcaaatggtggaagttctt 525
               ||||| ||||| || || || || | ||| |||||||||||||| ||||||||| || ||
Sbjct: 3918774 atgaaaggaactcctcaagaaccactctgtggtttcagcaagcagatggtggaaattgtt 3918833


Query: 526     aacaaacataatatccagtttagcagttttgatatcttctcagatgaagaagttcgccaa 585
                |||||||||||||  ||||||||||||||||| ||||   |||| |||| ||||| ||
Sbjct: 3918834 cacaaacataatatttagtttagcagttttgatgtcttt--agatcaagaggttcgacag 3918891


Query: 586     ggcctcaaaacctattccaattggcccacctacccccagctctatgtttctggagagctc 645
               || |||||| |||||||||||||||| ||||| || |||||||| |||||||||||||||
Sbjct: 3918892 gggctcaaagcctattccaattggcctacctatcctcagctctacgtttctggagagctc 3918951


Query: 646     atacgaggacttgatataatcaaggagctagaagcatctaaagaactagatacaatttgc 705
               ||| |||||||||||||||| |||||| || | |||||| |||||||||||| ||||||
Sbjct: 3918952 ataggaggacttgatataattaaggagatacacgcatctgaagaactagatataatttgt 3919011


Query: 706     cccacagctcccaaattagaggaaaggctcaaagtactgacaaataaagcttctgtgatg 765
               |||| |||||||||||||||||||||||||||||| ||||||||| |||||||| |||||
Sbjct: 3919012 cccaaagctcccaaattagaggaaaggctcaaagtgctgacaaatgaagcttctatgatg 3919071


Query: 766     ctctatatgaagggaaacaaacaggaagccaagtgtggtttcagcagacaaatcctgcaa 825
               |||| |||||| ||||||||||||||||| || ||||| ||||||| |||||| ||| ||
Sbjct: 3919072 ctctttatgaaaggaaacaaacaggaagcaaaatgtggattcagcaaacaaattctggaa 3919131


Query: 826     attctaaatagtactggtgtcgactacgagacgttcgacatactggaggatgaggtagtc 885
               || ||||||||||||||||  || || || || ||||| ||| |||||||||| | ||
Sbjct: 3919132 atactaaatagtactggtggtgaatatgaaacattcgatatattggaggatgaaggagat 3919191


Query: 886     cggcagggggttgaaacctactccaactggccgacgtaccctcagctgtatgtgaaaggt 945
               ||||| ||  |  || | ||||| || ||||| || |||||||||||||||||||||||
Sbjct: 3919192 cggcaaggattaaaagcttactcaaattggccaacataccctcagctgtatgtgaaaggg 3919251


Query: 946     gagctgg 952
               |||||||
Sbjct: 3919252 gagctgg 3919258



 Score = 50.1 bits (25), Expect = 0.003
 Identities = 46/53 (86%)
 Strand = Plus / Plus


Query: 311     accggttacatggtgcacatgccccagagttgaccaaaaaggttcagcgacat 363
               |||| ||| ||||||||||   |||||||||||||||||| | ||||||||||
Sbjct: 3918556 accgattagatggtgcacacatcccagagttgaccaaaaaagctcagcgacat 3918608



>gi|29741420|ref|NT_008818.14|Hs10_8975 Homo sapiens chromosome 10 genomic
               contig
          Length = 4603909

 Score =  228 bits (115), Expect = 6e-57
 Identities = 160/175 (91%)
 Strand = Plus / Plus


Query: 496     ggtttcagcaagcaaatggtggaagttcttaacaaacataatatccagtttagcagtttt 555
               |||||||||||||| ||||||||| ||||| ||||||||||||| |||||||||||||||
Sbjct: 3187275 ggtttcagcaagcagatggtggaaattcttcacaaacataatattcagtttagcagtttt 3187334


Query: 556     gatatcttctcagatgaagaagttcgccaaggcctcaaaacctattccaattggcccacc 615
               |||||||||||||||||||| ||||| || || |||||| ||||||||| |||||| |||
Sbjct: 3187335 gatatcttctcagatgaagaggttcgacagggactcaaagcctattccagttggcctacc 3187394


Query: 616     tacccccagctctatgtttctggagagctcatacgaggacttgatataatcaagg 670
               || || ||||||||||||||||||||||||||| |||||||||||||||| ||||
Sbjct: 3187395 tatcctcagctctatgtttctggagagctcataggaggacttgatataattaagg 3187449



 Score =  115 bits (58), Expect = 6e-23
 Identities = 139/166 (83%)
 Strand = Plus / Plus


Query: 311     accggttacatggtgcacatgccccagagttgaccaaaaaggttcagcgacatgcgtcca 370
               |||| ||| ||||||||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 3181581 accgattagatggtgcacatgccccagagttgaccaaaaaagttcagcgacatgcatcta 3181640


Query: 371     gcagctctttcccatctggcggtagcgagcacctgaaagaagacctcagccttcgcctga 430
               |  |||| |||| | |  ||| ||  || || || |||||||| |||| ||||||| |||
Sbjct: 3181641 gtggctccttcctacccagcgctaatgaacatcttaaagaagatctcaaccttcgcttga 3181700


Query: 431     agaagctgacccacgctgccccctgcatgctgttcatgaagggaac 476
               ||||  |||| || |||||||||||||||||||| ||||| |||||
Sbjct: 3181701 agaaattgactcatgctgccccctgcatgctgtttatgaaaggaac 3181746



 Score =  105 bits (53), Expect = 6e-20
 Identities = 62/65 (95%)
 Strand = Plus / Plus


Query: 668     aggagctagaagcatctaaagaactagatacaatttgccccacagctcccaaattagagg 727
               ||||||||||||||||| ||||||||||||||||||| |||| |||||||||||||||||
Sbjct: 3187686 aggagctagaagcatctgaagaactagatacaatttgtcccaaagctcccaaattagagg 3187745


Query: 728     aaagg 732
               |||||
Sbjct: 3187746 aaagg 3187750



 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 58/61 (95%)
 Strand = Plus / Plus


Query: 730     aggctcaaagtactgacaaataaagcttctgtgatgctctatatgaagggaaacaaacag 789
               ||||||||||| |||||||||||||||||||||||||||| |||||| ||||||||||||
Sbjct: 3190200 aggctcaaagtgctgacaaataaagcttctgtgatgctctttatgaaaggaaacaaacag 3190259


Query: 790     g 790
               |
Sbjct: 3190260 g 3190260



 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus


Query: 904     tactccaactggccgacgtaccctcagctgtatgtgaaaggtgagctgg 952
               ||||| || ||||| || ||||||||||||||||||||||| |||||||
Sbjct: 3195787 tactcaaattggccaacataccctcagctgtatgtgaaaggggagctgg 3195835



 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus


Query: 788     aggaagccaagtgtggtttcagcagacaaatcctgcaaattctaaatagtactgg 842
               ||||||| || ||||| ||||||| |||||| ||| |||| ||||||||||||||
Sbjct: 3192351 aggaagcaaaatgtggattcagcaaacaaattctggaaatactaaatagtactgg 3192405



>gi|29800185|ref|NT_030059.10|Hs10_30314 Homo sapiens chromosome 10 genomic
                contig
          Length = 42717118

 Score = 61.9 bits (31), Expect = 7e-07
 Identities = 43/47 (91%)
 Strand = Plus / Plus


Query: 8        tggcttctgattttgaaggctttctgatctatcaggagacacctttt 54
                |||||||||||| ||||| |||||||||||||||| |||||| ||||
Sbjct: 42426942 tggcttctgattgtgaagtctttctgatctatcagaagacacttttt 42426988



>gi|29805814|ref|NT_011362.8|Hs20_11519 Homo sapiens chromosome 20 genomic
                contig
          Length = 24982290

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Plus


Query: 256      aaggggctgggggtggggaggg 277
                ||||||||||||||||||||||
Sbjct: 13348443 aaggggctgggggtggggaggg 13348464



>gi|29823167|ref|NT_010966.13|Hs18_11123 Homo sapiens chromosome 18 genomic
                contig
          Length = 33548238

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 25/26 (96%)
 Strand = Plus / Plus


Query: 255      gaaggggctgggggtggggagggcac 280
                |||||||||||||| |||||||||||
Sbjct: 25222321 gaaggggctgggggaggggagggcac 25222346



>gi|29795229|ref|NT_008470.15|Hs9_8627 Homo sapiens chromosome 9 genomic
                contig
          Length = 34895695

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 21/21 (100%)
 Strand = Plus / Minus


Query: 259      gggctgggggtggggagggca 279
                |||||||||||||||||||||
Sbjct: 31662949 gggctgggggtggggagggca 31662929



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 260      ggctgggggtggggagggca 279
                ||||||||||||||||||||
Sbjct: 18186475 ggctgggggtggggagggca 18186494



>gi|29794559|ref|NT_008413.15|Hs9_8570 Homo sapiens chromosome 9 genomic
                contig
          Length = 39435727

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 24/25 (96%)
 Strand = Plus / Minus


Query: 752      aagcttctgtgatgctctatatgaa 776
                |||||||||||||||||| ||||||
Sbjct: 19957501 aagcttctgtgatgctctttatgaa 19957477



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 258      ggggctgggggtggggaggg 277
                ||||||||||||||||||||
Sbjct: 34475938 ggggctgggggtggggaggg 34475919



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 254      tgaaggggctgggggtgggg 273
                ||||||||||||||||||||
Sbjct: 34111647 tgaaggggctgggggtgggg 34111628



>gi|29797939|ref|NT_034772.4|Hs5_34934 Homo sapiens chromosome 5 genomic
                contig
          Length = 41199379

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 21/21 (100%)
 Strand = Plus / Plus


Query: 51       tttttgtttgcttgacatcat 71
                |||||||||||||||||||||
Sbjct: 35241855 tttttgtttgcttgacatcat 35241875



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus


Query: 965    atattgttaaggactaaaagaaaa 988
              ||||| ||||||||||||||||||
Sbjct: 858093 atatttttaaggactaaaagaaaa 858070



>gi|29791697|ref|NT_005825.15|Hs3_5982 Homo sapiens chromosome 3 genomic
               contig
          Length = 6530747

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 21/21 (100%)
 Strand = Plus / Minus


Query: 256     aaggggctgggggtggggagg 276
               |||||||||||||||||||||
Sbjct: 3415540 aaggggctgggggtggggagg 3415520



>gi|29800594|ref|NT_011109.15|Hs19_11266 Homo sapiens chromosome 19 genomic
               contig
          Length = 31383029

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 21/21 (100%)
 Strand = Plus / Minus


Query: 257     aggggctgggggtggggaggg 277
               |||||||||||||||||||||
Sbjct: 5129047 aggggctgggggtggggaggg 5129027



>gi|29799437|ref|NT_024871.10|Hs17_25027 Homo sapiens chromosome 17 genomic
               contig
          Length = 2096181

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 24/25 (96%)
 Strand = Plus / Minus


Query: 262     ctgggggtggggagggcacctcagg 286
               ||||||||| |||||||||||||||
Sbjct: 1278210 ctgggggtgaggagggcacctcagg 1278186



>gi|29807454|ref|NT_009237.15|Hs11_9394 Homo sapiens chromosome 11 genomic
               contig
          Length = 41484120

 Score = 42.1 bits (21), Expect = 0.69
 Identities = 21/21 (100%)
 Strand = Plus / Minus


Query: 258     ggggctgggggtggggagggc 278
               |||||||||||||||||||||
Sbjct: 9221133 ggggctgggggtggggagggc 9221113



>gi|29804170|ref|NT_011812.12|HsX_11969 Homo sapiens chromosome X genomic
               contig
          Length = 8907783

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 257     aggggctgggggtggggagg 276
               ||||||||||||||||||||
Sbjct: 8752649 aggggctgggggtggggagg 8752668



>gi|29803300|ref|NT_011757.12|HsX_11914 Homo sapiens chromosome X genomic
                contig
          Length = 23668874

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 527      acaaacataatatccagttt 546
                ||||||||||||||||||||
Sbjct: 20282359 acaaacataatatccagttt 20282340



>gi|29793892|ref|NT_078083.1|Hs9_78152 Homo sapiens chromosome 9 genomic
             contig
          Length = 140969

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus


Query: 259   gggctgggggtggggagggc 278
             ||||||||||||||||||||
Sbjct: 75750 gggctgggggtggggagggc 75769



>gi|29806267|ref|NT_011512.8|Hs21_11669 Homo sapiens chromosome 21 genomic
                contig
          Length = 28602556

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 458      tgctgttcatgaagggaaca 477
                ||||||||||||||||||||
Sbjct: 25474214 tgctgttcatgaagggaaca 25474195



>gi|29736559|ref|NT_026437.10|Hs14_26604 Homo sapiens chromosome 14 genomic
                contig
          Length = 87191216

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus


Query: 250      tgaatgaaggggctgggggtgggg 273
                ||||||||||||| ||||||||||
Sbjct: 68175504 tgaatgaaggggcggggggtgggg 68175481



>gi|29803948|ref|NT_029419.10|Hs12_29578 Homo sapiens chromosome 12 genomic
                contig
          Length = 38627316

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 257      aggggctgggggtggggagg 276
                ||||||||||||||||||||
Sbjct: 18670339 aggggctgggggtggggagg 18670320



 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus


Query: 258     ggggctgggggtggggaggg 277
               ||||||||||||||||||||
Sbjct: 8266364 ggggctgggggtggggaggg 8266345


  Database: Homo Sapiens Gene(masked sequence)
    Posted date:  Oct 8, 2003  7:48 PM
  Number of letters in database: 2,866,452,029
  Number of sequences in database:  545

Lambda     K      H
    1.37    0.711     1.31

Gapped
Lambda     K      H
    1.37    0.711     1.31


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
length of query: 1173
length of database: 2,866,452,029
effective HSP length: 21
effective length of query: 1152
effective length of database: 2,866,440,584
effective search space: 3302139552768
effective search space used: 3302139552768
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)