Animal-Genome cDNA 20110601C-002085

Search to RefSeqBP_Rel49

BLASTX 2.2.24 [Aug-08-2010]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 20110601C-002085
         (1583 letters)

Database: RefSeq49_BP.fasta 
           33,088 sequences; 17,681,374 total letters


                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

Alignment   gi|NP_899207.1| retinol dehydrogenase 12 [Bos taurus].               549   e-156
Alignment   gi|XP_002691025.1| PREDICTED: retinol dehydrogenase 11-like [Bo...   410   e-114
Alignment   gi|XP_582373.4| PREDICTED: retinol dehydrogenase 11 isoform 1 [...   410   e-114
Alignment   gi|NP_001068813.1| retinol dehydrogenase 13 [Bos taurus].            264   2e-70
Alignment   gi|NP_001068701.1| retinol dehydrogenase 14 [Bos taurus].            244   2e-64
Alignment   gi|NP_001069155.1| dehydrogenase/reductase SDR family member 13...   236   6e-62
Alignment   gi|NP_001071560.1| WW domain-containing oxidoreductase [Bos tau...   183   4e-46
Alignment   gi|NP_001095361.1| hypothetical protein LOC507942 [Bos taurus].      171   2e-42
Alignment   gi|XP_591168.4| PREDICTED: dehydrogenase/reductase (SDR family)...   127   2e-29
Alignment   gi|NP_001093783.1| dehydrogenase/reductase SDR family member 12...   110   3e-24

>ref|NP_899207.1| retinol dehydrogenase 12 [Bos taurus].
          Length = 316

 Score =  549 bits (1415), Expect = e-156
 Identities = 277/316 (87%), Positives = 287/316 (90%)
 Frame = +1







>ref|XP_002691025.1| PREDICTED: retinol dehydrogenase 11-like [Bos taurus].
          Length = 338

 Score =  410 bits (1055), Expect = e-114
 Identities = 205/313 (65%), Positives = 241/313 (76%)
 Frame = +1



            ILINNAGVM+CPYSKTADGFE H+GVN               + SAP+RVVN+SS+ H  


            S L+  +W +FS F+KT ++GAQTSL+CAL EGLE LSG +FSDC  AWVS +ARN   A

Query: 1075 ERLWNVSCELLGI 1113
Sbjct: 301  RRLWDVSCDLLGI 313

>ref|XP_582373.4| PREDICTED: retinol dehydrogenase 11 isoform 1 [Bos taurus].
          Length = 338

 Score =  410 bits (1055), Expect = e-114
 Identities = 205/313 (65%), Positives = 241/313 (76%)
 Frame = +1



            ILINNAGVM+CPYSKTADGFE H+GVN               + SAP+RVVN+SS+ H  


            S L+  +W +FS F+KT ++GAQTSL+CAL EGLE LSG +FSDC  AWVS +ARN   A

Query: 1075 ERLWNVSCELLGI 1113
Sbjct: 301  RRLWDVSCDLLGI 313

>ref|NP_001068813.1| retinol dehydrogenase 13 [Bos taurus].
          Length = 335

 Score =  264 bits (674), Expect = 2e-70
 Identities = 144/300 (48%), Positives = 191/300 (63%), Gaps = 7/300 (2%)
 Frame = +1

            ++ F AGG C +   +PGK V++TGANTGIGK+TA ELA+RG  + +ACRD+ K E+AA 

            EIR +T N +V  R LDL+  KSIR FA     EE+ +HILINNA VM CP+  T DGFE

              LGVN               KASAP+R++N+SS+ H AG I F DL  EK  Y+   AY

            C SKLA V+ T+EL++RLQGTGVT  A+HPG+ ++EL RH      +F    L  +F   

            +K+    AQ S++ A+AE LE +SGKYF   K    +P A + + A+RLW  S  L+G++

>ref|NP_001068701.1| retinol dehydrogenase 14 [Bos taurus].
          Length = 336

 Score =  244 bits (622), Expect = 2e-64
 Identities = 141/339 (41%), Positives = 199/339 (58%), Gaps = 22/339 (6%)
 Frame = +1

            AV T  A+L  L   L+       + R+F    V R +       + GK V+ITGAN+G+

            G+ TA EL R GARV + CRD  + E AA ++R +           NS    +++V++LD

            L+   S+R+F +  L EE +L +LINNAGV  CPY KT DGFE   GVN           

                K+SAP+R+V +SS ++  G I F DL  E+ YN+ F Y  SKLAN+LFTRELA+RL

            +GT VT   +HPGIV++ L RH  +  L+  LF+     F KT  EGAQT+++ A +  +

            E +SG+YF DCK   + P+A +   A +LW++S  ++GI

>ref|NP_001069155.1| dehydrogenase/reductase SDR family member 13 precursor [Bos taurus].
          Length = 377

 Score =  236 bits (601), Expect = 6e-62
 Identities = 148/326 (45%), Positives = 195/326 (59%), Gaps = 10/326 (3%)
 Frame = +1

            +E +L  +GLL      +Y   V AP          CR    L G+  V+TGAN+GIGK 

            TA ELARRGARV +ACR   +GE+AA ++R ++ N++V+   LDL+   S+RAFA  FL+

             E +L ILI+NAG+  C   +T + F   L VN               K SAP+RVV +S

            S  H  G++ F    H + G +   R  AY +SKLANVLF RELA +L+GTGVT YA HP

            G V SEL +RH   +L  LL  L    L+  R GAQT L+CAL EG+EPLSG+YF++C  

              V P AR+++ A RLW  S +L G+

>ref|NP_001071560.1| WW domain-containing oxidoreductase [Bos taurus].
          Length = 414

 Score =  183 bits (464), Expect = 4e-46
 Identities = 118/307 (38%), Positives = 167/307 (54%), Gaps = 13/307 (4%)
 Frame = +1

            T P+ R+ + G      +     L GKVVV+TGAN+GIG ETA+  A  GA V +ACR++

             +   A S I  +   ++V    LDL+  +S++ FA+ F  +   LH+L+ NA V   P+

            + T DG ET   VN                 SAPARVV +SS  H        +GK+ F 

             L   K+ Y    AY  SKL N+LF+ EL +RL   GVT+ AVHPG ++ S L R  ++ 

             LL+ L   F K+ ++GA T+++CA+A  LE L G YF+ C R   S  A++  +A  LW

Query: 1087 NVSCELL 1107
             +S  LL
Sbjct: 399  ALSERLL 405

>ref|NP_001095361.1| hypothetical protein LOC507942 [Bos taurus].
          Length = 330

 Score =  171 bits (432), Expect = 2e-42
 Identities = 109/295 (36%), Positives = 167/295 (56%), Gaps = 5/295 (1%)
 Frame = +1

            KF+   +   +  L GK  V+TGAN+GIGK  ++ELA RGARV +ACR   +G+ A +EI

            +A +K++++L+ ++DLS   SIR+FA+  L E  ++H+L+NNA V   P + T +G +  

               N               + +  ARVVN+SS     G I    L G      +N+   Y

              SKL    FT +LA+RLQGT VT  +V PG+V +++++H S+    L+ L S F K ++

            +GA   L+ +LA+ L+ +SGK+F S C        A++   A+ LWN S  L  +

>ref|XP_591168.4| PREDICTED: dehydrogenase/reductase (SDR family) X-linked [Bos
          Length = 237

 Score =  127 bits (320), Expect = 2e-29
 Identities = 88/230 (38%), Positives = 116/230 (50%), Gaps = 16/230 (6%)
 Frame = +1

            +SIR F + F  ++  LH+L+NNAGVM+ P   T DGFE H GVN               

            + S AP   ARVV +SS  H+ G++   DLQ   +Y+   AY  SKLA VLFT  L   L

              QG  VT     PG+V ++L R+ F     W  RL  + L     KT  EGA TS++ A

            +   LE L G+Y  + K         + +   +LW  SC+L GI    WE

>ref|NP_001093783.1| dehydrogenase/reductase SDR family member 12 [Bos taurus].
          Length = 317

 Score =  110 bits (276), Expect = 3e-24
 Identities = 85/257 (33%), Positives = 128/257 (49%), Gaps = 3/257 (1%)
 Frame = +1

            +Q+PG+  ++TG N+GIGK TA E+A+RG  V++ CRD  + E A +EI  ++ N  + +

              +DLS  KS+  F E F  +E  L++LINNAG M+     T DG E +   N       

                    +     RV+ +SS      K+   D Q E+  ++    Y  +K   V+ T  

             A+      +    +HPG V +  VR S +     RL +R L++  +GA T L  ALA  

Query: 994  --LEPLSGKYFSDCKRA 1038
               +P SG +F D K A

  Database: RefSeq49_BP.fasta
    Posted date:  Oct 17, 2011  1:42 PM
  Number of letters in database: 17,681,374
  Number of sequences in database:  33,088
Lambda     K      H
   0.318    0.134    0.401 

Lambda     K      H
   0.267   0.0410    0.140 

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 33088
Number of Hits to DB: 64,460,350
Number of extensions: 1897738
Number of successful extensions: 7004
Number of sequences better than 1.0e-05: 29
Number of HSP's gapped: 6954
Number of HSP's successfully gapped: 29
Length of query: 527
Length of database: 17,681,374
Length adjustment: 107
Effective length of query: 420
Effective length of database: 14,140,958
Effective search space: 5939202360
Effective search space used: 5939202360
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 36 (18.5 bits)

Search to RefSeqCP_Rel49

BLASTX 2.2.24 [Aug-08-2010]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 20110601C-002085
         (1583 letters)

Database: RefSeq49_CP.fasta 
           33,336 sequences; 18,874,504 total letters


                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

Alignment   gi|XP_547866.2| PREDICTED: similar to retinol dehydrogenase 12 ...   525   e-149
Alignment   gi|XP_854354.1| PREDICTED: similar to Retinol dehydrogenase 11 ...   403   e-112
Alignment   gi|XP_854127.1| PREDICTED: similar to Retinol dehydrogenase 13 ...   270   2e-72
Alignment   gi|XP_540096.2| PREDICTED: similar to retinol dehydrogenase 14 ...   248   2e-65
Alignment   gi|XP_548293.2| PREDICTED: similar to retinol dehydrogenase 11 ...   226   5e-59
Alignment   gi|XP_857582.1| PREDICTED: similar to retinol dehydrogenase 14 ...   194   2e-49
Alignment   gi|XP_533000.2| PREDICTED: similar to Retinol dehydrogenase 12 ...   182   8e-46
Alignment   gi|XP_852222.1| PREDICTED: similar to dehydrogenase/reductase (...   166   8e-41
Alignment   gi|XP_852623.1| PREDICTED: similar to WW domain-containing oxid...   144   2e-34
Alignment   gi|XP_857503.1| PREDICTED: similar to retinol dehydrogenase 14 ...    72   1e-12

>ref|XP_547866.2| PREDICTED: similar to retinol dehydrogenase 12 (all-trans and 9-cis)
            [Canis familiaris].
          Length = 303

 Score =  525 bits (1351), Expect = e-149
 Identities = 259/294 (88%), Positives = 270/294 (91%)
 Frame = +1






>ref|XP_854354.1| PREDICTED: similar to Retinol dehydrogenase 11 (Retinal reductase 1)
            (RalR1) (Prostate short-chain dehydrogenase/reductase 1)
            (Androgen-regulated short-chain dehydrogenase/reductase
            1) (HCV core-binding protein HCBP12) [Canis familiaris].
          Length = 337

 Score =  403 bits (1035), Expect = e-112
 Identities = 195/292 (66%), Positives = 233/292 (79%)
 Frame = +1



             H+GVN               K SAP+R+VN+SS+ HH G+I FHDLQGEK YN G AYC



>ref|XP_854127.1| PREDICTED: similar to Retinol dehydrogenase 13 [Canis familiaris].
          Length = 334

 Score =  270 bits (691), Expect = 2e-72
 Identities = 145/300 (48%), Positives = 192/300 (64%), Gaps = 7/300 (2%)
 Frame = +1

            +R + AGG C +   +PGK V++TGANTGIGK+TA ELARRG  + +ACRD+ K E+AA 

            EIR +T N +V    LDL+  KSIR FA   + EE+Q+HIL+NNA VM CP+  T DGFE

               GVN               KASAP+R++NLSS+ H AG I F DL  EK  Y+   AY

            C SKLA +LFT+EL++RLQGTGVT  A+HPG+ ++EL RH      +F    L  +F   

            +K+ +  AQ S + A+AE LE +SGKYF   K    +P A + + A+RLW  S  L+G++

>ref|XP_540096.2| PREDICTED: similar to retinol dehydrogenase 14 (all-trans and 9-cis)
            isoform 1 [Canis familiaris].
          Length = 336

 Score =  248 bits (632), Expect = 2e-65
 Identities = 139/336 (41%), Positives = 199/336 (59%), Gaps = 19/336 (5%)
 Frame = +1

            AV  + A+L  L+  L+        P +++   GG    +  + GK V+ITGAN+G+G+ 

            TA  L R GARV + CRD  + E AA ++R + + +             +++VR+LDL+ 

             +S+RAF +  L EE +L +LINNAG+  CPY KT DGFE   GVN              

             K SAP+R+V +SS ++  G I F DL  E+ YN+ F Y  SKLAN+LFTRELA+RL+GT

             VT   +HPGIV++ L RH  +  L+  LF+     F KT  EGAQTS++ A +  +E +

            SGKYF DCK   + P+A +   A +LW++S  ++GI

>ref|XP_548293.2| PREDICTED: similar to retinol dehydrogenase 11 (predicted) [Canis
          Length = 377

 Score =  226 bits (576), Expect = 5e-59
 Identities = 146/326 (44%), Positives = 190/326 (58%), Gaps = 10/326 (3%)
 Frame = +1

            +E +L   GLL      +Y   V AP       GG+      L G+  V+TGAN+GIGK 

            TA ELARRGARV +ACR   +GE+AA ++R ++ N++V+   LDL+   S+RAFA  FL+

             E +L ILI+NAG+  C   +T   F   L VN               K  AP+RVV +S

            S  H  G++ F  L     G +   R  AY  SKLANVLF RELA +L+GTGVT YA HP

            G V SEL +RH   +L  LL  L    L+  R GAQT L+CAL EG+EPLSG+YF++C  

              V P AR+++ A +LW  S  L G+

>ref|XP_857582.1| PREDICTED: similar to retinol dehydrogenase 14 (all-trans and 9-cis)
            isoform 4 [Canis familiaris].
          Length = 307

 Score =  194 bits (493), Expect = 2e-49
 Identities = 121/336 (36%), Positives = 178/336 (52%), Gaps = 19/336 (5%)
 Frame = +1

            AV  + A+L  L+  L+        P +++   GG    +  + GK V+ITGAN+G+G+ 

            TA  L R GARV + CRD  + E AA ++R + + +             +++VR+LDL+ 

             +S+RAF +  L                               GVN              
Sbjct: 119  LRSVRAFCQEVL-----------------------------QFGVNHLGHFLLTNLLLGL 149

             K SAP+R+V +SS ++  G I F DL  E+ YN+ F Y  SKLAN+LFTRELA+RL+GT

             VT   +HPGIV++ L RH  +  L+  LF+     F KT  EGAQTS++ A +  +E +

            SGKYF DCK   + P+A +   A +LW++S  ++GI

>ref|XP_533000.2| PREDICTED: similar to Retinol dehydrogenase 12 [Canis familiaris].
          Length = 596

 Score =  182 bits (462), Expect = 8e-46
 Identities = 113/286 (39%), Positives = 167/286 (58%), Gaps = 3/286 (1%)
 Frame = +1

            C T+  L GK  V+TGAN+GIGK   +ELARRGARV +ACR+  +G+ A +EI+  +K +

             +L+ ++DLS   SIR+FA   L E  ++H+L+NNA +   P + T +G +     N   

                        + +  ARVVN+SS  H  G +    L G  K  N   +Y  SKL    

            FT ELA+RLQGTGVT  +V PG+V +E+++ + +L   L+ LFS F K  ++GA   L+ 

            +LA+ L+ +SGKYF S C     +  A++ + A+ LWN S +L  +

>ref|XP_852222.1| PREDICTED: similar to dehydrogenase/reductase (SDR family) X-linked
            [Canis familiaris].
          Length = 387

 Score =  166 bits (419), Expect = 8e-41
 Identities = 109/284 (38%), Positives = 148/284 (52%), Gaps = 8/284 (2%)
 Frame = +1

            P +V ++TG   GIG  TA+ LAR G  V +A  +         +I+ +T N +V     

            DL+  +SIR F + F  ++  LH+L+NNAGVM+ P   T DGFE H G+N          

                 K S AP   ARVV +SS  H+ G++   DLQG + Y+   AY  SKLA VLFT  

            L + L  QG+ VT   V PG+V + L RH F    L+ +LF   F KT  EGA TS++ A

            +   LE L G+Y  + K         +      LW  SC++ GI

>ref|XP_852623.1| PREDICTED: similar to WW domain-containing oxidoreductase isoform 1
           [Canis familiaris].
          Length = 383

 Score =  144 bits (363), Expect = 2e-34
 Identities = 95/253 (37%), Positives = 134/253 (52%), Gaps = 13/253 (5%)
 Frame = +1

           T P+ R+ + GG     +       GKVVV+TGAN+GIG ETA+  A  GA V +ACR++

            +   A S+I  +   ++V    LDL+  +S++ FA+ F  +   LH+L+ NA     P+

           S T DG ET   VN                 SAPARVV +SS  H        +GK+ F 

            L   K  Y    AY  SKL N+LF+ EL +RL   GVT+ AVHPG ++ S + R+ ++ 

Query: 907 CLLWRLFSRFLKT 945
            LL+ L   F K+
Sbjct: 339 TLLFTLARPFTKS 351

>ref|XP_857503.1| PREDICTED: similar to retinol dehydrogenase 14 (all-trans and
           9-cis) isoform 3 [Canis familiaris].
          Length = 153

 Score = 72.4 bits (176), Expect = 1e-12
 Identities = 45/136 (33%), Positives = 73/136 (53%), Gaps = 15/136 (11%)
 Frame = +1

           AV  + A+L  L+  L+        P +++   GG    +  + GK V+ITGAN+G+G+ 

           TA  L R GARV + CRD  + E AA ++R + + +             +++VR+LDL+ 

            +S+RAF +  L   K

  Database: RefSeq49_CP.fasta
    Posted date:  Oct 17, 2011  1:42 PM
  Number of letters in database: 18,874,504
  Number of sequences in database:  33,336
Lambda     K      H
   0.318    0.134    0.401 

Lambda     K      H
   0.267   0.0410    0.140 

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 33336
Number of Hits to DB: 67,062,836
Number of extensions: 1945072
Number of successful extensions: 7384
Number of sequences better than 1.0e-05: 24
Number of HSP's gapped: 7330
Number of HSP's successfully gapped: 27
Length of query: 527
Length of database: 18,874,504
Length adjustment: 107
Effective length of query: 420
Effective length of database: 15,307,552
Effective search space: 6429171840
Effective search space used: 6429171840
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 36 (18.5 bits)

Search to RefSeqHP_Rel49

BLASTX 2.2.24 [Aug-08-2010]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 20110601C-002085
         (1583 letters)

Database: RefSeq49_HP.fasta 
           32,964 sequences; 18,297,164 total letters


                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

Alignment   gi|NP_689656.2| retinol dehydrogenase 12 [Homo sapiens].             550   e-156
Alignment   gi|NP_057110.3| retinol dehydrogenase 11 [Homo sapiens].             430   e-120
Alignment   gi|NP_001139443.1| retinol dehydrogenase 13 isoform 1 [Homo sap...   262   8e-70
Alignment   gi|NP_065956.1| retinol dehydrogenase 14 [Homo sapiens].             248   9e-66
Alignment   gi|NP_653284.2| dehydrogenase/reductase SDR family member 13 pr...   226   4e-59
Alignment   gi|NP_612421.1| retinol dehydrogenase 13 isoform 2 [Homo sapien...   199   8e-51
Alignment   gi|NP_057457.1| WW domain-containing oxidoreductase isoform 1 [...   184   2e-46
Alignment   gi|NP_001186032.1| NT5C1B-RDH14 protein isoform 1 [Homo sapiens].    180   3e-45
Alignment   gi|NP_660160.2| dehydrogenase/reductase SDR family member on ch...   171   1e-42
Alignment   gi|NP_078981.1| dehydrogenase/reductase SDR family member 12 is...    66   1e-10

>ref|NP_689656.2| retinol dehydrogenase 12 [Homo sapiens].
          Length = 316

 Score =  550 bits (1418), Expect = e-156
 Identities = 275/316 (87%), Positives = 284/316 (89%)
 Frame = +1







>ref|NP_057110.3| retinol dehydrogenase 11 [Homo sapiens].
          Length = 318

 Score =  430 bits (1105), Expect = e-120
 Identities = 214/316 (67%), Positives = 250/316 (79%)
 Frame = +1



             LH+LINNAGVM+CPYSKTADGFE H+GVN               K SAP+R+VN+SS+ 



              A RLW+VSC+LLG+

>ref|NP_001139443.1| retinol dehydrogenase 13 isoform 1 [Homo sapiens].
          Length = 331

 Score =  262 bits (669), Expect = 8e-70
 Identities = 141/300 (47%), Positives = 189/300 (63%), Gaps = 7/300 (2%)
 Frame = +1

            ++ +  GG C +   +PGK V++TGANTGIGK+TA ELARRG  + +ACRD+ K E+AA 

            +IR +T N  V  R LDL+  KSIR FA   + EE+++ ILINNAGVM CP+  T DGFE

               GVN               KASAP+R++NLSS+ H AG I F DL  + + YN   AY

            C SKLA VLFT+EL++RLQG+GVT  A+HPG+ ++EL RH      +F    L  +F   

            +K+    AQ S + A+AE L  +SGKYF   K+   +P A + + A RLW  S  L+G++

>ref|NP_065956.1| retinol dehydrogenase 14 [Homo sapiens].
          Length = 336

 Score =  248 bits (634), Expect = 9e-66
 Identities = 140/336 (41%), Positives = 199/336 (59%), Gaps = 19/336 (5%)
 Frame = +1

            AV T  AVL  L   L+        P +++   GG       + GK V+ITGAN+G+G+ 

            TA EL R GARV + CRD  + E AA ++R + + +             +++VR+LDL+ 

             +S+RAF +  L EE +L +LINNAG+  CPY KT DGFE   GVN              

             K+SAP+R+V +SS ++  G I F DL  E+ YN+ F Y  SKLAN+LFTRELA+RL+GT

             VT   +HPGIV++ L RH  +  L+  LF+     F KT  EGAQTS++ A +  +E +

            SG+YF DCK   + P+A +   A +LW++S  ++G+

>ref|NP_653284.2| dehydrogenase/reductase SDR family member 13 precursor [Homo
          Length = 377

 Score =  226 bits (577), Expect = 4e-59
 Identities = 149/353 (42%), Positives = 197/353 (55%), Gaps = 10/353 (2%)
 Frame = +1

            +E +L   GLL      +Y   V AP          C     L G+  V+TGAN+GIGK 

            TA ELARRGARV +ACR   +GE+AA ++R ++ N++V+   LDL+   S+RAFA  FL+

             E +L ILI+NAG+  C   +T + F   L VN               KA AP+RVV ++

            S  H  G++ F  L     G +   R  AY  +KLANVLF RELA +L+ TGVT YA HP

            G V SEL +RH   +L  LL  L    L+  R GAQT L+CAL EG+EPLSG+YF++C  

              V P AR+++ A RLW  S  L G+               GPG +A+  + P

>ref|NP_612421.1| retinol dehydrogenase 13 isoform 2 [Homo sapiens].
          Length = 260

 Score =  199 bits (505), Expect = 8e-51
 Identities = 113/247 (45%), Positives = 150/247 (60%), Gaps = 7/247 (2%)
 Frame = +1

            K E+AA +IR +T N  V  R LDL+  KSIR FA   + EE+++ ILINNAGVM CP+ 

             T DGFE   GVN               KASAP+R++NLSS+ H AG I F DL  + + 

            YN   AYC SKLA VLFT+EL++RLQG+GVT  A+HPG+ ++EL RH      +F    L

              +F   +K+    AQ S + A+AE L  +SGKYF   K+   +P A + + A RLW  S

Query: 1096 CELLGIQ 1116
Sbjct: 243  ARLVGLE 249

>ref|NP_057457.1| WW domain-containing oxidoreductase isoform 1 [Homo sapiens].
          Length = 414

 Score =  184 bits (467), Expect = 2e-46
 Identities = 116/307 (37%), Positives = 165/307 (53%), Gaps = 13/307 (4%)
 Frame = +1

            T P+ R+ + G      +       GKVVV+TGAN+GIG ETA+  A  GA V +ACR++

             +   A S I  +   ++V    LDL+  +S++ FAE F  +   LH+L+ NA     P+

            S T DG ET   VN                 SAPARV+ +SS  H         GK+ F 

             L   K+ Y    AY  SKL N+LF+ EL +RL   GVT+ AVHPG ++ S + R  ++ 

             LL+ L   F K+ ++GA T+++CA    LE L G YF++C R   SP A++ +TA  LW

Query: 1087 NVSCELL 1107
             +S  L+
Sbjct: 399  ALSERLI 405

>ref|NP_001186032.1| NT5C1B-RDH14 protein isoform 1 [Homo sapiens].
          Length = 650

 Score =  180 bits (457), Expect = 3e-45
 Identities = 93/203 (45%), Positives = 128/203 (63%), Gaps = 4/203 (1%)
 Frame = +1

            EE +L +LINNAG+  CPY KT DGFE   GVN               K+SAP+R+V +S

            S ++  G I F DL  E+ YN+ F Y  SKLAN+LFTRELA+RL+GT VT   +HPGIV+

            + L RH  +  L+  LF+     F KT  EGAQTS++ A +  +E +SG+YF DCK   +

             P+A +   A +LW++S  ++G+

>ref|NP_660160.2| dehydrogenase/reductase SDR family member on chromosome X precursor
            [Homo sapiens].
          Length = 330

 Score =  171 bits (434), Expect = 1e-42
 Identities = 108/288 (37%), Positives = 148/288 (51%), Gaps = 12/288 (4%)
 Frame = +1

            P +V ++TG   GIG  TA+ LAR G  V IA  +  K +   S+I+ +T N +V     

            DL+   SIR F + F  ++  LH+LINNAGVM+ P  KT DGFE H G+N          

                 K S      ARVV +SS  H+  ++   DLQ    Y+   AY  SKLA VLFT  

            L + L  +G+ VT   V PG+V +++ +H F    L      W LF    KT  EGA TS

            ++ A+   LE + G Y  + K         N K  ++LW+ SCE+ G+

>ref|NP_078981.1| dehydrogenase/reductase SDR family member 12 isoform 2 [Homo
          Length = 242

 Score = 65.9 bits (159), Expect = 1e-10
 Identities = 60/207 (28%), Positives = 92/207 (44%), Gaps = 4/207 (1%)
 Frame = +1

            A ++   + +  + +  +DLSD K I  F E F  E K LH+LINNAG M+     T DG

             E +   N               +     RV+ +SS      K+  +DLQ E+  ++   

             Y  +K   V+ T   A   QG   +   ++HPG   +  VR +  +      F   L++

              +GA T L  AL  A   +P SG++F

  Database: RefSeq49_HP.fasta
    Posted date:  Oct 17, 2011  1:42 PM
  Number of letters in database: 18,297,164
  Number of sequences in database:  32,964
Lambda     K      H
   0.318    0.134    0.401 

Lambda     K      H
   0.267   0.0410    0.140 

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 32964
Number of Hits to DB: 65,794,810
Number of extensions: 1909215
Number of successful extensions: 6882
Number of sequences better than 1.0e-05: 28
Number of HSP's gapped: 6836
Number of HSP's successfully gapped: 28
Length of query: 527
Length of database: 18,297,164
Length adjustment: 107
Effective length of query: 420
Effective length of database: 14,770,016
Effective search space: 6203406720
Effective search space used: 6203406720
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 36 (18.5 bits)

Search to RefSeqMP_Rel49

BLASTX 2.2.24 [Aug-08-2010]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 20110601C-002085
         (1583 letters)

Database: RefSeq49_MP.fasta 
           30,036 sequences; 15,617,559 total letters


                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

Alignment   gi|NP_084293.1| retinol dehydrogenase 12 [Mus musculus].             509   e-144
Alignment   gi|NP_067532.2| retinol dehydrogenase 11 [Mus musculus].             416   e-116
Alignment   gi|NP_780581.1| retinol dehydrogenase 13 [Mus musculus].             258   9e-69
Alignment   gi|NP_076186.1| retinol dehydrogenase 14 [Mus musculus].             249   3e-66
Alignment   gi|NP_899109.2| dehydrogenase/reductase SDR family member 13 pr...   227   2e-59
Alignment   gi|NP_062519.2| WW domain-containing oxidoreductase [Mus muscul...   181   1e-45
Alignment   gi|NP_001028498.2| dehydrogenase/reductase SDR family member on...   167   2e-41
Alignment   gi|NP_079798.2| dehydrogenase/reductase SDR family member 7 pre...    70   5e-12
Alignment   gi|NP_780721.1| dehydrogenase/reductase SDR family member 9 pre...    64   4e-10
Alignment   gi|NP_766635.1| carbonyl reductase 3 [Mus musculus].                  64   4e-10

>ref|NP_084293.1| retinol dehydrogenase 12 [Mus musculus].
          Length = 316

 Score =  509 bits (1312), Expect = e-144
 Identities = 257/316 (81%), Positives = 272/316 (86%)
 Frame = +1







>ref|NP_067532.2| retinol dehydrogenase 11 [Mus musculus].
          Length = 316

 Score =  416 bits (1070), Expect = e-116
 Identities = 204/307 (66%), Positives = 244/307 (79%)
 Frame = +1



            GVM+CPYSKTADGFE H+GVN               K SAP+R+VNLSS+ HH G+I FH



Query: 1093 SCELLGI 1113
Sbjct: 306  SCDLLGL 312

>ref|NP_780581.1| retinol dehydrogenase 13 [Mus musculus].
          Length = 334

 Score =  258 bits (659), Expect = 9e-69
 Identities = 140/299 (46%), Positives = 187/299 (62%), Gaps = 7/299 (2%)
 Frame = +1

            ++ + AGG C +   +PGK V++TGANTGIGK+TA ELA+RG  V +ACRD+ K E AA 

            +IR +T N +V   +LDL+  KSIR FA   + EE+++ IL+NNA VM CP+  T DGFE

               GVN               KASAP+R++NLSS+ H AG I F DL  + K Y+   AY

            C SKLA VLFT+EL+ RLQG+GVT  A+HPG+ ++EL RH      +F   +L   F   

             K+ +  AQ S + A+AE LE +SGKYF   +    SP A + + A RLW  S  L+G+

>ref|NP_076186.1| retinol dehydrogenase 14 [Mus musculus].
          Length = 334

 Score =  249 bits (637), Expect = 3e-66
 Identities = 132/289 (45%), Positives = 183/289 (63%), Gaps = 14/289 (4%)
 Frame = +1

            GK V+ITGAN+G+G+ TA EL R GARV + CRD  + E AA ++R           D  

            + Q++V++LDL+  +S+RAF +  L EE +L +LINNAGV  CPY+KT DGFE   GVN 

                          K+SAP+R+V +SS ++  G+I F DL  E+ YN+ F Y  SKLAN+

            LFTRELA+RL+GT VT   +HPGIV++ L RH  +  L   LF+     F KT  EGAQT

            S++ A +  +E +SG+YF DCK   + P+A +   A +LW++S  ++GI

>ref|NP_899109.2| dehydrogenase/reductase SDR family member 13 precursor [Mus
          Length = 376

 Score =  227 bits (579), Expect = 2e-59
 Identities = 156/386 (40%), Positives = 213/386 (55%), Gaps = 10/386 (2%)
 Frame = +1

            +E +L   GLL      +Y   V APS      GG+      L G+ VV+TGAN+GIGK 

            TA ELARRGARV +ACR   +GE+AA ++R ++ N++V+   LDL+   S++AFA  FL+

             E +L +LI+NAG+  C   +T + F   L VN               ++ AP+RVV +S

            S  H  G++ F  L     G +   R  AY  SKLANVLF RELA +L+GTGVT YA HP

            G V SEL +RH   +L  +L  L    L+  + GAQT L+CAL EG+EPLSG+YF++C  

              VSP AR+++ A+RLW  + +L G+                PG + D  D  P   D  

                +  P+     +  P H   SYQ

>ref|NP_062519.2| WW domain-containing oxidoreductase [Mus musculus].
          Length = 414

 Score =  181 bits (460), Expect = 1e-45
 Identities = 113/307 (36%), Positives = 167/307 (54%), Gaps = 13/307 (4%)
 Frame = +1

            T P+ R+ + G      +       GKVV++TGAN+GIG ETA+  A  GA V +ACR++

             +   A S I  +   ++V    LDL+  +S++ FAE F  +   LH+L+ NAG    P+

              T DG ET   VN                 S+PARV+ +SS  H        +GK+   

             L   +  Y    AY  SKL N+LF+ EL +RL   GVT+ AVHPG ++ S + R+S++ 

             LL+ L   F K+ ++GA T+++CA+A  LE L G YF++C R   S  A++ +TA  LW

Query: 1087 NVSCELL 1107
             +S  L+
Sbjct: 399  ELSERLI 405

>ref|NP_001028498.2| dehydrogenase/reductase SDR family member on chromosome X homolog
            precursor [Mus musculus].
          Length = 335

 Score =  167 bits (423), Expect = 2e-41
 Identities = 109/286 (38%), Positives = 145/286 (50%), Gaps = 11/286 (3%)
 Frame = +1

            PG+V ++TGA  GIG+ TAR+LAR G  V +A  D   G+   S IRA+  + +     L

            DL+   S+R FA  F      LH+L+NNAGVML P ++T DGFE HLGVN          

                 +AS      +RVV + S  H+ G +   DL G   Y+   AY  SKLA  LF  +

            L + L   G  VT+    PG+V +EL RH+  +    R   RFL     K+  EGA T +

            + A A  LE + G+Y  D   A     AR+ +   RLW     L G

>ref|NP_079798.2| dehydrogenase/reductase SDR family member 7 precursor [Mus musculus].
          Length = 338

 Score = 70.1 bits (170), Expect = 5e-12
 Identities = 67/263 (25%), Positives = 108/263 (41%), Gaps = 3/263 (1%)
 Frame = +1

            R   +L   VV +TGA++GIG+E A +L++ G  + ++ R   + E          + K 

              +LV  LDL+DT S  A  +  L E  ++ IL+NN G      S+ +   ET+L V   

                         K   P  +      +     +  + + G    +    YC SK A   

            F   L   L Q  G+T   V+PG VQS++V+++F             K+ R     S   

              +  +  +     +D K  W+S

>ref|NP_780721.1| dehydrogenase/reductase SDR family member 9 precursor [Mus
          Length = 319

 Score = 63.5 bits (153), Expect = 4e-10
 Identities = 62/203 (30%), Positives = 93/203 (45%), Gaps = 5/203 (2%)
 Frame = +1

           K V ITG +TG G   AR   ++G RV  AC  + +  SAA + +   +   VL   LD+

           +D ++++  A+   +   EK L  LINNAGV+  L P    T D +   + VN       

                   K  A  RV+N+SS+    G++ F           G  Y  SK A   F   L

            + ++  GV    + PG+ ++EL

>ref|NP_766635.1| carbonyl reductase 3 [Mus musculus].
          Length = 277

 Score = 63.5 bits (153), Expect = 4e-10
 Identities = 65/265 (24%), Positives = 109/265 (41%), Gaps = 34/265 (12%)
 Frame = +1

           +V ++TGAN GIG    R+L R+    V +  RD  +G +A  +++A+  + +    +LD

           + D +SIRA  +    E   L++L+NNAG+       T    +  + +            

Query: 649 XXXXKASAPARVVNLSSV--------------------------VHHAGKIRFHDLQGEK 750
                     RVVN+SS+                          +    K    D + E 

           H   G+   AY  SKL   + TR LA++L    +   +   A  PG V++++ R      

                  +  +T  EGA+T ++ AL
Sbjct: 238 ------DQGSRTVEEGAETPVYLAL 256

  Database: RefSeq49_MP.fasta
    Posted date:  Oct 17, 2011  1:42 PM
  Number of letters in database: 15,617,559
  Number of sequences in database:  30,036
Lambda     K      H
   0.318    0.134    0.401 

Lambda     K      H
   0.267   0.0410    0.140 

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 30036
Number of Hits to DB: 55,545,521
Number of extensions: 1592130
Number of successful extensions: 5760
Number of sequences better than 1.0e-05: 29
Number of HSP's gapped: 5714
Number of HSP's successfully gapped: 29
Length of query: 527
Length of database: 15,617,559
Length adjustment: 106
Effective length of query: 421
Effective length of database: 12,433,743
Effective search space: 5234605803
Effective search space used: 5234605803
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 36 (18.5 bits)

Search to RefSeqSP_Rel49

BLASTX 2.2.24 [Aug-08-2010]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 20110601C-002085
         (1583 letters)

Database: RefSeq49_SP.fasta 
           24,897 sequences; 11,343,932 total letters


                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

Alignment   gi|NP_001230331.1| retinol dehydrogenase 12 [Sus scrofa].            597   e-171
Alignment   gi|XP_001928802.1| PREDICTED: retinol dehydrogenase 11 [Sus scr...   425   e-119
Alignment   gi|XP_003125388.1| PREDICTED: retinol dehydrogenase 14-like [Su...   251   6e-67
Alignment   gi|XP_003125042.1| PREDICTED: retinol dehydrogenase 12-like [Su...   106   4e-23
Alignment   gi|XP_003126896.2| PREDICTED: WW domain-containing oxidoreducta...    79   5e-15
Alignment   gi|XP_003355526.1| PREDICTED: short-chain dehydrogenase/reducta...    65   8e-11
Alignment   gi|XP_003132810.1| PREDICTED: carbonyl reductase [NADPH] 3-like...    62   7e-10
Alignment   gi|XP_003358992.1| PREDICTED: carbonyl reductase [NADPH] 1-like...    60   3e-09
Alignment   gi|XP_003129386.2| PREDICTED: estradiol 17-beta-dehydrogenase 1...    60   4e-09
Alignment   gi|XP_003133511.1| PREDICTED: dehydrogenase/reductase SDR famil...    58   1e-08

>ref|NP_001230331.1| retinol dehydrogenase 12 [Sus scrofa].
          Length = 316

 Score =  597 bits (1540), Expect = e-171
 Identities = 301/316 (95%), Positives = 301/316 (95%)
 Frame = +1







>ref|XP_001928802.1| PREDICTED: retinol dehydrogenase 11 [Sus scrofa].
          Length = 316

 Score =  425 bits (1092), Expect = e-119
 Identities = 212/313 (67%), Positives = 247/313 (78%)
 Frame = +1

            M+ VL LL      LY+  P IRK  + GVC + +QLPGKV V+TGANTGIGKETA+ELA





Query: 1075 ERLWNVSCELLGI 1113
Sbjct: 301  RRLWDVSCDLLGI 313

>ref|XP_003125388.1| PREDICTED: retinol dehydrogenase 14-like [Sus scrofa].
          Length = 336

 Score =  251 bits (642), Expect = 6e-67
 Identities = 141/336 (41%), Positives = 201/336 (59%), Gaps = 19/336 (5%)
 Frame = +1

            AV T+ A L  L   L+        PS+++   GG    +  + GK V+ITGAN+G+G+ 

            TA EL R GARV + CRD  + E AA ++R + + ++             ++VR+LDL+ 

             +S+RAF +  L EE +L +LINNAG+  CPY KT DGFE    VN              

             K+SAP+R+V +SS ++  G I F DL  E+ YN+ F Y  SKLAN+LFTRELA+RL+GT

             VT   +HPGIV++ L RH  +  L+  LF+     F KT  EGAQTS++ A +  +E +

            SGKYF DCK   + P+A ++  A +LW++S  ++GI

>ref|XP_003125042.1| PREDICTED: retinol dehydrogenase 12-like [Sus scrofa].
          Length = 181

 Score =  106 bits (264), Expect = 4e-23
 Identities = 53/117 (45%), Positives = 80/117 (68%)
 Frame = +1

           C T+  L GK  V+TGAN+GIGK  ++ELARRGARV +ACR   +G+ A +EI+A T+++

           ++L+  +DLS   SIR+F +  L E  ++H+L+NNAGV   P ++T +G +     N

>ref|XP_003126896.2| PREDICTED: WW domain-containing oxidoreductase-like, partial [Sus
          Length = 163

 Score = 79.3 bits (194), Expect = 5e-15
 Identities = 58/154 (37%), Positives = 76/154 (49%), Gaps = 9/154 (5%)
 Frame = +1

           LH+L+ NA V   P+S T DG ET   VN                 SAPARVV +SS  H

                   +GK+ F  L      Y    AY  SKL N+LF+ EL +RL   GVT+ AVHP

           G ++ S L R  ++  LL+ L   F K+    ++

>ref|XP_003355526.1| PREDICTED: short-chain dehydrogenase/reductase family 9C member
           7-like [Sus scrofa].
          Length = 313

 Score = 65.5 bits (158), Expect = 8e-11
 Identities = 65/235 (27%), Positives = 101/235 (42%), Gaps = 5/235 (2%)
 Frame = +1

           C     L  K V ITG ++G G   AR+L  RG RV  AC      E  A +++ DT + 

           ++    LD++ T+SI+A A+    +  E+ L  L+NNAGV L        T + F   + 

           VN               K  A  RVVN+SS              G +    G  YC SK 

               F+  + + L   GV    + PG  ++ ++    L   + ++++R  +  R+

>ref|XP_003132810.1| PREDICTED: carbonyl reductase [NADPH] 3-like [Sus scrofa].
          Length = 277

 Score = 62.4 bits (150), Expect = 7e-10
 Identities = 65/265 (24%), Positives = 108/265 (40%), Gaps = 34/265 (12%)
 Frame = +1

           +V ++TGAN GIG   AR+L R+    V +  RD  +G +A  +++A+  + +    +LD

           + D +SIRA  +    E   L++L+NNAG+       T    +  + +            

Query: 649 XXXXKASAPARVVNLSSVVHHAG--------------------------KIRFHDLQGEK 750
                     RVVN+SS++                              K    D + E 

           H   G+   AY  SKL   + +R LA+RL    +   +   A  PG V++++        

                  +  +T  EGA T ++ AL
Sbjct: 238 ------GQGFETVEEGAVTPVYLAL 256

>ref|XP_003358992.1| PREDICTED: carbonyl reductase [NADPH] 1-like [Sus scrofa].
          Length = 281

 Score = 60.1 bits (144), Expect = 3e-09
 Identities = 35/106 (33%), Positives = 60/106 (56%), Gaps = 1/106 (0%)
 Frame = +1

           +V V+TG N GIG    R+L ++    V +  RDV +G++A  +++A+  + +    +LD

           + D +SI+A  +  L E   L++L+NNAG+      KT D    H+

>ref|XP_003129386.2| PREDICTED: estradiol 17-beta-dehydrogenase 11-like [Sus scrofa].
          Length = 313

 Score = 59.7 bits (143), Expect = 4e-09
 Identities = 69/243 (28%), Positives = 103/243 (42%), Gaps = 4/243 (1%)
 Frame = +1

           L VL LL   L F   T  S+ K F   + +    + G++V+ITGA  G+G+ TA E A+

              ++ +   +    E  A E +     +   V  +D SD + I + A+    E   + I

           L+NNAGV+      T+D F T                    KA  PA + N     +H  

            +      G        AYC SK A V F    T ELA  L+ TGV T  + P  + +  

Query: 886 VRH 894
Sbjct: 226 IKN 228

>ref|XP_003133511.1| PREDICTED: dehydrogenase/reductase SDR family member 9-like isoform
           1 [Sus scrofa].
          Length = 319

 Score = 58.2 bits (139), Expect = 1e-08
 Identities = 56/203 (27%), Positives = 93/203 (45%), Gaps = 5/203 (2%)
 Frame = +1

           K + ITG +TG G   AR   ++G  V  AC      ES ++ ++A+T + ++    LD+

           +D ++++  A+    +  EK L  LINNAG++  L P    T + +   + VN       

                   K  A  RV+N+SS+    G++ F           G  Y  SK A   F   L

            + ++  GV    + PG+ ++ L

  Database: RefSeq49_SP.fasta
    Posted date:  Oct 17, 2011  1:42 PM
  Number of letters in database: 11,343,932
  Number of sequences in database:  24,897
Lambda     K      H
   0.318    0.134    0.401 

Lambda     K      H
   0.267   0.0410    0.140 

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 24897
Number of Hits to DB: 41,629,131
Number of extensions: 1226204
Number of successful extensions: 4639
Number of sequences better than 1.0e-05: 24
Number of HSP's gapped: 4608
Number of HSP's successfully gapped: 24
Length of query: 527
Length of database: 11,343,932
Length adjustment: 104
Effective length of query: 423
Effective length of database: 8,754,644
Effective search space: 3703214412
Effective search space used: 3703214412
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 35 (18.1 bits)

Search to Sscrofa10_2

BLASTN 2.2.24 [Aug-08-2010]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 20110601C-002085
         (1583 letters)

Database: Sscrofa_10.2.fasta 
           4582 sequences; 2,808,509,378 total letters


                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

Sscrofa_Chr07                                                         963   0.0  
Sscrofa_ChrX                                                          262   5e-67

||          Length = 134764511

 Score =  963 bits (486), Expect = 0.0
 Identities = 552/567 (97%), Gaps = 6/567 (1%)
 Strand = Plus / Plus

Query: 1020     cagtgactgcaagagggcctgggtgtcgccaagggcccggaataacaaaacggccgagcg 1079
Sbjct: 97800133 cagtgactgcaagagggcctgggtgtcgccaagggcccggaataacaaaacggccgagcg 97800192

Query: 1080     cttgtggaacgtcagctgcgagctcctgggaatccagtgggagtagagctgctggaagat 1139
Sbjct: 97800193 cttgtggaacgtcagctgcgagctcctgggaatccagtgggagtagagctgctggaagat 97800252

Query: 1140     gcgcggctgtatcaagcctggtccaggccataacgcagaccggggagatggcccaccccg 1199
Sbjct: 97800253 gcgcggctgtatcaagcctggtccaggccataacgcagaccggggagatggcccaccccg 97800312

Query: 1200     aaggactgacctggctggctgctgtcccaaacacttccctgctttgattctcctgatcct 1259
Sbjct: 97800313 aaggactgacctggctggctgctgtcccaaacacttccctgctttgattctcctgatcct 97800372

Query: 1260     tggaaaacctccccacacctaaccctcttaccaggctgattctcggcataagaggttcat 1319
Sbjct: 97800373 tggaaaacctccccacacctaaccctcttaccaggctgattctcggcataagaggttcat 97800432

Query: 1320     acctggagagcatcgtccttgaagacttgcagagtcggccacctttctcggggcaagagg 1379
                ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 97800433 acctggagagcatcgtccttgaagacttgcagagtcggccacc-ttctcggggcaggagg 97800491

Query: 1380     actgggcagatgccaggctgggcacagggatggcagaggaaccctgggaaatgaagtcaa 1439
                ||||||||||||||||||||||||||||||||||||||||| ||||||||||  ||||||
Sbjct: 97800492 actgggcagatgccaggctgggcacagggatggcagaggaa-cctgggaaattgagtcaa 97800550

Query: 1440     tttccccacc-ataccagaaaacccagccagcaccctcgggaggtgtcagtgttacatat 1498
                ||||| |||| |||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 97800551 tttcctcaccaataccagaaaccccagccagcaccctcgggaggtgtcagtgttacatat 97800610

Query: 1499     tttcagggacatagactcaaacaccctga-cgatctctttnctcttngaanta-tagtct 1556
                ||||||||||||||||||||||| ||||| |||||||||| ||||| ||| || ||||||
Sbjct: 97800611 tttcagggacatagactcaaaca-cctgaccgatctctttcctctttgaaatattagtct 97800669

Query: 1557     gcagtctggactatgtggactaaaaaa 1583
                ||||||||||||||||||||| |||||
Sbjct: 97800670 gcagtctggactatgtggacttaaaaa 97800696

 Score =  440 bits (222), Expect = e-120
 Identities = 236/243 (97%)
 Strand = Plus / Plus

Query: 1        taggattctgggctacgctgagagccaggctgttgctgagcacccaggatcgagaagagg 60
Sbjct: 97788540 taggattctgggctacgctgagagccaggctgttgctgagcacccaggatcgagaagagg 97788599

Query: 61       cagaggaaagggaagcagagagaagcagccaagagttggagccagaccaggaggagcccg 120
Sbjct: 97788600 cagaggaaagggaagcagagagaagcagccaagagttggagccagaccaggaggagcccg 97788659

Query: 121      agtggagttgaagttccttttgcagaggcggcagcaagtaaagcagttgaaacgatgctg 180
Sbjct: 97788660 agtggagttgaagttccttttgcagaggcggcagcaagtaaagcagttgaaacgatgctg 97788719

Query: 181      gctgtcttgggactgctcacctccttccnnnnnnncctgtatgtgacagctccatccatc 240
                ||||||||||||||||||||||||||||       |||||||||||||||||||||||||
Sbjct: 97788720 gctgtcttgggactgctcacctccttcctttttttcctgtatgtgacagctccatccatc 97788779

Query: 241      agg 243
Sbjct: 97788780 agg 97788782

 Score =  420 bits (212), Expect = e-114
 Identities = 212/212 (100%)
 Strand = Plus / Plus

Query: 622      ggccacttccttctcacgcacttgctcttggagcagctgaaggcatctgctcccgcacgg 681
Sbjct: 97793310 ggccacttccttctcacgcacttgctcttggagcagctgaaggcatctgctcccgcacgg 97793369

Query: 682      gtggtgaacctgtcatccgtggtccaccatgctggcaagattcgcttccacgacctccag 741
Sbjct: 97793370 gtggtgaacctgtcatccgtggtccaccatgctggcaagattcgcttccacgacctccag 97793429

Query: 742      ggtgagaagcactacaaccggggttttgcttattgccacagcaagctggccaacgtgctc 801
Sbjct: 97793430 ggtgagaagcactacaaccggggttttgcttattgccacagcaagctggccaacgtgctc 97793489

Query: 802      tttactcgggaactggccaagaggctccaagg 833
Sbjct: 97793490 tttactcgggaactggccaagaggctccaagg 97793521

 Score =  381 bits (192), Expect = e-103
 Identities = 192/192 (100%)
 Strand = Plus / Plus

Query: 831      aggcacgggggtcaccacgtacgcagtgcacccaggcatcgtccagtctgagctggtccg 890
Sbjct: 97795667 aggcacgggggtcaccacgtacgcagtgcacccaggcatcgtccagtctgagctggtccg 97795726

Query: 891      gcattccttcctgctgtgcctgctctggcggctcttctcccgcttcctcaaaacagcgcg 950
Sbjct: 97795727 gcattccttcctgctgtgcctgctctggcggctcttctcccgcttcctcaaaacagcgcg 97795786

Query: 951      ggagggggcccagaccagcctgcactgcgccctggccgagggcctggagcccctgagcgg 1010
Sbjct: 97795787 ggagggggcccagaccagcctgcactgcgccctggccgagggcctggagcccctgagcgg 97795846

Query: 1011     caagtacttcag 1022
Sbjct: 97795847 caagtacttcag 97795858

 Score =  313 bits (158), Expect = 2e-82
 Identities = 158/158 (100%)
 Strand = Plus / Plus

Query: 360      aggagcccgagtatacattgcctgccgagatgtactgaagggggagtctgctgccagtga 419
Sbjct: 97791039 aggagcccgagtatacattgcctgccgagatgtactgaagggggagtctgctgccagtga 97791098

Query: 420      aatccgagctgatacaaagaactcccaggtgctggtgcggaaactggacctctctgatac 479
Sbjct: 97791099 aatccgagctgatacaaagaactcccaggtgctggtgcggaaactggacctctctgatac 97791158

Query: 480      caaatccatccgagcctttgctgagggctttctgacag 517
Sbjct: 97791159 caaatccatccgagcctttgctgagggctttctgacag 97791196

 Score =  242 bits (122), Expect = 5e-61
 Identities = 122/122 (100%)
 Strand = Plus / Plus

Query: 241      aggaagttctttgctggtggggtttgtaggacaaacatgcagcttcccgggaaggtggtg 300
Sbjct: 97790188 aggaagttctttgctggtggggtttgtaggacaaacatgcagcttcccgggaaggtggtg 97790247

Query: 301      gtgatcacgggtgccaacacgggcattggcaaggagacagccagagagctcgctcgcaga 360
Sbjct: 97790248 gtgatcacgggtgccaacacgggcattggcaaggagacagccagagagctcgctcgcaga 97790307

Query: 361      gg 362
Sbjct: 97790308 gg 97790309

 Score =  214 bits (108), Expect = 1e-52
 Identities = 108/108 (100%)
 Strand = Plus / Plus

Query: 516      agaggaaaagcagctccatattctgatcaacaatgctggagtgatgttgtgtccatattc 575
Sbjct: 97791851 agaggaaaagcagctccatattctgatcaacaatgctggagtgatgttgtgtccatattc 97791910

Query: 576      caagacagcggatggctttgagacccacctgggagtcaaccacctggg 623
Sbjct: 97791911 caagacagcggatggctttgagacccacctgggagtcaaccacctggg 97791958

 Score =  111 bits (56), Expect = 1e-21
 Identities = 92/104 (88%)
 Strand = Plus / Minus

Query: 515      cagaggaaaagcagctccatattctgatcaacaatgctggagtgatgttgtgtccatatt 574
                |||| |||||||| ||||| ||| ||||||||||||| ||||||||| ||||||| || |
Sbjct: 97744136 cagaagaaaagcatctccacattttgatcaacaatgcaggagtgatgatgtgtccttact 97744077

Query: 575      ccaagacagcggatggctttgagacccacctgggagtcaaccac 618
                |||||||||| || ||||||||||| ||| ||||||||||||||
Sbjct: 97744076 ccaagacagcagacggctttgagacgcacatgggagtcaaccac 97744033

 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

Query: 452      tggtgcggaaactggacctctctgataccaaatccatccgagcctttgctgagggctt 509
                |||||||||||||||||||  ||||||| ||||| || ||||| |||||| |||||||
Sbjct: 97745938 tggtgcggaaactggacctggctgatactaaatctattcgagcttttgctaagggctt 97745881

||          Length = 144288218

 Score =  262 bits (132), Expect = 5e-67
 Identities = 238/272 (87%), Gaps = 1/272 (0%)
 Strand = Plus / Plus

Query: 368      gagtatacattgcctgccgagatgtactgaagggggagtctgctgccagtgaaatccgag 427
                |||||| ||||||||||| ||||||| ||||| || |||  ||||||  ||||||| |||
Sbjct: 47505102 gagtattcattgcctgccaagatgtattgaagtggaagttggctgcccatgaaatctgag 47505161

Query: 428      ctgatacaaagaactcccaggtgctggtgcggaaactggacctctctgataccaaatcca 487
                ||||||||||||||||||||||||||||| ||||| ||||||| ||  ||||||||||||
Sbjct: 47505162 ctgatacaaagaactcccaggtgctggtgtggaaattggacctatccaataccaaatcca 47505221

Query: 488      tccgagcctttgctgagggctttctgacagag-gaaaagcagctccatattctgatcaac 546
                || |||| ||||||||| |||||||| ||| |  |||||||||||| ||||||||||| |
Sbjct: 47505222 tctgagcttttgctgagagctttctggcagtgcaaaaagcagctccgtattctgatcagc 47505281

Query: 547      aatgctggagtgatgttgtgtccatattccaagacagcggatggctttgagacccacctg 606
                ||  | ||||||||| ||||| |||||||||||||||| ||||||||||| |||||||||
Sbjct: 47505282 aacacaggagtgatgatgtgttcatattccaagacagccgatggctttgaaacccacctg 47505341

Query: 607      ggagtcaaccacctgggccacttccttctcac 638
                ||| |||||  |||||||||||||||||||||
Sbjct: 47505342 ggaatcaactgcctgggccacttccttctcac 47505373

 Score =  123 bits (62), Expect = 3e-25
 Identities = 225/278 (80%), Gaps = 1/278 (0%)
 Strand = Plus / Plus

Query: 853      gcagtgcacccaggcatcgtccagtctgagctggtccggcattccttcctgctgtgcctg 912
                |||| |||||||||||| || || ||||||||||||| ||| || ||||||||| |||||
Sbjct: 47505848 gcagagcacccaggcatagttcactctgagctggtccagcactcattcctgctgggcctg 47505907

Query: 913      ctctggcggctcttctcccgcttcctcaaaacagcgcgggagggggcccagaccagcctg 972
                ||||||| ||||||  ||  |||  ||||  ||| | | |||||| | | |||||| |||
Sbjct: 47505908 ctctggcagctctttgccacctttgtcaagtcagtgtgagaggggacacggaccagactg 47505967

Query: 973      cactgcgccctggccgagggcctggagcccctgagcggcaagtacttcagtgactgcaag 1032
                ||||||  |||||| ||| |||||||||||||||| | ||||   |||| ||||||||||
Sbjct: 47505968 cactgcatcctggctgagagcctggagcccctgagtgccaagggtttcaatgactgcaag 47506027

Query: 1033     agggcctgggtgtcgccaagggcccggaataacaaaacggccgagcgcttgtggaacgtc 1092
                ||| |  |||| || ||||||||| | | | || ||| | | ||| || ||||||| |||
Sbjct: 47506028 aggactggggtatctccaagggcctgaagtcac-aaatgtctgagagcctgtggaatgtc 47506086

Query: 1093     agctgcgagctcctgggaatccagtgggagtagagctg 1130
                ||||| ||||| || |||||||||||||||||||||||
Sbjct: 47506087 agctgtgagcttctaggaatccagtgggagtagagctg 47506124

 Score = 75.8 bits (38), Expect = 7e-11
 Identities = 41/42 (97%)
 Strand = Plus / Plus

Query: 72       gaagcagagagaagcagccaagagttggagccagaccaggag 113
                ||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 47504810 gaagcagagagaagcagccaagaattggagccagaccaggag 47504851

  Database: Sscrofa_10.2.fasta
    Posted date:  Nov 16, 2011 10:34 AM
  Number of letters in database: 2,808,509,378
  Number of sequences in database:  4582
Lambda     K      H
    1.37    0.711     1.31 

Lambda     K      H
    1.37    0.711     1.31 

Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4582
Number of Hits to DB: 42,810,151
Number of extensions: 318
Number of successful extensions: 318
Number of sequences better than 1.0e-05: 2
Number of HSP's gapped: 313
Number of HSP's successfully gapped: 14
Length of query: 1583
Length of database: 2,808,509,378
Length adjustment: 22
Effective length of query: 1561
Effective length of database: 2,808,408,574
Effective search space: 4383925784014
Effective search space used: 4383925784014
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 50 (99.1 bits)
S1: 18 (36.2 bits)
S2: 30 (60.0 bits)