Animal-Genome cDNA OVRT1_0146_C03

Search to RefSeqBP_Rel49

BLASTX 2.2.24 [Aug-08-2010]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= OVRT1_0146_C03
         (1362 letters)

Database: RefSeq49_BP.fasta 
           33,088 sequences; 17,681,374 total letters


                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

Alignment   gi|NP_899207.1| retinol dehydrogenase 12 [Bos taurus].               419   e-147
Alignment   gi|XP_002691025.1| PREDICTED: retinol dehydrogenase 11-like [Bo...   331   e-108
Alignment   gi|XP_582373.4| PREDICTED: retinol dehydrogenase 11 isoform 1 [...   331   e-108
Alignment   gi|NP_001068813.1| retinol dehydrogenase 13 [Bos taurus].            226   1e-66
Alignment   gi|NP_001068701.1| retinol dehydrogenase 14 [Bos taurus].            199   2e-59
Alignment   gi|NP_001069155.1| dehydrogenase/reductase SDR family member 13...   176   1e-57
Alignment   gi|NP_001071560.1| WW domain-containing oxidoreductase [Bos tau...   145   8e-42
Alignment   gi|NP_001095361.1| hypothetical protein LOC507942 [Bos taurus].      146   8e-39
Alignment   gi|XP_591168.4| PREDICTED: dehydrogenase/reductase (SDR family)...   101   2e-25
Alignment   gi|NP_001093783.1| dehydrogenase/reductase SDR family member 12...   103   4e-22

>ref|NP_899207.1| retinol dehydrogenase 12 [Bos taurus].
          Length = 316

 Score =  419 bits (1077), Expect(3) = e-147
 Identities = 214/248 (86%), Positives = 222/248 (89%)
 Frame = +2





Query: 935 FLKTAREG 958
           FLKT  EG
Sbjct: 254 FLKTTWEG 261

 Score =  118 bits (296), Expect(3) = e-147
 Identities = 53/56 (94%), Positives = 55/56 (98%)
 Frame = +1


 Score = 25.4 bits (54), Expect(3) = e-147
 Identities = 12/14 (85%), Positives = 12/14 (85%)
 Frame = +1

           ML VLGLLTSFL F

>ref|XP_002691025.1| PREDICTED: retinol dehydrogenase 11-like [Bos taurus].
          Length = 338

 Score =  331 bits (848), Expect(2) = e-108
 Identities = 163/249 (65%), Positives = 193/249 (77%)
 Frame = +2



           YSKTADGFE H+GVN               + SAP+RVVN+SS+ H  G+I FH+LQGEK


Query: 932 RFLKTAREG 958
            F+KT ++G
Sbjct: 253 FFIKTPQQG 261

 Score = 82.0 bits (201), Expect(2) = e-108
 Identities = 38/53 (71%), Positives = 43/53 (81%)
 Frame = +1


>ref|XP_582373.4| PREDICTED: retinol dehydrogenase 11 isoform 1 [Bos taurus].
          Length = 338

 Score =  331 bits (848), Expect(2) = e-108
 Identities = 163/249 (65%), Positives = 193/249 (77%)
 Frame = +2



           YSKTADGFE H+GVN               + SAP+RVVN+SS+ H  G+I FH+LQGEK


Query: 932 RFLKTAREG 958
            F+KT ++G
Sbjct: 253 FFIKTPQQG 261

 Score = 82.0 bits (201), Expect(2) = e-108
 Identities = 38/53 (71%), Positives = 43/53 (81%)
 Frame = +1


>ref|NP_001068813.1| retinol dehydrogenase 13 [Bos taurus].
          Length = 335

 Score =  226 bits (577), Expect(2) = 1e-66
 Identities = 117/221 (52%), Positives = 150/221 (67%), Gaps = 1/221 (0%)
 Frame = +2

           ++ F AGG C +   +PGK V++TGANTGIGK+TA ELA+RG  + +ACRD+ K E+AA 

           EIR +T N +V  R LDL+  KSIR FA     EE+ +HILINNA VM CP+  T DGFE

             LGVN               KASAP+R++N+SS+ H AG I F DL  EK  Y+   AY

           C SKLA V+ T+EL++RLQGTGVT  A+HPG+ ++EL RH+

 Score = 46.6 bits (109), Expect(2) = 1e-66
 Identities = 23/53 (43%), Positives = 34/53 (64%)
 Frame = +1

            AQ S++ A+AE LE +SGKYF   K    +P A + + A+RLW  S  L+G++

>ref|NP_001068701.1| retinol dehydrogenase 14 [Bos taurus].
          Length = 336

 Score =  199 bits (507), Expect(2) = 2e-59
 Identities = 111/244 (45%), Positives = 149/244 (61%), Gaps = 17/244 (6%)
 Frame = +2

           GK V+ITGAN+G+G+ TA EL R GARV + CRD  + E AA ++R +           N

           S    +++V++LDL+   S+R+F +  L EE +L +LINNAGV  CPY KT DGFE   G

           VN               K+SAP+R+V +SS ++  G I F DL  E+ YN+ F Y  SKL

           AN+LFTRELA+RL+GT VT   +HPGIV++ L RH  +  L+  LF+     F KT  EG

Query: 959 PRPA 970
            + A
Sbjct: 283 AQTA 286

 Score = 49.7 bits (117), Expect(2) = 2e-59
 Identities = 21/53 (39%), Positives = 36/53 (67%)
 Frame = +1

            GAQT+++ A +  +E +SG+YF DCK   + P+A +   A +LW++S  ++GI

>ref|NP_001069155.1| dehydrogenase/reductase SDR family member 13 precursor [Bos
          Length = 377

 Score =  176 bits (445), Expect(2) = 1e-57
 Identities = 104/215 (48%), Positives = 135/215 (62%), Gaps = 5/215 (2%)
 Frame = +2

           CR    L G+  V+TGAN+GIGK TA ELARRGARV +ACR   +GE+AA ++R ++ N+

           +V+   LDL+   S+RAFA  FL+ E +L ILI+NAG+  C   +T + F   L VN   

                       K SAP+RVV +SS  H  G++ F    H + G +   R  AY +SKLA


 Score = 67.4 bits (163), Expect(2) = 1e-57
 Identities = 30/54 (55%), Positives = 40/54 (74%)
 Frame = +1

            GGAQT L+CAL EG+EPLSG+YF++C    V P AR+++ A RLW  S +L G+

>ref|NP_001071560.1| WW domain-containing oxidoreductase [Bos taurus].
          Length = 414

 Score =  145 bits (366), Expect(2) = 8e-42
 Identities = 97/257 (37%), Positives = 137/257 (53%), Gaps = 13/257 (5%)
 Frame = +2

           T P+ R+ + G      +     L GKVVV+TGAN+GIG ETA+  A  GA V +ACR++

            +   A S I  +   ++V    LDL+  +S++ FA+ F  +   LH+L+ NA V   P+

           + T DG ET   VN                 SAPARVV +SS  H        +GK+ F 

            L   K+ Y    AY  SKL N+LF+ EL +RL   GVT+ AVHPG ++ S L R  ++ 

            LL+ L   F K+ ++G

 Score = 44.7 bits (104), Expect(2) = 8e-42
 Identities = 22/51 (43%), Positives = 31/51 (60%)
 Frame = +1

            GA T+++CA+A  LE L G YF+ C R   S  A++  +A  LW +S  LL

>ref|NP_001095361.1| hypothetical protein LOC507942 [Bos taurus].
          Length = 330

 Score =  146 bits (368), Expect(2) = 8e-39
 Identities = 92/245 (37%), Positives = 140/245 (57%), Gaps = 4/245 (1%)
 Frame = +2

           KF+   +   +  L GK  V+TGAN+GIGK  ++ELA RGARV +ACR   +G+ A +EI

           +A +K++++L+ ++DLS   SIR+FA+  L E  ++H+L+NNA V   P + T +G +  

              N               + +  ARVVN+SS     G I    L G      +N+   Y

             SKL    FT +LA+RLQGT VT  +V PG+V +++++H S+    L+ L S F K ++

Query: 953 EGPRP 967
           +G  P
Sbjct: 272 QGAVP 276

 Score = 33.9 bits (76), Expect(2) = 8e-39
 Identities = 20/59 (33%), Positives = 32/59 (54%), Gaps = 1/59 (1%)
 Frame = +1

            ++S  GA   L+ +LA+ L+ +SGK+F S C        A++   A+ LWN S  L  +

>ref|XP_591168.4| PREDICTED: dehydrogenase/reductase (SDR family) X-linked [Bos
          Length = 237

 Score =  101 bits (251), Expect(2) = 2e-25
 Identities = 61/146 (41%), Positives = 79/146 (54%), Gaps = 6/146 (4%)
 Frame = +2

           +SIR F + F  ++  LH+L+NNAGVM+ P   T DGFE H GVN               

           + S AP   ARVV +SS  H+ G++   DLQ   +Y+   AY  SKLA VLFT  L   L

             QG  VT     PG+V ++L R+ F

 Score = 34.3 bits (77), Expect(2) = 2e-25
 Identities = 20/59 (33%), Positives = 29/59 (49%), Gaps = 3/59 (5%)
 Frame = +1

            GA TS++ A+   LE L G+Y  + K         + +   +LW  SC+L GI    WE

>ref|NP_001093783.1| dehydrogenase/reductase SDR family member 12 [Bos taurus].
          Length = 317

 Score =  103 bits (257), Expect = 4e-22
 Identities = 67/208 (32%), Positives = 103/208 (49%), Gaps = 1/208 (0%)
 Frame = +2

           +Q+PG+  ++TG N+GIGK TA E+A+RG  V++ CRD  + E A +EI  ++ N  + +

             +DLS  KS+  F E F  +E  L++LINNAG M+     T DG E +   N       

                   +     RV+ +SS      K+   D Q E+  ++    Y  +K   V+ T  

            A+      +    +HPG V +  VR S

  Database: RefSeq49_BP.fasta
    Posted date:  Oct 17, 2011  1:42 PM
  Number of letters in database: 17,681,374
  Number of sequences in database:  33,088
Lambda     K      H
   0.318    0.134    0.401 

Lambda     K      H
   0.267   0.0410    0.140 

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 33088
Number of Hits to DB: 53,693,083
Number of extensions: 1533300
Number of successful extensions: 5450
Number of sequences better than 1.0e-05: 26
Number of HSP's gapped: 5414
Number of HSP's successfully gapped: 37
Length of query: 454
Length of database: 17,681,374
Length adjustment: 106
Effective length of query: 348
Effective length of database: 14,174,046
Effective search space: 4932568008
Effective search space used: 4932568008
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 35 (18.1 bits)
Animal-Genome cDNA OVRT1_0146_C03

Animal-Genome cDNA OVRT1_0146_C03

Search to RefSeqHP_Rel49

BLASTX 2.2.24 [Aug-08-2010]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= OVRT1_0146_C03
         (1362 letters)

Database: RefSeq49_HP.fasta 
           32,964 sequences; 18,297,164 total letters


                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

Alignment   gi|NP_689656.2| retinol dehydrogenase 12 [Homo sapiens].             424   e-148
Alignment   gi|NP_057110.3| retinol dehydrogenase 11 [Homo sapiens].             350   e-114
Alignment   gi|NP_001139443.1| retinol dehydrogenase 13 isoform 1 [Homo sap...   225   6e-66
Alignment   gi|NP_065956.1| retinol dehydrogenase 14 [Homo sapiens].             202   1e-60
Alignment   gi|NP_653284.2| dehydrogenase/reductase SDR family member 13 pr...   166   4e-55
Alignment   gi|NP_612421.1| retinol dehydrogenase 13 isoform 2 [Homo sapien...   162   4e-47
Alignment   gi|NP_057457.1| WW domain-containing oxidoreductase isoform 1 [...   143   4e-42
Alignment   gi|NP_001186032.1| NT5C1B-RDH14 protein isoform 1 [Homo sapiens].    137   5e-41
Alignment   gi|NP_660160.2| dehydrogenase/reductase SDR family member on ch...   142   2e-38
Alignment   gi|NP_003699.3| retinol dehydrogenase 16 [Homo sapiens].              65   1e-10

>ref|NP_689656.2| retinol dehydrogenase 12 [Homo sapiens].
          Length = 316

 Score =  424 bits (1089), Expect(3) = e-148
 Identities = 214/250 (85%), Positives = 222/250 (88%)
 Frame = +2





Query: 929 SRFLKTAREG 958
           S F+KTAREG
Sbjct: 252 SPFVKTAREG 261

 Score =  119 bits (299), Expect(3) = e-148
 Identities = 54/56 (96%), Positives = 55/56 (98%)
 Frame = +1


 Score = 22.3 bits (46), Expect(3) = e-148
 Identities = 10/14 (71%), Positives = 10/14 (71%)
 Frame = +1

           ML  LGLLTSF  F

>ref|NP_057110.3| retinol dehydrogenase 11 [Homo sapiens].
          Length = 318

 Score =  350 bits (898), Expect(2) = e-114
 Identities = 170/249 (68%), Positives = 200/249 (80%)
 Frame = +2



           YSKTADGFE H+GVN               K SAP+R+VN+SS+ HH G+I FH+LQGEK


Query: 932 RFLKTAREG 958
            F+KT ++G
Sbjct: 255 FFIKTPQQG 263

 Score = 82.8 bits (203), Expect(2) = e-114
 Identities = 38/53 (71%), Positives = 43/53 (81%)
 Frame = +1


>ref|NP_001139443.1| retinol dehydrogenase 13 isoform 1 [Homo sapiens].
          Length = 331

 Score =  225 bits (574), Expect(2) = 6e-66
 Identities = 115/221 (52%), Positives = 150/221 (67%), Gaps = 1/221 (0%)
 Frame = +2

           ++ +  GG C +   +PGK V++TGANTGIGK+TA ELARRG  + +ACRD+ K E+AA 

           +IR +T N  V  R LDL+  KSIR FA   + EE+++ ILINNAGVM CP+  T DGFE

              GVN               KASAP+R++NLSS+ H AG I F DL  + + YN   AY

           C SKLA VLFT+EL++RLQG+GVT  A+HPG+ ++EL RH+

 Score = 45.4 bits (106), Expect(2) = 6e-66
 Identities = 22/53 (41%), Positives = 32/53 (60%)
 Frame = +1

            AQ S + A+AE L  +SGKYF   K+   +P A + + A RLW  S  L+G++

>ref|NP_065956.1| retinol dehydrogenase 14 [Homo sapiens].
          Length = 336

 Score =  202 bits (514), Expect(2) = 1e-60
 Identities = 109/240 (45%), Positives = 148/240 (61%), Gaps = 17/240 (7%)
 Frame = +2

           GK V+ITGAN+G+G+ TA EL R GARV + CRD  + E AA ++R + + +        

                +++VR+LDL+  +S+RAF +  L EE +L +LINNAG+  CPY KT DGFE   G

           VN               K+SAP+R+V +SS ++  G I F DL  E+ YN+ F Y  SKL

           AN+LFTRELA+RL+GT VT   +HPGIV++ L RH  +  L+  LF+     F KT  EG

 Score = 50.4 bits (119), Expect(2) = 1e-60
 Identities = 21/53 (39%), Positives = 36/53 (67%)
 Frame = +1

            GAQTS++ A +  +E +SG+YF DCK   + P+A +   A +LW++S  ++G+

>ref|NP_653284.2| dehydrogenase/reductase SDR family member 13 precursor [Homo
          Length = 377

 Score =  166 bits (419), Expect(2) = 4e-55
 Identities = 99/209 (47%), Positives = 130/209 (62%), Gaps = 5/209 (2%)
 Frame = +2

           L G+  V+TGAN+GIGK TA ELARRGARV +ACR   +GE+AA ++R ++ N++V+   

           LDL+   S+RAFA  FL+ E +L ILI+NAG+  C   +T + F   L VN         

                 KA AP+RVV ++S  H  G++ F  L     G +   R  AY  +KLANVLF R

           ELA +L+ TGVT YA HPG V SEL +RH

 Score = 68.9 bits (167), Expect(2) = 4e-55
 Identities = 35/81 (43%), Positives = 47/81 (58%)
 Frame = +1

            GGAQT L+CAL EG+EPLSG+YF++C    V P AR+++ A RLW  S  L G+      

                     GPG +A+  + P
Sbjct: 314  ---------GPGEDAEPDEDP 325

>ref|NP_612421.1| retinol dehydrogenase 13 isoform 2 [Homo sapiens].
          Length = 260

 Score =  162 bits (410), Expect(2) = 4e-47
 Identities = 87/168 (51%), Positives = 111/168 (66%), Gaps = 1/168 (0%)
 Frame = +2

           K E+AA +IR +T N  V  R LDL+  KSIR FA   + EE+++ ILINNAGVM CP+ 

            T DGFE   GVN               KASAP+R++NLSS+ H AG I F DL  + + 


 Score = 45.4 bits (106), Expect(2) = 4e-47
 Identities = 22/53 (41%), Positives = 32/53 (60%)
 Frame = +1

            AQ S + A+AE L  +SGKYF   K+   +P A + + A RLW  S  L+G++

>ref|NP_057457.1| WW domain-containing oxidoreductase isoform 1 [Homo sapiens].
          Length = 414

 Score =  143 bits (361), Expect(2) = 4e-42
 Identities = 95/257 (36%), Positives = 134/257 (52%), Gaps = 13/257 (5%)
 Frame = +2

           T P+ R+ + G      +       GKVVV+TGAN+GIG ETA+  A  GA V +ACR++

            +   A S I  +   ++V    LDL+  +S++ FAE F  +   LH+L+ NA     P+

           S T DG ET   VN                 SAPARV+ +SS  H         GK+ F 

            L   K+ Y    AY  SKL N+LF+ EL +RL   GVT+ AVHPG ++ S + R  ++ 

            LL+ L   F K+ ++G

 Score = 47.8 bits (112), Expect(2) = 4e-42
 Identities = 22/51 (43%), Positives = 32/51 (62%)
 Frame = +1

            GA T+++CA    LE L G YF++C R   SP A++ +TA  LW +S  L+

>ref|NP_001186032.1| NT5C1B-RDH14 protein isoform 1 [Homo sapiens].
          Length = 650

 Score =  137 bits (344), Expect(2) = 5e-41
 Identities = 73/151 (48%), Positives = 93/151 (61%), Gaps = 4/151 (2%)
 Frame = +2

           EE +L +LINNAG+  CPY KT DGFE   GVN               K+SAP+R+V +S

           S ++  G I F DL  E+ YN+ F Y  SKLAN+LFTRELA+RL+GT VT   +HPGIV+

           + L RH  +  L+  LF+     F KT  EG

 Score = 50.4 bits (119), Expect(2) = 5e-41
 Identities = 21/53 (39%), Positives = 36/53 (67%)
 Frame = +1

            GAQTS++ A +  +E +SG+YF DCK   + P+A +   A +LW++S  ++G+

>ref|NP_660160.2| dehydrogenase/reductase SDR family member on chromosome X precursor
           [Homo sapiens].
          Length = 330

 Score =  142 bits (357), Expect(2) = 2e-38
 Identities = 91/236 (38%), Positives = 121/236 (51%), Gaps = 12/236 (5%)
 Frame = +2

           P +V ++TG   GIG  TA+ LAR G  V IA  +  K +   S+I+ +T N +V     

           DL+   SIR F + F  ++  LH+LINNAGVM+ P  KT DGFE H G+N          

                K S      ARVV +SS  H+  ++   DLQ    Y+   AY  SKLA VLFT  

           L + L  +G+ VT   V PG+V +++ +H F    L      W LF    KT  EG

 Score = 36.6 bits (83), Expect(2) = 2e-38
 Identities = 18/53 (33%), Positives = 28/53 (52%)
 Frame = +1

            GA TS++ A+   LE + G Y  + K         N K  ++LW+ SCE+ G+

>ref|NP_003699.3| retinol dehydrogenase 16 [Homo sapiens].
          Length = 317

 Score = 65.1 bits (157), Expect = 1e-10
 Identities = 67/229 (29%), Positives = 95/229 (41%), Gaps = 5/229 (2%)
 Frame = +2

           L  K V ITG ++G GK  AR+L  RG RV  AC      E  A ++R  T +    V  

           LD++ T+S+ A A+       +K L  L+NNAG+ L        T   F T L VN    

                      +  A  RVVN+SSV+   G++             G  YC SK     F+

             L + L   GV    + PG  ++ +      L     ++ R     +E

  Database: RefSeq49_HP.fasta
    Posted date:  Oct 17, 2011  1:42 PM
  Number of letters in database: 18,297,164
  Number of sequences in database:  32,964
Lambda     K      H
   0.318    0.134    0.401 

Lambda     K      H
   0.267   0.0410    0.140 

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 32964
Number of Hits to DB: 54,672,432
Number of extensions: 1522616
Number of successful extensions: 5441
Number of sequences better than 1.0e-05: 28
Number of HSP's gapped: 5407
Number of HSP's successfully gapped: 38
Length of query: 454
Length of database: 18,297,164
Length adjustment: 106
Effective length of query: 348
Effective length of database: 14,802,980
Effective search space: 5151437040
Effective search space used: 5151437040
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 36 (18.5 bits)

Search to RefSeqCP_Rel49

BLASTX 2.2.24 [Aug-08-2010]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= OVRT1_0146_C03
         (1362 letters)

Database: RefSeq49_CP.fasta 
           33,336 sequences; 18,874,504 total letters


                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

Alignment   gi|XP_547866.2| PREDICTED: similar to retinol dehydrogenase 12 ...   412   e-144
Alignment   gi|XP_854354.1| PREDICTED: similar to Retinol dehydrogenase 11 ...   329   e-107
Alignment   gi|XP_854127.1| PREDICTED: similar to Retinol dehydrogenase 13 ...   231   2e-68
Alignment   gi|XP_540096.2| PREDICTED: similar to retinol dehydrogenase 14 ...   200   3e-60
Alignment   gi|XP_548293.2| PREDICTED: similar to retinol dehydrogenase 11 ...   167   1e-54
Alignment   gi|XP_857582.1| PREDICTED: similar to retinol dehydrogenase 14 ...   146   3e-44
Alignment   gi|XP_533000.2| PREDICTED: similar to Retinol dehydrogenase 12 ...   154   7e-42
Alignment   gi|XP_852623.1| PREDICTED: similar to WW domain-containing oxid...   144   2e-34
Alignment   gi|XP_852222.1| PREDICTED: similar to dehydrogenase/reductase (...   142   6e-34
Alignment   gi|XP_857503.1| PREDICTED: similar to retinol dehydrogenase 14 ...    70   6e-12

>ref|XP_547866.2| PREDICTED: similar to retinol dehydrogenase 12 (all-trans and
           9-cis) [Canis familiaris].
          Length = 303

 Score =  412 bits (1058), Expect(2) = e-144
 Identities = 206/239 (86%), Positives = 215/239 (89%)
 Frame = +2





 Score =  119 bits (299), Expect(2) = e-144
 Identities = 54/56 (96%), Positives = 56/56 (100%)
 Frame = +1


>ref|XP_854354.1| PREDICTED: similar to Retinol dehydrogenase 11 (Retinal reductase
           1) (RalR1) (Prostate short-chain dehydrogenase/reductase
           1) (Androgen-regulated short-chain
           dehydrogenase/reductase 1) (HCV core-binding protein
           HCBP12) [Canis familiaris].
          Length = 337

 Score =  329 bits (843), Expect(2) = e-107
 Identities = 159/240 (66%), Positives = 191/240 (79%)
 Frame = +2



            H+GVN               K SAP+R+VN+SS+ HH G+I FHDLQGEK YN G AYC


 Score = 80.9 bits (198), Expect(2) = e-107
 Identities = 37/53 (69%), Positives = 43/53 (81%)
 Frame = +1


>ref|XP_854127.1| PREDICTED: similar to Retinol dehydrogenase 13 [Canis familiaris].
          Length = 334

 Score =  231 bits (590), Expect(2) = 2e-68
 Identities = 118/221 (53%), Positives = 151/221 (68%), Gaps = 1/221 (0%)
 Frame = +2

           +R + AGG C +   +PGK V++TGANTGIGK+TA ELARRG  + +ACRD+ K E+AA 

           EIR +T N +V    LDL+  KSIR FA   + EE+Q+HIL+NNA VM CP+  T DGFE

              GVN               KASAP+R++NLSS+ H AG I F DL  EK  Y+   AY

           C SKLA +LFT+EL++RLQGTGVT  A+HPG+ ++EL RH+

 Score = 47.8 bits (112), Expect(2) = 2e-68
 Identities = 23/53 (43%), Positives = 33/53 (62%)
 Frame = +1

            AQ S + A+AE LE +SGKYF   K    +P A + + A+RLW  S  L+G++

>ref|XP_540096.2| PREDICTED: similar to retinol dehydrogenase 14 (all-trans and
           9-cis) isoform 1 [Canis familiaris].
          Length = 336

 Score =  200 bits (508), Expect(2) = 3e-60
 Identities = 111/259 (42%), Positives = 154/259 (59%), Gaps = 17/259 (6%)
 Frame = +2

           P +++   GG    +  + GK V+ITGAN+G+G+ TA  L R GARV + CRD  + E A

           A ++R + + +             +++VR+LDL+  +S+RAF +  L EE +L +LINNA

           G+  CPY KT DGFE   GVN               K SAP+R+V +SS ++  G I F 

           DL  E+ YN+ F Y  SKLAN+LFTRELA+RL+GT VT   +HPGIV++ L RH  +  L

Query: 914 LWRLFS----RFLKTAREG 958
           +  LF+     F KT  EG

 Score = 52.0 bits (123), Expect(2) = 3e-60
 Identities = 23/53 (43%), Positives = 36/53 (67%)
 Frame = +1

            GAQTS++ A +  +E +SGKYF DCK   + P+A +   A +LW++S  ++GI

>ref|XP_548293.2| PREDICTED: similar to retinol dehydrogenase 11 (predicted) [Canis
          Length = 377

 Score =  167 bits (423), Expect(2) = 1e-54
 Identities = 109/238 (45%), Positives = 139/238 (58%), Gaps = 7/238 (2%)
 Frame = +2

           C     L G+  V+TGAN+GIGK TA ELARRGARV +ACR   +GE+AA ++R ++ N+

           +V+   LDL+   S+RAFA  FL+ E +L ILI+NAG+  C   +T   F   L VN   

                       K  AP+RVV +SS  H  G++ F  L     G +   R  AY  SKLA

           NVLF RELA +L+GTGVT YA HPG V SEL +RH   +L  LL  L    L+  R G

 Score = 65.5 bits (158), Expect(2) = 1e-54
 Identities = 29/54 (53%), Positives = 39/54 (72%)
 Frame = +1

            GGAQT L+CAL EG+EPLSG+YF++C    V P AR+++ A +LW  S  L G+

>ref|XP_857582.1| PREDICTED: similar to retinol dehydrogenase 14 (all-trans and
           9-cis) isoform 4 [Canis familiaris].
          Length = 307

 Score =  146 bits (369), Expect(2) = 3e-44
 Identities = 93/259 (35%), Positives = 133/259 (51%), Gaps = 17/259 (6%)
 Frame = +2

           P +++   GG    +  + GK V+ITGAN+G+G+ TA  L R GARV + CRD  + E A

           A ++R + + +             +++VR+LDL+  +S+RAF +  L             

                             GVN               K SAP+R+V +SS ++  G I F 

           DL  E+ YN+ F Y  SKLAN+LFTRELA+RL+GT VT   +HPGIV++ L RH  +  L

Query: 914 LWRLFS----RFLKTAREG 958
           +  LF+     F KT  EG

 Score = 52.0 bits (123), Expect(2) = 3e-44
 Identities = 23/53 (43%), Positives = 36/53 (67%)
 Frame = +1

            GAQTS++ A +  +E +SGKYF DCK   + P+A +   A +LW++S  ++GI

>ref|XP_533000.2| PREDICTED: similar to Retinol dehydrogenase 12 [Canis familiaris].
          Length = 596

 Score =  154 bits (388), Expect(2) = 7e-42
 Identities = 95/236 (40%), Positives = 137/236 (58%), Gaps = 2/236 (0%)
 Frame = +2

            C T+  L GK  V+TGAN+GIGK   +ELARRGARV +ACR+  +G+ A +EI+  +K +

             +L+ ++DLS   SIR+FA   L E  ++H+L+NNA +   P + T +G +     N   

                        + +  ARVVN+SS  H  G +    L G  K  N   +Y  SKL    

            FT ELA+RLQGTGVT  +V PG+V +E+++ + +L   L+ LFS F K  ++G  P

 Score = 36.6 bits (83), Expect(2) = 7e-42
 Identities = 20/54 (37%), Positives = 32/54 (59%), Gaps = 1/54 (1%)
 Frame = +1

            GA   L+ +LA+ L+ +SGKYF S C     +  A++ + A+ LWN S +L  +

>ref|XP_852623.1| PREDICTED: similar to WW domain-containing oxidoreductase isoform 1
           [Canis familiaris].
          Length = 383

 Score =  144 bits (363), Expect = 2e-34
 Identities = 95/253 (37%), Positives = 134/253 (52%), Gaps = 13/253 (5%)
 Frame = +2

           T P+ R+ + GG     +       GKVVV+TGAN+GIG ETA+  A  GA V +ACR++

            +   A S+I  +   ++V    LDL+  +S++ FA+ F  +   LH+L+ NA     P+

           S T DG ET   VN                 SAPARVV +SS  H        +GK+ F 

            L   K  Y    AY  SKL N+LF+ EL +RL   GVT+ AVHPG ++ S + R+ ++ 

Query: 908 CLLWRLFSRFLKT 946
            LL+ L   F K+
Sbjct: 339 TLLFTLARPFTKS 351

>ref|XP_852222.1| PREDICTED: similar to dehydrogenase/reductase (SDR family) X-linked
           [Canis familiaris].
          Length = 387

 Score =  142 bits (359), Expect = 6e-34
 Identities = 93/232 (40%), Positives = 124/232 (53%), Gaps = 8/232 (3%)
 Frame = +2

           P +V ++TG   GIG  TA+ LAR G  V +A  +         +I+ +T N +V     

           DL+  +SIR F + F  ++  LH+L+NNAGVM+ P   T DGFE H G+N          

                K S AP   ARVV +SS  H+ G++   DLQG + Y+   AY  SKLA VLFT  

           L + L  QG+ VT   V PG+V + L RH F    L+ +LF   F KT  EG

>ref|XP_857503.1| PREDICTED: similar to retinol dehydrogenase 14 (all-trans and
           9-cis) isoform 3 [Canis familiaris].
          Length = 153

 Score = 69.7 bits (169), Expect = 6e-12
 Identities = 39/111 (35%), Positives = 63/111 (56%), Gaps = 13/111 (11%)
 Frame = +2

           P +++   GG    +  + GK V+ITGAN+G+G+ TA  L R GARV + CRD  + E A

           A ++R + + +             +++VR+LDL+  +S+RAF +  L   K

  Database: RefSeq49_CP.fasta
    Posted date:  Oct 17, 2011  1:42 PM
  Number of letters in database: 18,874,504
  Number of sequences in database:  33,336
Lambda     K      H
   0.318    0.134    0.401 

Lambda     K      H
   0.267   0.0410    0.140 

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 33336
Number of Hits to DB: 55,730,960
Number of extensions: 1551610
Number of successful extensions: 5952
Number of sequences better than 1.0e-05: 25
Number of HSP's gapped: 5913
Number of HSP's successfully gapped: 35
Length of query: 454
Length of database: 18,874,504
Length adjustment: 106
Effective length of query: 348
Effective length of database: 15,340,888
Effective search space: 5338629024
Effective search space used: 5338629024
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 36 (18.5 bits)
Animal-Genome cDNA OVRT1_0146_C03

Animal-Genome cDNA OVRT1_0146_C03

Search to RefSeqMP_Rel49

BLASTX 2.2.24 [Aug-08-2010]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= OVRT1_0146_C03
         (1362 letters)

Database: RefSeq49_MP.fasta 
           30,036 sequences; 15,617,559 total letters


                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

Alignment   gi|NP_084293.1| retinol dehydrogenase 12 [Mus musculus].             390   e-136
Alignment   gi|NP_067532.2| retinol dehydrogenase 11 [Mus musculus].             341   e-111
Alignment   gi|NP_780581.1| retinol dehydrogenase 13 [Mus musculus].             221   4e-65
Alignment   gi|NP_076186.1| retinol dehydrogenase 14 [Mus musculus].             204   9e-62
Alignment   gi|NP_899109.2| dehydrogenase/reductase SDR family member 13 pr...   167   1e-55
Alignment   gi|NP_062519.2| WW domain-containing oxidoreductase [Mus muscul...   141   2e-41
Alignment   gi|NP_001028498.2| dehydrogenase/reductase SDR family member on...   144   3e-37
Alignment   gi|NP_079798.2| dehydrogenase/reductase SDR family member 7 pre...    69   9e-12
Alignment   gi|NP_780721.1| dehydrogenase/reductase SDR family member 9 pre...    64   4e-10
Alignment   gi|NP_766635.1| carbonyl reductase 3 [Mus musculus].                  59   7e-09

>ref|NP_084293.1| retinol dehydrogenase 12 [Mus musculus].
          Length = 316

 Score =  390 bits (1001), Expect(2) = e-136
 Identities = 197/247 (79%), Positives = 211/247 (85%)
 Frame = +2





Query: 938 LKTAREG 958
            K+  +G
Sbjct: 255 FKSTSQG 261

 Score =  113 bits (283), Expect(2) = e-136
 Identities = 52/61 (85%), Positives = 56/61 (91%)
 Frame = +1


Query: 1120 E 1122
Sbjct: 316  E 316

>ref|NP_067532.2| retinol dehydrogenase 11 [Mus musculus].
          Length = 316

 Score =  341 bits (874), Expect(2) = e-111
 Identities = 166/249 (66%), Positives = 199/249 (79%)
 Frame = +2



           YSKTADGFE H+GVN               K SAP+R+VNLSS+ HH G+I FH+LQGEK


Query: 932 RFLKTAREG 958
            F+KT +EG
Sbjct: 252 VFIKTPQEG 260

 Score = 79.3 bits (194), Expect(2) = e-111
 Identities = 36/53 (67%), Positives = 43/53 (81%)
 Frame = +1


>ref|NP_780581.1| retinol dehydrogenase 13 [Mus musculus].
          Length = 334

 Score =  221 bits (562), Expect(2) = 4e-65
 Identities = 113/221 (51%), Positives = 149/221 (67%), Gaps = 1/221 (0%)
 Frame = +2

           ++ + AGG C +   +PGK V++TGANTGIGK+TA ELA+RG  V +ACRD+ K E AA 

           +IR +T N +V   +LDL+  KSIR FA   + EE+++ IL+NNA VM CP+  T DGFE

              GVN               KASAP+R++NLSS+ H AG I F DL  + K Y+   AY

           C SKLA VLFT+EL+ RLQG+GVT  A+HPG+ ++EL RH+

 Score = 47.0 bits (110), Expect(2) = 4e-65
 Identities = 23/52 (44%), Positives = 31/52 (59%)
 Frame = +1

            AQ S + A+AE LE +SGKYF   +    SP A + + A RLW  S  L+G+

>ref|NP_076186.1| retinol dehydrogenase 14 [Mus musculus].
          Length = 334

 Score =  204 bits (520), Expect(2) = 9e-62
 Identities = 111/237 (46%), Positives = 148/237 (62%), Gaps = 14/237 (5%)
 Frame = +2

           GK V+ITGAN+G+G+ TA EL R GARV + CRD  + E AA ++R           D  

           + Q++V++LDL+  +S+RAF +  L EE +L +LINNAGV  CPY+KT DGFE   GVN 

                         K+SAP+R+V +SS ++  G+I F DL  E+ YN+ F Y  SKLAN+

           LFTRELA+RL+GT VT   +HPGIV++ L RH  +  L   LF+     F KT  EG

 Score = 52.0 bits (123), Expect(2) = 9e-62
 Identities = 22/53 (41%), Positives = 36/53 (67%)
 Frame = +1

            GAQTS++ A +  +E +SG+YF DCK   + P+A +   A +LW++S  ++GI

>ref|NP_899109.2| dehydrogenase/reductase SDR family member 13 precursor [Mus
          Length = 376

 Score =  167 bits (422), Expect(2) = 1e-55
 Identities = 105/233 (45%), Positives = 141/233 (60%), Gaps = 5/233 (2%)
 Frame = +2

           ++  V APS      GG+      L G+ VV+TGAN+GIGK TA ELARRGARV +ACR 

             +GE+AA ++R ++ N++V+   LDL+   S++AFA  FL+ E +L +LI+NAG+  C 

             +T + F   L VN               ++ AP+RVV +SS  H  G++ F  L    


 Score = 69.3 bits (168), Expect(2) = 1e-55
 Identities = 42/114 (36%), Positives = 58/114 (50%)
 Frame = +1

            GGAQT L+CAL EG+EPLSG+YF++C    VSP AR+++ A+RLW  + +L G+      

                      PG + D  D  P   D      +  P+     +  P H   SYQ

>ref|NP_062519.2| WW domain-containing oxidoreductase [Mus musculus].
          Length = 414

 Score =  141 bits (355), Expect(2) = 2e-41
 Identities = 92/257 (35%), Positives = 135/257 (52%), Gaps = 13/257 (5%)
 Frame = +2

           T P+ R+ + G      +       GKVV++TGAN+GIG ETA+  A  GA V +ACR++

            +   A S I  +   ++V    LDL+  +S++ FAE F  +   LH+L+ NAG    P+

             T DG ET   VN                 S+PARV+ +SS  H        +GK+   

            L   +  Y    AY  SKL N+LF+ EL +RL   GVT+ AVHPG ++ S + R+S++ 

            LL+ L   F K+ ++G

 Score = 47.4 bits (111), Expect(2) = 2e-41
 Identities = 22/51 (43%), Positives = 33/51 (64%)
 Frame = +1

            GA T+++CA+A  LE L G YF++C R   S  A++ +TA  LW +S  L+

>ref|NP_001028498.2| dehydrogenase/reductase SDR family member on chromosome X homolog
           precursor [Mus musculus].
          Length = 335

 Score =  144 bits (362), Expect(2) = 3e-37
 Identities = 85/210 (40%), Positives = 113/210 (53%), Gaps = 6/210 (2%)
 Frame = +2

           PG+V ++TGA  GIG+ TAR+LAR G  V +A  D   G+   S IRA+  + +     L

           DL+   S+R FA  F      LH+L+NNAGVML P ++T DGFE HLGVN          

                +AS      +RVV + S  H+ G +   DL G   Y+   AY  SKLA  LF  +

           L + L   G  VT+    PG+V +EL RH+

 Score = 30.8 bits (68), Expect(2) = 3e-37
 Identities = 18/52 (34%), Positives = 24/52 (46%)
 Frame = +1

            GA T ++ A A  LE + G+Y  D   A     AR+ +   RLW     L G

>ref|NP_079798.2| dehydrogenase/reductase SDR family member 7 precursor [Mus
          Length = 338

 Score = 68.9 bits (167), Expect = 9e-12
 Identities = 60/214 (28%), Positives = 95/214 (44%), Gaps = 3/214 (1%)
 Frame = +2

           R   +L   VV +TGA++GIG+E A +L++ G  + ++ R   + E          + K 

             +LV  LDL+DT S  A  +  L E  ++ IL+NN G      S+ +   ET+L V   

                        K   P  +      +     +  + + G    +    YC SK A   

           F   L   L Q  G+T   V+PG VQS++V+++F

>ref|NP_780721.1| dehydrogenase/reductase SDR family member 9 precursor [Mus
          Length = 319

 Score = 63.5 bits (153), Expect = 4e-10
 Identities = 62/203 (30%), Positives = 93/203 (45%), Gaps = 5/203 (2%)
 Frame = +2

           K V ITG +TG G   AR   ++G RV  AC  + +  SAA + +   +   VL   LD+

           +D ++++  A+   +   EK L  LINNAGV+  L P    T D +   + VN       

                   K  A  RV+N+SS+    G++ F           G  Y  SK A   F   L

            + ++  GV    + PG+ ++EL

>ref|NP_766635.1| carbonyl reductase 3 [Mus musculus].
          Length = 277

 Score = 59.3 bits (142), Expect = 7e-09
 Identities = 58/234 (24%), Positives = 97/234 (41%), Gaps = 34/234 (14%)
 Frame = +2

           +V ++TGAN GIG    R+L R+    V +  RD  +G +A  +++A+  + +    +LD

           + D +SIRA  +    E   L++L+NNAG+       T    +  + +            

Query: 650 XXXXKASAPARVVNLSSV--------------------------VHHAGKIRFHDLQGEK 751
                     RVVN+SS+                          +    K    D + E 

           H   G+   AY  SKL   + TR LA++L    +   +   A  PG V++++ R

  Database: RefSeq49_MP.fasta
    Posted date:  Oct 17, 2011  1:42 PM
  Number of letters in database: 15,617,559
  Number of sequences in database:  30,036
Lambda     K      H
   0.318    0.134    0.401 

Lambda     K      H
   0.267   0.0410    0.140 

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 30036
Number of Hits to DB: 46,130,164
Number of extensions: 1268260
Number of successful extensions: 4583
Number of sequences better than 1.0e-05: 29
Number of HSP's gapped: 4544
Number of HSP's successfully gapped: 36
Length of query: 454
Length of database: 15,617,559
Length adjustment: 105
Effective length of query: 349
Effective length of database: 12,463,779
Effective search space: 4349858871
Effective search space used: 4349858871
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 35 (18.1 bits)

Search to RefSeqSP_Rel49

BLASTX 2.2.24 [Aug-08-2010]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= OVRT1_0146_C03
         (1362 letters)

Database: RefSeq49_SP.fasta 
           24,897 sequences; 11,343,932 total letters


                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

Alignment   gi|NP_001230331.1| retinol dehydrogenase 12 [Sus scrofa].            461   e-162
Alignment   gi|XP_001928802.1| PREDICTED: retinol dehydrogenase 11 [Sus scr...   345   e-113
Alignment   gi|XP_003125388.1| PREDICTED: retinol dehydrogenase 14-like [Su...   204   5e-62
Alignment   gi|XP_003125042.1| PREDICTED: retinol dehydrogenase 12-like [Su...   106   3e-23
Alignment   gi|XP_003126896.2| PREDICTED: WW domain-containing oxidoreducta...    80   2e-15
Alignment   gi|XP_003355526.1| PREDICTED: short-chain dehydrogenase/reducta...    65   7e-11
Alignment   gi|XP_003132810.1| PREDICTED: carbonyl reductase [NADPH] 3-like...    60   3e-09
Alignment   gi|XP_003358992.1| PREDICTED: carbonyl reductase [NADPH] 1-like...    60   3e-09
Alignment   gi|XP_003133511.1| PREDICTED: dehydrogenase/reductase SDR famil...    58   1e-08
Alignment   gi|XP_003133510.1| PREDICTED: dehydrogenase/reductase SDR famil...    58   1e-08

>ref|NP_001230331.1| retinol dehydrogenase 12 [Sus scrofa].
          Length = 316

 Score =  461 bits (1185), Expect(3) = e-162
 Identities = 234/249 (93%), Positives = 234/249 (93%)
 Frame = +2





Query: 932 RFLKTAREG 958
Sbjct: 253 RFLKTAREG 261

 Score =  122 bits (307), Expect(3) = e-162
 Identities = 56/56 (100%), Positives = 56/56 (100%)
 Frame = +1


 Score = 30.0 bits (66), Expect(3) = e-162
 Identities = 14/14 (100%), Positives = 14/14 (100%)
 Frame = +1


>ref|XP_001928802.1| PREDICTED: retinol dehydrogenase 11 [Sus scrofa].
          Length = 316

 Score =  345 bits (884), Expect(2) = e-113
 Identities = 170/247 (68%), Positives = 199/247 (80%)
 Frame = +2



           KTADGFETH+GVN               K SAP+RVVN+SS+ HH G+I FH+LQGEK Y


Query: 938 LKTAREG 958
           +KT ++G
Sbjct: 255 IKTPQQG 261

 Score = 82.0 bits (201), Expect(2) = e-113
 Identities = 38/53 (71%), Positives = 43/53 (81%)
 Frame = +1


>ref|XP_003125388.1| PREDICTED: retinol dehydrogenase 14-like [Sus scrofa].
          Length = 336

 Score =  204 bits (518), Expect(2) = 5e-62
 Identities = 112/259 (43%), Positives = 156/259 (60%), Gaps = 17/259 (6%)
 Frame = +2

           PS+++   GG    +  + GK V+ITGAN+G+G+ TA EL R GARV + CRD  + E A

           A ++R + + ++             ++VR+LDL+  +S+RAF +  L EE +L +LINNA

           G+  CPY KT DGFE    VN               K+SAP+R+V +SS ++  G I F 

           DL  E+ YN+ F Y  SKLAN+LFTRELA+RL+GT VT   +HPGIV++ L RH  +  L

Query: 914 LWRLFS----RFLKTAREG 958
           +  LF+     F KT  EG

 Score = 53.1 bits (126), Expect(2) = 5e-62
 Identities = 24/55 (43%), Positives = 38/55 (69%)
 Frame = +1

            A GAQTS++ A +  +E +SGKYF DCK   + P+A ++  A +LW++S  ++GI

>ref|XP_003125042.1| PREDICTED: retinol dehydrogenase 12-like [Sus scrofa].
          Length = 181

 Score =  106 bits (264), Expect = 3e-23
 Identities = 53/117 (45%), Positives = 80/117 (68%)
 Frame = +2

           C T+  L GK  V+TGAN+GIGK  ++ELARRGARV +ACR   +G+ A +EI+A T+++

           ++L+  +DLS   SIR+F +  L E  ++H+L+NNAGV   P ++T +G +     N

>ref|XP_003126896.2| PREDICTED: WW domain-containing oxidoreductase-like, partial [Sus
          Length = 163

 Score = 80.5 bits (197), Expect = 2e-15
 Identities = 59/155 (38%), Positives = 75/155 (48%), Gaps = 9/155 (5%)
 Frame = +2

           LH+L+ NA V   P+S T DG ET   VN                 SAPARVV +SS  H

                   +GK+ F  L      Y    AY  SKL N+LF+ EL +RL   GVT+ AVHP

           G ++ S L R  ++  LL+ L   F K+      P

>ref|XP_003355526.1| PREDICTED: short-chain dehydrogenase/reductase family 9C member
           7-like [Sus scrofa].
          Length = 313

 Score = 65.5 bits (158), Expect = 7e-11
 Identities = 65/235 (27%), Positives = 101/235 (42%), Gaps = 5/235 (2%)
 Frame = +2

           C     L  K V ITG ++G G   AR+L  RG RV  AC      E  A +++ DT + 

           ++    LD++ T+SI+A A+    +  E+ L  L+NNAGV L        T + F   + 

           VN               K  A  RVVN+SS              G +    G  YC SK 

               F+  + + L   GV    + PG  ++ ++    L   + ++++R  +  R+

>ref|XP_003132810.1| PREDICTED: carbonyl reductase [NADPH] 3-like [Sus scrofa].
          Length = 277

 Score = 60.1 bits (144), Expect = 3e-09
 Identities = 58/232 (25%), Positives = 97/232 (41%), Gaps = 34/232 (14%)
 Frame = +2

           +V ++TGAN GIG   AR+L R+    V +  RD  +G +A  +++A+  + +    +LD

           + D +SIRA  +    E   L++L+NNAG+       T    +  + +            

Query: 650 XXXXKASAPARVVNLSSVVHHAG--------------------------KIRFHDLQGEK 751
                     RVVN+SS++                              K    D + E 

           H   G+   AY  SKL   + +R LA+RL    +   +   A  PG V++++

>ref|XP_003358992.1| PREDICTED: carbonyl reductase [NADPH] 1-like [Sus scrofa].
          Length = 281

 Score = 60.1 bits (144), Expect = 3e-09
 Identities = 35/106 (33%), Positives = 60/106 (56%), Gaps = 1/106 (0%)
 Frame = +2

           +V V+TG N GIG    R+L ++    V +  RDV +G++A  +++A+  + +    +LD

           + D +SI+A  +  L E   L++L+NNAG+      KT D    H+

>ref|XP_003133511.1| PREDICTED: dehydrogenase/reductase SDR family member 9-like isoform
           1 [Sus scrofa].
          Length = 319

 Score = 58.2 bits (139), Expect = 1e-08
 Identities = 56/203 (27%), Positives = 93/203 (45%), Gaps = 5/203 (2%)
 Frame = +2

           K + ITG +TG G   AR   ++G  V  AC      ES ++ ++A+T + ++    LD+

           +D ++++  A+    +  EK L  LINNAG++  L P    T + +   + VN       

                   K  A  RV+N+SS+    G++ F           G  Y  SK A   F   L

            + ++  GV    + PG+ ++ L

>ref|XP_003133510.1| PREDICTED: dehydrogenase/reductase SDR family member 9-like,
           partial [Sus scrofa].
          Length = 245

 Score = 58.2 bits (139), Expect = 1e-08
 Identities = 56/203 (27%), Positives = 93/203 (45%), Gaps = 5/203 (2%)
 Frame = +2

           K + ITG +TG G   AR   ++G  V  AC      ES ++ ++A+T + ++    LD+

           +D ++++  A+    +  EK L  LINNAG++  L P    T + +   + VN       

                   K  A  RV+N+SS+    G++ F           G  Y  SK A   F   L

            + ++  GV    + PG+ ++ L

  Database: RefSeq49_SP.fasta
    Posted date:  Oct 17, 2011  1:42 PM
  Number of letters in database: 11,343,932
  Number of sequences in database:  24,897
Lambda     K      H
   0.318    0.134    0.401 

Lambda     K      H
   0.267   0.0410    0.140 

Matrix: BLOSUM62
Gap Penalties: Existence: 11, Extension: 1
Number of Sequences: 24897
Number of Hits to DB: 34,807,355
Number of extensions: 1009195
Number of successful extensions: 3688
Number of sequences better than 1.0e-05: 24
Number of HSP's gapped: 3663
Number of HSP's successfully gapped: 28
Length of query: 454
Length of database: 11,343,932
Length adjustment: 102
Effective length of query: 352
Effective length of database: 8,804,438
Effective search space: 3099162176
Effective search space used: 3099162176
Neighboring words threshold: 12
Window for multiple hits: 40
X1: 16 ( 7.3 bits)
X2: 38 (14.6 bits)
X3: 64 (24.7 bits)
S1: 41 (21.7 bits)
S2: 35 (18.1 bits)

Search to Sscrofa10_2

BLASTN 2.2.24 [Aug-08-2010]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= OVRT1_0146_C03
         (1362 letters)

Database: Sscrofa_10.2.fasta 
           4582 sequences; 2,808,509,378 total letters


                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

Sscrofa_Chr07                                                         634   e-179
Sscrofa_ChrX                                                          254   1e-64

||          Length = 134764511

 Score =  634 bits (320), Expect = e-179
 Identities = 320/320 (100%)
 Strand = Plus / Plus

Query: 1020     cagtgactgcaagagggcctgggtgtcgccaagggcccggaataacaaaacggccgagcg 1079
Sbjct: 97800133 cagtgactgcaagagggcctgggtgtcgccaagggcccggaataacaaaacggccgagcg 97800192

Query: 1080     cttgtggaacgtcagctgcgagctcctgggaatccagtgggagtagagctgctggaagat 1139
Sbjct: 97800193 cttgtggaacgtcagctgcgagctcctgggaatccagtgggagtagagctgctggaagat 97800252

Query: 1140     gcgcggctgtatcaagcctggtccaggccataacgcagaccggggagatggcccaccccg 1199
Sbjct: 97800253 gcgcggctgtatcaagcctggtccaggccataacgcagaccggggagatggcccaccccg 97800312

Query: 1200     aaggactgacctggctggctgctgtcccaaacacttccctgctttgattctcctgatcct 1259
Sbjct: 97800313 aaggactgacctggctggctgctgtcccaaacacttccctgctttgattctcctgatcct 97800372

Query: 1260     tggaaaacctccccacacctaaccctcttaccaggctgattctcggcataagaggttcat 1319
Sbjct: 97800373 tggaaaacctccccacacctaaccctcttaccaggctgattctcggcataagaggttcat 97800432

Query: 1320     acctggagagcatcgtcctt 1339
Sbjct: 97800433 acctggagagcatcgtcctt 97800452

 Score =  426 bits (215), Expect = e-116
 Identities = 236/244 (96%), Gaps = 1/244 (0%)
 Strand = Plus / Plus

Query: 1        taggattctgggctacgctgagagccaggctgttgctgagcacccaggatcgagaagagg 60
Sbjct: 97788540 taggattctgggctacgctgagagccaggctgttgctgagcacccaggatcgagaagagg 97788599

Query: 61       cagaggaaagggaagcagagagaagcagccaagagttggagccagaccaggaggagcccg 120
Sbjct: 97788600 cagaggaaagggaagcagagagaagcagccaagagttggagccagaccaggaggagcccg 97788659

Query: 121      agtggagttgaagttccttttgcagaggcggcagcaagtaaagcagttgaaacgatgctg 180
Sbjct: 97788660 agtggagttgaagttccttttgcagaggcggcagcaagtaaagcagttgaaacgatgctg 97788719

Query: 181      gctgtcttgggactgctcacctccttccnnnnnnnncctgtatgtgacagctccatccat 240
                ||||||||||||||||||||||||||||        ||||||||||||||||||||||||
Sbjct: 97788720 gctgtcttgggactgctcacctccttcc-tttttttcctgtatgtgacagctccatccat 97788778

Query: 241      cagg 244
Sbjct: 97788779 cagg 97788782

 Score =  420 bits (212), Expect = e-115
 Identities = 212/212 (100%)
 Strand = Plus / Plus

Query: 623      ggccacttccttctcacgcacttgctcttggagcagctgaaggcatctgctcccgcacgg 682
Sbjct: 97793310 ggccacttccttctcacgcacttgctcttggagcagctgaaggcatctgctcccgcacgg 97793369

Query: 683      gtggtgaacctgtcatccgtggtccaccatgctggcaagattcgcttccacgacctccag 742
Sbjct: 97793370 gtggtgaacctgtcatccgtggtccaccatgctggcaagattcgcttccacgacctccag 97793429

Query: 743      ggtgagaagcactacaaccggggttttgcttattgccacagcaagctggccaacgtgctc 802
Sbjct: 97793430 ggtgagaagcactacaaccggggttttgcttattgccacagcaagctggccaacgtgctc 97793489

Query: 803      tttactcgggaactggccaagaggctccaagg 834
Sbjct: 97793490 tttactcgggaactggccaagaggctccaagg 97793521

 Score =  365 bits (184), Expect = 4e-98
 Identities = 191/192 (99%), Gaps = 1/192 (0%)
 Strand = Plus / Plus

Query: 832      aggcacgggggtcaccacgtacgcagtgcacccaggcatcgtccagtctgagctggtccg 891
Sbjct: 97795667 aggcacgggggtcaccacgtacgcagtgcacccaggcatcgtccagtctgagctggtccg 97795726

Query: 892      gcattccttcctgctgtgcctgctctggcggctcttctcccgcttcctcaaaacagcgcg 951
Sbjct: 97795727 gcattccttcctgctgtgcctgctctggcggctcttctcccgcttcctcaaaacagcgcg 97795786

Query: 952      gga-ggggcccagaccagcctgcactgcgccctggccgagggcctggagcccctgagcgg 1010
                ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 97795787 ggagggggcccagaccagcctgcactgcgccctggccgagggcctggagcccctgagcgg 97795846

Query: 1011     caagtacttcag 1022
Sbjct: 97795847 caagtacttcag 97795858

 Score =  305 bits (154), Expect = 3e-80
 Identities = 157/158 (99%)
 Strand = Plus / Plus

Query: 361      aggagcccgagtatacattgcctgccgagatgtactgaagggggagtctgctgccagtga 420
Sbjct: 97791039 aggagcccgagtatacattgcctgccgagatgtactgaagggggagtctgctgccagtga 97791098

Query: 421      gatccgagctgatacaaagaactcccaggtgctggtgcggaaactggacctctctgatac 480
Sbjct: 97791099 aatccgagctgatacaaagaactcccaggtgctggtgcggaaactggacctctctgatac 97791158

Query: 481      caaatccatccgagcctttgctgagggctttctgacag 518
Sbjct: 97791159 caaatccatccgagcctttgctgagggctttctgacag 97791196

 Score =  242 bits (122), Expect = 4e-61
 Identities = 122/122 (100%)
 Strand = Plus / Plus

Query: 242      aggaagttctttgctggtggggtttgtaggacaaacatgcagcttcccgggaaggtggtg 301
Sbjct: 97790188 aggaagttctttgctggtggggtttgtaggacaaacatgcagcttcccgggaaggtggtg 97790247

Query: 302      gtgatcacgggtgccaacacgggcattggcaaggagacagccagagagctcgctcgcaga 361
Sbjct: 97790248 gtgatcacgggtgccaacacgggcattggcaaggagacagccagagagctcgctcgcaga 97790307

Query: 362      gg 363
Sbjct: 97790308 gg 97790309

 Score =  214 bits (108), Expect = 1e-52
 Identities = 108/108 (100%)
 Strand = Plus / Plus

Query: 517      agaggaaaagcagctccatattctgatcaacaatgctggagtgatgttgtgtccatattc 576
Sbjct: 97791851 agaggaaaagcagctccatattctgatcaacaatgctggagtgatgttgtgtccatattc 97791910

Query: 577      caagacagcggatggctttgagacccacctgggagtcaaccacctggg 624
Sbjct: 97791911 caagacagcggatggctttgagacccacctgggagtcaaccacctggg 97791958

 Score =  111 bits (56), Expect = 1e-21
 Identities = 92/104 (88%)
 Strand = Plus / Minus

Query: 516      cagaggaaaagcagctccatattctgatcaacaatgctggagtgatgttgtgtccatatt 575
                |||| |||||||| ||||| ||| ||||||||||||| ||||||||| ||||||| || |
Sbjct: 97744136 cagaagaaaagcatctccacattttgatcaacaatgcaggagtgatgatgtgtccttact 97744077

Query: 576      ccaagacagcggatggctttgagacccacctgggagtcaaccac 619
                |||||||||| || ||||||||||| ||| ||||||||||||||
Sbjct: 97744076 ccaagacagcagacggctttgagacgcacatgggagtcaaccac 97744033

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 51/58 (87%)
 Strand = Plus / Minus

Query: 453      tggtgcggaaactggacctctctgataccaaatccatccgagcctttgctgagggctt 510
                |||||||||||||||||||  ||||||| ||||| || ||||| |||||| |||||||
Sbjct: 97745938 tggtgcggaaactggacctggctgatactaaatctattcgagcttttgctaagggctt 97745881

||          Length = 144288218

 Score =  254 bits (128), Expect = 1e-64
 Identities = 237/272 (87%), Gaps = 1/272 (0%)
 Strand = Plus / Plus

Query: 369      gagtatacattgcctgccgagatgtactgaagggggagtctgctgccagtgagatccgag 428
                |||||| ||||||||||| ||||||| ||||| || |||  ||||||  ||| ||| |||
Sbjct: 47505102 gagtattcattgcctgccaagatgtattgaagtggaagttggctgcccatgaaatctgag 47505161

Query: 429      ctgatacaaagaactcccaggtgctggtgcggaaactggacctctctgataccaaatcca 488
                ||||||||||||||||||||||||||||| ||||| ||||||| ||  ||||||||||||
Sbjct: 47505162 ctgatacaaagaactcccaggtgctggtgtggaaattggacctatccaataccaaatcca 47505221

Query: 489      tccgagcctttgctgagggctttctgacagag-gaaaagcagctccatattctgatcaac 547
                || |||| ||||||||| |||||||| ||| |  |||||||||||| ||||||||||| |
Sbjct: 47505222 tctgagcttttgctgagagctttctggcagtgcaaaaagcagctccgtattctgatcagc 47505281

Query: 548      aatgctggagtgatgttgtgtccatattccaagacagcggatggctttgagacccacctg 607
                ||  | ||||||||| ||||| |||||||||||||||| ||||||||||| |||||||||
Sbjct: 47505282 aacacaggagtgatgatgtgttcatattccaagacagccgatggctttgaaacccacctg 47505341

Query: 608      ggagtcaaccacctgggccacttccttctcac 639
                ||| |||||  |||||||||||||||||||||
Sbjct: 47505342 ggaatcaactgcctgggccacttccttctcac 47505373

 Score =  115 bits (58), Expect = 7e-23
 Identities = 225/278 (80%), Gaps = 2/278 (0%)
 Strand = Plus / Plus

Query: 854      gcagtgcacccaggcatcgtccagtctgagctggtccggcattccttcctgctgtgcctg 913
                |||| |||||||||||| || || ||||||||||||| ||| || ||||||||| |||||
Sbjct: 47505848 gcagagcacccaggcatagttcactctgagctggtccagcactcattcctgctgggcctg 47505907

Query: 914      ctctggcggctcttctcccgcttcctcaaaacagcgcgggagggg-cccagaccagcctg 972
                ||||||| ||||||  ||  |||  ||||  ||| | | |||||| | | |||||| |||
Sbjct: 47505908 ctctggcagctctttgccacctttgtcaagtcagtgtgagaggggacacggaccagactg 47505967

Query: 973      cactgcgccctggccgagggcctggagcccctgagcggcaagtacttcagtgactgcaag 1032
                ||||||  |||||| ||| |||||||||||||||| | ||||   |||| ||||||||||
Sbjct: 47505968 cactgcatcctggctgagagcctggagcccctgagtgccaagggtttcaatgactgcaag 47506027

Query: 1033     agggcctgggtgtcgccaagggcccggaataacaaaacggccgagcgcttgtggaacgtc 1092
                ||| |  |||| || ||||||||| | | | || ||| | | ||| || ||||||| |||
Sbjct: 47506028 aggactggggtatctccaagggcctgaagtcac-aaatgtctgagagcctgtggaatgtc 47506086

Query: 1093     agctgcgagctcctgggaatccagtgggagtagagctg 1130
                ||||| ||||| || |||||||||||||||||||||||
Sbjct: 47506087 agctgtgagcttctaggaatccagtgggagtagagctg 47506124

 Score = 75.8 bits (38), Expect = 6e-11
 Identities = 41/42 (97%)
 Strand = Plus / Plus

Query: 72       gaagcagagagaagcagccaagagttggagccagaccaggag 113
                ||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 47504810 gaagcagagagaagcagccaagaattggagccagaccaggag 47504851

  Database: Sscrofa_10.2.fasta
    Posted date:  Nov 16, 2011 10:34 AM
  Number of letters in database: 2,808,509,378
  Number of sequences in database:  4582
Lambda     K      H
    1.37    0.711     1.31 

Lambda     K      H
    1.37    0.711     1.31 

Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4582
Number of Hits to DB: 35,934,720
Number of extensions: 261
Number of successful extensions: 261
Number of sequences better than 1.0e-05: 2
Number of HSP's gapped: 259
Number of HSP's successfully gapped: 14
Length of query: 1362
Length of database: 2,808,509,378
Length adjustment: 21
Effective length of query: 1341
Effective length of database: 2,808,413,156
Effective search space: 3766082042196
Effective search space used: 3766082042196
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 50 (99.1 bits)
S1: 18 (36.2 bits)
S2: 30 (60.0 bits)