Search to UniGene2 database
Query= 20030531C-000541 (20030531C-000541) 20030531C-000541
(999 letters)
Database: UniGene(Bt+Hs+Ssc+Mm)
230,285 sequences; 241,976,893 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
Alignment gnl|UG|Bt#S11916823 AV610583 Bos taurus lung fetus Bos taurus c... 504 e-141
Alignment gnl|UG|Hs#S1728714 Homo sapiens interferon regulatory factor 3 ... 406 e-112
Alignment gnl|UG|Mm#S8539617 Mus musculus interferon regulatory factor 3 ... 204 6e-51
Alignment gnl|UG|Hs#S5979107 Homo sapiens, clone IMAGE:5260671, mRNA /gb=... 38 0.76
Alignment gnl|UG|Hs#S4808151 Homo sapiens, clone IMAGE:5300989, mRNA /gb=... 38 0.76
Alignment gnl|UG|Hs#S1727190 Homo sapiens interferon regulatory factor 4 ... 38 0.76
Alignment gnl|UG|Mm#S10870101 Mus musculus 12 days embryo embryonic body ... 38 0.76
Alignment gnl|UG|Hs#S5909059 UI-E-CI1-aft-c-02-0-UI.s1 UI-E-CI1 Homo sapi... 36 3.0
Alignment gnl|UG|Hs#S3219584 Homo sapiens forkhead box B1 (FOXB1), mRNA /... 36 3.0
Alignment gnl|UG|Hs#S3439107 Homo sapiens NADPH oxidase, EF hand calcium-... 36 3.0
>gnl|UG|Bt#S11916823 AV610583 Bos taurus lung fetus Bos taurus cDNA
clone E1LU033C11 5', mRNA sequence /clone=E1LU033C11
/clone_end=5' /gb=AV610583 /gi=9746253 /ug=Bt.20182
/len=694
Length = 694
Score = 504 bits (254), Expect = e-141
Identities = 402/450 (89%), Gaps = 4/450 (0%)
Strand = Plus / Plus
Query: 283 ccatgggaactcagaagcctcggatcctgccctggctgatatctcagctgaaccaggggc 342
|||||||||| || ||||||||||| |||||||||||||||||||||||| ||| |||
Sbjct: 144 ccatgggaacccaaaagcctcggatactgccctggctgatatctcagctggaccgagggg 203
Query: 343 aactggagggcgtggcctggctggatgagggccacacgcgcttccgcatcccttggaagc 402
| ||||||||||||||||||||| ||| ||| |||||| |||||||||||||||||||
Sbjct: 204 agttggagggcgtggcctggctgggcgagagccgcacgcgtttccgcatcccttggaagc 263
Query: 403 acggcttgcggcaggatgcccagcaggaggacttcggcatcttccaggcctgggccgagg 462
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |
Sbjct: 264 acggcttgcggcaggatgcccagcaggaggatttcggcatcttccaggcctgggctgtag 323
Query: 463 ccagtggtgcctacactcctgggaaggataagcccgacctgcccacctggaagaggaatt 522
|||| |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 324 ccagnggtgcctatactcctgggaaggataagcccgacctgccgacctggaagaggaatt 383
Query: 523 tccggtctgccctgaaccggaaagaagcattgcgtttagcagaggaccacagcaaggacc 582
|||||||||||||||||||||| |||| ||||||||||| |||||||||| |||||||
Sbjct: 384 tccggtctgccctgaaccggaaggaagtgttgcgtttagcggaggaccacancaaggact 443
Query: 583 cccacgacccacacaagatctatgagtttgtgacctcaggagttggggactttcctgagc 642
|||| ||||||||||| |||||||||||||||| ||||||||| ||||| |||||||||
Sbjct: 444 cccaagacccacacaaaatctatgagtttgtgaactcaggagtcagggacattcctgagc 503
Query: 643 cagacacctctctagacctcagtggcagatacagtacctctgatacccacgaagacagtc 702
|||| |||| || ||| || ||||||| ||| ||||||||||||||| ||||||| ||
Sbjct: 504 cagatacctttcaaga---caatggcagacacaatacctctgatacccaggaagacactc 560
Query: 703 tggataagttac-taagtggcatggacttg 731
|||| ||||||| | |||| ||||||||||
Sbjct: 561 tggagaagttacttgagtgacatggacttg 590
Score = 63.9 bits (32), Expect = 1e-08
Identities = 57/64 (89%), Gaps = 1/64 (1%)
Strand = Plus / Plus
Query: 122 cccacctctaaaactcagctgacgagaagt-ggggtgtgcggcggcgagttcgagagcta 180
|||||||||||| |||| |||||| ||||| ||||||||| || | ||||||||||||||
Sbjct: 19 cccacctctaaagctcaactgacgggaagtgggggtgtgcagctgagagttcgagagcta 78
Query: 181 cggg 184
||||
Sbjct: 79 cggg 82
>gnl|UG|Hs#S1728714 Homo sapiens interferon regulatory factor 3
(IRF3), mRNA /cds=(47,1330) /gb=NM_001571 /gi=4504724
/ug=Hs.75254 /len=1407
Length = 1407
Score = 406 bits (205), Expect = e-112
Identities = 376/433 (86%)
Strand = Plus / Plus
Query: 283 ccatgggaactcagaagcctcggatcctgccctggctgatatctcagctgaaccaggggc 342
|||||||||| | ||||| |||||||||||||||||| | || |||||| ||| |||||
Sbjct: 45 ccatgggaaccccaaagccacggatcctgccctggctggtgtcgcagctggacctggggc 104
Query: 343 aactggagggcgtggcctggctggatgagggccacacgcgcttccgcatcccttggaagc 402
|||||||||||||||||||| || | || ||| ||||||||||||||||||||||||||
Sbjct: 105 aactggagggcgtggcctgggtgaacaagagccgcacgcgcttccgcatcccttggaagc 164
Query: 403 acggcttgcggcaggatgcccagcaggaggacttcggcatcttccaggcctgggccgagg 462
||||| | ||||||||||| ||||||||||| ||||| ||||||||||||||||||||||
Sbjct: 165 acggcctacggcaggatgcacagcaggaggatttcggaatcttccaggcctgggccgagg 224
Query: 463 ccagtggtgcctacactcctgggaaggataagcccgacctgcccacctggaagaggaatt 522
||| |||||| || ||| |||| ||||||||| |||||||| ||||||||||||||||
Sbjct: 225 ccactggtgcatatgttcccgggagggataagccagacctgccaacctggaagaggaatt 284
Query: 523 tccggtctgccctgaaccggaaagaagcattgcgtttagcagaggaccacagcaaggacc 582
|||| |||||||| ||||| ||||||| ||||||||||||||||||| ||||||||||
Sbjct: 285 tccgctctgccctcaaccgcaaagaagggttgcgtttagcagaggaccggagcaaggacc 344
Query: 583 cccacgacccacacaagatctatgagtttgtgacctcaggagttggggactttcctgagc 642
| ||||||||||| || ||||| |||||||||| ||||||||||||||||||| | |||
Sbjct: 345 ctcacgacccacataaaatctacgagtttgtgaactcaggagttggggacttttcccagc 404
Query: 643 cagacacctctctagacctcagtggcagatacagtacctctgatacccacgaagacagtc 702
|||||||||||| ||| || ||| || |||||| ||||||||||| ||||||| ||
Sbjct: 405 cagacacctctccggacaccaatggtggaggcagtacttctgatacccaggaagacattc 464
Query: 703 tggataagttact 715
||||| |||||||
Sbjct: 465 tggatgagttact 477
Score = 105 bits (53), Expect = 4e-21
Identities = 80/89 (89%)
Strand = Plus / Plus
Query: 879 gagtgggagttccaggtgaccgtcttctaccggggctgccaagtcttccagcagactgtc 938
|||||||||||| ||||||| | ||||||||||||| ||||||||||||||||||| ||
Sbjct: 647 gagtgggagttcgaggtgacagccttctaccggggccgccaagtcttccagcagaccatc 706
Query: 939 tgcagcccggggggcctgcggctggtggg 967
| | |||||| ||||||||||||||||||
Sbjct: 707 tcctgcccggagggcctgcggctggtggg 735
>gnl|UG|Mm#S8539617 Mus musculus interferon regulatory factor 3
(Irf3), mRNA /cds=(244,1503) /gb=NM_016849 /gi=8393626
/ug=Mm.3960 /len=1546
Length = 1546
Score = 204 bits (103), Expect = 6e-51
Identities = 256/307 (83%)
Strand = Plus / Plus
Query: 310 tgccctggctgatatctcagctgaaccaggggcaactggagggcgtggcctggctggatg 369
||||||||||| | || |||||| ||| |||||| ||||| ||||||||||||||||| |
Sbjct: 269 tgccctggctggtgtcacagctggacctggggcagctggaaggcgtggcctggctggacg 328
Query: 370 agggccacacgcgcttccgcatcccttggaagcacggcttgcggcaggatgcccagcagg 429
|| ||| ||| | ||| | ||||| |||||||| ||| | |||||||| || ||| ||
Sbjct: 329 agagccgaacgaggttcaggatcccgtggaagcatggcctacggcaggacgcacagatgg 388
Query: 430 aggacttcggcatcttccaggcctgggccgaggccagtggtgcctacactcctgggaagg 489
||||| |||||||||||||||||||| || ||||||||||||||||| || |||||||
Sbjct: 389 ctgactttggcatcttccaggcctgggcagaagccagtggtgcctacaccccggggaagg 448
Query: 490 ataagcccgacctgcccacctggaagaggaatttccggtctgccctgaaccggaaagaag 549
||||||| ||| || | ||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 449 ataagccggacgtgtcaacctggaagaggaatttccggtcagccctgaaccggaaagaag 508
Query: 550 cattgcgtttagcagaggaccacagcaaggacccccacgacccacacaagatctatgagt 609
||||| ||||| | ||| | ||||||||||| | ||||| || || | |||||||
Sbjct: 509 tgttgcggttagctgctgacaatagcaaggacccttatgaccctcataaagtgtatgagt 568
Query: 610 ttgtgac 616
|||||||
Sbjct: 569 ttgtgac 575
Score = 93.7 bits (47), Expect = 1e-17
Identities = 106/125 (84%), Gaps = 3/125 (2%)
Strand = Plus / Plus
Query: 843 gaaaacccactgaagcagctgctggcgaatgacgacgagtgggagttccaggtgaccgtc 902
||||| ||||||||||||||||| || ||| || | ||||||||| ||||||||| |
Sbjct: 793 gaaaatccactgaagcagctgctagc---tgaggaacaatgggagttcgaggtgaccgcc 849
Query: 903 ttctaccggggctgccaagtcttccagcagactgtctgcagcccggggggcctgcggctg 962
|||||||| ||| |||| |||||||||||||| ||| ||||||||||||||||||||
Sbjct: 850 ttctaccgaggccgccaggtcttccagcagacactcttttgcccggggggcctgcggctg 909
Query: 963 gtggg 967
|||||
Sbjct: 910 gtggg 914
>gnl|UG|Hs#S5979107 Homo sapiens, clone IMAGE:5260671, mRNA
/gb=BC038114 /gi=23958662 /ug=Hs.281434 /len=5645
Length = 5645
Score = 38.2 bits (19), Expect = 0.76
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 415 aggatgcccagcaggagga 433
|||||||||||||||||||
Sbjct: 430 aggatgcccagcaggagga 412
>gnl|UG|Hs#S4808151 Homo sapiens, clone IMAGE:5300989, mRNA
/gb=BC031291 /gi=22658404 /ug=Hs.127680 /len=1584
Length = 1584
Score = 38.2 bits (19), Expect = 0.76
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 492 aagcccgacctgcccacct 510
|||||||||||||||||||
Sbjct: 668 aagcccgacctgcccacct 686
>gnl|UG|Hs#S1727190 Homo sapiens interferon regulatory factor 4
(IRF4), mRNA /cds=(106,1461) /gb=NM_002460 /gi=4505286
/ug=Hs.82132 /len=5065
Length = 5065
Score = 38.2 bits (19), Expect = 0.76
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 383 cttccgcatcccttggaagcacg 405
|||||||||||| ||||||||||
Sbjct: 252 cttccgcatcccctggaagcacg 274
>gnl|UG|Mm#S10870101 Mus musculus 12 days embryo embryonic body
between diaphragm region and neck cDNA, RIKEN full-length
enriched library, clone:9430032P18 product:weakly similar
to SIMILAR TO RIKEN CDNA 2010013B10 GENE [Mus musculus],
full insert sequence. /gb=AK034767 /gi=26084180
/ug=Mm.149027 /len=2589
Length = 2589
Score = 38.2 bits (19), Expect = 0.76
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 660 ctcagtggcagatacagta 678
|||||||||||||||||||
Sbjct: 2129 ctcagtggcagatacagta 2111
>gnl|UG|Hs#S5909059 UI-E-CI1-aft-c-02-0-UI.s1 UI-E-CI1 Homo sapiens
cDNA clone UI-E-CI1-aft-c-02-0-UI 3', mRNA sequence
/clone=UI-E-CI1-aft-c-02-0-UI /clone_end=3' /gb=BU731856
/gi=23657167 /ug=Hs.436898 /len=1096
Length = 1096
Score = 36.2 bits (18), Expect = 3.0
Identities = 24/26 (92%)
Strand = Plus / Plus
Query: 478 ctcctgggaaggataagcccgacctg 503
||||||||||| | ||||||||||||
Sbjct: 134 ctcctgggaagaaaaagcccgacctg 159
>gnl|UG|Hs#S3219584 Homo sapiens forkhead box B1 (FOXB1), mRNA
/cds=(28,1002) /gb=NM_012182 /gi=11386194 /ug=Hs.247756
/len=1004
Length = 1004
Score = 36.2 bits (18), Expect = 3.0
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 161 ggcggcgagttcgagagc 178
||||||||||||||||||
Sbjct: 890 ggcggcgagttcgagagc 873
>gnl|UG|Hs#S3439107 Homo sapiens NADPH oxidase, EF hand
calcium-binding domain 5 (NOX5), mRNA /cds=(302,2545)
/gb=NM_024505 /gi=20127623 /ug=Hs.160199 /len=2582
Length = 2582
Score = 36.2 bits (18), Expect = 3.0
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 506 cacctggaagaggaattt 523
||||||||||||||||||
Sbjct: 559 cacctggaagaggaattt 542
Database: UniGene(Bt+Hs+Ssc+Mm)
Posted date: May 6, 2003 5:18 PM
Number of letters in database: 241,976,893
Number of sequences in database: 230,285
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 151440
Number of Sequences: 230285
Number of extensions: 151440
Number of successful extensions: 11674
Number of sequences better than 10.0: 21
length of query: 999
length of database: 241,976,893
effective HSP length: 19
effective length of query: 980
effective length of database: 237,601,478
effective search space: 232849448440
effective search space used: 232849448440
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)