Search to UniGene2 database
Query= 20030531S-030661 (20030531S-030661) 20030531S-030661
(767 letters)
Database: UniGene(Bt+Hs+Ssc+Mm)
230,285 sequences; 241,976,893 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
Alignment gnl|UG|Mm#S9824339 AGENCOURT_8755752 NIH_MGC_130 Mus musculus c... 46 0.002
Alignment gnl|UG|Hs#S4321320 UI-H-CO0-asl-d-03-0-UI.s1 NCI_CGAP_Sub9 Homo... 42 0.037
Alignment gnl|UG|Mm#S10871009 Mus musculus 15 days embryo male testis cDN... 42 0.037
Alignment gnl|UG|Mm#S10861621 Mus musculus 16 days embryo head cDNA, RIKE... 40 0.15
Alignment gnl|UG|Mm#S7893028 AV267939 RIKEN full-length enriched, adult m... 40 0.15
Alignment gnl|UG|Hs#S2652593 Homo sapiens cDNA: FLJ21028 fis, clone CAE07... 38 0.58
Alignment gnl|UG|Mm#S8870831 UI-M-CG0p-bin-e-03-0-UI.s1 NIH_BMAP_Ret4_S2 ... 38 0.58
Alignment gnl|UG|Mm#S10872291 Mus musculus adult male thymus cDNA, RIKEN ... 38 0.58
Alignment gnl|UG|Mm#S8864431 UI-M-CG0p-bhj-f-03-0-UI.s1 NIH_BMAP_Ret4_S2 ... 38 0.58
>gnl|UG|Mm#S9824339 AGENCOURT_8755752 NIH_MGC_130 Mus musculus cDNA
clone IMAGE:6331179 5', mRNA sequence
/clone=IMAGE:6331179 /clone_end=5' /gb=BU152268
/gi=22665800 /ug=Mm.216892 /len=983
Length = 983
Score = 46.1 bits (23), Expect = 0.002
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 325 ttaagggttttttaaaaaattct 347
|||||||||||||||||||||||
Sbjct: 880 ttaagggttttttaaaaaattct 858
>gnl|UG|Hs#S4321320 UI-H-CO0-asl-d-03-0-UI.s1 NCI_CGAP_Sub9 Homo
sapiens cDNA clone IMAGE:5859101 3', mRNA sequence
/clone=IMAGE:5859101 /clone_end=3' /gb=BM987561
/gi=19706950 /ug=Hs.365595 /len=1102
Length = 1102
Score = 42.1 bits (21), Expect = 0.037
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 614 aaaaaaaattccctttccccc 634
|||||||||||||||||||||
Sbjct: 942 aaaaaaaattccctttccccc 962
>gnl|UG|Mm#S10871009 Mus musculus 15 days embryo male testis cDNA,
RIKEN full-length enriched library, clone:8030459K01
product:unclassifiable, full insert sequence.
/gb=AK033200 /gi=26083272 /ug=Mm.156937 /len=4382
Length = 4382
Score = 42.1 bits (21), Expect = 0.037
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 245 ttggaaaggttccctatttct 265
|||||||||||||||||||||
Sbjct: 3783 ttggaaaggttccctatttct 3763
>gnl|UG|Mm#S10861621 Mus musculus 16 days embryo head cDNA, RIKEN
full-length enriched library, clone:C130038A22
product:neurobeachin, full insert sequence. /gb=AK048157
/gi=26092686 /ug=Mm.256536 /len=3740
Length = 3740
Score = 40.1 bits (20), Expect = 0.15
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 204 tatgtttataataaatactttatg 227
||||||||||||||||| ||||||
Sbjct: 329 tatgtttataataaatattttatg 352
>gnl|UG|Mm#S7893028 AV267939 RIKEN full-length enriched, adult male
testis (DH10B) Mus musculus cDNA clone 4930529M07 3'.
/clone=4930529M07 /clone_end=3' /gb=AV267939 /gi=6255976
/ug=Mm.251437 /len=278
Length = 278
Score = 40.1 bits (20), Expect = 0.15
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 668 ggaggttttttttctaaaac 687
||||||||||||||||||||
Sbjct: 93 ggaggttttttttctaaaac 112
>gnl|UG|Hs#S2652593 Homo sapiens cDNA: FLJ21028 fis, clone CAE07155.
/gb=AK024681 /gi=10437022 /ug=Hs.6083 /len=2346
Length = 2346
Score = 38.2 bits (19), Expect = 0.58
Identities = 25/27 (92%)
Strand = Plus / Plus
Query: 167 ctaggcaacagagatccagcttaattt 193
|||||| |||||||||||| |||||||
Sbjct: 109 ctaggccacagagatccagtttaattt 135
>gnl|UG|Mm#S8870831 UI-M-CG0p-bin-e-03-0-UI.s1 NIH_BMAP_Ret4_S2 Mus
musculus cDNA clone UI-M-CG0p-bin-e-03-0-UI 3'.
/clone=UI-M-CG0p-bin-e-03-0-UI /clone_end=3' /gb=BE995475
/gi=10679762 /ug=Mm.252459 /len=1248
Length = 1248
Score = 38.2 bits (19), Expect = 0.58
Identities = 26/27 (96%), Gaps = 1/27 (3%)
Strand = Plus / Plus
Query: 607 ttctctcaaaaaaaattccctttcccc 633
||||||||||||||| |||||||||||
Sbjct: 1003 ttctctcaaaaaaaa-tccctttcccc 1028
>gnl|UG|Mm#S10872291 Mus musculus adult male thymus cDNA, RIKEN
full-length enriched library, clone:5830403B09
product:weakly similar to GC-RICH SEQUENCE DNA-BINDING
FACTOR (GCF) (TRANSCRIPTION FACTOR 9) (TCF-9) [Homo
sapiens], full insert sequence. /gb=AK030793 /gi=26081990
/ug=Mm.246219 /len=5083
Length = 5083
Score = 38.2 bits (19), Expect = 0.58
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 124 tctctgatggtttcttttg 142
|||||||||||||||||||
Sbjct: 3487 tctctgatggtttcttttg 3469
>gnl|UG|Mm#S8864431 UI-M-CG0p-bhj-f-03-0-UI.s1 NIH_BMAP_Ret4_S2 Mus
musculus cDNA clone UI-M-CG0p-bhj-f-03-0-UI 3'.
/clone=UI-M-CG0p-bhj-f-03-0-UI /clone_end=3'
/gb=BE989075 /gi=10666082 /ug=Mm.151987 /len=1020
Length = 1020
Score = 38.2 bits (19), Expect = 0.58
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 614 aaaaaaaattccctttccc 632
|||||||||||||||||||
Sbjct: 761 aaaaaaaattccctttccc 779
Database: UniGene(Bt+Hs+Ssc+Mm)
Posted date: May 6, 2003 5:18 PM
Number of letters in database: 241,976,893
Number of sequences in database: 230,285
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 194174
Number of Sequences: 230285
Number of extensions: 194174
Number of successful extensions: 14947
Number of sequences better than 10.0: 125
length of query: 767
length of database: 241,976,893
effective HSP length: 19
effective length of query: 748
effective length of database: 237,601,478
effective search space: 177725905544
effective search space used: 177725905544
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)