Search to UniGene2 database
Query= 20040204S-034613 (20040204S-034613) 20040204S-034613
(953 letters)
Database: UniGene(Bt+Hs+Ssc+Mm)
238,354 sequences; 272,110,533 total letters
Searching..................................................done
Score E
Sequences producing significant alignments: (bits) Value
Alignment gnl|UG|Hs#S5979193 Homo sapiens hypothetical protein MGC20446 (M... 297 5e-79
Alignment gnl|UG|Mm#S11072786 Mus musculus similar to hypothetical protein... 192 2e-47
Alignment gnl|UG|Hs#S5500502 UI-H-FG1-bgk-d-05-0-UI.s1 NCI_CGAP_FG1 Homo s... 40 0.21
Alignment gnl|UG|Hs#S6159062 Homo sapiens nucleoporin 50kDa (NUP50), trans... 40 0.21
Alignment gnl|UG|Hs#S11128360 BX101748 NCI_CGAP_GCB1 Homo sapiens cDNA clo... 40 0.21
Alignment gnl|UG|Mm#S8040876 Mus musculus calcium channel, voltage-depende... 40 0.21
Alignment gnl|UG|Hs#S3438804 Homo sapiens cytochrome b reductase 1 (CYBRD1... 38 0.82
Alignment gnl|UG|Mm#S17053510 Mus musculus mRNA for mKIAA0921 protein /gb=... 38 0.82
Alignment gnl|UG|Mm#S9707717 Mus musculus RIKEN cDNA 1500011H22 gene (1500... 38 0.82
Alignment gnl|UG|Hs#S17090776 Homo sapiens chromosome 14 open reading fram... 36 3.2
>gnl|UG|Hs#S5979193 Homo sapiens hypothetical protein MGC20446
(MGC20446), mRNA /cds=(264,992) /gb=NM_153611
/gi=23957705 /ug=Hs.22546 /len=2583
Length = 2583
Score = 297 bits (150), Expect = 5e-79
Identities = 401/482 (83%), Gaps = 2/482 (0%)
Strand = Plus / Plus
Query: 473 tccctgggctccatgtgcatcctctccaccatctattggatgcggtactggcacgaaggc 532
||||||||||| ||||||||||||| ||| ||||| ||||||| |||||||| | |||
Sbjct: 306 tccctgggctctatgtgcatcctcttcactatctactggatgcagtactggcgtggtggc 365
Query: 533 tttgcctgagatggcaccatactcacgttcaactggcacccggtgctcatggtgactggc 592
|||||||| |||||| ||| || ||||||||||||||| ||||| ||||| |||||
Sbjct: 366 tttgcctggaatggcagcatctacatgttcaactggcacccagtgcttatggttgctggc 425
Query: 593 atggtggtgctctacagtgctgcgtcactggcgtaccgcctgccccagtcatgggtaggg 652
|||||||| |||| | | ||||||||||| |||||||||||||||||| ||||| |||
Sbjct: 426 atggtggtattctatggaggtgcgtcactggtgtaccgcctgccccagtcgtgggtgggg 485
Query: 653 cccaagctgccctggaagttgggccacgcagccatgcacctgatggccttcatcctgact 712
||||| ||||||||||| | ||| ||||| ||||||||||||||||| |||| |||
Sbjct: 486 cccaaactgccctggaaactcctccatgcagcgctgcacctgatggccttcgtcctcact 545
Query: 713 gtgctggggctggcgggcgtctttaactctcacaaccacgagaagatccccaacctctac 772
|| ||||||||| | ||||||| | ||||||||| | | || |||||||||||
Sbjct: 546 gttgtggggctggttgctgtctttacgtttcacaaccatggaaggactgccaacctctac 605
Query: 773 tccctgcacagctggctgggcatcaccaccgtcttcctcttcgcctgccagtggttcttg 832
||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| ||
Sbjct: 606 tcccttcacagctggctgggcatcaccactgtcttcctcttcgcctgccagtggttcctg 665
Query: 833 gggcttgtggtctttctgctgcccctgggcgtctgtgcggctgcgcagcctccttaaacc 892
|| ||| ||||| || ||| ||||||||||| || |||||||||||||||| |||||
Sbjct: 666 ggctttgctgtcttcctcctg-ccctgggcgtccatgtggctgcgcagcctcctaaaacc 724
Query: 893 catccacgtcctctttggagcc-tcattctctctctggccattgcgtctgtcatttccgg 951
||||||||| | ||||||||| ||| ||||||||| |||| || || |||||||| ||
Sbjct: 725 tatccacgtcttttttggagccgccatcctctctctgtccatcgcatccgtcatttcggg 784
Query: 952 ca 953
||
Sbjct: 785 ca 786
Score = 40.1 bits (20), Expect = 0.21
Identities = 68/84 (80%)
Strand = Plus / Plus
Query: 79 ctcgggagctgcggctccggcgccaggtggcaagacgcgggtctcggagacgccagcctc 138
||||||||| || ||||||||||| ||| || ||| |||||| |||||| || |||||
Sbjct: 70 ctcgggagcggcagctccggcgcctggtagcgagaggcgggttccggagatcccggcctc 129
Query: 139 cgtgcatcccactgtggttcgggg 162
| | ||||||||||||| ||||
Sbjct: 130 acttcgtcccactgtggttagggg 153
>gnl|UG|Mm#S11072786 Mus musculus similar to hypothetical protein
MGC20446 (LOC225912), mRNA /cds=(67,840) /gb=XM_129187
/gi=38084851 /ug=Mm.252701 /len=1674
Length = 1674
Score = 192 bits (97), Expect = 2e-47
Identities = 336/413 (81%), Gaps = 2/413 (0%)
Strand = Plus / Plus
Query: 423 tgatcagaatggctgtgggatggttttacctgtcggccctggcgctgttctccctgggct 482
|||||||||||||| ||||||||||||||||| | ||| |||| || ||||| |
Sbjct: 59 tgatcagaatggcttcaggatggttttacctgtcctgcatggtgctgggatcgctgggat 118
Query: 483 ccatgtgcatcctctccaccatctattggatgcggtactggcacgaaggctttgcctgag 542
| ||||||||||||| ||| ||| ||||||| |||||||| || ||||||||||| |
Sbjct: 119 cgatgtgcatcctcttcactgcctactggatgcagtactggcgcggtggctttgcctggg 178
Query: 543 atggcaccatactcacgttcaactggcacccggtgctcatggtgactggcatggtggtgc 602
||||||| | |||| ||| ||||||||||| ||||||||||| | |||||||||||||
Sbjct: 179 atggcacggtgctcatgtttaactggcacccagtgctcatggttgccggcatggtggtgc 238
Query: 603 tctacagtgctgcgtcactggcgtaccgcctgccccagtcatgggtagggcccaagctgc 662
|||| | ||||| ||||||| |||||||||||| || ||||| ||||||| |||||
Sbjct: 239 tctatggagctgcctcactggtgtaccgcctgccttcatcgtgggtggggcccaggctgc 298
Query: 663 cctggaagttgggccacgcagccatgcacctgatggccttcatcctg-actgtgctgggg 721
||||||| | ||| ||||| |||||||| ||||||||| |||| |||||| |||||
Sbjct: 299 cctggaaagttctccatgcagcactgcacctgctggccttca-cctgcactgtggtgggg 357
Query: 722 ctggcgggcgtctttaactctcacaaccacgagaagatccccaacctctactccctgcac 781
||| | ||||||| | |||||||||| || ||| | |||||||||||||||||
Sbjct: 358 ctgattgccgtctttcggtttcacaaccactcgagaatcgcacacctctactccctgcac 417
Query: 782 agctggctgggcatcaccaccgtcttcctcttcgcctgccagtggttcttggg 834
||||||||||| |||||||| || ||||||||||||||||||||||| ||||
Sbjct: 418 agctggctgggtatcaccactgtagtcctcttcgcctgccagtggttcctggg 470
>gnl|UG|Hs#S5500502 UI-H-FG1-bgk-d-05-0-UI.s1 NCI_CGAP_FG1 Homo
sapiens cDNA clone UI-H-FG1-bgk-d-05-0-UI 3', mRNA
sequence /clone=UI-H-FG1-bgk-d-05-0-UI /clone_end=3'
/gb=BU624544 /gi=23290759 /ti=159708507 /ug=Hs.519622
/len=1088
Length = 1088
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 580 catggtgactggcatggtgg 599
||||||||||||||||||||
Sbjct: 336 catggtgactggcatggtgg 355
>gnl|UG|Hs#S6159062 Homo sapiens nucleoporin 50kDa (NUP50), transcript
variant 1, mRNA /cds=(703,2025) /gb=NM_153684
/gi=24497448 /ug=Hs.362841 /len=2210
Length = 2210
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 580 catggtgactggcatggtgg 599
||||||||||||||||||||
Sbjct: 1953 catggtgactggcatggtgg 1934
>gnl|UG|Hs#S11128360 BX101748 NCI_CGAP_GCB1 Homo sapiens cDNA clone
IMAGp998C193244, mRNA sequence
/clone=IMAGp998C193244_;_IMAGE:1287882 /gb=BX101748
/gi=27831353 /ug=Hs.325890 /len=511
Length = 511
Score = 40.1 bits (20), Expect = 0.21
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 432 tggctgtgggatggttttac 451
||||||||||||||||||||
Sbjct: 505 tggctgtgggatggttttac 486
>gnl|UG|Mm#S8040876 Mus musculus calcium channel, voltage-dependent,
P/Q type, alpha 1A subunit (Cacna1a), mRNA /cds=(1,6495)
/gb=NM_007578 /gi=6680819 /ug=Mm.208735 /len=6495
Length = 6495
Score = 40.1 bits (20), Expect = 0.21
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 480 gctccatgtgcatcctctccacca 503
||||||||| ||||||||||||||
Sbjct: 3374 gctccatgttcatcctctccacca 3397
>gnl|UG|Hs#S3438804 Homo sapiens cytochrome b reductase 1 (CYBRD1),
mRNA /cds=(74,934) /gb=NM_024843 /gi=19923602
/ug=Hs.31297 /len=4254
Length = 4254
Score = 38.2 bits (19), Expect = 0.82
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 563 aactggcacccggtgctcatggt 585
||||||||||| |||||||||||
Sbjct: 215 aactggcacccagtgctcatggt 237
>gnl|UG|Mm#S17053510 Mus musculus mRNA for mKIAA0921 protein
/gb=AK129239 /gi=37360141 /ug=Mm.255961 /len=5118
Length = 5118
Score = 38.2 bits (19), Expect = 0.82
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 437 gtgggatggttttacctgt 455
|||||||||||||||||||
Sbjct: 3773 gtgggatggttttacctgt 3791
>gnl|UG|Mm#S9707717 Mus musculus RIKEN cDNA 1500011H22 gene
(1500011H22Rik), mRNA /cds=(409,1164) /gb=NM_026883
/gi=21312148 /ug=Mm.27662 /len=1373
Length = 1373
Score = 38.2 bits (19), Expect = 0.82
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 222 cccgagttcctggagctgt 240
|||||||||||||||||||
Sbjct: 308 cccgagttcctggagctgt 290
>gnl|UG|Hs#S17090776 Homo sapiens chromosome 14 open reading frame 25
(C14orf25), mRNA /cds=(210,1220) /gb=XM_350932
/gi=37545927 /ug=Hs.497119 /len=1220
Length = 1220
Score = 36.2 bits (18), Expect = 3.2
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 467 ctgttctccctgggctcc 484
||||||||||||||||||
Sbjct: 1010 ctgttctccctgggctcc 993
Database: UniGene(Bt+Hs+Ssc+Mm)
Posted date: Jan 30, 2004 10:32 AM
Number of letters in database: 272,110,533
Number of sequences in database: 238,354
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 163,901
Number of Sequences: 238354
Number of extensions: 163901
Number of successful extensions: 13673
Number of sequences better than 10.0: 31
length of query: 953
length of database: 272,110,533
effective HSP length: 19
effective length of query: 934
effective length of database: 267,581,807
effective search space: 249921407738
effective search space used: 249921407738
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)