Search to UniGene2 database
Query= 20050322C-006005 (20050322C-006005) 20050322C-006005
(1281 letters)
Database: UniGene(Bt+Hs+Ssc+Mm)
151,043 sequences; 222,131,506 total letters
Searching...................................................done
Score E
Sequences producing significant alignments: (bits) Value
Alignment gnl|UG|Hs#S2294018 Homo sapiens LanC lantibiotic synthetase comp... 737 0.0
Alignment gnl|UG|Mm#S7116296 M.musculus SCH mRNA for schwannomin /cds=p(57... 44 0.015
Alignment gnl|UG|Bt#S21669081 BovGen_06533 normal cattle brain Bos taurus ... 42 0.058
Alignment gnl|UG|Mm#S10844877 Mus musculus 16 days neonate cerebellum cDNA... 40 0.23
Alignment gnl|UG|Hs#S4809526 PREDICTED: Homo sapiens similar to RIKEN cDNA... 38 0.90
Alignment gnl|UG|Hs#S3333525 Homo sapiens mRNA for KIAA1703 protein, parti... 38 0.90
Alignment gnl|UG|Hs#S3619738 Homo sapiens TEA domain family member 3 (TEAD... 38 0.90
Alignment gnl|UG|Hs#S3618492 Homo sapiens T-box 1 transcription factor C (... 38 0.90
Alignment gnl|UG|Hs#S1970043 Homo sapiens cDNA FLJ20778 fis, clone COL0570... 38 0.90
Alignment gnl|UG|Hs#S2138742 Homo sapiens protein phosphatase 2A 48 kDa re... 38 0.90
>gnl|UG|Hs#S2294018 Homo sapiens LanC lantibiotic synthetase component
C-like 2 (bacterial) (LANCL2), mRNA /cds=p(579,1931)
/gb=NM_018697 /gi=50593015 /ug=Hs.224282 /len=4353
Length = 4353
Score = 737 bits (372), Expect = 0.0
Identities = 686/788 (87%), Gaps = 2/788 (0%)
Strand = Plus / Plus
Query: 442 cggaggagctcggcctccctttcca-cagcgacgggaagatcattcataatttcacaagg 500
|||| |||| |||||||||||| || ||| ||||||||||||||||||||||||| |||
Sbjct: 745 cggatgagcccggcctcccttttcatcag-gacgggaagatcattcataatttcataaga 803
Query: 501 cggatccagagcaaaatcaaagatcttctacagcagatggaagaagggctgaagacagct 560
|||||||||| |||||| ||||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 804 cggatccagaccaaaattaaagatcttctgcagcaaatggaagaagggctgaagacagct 863
Query: 561 gatccgcacgattgctctgcttacacgggttggacaggcatagcccttttgtaccttcag 620
||||| || || ||||||||||| || || |||||||||||||||||||||||||| |||
Sbjct: 864 gatccccatgactgctctgcttatactggctggacaggcatagcccttttgtacctgcag 923
Query: 621 ttgtaccgggtcacatgtgaccagaactatctgctccgatccctggattacgtaaaaaga 680
||||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||
Sbjct: 924 ttgtaccgggtcacatgtgaccaaacctacctgctccgatccctggattacgtaaaaaga 983
Query: 681 acacttcggaatctgaacggccggagggtcactttcctctgtggagatgccgggcccctg 740
||||||||||||||||| ||||| |||||||| ||||||||||| ||||| || ||||||
Sbjct: 984 acacttcggaatctgaatggccgcagggtcaccttcctctgtggggatgctggccccctg 1043
Query: 741 gccgtcggagctgtggtgtatcacaaactcaaaagtgatggcgagtcccaggaatgcatc 800
|| || ||||||||| | ||||||||||||| |||||| | |||||||||||||| ||
Sbjct: 1044 gctgttggagctgtgatttatcacaaactcagaagtgactgtgagtcccaggaatgtgtc 1103
Query: 801 acaaaactcctgcagctccagagaaccatcgtctgccgcgactcggaccttcccgatgag 860
|||||||| |||||||||||||| | | ||||||| || || |||||||| ||||||
Sbjct: 1104 acaaaacttttgcagctccagagatcggttgtctgccaagaatcagaccttcctgatgag 1163
Query: 861 ctgcttttcggccgcgcgggctacctgtacgccttgctctatgtgaacacggagatgggt 920
||||||| || || || || || ||||| ||||| || || ||||||| ||||| |||
Sbjct: 1164 ctgctttatggacgggcaggttatctgtatgccttactgtacctgaacacagagataggt 1223
Query: 921 ccgggcgccgtgtgcgaatcagccatcaaagaggtggtcgatgctattattgaatcgggc 980
|| ||| ||||||| || ||||| || |||||||| ||| |||||||||||||||||||
Sbjct: 1224 ccaggcaccgtgtgtgagtcagctattaaagaggtagtcaatgctattattgaatcgggt 1283
Query: 981 aagactttgtcaaaggaagaaaggaaggccgagcgctgccccctgttgtaccagtggcac 1040
||||||||||||| ||||||||| || | ||||||||||| ||||||||||||||||||
Sbjct: 1284 aagactttgtcaagggaagaaagaaaaacggagcgctgcccgctgttgtaccagtggcac 1343
Query: 1041 aggaagcagtacgtcggagccgcccacggcatggctgggatctactacatgctaatgcag 1100
||||||||||||| ||||| ||||| ||||||||||| || ||||| ||| ||||||||
Sbjct: 1344 cggaagcagtacgttggagcagcccatggcatggctggaatttactatatgttaatgcag 1403
Query: 1101 ccagcagcaaaagtggaccaagaaaccttgacagagatggtgaagcctagtattgactac 1160
|| |||||||||||||||||||||||||||||||| |||||||| || |||||||| ||
Sbjct: 1404 ccggcagcaaaagtggaccaagaaaccttgacagaaatggtgaaacccagtattgattat 1463
Query: 1161 atgcgccacaaaaggttccgatccggaaactacccatcctcgttaagcaacgagacagac 1220
|||||||||||| |||||||| || || |||||||| || |||||||| || ||||||
Sbjct: 1464 gtgcgccacaaaaaattccgatctgggaattacccatcatcattaagcaatgaaacagac 1523
Query: 1221 cgcctggt 1228
|| |||||
Sbjct: 1524 cggctggt 1531
Score = 69.9 bits (35), Expect = 3e-10
Identities = 50/55 (90%)
Strand = Plus / Plus
Query: 342 gaaatggaggagcgggcgttccccaaccctttcccggactacgaggccgcggccg 396
||||||||||| ||||||||| |||||| |||||||||||||||||||| ||||
Sbjct: 630 gaaatggaggaacgggcgttcgtcaaccccttcccggactacgaggccgccgccg 684
Score = 42.1 bits (21), Expect = 0.058
Identities = 30/33 (90%)
Strand = Plus / Plus
Query: 226 ggaggtttgtccccgctcgctcgccgtagcgcg 258
|||||||||||||||| ||| ||||||| ||||
Sbjct: 540 ggaggtttgtccccgcccgcgcgccgtaccgcg 572
>gnl|UG|Mm#S7116296 M.musculus SCH mRNA for schwannomin
/cds=p(577,2367) /gb=X74671 /gi=456656 /ug=Mm.297109
/len=2604
Length = 2604
Score = 44.1 bits (22), Expect = 0.015
Identities = 25/26 (96%)
Strand = Plus / Plus
Query: 111 gtccggagccggggcggggcggggcg 136
|||||||| |||||||||||||||||
Sbjct: 64 gtccggaggcggggcggggcggggcg 89
>gnl|UG|Bt#S21669081 BovGen_06533 normal cattle brain Bos taurus cDNA
clone RZPDp1056M0826Q 5', mRNA sequence
/clone=RZPDp1056M0826Q /clone_end=5' /gb=CO878208
/gi=51808124 /ug=Bt.35028 /len=676
Length = 676
Score = 42.1 bits (21), Expect = 0.058
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 1204 taagcaacgagacagaccgcctggt 1228
||||||| |||||||||||||||||
Sbjct: 30 taagcaatgagacagaccgcctggt 54
>gnl|UG|Mm#S10844877 Mus musculus 16 days neonate cerebellum cDNA,
RIKEN full-length enriched library, clone:9630047F15
product:trans-acting transcription factor 5, full insert
sequence /cds=p(344,1540) /gb=AK036234 /gi=26331249
/ug=Mm.308089 /len=2097
Length = 2097
Score = 40.1 bits (20), Expect = 0.23
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 110 cgtccggagccggggcgggg 129
||||||||||||||||||||
Sbjct: 899 cgtccggagccggggcgggg 880
>gnl|UG|Hs#S4809526 PREDICTED: Homo sapiens similar to RIKEN cDNA
0610009J22 (LOC200312), mRNA /cds=p(1,1563)
/gb=XM_117224 /gi=51475992 /ug=Hs.549272 /len=1890
Length = 1890
Score = 38.2 bits (19), Expect = 0.90
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 118 gccggggcggggcggggcg 136
|||||||||||||||||||
Sbjct: 577 gccggggcggggcggggcg 595
>gnl|UG|Hs#S3333525 Homo sapiens mRNA for KIAA1703 protein, partial
cds. /cds=p(1,3500) /gb=AB051490 /gi=12697950
/ug=Hs.536490 /len=4701
Length = 4701
Score = 38.2 bits (19), Expect = 0.90
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 417 ccatgtgctcgccctgcgc 435
|||||||||||||||||||
Sbjct: 3153 ccatgtgctcgccctgcgc 3135
>gnl|UG|Hs#S3619738 Homo sapiens TEA domain family member 3 (TEAD3),
mRNA /cds=p(161,1468) /gb=NM_003214 /gi=42490752
/ug=Hs.485205 /len=2947
Length = 2947
Score = 38.2 bits (19), Expect = 0.90
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 202 gcggcccggccggagcgcc 220
|||||||||||||||||||
Sbjct: 75 gcggcccggccggagcgcc 93
>gnl|UG|Hs#S3618492 Homo sapiens T-box 1 transcription factor C
(TBX1C) mRNA, complete cds /cds=p(130,1617) /gb=AF373867
/gi=14289454 /ug=Hs.173984 /len=2082
Length = 2082
Score = 38.2 bits (19), Expect = 0.90
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 196 tcgcccgcggcccggccgg 214
|||||||||||||||||||
Sbjct: 1944 tcgcccgcggcccggccgg 1962
>gnl|UG|Hs#S1970043 Homo sapiens cDNA FLJ20778 fis, clone COL05704
/cds=p(385,2283) /gb=AK000785 /gi=7021086 /ug=Hs.165904
/len=2943
Length = 2943
Score = 38.2 bits (19), Expect = 0.90
Identities = 25/27 (92%)
Strand = Plus / Plus
Query: 112 tccggagccggggcggggcggggcgcc 138
|||||| ||||||| ||||||||||||
Sbjct: 2340 tccggacccggggctgggcggggcgcc 2366
>gnl|UG|Hs#S2138742 Homo sapiens protein phosphatase 2A 48 kDa
regulatory subunit (PR48), transcript variant 1, mRNA
/cds=p(202,1929) /gb=NM_013239 /gi=41349492
/ug=Hs.124942 /len=2071
Length = 2071
Score = 38.2 bits (19), Expect = 0.90
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 119 ccggggcggggcggggcgc 137
|||||||||||||||||||
Sbjct: 148 ccggggcggggcggggcgc 166
Database: UniGene(Bt+Hs+Ssc+Mm)
Posted date: Mar 18, 2005 8:01 PM
Number of letters in database: 222,131,506
Number of sequences in database: 151,043
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
length of query: 1281
length of database: 222,131,506
effective HSP length: 19
effective length of query: 1262
effective length of database: 219,261,689
effective search space: 276708251518
effective search space used: 276708251518
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)