Search to UniGene2 database
Query= 20050322C-008086 (20050322C-008086) 20050322C-008086
(1036 letters)
Database: UniGene(Bt+Hs+Ssc+Mm)
151,043 sequences; 222,131,506 total letters
Searching...................................................done
Score E
Sequences producing significant alignments: (bits) Value
Alignment gnl|UG|Bt#S11835419 10659 MARC 3BOV Bos taurus cDNA 5', mRNA seq... 454 e-126
Alignment gnl|UG|Hs#S19656269 Homo sapiens cytochrome b, ascorbate depende... 260 1e-67
Alignment gnl|UG|Mm#S18353595 Mus musculus cytochrome b, ascorbate depende... 184 5e-45
Alignment gnl|UG|Mm#S9632520 Mus musculus Cacna1a mRNA for CaV2.1, complet... 40 0.18
Alignment gnl|UG|Mm#S11066475 Mus musculus adult male testis cDNA, RIKEN f... 40 0.18
Alignment gnl|UG|Hs#S3335345 Homo sapiens mRNA; cDNA DKFZp564E227 (from cl... 38 0.73
Alignment gnl|UG|Mm#S11081930 PREDICTED: Mus musculus neurexin II (Nrxn2),... 38 0.73
Alignment gnl|UG|Mm#S10865269 Mus musculus 3 days neonate thymus cDNA, RIK... 38 0.73
Alignment gnl|UG|Mm#S9084071 Mus musculus adult male cerebellum cDNA, RIKE... 38 0.73
Alignment gnl|UG|Hs#S16886035 Homo sapiens cDNA FLJ44713 fis, clone BRACE3... 36 2.9
>gnl|UG|Bt#S11835419 10659 MARC 3BOV Bos taurus cDNA 5', mRNA
sequence /clone_end=5' /gb=AW314509 /gi=6743756
/ti=434440072 /ug=Bt.1479 /len=1097
Length = 1097
Score = 454 bits (229), Expect = e-126
Identities = 360/401 (89%), Gaps = 2/401 (0%)
Strand = Plus / Plus
Query: 528 tgcctgatcagaatggctgtgggatggttttacctgtcggccctggcgctgttctccctg 587
|||||| |||||||||| ||||||| |||||||||||| | |||||| |||| |||||||
Sbjct: 202 tgcctggtcagaatggccgtgggatagttttacctgtctgtcctggcactgtgctccctg 261
Query: 588 ggctccatgtgcatcctctccaccatctattggatgcggtactggcacaaaggctttgcc 647
||||| ||||||||||||| ||||||||| ||||||||||||||||| ||||| |||
Sbjct: 262 ggctcgatgtgcatcctcttcaccatctactggatgcggtactggcatggtggcttcgcc 321
Query: 648 tgggatggcaccatactcacgttcaactggcacccggtgctcatggtgactggcatggtg 707
|||||||||| ||| |||| ||||||||||||||||||||||||||| || |||||||||
Sbjct: 322 tgggatggcagcatgctcatgttcaactggcacccggtgctcatggttacaggcatggtg 381
Query: 708 gtgctctacagtgctgcgtcgctggcgtaccgcctgccccagtcatgggtagggcccaag 767
||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||||| |
Sbjct: 382 gtgctctacagcgctgcatcgctggtctaccgcctgccccagtcatgggtagggcccagg 441
Query: 768 ctgccctggaagttgggccacgcagccatgcacctgatggccttcatcctgactgtgctg 827
||||||||||| | ||||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 442 ctgccctggaaatccggccacgcagccatgcacctgctggccttcctcctgactgtgctg 501
Query: 828 gggctggcggccgtctttaactttcacaaccacgagaagatccccaacctctactccctg 887
|||||| || |||||| | ||||||||||||| ||||||||| ||||||||||||||
Sbjct: 502 gggctgcacgcggtctttgaatttcacaaccacgcaaagatcccccacctctactccctg 561
Query: 888 cacagct-ggctgggca-tcaccaccgtcttcctctttcgc 926
||||||| ||||||||| |||||||||||||||||||||||
Sbjct: 562 cacagctgggctgggcattcaccaccgtcttcctctttcgc 602
Score = 73.8 bits (37), Expect = 1e-11
Identities = 73/85 (85%)
Strand = Plus / Plus
Query: 80 ctcgggagctgcggctccggcgccaggtggcaagacgcgggtctcggagacgccagcctc 139
||||||||| |||||||||| || | |||||||| |||||||||||||| |||| | |
Sbjct: 115 ctcgggagcagcggctccggggcgggttggcaagagacgggtctcggagaccccagtccc 174
Query: 140 cgtgcatcccactgtggttcggggg 164
| ||| |||||||||||||||||||
Sbjct: 175 cttgcgtcccactgtggttcggggg 199
>gnl|UG|Hs#S19656269 Homo sapiens cytochrome b, ascorbate dependent 3,
mRNA (cDNA clone MGC:10970 IMAGE:3634997), complete cds
/cds=p(637,1365) /gb=BC004391 /gi=46255811 /ug=Hs.22546
/len=2994
Length = 2994
Score = 260 bits (131), Expect = 1e-67
Identities = 365/439 (83%), Gaps = 3/439 (0%)
Strand = Plus / Plus
Query: 582 tccctgggctccatgtgcatcctctccaccatctattggatgcggtactggcacaaaggc 641
||||||||||| ||||||||||||| ||| ||||| ||||||| |||||||| |||
Sbjct: 679 tccctgggctctatgtgcatcctcttcactatctactggatgcagtactggcgtggtggc 738
Query: 642 tttgcctgggatggcaccatactcacgttcaactggcacccggtgctcatggtgactggc 701
||||||||| |||||| ||| || ||||||||||||||| ||||| ||||| |||||
Sbjct: 739 tttgcctggaatggcagcatctacatgttcaactggcacccagtgcttatggttgctggc 798
Query: 702 atggtggtgctctacagtgctgcgtcgctggcgtaccgcctgccccagtcatgggtaggg 761
|||||||| |||| | | |||||| |||| |||||||||||||||||| ||||| |||
Sbjct: 799 atggtggtattctatggaggtgcgtcactggtgtaccgcctgccccagtcgtgggtgggg 858
Query: 762 cccaagctgccctggaagttgggccacgcagccatgcacctgatggccttcatcctgact 821
||||| ||||||||||| | ||| ||||| ||||||||||||||||| |||| |||
Sbjct: 859 cccaaactgccctggaaactcctccatgcagcgctgcacctgatggccttcgtcctcact 918
Query: 822 gtgctggggctggcggccgtctttaactttcacaaccacgagaagatccccaacctctac 881
|| ||||||||| || ||||||| ||||||||||| | | || |||||||||||
Sbjct: 919 gttgtggggctggttgctgtctttacgtttcacaaccatggaaggactgccaacctctac 978
Query: 882 tccctgcacagctggctgggcatcaccaccgtcttcctctttcgcctg-cagtgggtctt 940
||||| |||||||||||||||| |||||| ||||||||| |||||||| |||||| || |
Sbjct: 979 tcccttcacagctggctgggcaccaccactgtcttcctc-ttcgcctgccagtggttcct 1037
Query: 941 gggctttgtggtctttctgctgccctgggcgtctgtgccgctgcgcagcct-cttaaacc 999
|||||||| ||||| || |||||||||||||| || |||||||||||| || |||||
Sbjct: 1038 gggctttgctgtcttcctcctgccctgggcgtccatgtggctgcgcagcctcctaaaacc 1097
Query: 1000 catccacgtcttctttgga 1018
||||||||||| ||||||
Sbjct: 1098 tatccacgtcttttttgga 1116
Score = 40.1 bits (20), Expect = 0.18
Identities = 68/84 (80%)
Strand = Plus / Plus
Query: 80 ctcgggagctgcggctccggcgccaggtggcaagacgcgggtctcggagacgccagcctc 139
||||||||| || ||||||||||| ||| || ||| |||||| |||||| || |||||
Sbjct: 443 ctcgggagcggcagctccggcgcctggtagcgagaggcgggttccggagatcccggcctc 502
Query: 140 cgtgcatcccactgtggttcgggg 163
| | ||||||||||||| ||||
Sbjct: 503 acttcgtcccactgtggttagggg 526
>gnl|UG|Mm#S18353595 Mus musculus cytochrome b, ascorbate dependent 3,
mRNA (cDNA clone MGC:86114 IMAGE:6817093), complete cds
/cds=p(570,1298) /gb=BC065078 /gi=40787720 /ug=Mm.252701
/len=2597
Length = 2597
Score = 184 bits (93), Expect = 5e-45
Identities = 358/441 (81%), Gaps = 4/441 (0%)
Strand = Plus / Plus
Query: 532 tgatcagaatggctgtgggatggttttacctgtcggccctggcgctgttctccctgggct 591
|||||||||||||| ||||||||||||||||| | ||| |||| || ||||| |
Sbjct: 562 tgatcagaatggcttcaggatggttttacctgtcctgcatggtgctgggatcgctgggat 621
Query: 592 ccatgtgcatcctctccaccatctattggatgcggtactggcacaaaggctttgcctggg 651
| ||||||||||||| ||| ||| ||||||| |||||||| | |||||||||||||
Sbjct: 622 cgatgtgcatcctcttcactgcctactggatgcagtactggcgcggtggctttgcctggg 681
Query: 652 atggcaccatactcacgttcaactggcacccggtgctcatggtgactggcatggtggtgc 711
||||||| | |||| ||| ||||||||||| ||||||||||| | |||||||||||||
Sbjct: 682 atggcacggtgctcatgtttaactggcacccagtgctcatggttgccggcatggtggtgc 741
Query: 712 tctacagtgctgcgtcgctggcgtaccgcctgccccagtcatgggtagggcccaagctgc 771
|||| | ||||| || |||| |||||||||||| || ||||| ||||||| |||||
Sbjct: 742 tctatggagctgcctcactggtgtaccgcctgccttcatcgtgggtggggcccaggctgc 801
Query: 772 cctggaagttgggccacgcagccatgcacctgatggccttcatcctg-actgtgctgggg 830
||||||| | ||| ||||| |||||||| ||||||||| |||| |||||| |||||
Sbjct: 802 cctggaaagttctccatgcagcactgcacctgctggccttca-cctgcactgtggtgggg 860
Query: 831 ctggcggccgtctttaactttcacaaccacgagaagatccccaacctctactccctgcac 890
||| ||||||||| |||||||||||| || ||| | |||||||||||||||||
Sbjct: 861 ctgattgccgtctttcggtttcacaaccactcgagaatcgcacacctctactccctgcac 920
Query: 891 agctggctgggcatcaccaccgtcttcctctttcgcctg-cagtgggtcttgggctttgt 949
||||||||||| |||||||| || ||||| |||||||| |||||| || |||||||||
Sbjct: 921 agctggctgggtatcaccactgtagtcctc-ttcgcctgccagtggttcctgggctttgc 979
Query: 950 ggtctttctgctgccctgggc 970
||||| || |||||||||||
Sbjct: 980 tgtcttcctcctgccctgggc 1000
>gnl|UG|Mm#S9632520 Mus musculus Cacna1a mRNA for CaV2.1, complete
cds, clone:MPII. /cds=p(55,7152) /gb=AB066609
/gi=18958262 /ug=Mm.334658 /len=7378
Length = 7378
Score = 40.1 bits (20), Expect = 0.18
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 589 gctccatgtgcatcctctccacca 612
||||||||| ||||||||||||||
Sbjct: 3572 gctccatgttcatcctctccacca 3595
>gnl|UG|Mm#S11066475 Mus musculus adult male testis cDNA, RIKEN
full-length enriched library, clone:4930535O05
product:unclassifiable, full insert sequence
/gb=AK015983 /gi=12854544 /ug=Mm.261414 /len=422
Length = 422
Score = 40.1 bits (20), Expect = 0.18
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 402 cttctagggagatgagaagactgagtcc 429
||||||| |||||||||||||||||||
Sbjct: 134 cttctagacagatgagaagactgagtcc 161
>gnl|UG|Hs#S3335345 Homo sapiens mRNA; cDNA DKFZp564E227 (from clone
DKFZp564E227) /cds=p(74,934) /gb=AL136693 /gi=12052907
/ug=Hs.221941 /len=4254
Length = 4254
Score = 38.2 bits (19), Expect = 0.73
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 672 aactggcacccggtgctcatggt 694
||||||||||| |||||||||||
Sbjct: 215 aactggcacccagtgctcatggt 237
>gnl|UG|Mm#S11081930 PREDICTED: Mus musculus neurexin II (Nrxn2), mRNA
/cds=p(1,4983) /gb=XM_111780 /gi=51771720 /ug=Mm.329616
/len=5120
Length = 5120
Score = 38.2 bits (19), Expect = 0.73
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 546 gtgggatggttttacctgt 564
|||||||||||||||||||
Sbjct: 3192 gtgggatggttttacctgt 3210
>gnl|UG|Mm#S10865269 Mus musculus 3 days neonate thymus cDNA, RIKEN
full-length enriched library, clone:A630089G19
product:hypothetical Conserved hypothetical ATP binding
protein containing protein, full insert sequence
/gb=AK042405 /gi=26089012 /ug=Mm.266328 /len=2199
Length = 2199
Score = 38.2 bits (19), Expect = 0.73
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 223 cccgagttcctggagctgt 241
|||||||||||||||||||
Sbjct: 174 cccgagttcctggagctgt 192
>gnl|UG|Mm#S9084071 Mus musculus adult male cerebellum cDNA, RIKEN
full-length enriched library, clone:1500011H22
product:hypothetical protein, full insert sequence
/cds=p(409,1164) /gb=AK005211 /gi=12837613 /ug=Mm.27662
/len=1373
Length = 1373
Score = 38.2 bits (19), Expect = 0.73
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 223 cccgagttcctggagctgt 241
|||||||||||||||||||
Sbjct: 308 cccgagttcctggagctgt 290
>gnl|UG|Hs#S16886035 Homo sapiens cDNA FLJ44713 fis, clone
BRACE3020356 /gb=AK126669 /gi=34533236 /ug=Hs.551367
/len=3820
Length = 3820
Score = 36.2 bits (18), Expect = 2.9
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 490 ccactccgtcagcctgcctcta 511
|||||| |||||||||||||||
Sbjct: 2219 ccactcagtcagcctgcctcta 2198
Database: UniGene(Bt+Hs+Ssc+Mm)
Posted date: Mar 18, 2005 8:01 PM
Number of letters in database: 222,131,506
Number of sequences in database: 151,043
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
length of query: 1036
length of database: 222,131,506
effective HSP length: 19
effective length of query: 1017
effective length of database: 219,261,689
effective search space: 222989137713
effective search space used: 222989137713
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)