Search to UniGene2 database
Query= 20050322C-008469 (20050322C-008469) 20050322C-008469
(843 letters)
Database: UniGene(Bt+Hs+Ssc+Mm)
151,043 sequences; 222,131,506 total letters
Searching...................................................done
Score E
Sequences producing significant alignments: (bits) Value
Alignment gnl|UG|Hs#S16886809 Homo sapiens cDNA FLJ43907 fis, clone TESTI4... 38 0.59
Alignment gnl|UG|Hs#S2652429 Homo sapiens cDNA FLJ14337 fis, clone PLACE40... 38 0.59
Alignment gnl|UG|Mm#S22966390 UI-M-HK0-cut-c-09-0-UI.r1 NIH_BMAP_HK0 Mus m... 38 0.59
Alignment gnl|UG|Ssc#S18358820 911545 MARC 4PIG Sus scrofa cDNA 5', mRNA s... 38 0.59
Alignment gnl|UG|Hs#S3547219 Homo sapiens chromosome 1 open reading frame ... 36 2.3
Alignment gnl|UG|Hs#S4435645 Homo sapiens delta-notch-like EGF repeat-cont... 36 2.3
Alignment gnl|UG|Mm#S8468809 BB377635 RIKEN full-length enriched, 16 days ... 36 2.3
Alignment gnl|UG|Mm#S21693384 PREDICTED: Mus musculus similar to Nuclear r... 36 2.3
Alignment gnl|UG|Mm#S9632571 Mus musculus SERTA domain containing 3 (Serta... 36 2.3
Alignment gnl|UG|Mm#S22421559 Mus musculus leucine-rich repeat kinase 2 (L... 36 2.3
>gnl|UG|Hs#S16886809 Homo sapiens cDNA FLJ43907 fis, clone
TESTI4010789 /cds=p(2218,2778) /gb=AK125895 /gi=34532161
/ug=Hs.516807 /len=4602
Length = 4602
Score = 38.2 bits (19), Expect = 0.59
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 200 tgtcctgtgtcaagcagct 218
|||||||||||||||||||
Sbjct: 1871 tgtcctgtgtcaagcagct 1853
>gnl|UG|Hs#S2652429 Homo sapiens cDNA FLJ14337 fis, clone PLACE4000494
/gb=AK024399 /gi=10436778 /ug=Hs.505141 /len=4588
Length = 4588
Score = 38.2 bits (19), Expect = 0.59
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 253 ggaggctgctacagccttg 271
|||||||||||||||||||
Sbjct: 2306 ggaggctgctacagccttg 2324
>gnl|UG|Mm#S22966390 UI-M-HK0-cut-c-09-0-UI.r1 NIH_BMAP_HK0 Mus
musculus cDNA clone IMAGE:30944888 5', mRNA sequence
/clone=IMAGE:30944888 /clone_end=5' /gb=CX567812
/gi=57594841 /ug=Mm.277289 /len=710
Length = 710
Score = 38.2 bits (19), Expect = 0.59
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 413 ggaaaaacctcttccctat 431
|||||||||||||||||||
Sbjct: 273 ggaaaaacctcttccctat 291
>gnl|UG|Ssc#S18358820 911545 MARC 4PIG Sus scrofa cDNA 5', mRNA
sequence /clone_end=5' /gb=CK454261 /gi=40801475
/ug=Ssc.2936 /len=836
Length = 836
Score = 38.2 bits (19), Expect = 0.59
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 379 ctccaccaaagagcctctg 397
|||||||||||||||||||
Sbjct: 482 ctccaccaaagagcctctg 500
>gnl|UG|Hs#S3547219 Homo sapiens chromosome 1 open reading frame 21
(C1orf21), mRNA /cds=p(469,834) /gb=NM_030806
/gi=40788019 /ug=Hs.497159 /len=10310
Length = 10310
Score = 36.2 bits (18), Expect = 2.3
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 265 agccttgccacttccttt 282
||||||||||||||||||
Sbjct: 1881 agccttgccacttccttt 1898
>gnl|UG|Hs#S4435645 Homo sapiens delta-notch-like EGF
repeat-containing transmembrane (DNER), mRNA
/cds=p(138,2351) /gb=NM_139072 /gi=31542542 /ug=Hs.234074
/len=3308
Length = 3308
Score = 36.2 bits (18), Expect = 2.3
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 752 atttacatttgggttgtttgtt 773
||||||||||| ||||||||||
Sbjct: 3069 atttacatttgagttgtttgtt 3090
>gnl|UG|Mm#S8468809 BB377635 RIKEN full-length enriched, 16 days
embryo head Mus musculus cDNA clone C130090B09 3'.
/clone=C130090B09 /clone_end=3' /gb=BB377635 /gi=9090471
/ug=Mm.361912 /len=342
Length = 342
Score = 36.2 bits (18), Expect = 2.3
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 391 gcctctgcaaaccctgcctcct 412
||||||||||||||| ||||||
Sbjct: 221 gcctctgcaaaccctacctcct 200
>gnl|UG|Mm#S21693384 PREDICTED: Mus musculus similar to Nuclear
receptor binding factor 2 (LOC432912), mRNA
/cds=p(1,1044) /gb=XM_484426 /gi=51768699 /ug=Mm.352726
/len=1813
Length = 1813
Score = 36.2 bits (18), Expect = 2.3
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 511 ttcagcaccaaggagagtgcct 532
|||||||| |||||||||||||
Sbjct: 1739 ttcagcacaaaggagagtgcct 1718
>gnl|UG|Mm#S9632571 Mus musculus SERTA domain containing 3 (Sertad3),
mRNA /cds=p(36,629) /gb=NM_133210 /gi=40254112
/ug=Mm.200120 /len=1356
Length = 1356
Score = 36.2 bits (18), Expect = 2.3
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 391 gcctctgcaaaccctgcctcct 412
||||||||||||||| ||||||
Sbjct: 1131 gcctctgcaaaccctacctcct 1110
>gnl|UG|Mm#S22421559 Mus musculus leucine-rich repeat kinase 2 (Lrrk2)
mRNA, complete cds /cds=p(1,7584) /gb=AY792512
/gi=55740399 /ug=Mm.37558 /len=7584
Length = 7584
Score = 36.2 bits (18), Expect = 2.3
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 795 ttcatcagatgtcttcca 812
||||||||||||||||||
Sbjct: 2027 ttcatcagatgtcttcca 2044
Database: UniGene(Bt+Hs+Ssc+Mm)
Posted date: Mar 18, 2005 8:01 PM
Number of letters in database: 222,131,506
Number of sequences in database: 151,043
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
length of query: 843
length of database: 222,131,506
effective HSP length: 19
effective length of query: 824
effective length of database: 219,261,689
effective search space: 180671631736
effective search space used: 180671631736
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)