Search to UniGene2 database
Query= 20050322S-039735 (20050322S-039735) 20050322S-039735
(952 letters)
Database: UniGene(Bt+Hs+Ssc+Mm)
151,043 sequences; 222,131,506 total letters
Searching...................................................done
Score E
Sequences producing significant alignments: (bits) Value
Alignment gnl|UG|Bt#S11835419 10659 MARC 3BOV Bos taurus cDNA 5', mRNA seq... 422 e-116
Alignment gnl|UG|Hs#S19656269 Homo sapiens cytochrome b, ascorbate depende... 289 1e-76
Alignment gnl|UG|Mm#S18353595 Mus musculus cytochrome b, ascorbate depende... 192 2e-47
Alignment gnl|UG|Mm#S9632520 Mus musculus Cacna1a mRNA for CaV2.1, complet... 40 0.17
Alignment gnl|UG|Hs#S3335345 Homo sapiens mRNA; cDNA DKFZp564E227 (from cl... 38 0.67
Alignment gnl|UG|Mm#S11081930 PREDICTED: Mus musculus neurexin II (Nrxn2),... 38 0.67
Alignment gnl|UG|Mm#S10865269 Mus musculus 3 days neonate thymus cDNA, RIK... 38 0.67
Alignment gnl|UG|Mm#S9084071 Mus musculus adult male cerebellum cDNA, RIKE... 38 0.67
Alignment gnl|UG|Hs#S2650482 Homo sapiens cDNA FLJ12345 fis, clone MAMMA10... 36 2.6
Alignment gnl|UG|Hs#S5517546 Homo sapiens chromosome 14 open reading frame... 36 2.6
>gnl|UG|Bt#S11835419 10659 MARC 3BOV Bos taurus cDNA 5', mRNA
sequence /clone_end=5' /gb=AW314509 /gi=6743756
/ti=434440072 /ug=Bt.1479 /len=1097
Length = 1097
Score = 422 bits (213), Expect = e-116
Identities = 353/397 (88%), Gaps = 2/397 (0%)
Strand = Plus / Plus
Query: 418 tgcctgatcagaatggctgtgggatggttttacctgtcggccctggcgctgttctccctg 477
|||||| |||||||||| ||||||| |||||||||||| | |||||| |||| |||||||
Sbjct: 202 tgcctggtcagaatggccgtgggatagttttacctgtctgtcctggcactgtgctccctg 261
Query: 478 ggctccatgtgcatcctctccaccatctattggatgcggtactggcacgaaggctttgcc 537
||||| ||||||||||||| ||||||||| ||||||||||||||||| | ||||| |||
Sbjct: 262 ggctcgatgtgcatcctcttcaccatctactggatgcggtactggcatggtggcttcgcc 321
Query: 538 tgagatggcaccatactcacgttcaactggcacccggtgctcatggtgactggcatggtg 597
|| ||||||| ||| |||| ||||||||||||||||||||||||||| || |||||||||
Sbjct: 322 tgggatggcagcatgctcatgttcaactggcacccggtgctcatggttacaggcatggtg 381
Query: 598 gtgctctacagtgctgcgtcactggcgtaccgcctgccccagtcatgggtagggcccaag 657
||||||||||| ||||| || |||| ||||||||||||||||||||||||||||||| |
Sbjct: 382 gtgctctacagcgctgcatcgctggtctaccgcctgccccagtcatgggtagggcccagg 441
Query: 658 ctgccctggaagttgggccacgcagccatgcacctgatggccttcatcctgactgtgctg 717
||||||||||| | ||||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 442 ctgccctggaaatccggccacgcagccatgcacctgctggccttcctcctgactgtgctg 501
Query: 718 gggctggcgggcgtctttaactctcacaaccacgagaagatccccaacctctactccctg 777
|||||| | |||||| | | ||||||||||| ||||||||| ||||||||||||||
Sbjct: 502 gggctgcacgcggtctttgaatttcacaaccacgcaaagatcccccacctctactccctg 561
Query: 778 cacagct-ggctgggca-tcaccaccgtcttcctctt 812
||||||| ||||||||| |||||||||||||||||||
Sbjct: 562 cacagctgggctgggcattcaccaccgtcttcctctt 598
Score = 73.8 bits (37), Expect = 1e-11
Identities = 73/85 (85%)
Strand = Plus / Plus
Query: 78 ctcgggagctgcggctccggcgccaggtggcaagacgcgggtctcggagacgccagcctc 137
||||||||| |||||||||| || | |||||||| |||||||||||||| |||| | |
Sbjct: 115 ctcgggagcagcggctccggggcgggttggcaagagacgggtctcggagaccccagtccc 174
Query: 138 cgtgcatcccactgtggttcggggg 162
| ||| |||||||||||||||||||
Sbjct: 175 cttgcgtcccactgtggttcggggg 199
>gnl|UG|Hs#S19656269 Homo sapiens cytochrome b, ascorbate dependent 3,
mRNA (cDNA clone MGC:10970 IMAGE:3634997), complete cds
/cds=p(637,1365) /gb=BC004391 /gi=46255811 /ug=Hs.22546
/len=2994
Length = 2994
Score = 289 bits (146), Expect = 1e-76
Identities = 400/482 (82%), Gaps = 2/482 (0%)
Strand = Plus / Plus
Query: 472 tccctgggctccatgtgcatcctctccaccatctattggatgcggtactggcacgaaggc 531
||||||||||| ||||||||||||| ||| ||||| ||||||| |||||||| | |||
Sbjct: 679 tccctgggctctatgtgcatcctcttcactatctactggatgcagtactggcgtggtggc 738
Query: 532 tttgcctgagatggcaccatactcacgttcaactggcacccggtgctcatggtgactggc 591
|||||||| |||||| ||| || ||||||||||||||| ||||| ||||| |||||
Sbjct: 739 tttgcctggaatggcagcatctacatgttcaactggcacccagtgcttatggttgctggc 798
Query: 592 atggtggtgctctacagtgctgcgtcactggcgtaccgcctgccccagtcatgggtaggg 651
|||||||| |||| | | ||||||||||| |||||||||||||||||| ||||| |||
Sbjct: 799 atggtggtattctatggaggtgcgtcactggtgtaccgcctgccccagtcgtgggtgggg 858
Query: 652 cccaagctgccctggaagttgggccacgcagccatgcacctgatggccttcatcctgact 711
||||| ||||||||||| | ||| ||||| ||||||||||||||||| |||| |||
Sbjct: 859 cccaaactgccctggaaactcctccatgcagcgctgcacctgatggccttcgtcctcact 918
Query: 712 gtgctggggctggcgggcgtctttaactctcacaaccacgagaagatccccaacctctac 771
|| ||||||||| | ||||||| | ||||||||| | | || |||||||||||
Sbjct: 919 gttgtggggctggttgctgtctttacgtttcacaaccatggaaggactgccaacctctac 978
Query: 772 tccctgcacagctggctgggcatcaccaccgtcttcctcttcgcctgccagtggttcttg 831
||||| |||||||||||||||| |||||| ||||||||||||||||||||||||||| ||
Sbjct: 979 tcccttcacagctggctgggcaccaccactgtcttcctcttcgcctgccagtggttcctg 1038
Query: 832 gggcttgtggtctttctgctgcccctgggcgtctgtgcggctgcgcagcctccttaaacc 891
|| ||| ||||| || ||| ||||||||||| || |||||||||||||||| |||||
Sbjct: 1039 ggctttgctgtcttcctcctg-ccctgggcgtccatgtggctgcgcagcctcctaaaacc 1097
Query: 892 catccacgtcctctttggagcc-tcattctctctctggccattgcgtctgtcatttccgg 950
||||||||| | ||||||||| ||| ||||||||| |||| || || |||||||| ||
Sbjct: 1098 tatccacgtcttttttggagccgccatcctctctctgtccatcgcatccgtcatttcggg 1157
Query: 951 ca 952
||
Sbjct: 1158 ca 1159
Score = 40.1 bits (20), Expect = 0.17
Identities = 68/84 (80%)
Strand = Plus / Plus
Query: 78 ctcgggagctgcggctccggcgccaggtggcaagacgcgggtctcggagacgccagcctc 137
||||||||| || ||||||||||| ||| || ||| |||||| |||||| || |||||
Sbjct: 443 ctcgggagcggcagctccggcgcctggtagcgagaggcgggttccggagatcccggcctc 502
Query: 138 cgtgcatcccactgtggttcgggg 161
| | ||||||||||||| ||||
Sbjct: 503 acttcgtcccactgtggttagggg 526
>gnl|UG|Mm#S18353595 Mus musculus cytochrome b, ascorbate dependent
3, mRNA (cDNA clone MGC:86114 IMAGE:6817093), complete
cds /cds=p(570,1298) /gb=BC065078 /gi=40787720
/ug=Mm.252701 /len=2597
Length = 2597
Score = 192 bits (97), Expect = 2e-47
Identities = 336/413 (81%), Gaps = 2/413 (0%)
Strand = Plus / Plus
Query: 422 tgatcagaatggctgtgggatggttttacctgtcggccctggcgctgttctccctgggct 481
|||||||||||||| ||||||||||||||||| | ||| |||| || ||||| |
Sbjct: 562 tgatcagaatggcttcaggatggttttacctgtcctgcatggtgctgggatcgctgggat 621
Query: 482 ccatgtgcatcctctccaccatctattggatgcggtactggcacgaaggctttgcctgag 541
| ||||||||||||| ||| ||| ||||||| |||||||| || ||||||||||| |
Sbjct: 622 cgatgtgcatcctcttcactgcctactggatgcagtactggcgcggtggctttgcctggg 681
Query: 542 atggcaccatactcacgttcaactggcacccggtgctcatggtgactggcatggtggtgc 601
||||||| | |||| ||| ||||||||||| ||||||||||| | |||||||||||||
Sbjct: 682 atggcacggtgctcatgtttaactggcacccagtgctcatggttgccggcatggtggtgc 741
Query: 602 tctacagtgctgcgtcactggcgtaccgcctgccccagtcatgggtagggcccaagctgc 661
|||| | ||||| ||||||| |||||||||||| || ||||| ||||||| |||||
Sbjct: 742 tctatggagctgcctcactggtgtaccgcctgccttcatcgtgggtggggcccaggctgc 801
Query: 662 cctggaagttgggccacgcagccatgcacctgatggccttcatcctg-actgtgctgggg 720
||||||| | ||| ||||| |||||||| ||||||||| |||| |||||| |||||
Sbjct: 802 cctggaaagttctccatgcagcactgcacctgctggccttca-cctgcactgtggtgggg 860
Query: 721 ctggcgggcgtctttaactctcacaaccacgagaagatccccaacctctactccctgcac 780
||| | ||||||| | |||||||||| || ||| | |||||||||||||||||
Sbjct: 861 ctgattgccgtctttcggtttcacaaccactcgagaatcgcacacctctactccctgcac 920
Query: 781 agctggctgggcatcaccaccgtcttcctcttcgcctgccagtggttcttggg 833
||||||||||| |||||||| || ||||||||||||||||||||||| ||||
Sbjct: 921 agctggctgggtatcaccactgtagtcctcttcgcctgccagtggttcctggg 973
>gnl|UG|Mm#S9632520 Mus musculus Cacna1a mRNA for CaV2.1, complete
cds, clone:MPII. /cds=p(55,7152) /gb=AB066609
/gi=18958262 /ug=Mm.334658 /len=7378
Length = 7378
Score = 40.1 bits (20), Expect = 0.17
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 479 gctccatgtgcatcctctccacca 502
||||||||| ||||||||||||||
Sbjct: 3572 gctccatgttcatcctctccacca 3595
>gnl|UG|Hs#S3335345 Homo sapiens mRNA; cDNA DKFZp564E227 (from clone
DKFZp564E227) /cds=p(74,934) /gb=AL136693 /gi=12052907
/ug=Hs.221941 /len=4254
Length = 4254
Score = 38.2 bits (19), Expect = 0.67
Identities = 22/23 (95%)
Strand = Plus / Plus
Query: 562 aactggcacccggtgctcatggt 584
||||||||||| |||||||||||
Sbjct: 215 aactggcacccagtgctcatggt 237
>gnl|UG|Mm#S11081930 PREDICTED: Mus musculus neurexin II (Nrxn2), mRNA
/cds=p(1,4983) /gb=XM_111780 /gi=51771720 /ug=Mm.329616
/len=5120
Length = 5120
Score = 38.2 bits (19), Expect = 0.67
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 436 gtgggatggttttacctgt 454
|||||||||||||||||||
Sbjct: 3192 gtgggatggttttacctgt 3210
>gnl|UG|Mm#S10865269 Mus musculus 3 days neonate thymus cDNA, RIKEN
full-length enriched library, clone:A630089G19
product:hypothetical Conserved hypothetical ATP binding
protein containing protein, full insert sequence
/gb=AK042405 /gi=26089012 /ug=Mm.266328 /len=2199
Length = 2199
Score = 38.2 bits (19), Expect = 0.67
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 221 cccgagttcctggagctgt 239
|||||||||||||||||||
Sbjct: 174 cccgagttcctggagctgt 192
>gnl|UG|Mm#S9084071 Mus musculus adult male cerebellum cDNA, RIKEN
full-length enriched library, clone:1500011H22
product:hypothetical protein, full insert sequence
/cds=p(409,1164) /gb=AK005211 /gi=12837613 /ug=Mm.27662
/len=1373
Length = 1373
Score = 38.2 bits (19), Expect = 0.67
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 221 cccgagttcctggagctgt 239
|||||||||||||||||||
Sbjct: 308 cccgagttcctggagctgt 290
>gnl|UG|Hs#S2650482 Homo sapiens cDNA FLJ12345 fis, clone
MAMMA1002294 /cds=p(29,436) /gb=AK022407 /gi=10433797
/ug=Hs.538498 /len=1661
Length = 1661
Score = 36.2 bits (18), Expect = 2.6
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 837 tgtggtctttctgctgcc 854
||||||||||||||||||
Sbjct: 835 tgtggtctttctgctgcc 852
>gnl|UG|Hs#S5517546 Homo sapiens chromosome 14 open reading frame
25, mRNA (cDNA clone IMAGE:5268731), partial cds
/cds=p(1,1449) /gb=BC038110 /gi=34190831 /ug=Hs.509182
/len=3619
Length = 3619
Score = 36.2 bits (18), Expect = 2.6
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 466 ctgttctccctgggctcc 483
||||||||||||||||||
Sbjct: 879 ctgttctccctgggctcc 862
Database: UniGene(Bt+Hs+Ssc+Mm)
Posted date: Mar 18, 2005 8:01 PM
Number of letters in database: 222,131,506
Number of sequences in database: 151,043
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
length of query: 952
length of database: 222,131,506
effective HSP length: 19
effective length of query: 933
effective length of database: 219,261,689
effective search space: 204571155837
effective search space used: 204571155837
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)