Search to UniGene2 database
Query= 20060611S-012432 (20060611S-012432) 20060611S-012432
(1142 letters)
Database: UniGene(Bt+Hs+Ssc+Mm)
166,829 sequences; 236,476,188 total letters
Searching...................................................done
Score E
Sequences producing significant alignments: (bits) Value
Alignment gnl|UG|Hs#S1736029 UI-H-BI2-ahe-h-07-0-UI.s1 NCI_CGAP_Sub4 Homo ... 36 3.4
Alignment gnl|UG|Mm#S16507862 Mus musculus olfactory receptor 458 (Olfr458... 36 3.4
Alignment gnl|UG|Mm#S10845528 Mus musculus adult male diencephalon cDNA, R... 36 3.4
Alignment gnl|UG|Ssc#S5989924 110874 MARC 1PIG Sus scrofa cDNA 5', mRNA se... 36 3.4
>gnl|UG|Hs#S1736029 UI-H-BI2-ahe-h-07-0-UI.s1 NCI_CGAP_Sub4 Homo
sapiens cDNA clone IMAGE:2726652 3', mRNA sequence
/clone=IMAGE:2726652 /clone_end=3' /gb=AW294430
/gi=6701066 /ti=154074827 /ug=Hs.513580 /len=600
Length = 600
Score = 36.2 bits (18), Expect = 3.4
Identities = 24/26 (92%)
Strand = Plus / Minus
Query: 804 gctgtgatgatgttaaagattaaaaa 829
||||||||| || |||||||||||||
Sbjct: 245 gctgtgatgttgctaaagattaaaaa 220
>gnl|UG|Mm#S16507862 Mus musculus olfactory receptor 458 (Olfr458),
mRNA /cds=p(1,942) /gb=NM_146444 /gi=33238925
/ug=Mm.377501 /len=942
Length = 942
Score = 36.2 bits (18), Expect = 3.4
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 692 atagggcaaaagagatgg 709
||||||||||||||||||
Sbjct: 289 atagggcaaaagagatgg 272
>gnl|UG|Mm#S10845528 Mus musculus adult male diencephalon cDNA, RIKEN
full-length enriched library, clone:9330189G22
product:hypothetical Mitochondrial energy transfer
proteins (carrier protein) containing protein, full
insert sequence /cds=p(44,562) /gb=AK034423 /gi=26329930
/ug=Mm.228067 /len=4012
Length = 4012
Score = 36.2 bits (18), Expect = 3.4
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 822 attaaaaatattccaatc 839
||||||||||||||||||
Sbjct: 2192 attaaaaatattccaatc 2209
>gnl|UG|Ssc#S5989924 110874 MARC 1PIG Sus scrofa cDNA 5', mRNA
sequence /clone_end=5' /gb=AW657635 /gi=7423398
/ti=447569149 /ug=Ssc.30627 /len=610
Length = 610
Score = 36.2 bits (18), Expect = 3.4
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 816 ttaaagattaaaaatatt 833
||||||||||||||||||
Sbjct: 267 ttaaagattaaaaatatt 250
Database: UniGene(Bt+Hs+Ssc+Mm)
Posted date: Jun 10, 2005 8:02 PM
Number of letters in database: 236,476,188
Number of sequences in database: 166,829
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
length of query: 1142
length of database: 236,476,188
effective HSP length: 19
effective length of query: 1123
effective length of database: 233,306,437
effective search space: 262003128751
effective search space used: 262003128751
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)