[Help]

[Overview] [RefSeq] [Assembly & SNP] [Alignment]

Assembly Name:  20060611C-000543

Length: 991

Sequence [FASTA format sequence]
TTCCGTCCCG GCTCCTCCCG CTTGCCGCCG CAGTGACAGG GAAGCCGGGC CCGGTGGCAG
AGAGGAAGTG CGGGGCCGCC GCGCCGAGCC CGTCCCCGCC GAGGCCGGCT CCCCCAGGCG
GCTCGGGTGA CAGTGTCGCG GCCGCCGGGC GCAGCGCGGG GCACGCGCCG GGCAGAGCCA
AGGGCCAGGC GGACGCTTCA GCAGAGACGC GGGGAAAATG GCTGATGACT TTGGCTTCTT
CTCGTCATCG GAGAGCGGGG CCCCTGAGGT TGCCGAGGAG GACCCGGCGG CTGCCTTCCT
GGCCCAGCAG GAGAGTGAAA TCGCGGGCAT AGAGAATGAC GAGGGCTTCG GGGCACCTGC
CGGCAGCCAG GCGGCCCTCG CGCAGCCGGG ACTAGCGAGT GGGGGTCCTG AGGACATGGG
GACCACAGTC AATGGAGATG TGTTTCAGGA TGCTAACGGT CCAGCTGATG GCTACGCTGC
CATTGCCCAG GCGGACAGAC TGACTCAGGA ACCCGAGAGC ATCCGCAAGT GGAGAGAGGA
GCAGCGGAAA CGGCTGCAAG AGCTGGATGC TGCCTCCAAA GTGACGGAAC AAGAGTGGCG
GGAGAAGGCC AAGAAGGACT TGGAGGAATG GAACCAGCGC CAGAGTGAGC AAGTTGAGAA
GAACAAGATC AATAACCGGG CATCCGAGGA GGCTTTTGTG AAGGAATCCA AGGAGGAGAC
CCCAGGTACA GAGTGGGAGA AGGTGGCCCA GCTGTGTGAC TTCAACCCCA AGAGCAGCAA
GCAATGCAAA GACGTGTCCC GCCTGCGCTC GGTGCTCATG TCCCTGAAGC AGACCCCACT
GTCCCGCTAG GAGCCTGTCA CCAGCATGGC CGCCAAGCGG GGGCAGGGCC GGGCAAAATA
GGAACAACCT GCTTCGGCCA GGTGGGGGAA AACGCCTCCT GTGGCTGCTA CACAGCCTAA
TCCGTTTCTC CCCATCTCCC AGGGCTGGGA A


SNP mapping information
SNP IDRel.Chr.Location (cM)


Assembly Overview:      TOP
Change score limit to  


BLAST on RefSeq (Human):      TOP

LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCLTBclathrin, light polypeptide (Lcb)3531e-97O
Contig/Assembly ProteinCLTBclathrin, light polypeptide (Lcb)3423e-94O
Contig/Assembly ProteinCLTAclathrin, light polypeptide (Lca)2362e-62O
Contig/Assembly ProteinCLTAclathrin, light polypeptide (Lca)2201e-57O


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL


Assembly Members: 4      TOP
LibraryPlateLoc.Read NameAccessionFull Seq.
LNG010074G06LNG01_0074_G06.bBP439416 
TES010029G01TES01_0029_G01.bCJ031932 
TES010079A12TES01_0079_A12.bCJ035059 
TES010092B09TES01_0092_B09.bCJ035946 

  

Alignment:      TOP

20060611C-000543 : ......................................TTCCGTCCCGGCTCCTCCCGCT
---------+---------+---------+---------+---------+---------+ 22
TES01_0029_G01.b : ctgacgtggctctggaTTCCGTCCCGGCTCCTCCCGCT
TES01_0079_A12.b : cactcggcggtggctactgggatCCGTCCCGGCTCCTCCCGCT
LNG01_0074_G06.b : nnggcttggacttaaacagtttgtcxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
TES01_0092_B09.b : nnttcgc
20060611C-000543 : TGCCGCCGCAGTGACAGGGAAGCCGGGCCCGGTGGCAGAGAGGAAGTGCGGGGCCGCCGC
---------+---------+---------+---------+---------+---------+ 82
TES01_0029_G01.b : TGCCGCCGCAGTGACAGGGAAGCCGGGCCCGGTGGCAGAGAGGAAGTGCGGGGCCGCCGC
TES01_0079_A12.b : TGCCGCCGCAGTGACAGGGAAGCCGGGCCCGGTGGCAGAGAGGAAGTGCGGGGCCGCCGC
LNG01_0074_G06.b : xxxxxxxxxxxxGACAGGGAAGCCGGGCCCGGTGGCAGAGAGGAAGTGCGGGGCCGCCGC
TES01_0092_B09.b : tgtggctctgggtgacGGGAAGCCGGGCCCGGTGGCAGAGAGGAAGTGCGGGGCCGCCGC
20060611C-000543 : GCCGAGCCCGTCCCCGCCGAGGCCGGCTCCCCCAGGCGGCTCGGGTGACAGTGTCGCGGC
---------+---------+---------+---------+---------+---------+ 142
TES01_0029_G01.b : GCCGAGCCCGTCCCCGCCGAGGCCGGCTCCCCCAGGCGGCTCGGGTGACAGTGTcgcggc
TES01_0079_A12.b : GCCGAGCCCGTCCCCGCCGAGGCCGGCTCCCCCAGGCGGCTCGGGTGACAGTGTcgcggc
LNG01_0074_G06.b : GCCGAGCCCGTCCCCGCCGAGGCCGGCTCCCCCAGGCGGCTCGGGTGACAGTGTcgcggc
TES01_0092_B09.b : GCCGAGCCCGTCCCCGCCGAGGCCGGCTCCCCCAGGCGGCTCGGGTGACAGTGTcgcggc
20060611C-000543 : CGCCGGGCGCAGCGCGGGGCACGCGCCGGGCAGAGCCAAGGGCCAGGCGGACGCTTCAGC
---------+---------+---------+---------+---------+---------+ 202
TES01_0029_G01.b : cgccgggcgcagcgcggggcacgcgccgggcAGAGCCAAGGGCCAGGCGGACGCTTCAGC
TES01_0079_A12.b : cgccgggcgcagcgcggggcacgcgccgggcAGAGCCAAGGGCCAGGCGGACGCTTCAGC
LNG01_0074_G06.b : cgccgggcgcagcgcggggcacgcgccgggcAGAGCCAAGGGCCAGGCGGACGCTTCAGC
TES01_0092_B09.b : cgccgggcgcagcgcggggcacgcgccgggcAGAGCCAAGGGCCAGGCGGACGCTTCAGC
20060611C-000543 : AGAGACGCGGGGAAAATGGCTGATGACTTTGGCTTCTTCTCGTCATCGGAGAGCGGGGCC
---------+---------+---------+---------+---------+---------+ 262
TES01_0029_G01.b : AGAGACGCGGGGAAAATGGCTGATGACTTTGGCTTCTTCTCGTCATCGGAGAGCGGGGCC
TES01_0079_A12.b : AGAGACGCGGGGAAAATGGCTGATGACTTTGGCTTCTTCTCGTCATCGGAGAGCGGGGCC
LNG01_0074_G06.b : AGAGACGCGGGGAAGATGGCTGATGACTTTGGCTTCTTCTCGTCATCGGAGAGCGGGGCC
TES01_0092_B09.b : AGAGACGCGGGGAAAATGGCTGATGACTTTGGCTTCTTCTCGTCATCGGAGAGCGGGGCC
20060611C-000543 : CCTGAGGTTGCCGAGGAGGACCCGGCGGCTGCCTTCCTGGCCCAGCAGGAGAGTGAAATC
---------+---------+---------+---------+---------+---------+ 322
TES01_0029_G01.b : CCTGAGGTTGCCGAGGAGGACCCGGCGGCTGCCTTCCTGGCCCAGCAGGAGAGTGAAATC
TES01_0079_A12.b : CCTGAGGTTGCCGAGGAGGACCCGGCGGCTGCCTTCCTGGCCCAGCAGGAGAGTGAAATC
LNG01_0074_G06.b : CCTGAGGTTGCCGAGGAGGACCCGGCGGCTGCCTTCCTGGCCCAGCAGGAGAGTGAAATC
TES01_0092_B09.b : CCTGAGGTTGCCGAGGAGGACCCGGCGGCTGCCTTCCTGGCCCAGCAGGAGAGTGAAATC
20060611C-000543 : GCGGGCATAGAGAATGACGAGGGCTTCGGGGCACCTGCCGGCAGCCAGGCGGCCCTCGCG
---------+---------+---------+---------+---------+---------+ 382
TES01_0029_G01.b : GCGGGCATAGAGAATGACGAGGGCTTCGGGGCACCTGCCGGCAGCCAGGCGGCCCTCGCG
TES01_0079_A12.b : GCGGGCATAGAGAATGACGAGGGCTTCGGGGCACCTGCCGGCAGCCAGGCGGCCCTCGCG
LNG01_0074_G06.b : GCGGGCATAGAGAATGACGAGGGCTTCGGGGCACCTGCCGGCAGCCAGGCGGCCCTCGCG
TES01_0092_B09.b : GCGGGCATAGAGAATGACGAGGGCTTCGGGGCACCTGCCGGCAGCCAGGCGGCCCTCGCG
20060611C-000543 : CAGCCGGGACTAGCGAGTGGGGGTCCTGAGGACATGGGGACCACAGTCAATGGAGATGTG
---------+---------+---------+---------+---------+---------+ 442
TES01_0029_G01.b : CAGCCGGGACTAGCGAGTGGGGGTCCTGAGGACATGGGGACCACAGTCAATGGAGATGTG
TES01_0079_A12.b : CAGCCGGGACTAGCGAGTGGGGGTCCTGAGGACATGGGGACCACAGTCAATGGAGATGTG
LNG01_0074_G06.b : CAGCCGGGACCAGCGAGTGGGGGTCCTGAGGACATGGGGACCACAGTCAATGGAGATGTG
TES01_0092_B09.b : CAGCCGGGACTAGCGAGTGGGGGTCCTGAGGACATGGGGACCACAGTCAATGGAGATGTG
20060611C-000543 : TTTCAGGATGCTAACGGTCCAGCTGATGGCTACGCTGCCATTGCCCAGGCGGACAGACTG
---------+---------+---------+---------+---------+---------+ 502
TES01_0029_G01.b : TTTCAGGATGCTAACGGTCCAGCTGATGGCTACGCTGCCATTGCCCAGGCGGACAGACTG
TES01_0079_A12.b : TTTCAGGATGCTAACGGTCCAGCTGATGGCTACGCTGCCATTGCCCAGGCGGACAGACTG
LNG01_0074_G06.b : TTTCAGGATGCTAACGGTCCAGCTGATGGCTACGCTGCCATTGCCCAGGCGGACAGACTG
TES01_0092_B09.b : TTTCAGGATGCTAACGGTCCAGCTGATGGCTACGCTGCCATTGCCCAGGCGGACAGACTG
20060611C-000543 : ACTCAGGAACCCGAGAGCATCCGCAAGTGGAGAGAGGAGCAGCGGAAACGGCTGCAAGAG
---------+---------+---------+---------+---------+---------+ 562
TES01_0029_G01.b : ACTCAGGAACCCGAGAGCATCCGCAAGTGGAGAGAGGAGCAGCGGAAACGGCTGCAAGAG
TES01_0079_A12.b : ACTCAGGACCCCGAGAGCATCCGCAAGTGGAGAGAGGAGCAGCGGAAACGGCTGCAAGAG
LNG01_0074_G06.b : ACTCAGGAACCCGAGAGCATCCGCAAGTGGAGAGAGGAGCAGCGGAAACGGCTGCTAGAG
TES01_0092_B09.b : ACTCAGGAACCCGAGAGCATCCGCAAGTGGAGAGAGGAGCAGCGGAAACGGCTGCAAGAG
20060611C-000543 : CTGGATGCTGCCTCCAAAGTGACGGAACAAGAGTGGCGGGAGAAGGCCAAGAAGGACTTG
---------+---------+---------+---------+---------+---------+ 622
TES01_0029_G01.b : CTGGATGCTGCCTCCAAAGTGACGGAACAAGAGTGGCGGGAGAAGGCCAAGAAGGACTTG
TES01_0079_A12.b : CTGGATGCTGCCCTCCAATTGACGGAACAAGATTGGCGGGAGAGGGCCAAGAAGGACTTG
LNG01_0074_G06.b : CTGGATGCTGCCTCCAAAGTGACGGAACAAGAGTGGCGGGAGAAGGCCAAGAAGGACTTG
TES01_0092_B09.b : CTGGATGCTGCCTCCAAAGTGACGGGACAAGAGTGGCGGGAGAAGGCCAAGAAGGACTTG
20060611C-000543 : GAGGAATGGAACCAGCGCC*AGAGTGAGCAAGTTGAGA*AGAACAAGATCAATAACCGGG
---------+---------+---------+---------+---------+---------+ 680
TES01_0029_G01.b : GAGGAATGGAACCAGCGCC*AGAGTGAGCAAGTTGAGA*AGAACAAGATCAATAACCGGG
TES01_0079_A12.b : TAGGAATGGAACCAGCCCCCAGATTGAGCCAGTTTAAAAAAAACAAGATCAATAACCGGG
LNG01_0074_G06.b : GAGGAATGGAACCAGCGCC*AGAGTGAGCAAGTTGAGA*AGAACAAGATCAATAACCGGG
TES01_0092_B09.b : GAGGAATGGAACCAGCGCC*AGAGTGAGCAAGTTGAGA*AGAACAAGATCAATAACCGGG
20060611C-000543 : CA*TCCGAGG*AGGCTTTTGTGAAGGAATCCAAGGAGGAGACCCCAGGTACAGAGTGGGA
---------+---------+---------+---------+---------+---------+ 738
TES01_0029_G01.b : CA*TCCGAGG*AGGCTTTTGTGAAGGAATCCAAGGAGGAGACCCCAGGTACAGAGTGGGA
TES01_0079_A12.b : CATTCCAAGGAAGGTTTTTGTGAAGGAATtccagggagaaaacccccggtaactaaaggg
LNG01_0074_G06.b : CA*TCCGAGG*AGGCTTTTGTGAAGGAATCCAAGGAGGAGACCCCCGGTACAGAGTGGGA
TES01_0092_B09.b : CA*TCCGAGG*AGGCTTTTGTGAAGGAATCCCAGGAGGAGACCCCANGTACAGAGTGGGA
20060611C-000543 : GAAGGTGGCCCAGCTGTGTGACTTCAACCCCAAGAGCAGCAAGCAATGCAAAGACGTGTC
---------+---------+---------+---------+---------+---------+ 798
TES01_0029_G01.b : GAAGGTGGCCCAGCTGTGTGACTTCAACCCCAAGAGCAGCAAGCAATGCAAAGACGTGTC
TES01_0079_A12.b : gaaaaaggtggcccctcttgttgactttcaaccccaagaaccacaagcaatggcaaaaac
LNG01_0074_G06.b : GAAGGTGGCCCAGCTGTGTGACTCCA*CCCCAAGAGCAGCAAGCAATGCTAAGACGTGTC
TES01_0092_B09.b : GAAGGTGGCCCAGCTGTGTGACTTCAACCCCAAGAGCAGCAAGCAATGCAAAGACCTGTC
20060611C-000543 : CCGCCTGCGCTCGGTGCTCATGTCCCTGAAGCAGACCCCACTGTCCCGCTAGGAGCCT*G
---------+---------+---------+---------+---------+---------+ 857
TES01_0029_G01.b : CCGCCTGCGCTCGGTGCTCATGTCCCTGAAGCAGACACCACTGTCCCGCTAGGAGCCT*G
TES01_0079_A12.b : cttgccccccctgcccccggggccttggtcccctgaaaacaaacccactgttcccccttg
LNG01_0074_G06.b : CCGCCTGCGCTCGGTGCTCATGTTCCTGAAGCAGACCCCACTGTCCCGCTAGGAGCCT*G
TES01_0092_B09.b : CCCGCTGCGCTCGGTGCTCATGTCCCTGAAGCAGACCACACTGTCCCGCCTGGAGCCTTG
20060611C-000543 : TCACCAGCATGGCC*GCCAAGCGGGGGCAGGGCC*GGGCAAAATAGGAACAACCTGCTTC
---------+---------+---------+---------+---------+---------+ 915
TES01_0029_G01.b : TCACCAGCTTGGGC*GCCAAGCCGGGGCAGGGCC*TGGCAAAATAGGAGCAA*CTGCTTC
TES01_0079_A12.b : gagacctgttcccccttctgggccccccaagggggggccggggcccggtcaaaaaatgga
LNG01_0074_G06.b : TCACCAGCATGGCC*GCCAAGCGGGGGCAGGGCC*GGGCAGAGTAGGAGCAACCTGCTTC
TES01_0092_B09.b : TCACCAGCATGGCCCGCCAAGCGGGGGCAGGGCCCGGGCAAAAATAGAACCACCTGCTTC
20060611C-000543 : GGCCAGGTGGGGGAAAACGCCTCCTGTGGCTGCTACACAGCCTAATCCGTTTCTCCCCAT
---------+---------+---------+---------+---------+---------+ 975
TES01_0029_G01.b : GGCCAGGTGGGGAAAAACGCCTCCTGTGGCTGCTACACAGCCTAATCCCGTTCTCCCCAT
TES01_0079_A12.b : acctcttctttcccccggggggggaaaaacccctcccgggggttgtaaaaaaagtcttat
LNG01_0074_G06.b : GCCCAGGTGGGGGAAA*CGCCCTCTGTGGCTGCTACAAAGCCT*ATCCGTTTCCTCCCAT
TES01_0092_B09.b : GGCCAGGGGGGGGAAAACCCCTCCTGGggcggctaacaagccttatccggtcctccccct
20060611C-000543 : CTCCCAGGGCTGGGAA............................................
---------+---------+---------+---------+---------+---------+ 991
TES01_0029_G01.b : CTCCCAGGGGTTGGGaaaagggaagttcaaccctttttgcccattattcccttcaaaacc
TES01_0079_A12.b : ccggtttcccccccttccctcagggggggggaaaagggaatttacccccctttcccccaa
LNG01_0074_G06.b : CTCCCAGGGCTGGGAAgaggaagtttacccctttggccataattccctaaggccctgggc
TES01_0092_B09.b : tctcccagggtgggggaaaaaggaatttcaccctttttgccccaataatccctttaaggc
20060611C-000543 : ............................................................
---------+---------+---------+---------+---------+---------+ 991
TES01_0029_G01.b : cttatggcccagcccccccaatggtccctccaatccacaaaatttgactggccccccccg
TES01_0079_A12.b : atttcccctataaccttttgggtccccccccctctaagttctcctccactccccaaaaaa
LNG01_0074_G06.b : ccaccccctccctggcctcctagcccccaaattgactggccttccgaggaattttttttt
TES01_0092_B09.b : cttatgtgcccgccccccccaggtcccccccggcccacaaaattgacggtcccccccgga
20060611C-000543 : ............................................................
---------+---------+---------+---------+---------+---------+ 991
TES01_0029_G01.b : gatgcattttttttattttttcttgggcttaaagggggtttttgtttaatctctcttaaa
TES01_0079_A12.b : aaagaggccccccccggaatttattttttttttctttccttcacctaaggggtgggttgt
LNG01_0074_G06.b : ctcgcctaaagggggggttgtacccttacctcaaaaaccaagaatatacacaaaaaaggc
TES01_0092_B09.b : ggtttttttttttttttcctgggcttaaaggggggggtgttattcaaaaataataactct
20060611C-000543 : ............................................................
---------+---------+---------+---------+---------+---------+ 991
TES01_0029_G01.b : tactatatatactatatttcataaaatggcgcccatggttctctaaacttgcggggctcc
TES01_0079_A12.b : taaaaacaataaaaaaaaaaaaatggccgcttttcttctccctcgttgtgtcggcgcccc
LNG01_0074_G06.b : cccgtgctccgaatgcggcccggcccccctaaatatccccaagggccaaactatgggacc
TES01_0092_B09.b : aaatttttagggccccctttgtccccttccgggtgcgcgcgcccctataatttttataaa
20060611C-000543 : ............................................................
---------+---------+---------+---------+---------+---------+ 991
TES01_0029_G01.b : ggccccctataacttatctttgaaagaaaaaaacctcccctcacctcccccagatcacgt
TES01_0079_A12.b : tttattttttttaaaaaaaacctcccccacccctctctctttataaataaaaaaagaaag
LNG01_0074_G06.b : cccttttgtgtaaggggccccaaagggggcataaaaacaaggtggggctttttaaacctg
TES01_0092_B09.b : aaaaaacccccccccccccccgagaccggaaaataaaaaaagagcagctgggtgttttac
20060611C-000543 : ............................................................
---------+---------+---------+---------+---------+---------+ 991
TES01_0029_G01.b : gaaacaataaattgagggcgat
TES01_0079_A12.b : gctcgtggttataacttctctattacagcatatagtaaa
LNG01_0074_G06.b : tggggaaacgactctgggatttgtaaaacttttctgggtggtatttgcaacaccccaaat
TES01_0092_B09.b : cggttatatcccccattgggggcaaaaaaagccataacctccaattctcacaataagctc
20060611C-000543 : ............................................................
---------+---------+---------+---------+---------+---------+ 991
TES01_0029_G01.b :
TES01_0079_A12.b :
LNG01_0074_G06.b : taagcccgggaaaaaattttggagacgtcaaccccatctccgcgggtgtctctgccttta
TES01_0092_B09.b : tttttccgcctcaccgggggtgcgcacacaccatag
20060611C-000543 : ............................................................
---------+---------+---------+---------+---------+---------+ 991
TES01_0029_G01.b :
TES01_0079_A12.b :
LNG01_0074_G06.b : taataacacggtgtttctttgttttctccccccc
TES01_0092_B09.b :